New Developments in Chromatin Research [1 ed.] 9781620818329, 9781620818169

Citation preview

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved. New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012. ProQuest

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved. New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

GENETICS - RESEARCH AND ISSUES

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

NEW DEVELOPMENTS IN CHROMATIN RESEARCH

No part of this digital document may be reproduced, stored in a retrieval system or transmitted in any form or by any means. The publisher has taken reasonable care in the preparation of this digital document, but makes no expressed or implied warranty of any kind and assumes no responsibility for any errors or omissions. No liability is assumed for incidental or consequential damages in connection with or arising out of information contained herein. This digital document is sold with the clear understanding that the publisher is not engaged in rendering legal, medical or any other professional services.

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

GENETICS - RESEARCH AND ISSUES Additional books in this series can be found on Nova’s website under the Series tab.

Additional E-books in this series can be found on Nova’s website under the E-book tab.

CELL BIOLOGY RESEARCH PROGRESS Additional books in this series can be found on Nova’s website under the Series tab.

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

Additional e-books in this series can be found on Nova’s website under the e-book tab.

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

GENETICS - RESEARCH AND ISSUES

NEW DEVELOPMENTS IN CHROMATIN RESEARCH

NEIL M. SIMPSON AND

VALERIE J. STEWART Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

EDITORS

Nova Science Publishers, Inc. New York

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

Copyright © 2012 by Nova Science Publishers, Inc. All rights reserved. No part of this book may be reproduced, stored in a retrieval system or transmitted in any form or by any means: electronic, electrostatic, magnetic, tape, mechanical photocopying, recording or otherwise without the written permission of the Publisher. For permission to use material from this book please contact us: Telephone 631-231-7269; Fax 631-231-8175 Web Site: http://www.novapublishers.com NOTICE TO THE READER The Publisher has taken reasonable care in the preparation of this book, but makes no expressed or implied warranty of any kind and assumes no responsibility for any errors or omissions. No liability is assumed for incidental or consequential damages in connection with or arising out of information contained in this book. The Publisher shall not be liable for any special, consequential, or exemplary damages resulting, in whole or in part, from the readers’ use of, or reliance upon, this material. Any parts of this book based on government reports are so indicated and copyright is claimed for those parts to the extent applicable to compilations of such works.

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

Independent verification should be sought for any data, advice or recommendations contained in this book. In addition, no responsibility is assumed by the publisher for any injury and/or damage to persons or property arising from any methods, products, instructions, ideas or otherwise contained in this publication. This publication is designed to provide accurate and authoritative information with regard to the subject matter covered herein. It is sold with the clear understanding that the Publisher is not engaged in rendering legal or any other professional services. If legal or any other expert assistance is required, the services of a competent person should be sought. FROM A DECLARATION OF PARTICIPANTS JOINTLY ADOPTED BY A COMMITTEE OF THE AMERICAN BAR ASSOCIATION AND A COMMITTEE OF PUBLISHERS. Additional color graphics may be available in the e-book version of this book. LIBRARY OF CONGRESS CATALOGING-IN-PUBLICATION DATA New developments in chromatin research / editors, Neil M. Simpson and Valerie J. Stewart. p. cm. Includes index. ISBN:  (eBook)

1. Chromatin--Research--Methodology. I. Simpson, Neil M. II. Stewart, Valerie J. QH599.N49 2011 572.8'7--dc23 2012015279

Published by Nova Science Publishers, Inc. † New York New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

CONTENTS Preface

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

Chapter 1

vii The Varied Functions of Aurora Kinases A and B in Mitosis and Carcinogenesis Jyoti Iyer, Saili Moghe, Niveditha Rajagopalan, Manabu Furukawa and Ming-Ying Tsai

Chapter 2

Chromatin Structure and Epigenetics Vichithra R. B. Liyanage, Robby M. Zachariah, Geneviève P. Delcuve, James R. Davie and Mojgan Rastegar

Chapter 3

Sperm Chromatin Integrity, DNA Fragmentation and Male Fertility María Enciso and Dagan Wells

1

29

61

Chapter 4

The Chromatin State of Pluripotent Stem Cells Mehdi Shafa and Derrick E. Rancourt

Chapter 5

MITF Meets Chromatin in Melanoma Jiri Vachtenheim and Lubica Ondrušová

107

Chapter 6

The State of Chromatin as an Integrative Indicator of Cell Stress Yuriy Shckorbatov

125

Chapter 7

A Genomics Approach to Analysing DNA Damage and Its Repair throughout Entire Genomes Yumin Teng, Mark Bennett, Katie E. Evans, Huayun Zhuang-Jackson,Andy Higgs, Simon H. Reed and Raymond Waters

Chapter 8

Chapter 9

85

147

Recent Patent on Revolver-2: A Novel Transposon-Like Gene Useful for Chromosome Tags of Rye Motonori Tomita

163

The Removal of DNA Damage Is Promoted by the Yeast Global Genome Nucleotide Excision Repair Factor Rad16 Shirong Yu, Yumin Teng, Raymond Waters and Simon Reed

179

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

vi

Contents

Chapter 10

Chromatin Condensation in Infertile Sperm Sirikul Manochantr

Chapter 11

Glucocorticoid-Induced Chromatin Remodeling: A Novel Molecular Mechanism of Traumatic Stress Lei Zhang, He Li, Xian-Zhang Hu, Xiao Xia Li, Stanley Smerin and Robert Ursano

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

Index

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

197

213

225

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

PREFACE Chromatin is DNA plus the proteins (and RNA) that package DNA within the cell nucleus. The primary functions of chromatin are: to package DNA into a smaller volume to fit in the cell, to strengthen the DNA to allow mitosis and meiosis and prevent DNA damage, and to control gene expression and DNA replication. In this book, the authors present topical research in the study of chromatin including the varied functions of aurora kinases A and B in mitosis and carcinogenesis; the chromatin state of pluripotent stem cells; MITF meets chromatin in melanoma; the state of chromatin as an integrative indicator of cell stress; analyzing DNA damage and its repair throughout entire genomes; the cloning process, structural characterization of Revolver transposon and its patented application for chromosome tags; DNA damage and Rad16; and glucocorticoid-induced chromatin remodeling. Chapter 1 - Aurora kinases are master regulators of mitosis. Aurora kinase A is necessary for centrosome separation and maturation and for the assembly of a functional bipolar spindle. Aurora A’s sister kinase Aurora kinase B, functions in monitoring and mediating proper chromosome-microtubule attachments and facilitating accurate cytokinesis. Errors in any of these functions of Aurora kinases can cause defects in chromosome alignment and segregation. This ultimately results in aneuploidy and genome instability. Thus, both Aurora kinases A and B either indirectly or directly influence chromosome segregation and hence, genome integrity. Therefore, it is critical to obtain a clear understanding of the control and regulation of these kinases to bring about proper chromosome segregation and mitosis. This chapter focuses on the mode by which Aurora kinases are regulated by, and regulate, various proteins in mitosis and cancer. Importantly, this chapter also brings into light the data that hint at a possible signaling cross-talk between Aurora A and Aurora B signaling pathways. Chapter 2 - The term “chromatin” was first referred to the darkly stained DNA in the nucleus in early 1880s. Over the past century, much meaning has been added to the term chromatin with regard to its structure, organization and function. During the last two decades the field of chromatin has evolved in an incredible pace with the utilization of high throughput techniques. These comprehensive studies reveal that chromatin is no longer a static structure but is changing dynamically in order to regulate nuclear processes including DNA replication and gene transcription. The dynamic nature of chromatin is ruled by several epigenetic mechanisms such as nucleosome remodelling, histone post-translational modifications and DNA methylation. Recent studies in the chromatin field provide insights to the detailed mechanisms underlying the regulation of gene expression by structural and

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

viii

Neil M. Simpson and Valerie J. Stewart

chemical changes in chromatin. This chapter reviews recent advances in chromatin research in an epigenetic perspective, leading to a higher level of understanding on how chromatin structure is organized and dynamically modified in order to regulate gene expression. Chapter 3 - During the last 15 years, largely as a result of the advent of assisted reproductive technology (ART), many research groups have focussed their attention on the study of sperm chromatin and its impact on reproductive outcome. Published studies on the topic have allowed for real progress in the authors' understanding of elementary aspects of sperm chromatin structure and composition. Some have also shed some light on the impact of chromatin defects on sperm function and the ability to produce viable embryos. The authors are now beginning to understand how the sperm nucleus is configured and the implications of sperm genetic integrity on male fertility. As a result of the growing interest in this area, many novel tests to assess sperm chromatin composition and/or integrity have been developed. Currently available tests are directed to identify the presence of DNA and/or chromatin defects in the sperm nucleus, either by detecting DNA breaks or by assessing chromatin configuration in individual spermatozoa. A higher incidence of spermatozoa with chromatin defects has been found in samples from infertile subjects compared to those from fertile men, suggesting that sperm chromatin damage can be considered as a new biomarker of semen quality that may help in the identification and characterisation of men with fertility problems. Correlations between DNA damage in spermatozoa and adverse ART reproductive outcomes, such as reduced fertilization and conception rates, increased miscarriage and elevated incidence of birth defects have been described. It therefore seems that sperm genetic integrity is a requirement for successful fertilization and adequate embryo development. However, despite the advances made so far in the field of sperm chromatin integrity and male infertility, the clinical relevance of the data is still debated. More studies are needed in order to determine the specifics of sperm chromatin configuration and gain an improved understanding of the origin and implications of chromatin defects in spermatozoa. Many essential questions remain to be answered, further investigations on sperm chromatin structure, chromatin packaging and unpackaging during spermatogenesis and after fertilization, and the capacity of the oocyte to repair sperm DNA damage, are essential to have a better understanding of the genetic integrity of the male germ line and its significance on reproduction. This chapter reviews the authors' present knowledge on the structure and composition of sperm chromatin, the existing information about the origin and aetiology of DNA damage in spermatozoa, the methods available for the analysis of sperm genetic integrity, and some of the most relevant clinical data produced over the last years about the correlations found between sperm chromatin defects and adverse reproductive outcomes. Chapter 4 - Pluripotent stem cells (PSCs) including embryonic stem cells (ESCs) and induced pluripotent stem cells (iPSCs) can indefinitely self-renew and contribute to all tissue types of the adult organism. PSC-based therapeutic approaches hold enormous promise for the cure of regenerative diseases. In the past few years, several studies have attempted to decipher the important role of a core network of transcription factors and their cognate epigenetic regulatory signals in maintaining pluripotency, but the exact underlying mechanisms have yet to be identified. Among the epigenetic factors, chromatin function and structure have been found to contribute greatly to the maintenance of pluripotency and regulation of differentiation in PSCs. These modifications include: covalent histone modifications, histone bivalents and chromatin remodeling, and DNA methylation. Studies in ESCs have showed that genes associated with early development are arranged within a

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

Preface

ix

bivalent chromatin structure. This is thought to be a “poised yet repressed” situation, which can be activated upon differentiation. The breakthrough of iPSCs has opened a new era in stem cell biology. During reprogramming, the chromatin state of differentiated cells is reset to an embryonic form via a largely undetermined mechanism. Since epigenetic changes are key factors in human health and disease, there is hope that understanding the mechanism of stem cell epigenome regulation will aid in more effective treatment of human degenerative disorders in the near future. In this review, the fundamental impact of chromatin dynamics in ESCs as well as its critical role in the generation of iPSCs will be discussed. Chapter 5 - SWI/SNF chromatin remodeling complexes contain either Brm (Brahma) or Brg1 (Brahma-related gene 1) as the ATPase subunits. These ATP-dependent complexes are specialized protein machineries which remodel the nucleosomes to make the DNA accessible during processes like transcription, DNA repair and DNA replication. MITF (microphthalmia-associated transcription factor) is a pivotal protein required for the survival and proliferation of normal melanocytes and melanoma cells. MITF activates transcription of many genes regulating proliferation, apoptosis and invasiveness of melanoma cells and is a potential target for gene therapy of melanoma, an aggressive malignant tumor for which no effective therapy exists when metastases occur. It has been shown that many MITF target genes require SWI/SNF remodeling complex for expression. Importantly, expression of MITF itself is absolutely dependent on this complex, and both Brg1- or Brm-containing complexes are sufficient to support MITF gene transcription. Additionally, especially Brg1 complex seems to support tumor growth even independently of the MITF axis. Thus, SWI/SNF complexes appear to be crucial determinants of melanoma development and progression. Chapter 6 - The terms heterochromatin and euchromatin and conception of connection of heteropicnotic state of chromosomes and parts of chromosomes with genetically inert regions of chromosomes was introduced by Emil Heitz. These findings were made practically at the same time with findings of Dmitry Nassonov, who was interested in the non-specific cell reactions to different environmental factors, and defined the main traits of these reactions. Among the main features of non-specific cell reactions to environmental factors which he defined as “paranecrosis” and the authors call “stress reaction”, Nassonov outlined the reaction of cell nucleus defined as gelatinization. Nassonov noted that this response might be reversible. In modern terminology it corresponds to reversible process of heterochromatinization. Chapter 7 - DNA damage occurs via endogenous and exogenous genotoxic agents; it compromises a genome’s integrity and unrepaired DNA damage can result in mutation and cell death. Knowing where damage occurs within a genome is crucial to understanding the repair mechanisms which protect this integrity. Here the authors describe a new development based on microarray technology which uses ultraviolet light induced DNA damage as a paradigm to determine the position and frequency of DNA damage and its subsequent excision repair throughout the entire yeast genome. One of these excision repair mechanisms is nucleotide excision repair (NER) which is well conserved during evolution. In humans a NER deficiency predisposes affected individuals to a cancer-prone genetic disorder, xeroderma pigmentosum. NER removes a wide range of DNA lesions, and often recognizes damages that distort the DNA helical structure including ultraviolet light (UV) induced cyclobutane pyrimidine dimers (CPDs). More than 30 repair proteins have been identified as having roles in NER on naked DNA templates in vitro. In cells, DNA is tightly packaged as

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

x

Neil M. Simpson and Valerie J. Stewart

chromatin and this poses a barrier to the operation of these core proteins. The roles of these core proteins were identified in part via studies with Saccharomyces cerevisiae, and where NER has many homologous steps to the mechanism in humans. How NER operates in the context of chromatin remains elusive, although some inroads have been made in this area often by employing methods to examine DNA damage and repair in specific regions of a genome. Technologies are available to examine DNA damage and repair in selected genes and certain damages can be analyzed at nucleotide resolution in some of those genes. However, none of these approaches are designed to examine repair events throughout genomes at a high resolution in order to identify the variations in repair rate and reveal any correlation of this with changes in chromatin structure. A whole genome high resolution approach would enable one to examine the global influence of factors on repair: for example, the accessibility of DNA damage in chromatin to repair proteins and the chromatin modification factors that facilitate damage repair. To address this there was a need to develop a new approach to rapidly screen entire genomes for DNA damage and to measure their repair. DNA microarrays were developed decades ago for whole genome transcription profiling. The combination of these and chromatin immunoprecipitation, namely ChIP on chip, was an extension that enabled the identification of the binding sites of DNA-binding proteins and the covalent modifications to nucleosomes on a genome-wide basis. Here, the authors describe a genome wide approach that employs microarrays to monitor UV-induced DNA damage (CPDs) and its repair. Quality control measure included using the mitochondrial DNA probes as a control, as this genome does not undertake NER and CPDs persist within it, and also analysing events in a yeast rad4 mutant which is defective in much of the NER genome –wide. Hence the authors' approach enables us to identify the UVinduced changes in chromatin and the chromatin modifications that facilitate and influence repair throughout an entire genome. Chapter 8 - Novel genomic components might be key tools for useful molecular tags and the comprehension of huge and complex genomes. Revolver is a new multi-gene family dispersed-like transposon in the Triticeae genome. An 89 bp segment of Revolver that is enriched in the genome of rye was isolated via the genomic subtraction method deleting the DNA sequences common to rye and wheat. The entire structure of Revolver was determined by using rye genomic clones, which were screened by the 89 bp probe. Revolver encompasses 2929 bp-3041 bp and has 20 bp of terminal-inverted repeated sequences at both ends and contains a transcriptionally active gene encoding a DNA binding-like protein. A putative TATA box is located at base 221, with a cap site at base 261 and a possible polyadenylation signal AATAAA at base 2918. It is like Class II transposable elements. The 3’-flanking region of a typical genomic clone of Revolver-2 used as a single PCR primer amplified four DNA fragments (2.3 kb, 2.8 kb, 3.3 kb, and 4.3 kb) of the Revolver-family from rye genome. By PCR with this single primer, rye chromosomes 1R, 5R, and 6R can be simultaneously identified. These variants of Revolver family shared the downstream region of the second intron, but they varied structurally at the 5’first exon. Structural divergences of Revolver family were utilized for chromosome tags and patented as US No. 7,351,536. This article reviewed the cloning process, structural characterization of Revolver transposon and its patented application for chromosome tags. Chapter 9 - In response to UV radiation induced DNA damage, increased histone H3 acetylation at lysine 9 and 14 correlates with changes in chromatin structure and these alterations are associated with efficient global genome nucleotide excision repair (GG-NER)

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

Preface

xi

in yeast. The authors showed that both these changes occur in response to UV radiation in the absence of functional GG-NER. More recently the authors reported that although these changes occur independently of functional NER, they do depend on the Rad16 GG-NER protein. Remarkably, the authors showed that constitutive hyperacetylation of histone H3 can suppress the requirement for both the Rad7 and Rad16 GG-NER proteins during DNA repair. These observations hinted at a possible mechanistic link between the Rad7 and Rad16 proteins and the process of chromatin remodelling required for efficient DNA repair. In this chapter the authors reveal how UV induced histone H3 acetylation is regulated during GGNER, and show that this activity promotes the chromatin remodelling necessary for efficient repair of DNA damage. The authors' studies demonstrate that yeast Rad7 and Rad16 proteins drive UV induced chromatin remodelling required for DNA repair by controlling histone H3 acetylation levels in chromatin. This is achieved via the concerted action of the ATPase, and C3HC4 RING domains of Rad16, which combine to regulate the occupancy of histone acetyl transferases on chromatin in response to UV damage. Chapter 10 - Normal chromatin condensation has been recognized as one of the vital determinants of normal fertilization and embryo growth in both natural and assisted conception. The various spermatozoa types present in an ejaculate differ in their motility and morphology. However, little is known about nuclear maturity of these spermatozoa and their relationship with morphological and motile characteristics. Routine semen analysis does not identify defects in sperm chromatin structure. Therefore, the investigations of chromatin condensation and DNA integrity in spermatozoa of infertile men are necessary. The ultrastructural analysis of spermatozoa from infertile men showed heterogeneity in sperm nuclear morphology. Some spermatozoa displayed a round nucleus with incomplete chromatin condensation. Immuno-reactivity with anti-transitional protein and anti-protamine antibodies indicated nuclear maturation defect in the spermatozoa of infertile men. Spearman’s correlation analysis indicated the positive correlation between the percentages of CMA3- and TUNEL- positive spermatozoa. In addition, these 2 parameters were negatively correlated with concentration, motility and normal morphology. It is possible that the men with abnormal semen parameters carrying higher loads of protamine deficiency and DNAdamaged spermatozoa. Therefore, the evaluation of chromatin integrity appears to be a useful tool for assessing male fertility potential. Chapter 11 - While the actions of glucocorticoids (GCs) on brain function have been comprehensively studied, understanding of the underlying genomic mechanisms is advancing slowly. Recent evidence shows that the transcriptional activation of the GC target gene is mediated by remodeling of chromatin. Such chromatin remodeling may specifically occur in the GC receptor-regulated promoter region of the target genes. Chromatin remodeling is complex and essential in numerous cellular processes. It may play a role in response to psychological stress. In this chapter, the authors will review information regarding the role of chromatin remodeling in responding to traumatic stress. As an example the authors will discuss chromatin remodeling in GC-induced gene expression of p11, a traumatic stressrelated molecule. The authors discuss how GC regulates the expression of p11 in an animal model and in a culture cell line. The authors will present the evidence showing that the ligand-activated glucocorticoid receptor (GR) interacts with two glucocorticoid response elements (GREs) in the p11 gene promoter region to up-regulate the p11. The authors also demonstrate that RU486, a glucocorticoid receptor antagonist, and mutation of GREs both block glucocorticoid-induced p11 over-expression, suggesting that glucocorticoid-induced

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

xii

Neil M. Simpson and Valerie J. Stewart

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

p11 over-expression is mediated by GR and GREs. Thus, the p11 gene can be transcriptionally activated. The authors discuss the first step toward identifying chromatin modifications leading to the expression of the p11 gene in the brain of animals in rodent stressed model. A recently developed method that examines protein–DNA interactions within the context of living cells, i.e., chromatin immunoprecipitation, has been performed to study the binding of GR to DNA in brain. This method has been used to examine the dynamics of the binding of steroid receptors to DNA and the role of co-regulators in the effect of glucocorticoids on gene expression particularly in the brain. Glucocorticoid regulation of gene expression occurs via GR and the mechanisms are varied and complex. Ligand-activated GR can regulate gene expression by binding to transcription factors to trans-activate or transrepress expression of genes that lack functional GRE cis-elements in their promoter region. Ligand-activated GR also recruits various coactivators or corepressors to the promoters of GR targeted genes, which contribute to chromatin remodeling, as does histone acetylation and deacetylation by histone deacetylases (HDAC). The characteristics of glucocorticoids indicate that their regulation of the expression of the p11 gene might be at the chromatin level. In this chapter the authors will discuss the possible molecular mechanism of gene regulation associated with chromatin remodeling. The authors translate this information into the knowledge required to examine the possibility of using a histone deacetylase inhibitor (HDACi), such as valproic acid (VPA), to treat post-traumatic disorder (PTSD). Therefore, these studies in stress-induced chromatin remodeling provide not only the information for understanding the molecular mechanisms in the glucocorticoid-mediated gene expression, but also identify a new therapeutic target, chromatin modeling, for stress related mental diseases, such as PTSD and depressive disorders.

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

In: New Developments in Chromatin Research Editors: Neil M. Simpson and Valerie J. Stewart

ISBN: 978-1-62081-816-9 © 2012 Nova Science Publishers, Inc.

Chapter 1

THE VARIED FUNCTIONS OF AURORA KINASES A AND B IN MITOSIS AND CARCINOGENESIS Jyoti Iyer, Saili Moghe, Niveditha Rajagopalan, Manabu Furukawa and Ming-Ying Tsai Eppley Institute for Research in Cancer and Allied Diseases, University of Nebraska Medical Center, Omaha, NE, US

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

ABSTRACT Aurora kinases are master regulators of mitosis. Aurora kinase A is necessary for centrosome separation and maturation and for the assembly of a functional bipolar spindle. Aurora A’s sister kinase Aurora kinase B, functions in monitoring and mediating proper chromosome-microtubule attachments and facilitating accurate cytokinesis. Errors in any of these functions of Aurora kinases can cause defects in chromosome alignment and segregation. This ultimately results in aneuploidy and genome instability. Thus, both Aurora kinases A and B either indirectly or directly influence chromosome segregation and hence, genome integrity. Therefore, it is critical to obtain a clear understanding of the control and regulation of these kinases to bring about proper chromosome segregation and mitosis. This chapter focuses on the mode by which Aurora kinases are regulated by, and regulate, various proteins in mitosis and cancer. Importantly, this chapter also brings into light the data that hint at a possible signaling cross-talk between Aurora A and Aurora B signaling pathways.

Keywords: Aurora A, Aurora B, mitosis, cancer, cross-talk



Corresponding Author: Ming-Ying Tsai, Eppley Institute for Research in Cancer and Allied Diseases, University of Nebraska Medical Center, 987696 Nebraska Medical Center, Omaha, NE 68198-7696. Phone: 402-5595241, Fax: 402-559-4651. E-mail: [email protected].

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

2

Jyoti Iyer, Saili Moghe, Niveditha Rajagopalan et al.

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

INTRODUCTION Mitosis is a fundamental biological process that needs to be carried out accurately and with minimum errors to ensure the generation of two genetically identical daughter cells. Any defect in this process can lead to genomic instability, which is a hallmark of cancer cells [1]. Aurora kinases are Ser/ Threonine directed protein kinases that are master regulators of mitosis and are overexpressed in a variety of malignancies [2-4]. Aurora kinases have been widely studied owing to their potential roles in tumorigenesis. Currently, several small molecule inhibitors targeted against Aurora kinases are being evaluated for their therapeutic efficacy in cancer therapy [5]. The number of Aurora kinase members varies amongst different species. Fungi possess a lone Aurora kinase member named Ipl-1 (Increase in ploidy-1). D. melanogaster, C. elegans and X. laevis have two Aurora kinases- A and B. In mammals, three Aurora kinases- A, B and C are present [6]. Of these, the expression of Aurora kinase C is restricted to the germ cells [7-11]. Therefore, this review will mainly concentrate on the functions of Aurora kinases A and B. Aurora kinases A and B exhibit considerable structural homology (over 70%) in their Cterminally located catalytic kinase domains. However, their N-terminal domains are of variable lengths and share very little resemblance to each other. In spite of a considerable amount of structural similarity in their catalytic domains, these Aurora kinases interact with different substrates and activators, localize predominantly to different cellular locations and carry out different functions during mitosis [6]. However, an ever-increasing body of literature is now starting to suggest that these kinases may in fact be able to cross-talk with each other to mediate proper mitosis. This book chapter focuses on how Aurora kinases are able to bring about proper mitosis and chromosome segregation to enable an equal division of genetic material between two daughter cells. Additionally, this chapter will also discuss the roles of Aurora kinases A and B in tumorigenesis and the potential cross-talk and convergence of Aurora A and B pathways.

AURORA A KINASE The Aurora allele was first identified in Drosophila in a screen for mutants with defective spindle poles. The phenomenon Aurora borealis is observed at the poles of the earth. Since mutations in this allele caused spindle pole defects, the name Aurora was coined for these kinases [4, 6]. Aurora A plays a crucial role in mitosis by mediating mitotic entry, accurate centrosome separation and maturation, and facilitating the formation and maintenance of a proper bipolar spindle that helps to pull chromosomes apart during mitosis [6, 12].

Aurora A Localization Aurora A exhibits a dynamic localization pattern during mitosis. In late G2 phase, active Aurora A is located at the centrosomes [13]. A majority of Aurora A protein localizes to the centrosomes and spindle poles from prophase to anaphase [6]. The Aurora A activator protein TPX2 (Targeting protein for Xenopus kinesin-like protein 2) is required for localization of

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

Aurora Kinases in Mitosis and Carcinogenesis

3

Aurora A to the spindle microtubules (MTs) [14]. The proteins Plk1 (Polo-like kinase 1), Cep192 (Centrosomal protein of 192 kDa), and Centrosomin are all required for the centrosomal targeting of Aurora A [16-18]. Recently, the protein SAF-A (Scaffold attachment factor –A) was also shown to regulate the localization of Aurora A to the mitotic spindle [19]. In addition to localizing to the spindle poles, a small fraction of Aurora A also localizes to the spindle midzone during anaphase [6, 20, 21]. During telophase, Aurora A is present at the midbody [6, 20, 21].

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

Regulation of Aurora A Protein Levels Aurora A is expressed in all mitotic cells. Aurora A levels increase starting from G2 to M phase. Aurora A levels peak in mitosis and begin to decline from the anaphase stage of mitosis [6, 22]. The APC/C (Anaphase Promoting Complex)- Cdh1 E3 ligase is responsible for causing degradation of Aurora A protein via the proteosomal pathway [23, 24]. A recent study reported that the mitotic protein Plk1 activates APC/C-Cdh1, possibly by phosphorylation of the phosphatase CDC14A and thereby, contributes to Aurora A degradation [25]. There are conserved A and D-boxes within the N and C-termini of the Aurora A protein sequence. These are known to regulate Aurora A degradation. Specifically, phosphorylation of human Serine (Ser) 51 within the A-box of Aurora A prevents its degradation by APC/C-Cdh1. This site can be dephosphorylated by the phosphatase PP2A. Thus, PP2A serves as a negative regulator of Aurora A stability [24, 26-28]. Other additional proteins have also been known to modulate Aurora A stability. A recent study demonstrated that TPX2 positively regulates Aurora A stability [29]. Furthermore, Shi and colleagues have now shown that the deubiquitinating enzyme USP2a (Ubiquitin-specific Cysteine Protease 2a) also positively regulates Aurora A cellular levels by deubiquitinating Aurora A thereby, protecting it from proteosomal degradation [30]. In contrast, AIP (Aurorainteracting protein) has been shown to promote downregulation of Aurora A by facilitating its degradation in an antizyme-1 dependent manner [31]. CHFR (Checkpoint protein with FHA and Ring domain) is another E3 ubiquitin ligase that mediates Aurora A degradation [32]. Thus, Aurora A cellular levels are controlled by many proteins, further highlighting that this important protein is tightly regulated in cells.

Aurora A Mitotic Functions Aurora A Functions in Mitotic Entry and Centrosomal Regulation Aurora A activation, which occurs through autophosphorylation at Threonine (Thr) 288 in humans, is an essential feature for cells to enter mitosis [13]. Its activity increases during late G2 to M phase and the inactivation of Aurora A delays mitotic entry [33]. Aurora A plays an essential role in both the maturation and separation of centrosomes, structures that are necessary for proper entry into mitosis as well as progression through mitosis [21]. Additionally, active Aurora A regulates different proteins that are required for mitotic entry. Thus, by acting through a variety of pathways necessary for mitotic entry, Aurora A holds an essential role at the gateway of mitosis.

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

4

Jyoti Iyer, Saili Moghe, Niveditha Rajagopalan et al.

Both, centrosome separation which occurs at G2, and centrosome maturation which occurs at mitosis, requires Aurora A activity (Reviewed by [34]). The overexpression of Aurora A results in the formation of multiple centrosomes that may contribute to aneuploidy [35]. Additionally, the role of Aurora A in centrosome maturation is evident in studies in cultured human cells, where the inhibition of centrosome maturation was detected upon Aurora A depletion [13]. These findings are also consistent in a variety of organisms including C. elegans and D. melanogaster [36, 37]. Specifically, Aurora A is required for the recruitment of pericentriolar matrix components, including -tubulin, to the centrosomes [18]. Aurora A regulates a plethora of centrosomal proteins including centrosomin, NDEL1 (nudE nuclear distribution gene E homolog (A. nidulans)-like 1), BRCA1 (breast cancer associated gene 1), TPX2, and Bora to mediate proper centrosome maturation [14, 38-41]. The phosphorylation of NDEL1 by Aurora A is also required for centrosome maturation and separation. NDEL1 is necessary to recruit the Aurora A substrate TACC3 (transforming acidic coiled coil 3) and the MT severing protein katanin to the centrosomes [39]. The phosphorylation of TACC3 by Aurora A was shown to be required for the centrosomal targeting of TACC3 [42-44]. Furthermore, Aurora A phosphorylation of Drosophila p150glued was also shown to be necessary for p150glued recruitment to the spindle MTs [15]. Besides these proteins, Aurora A also phosphorylates the E3 ubiquitin ligase BRCA1 to negatively regulate its inhibition of MTnucleation at the centrosomes [40, 45]. The kinesin motor protein Eg5 is another Aurora A substrate [46]. The inhibition of Eg5 activity causes formation of monopolar spindles, indicating a role for Eg5 in centrosome separation [47]. However, the functional relevance of the phosphorylation of Eg5 by Aurora A is still unclear and requires further probing. In addition to regulating proper centrosome separation and maturation that is required for mitotic entry, Aurora A also regulates a variety of other proteins that are essential for mitotic entry. Aurora A facilitates activation of the Cyclin B/Cdk1 complex which is required for the transition from G2 to mitosis in different ways. Aurora A phosphorylates the phosphatase CDC25B to activate it. Activated CDC25B leads to the activation of the cyclin B/ Cdk1 complex, thus promoting mitotic entry [48]. Another manner by which Aurora A regulates the activation of Cyclin B/Cdk1 is by regulating Plk1 activity. The complex of Aurora A and Bora is required for the activation of Plk1 during early mitosis [49]. The activated Plk1 then causes degradation of the cyclin B/ Cdk1 inhibitor Wee1, thereby leading to activation of the cyclin B/ Cdk1 complex and mediating mitotic entry [49]. Interestingly, Aurora A also phosphorylates Plk1 for mitotic entry even after checkpoint-dependent cell arrest. This indicates that the kinase plays important roles in mediating mitotic entry during both the normal cell cycle as well as upon checkpoint-dependent arrest [50].

Aurora A Functions in Spindle Assembly In addition to regulating mitotic entry, centrosome separation and maturation, Aurora A also functions to ensure that a proper bipolar spindle forms to separate the segregating chromosomes. A complex comprising of Aurora A, Eg5, XMAP215 (MT Associated Protein 215 kDa), HURP (hepatoma up-regulated protein) and TPX2 aids in bipolar spindle assembly by influencing MT dynamics in a Ran-dependent manner [51-53]. Importantly, Aurora A activity is required for assembly of this complex [51]. Besides these proteins, Aurora A also regulates other proteins that are essential for bipolar spindle assembly by phosphorylation including the MT severing protein MCAK

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

Aurora Kinases in Mitosis and Carcinogenesis

5

(mitotic centromere- associated kinesin) and the protein ASAP (Aster Associated Protein) [54-56]. Phosphorylation of MCAK on Ser 719 by Aurora A is necessary to target MCAK to the centrosomes where it can alter MT dynamics to enable proper spindle assembly. Additionally, phosphorylation of MCAK on its Ser 196 residue by Aurora A is required for proper focusing of the spindle poles [54, 57]. Recently, Aurora A, along with Aurora B was shown to negatively regulate the formation of a Kif18b-MCAK complex to control MT plus end stability [55]. Furthermore, the phosphorylation of the protein ASAP on its Ser 625 residue by Aurora A has also been shown to contribute to bipolar spindle formation [56]. In a recent publication, Aurora A was shown to phosphorylate the Augmin component protein Hice and inhibit its MT-binding ability to ensure accurate spindle formation [58]. In this manner, Aurora A forms complexes with, and regulates a variety of different MT-associated proteins by phosphorylation to ensure accurate construction of a bipolar spindle. It is well-established that asymmetric cell division depends upon the positioning of the mitotic spindle apparatus. Since Aurora A is such a critical component of bipolar spindle assembly, it is not surprising that Aurora A also plays a crucial role in asymmetric cell division [37, 59-61].

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

Regulation of Aurora A Activity Owing to its numerous functions in mitosis, and in turn, the maintenance of genetic integrity, Aurora A activation is tightly regulated by several proteins. The best characterized Aurora A activator protein is TPX2. The first 43 amino acid residues of TPX2 are sufficient to activate Aurora A [62]. When not bound to the importins, TPX2 binds to the catalytic kinase domain of Aurora A and promotes Aurora A autophosphorylation on Thr 288 (human) or Thr 295 (Xenopus) and causes its subsequent activation [62-64]. TPX2 also prevents access of the phosphatase PP1 to Aurora A, further enhancing its activation [63]. Crystallographic studies have shed further light upon the mode of Aurora A activation by TPX2. When Aurora A is not bound to TPX2, the Thr 288/ Thr 295 residue that is a marker of Aurora A activity is exposed to the solvent and thus, more accessible to PP1. Moreover, in this conformation, the substrate binding site on Aurora A is partially masked and therefore, Aurora A cannot bind its substrates efficiently. However, upon TPX2 binding, a conformational change is induced in Aurora A which makes the Thr 288/ Thr 295 site on Aurora A inaccessible to PP1 action and also opens up the substrate-binding region on Aurora A, facilitating the binding and phosphorylation of substrates by Aurora A [65]. Besides TPX2, other proteins including I-2 (protein phosphatase inhibitor-2), Ajuba, Cep192, HEF1 (enhancer of filamentation 1), Arpc1b (actin related protein 2/3 complex subunit 1B), PAK1 (p21 protein (Cdc42/Rac)-activated kinase 1), and Bora are also known to act as positive regulators of Aurora A activation [13, 17, 41, 66-70] Although Ajuba is believed to be an Aurora A activator, a very recent study demonstrates that in Drosophila, Ajuba does not activate Aurora A. In this model system, Ajuba is instead required for the centrosomal localization and maintenance of Aurora A kinase, but not its activation [71]. Besides these proteins, PKA (protein kinase A) was also shown to phosphorylate and activate Aurora A in vitro [69]. The important mitotic kinase, Plk1, also serves as a fine tuner of Aurora A activity [25, 72]. Plk1 negatively regulates Aurora A activity by promoting degradation of the Aurora A

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

6

Jyoti Iyer, Saili Moghe, Niveditha Rajagopalan et al.

activator protein Bora via the SCF-beta TrCP E3 ubiquitin ligase. Moreover, Plk1 also inhibits Aurora A activity by facilitating its degradation via the APC/C E3 ubiquiting ligase [25]. However, another study has reported that Plk1 phosphorylates TPX2 to enhance TPX2mediated activation of Aurora A, thereby increasing its activity [73]. Thus, it appears that Plk1 can both activate and inhibit Aurora A as per the requirements of the cell. In addition to Plk1, Katayama and colleagues demonstrated that the CPC (chromosomal passenger complex) protein INCENP (inner centromere protein) also contributes to Aurora A activation in vitro [74]. A very recent study has indicated that the CUL3-KLHL18 (Cullin3- kelch-like protein 18) E3 ubiquitin ligase may contribute to Aurora A activation at the centrosomes. In this study, the knockdown of either KLHL18 or CUL3 led to a drastic inhibition of Aurora A activity at the centrosomes. Further, Aurora A was ubiquitinated by the CUL3-KLHL18 E3 ligase, though this ubiquitination did not facilitate Aurora A degradation [75]. Thus, CUL3KLHL18 is another protein complex that regulates Aurora A activity. While all the above mentioned proteins promote Aurora A activation, many proteins that inhibit Aurora A activity have also been identified. These proteins include p53, the p53 target gene product GADD45a (growth arrest and DNA-damage-inducible protein GADD45 alpha), PP1, PP6, RasGAP (ras GTPase-activating protein) and PTTG1 (Pituitary tumor transforming gene 1) [2, 69, 76-83].

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

Aurora A and Cancer The role of Aurora A as an oncogenic product is now well documented. Aurora A overexpression was sufficient to induce the transformation of rodent cells and mouse NIH3T3 cells [84, 85]. Further, Aurora A overexpression has been observed in several cancers including breast, ovarian, prostate, cervical, colon, pancreatic and lung cancers [84-89]. In fact, the 20q13 chromosome on which the Aurora A gene is located, is often amplified in different malignancies [85]. Indeed, the involvement of Aurora A in cancer is not limited to its overexpression, but Aurora A also converges with different oncogenic pathways to facilitate cancer progression. In addition to playing prominent roles in centrosome separation and maturation, bipolar spindle assembly and asymmetric cell division, Aurora A also regulates proteins that play crucial roles in oncogenic pathways. Aurora A activates several pathways that are important for tumorigenesis including the p53, BRCA1, Akt, NFB (nuclear factor kappa-B), -catenin, Ras and myc pathways [5]. The phosphorylation of p53 on Ser 215 by Aurora A inhibits its DNA binding and transactivation activities [89]. On the other hand, p53 phosphorylation on Ser 315 by Aurora A facilitates MDM2-mediated degradation of p53 [90]. In this way, Aurora A inhibits the functions of the tumor suppressor protein p53. p53 itself also negatively regulates Aurora A function in two ways- 1) p53 can directly bind the T-loop of Aurora A and inhibit its kinase activity [76]. 2) p53 mediates the transcription of GADD45a and causes GADD45a-mediated inhibition of Aurora A activity [77]. In addition to p53, Aurora A also inactivates another tumor suppressor protein BRCA1, by phosphorylating it [40]. Aurora A activates the oncogene Akt in a p53-dependent manner [91]. Additionally, Aurora A also contributes to activation of the transcription factor NFB by phosphorylating the NFB inhibitor protein IκBα (NF-kappa-B inhibitor alpha) and mediating its TNFα (tumor necrosis factor α) –

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

Aurora Kinases in Mitosis and Carcinogenesis

7

induced degradation [92]. Phosphorylation of GSK3 (Glycogen Synthase Kinase-3 Beta) by Aurora A leads to activation of the oncogenic  catenin-TCF transcription complex [93]. The oncogene Ras is one of the most frequently mutated genes in human cancers. Aurora A is known to co-operate with Ras to mediate tumorigenesis [94]. Aurora A phosphorylates the Ras effector protein RalA to promote its activation and translocation from the plasma membrane [94]. Thus, Aurora A activates the Ras pathway via the regulation of RalA. Another important oncogene that Aurora A regulates is myc. Significantly, Aurora A was shown to promote stabilization of N-myc in human neuroblastoma [95]. A very recent study by Colon and colleagues shows that Aurora A regulates N-myc activity through the phosphorylation of GSK3 and  catenin [96]. Aurora A also causes the up-regulation of hTERT (human Telomerase Reverse Transcriptase) mRNA via c-myc [97]. All these studies clearly establish the role of Aurora A as an oncogenic protein. Thus, Aurora A negatively regulates tumor suppressors and activates oncogenes to facilitate tumorigenesis. Since Aurora A targets so many important oncogenic pathways, it is an attractive target for anticancer therapy. Indeed, several Aurora kinase inhibitors have been developed and are currently being evaluated for their efficacy in cancer therapy (Reviewed in [5]). A summary of all Aurora A-regulating proteins discussed herein may be referred to in table I.

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

Table I. Proteins that regulate Aurora A kinase activity and localization Positive regulators of Aurora A

Negative regulators of Aurora A

USP2a [30] TPX2 [62-64] I-2 [70] Ajuba [13] Cep192 [17] HEF1 [66] Arpc1b [67] PAK1 [68] Bora [41] PKA [69] Plx1 [73] INCENP [74] CUL3-KLHL18 [75]

APC/C-Cdh1 [23, 24] PP2A [28] AIP [31] CHFR [32] PP1 [63,65] Plk1 [25] p53 [76] GADD45a [77] PP1 [2] PP6 [81] RasGAP [82] PTTG1 [83]

Proteins that regulate Aurora A localization TPX2 [14] Plk1 [16] Cep192 [17] Centrosomin [18]

AURORA B KINASE Aurora B Localization Aurora B is the enzymatic core of the CPC. The CPC comprises of three other proteins besides Aurora B: INCENP, Survivin and Dasra B/ Borealin. The CPC localizes to the inner centromeres from prophase to metaphase, translocates to the spindle midzone in anaphase and relocates to the midbody during telophase [6, 22].

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

8

Jyoti Iyer, Saili Moghe, Niveditha Rajagopalan et al.

Additionally, two studies have clearly demonstrated the existence of low levels of Aurora B kinase at the spindle poles during the early stages of mitosis [98, 99]. Several proteins are known to contribute to proper localization of the CPC during mitosis. In fact, the CPC proteins themselves are interdependent upon each other for their correct localization [12]. A ternary subcomplex comprising of Borealin, Survivin and the N-terminus of INCENP is also required for the centromere localization of the CPC [100]. Phosphorylation of HH3 T3 (Histone H3 threonine 3) by Haspin kinase is one of the mechanisms by which the CPC is localized to the centromeres during metaphase. The phosphorylated HH3 T3 is recognized by the passenger complex protein Survivin to localize Aurora B to the inner centromeres [101104]. The phosphatase PP1 dephosphorylates HH3 T3 and thereby, prevents the association of Aurora B with the inner centromeres [105, 106]. Another mode by which the CPC localizes to the centromeres is via the phosphorylation of Histone H2A Thr 120 by the checkpoint kinase BuB1. This phosphorylation generates a docking site for the protein SGO2 (Shugoshin 2) that is a centromeric interaction partner of Cdk1-phosphorylated CPC [104, 107, 108]. Thus, this post-translational modification also aids in recruiting the CPC to the centromeres. Upon the onset of anaphase, the CPC translocates to the spindle midzone [109]. This midzone localization of the CPC is achieved through two pathways. One manner by which the CPC localizes to the midzone is by ubiquitination of Aurora B by a CUL3-KLHL21 E3 ligase. Upon knockdown of these E3 ligase components, the midzone localization of the CPC was abolished, indicating a role of this complex in regulating CPC localization to the spindle midzone [110]. Additionally, the phosphatase CDC14A and the motor protein MKLP2 (Mitotic kinesin-like protein 2) have also been shown to be necessary for CPC localization to the spindle midzone during anaphase. The dephosphorylation of INCENP by CDC14A promotes interaction of the CPC with MKLP2 and its consequent recruitment to the spindle midzone [111, 112]. Phosphorylation of the CPC protein INCENP by the CyclinB-Cdk1 complex negatively regulates the targeting of the CPC to the spindle midzone during anaphase [111]. Another protein, Mob1 (Mps one binding 1) was also shown to contribute to the timely recruitment of Aurora B to the spindle midzone [113]. Besides these proteins, the CPC proteins INCENP and Survivin themselves possess inherent MT-binding ability and may help maintain the CPC at specific cellular locations during different stages of the cell cycle [114-116]. A recent study showed that the phosphorylation of INCENP by Aurora B decreased the direct binding of the CPC to bundled MTs in pre-anaphase and central spindles [117].

Regulation of Aurora B Levels Like its sister kinase Aurora A, Aurora B levels are also tightly controlled during mitosis. Aurora B protein expression peaks during the G2/M transition and the protein is degraded at the next G1 phase [109]. The APC/C-Cdh1 E3 ubiquitin ligase that degrades Aurora A at the end of mitosis is also responsible for mediating the degradation of Aurora kinase B upon mitotic exit [118, 119]. Recently, the lipid raft protein, Fillotin was shown to be necessary to maintain the cellular levels of Aurora B. The depletion of Fillotin decreased the amount of Aurora B protein, suggesting that Fillotin positively regulates the levels of Aurora B in the cell [120]. However, the mechanistic details of this phenomenon remain unclear. Similarly,

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

Aurora Kinases in Mitosis and Carcinogenesis

9

the bromodomain protein, Brd4, is another protein that positively regulates the expression of Aurora B [121].

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

Regulation of Aurora B Activity Not only is the level of Aurora B tightly regulated during mitosis, but its activity has also been shown to be controlled by several proteins during mitosis. The autophosphorylation of Aurora B on Thr 232 (human) or Thr 248 (Xenopus) has been shown to correlate directly with Aurora B activity [122-125]. Moreover, a recent study by Petsalaki et. al. has shown that the phosphorylation of Aurora B on another residue Ser 331, is also required for the complete activation of Aurora B [126]. The proteins that promote Aurora B activation include Survivin, INCENP, Borealin, Chk1, TLK1 (Tousled-like kinase 1), EB1 (end binding protein-1), Fillotin, TD-60 (telophase-disc 60) and MTs [102, 120, 122, 124, 126-135]. The role of Survivin in mediating Aurora B activation was controversial until recently. A study by Honda et. al. had shown that Survivin does not function as an Aurora B activator [123]. However, several studies have indicated that Survivin contributes to Aurora B activation in both Xenopus egg extracts as well as in human cells [102, 127-129]. In fact, a recent study showed that Survivin is phosphorylated by Plk1 on its Ser 20 residue and that this phosphorylation is required for Aurora B activation [129]. Thus, there seems to be enough evidence in the literature now to suggest that Survivin indeed serves as an Aurora B activator. The most well-characterized and studied activator of Aurora B kinase is INCENP. Aurora B binds the IN-box of INCENP and phosphorylates TSS (Thr-Ser-Ser) residues within this IN-box. This phosphorylation further enhances Aurora B autophosphorylation and activation [122-125]. The phosphorylation of the CPC protein Borealin by the checkpoint kinase Mps1 (multipolar spindle 1) is known to contribute to Aurora B activation through an as yet unknown mechanism [130]. Borealin may promote clustering and activation of Aurora B at the centromeres [124, 135]. The kinase Chk1 was shown to phosphorylate the Ser 331 residue of Aurora B and thereby enhance its activity [126]. Another study demonstrated that the C. elegans TLK-1 protein increases Aurora B activity in an INCENP-dependent manner [132]. Furthermore, the MT plus-end-tracking protein EB1 inhibits the inactivation of Aurora B by the phosphatase PP2A and therefore contributes to increasing Aurora B activity [133]. Additionally, TD-60 and MTs were also shown to promote Aurora B activation in vitro [134]. Recently, Ban and colleagues demonstrated that the SUMOylation of Aurora B by the SUMO-protein ligase PIAS3 (protein inhibitor of activated STAT) positively regulates Aurora B activity by promoting its autophosphorylation [136]. Thus, besides phosphorylation, the post-translational modification of SUMOylation also contributes to Aurora B activation. In addition to interacting with proteins that positively regulate Aurora B activity, many proteins are also known to negatively regulate Aurora B. The phosphatases PP1 and PP2A are the major phosphatases that inhibit Aurora B activity [80, 133, 137-139]. The protein KNL1 (Kinetochore-null protein 1) also promotes Aurora B inhibition by recruiting the phosphatase PP1 to the outer kinetochores and consequently inhibiting Aurora B activity [140]. Another protein Sds22, a regulator of PP1 also mediates Aurora B inhibition via PP1 [138]. Aurora B also phosphorylates SGO2 to recruit PP2A to the centromeres thereby, negatively regulating its own activity [141]. Additionally, the checkpoint protein BuBR1 (MAD3/BUB1-related

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

10

Jyoti Iyer, Saili Moghe, Niveditha Rajagopalan et al.

protein kinase 1) has also been shown to inhibit kinetochore-localized Aurora B activity [12, 142]. In their study, Ramadan and colleagues showed that the ubiquitin-specific chaperone complex p97Ufd1-Npl4 negatively regulates Aurora B activity during mitotic exit [143]. Thus, Aurora B activity is under strict surveillance by all the above-mentioned proteins to ensure that it phosphorylates the correct substrates at the right time and location to bring about its functions during mitosis.

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

Aurora B Mitotic Functions Aurora B Functions in Chromosome Structure and Alignment Aurora B plays a critical role in the processes of chromosome cohesion and condensation [12, 80, 144-155]. Aurora B and Plk1 synergize to control chromosome cohesion during prophase [12, 144, 156]. Aurora B activity is required for the proper localization of separase to the mitotic chromosomes [147]. Separase causes the dissolution of cohesion between the sister chromatids and thereby, promotes the onset of chromosome segregation [192]. Thus, this is another avenue by which Aurora B regulates cohesion between chromosome arms. Further, Aurora B along with the phosphatase PP2A and the checkpoint protein BUB1 (budding uninhibited by benzimidazoles 1) regulates the localization of SGO1 to modulate cohesion between the sister chromatids [12, 155, 157-159]. Ramadan and colleagues report that the AAA ATPase Cdc48/p97 may negatively regulate Aurora B activity and thereby, promote chromosome decondensation during telophase [143]. A major function of Aurora B kinase is to ensure that the chromosomes align properly at the metaphase plate during mitosis. This is accomplished by the regulation of kinetochoreMT interactions by Aurora B [57, 160]. There is strong evidence which suggests that Aurora B functions to mediate proper chromosome alignment by sensing tension between sister chromatids [161, 162]. Aurora B localizes to the inner centromeres during metaphase [22, 109]. When the sister chromatids are aberrantly attached (syntelic or monotelic attachments), the sister chromatids are not under the optimal amount of tension. As a result, Aurora B is the close proximity of its kinetochore substrates. Consequently, Aurora B can phosphorylate its kinetochore substrates such as Hec1/Ndc80, KNL1, mDia3 (diaphanous homolog 3) and the Mis12 complex subunit protein, Dsn1 (Kinetochore-associated protein DSN1 homolog) [161]. These proteins mediate the attachment of chromosomes to the kinetochore MTs. Phosphorylation of these proteins by Aurora B reduces their affinity to MTs and thereby, causes the kinetochore MTs to detach from the sister chromatids (Reviewed by [161, 163]). Additionally, Aurora B also phosphorylates the MT depolymerizing proteins MCAK and Kif2a (kinesin-like protein KIF2A) and inhibits their MT-depolymerizing activities [164168]. MCAK activity has been shown to be required for proper bipolar spindle assembly and chromosome segregation [22, 167, 169]. Thus, influencing MT dynamics by inhibiting MCAK activity is another way by which Aurora B controls chromosome alignment. However, it is a bit surprising that Aurora B negatively regulates the activities of MCAK and Kif2a at the kinetochores. The current model suggests that Aurora B facilitates the depolymerization of kinetochore MTs when sister chromatids are not attached correctly. Since Aurora B inhibits MCAK and Kif2a activities, Aurora B, if active, would promote MT polymerization at unattached kinetochores in this case. Additional studies are required to

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

Aurora Kinases in Mitosis and Carcinogenesis

11

understand exactly how the regulation of MCAK and Kif2a by Aurora B contributes to proper metaphase chromosome alignment.

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

Aurora B Functions in Chromosome Segregation and Anaphase Onset Aurora B also functions to regulate the spindle assembly checkpoint (SAC) and prevents chromosome segregation till all sister chromatids are correctly attached [170, 171]. This process continues until an amphitelic attachment is established between the kinetochore MTs and the sister chromatids. The current paradigm is that once the correct attachment is achieved, the sister chromatids are under an optimum amount of tension. As a consequence, the kinetochore substrates of Aurora B are physically separated from Aurora B. Hence, Aurora B can no longer phosphorylate its substrates and this leads to the stable attachment of chromosomes to the kinetochore MTs. This, in turn, satisfies the SAC and leads to chromosome separation [162, 172]. Furthermore, Aurora B activity at the kinetochore is negatively regulated by the phosphatase PP1 [2, 151, 162, 173]. The kinetochore protein KNL1 mediates the localization of PP1 to the kinetochores. When the sister chromatids are not attached in an amphitelic manner, Aurora B phosphorylates KNL1 on its RVSF motif and this prevents the association of PP1 with KNL1 [140]. Thus, Aurora B ensures that it is active until all the sister chromatids are properly attached, by preventing the recruitment of its opposing phosphatase PP1 to the kinetochores. Once the chromosomes are accurately aligned, Aurora B may be physically separated from KNL1 due to tension on the kinetochore MTs. This would therefore prevent the phosphorylation of KNL1 by Aurora B and lead to the recruitment of PP1 to the kinetochores. PP1 would then further inhibit Aurora B activity at the kinetochores. As a consequence, the kinetochore-MT interactions would be stabilized and the SAC would be inactivated and satisfied. Consequently, anaphase onset would be triggered. Aurora B Functions in Cytokinesis In addition to its role in chromosome alignment and segregation, Aurora B is also crucial for the process of cytokinesis. Aurora B depletion causes polyploidy, indicative of cytokinesis failure [174]. In particular, the kinase activity of Aurora B is necessary for cytokinesis; overexpression of kinase dead Aurora B consistently leads to multinucleated cells as a consequence of improper cytokinesis [109]. Indeed, Aurora B phosphorylates multiple substrates during telophase and cytokinesis, and these phosphorylation events have all been demonstrated to be required for successful completion and exit from mitosis. Aurora B substrates during telophase and cytokinesis include Vimentin, GFAP (Glial fibrillary acidic protein), Desmin, MKLP1 (Mitotic kinesin-like protein 1), and RacGAP-1 (Rac GTPaseactivating Protein-1) [150, 175-177]. Studies have demonstrated the importance of Aurora B mediated phosphorylation of different intermediate filaments (IFs) which are located at the cleavage furrow. Importantly, expression of kinase dead Aurora B results not only in cytokinesis failure, but also IF-bridges [150, 175]. There is evidence indicating that Aurora B phosphorylates the IFs Desmin and GFAP, and that this phosphorylation inhibits the filament forming capacity of these proteins in vitro. Moreover, the sites phosphorylated by Aurora B on GFAP and Desmin are sites that are phosphorylated specifically at the cleavage furrow [175]. Similarly, Aurora B also phosphorylates another IF Vimentin at Ser 72, a site which is necessary for cleavage furrow ingression [150]. Since a number of Aurora B substrates during cytokinesis are IFs, and

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

12

Jyoti Iyer, Saili Moghe, Niveditha Rajagopalan et al.

expression of kinase dead Aurora B leads to IF-bridges and failure to complete cytokinesis, regulation of IFs at the cleavage furrow appears to be an important avenue by which Aurora B regulates cytokinesis. Furthermore, extensive studies have demonstrated that Aurora B activity also regulates the localization and function of other proteins at the midbody during cytokinesis. Aurora B phosphorylates and regulates the localization of MKLP1 to the midbody during cytokinesis [178]. MLKP1 mislocalizes upon the inhibition of Aurora B activity, and this leads to cytokinesis defects [177]. Additionally, phosphorylation of RacGAP1 at Ser 387 is mediated by Aurora B. This specific phosphorylation by Aurora B converts RacGAP1 from a GAP for Rac/Cdc42, to a GAP for Rho, which is an activity that is necessary for cytokinesis [176]. Thus, Aurora B regulates cytokinesis in a multi-pronged manner, by regulating the functions, localizations, and activities of several proteins that serve necessary functions during cytokinesis.

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

Aurora B and Cancer The role of Aurora B in cancer is closely related to its essential function in mitosis, especially in its regulation of chromosome alignment and cytokinesis. Failure of cells to undergo proper cytokinesis can lead to genomic instability, which is linked to cancer [179]. Aurora B does not directly possess transforming potential, although several cancers show a correlation between Aurora B expression and poor prognosis. Examples of such a correlation include cancers of the breast, colon, kidney, prostate, lung, and thyroid, among others [81, 88, 180, 181]. Indeed, Aurora B inhibitors are being studied in regard to potential therapy for cancer [5, 181]. Aurora B overexpression correlates with genomic instability, thereby increasing the propensity of cells to aquire genetic alterations necessary for neoplastic transformation. As expected, the overexpression of Aurora B in p53-deficient Chinese hamster embryonic cells causes defects in chromosome segregation and cytokinesis [182]. Although not a classical oncogene, Aurora B can potentiate oncogenic transformation with other oncogenes, an instance being Aurora B involvement in Ras-mediated cell transformation [183]. In a study by Nguyen and colleagues, the overexpression of Aurora B resulted in the formation of tetraploid murine epithelial cells. Further, the injection of these tetraploid cells into nude mice yielded mammary tumors [174]. This evidence clearly suggests that either the overexpression or the hyperactivation of Aurora B facilitates tumorigenesis. However, another study by Stiegemann and group demonstrated that Aurora B activity is required to prevent tetraploidization when unsegregated chromatin is present at the cleavage plane [184]. This implies that in this scenario, Aurora B activity may be essential to deter transformation. Thus, it appears that either too much or too little Aurora B may be able to promote cancer progression. A summary of all Aurora B-regulating proteins discussed herein may be referred to in table II.

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

Aurora Kinases in Mitosis and Carcinogenesis

13

Table II. Proteins that regulate Aurora B kinase activity and localization Positive regulators of Aurora B INCENP [122, 124] Survivin [127, 128 129] Borealin [130] Chk1 [126, 131] TLK-1 [132] Fillotin [120] Brd4 [121] TD-60 [134] MTs [134] Mps1 [130] EB1 [133] PIAS3 [136]

Negative regulators of Aurora B APC/C- Cdh1 [109] PP2A [133, 137, 139] PP1 [80, 139] Sds22 [138] BuBR1 [12, 142] p97Ufd1-Npl4 [143] KNL1 [140]

Proteins that regulate Aurora B localization INCENP [12, 100] Survivin [12, 100] Dasra B/ Borealin [12, 100] Haspin [101, 104] Histone H3 [101, 104] Histone H2A [104, 107] PP1 [105, 106] BUB1 [104, 107] SGO2 [104, 107] Cyclin B- Cdk1 [108] CUL3-KHLH21 [110] CDC14A [111] MKLP2 [112] Mob1 [113]

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

PERSPECTIVES - IS THERE A SIGNALING CROSS-TALK BETWEEN AURORA A AND AURORA B? Aurora A and Aurora B kinases localize to different cellular locations during mitosis. Therefore, the current paradigm is that these kinases function independent of each other and phosphorylate different substrates to perform separate functions during mitosis. However, this view is being challenged by recent evidence, which indicates that there may in fact exist a cross-talk between Aurora A and Aurora B kinases. There is much evidence which suggests the existence of a cross-talk between Aurora A and Aurora B pathways. The machinery that controls chromosome alignment and the SAC may need to communicate with the spindle assembly apparatus to ensure accurate chromosome alignment and segregation during mitosis. Therefore, it is rational to propose that Aurora B, a protein which regulates chromosome alignment and the SAC, may be able to cross-talk with Aurora A, a protein that is involved in constructing a functional bipolar spindle to align and separate the chromosomes during mitosis. Furthermore, the overexpression of Aurora A causes overriding of the SAC which is controlled by Aurora B [185]. This observation points towards a possible signaling cross-talk between the two Aurora kinases. Further, the inhibition of Aurora A activity using the inhibitor ZM447439, which inhibits Aurora A kinase activity at a slightly greater potency than Aurora B kinase activity, gives rise to phenotypes that are indicative of Aurora B inhibition [5, 171]. This suggests that either Aurora A can independently perform the same functions as Aurora B or Aurora A can either directly or indirectly affect the Aurora B pathway to bring about these cellular phenotypes. Aurora kinases share over 70% homology in their catalytic kinase domains [22]. Therefore, these kinases are likely to share similar substrates during mitosis. In fact, Aurora A and Aurora B share some common substrates during mitosis. Both these kinases

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

14

Jyoti Iyer, Saili Moghe, Niveditha Rajagopalan et al.

phosphorylate a shared set of substrates including CENP-A (Centromere protein A), histone H3, Kif2, MCAK, RASSF1A (ras association domain-containing protein 1 isoform A), INCENP, and LATS2 (Large tumor suppressor homolog 2) [5, 186-190]. Aurora A phosphorylates LATS2 on its Ser 380 residue. An Aurora A non-phosphorylatable form of LATS2 causes chromosome missegregation and cytokinesis failure, which is reminiscent of Aurora B inactivation [190]. Moreover, the localization of LATS2 overlaps with that of both Aurora A and Aurora B kinases [38]. Therefore, it is tempting to speculate that LATS2 may facilitate a cross-talk between Aurora A and Aurora B kinases during mitosis. Further, both these Aurora kinases also share common interacting partners during mitosis including the phosphatases PP1 and PP2A and the E3 ubiquitin ligase component, CUL3 [5, 75, 110, 139, 161, 162]. Interestingly, a CUL3-KLHL21 based E3 ligase was shown to control the localization of Aurora B and the chromosomal passenger complex (CPC) to the spindle midzone during anaphase [110]. Very recently, a study by Moghe, et. al. has demonstrated that in addition to controlling localization of Aurora B and the CPC, CUL3 also regulates the activity of centrosome-localized Aurora A to control mitotic entry [75]. Thus, in this case, the same protein regulates both Aurora A and Aurora B signaling pathways. Further, the phosphatases PP1 and PP2A regulate both Aurora A and Aurora B activities [5, 139, 161, 162]. Our unpublished data shows that the Aurora B activator protein, INCENP co-localizes with Aurora A at the spindle poles (Iyer, et. al, unpublished). Moreover, a study by Katayama, et. al. identified INCENP as an Aurora A substrate in vitro [74]. Whether endogenous Aurora A can interact with INCENP under endogenous conditions requires further investigation. In addition to the Aurora B activator protein INCENP co-localizing with Aurora A at the spindle, the Aurora A activator protein, TPX2 also co-localizes with Aurora B at the kinetochore MTs during metaphase (Iyer, et. al., unpublished). In spite of strong evidence hinting towards a cross-talk between Aurora A and Aurora B, many researchers still argue that these kinases operate via independent pathways during mitosis. One major reason for this controversy is that Aurora kinases occupy different cellular locations during early mitosis. However, two independent studies have exhibited that Aurora B localizes to the spindle poles during early mitosis where Aurora A is present. In the first of these studies by Murata Hori et. al., the authors showed that GFP-Aurora B localizes to the spindle poles, where Aurora A is located [98]. In the second study, Tseng et. al. demonstrated that under endogenous conditions, a small fraction of Aurora B protein localizes to the spindle poles during mitosis [99]. Importantly, the knockdown of Aurora B protein in these cells abolished the spindle pole localization of the kinase [99]. This evidence suggests that the localization of Aurora B to the spindle poles during early mitosis is clearly specific. Additionally, even if these proteins localize at different locations during early mitosis, they may be able to communicate with each other via other proteins that share overlapping localizations and interactions with the two kinases such as LATS2. These intermediate proteins may be transported by motor proteins from the spindle poles to the kinetochore MTs and vice versa and thereby, serve as messengers to relay signals from one kinase to another. Moreover, a fraction of Aurora A is known to localize at the spindle midzone and the midbody during anaphase and telophase respectively, where Aurora B is also housed [6]. The fact that both Aurora A and Aurora B occupy similar cellular compartments during different stages of mitosis suggests that, these two pathways may be able to cross-talk during these stages of mitosis. Indeed, a recent study by Hegarat and colleagues showed that Aurora A and Aurora

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

Aurora Kinases in Mitosis and Carcinogenesis

15

B together co-ordinate chromosome segregation and MT dynamics during anaphase in DT40 cells [191]. In summary, the current evidence suggests that Aurora A and Aurora B kinases may communicate with each other to bring about proper mitosis. Although we have made rational speculations about the existence of a cross-talk between Aurora A and Aurora B pathways based upon the available literature, further experimental evidence directly testing this hypothesis will shed more light on whether a cross-talk indeed exists between Aurora A and Aurora B signaling pathways. Since Aurora A and Aurora B kinases are crucial players in the process of mitosis and tumorigenesis, more studies should be directed to study the regulation of these proteins in these important biological processes.

ACKNOWLEDGMENTS Due to the overwhelming amount of literature available on Aurora kinases in mitosis and tumorigenesis, we have not been able to include all the publications pertaining to these proteins in this review paper. We apologize to the authors of those significant studies that could not be included in this article due to time and space constraints.

REFERENCES [1]

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

[2]

[3] [4]

[5] [6] [7]

[8]

[9]

Lengauer, C.; Kinzler, K. and Vogelstein, B. (1998). Genetic instabilities in human cancers. Nature, 396, 643-649. Francisco, L.; Wang, W. and Chan, C. (1994). Type 1 protein phosphatase acts in opposition to IpL1 protein kinase in regulating yeast chromosome segregation. Mol. Cell. Biol., 14, 4731-4740. Giet, R. and Prigent, C. (1999). Aurora/Ipl1p-related kinases, a new oncogenic family of mitotic Ser-threonine kinases. J. Cell. Sci., 112, 3591-3601. Glover, D. M.; Leibowitz, M.; McLean, D. and Parry, H. (1995). Mutations in aurora prevent centrosome separation leading to the formation of monopolar spindles. Cell, 81, 95-105. Katayama, H. and Sen, S. (2010). Aurora kinase inhibitors as anticancer molecules. Biochimica et Biophysica Acta (BBA) - Gene Regulatory Mechanisms, 1799, 829-839. Carmena, M. and Earnshaw, W. C. (2003). The cellular geography of aurora kinases. Nat. Rev. Mol. Cell Biol., 4, 842-854. Dieterich, K.; Soto Rifo, R.; Faure, A.; Hennebicq, S.; Ben Amar, B.; Zahi, M.; Perrin, J.; Martinez, D.; Sèle, B.; Jouk, P.; Ohlmann, T.; Rousseaux, S.; Lunardi, J. and Ray, P. (2007). Homozygous mutation of AURKC yields large-headed polyploid spermatozoa and causes male infertility. Nature Genetics, 39, 661-665. Hu, H.; Chuang, C.; Lee, M.; Tseng, T. and Tang, T. (2000). Genomic organization, expression, and chromosome localization of a third aurora-related kinase gene, Aie1. DNA and Cell Biology, 19, 679-688. Kimmins, S.; Crosio, C.; Kotaja, N.; Hirayama, J.; Monaco, L.; Höög, C.; Van Duin, M.; Gossen, J. and Sassone-Corsi, P. (2006). Differential functions of the Aurora-B and

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

16

[10]

[11]

[12]

[13]

[14]

[15]

[16]

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

[17]

[18]

[19]

[20]

[21]

[22]

Jyoti Iyer, Saili Moghe, Niveditha Rajagopalan et al. Aurora-C kinases in mammalian spermatogenesis. Molecular Endocrinology (Baltimore), 21, 726-739. Kimura, M.; Matsuda, Y.; Yoshioka, T. and Okano, Y. (1999). Cell cycle-dependent expression and centrosome localization of a third human aurora/Ipl1-related protein kinase, AIK3. Journal of Biological Chemistry, 274, 7334-7340. Tseng, T.; Chen, S.; Hsu, Y. and Tang, T. (1998). Protein kinase profile of sperm and eggs: cloning and characterization of two novel testis-specific protein kinases (AIE1, AIE2) related to yeast and fly chromosome segregation regulators. DNA Cell Biol., 17, 823-833. Carmena, M.; Ruchaud, S. and Earnshaw, W. C. (2009). Making the Auroras glow: regulation of Aurora A and B kinase function by interacting proteins. Curr. Opin. Cell Biol., 21, 796-805. Hirota, T.; Kunitoku, N.; Sasayama, T.; Marumoto, T.; Zhang, D.; Nitta, M.; Hatakeyama, K. and Saya, H. (2003). Aurora-A and an Interacting Activator, the LIM Protein Ajuba, Are Required for Mitotic Commitment in Human Cells. Cell, 114, 585598. Kufer, T. A.; Silljé, H. H. W.; Körner, R.; Gruss, O. J.; Meraldi, P. and Nigg, E. A. (2002). Human TPX2 is required for targeting Aurora-A kinase to the spindle. J. Cell Biol., 158, 617-623. Romé, P.; Montembault, E.; Franck, N.; Pascal, A.; Glover, D. M. and Giet, R. (2010). Aurora A contributes to p150glued phosphorylation and function during mitosis. The Journal of Cell Biology, 189, 651-659. Luca, M. D.; Lavia, P. and Guarguaglini, G. (2006). A Functional Interplay Between Aurora-A, Plk1 and TPX2 at Spindle Poles: Plk1 Controls Centrosomal Localization of Aurora-A and TPX2 Spindle Association. Cell Cycle, 5, 296-303. Joukov, V.; De Nicolo, A.; Rodriguez, A.; Walter, J. C. and Livingston, D. M. (2010). Centrosomal protein of 192 kDa (Cep192) promotes centrosome-driven spindle assembly by engaging in organelle-specific Aurora A activation. Proceedings of the National Academy of Sciences - PNAS, 107, 21022-21027. Terada, Y.; Uetake, Y. and Kuriyama, R. (2003). Interaction of Aurora-A and centrosomin at the microtubule-nucleating site in Drosophila and mammalian cells. The Journal of Cell Biology, 162, 757-764. Ma, N.; Matsunaga, S.; Morimoto, A.; Sakashita, G.; Urano, T.; Uchiyama, S. and Fukui, K. (2011). The nuclear scaffold protein SAF-A is required for kinetochore– microtubule attachment and contributes to the targeting of Aurora-A to mitotic spindles. Journal of Cell Science, 124, 394-404. Sugimoto, K.; Urano, T.; Zushi, H.; Inoue, K.; Tasaka, H.; Tachibana, M. and Dotsu, M. (2002). Molecular dynamics of Aurora-A kinase in living mitotic cells simultaneously visualized with histone H3 and nuclear membrane protein importinalpha. Cell structure and function, 27, 457-467. Marumoto, T.; Honda, S.; Hara, T.; Nitta, M.; Hirota, T.; Kohmura, E. and Saya, H. (2003). Aurora-A Kinase Maintains the Fidelity of Early and Late Mitotic Events in HeLa Cells. Journal of Biological Chemistry, 278, 51786-51795. Ruchaud, S.; Carmena, M. and Earnshaw, W. C. (2007). Chromosomal passengers: conducting cell division. Nature Reviews Molecular Cell Biology, 8, 798-812.

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

Aurora Kinases in Mitosis and Carcinogenesis

17

[23] Castro, A.; Vigneron, S.; Bernis, C.; Labbé, J.; Prigent, C. and Lorca, T. (2002). The DBox-activating domain (DAD) is a new proteolysis signal that stimulates the silent DBox sequence of Aurora-A. Embo Reports, 3, 1209-1214. [24] Castro, A.; Arlot-Bonnemains, Y.; Vigneron, S.; Labbé, J., C.; Prigent, C. and Lorca, T. (2002). APC/Fizzy-Related targets Aurora-A kinase for proteolysis. Embo Reports, 3, 457-462. [25] van Leuken, R.; Clijsters, L.; Van Zon, W.; Lim, D.; Yao, X.; Wolthuis, R.; Yaffe, M., B.; Medema, R., H. and Van Vugt, M. (2009). Polo-Like Kinase-1 Controls Aurora A Destruction by Activating APC/C-Cdh1. PLoS ONE, 4, e5282. [26] Katayama, H.; Brinkley, W. R. and Sen, S. (2003). The Aurora kinases: role in cell transformation and tumorigenesis. Cancer Metastasis Rev., 22, 451-464. [27] Littlepage, L., E. and Ruderman, J., V. (2002). Identification of a new APC/C recognition domain, the A box, which is required for the Cdh1-dependent destruction of the kinase Aurora-A during mitotic exit. Genes and Development, 16, 2274-2278. [28] Horn, V.; Thélu, J.; Garcia, A.; Albigès-Rizo, C.; Block, M. R. and Viallet, J. (2007). Functional Interaction of Aurora-A and PP2A during Mitosis. Molecular Biology of the Cell, 18, 1233-1241. [29] Giubettini, M.; Asteriti, I. A.; Scrofani, J.; De Luca, M.; Lindon, C.; Lavia, P. and Guarguaglini, G. (2011). Control of Aurora-A stability through interaction with TPX2. Journal of Cell Science, 124, 113-122. [30] Shi, Y.; Solomon, L. R.; Pereda-Lopez, A.; Giranda, V. L.; Luo, Y.; Johnson, E. F.; Shoemaker, A. R.; Leverson, J. and Liu, X. (2011). Ubiquitin-specific Cysteine Protease 2a (USP2a) Regulates the Stability of Aurora-A. Journal of Biological Chemistry, 286, 38960-38968. [31] Lim, S. K. and Gopalan, G. (2007). Antizyme1 mediates AURKAIP1-dependent degradation of Aurora-A. Oncogene, 26, 6593-6603. [32] Yu, X.; Minter-Dykhouse, K.; Malureanu, L.; Zhao, W.; Zhang, D.; Merkle, C. J.; Ward, I. M.; Saya, H.; Fang, G.; van Deursen, J. and Chen, J. (2005). Chfr is required for tumor suppression and Aurora A regulation. Nature Genetics, 37, 401-406. [33] Liu, Q. and Ruderman, J. V. (2006). Aurora A, mitotic entry, and spindle bipolarity. Proceedings of the National Academy of Sciences, 103, 5811-5816. [34] Dutertre, S.; Descamps, S. and Prigent, C. (2002). On the role of aurora-A in centrosome function. Oncogene, 21, 6175-6183. [35] Meraldi, P.; Honda, R. and A.Nigg, E. (2002). Aurora-A overexpression reveals tetraploidization as a major route to centrosome amplification in p53-/- cells. EMBO J., 21, 483-492. [36] Hannak, E.; Kirkham, M.; Hyman, A. A. and Oegema, K. (2001). Aurora-A kinase is required for centrosome maturation in Caenorhabditis elegans. The Journal of Cell Biology, 155, 1109-1116. [37] Berdnik, D. and Knoblich, J., A. (2002). Drosophila Aurora-A Is Required for Centrosome Maturation and Actin-Dependent Asymmetric Protein Localization during Mitosis. Current Biology, 12, 640-647. [38] Toji, S.; Yabuta, N.; Hosomi, T.; Nishihara, S.; Kobayashi, T.; Suzuki, S.; Tamai, K. and Nojima, H. (2004). The centrosomal protein Lats2 is a phosphorylation target of Aurora-A kinase. Genes to Cells, 9, 383-397.

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

18

Jyoti Iyer, Saili Moghe, Niveditha Rajagopalan et al.

[39] Mori, D.; Yano, Y.; Toyo-oka, K.; Yoshida, N.; Yamada, M.; Muramatsu, M.; Zhang, D.; Saya, H.; Toyoshima, Y. Y.; Kinoshita, K.; Wynshaw-Boris, A. and Hirotsune, S. (January 1, 2007). NDEL1 Phosphorylation by Aurora-A Kinase Is Essential for Centrosomal Maturation, Separation, and TACC3 Recruitment. Molecular and Cellular Biology, 27, 352-367. [40] Sankaran, S.; Crone, D. E.; Palazzo, R. E. and Parvin, J. D. (2007). Aurora-A Kinase Regulates Breast Cancer–Associated Gene 1 Inhibition of Centrosome-Dependent Microtubule Nucleation. Cancer Research, 67, 11186-11194. [41] Hutterer, A.; Berdnik, D.; Wirtz-Peitz, F.; Žigman, M.; Schleiffer, A. and Knoblich, J., A. (2006). Mitotic Activation of the Kinase Aurora-A Requires Its Binding Partner Bora. Developmental Cell, 11, 147-157. [42] Giet, R.; McLean, D.; Descamps, S.; Lee, M., J.; Raff, J., W.; Prigent, C. and Glover, D., M. (2002). Drosophila Aurora A kinase is required to localize D-TACC to centrosomes and to regulate astral microtubules. Journal of Cell Biology, 156, 437-451. [43] Bellanger, J. and Gönczy, P. (2003). TAC-1 and ZYG-9 Form a Complex that Promotes Microtubule Assembly in C. elegans Embryos. Current Biology, 13, 1488-1498. [44] Peset, I.; Seiler, J.; Sardon, T.; Bejarano, L. A.; Rybina, S. and Vernos, I. (2005). Function and regulation of Maskin, a TACC family protein, in microtubule growth during mitosis. J. Cell Biol., 170, 1057-1066. [45] Ouchi, M.; Fujiuchi, N.; Sasai, K.; Katayama, H.; Minamishima, Y. A.; Ongusaha, P. P.; Deng, C.; Sen, S.; Lee, S. W. and Ouchi, T. (2004). BRCA1 Phosphorylation by Aurora-A in the Regulation of G2 to M Transition. Journal of Biological Chemistry, 279, 19643-19648. [46] Giet, R.; Uzbekov, R.; Cubizolles, F.; Le Guellec, K. and Prigent, C. (1999). The Xenopus laevis aurora-related protein kinase pEg2 associates with and phosphorylates the kinesin-related protein XlEg5. Journal of Biological Chemistry, 274, 15005-15013. [47] Kapoor, T. M.; Mayer, T. U.; Coughlin, M. L. and Mitchison, T. J. (2000). Probing Spindle Assembly Mechanisms with Monastrol, a Small Molecule Inhibitor of the Mitotic Kinesin, Eg5. The Journal of Cell Biology, 150, 975-988. [48] Dutertre, S.; Cazales, M.; Quaranta, M.; Froment, C.; Trabut, V.; Dozier, C.; Mirey, G.; Bouché, J.; Theis-Febvre, N.; Schmitt, E.; Monsarrat, B.; Prigent, C. and Ducommun, B. (2004). Phosphorylation of CDC25B by Aurora-A at the centrosome contributes to the G2–M transition. Journal of Cell Science, 117, 2523-2531. [49] Seki, A.; Coppinger, J. A.; Jang, C. -.; Yates, J. R. and Fang, G. (2008). Bora and the Kinase Aurora A Cooperatively Activate the Kinase Plk1 and Control Mitotic Entry. Science, 320, 1655-1658. [50] Macurek, L.; Lindqvist, A.; Lim, D.; Lampson, M. A.; Klompmaker, R.; Freire, R.; Clouin, C.; Taylor, S. S.; Yaffe, M. B. and Medema, R. H. (2008). Polo-like kinase-1 is activated by aurora A to promote checkpoint recovery. Nature, 455, 119-123. [51] Koffa, M. D.; Casanova, C. M.; Santarella, R.; Köcher, T.; Wilm, M. and Mattaj, I. W. (2006). HURP Is Part of a Ran-Dependent Complex Involved in Spindle Formation. Current Biology, 16, 743-754. [52] Sauer, G.; Körner, R.; Hanisch, A.; Ries, A.; Nigg, E. A. and Silljé, H. H. W. (2005). Proteome analysis of the human mitotic spindle. Molecular and Cellular Proteomics, 4, 35-43.

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

Aurora Kinases in Mitosis and Carcinogenesis

19

[53] Barr, A. R. and Gergely, F. (2007). Aurora-A: the maker and breaker of spindle poles. Journal of Cell Science (Formerly : Quarterly Journal of Microscopical Science), 120, 2987-2996. [54] Zhang, X.; Ems-McClung, S. C. and Walczak, C., E. (2008). Aurora A Phosphorylates MCAK to Control Ran-dependent Spindle Bipolarity. Molecular Biology of the Cell, 19, 2752-2765. [55] Tanenbaum, M., E.; Macurek, L.; Van der Vaart, B.; Galli, M.; Akhmanova, A. and Medema, R., H. (2011). A Complex of Kif18b and MCAK Promotes Microtubule Depolymerization and Is Negatively Regulated by Aurora Kinases. Current Biology, 21, 1356-1365. [56] Venoux, M.; Basbous, J.; Berthenet, C.; Prigent, C.; Fernandez, A.; Lamb, N. J. and Rouquier, S. (2007). ASAP is a novel substrate of the oncogenic mitotic kinase AuroraA: phosphorylation on Ser625 is essential to spindle formation and mitosis. Human Molecular Genetics, 17, 215-224. [57] Walczak, C. E.; Cai, S. and Khodjakov, A. (2010). Mechanisms of chromosome behaviour during mitosis. Nature Reviews - Molecular Cell Biology, 11, 91-102. [58] Tsai, C., Y.; Ngo, B.; Tapadia, A.; Hsu, P.; Wu, G. and Lee, W. (2011). Aurora-A Phosphorylates Augmin Complex Component Hice1 Protein at an N-terminal Ser/Threonine Cluster to Modulate Its Microtubule Binding Activity during Spindle Assembly. J. Biol. Chem., 286, 30097-30106. [59] Lee, C.; Andersen, R. O.; Cabernard, C.; Manning, L.; Tran, K. D.; Lanskey, M. J.; Bashirullah, A. and Doe, C. Q. (2006). Drosophila Aurora-A kinase inhibits neuroblast self-renewal by regulating aPKC/Numb cortical polarity and spindle orientation. Genes and Development, 20, 3464-3474. [60] Wang, H.; Somers, G. W.; Bashirullah, A.; Heberlein, U.; Yu, F. and Chia, W. (2006). Aurora-A acts as a tumor suppressor and regulates self-renewal of Drosophila neuroblasts. Genes and Development, 20, 3453-3463. [61] Wirtz-Peitz, F.; Nishimura, T. and Knoblich, J. A. (2008). Linking Cell Cycle to Asymmetric Division: Aurora-A Phosphorylates the Par Complex to Regulate Numb Localization. Cell, 135, 161-173. [62] Bayliss, R.; Sardon, T.; Vernos, I. and Conti, E. (2003). Structural basis of Aurora-A activation by TPX2 at the mitotic spindle. Molecular Cell, 12, 851-862. [63] Tsai, M. Y.; Wiese, C.; Cao, K.; Martin, O.; Donovan, P.; Ruderman, J.; Prigent, C. and Zheng, Y. (2003). A Ran signalling pathway mediated by the mitotic kinase Aurora A in spindle assembly. Nature Cell Biology, 5, 242-248. [64] Eyers, P.; Erikson, E.; Chen, L. and Maller, J. (2003). A novel mechanism for activation of the protein kinase Aurora A. Current Biology, 13, 691-697. [65] Bayliss, R.; Sardon, T.; Ebert, J.; Lindner, D.; Vernos, I. and Conti, E. (2004). Determinants for Aurora-A activation and Aurora-B discrimination by TPX2. Cell Cycle, 3, 404-407. [66] Pugacheva, E. N. and Golemis, E. A. (2005). The focal adhesion scaffolding protein HEF1 regulates activation of the Aurora-A and Nek2 kinases at the centrosome. Nat. Cell Biol., 7, 937-946. [67] Molli, P. R.; Li, D. Q.; Bagheri-Yarmand, R.; Pakala, S. B.; Katayama, H.; Sen, S.; Iyer, J.; Chernoff, J.; Tsai, M. Y.; Nair, S. S. and Kumar, R. (2010). Arpc1b, a

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

20

[68]

[69]

[70]

[71]

[72]

[73]

[74]

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

[75]

[76]

[77]

[78] [79]

[80]

[81]

Jyoti Iyer, Saili Moghe, Niveditha Rajagopalan et al. centrosomal protein, is both an activator and substrate of Aurora A. Journal of Cell Biology, 190, 101-114. Zhao, Z.; Lim, J. P.; Ng, Y.; Lim, L. and Manser, E. (2005). The GIT-Associated Kinase PAK Targets to the Centrosome and Regulates Aurora-A. Mol.Cell, 20, 237249. Walter, A., O.; Seghezzi, W.; Korver, W.; Sheung, J. and Lees, E. (2000). The mitotic Ser/threonine kinase Aurora2/AIK is regulated by phosphorylation and degradation. Oncogene, 19, 4906-4916. Satinover, D. L.; Leach, C., A.; Stukenberg, P., T. and Brautigan, D., L. (2004). Activation of Aurora-A kinase by protein phosphatase inhibitor-2, a bifunctional signaling protein. Proceedings of the National Academy of Sciences - PNAS, 101, 86258630. Sabino, D.; Brown, N. H. and Basto, R. (2011). Drosophila Ajuba is not an Aurora-A activator but is required to maintain Aurora-A at the centrosome. Journal of Cell Science (Formerly : Quarterly Journal of Microscopical Science), 124, 1156-1166. Chan, E., H.; Santamaria, A.; Silljé, H., H. and Nigg, E., A. (2008). Plk1 regulates mitotic Aurora A function through βTrCP-dependent degradation of hBora. 117, 457469. Eckerdt, F.; Pascreau, G.; Phistry, M.; Lewellyn, A., L. and DePaoli-Roach, A. (2009). Phosphorylation of TPX2 by Plx1 enhances activation of Aurora A. Cell Cycle, 8, 2413-2419. Katayama, H.; Sasai, K.; Kloc, M.; Brinkley, B. R. and Sen, S. (2008). Aurora kinase-A regulates kinetochore/chromatin associated microtubule assembly in human cells. Cell Cycle, 7, 2691-2704. Moghe, S.; Jiang, F.; Miura, Y.; Cerny, R., L.; Tsai, M., Y. and Furukawa, M. (2012). The CUL3‐KLHL18 ligase regulates mitotic entry and ubiquitylates Aurora‐A. Biology Open, 1, 82-91. Chen, S.,S.; Chang, P.,C.; Cheng, Y.,W.; Tang, F.,M. and Lin, Y.,S. (2002). Suppression of the STK15 oncogenic activity requires a transactivation-independent p53 function. EMBO J., 21, 4491-4499. Shao, S.; Wang, Y.; Jin, S.; Song, Y.; Wang, X.; Fan, W.; Zhao, Z.; Fu, M.; Tong, T.; Dong, L.; Fan, F.; Xu, N. and Zhan, Q. (2006). Gadd45a Interacts with Aurora-A and Inhibits Its Kinase Activity. J. Biol. Chem., 281, 28943-28950. Andresson, T. and Ruderman, J. V. (1998). The kinase Eg2 is a component of the Xenopus oocyte progesterone-activated signaling pathway. EMBO J., 17, 5627-5637. Katayama, H.; Zhou, H.; Li, Q.; Tatsuka, M. and Sen, S. (2001). Interaction and Feedback Regulation between STK15/BTAK/Aurora-A Kinase and Protein Phosphatase 1 through Mitotic Cell Division Cycle. Journal of Biological Chemistry, 276, 46219-46224. Murnion, M. E.; Adams, R. R.; Callister, D. M.; Allis, C. D.; Earnshaw, W. C. and Swedlow, J. R. (2001). Chromatin-associated Protein Phosphatase 1 Regulates AuroraB and Histone H3 Phosphorylation. Journal of Biological Chemistry, 276, 2665626665. Zeng, K.; Bastos, R., N.; Barr, F., A. and Gruneberg, U. (2010). Protein phosphatase 6 regulates mitotic spindle formation by controlling the T-loop phosphorylation state of Aurora A bound to its activator TPX2. J. Cell Biol., 191, 1315-1332.

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

Aurora Kinases in Mitosis and Carcinogenesis

21

[82] Gigoux, V.; L'Hoste, S.; Raynaud, F.; Camonis, J. and Garbay, C. (2002). Identification of Aurora Kinases as RasGAP Src Homology 3 Domain-binding Proteins. J. Biol. Chem., 277, 23742-23746. [83] Tong, Y.; Ben-Shlomo, A.; Zhou, C.; Wawrowsky, K. and Melmed, S. (2008). Pituitary tumor transforming gene 1 regulates Aurora kinase A activity. Oncogene, 27, 63856395. [84] Bischoff, J. R.; Anderson, L.; Zhu, Y.; Mossie, K.; Ng, L.; Souza, B.; Schryver, B.; Flanagan, P.; Clairvoyant, F.; Ginther, C.; Chan, C. S. M.; Novotny, M.; Slamon, D. J. and Plowman, G. D. (1998). A homologue of Drosophila aurora kinase is oncogenic and amplified in human colorectal cancers. EMBO J., 17, 3052-3065. [85] Zhou, H.; Kuang, J.; Zhong, L.; Kuo, W.; Gray, J.; Sahin, A.; Brinkley, B. and Sen, S. (1998). Tumour amplified kinase STK15/BTAK induces centrosome amplification, aneuploidy and transformation. Nat. Genet., 20, 189-193. [86] Gritsko, T. M.; Coppola, D.; Paciga, J. E.; Yang, L.; Sun, M.; Shelley, S. A.; Fiorica, J. V.; Nicosia, S. V. and Cheng, J. Q. (2003). Activation and Overexpression of Centrosome Kinase BTAK/Aurora-A in Human Ovarian Cancer. Clinical Cancer Research, 9, 1420-1426. [87] Jeng, Y.; Peng, S.; Lin, C. and Hsu, H. (2004). Overexpression and Amplification of Aurora-A in Hepatocellular Carcinoma. Clinical Cancer Research, 10, 2065-2071. [88] Kollareddy, M.; Dzubak, P.; Zheleva, D. and Hajduch, M. (2008). Aurora kinases: structure, functions and their association with cancer. Biomed. Pap. Med. Fac. Univ. Palacky Olomouc Czech Repub., 152, 27-33. [89] Liu, Q.; Kaneko, S.; Yang, L.; Feldman, R. I.; Nicosia, S. V.; Chen, J. and Cheng, J. Q. (2004). Aurora-A Abrogation of p53 DNA Binding and Transactivation Activity by Phosphorylation of Ser 215. Journal of Biological Chemistry, 279, 52175-52182. [90] [90] Katayama, H.; Sasai, K.; Kawai, H.; Yuan, Z. M.; Bondaruk, J.; Suzuki, F.; Fujii, S.; Arlinghaus, R. B.; Czerniak, B. A. and Sen, S. (2003). Phosphorylation by aurora kinase A induces Mdm2-mediated destabilization and inhibition of p53. Nature Genetics, 36, 55-62. [91] Yang, H.; He, L.; Kruk, P.; Nicosia, S. V. and Cheng, J. Q. (2006). Aurora-A induces cell survival and chemoresistance by activation of Akt through a p53-dependent manner in ovarian cancer cells. International Journal of Cancer, 119, 2304-2312. [92] Briassouli, P.; Chan, F.; Savage, K.; Reis-Filho, J. S. and Linardopoulos, S. (2007). Aurora-A Regulation of Nuclear Factor-κB Signaling by Phosphorylation of IκBα. Cancer Research, 67, 1689-1695. [93] Dar, A. A.; Belkhiri, A. and El-Rifai, W. (2009). The aurora kinase A regulates GSK3[beta] in gastric cancer cells. Oncogene, 28, 866-875. [94] Lim, K.; Brady, D. C.; Kashatus, D. F.; Ancrile, B. B.; Der, C. J.; Cox, A. D. and Counter, C. M. (2010). Aurora-A Phosphorylates, Activates, and Relocalizes the Small GTPase RalA. Molecular and Cellular Biology, 30, 508-523. [95] Otto, T.; Horn, S.; Brockmann, M.; Eilers, U.; Schüttrumpf, L.; Popov, N.; Kenney, A. M.; Schulte, J. H.; Beijersbergen, R.; Christiansen, H.; Berwanger, B. and Eilers, M. (2009). Stabilization of N-Myc Is a Critical Function of Aurora A in Human Neuroblastoma. Cancer Cell, 15, 67-78.

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

22

Jyoti Iyer, Saili Moghe, Niveditha Rajagopalan et al.

[96] Colon, N. C.; Schlegel, C. E.; Qiao, J. and Chung, D. H. (2011). Aurora A kinase regulates N-myc activity through phosphorylation of GSK3-beta and beta-catenin. Journal of the American College of Surgeons, 213, S82-S83. [97] Yang, H.; Ou, C. C.; Feldman, R. I.; Nicosia, S. V.; Kruk, P. A. and Cheng, J. Q. (2004). Aurora-A Kinase Regulates Telomerase Activity through c-Myc in Human Ovarian and Breast Epithelial Cells. Cancer Research, 64, 463-467. [98] Murata-Hori, M.; Tatsuka, M. and Wang, Y. (2002). Probing the dynamics and functions of aurora B kinase in living cells during mitosis and cytokinesis. Molecular Biology of the Cell (Formerly : Cell Regulation), 13, 1099-1108. [99] Tseng, B. S.; Tan, L.; Kapoor, T. M. and Funabiki, H. (2010). Dual detection of chromosomes and microtubules by the chromosomal passenger complex drives spindle assembly. Developmental Cell, 18, 903-912. [100] Klein, U. R.; Nigg, E. A. and Gruneberg, U. (2006). Centromere targeting of the chromosomal passenger complex requires a ternary subcomplex of Borealin, Survivin, and the N-terminal domain of INCENP. Mol. Biol. Cell, 17, 2547. [101] Wang, F.; Dai, J.; Daum, J. R.; Niedzialkowska, E.; Banerjee, B.; Stukenberg, P. T.; Gorbsky, G. J. and Higgins, J. M. G. (2010). Histone H3 Thr-3 Phosphorylation by Haspin Positions Aurora B at Centromeres in Mitosis. Science, 330, 231-235. [102] Kelly, A.; Ghenoiu, C.; Xue, J.; Zierhut, C.; Kimura, H. and Funabiki, H. (2010). Survivin reads phosphorylated histone H3 threonine 3 to activate the mitotic kinase Aurora B. Science, 330, 235-239. [103] Yamagishi, Y.; Honda, T.; Tanno, Y. and Watanabe, Y. (2010). Two Histone Marks Establish the Inner Centromere and Chromosome Bi-Orientation. Science, 330, 239243. [104] Musacchio, A. (2010). Surfing Chromosomes (and Survivin). Science, 330, 183-184. [105] Qian, J.; Lesage, B.; Beullens, M.; Van Eynde, A. and Bollen, M. (2011). PP1/RepoMan Dephosphorylates Mitotic Histone H3 at T3 and Regulates Chromosomal Aurora B Targeting. Current Biology, 21, 766-773. [106] Vagnarelli, P.; Ribeiro, S.; Sennels, L.; Sanchez-Pulido, L.; de Lima Alves, F.; Verheyen, T.; Kelly, D.; Ponting, C.; Rappsilber, J. and Earnshaw, W. (2011). RepoMan Coordinates Chromosomal Reorganization with Nuclear Envelope Reassembly during Mitotic Exit. Developmental Cell, 21, 328-342. [107] Kawashima, S. A.; Yamagishi, Y.; Honda, T.; Ishiguro, K. and Watanabe, Y. (2010). Phosphorylation of H2A by Bub1 Prevents Chromosomal Instability Through Localizing Shugoshin. Science, 327, 172-177. [108] Tsukahara, T.; Tanno, Y. and Watanabe, Y. (2010). Phosphorylation of the CPC by Cdk1 promotes chromosome bi-orientation. Nature, 467, 719-723. [109] Terada, Y.; Tatsuka, M.; Suzuki, F.; Yasuda, Y.; Fujita, S. and Otsu, M. (1998). AIM-1: a mammalian midbody-associated protein required for cytokinesis. EMBO Journal, The, 17, 667-676. [110] Maerki, S.; Olma, M. H.; Staubli, T.; Steigemann, P.; Gerlich, D. W.; Quadroni, M.; Sumara, I. and Peter, M. (2009). The Cul3-KLHL21 E3 ubiquitin ligase targets Aurora B to midzone microtubules in anaphase and is required for cytokinesis. Journal of Cell Biology, 187, 791-800. [111] Pereira, G. and Schiebel, E. (2003). Separase Regulates INCENP-Aurora B Anaphase Spindle Function Through Cdc14. Science, 302, 2120-2124.

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

Aurora Kinases in Mitosis and Carcinogenesis

23

[112] Gruneberg, U.; Neef, R.; Honda, R.; Nigg, E. A. and Barr, F. A. (2004). Relocation of Aurora B from centromeres to the central spindle at the metaphase to anaphase transition requires MKlp2. The Journal of Cell Biology, 166, 167-172. [113] Wilmeth, L. J.; Shrestha, S.; Montano, G.; Rashe, J. and Shuster, C. B. (2010). Mutual Dependence of Mob1 and the Chromosomal Passenger Complex for Localization during Mitosis. Molecular Biology of the Cell (Formerly: Cell Regulation), 21, 380392. [114] Mackay, A. M.; Eckley, D. M.; Chue, C. and Earnshaw, W. C. (1993). Molecular analysis of the INCENPs (inner centromere proteins): separate domains are required for association with microtubules during interphase and with the central spindle during anaphase. The Journal of Cell Biology, 123, 373-385. [115] Li, F.; Ambrosini, G.; Chu, E. Y.; Plescia, J.; Tognin, S.; Marchisio, P. C. and Altieri, D. C. (1998). Control of apoptosis and mitotic spindle checkpoint by survivin. Nature, 396, 580-584. [116] Vader, G.; Medema, R. H. and Lens, S. (2006). The chromosomal passenger complex: guiding Aurora-B through mitosis. J. Cell Biol., 173, 833-837. [117] Nakajima, Y.; Cormier, A.; Tyers, R. G.; Pigula, A.; Peng, Y.; Drubin, D. G. and Barnes, G. (2011). Ipl1/Aurora-dependent phosphorylation of Sli15/INCENP regulates CPC-spindle interaction to ensure proper microtubule dynamics. Journal of Cell Biology, 194, 137-153. [118] Stewart, S. and Fang, G. (2005). Destruction Box–Dependent Degradation of Aurora B Is Mediated by the Anaphase-Promoting Complex/Cyclosome and Cdh1. Cancer Research, 65, 8730-8735. [119] Nguyen, H. G.; Chinnappan, D.; Urano, T. and Ravid, K. (2005). Mechanism of Aurora-B Degradation and Its Dependency on Intact KEN and A-Boxes: Identification of an Aneuploidy-Promoting Property. Molecular and Cellular Biology, 25, 4977-4992. [120] Gomez, V.; Sese, M.; Santamaria, A.; Martinez, J. D.; Castellanos, E.; Soler, M.; Thomson, T. M. and Paciucci, R. (2010). Regulation of Aurora B Kinase by the Lipid Raft Protein Flotillin-1. Journal of Biological Chemistry, 285, 20683-20690. [121] You, J.; Li, Q.; Wu, C.; Kim, J.; Ottinger, M. and Howley, P. M. (September 15, 2009). Regulation of Aurora B Expression by the Bromodomain Protein Brd4. Molecular and Cellular Biology, 29, 5094-5103. [122] Bishop, J. and Schumacher, J. (2002). Phosphorylation of the carboxyl terminus of inner centromere protein (INCENP) by the Aurora B Kinase stimulates Aurora B kinase activity. Journal of Biological Chemistry, 277, 27577-27580. [123] Honda, R.; Körner, R. and Nigg, E. (2003). Exploring the functional interactions between Aurora B, INCENP, and survivin in mitosis. Molecular Biology of the Cell (Formerly : Cell Regulation), 14, 3325-3341. [124] Sessa, F.; Mapelli, M.; Ciferri, C.; Tarricone, C.; Areces, L.; Schneider, T.; Stukenberg, P. T. and Musacchio, A. (2005). Mechanism of Aurora B activation by INCENP and inhibition by hesperadin. Molecular Cell, 18, 379-391. [125] Yasui, Y.; Urano, T.; Kawajiri, A.; Nagata, K.; Tatsuka, M.; Saya, H.; Furukawa, K.; Takahashi, T.; Izawa, I. and Inagaki, M. (2003). Autophosphorylation of a newly identified site of Aurora-B is indispensable for cytokinesis. Journal of Biological Chemistry, 279, 12997-13003.

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

24

Jyoti Iyer, Saili Moghe, Niveditha Rajagopalan et al.

[126] Petsalaki, E.; Akoumianaki, T.; Black, E.; Gillespie, D. and Zachos, G. (2011). Phosphorylation at Ser 331 is required for Aurora B activation. Journal of Cell Biology, 195, 449-466. [127] Bolton, M.; Lan, W.; Powers, S.; McCleland, M.; Kuang, J. and Stukenberg, T. (2002). Aurora B kinase exists in a complex with survivin and INCENP and its kinase activity is stimulated by survivin binding and phosphorylation. Molecular Biology of the Cell (Formerly : Cell Regulation), 13, 3064-3077. [128] Chen, J.; Jin, S.; Tahir, S.; Zhang, H.; Liu, X.; Sarthy, A.; McGonigal, P.; Liu, Z.; Rosenberg, S. and Ng, S. (2002). Survivin enhances Aurora-B kinase activity and localizes Aurora-B in human cells. Journal of Biological Chemistry, 278, 486-490. [129] Chu, Y.; Yao, P. Y.; Wang, W.; Wang, D.; Wang, Z.; Zhang, L.; Huang, Y.; Ke, Y.; Ding, X. and Yao, X. (2011). Aurora B kinase activation requires survivin priming phosphorylation by PLK1. Journal of Molecular Cell Biology, 3, 260-267. [130] Jelluma, N.; Brenkman, A. B.; van den Broek, N. J. F.; Cruijsen, C. W. A.; van Osch, M. H. J.; Lens, S.; Medema, R. H. and Kops, G. J. P. L. (2008). Mps1 phosphorylates Borealin to control Aurora B activity and chromosome alignment. Cell, 132, 233-246. [131] Zachos, G.; Black, E. J.; Walker, M.; Scott, M. T.; Vagnarelli, P.; Earnshaw, W. C. and Gillespie, D. A. (2007). Chk1 is required for spindle checkpoint function. Developmental Cell, 12, 247-260. [132] Han, Z.; Riefler, G.; Saam, J.; Mango, S. and Schumacher, J. (2005). The C. elegans Tousled-like kinase contributes to chromosome segregation as a substrate and regulator of the Aurora B kinase. Current Biology, 15, 894-904. [133] Sun, L.; Gao, J.; Dong, X.; Liu, M.; Li, D.; Shi, X.; Dong, J.; Lu, X.; Liu, C. and Zhou, J. (2008). EB1 promotes Aurora-B kinase activity through blocking its inactivation by protein phosphatase 2A. Proceedings of the National Academy of Sciences - PNAS, 105, 7153-7158. [134] Rosasco-Nitcher, S.; Lan, W.; Khorasanizadeh, S. and Stukenberg, P. T. (2008). Centromeric Aurora-B activation requires TD-60, microtubules, and substrate priming phosphorylation. Science, 319, 469-472. [135] Kelly, A. E.; Sampath, S. C.; Maniar, T. A.; Woo, E. M.; Chait, B. T. and Funabiki, H. (2007). Chromosomal Enrichment and Activation of the Aurora B Pathway Are Coupled to Spatially Regulate Spindle Assembly. Developmental Cell, 12, 31-43. [136] Ban, R.; Nishida, T. and Urano, T. (2011). Mitotic kinase Aurora-B is regulated by SUMO-2/3 conjugation/deconjugation during mitosis. Genes to Cells, 16, 652-669. [137] Sugiyama, K.; Sugiura, K.; Hara, T.; Sugimoto, K.; Shima, H.; Honda, K.; Furukawa, K.; Yamashita, S. and Urano, T. (2002). Aurora-B associated protein phosphatases as negative regulators of kinase activation. Oncogene, 21, 3103-3111. [138] Posch, M.; Khoudoli, G. A.; Swift, S.; King, E. M.; DeLuca, J. G. and Swedlow, J. R. (2010). Sds22 regulates aurora B activity and microtubule-kinetochore interactions at mitosis. Journal of Cell Biology, 191, 61-74. [139] [Barr, F. A.; Elliott, P. R. and Gruneberg, U. (2011). Protein phosphatases and the regulation of mitosis. Journal of Cell Science (Formerly : Quarterly Journal of Microscopical Science), 124, 2323-2334. [140] Liu, D.; Vleugel, M.; Backer, C. B.; Hori, T.; Fukagawa, T.; Cheeseman, I. M. and Lampson, M. A. (2010). Regulated targeting of protein phosphatase 1 to the outer kinetochore by KNL1 opposes Aurora B kinase. Journal of Cell Biology, 188, 809-820.

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

Aurora Kinases in Mitosis and Carcinogenesis

25

[141] Tanno, Y.; Kitajima, T. S.; Honda, T.; Ando, Y.; Ishiguro, K. -. and Watanabe, Y. (2010). Phosphorylation of mammalian Sgo2 by Aurora B recruits PP2A and MCAK to centromeres. Genes and Development, 24, 2169-2179. [142] Lampson, M. A. and Kapoor, T. M. (2004). The human mitotic checkpoint protein BubR1 regulates chromosome–spindle attachments. Nature Cell Biology, 7, 93-98. [143] Ramadan, K.; Bruderer, R.; Spiga, F. M.; Popp, O.; Baur, T.; Gotta, M. and Meyer, H. H. (2007). Cdc48/p97 promotes reformation of the nucleus by extracting the kinase Aurora B from chromatin. Nature, 450, 1258-1262. [144] Losada, A.; Hirano, M. and Hirano, T. (2002). Cohesin release is required for sister chromatid resolution, but not for condensin-mediated compaction, at the onset of mitosis. Genes and Development, 16, 3004-3016. [145] Giménez-Abián, J. F.; Sumara, I.; Hirota, T.; Hauf, S.; Gerlich, D.; de la Torre, C.; Ellenberg, J. and Peters, J. (2004). Regulation of Sister Chromatid Cohesion between Chromosome Arms. Current Biology, 14, 1187-1193. [146] Hauf, S.; Roitinger, E.; Koch, B.; Dittrich, C. M.; Mechtler, K. and Peters, J. (2005). Dissociation of Cohesin from Chromosome Arms and Loss of Arm Cohesion during Early Mitosis Depends on Phosphorylation of SA2. PLoS Biol, 3, e69. [147] Li, N. and Yao, X. (2009). Recruitment of separase to mitotic chromosomes is regulated by Aurora B. Cell Cycle, 8, 1433-1443. [148] Giet, R. and Glover, D. (2001). Drosophila aurora B kinase is required for histone H3 phosphorylation and condensin recruitment during chromosome condensation and to organize the central spindle during cytokinesis. Journal of Cell Biology, 152, 669-682. [149] Hirota, T.; Lipp, J. J.; Toh, B. and Peters, J. (2005). Histone H3 Ser[thinsp]10 phosphorylation by Aurora B causes HP1 dissociation from heterochromatin. Nature, 438, 1176-1180. [150] Goto, H.; Yasui, Y.; Nigg, E. A. and Inagaki, M. (2002). Aurora-B phosphorylates Histone H3 at Ser28 with regard to the mitotic chromosome condensation. Genes To Cells, 7, 11-17. [151] Hsu, J.; Sun, Z.; Li, X.; Reuben, M.; Tatchell, K.; Bishop, D.; Grushcow, J.; Brame, C.; Caldwell, J.; Hunt, D.; Lin, R.; Smith, M. and Allis, C. (2000). Mitotic phosphorylation of histone H3 is governed by Ipl1/aurora kinase and Glc7/PP1 phosphatase in budding yeast and nematodes. Cell, 102, 279-291. [152] Adams, R. R.; Carmena, M. and Earnshaw, W. C. (2001). Chromosomal passengers and the (aurora) ABCs of mitosis. Trends Cell Biol., 11, 49-54. [153] Gadea, B. and Ruderman, J. (2005). Aurora Kinase Inhibitor ZM447439 Blocks Chromosome-induced Spindle Assembly, the Completion of Chromosome Condensation, and the Establishment of the Spindle Integrity Checkpoint in Xenopus Egg Extracts. Molecular Biology of the Cell (Formerly: Cell Regulation), 16, 13051318. [154] Hagstrom, K. A.; Holmes, V.; CozzarellI, N.,R. and Meyer, B., J. (2002). C. elegans condensin promotes mitotic chromosome architecture, centromere organization, and sister chromatid segregation during mitosis and meiosis. Genes and Development, 16, 729-742. [155] Dai, J.; Sullivan, B. A. and Higgins, J. M. G. (2006). Regulation of Mitotic Chromosome Cohesion by Haspin and Aurora B. Developmental Cell, 11, 741-750.

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

26

Jyoti Iyer, Saili Moghe, Niveditha Rajagopalan et al.

[156] Sumara, I.; Vorlaufer, E.; Stukenberg, P. T.; Kelm, O.; Redemann, N.; Nigg, E. A. and Peters, J. (2002). The Dissociation of Cohesin from Chromosomes in Prophase Is Regulated by Polo-like Kinase. Mol.Cell, 9, 515-525. [157] Kitajima, T. S.; Hauf, S.; Ohsugi, M.; Yamamoto, T. and Watanabe, Y. (2005). Human Bub1 Defines the Persistent Cohesion Site along the Mitotic Chromosome by Affecting Shugoshin Localization. Current Biology, 15, 353-359. [158] Kitajima, T. S.; Sakuno, T.; Ishiguro, K.; Iemura, S.; Natsume, T.; Kawashima, S. A. and Watanabe, Y. (2006). Shugoshin collaborates with protein phosphatase 2A to protect cohesin. Nature, 441, 46-52. [159] Tang, Z.; Shu, H.; Qi, W.; Mahmood, N. A.; Mumby, M. C. and Yu, H. (2006). PP2A Is Required for Centromeric Localization of Sgo1 and Proper Chromosome Segregation. Developmental Cell, 10, 575-585. [160] Murata-Hori, M. and Wang, Y., L.i. (2002). The Kinase Activity of Aurora B Is Required for Kinetochore-Microtubule Interactions during Mitosis. Current Biology, 12, 894-899. [161] Lampson, M. A. and Cheeseman, I. M. (2011). Sensing centromere tension: Aurora B and the regulation of kinetochore function. Trends Cell Biol., 21, 133-140. [162] Kelly, A. E. and Funabiki, H. (2009). Correcting aberrant kinetochore microtubule attachments: an Aurora B-centric view. Curr.Opin.Cell Biol., 21, 51-58. [163] Wiggan, O. and DeLuca, J. (2011). FORMIN Stable Kinetochore-Microtubule Attachments. Developmental Cell, 20, 283-284. [164] Andrews, P., D.; Ovechkina, Y.; Morrice, N.; Wagenbach, M.; Duncan, K.; Wordeman, L. and Swedlow, J., R. (2004). Aurora B Regulates MCAK at the Mitotic Centromere. Developmental Cell, 6, 253-268. [165] Zhang, X.; Lan, W.; Ems-McClung, S. C.; Stukenberg, P. T. and Walczak, C. E. (2007). Aurora B Phosphorylates Multiple Sites on Mitotic Centromere-associated Kinesin to Spatially and Temporally Regulate Its Function. Molecular Biology of the Cell (Formerly: Cell Regulation), 18, 3264-3276. [166] Lan, W.; Zhang, X.; Kline-Smith, S.,L.; Rosasco, S.,E.; Barrett-Wilt, G.,A.; Shabanowitz, J.; Hunt, D.,F.; Walczak, C.,E. and Stukenberg, P.,T. (2004). Aurora B phosphorylates centromeric MCAK and regulates its localization and microtubule depolymerization activity. Current Biology, 14, 273-286. [167] Ohi, R.; Sapra, T.; Howard, J. and Mitchison, T., J. (2004). Differentiation of Cytoplasmic and Meiotic Spindle Assembly MCAK Functions by Aurora B-dependent Phosphorylation. Molecular Biology of the Cell (Formerly : Cell Regulation), 15, 28952906. [168] Knowlton, A. L.; Vorozhko, V., V.; Lan, W.; Gorbsky, G., J. and Stukenberg, P. T. (2009). ICIS and Aurora B Coregulate the Microtubule Depolymerase Kif2a. Current Biology, 19, 758-763. [169] Kline-Smith, S. L.; Khodjakov, A.; Hergert, P. and Walczak, C., E. (2003). Depletion of Centromeric MCAK Leads to Chromosome Congression and Segregation Defects Due to Improper Kinetochore Attachments. Molecular Biology of the Cell (Formerly: Cell Regulation), 15, 1146-1159. [170] Hauf, S.; Cole, R. W.; LaTerra, S.; Zimmer, C.; Schnapp, G.; Walter, R.; Heckel, A.; van Meel, J.; Rieder, C. L. and Peters, J. (2003). The small molecule Hesperadin

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

Aurora Kinases in Mitosis and Carcinogenesis

27

reveals a role for Aurora B in correcting kinetochore-microtubule attachment and in maintaining the spindle assembly checkpoint. J. Cell Biol., 161, 281-294. [171] Ditchfield, C.; Johnson, V. L.; Tighe, A.; Ellston, R.; Haworth, C.; Johnson, T.; Mortlock, A.; Keen, N. and Taylor, S. S. (2003). Aurora B couples chromosome alignment with anaphase by targeting BubR1, Mad2, and Cenp-E to kinetochores. J. Cell Biol., 161, 267-280. [172] Santaguida, S. and Musacchio, A. (2009). The life and miracles of kinetochores. EMBO J., 28, 2511-2531. [173] Emanuele, M. J.; Lan, W.; Jwa, M.; Miller, S. A.; Chan, C. S. M. and Stukenberg, P. T. (2008). Aurora B kinase and protein phosphatase 1 have opposing roles in modulating kinetochore assembly. J. Cell Biol., 181, 241-254. [174] Nguyen, H. G.; Makitalo, M.; Yang, D.; Chinnappan, D.; St. Hilaire, C. and Ravid, K. (2009). Deregulated Aurora-B induced tetraploidy promotes tumorigenesis. The FASEB Journal, 23, 2741-2748. [175] Kawajiri, A.; Yasui, Y.; Goto, H.; Tatsuka, M.; Takahashi, M.; Nagata, K. and Inagaki, M. (2003). Functional Significance of the Specific Sites Phosphorylated in Desmin at Cleavage Furrow: Aurora-B May Phosphorylate and Regulate Type III Intermediate Filaments during Cytokinesis Coordinatedly with Rho-kinase. Molecular Biology of the Cell, 14, 1489-1500. [176] Minoshima, Y.; Kawashima, T.; Hirose, K.; Tonozuka, Y.; Kawajiri, A.; Bao, Y. C.; Deng, X.; Tatsuka, M.; Narumiya, S.; May Jr., W. S.; Nosaka, T.; Semba, K.; Inoue, T.; Satoh, T.; Inagaki, M. and Kitamura, T. (2003). Phosphorylation by Aurora B Converts MgcRacGAP to a RhoGAP during Cytokinesis. Developmental Cell, 4, 549-560. [177] Severson, A. F.; Hamill, D. R.; Carter, J. C.; Schumacher, J. and Bowerman, B. (2000). The Aurora-related kinase AIR-2 recruits ZEN-4/CeMKLP1 to the mitotic spindle at metaphase and is required for cytokinesis. Current Biology, 10, 1162-1171. [178] Guse, A.; Mishima, M. and Glotzer, M. (2005). Phosphorylation of ZEN-4/MKLP1 by Aurora B Regulates Completion of Cytokinesis. Current Biology, 15, 778-786. [179] Ganem, N. J.; Storchova, Z. and Pellman, D. (2007). Tetraploidy, aneuploidy and cancer. Curr. Opin. Genet. Dev., 17, 157-162. [180] Portella, G.; Passaro, C. and Chieffi, P. (2011). Aurora B: A New Prognostic Marker and Therapeutic Target in Cancer. Current medicinal chemistry, 18, 482-496. [181] Dar, A. A.; Goff, L. W.; Majid, S.; Berlin, J. and El-Rifai, W. (2010). Aurora Kinase Inhibitors - Rising Stars in Cancer Therapeutics? Molecular Cancer Therapeutics, 9, 268-278. [182] Ota, T.; Suto, S.; Katayama, H.; Han, Z.; Suzuki, F.; Maeda, M.; Tanino, M.; Terada, Y. and Tatsuka, M. (2002). Increased mitotic phosphorylation of histone H3 attributable to AIM-1/Aurora-B overexpression contributes to chromosome number instability. Cancer Research, 62, 5168-5177. [183] Kanda, A.; Kawai, H.; Suto, S.; Kitajima, S.; Sato, S.; Takata, T. and Tatsuka, M. (2005). Aurora-B//AIM-1 kinase activity is involved in Ras-mediated cell transformation. Oncogene, 24, 7266-7272. [184] Steigemann, P.; Wurzenberger, C.; Schmitz, M. H. A.; Held, M.; Guizetti, J.; Maar, S. and Gerlich, D. W. (2009). Aurora B-Mediated Abscission Checkpoint Protects against Tetraploidization. Cell, 136, 473-484.

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

28

Jyoti Iyer, Saili Moghe, Niveditha Rajagopalan et al.

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

[185] Anand, S.; Penrhyn-Lowe, S. and Venkitaraman, A. R. (2003). AURORA-A amplification overrides the mitotic spindle assembly checkpoint, inducing resistance to Taxol. Cancer Cell, 3, 51-62. [186] Scrittori, L.; Hans, F.; Angelov, D.; Charra, M.; Prigent, C. and Dimitrov, S. (2001). pEg2 Aurora-A Kinase, Histone H3 Phosphorylation, and Chromosome Assembly in Xenopus Egg Extract. J. Biol. Chem., 276, 30002-30010. [187] Kunitoku, N.; Sasayama, T.; Marumoto, T.; Zhang, D.; Honda, S.; Kobayashi, O.; Hatakeyama, K.; Ushio, Y.; Saya, H. and Hirota, T. (2003). CENP-A Phosphorylation by Aurora-A in Prophase Is Required for Enrichment of Aurora-B at Inner Centromeres and for Kinetochore Function. Developmental Cell, 5, 853-864. [188] Zeitlin, S. G.; Shelby, R. D. and Sullivan, K. F. (2001). CENP-A is phosphorylated by Aurora B kinase and plays an unexpected role in completion of cytokinesis. J. Cell Biol., 155, 1147-1158. [189] [189] Crosio, C.; Fimia, G.; Loury, R.; Kimura, M.; Okano, Y.; Zhou, H.; Sen, S.; Allis, C. and Sassone-Corsi, P. (2002). Mitotic phosphorylation of histone H3: spatiotemporal regulation by mammalian Aurora kinases. Molecular and Cellular Biology, 22, 874-885. [190] Yabuta, N.; Mukai, S.; Okada, N.; Aylon, Y. and Nojima, H. (2011). The tumor suppressor Lats2 is pivotal in Aurora A and Aurora B signaling during mitosis. Cell Cycle, 10, 2724-2736. [191] Hegarat, N.; Smith, E.; Nayak, G.; Takeda, S.; Eyers, P. A. and Hochegger, H. (2011). Aurora A and Aurora B jointly coordinate chromosome segregation and anaphase microtubule dynamics. Journal of Cell Biology, 195, 1103-1113. [192] Nasmyth, K. (2002). Segregating Sister Genomes: The Molecular Biology of Chromosome Separation. Science, 297, 559-565.

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

In: New Developments in Chromatin Research Editors: Neil M. Simpson and Valerie J. Stewart

ISBN: 978-1-62081-816-9 © 2012 Nova Science Publishers, Inc.

Chapter 2

CHROMATIN STRUCTURE AND EPIGENETICS Vichithra R. B. Liyanage1,2,†, Robby M. Zachariah1,2,†, Geneviève P. Delcuve2, James R. Davie2 and Mojgan Rastegar1,2, 1

Regenerative Medicine Program, University of Manitoba, Winnipeg, MB, Canada 2 Department of Biochemistry and Medical Genetics, University of Manitoba, Winnipeg, MB, Canada

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

ABSTRACT The term “chromatin” was first referred to the darkly stained DNA in the nucleus in early 1880s. Over the past century, much meaning has been added to the term chromatin with regard to its structure, organization and function. During the last two decades the field of chromatin has evolved in an incredible pace with the utilization of high throughput techniques. These comprehensive studies reveal that chromatin is no longer a static structure but is changing dynamically in order to regulate nuclear processes including DNA replication and gene transcription. The dynamic nature of chromatin is ruled by several epigenetic mechanisms such as nucleosome remodelling, histone posttranslational modifications and DNA methylation. Recent studies in the chromatin field provide insights to the detailed mechanisms underlying the regulation of gene expression by structural and chemical changes in chromatin. This chapter reviews recent advances in chromatin research and epigenetic mechansisms, intending to provide a comprehensive and detailed understanding on how chromatin structure is organized and dynamically modified in order to regulate gene expression.

Keywords: Epigenetics, DNA Methylation, Nucleosome, Histone PTMs, Chromatin, Methyl Binding Proteins, MeCP2, Heterochromatin, Euchromatin

†



These authors have contributed equally. To whom correspondences should be addressed: Dr. Mojgan Rastegar, University of Manitoba, 745 Bannatyne Ave., Basic Medical Sciences Building, Rm. 627, Winnipeg, MB R3E 0J9, Canada. Phone: (204) 272-3108, Fax: (204) 789-3900. E-mail: [email protected]

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

30

Vichithra R. B. Liyanage, Robby M. Zachariah, Geneviève P. Delcuve et al.

1. INTRODUCTION

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

Genetic information of an organism is stored in DNA, which is highly organized into a structure called chromatin. The term “chromatin” was first used to describe the darkly stained DNA in the nucleus in 1882 [1, 2]. After 70 years, in 1953 James Watson and Francis Crick discovered the molecular structure of the DNA double helix [3]. Since then, the field of chromatin research expanded extensively over the last six decades. Till 1970s there was a dark period in chromatin research which was largely devoid of any developments. At the beginning of the nucleosome era in 1980s, the research in chromatin field was revolutionized with interesting information about genes and chromatin structure [4-6]. The 21th century started by introducing “epigenetics” to the chromatin field, leading to a metamorphosis on the view of chromatin structure and gene expression [7, 8] (Figure 1). Epigenetic mechanisms are inheritable changes that control gene expression, without alterations in the underlying DNA sequences [9]. Major epigenetic mechanisms include chromatin remodelling, histone posttranslational modifications (PTMs), DNA methylation and the activity of non-coding RNAs. Research studies based on epigenetic mechanisms indicate that chromatin is not a static structure but rather, a highly dynamic structure which can transform from inactive heterochromatin to active euchromatin. Indeed, these dynamic changes in chromatin structure mainly mediate transcription and regulation of gene expression by epigenetic mechanisms throughout development and life. The overall objective of this book chapter is to summarize the recent advances in the chromatin research which aids to interpret the interplay between epigenetic mechanisms, regulation of gene transcription and relation to chromatin structure.

Figure 1. Developments in chromatin research. The history of chromatin research extends to 1880s with the discovery of chromatin and histone proteins. However, after that the progress of chromatin field was very slow. Uncovering the molecular structure of DNA was a remarkable milestone in chromatin research. By nucleosome discovery, the field of chromatin research progressed tremendously. The 21th century was the golden age of chromatin research with several advancements in chromatin field.

First, we will briefly describe the basic chromatin structure and the role of nucleosome dynamics in regulating gene expression. We will next focus on histone PTMs, which are one of the key determinants of euchromatin and heterochromatin formation. Accordingly, we will review the role of histone PTMs in chromatin structure determination. Finally, we will

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

Chromatin Structure and Epigenetics

31

discuss the role of DNA methylation, methyl binding proteins (MBD) and their possible crosstalks with histone PTMs in modulating gene transcription and chromatin structure.

2. CHROMATIN STRUCTURE AND NUCLEOSOME DYNAMICS 2.1. DNA Structure and Chromatin Fibers In the eukaryotic nucleus, the bulk of genomic DNA is transcriptionally inactive and condensed into higher order chromatin structures. The basic level of chromatin organization consists of a nucleosome array, the 11-nm ‘beads-on-a-string’ fiber. It is commonly believed that higher levels of compaction are achieved through the formation of an intermediate 30-nm fiber, of which the structure is a matter of controversy between the solenoid and the zig-zag models [10]. However, recent evidence obtained through cryo-EM of mitotic chromosomes [11, 12], electron spectroscopic imaging (ESI) of interphase chromatin [13, 14], chromosome conformation capture (3C) of a transcriptionally active domain of yeast Saccharomyces cerevisiae [15] and Hi-C probing of the three-dimensional architecture of the whole genome from a human lymphoblastoid cell line [16] suggest that the 30-nm chromatin fiber does not exist in vivo. Instead, the various models proposed for higher-order chromatin arrangements imply the dense packing of only 10-nm chromatin fibers [17, 18]. While chromatin readily folds into 30-nm fibers under physiological conditions in vitro, we hypothesize that in vivo, chromatin must be in a high-energy state, which prevents the formation of the preferred 30nm fiber, possibly through anchorage to the nuclear matrix including the nuclear lamina.

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

2.2. Nucleosome Positioning The nucleosome consists of a 147-bp stretch of DNA wrapped around a histone octamer in almost two left-handed superhelical turns. Nucleosomes are joined by a 20 to 50-bp stretch of DNA called linker DNA, which is more accessible to DNA-binding proteins than nucleosomal DNA. Thus, nucleosomes serve as negative regulators, and their positioning and occupancy play an important role in the regulation of gene expression [19]. The development of microarray and deep sequencing technologies have provided high-resolution maps of nucleosome organization across the genomes of organisms ranging from yeast to humans [20, 21], and common patterns across species have been revealed. Nucleosome-depleted regions (NDRs] usually correlate with regulatory regions at the 5' end of genes, upstream of the transcription start site and with the transcription termination site at the 3' end. A highly positioned nucleosome defines the transcription start site, followed by phased nucleosomes along the gene; however the phasing becomes less evident as the distance from the transcription start site increases [22]. A higher density of nucleosomes is also apparent at intron-exon junctions, suggesting a role of nucleosome occupancy in exon definition and RNA splicing [23]. On the other hand, it has long been known that spacing between nucleosomes varies with organisms and cell types [24]. Thus, nucleosomes are organized in context-dependent patterns.

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

32

Vichithra R. B. Liyanage, Robby M. Zachariah, Geneviève P. Delcuve et al.

What determines nucleosome positioning however is poorly understood. Suggested contributing mechanisms involve: 1) nucleosome preference for DNA sequences based on the sequence abilities to wrap their helical twist around the histone octamer, 2) DNA methylation possibly affecting DNA flexibility, 3) statistical positioning where freely moving nucleosomes are packed against a barrier like an NDR for example, 4) histones variants and PTMs which can alter nucleosome structure and interaction with DNA, 5) higher order chromatin structure where distant nucleosomes may interact with each other and linker histone H1 may influence linker DNA length, 6) competition with DNA-binding proteins, and 7) ATP-dependent chromatin remodeling [19, 20, 22, 25]. However, the importance of nucleosomal DNA sequence preferences was challenged in recent studies. In particular, NDRs have been perceived as sequences intrinsically unfavorable to nucleosome formation, but in the case of the yeast CLN2 promoter, it was showed that nucleosome depletion is due not to an anti-nucleosomal sequence, but to the concerted action of multiple DNA-binding proteins, termed nucleosome-depleting factors. The mutation of the DNA-binding ability of all factors prevents the formation of the NDR and results in unreliable transcriptional activity. The authors suggest that this mechanism is operational across the genome [26]. In another study determining nucleosome organization in three primary human cell lines (granulocytes, CD4+ and CD8+ T cells) as well as performing in vitro reconstitution, it was established that sequence-driven nucleosome positioning exists in vivo, but is often overridden by the cellular environment. Moreover, it was determined that positioning preference is statistically detected for only 20% of the genome. Across the rest of the human genome, nucleosomes are not preferentially positioned neither by DNA preference or cellular function [27]. Variations between cell lines of internucleosomal spacing were confirmed, and moreover, spacing was found to vary with the state of transcriptional chromatin domains, silent genes having a longer DNA linker than active genes [27]. As to nucleosomes strongly positioned both in vitro and in vivo, they were characterized by strong G/C cores and A/T flanks and were called "container sites". Data also supported the theory of nucleosome packing against a barrier, and it was suggested that the barrier could be a nucleosome at a container site, a sequence-specific regulatory factor or RNA polymerase II stalled at the promoter [27]. In in vitro reconstitution experiments on yeast DNA, it was discovered that nucleosome exclusion at the 5' end of genes and a strongly positioned nucleosome at transcription start sites were consistently reproduced, but not the phasing of downstream nucleosomes unless ATP was added to the yeast whole cell extract [28]. These results support the concept of barriers at the 5' end of genes; however, they disagree with the theories of DNA-encoded positioning, statistical positioning or transcription-driven positioning but suggest the involvement of ATP-dependent chromatin remodelers in the packing of nucleosomes against the barrier. The current view is that nucleosome positioning and occupancy are governed by the dynamic interplay of several factors, namely DNA sequence properties, cell-specific transacting regulatory proteins, histone-modifying enzymes and nucleosome remodelers. Viceversa, nucleosome organization plays a role in gene regulation and cellular function [29]. But little is known of the chronologic cascade of events that integrate chromatin states and gene activity.

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

Chromatin Structure and Epigenetics

33

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

2.3. Nucleosome Dynamics and Gene Regulation Chromatin remodelers, found in multiprotein complexes, use the energy of ATP hydrolysis to reshape the chromatin environment. Depending on the domain [30] located next to the ATPase domain of their catalytic subunit, remodelers are grouped into four families: SWI/SNF (bromodomain and helicase-SANT domain), ISWI (SANT-SLIDE domain), CHD (tandem chromodomains) and INO80 (helicase-SANT domain) [31, 32]. Remodelers move or evict nucleosomes to establish regular spacing or to provide or deny transcription factors access to DNA. Some remodelers also restructure nucleosomes by promoting the exchange of nucleosomal histones with their variants, imparting different properties to nucleosomes [31]. Furthermore, mammalian BAF complexes (of the SWI/SNF family) also repress transcription through long-range interactions from distal regulatory sites [32, 33]. The different remodelers share a wide range of biological functions, but some also specialize in specific processes, for example SWR1 is involved in variant H2A.Z incorporation [34-36], yeast ISW2 prevents transcription initiation from cryptic sites [37]. Depending on the developmental context, BAF complexes can either activate or repress the transcription of the same gene [38]. Contrary to yeast SWI/SNF remodelers, mammalian BAF complexes are polymorphic and thus attain more functional diversity through combinatorial assembly. It was shown that BAF complexes have a unique composition in embryonic stem cells, and during sequential developmental transitions, BAF selective assemblies contribute to cell fate decisions as they correlate with lineage-specific gene expression programs [39]. Remodelers act in concert with histone modifying complexes and are recruited to specific nucleosomes by transcription factors or histone modifications. There is evidence that DNA features (sequence, unusual structures like quadruplexes or methylation) as well as RNA are also involved in the targeting of remodelers [40]. Histone modifications are recognized by specific protein domains sometimes called reader modules, for example acetyllysine marks are read by bromodomains, while methyllysine marks are read by Royal-superfamily modules or PHD fingers [41, 42]. Moreover, multivalent interactions are thought to occur between combinations of histone post-translational modifications and remodeling complexes presenting different reading domains [43]. In support of this hypothesis, BPTF, a bromodomain PHD finger transcription factor and subunit of the NURF remodeling complex, is recruited to nucleosomes displaying the combination of di- or trimethylated lysine 4 on H3 and acetylated lysine 16 on H4 (H3K4me2/3 and H4K16ac) [44]. The recognition of hyperacetylated histone tails is generally attributed to the cooperative binding of bromodomains, with each bromodomain engaging one acetyllysine mark. However, in the case of the testis-specific BRDT protein, a single bromodomain is responsible for recognizing two or more acetylated lysine residues coexisting on the tail of histone H4 [45]. Other unexpected recognition patterns have recently emerged, including the recognition of an acetyllysine mark (H3K14ac), not by a bromodomain but by the tandem PHD finger of BAFassociated DPF3 [46-48]. Also cooperating with chromatin remodelers and histone modifiers, are histone chaperones, which facilitate nucleosome assembly/disassembly and histone exchange [49-51]. For example, Asf1 is involved in DNA replication-dependent or -independent nucleosome assembly, histone acetylation, histone exchange, regulation of transcription, chromatin silencing and maintenance of genomic stability [52]. Distinct mechanisms of transcription regulation by Asf1 have been implied at different gene promoters, demonstrating a

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

34

Vichithra R. B. Liyanage, Robby M. Zachariah, Geneviève P. Delcuve et al.

multifaceted functional interplay with other regulators [53]. FACT, another histone chaperone, facilitates transcription elongation by executing opposing actions, as it evicts one H2A-H2B dimer, destabilizing nucleosomal structure ahead of RNA polymerase II, while it reassembles chromatin in the wake of the polymerase [54, 55]. Spt6 is another chaperone involved in transcription initiation and elongation. The role of these histone chaperones and others has recently been reviewed, with an emphasis on their crosstalk with histone posttranscriptional modifications [56]. As mentioned above, the insertion of histone variants affects chromatin structure and function [57]. Except for H4, all histones have variants, some of which expressed at the time of DNA synthesis (H3.1, H2A.1) and others expressed throughout the cell cycle (H2A.Z, H3.3). H3.3 is mostly deposited during transcription and is enriched at active genes, promoters, and regulatory elements. Accordingly, H3.3 is enriched in active marks. However, H3.3 is also present at telomeres where it is required for the transcriptional repression of telomeric repeats. Different histone chaperones are involved in the deposition of H3.3 at different genomic loci [58-60]. Similarly, the outcome of H2A.Z incorporation is contextdependent, as it can result in transcription activation or repression [61, 62]. Of note, while specific antibodies can be raised against H2A.Z, this is not the case with H3.3. Therefore, studies on H3.3 have used exogenously expressed tagged H3.3, which raises the concern of results being skewed as a consequence of H3.3 overexpression. However, this caveat has been avoided in a recent study of genome-wide profiles of H3 variants by the use of genome editing with zinc-finger nucleases to tag endogenous H3.3 [59]. Only some of the variants are mentioned here. A histone sequence database is available [63].

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

3. HISTONE POST-TRANSLATIONAL MODIFICATIONS AND CHROMATIN STRUCTURE Histone post-translational modifications represent one of the most diverse and versatile mode of cellular epigenetic regulation. Histone PTMs in association with DNA methylation lay the basic landscape for chromatin structure and gene expression regulation [64]. Histone PTMs were first discovered in the early 1960`s by Vincent Allfrey [65, 66]. Since then, a plethora of histone PTMs have been identified including acetylation, phosphorylation, methylation, sumoylation, ubiquitination and ADP-ribosylation [66]. The particular sites for most histone PTMs are considered to be the N-terminal tail of histones. However, few exceptions have been identified to date including H3K56 acetylation [67] and phosphorylation of H3Y41 [68], which occur within the histone core. Although a vast variety of histone PTMs have been identified so far, only a handful of residues seem to be modified (Table 1). Examples include lysine residues which are targeted by different enzymes towards acetylation, methylation, ubiquitination and sumoylation; and arginine residues being subjected to methylation and ADP-ribosylation [66].

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

Chromatin Structure and Epigenetics

35

Table 1. Histone Post-Translational Modifications Histone H2A

H2B

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

H3

Residue K4 K5 K7 K9 K11 K13 K36 K118 K119 K121 K125 K126

Modification* ac ac ac ac, me1 me1 arb Cr fo, cr cr, ub ub me1, cr su

Ref. [73] [66, 75] [73] [76]

E2 K5 K6/7 K11 K12 K15 K16 K20 K23 K30 K34 K46 K57

arb ac, me1, fo, cr su ac, me1, cr ac, cr ac, me1, cr ac, cr ac, me1, cr ac, me1, cr arb fo, cr ac, fo me1

[78] [75, 76, 79] [81] [76, 82]

K4 K9 K14 K18

ac, me1, me2, me3, cr ac, me1, me2, me3, cr ac, me1 ac, me1, cr

[76]

K23 K27

ac, me1, cr ac, me1, me2, me3, cr, arb ac, me1,me2, me3 arb ac, fo, cr ac, me1, me2, me3, fo ac, me1, fo iso iso me1, me2

K36 K37 K56 K79 K122 P30 P38 R2

Histone H2A

Residue R3 R42 R88 S1 S122 S129 S137 S139 T119 T120 Y39 Y142

Modification* me2 me1 me1 p p p p p p p oh p

Ref. [74] [76]

K85 K108 K116 K120 K123 R79 R99 S10 S14 S33 Y37 Y83

me1 fo me1, fo ac, fo, ub ub me1 me1 P P p oh oh

[76] [82] [76]

[66] [76]

R8 R17 R26 R63

me2 me1, me2 me1 me1

[76, 78]

R128 S6

me1 p

S10 S28 S31 T3 T6 T11 T46

P P p P p p p

[78] [76] [76, 79] [76, 80] [80] [76] [81] H2B

[76, 82, 84] [78] [76, 85] [74] [76]

[74] [78] [76] [84] [76] [66]

H3

H4

[77] [74]

[76] [74]

[83] [76] [74] [74] [76]

[76] [79]

[76]

K5 ac, cr [76] H4 K91 ac, fo, ub [76, 79] K8 ac, cr R3 me2 [66] K12 ac, fo, cr R35 me1 [76] K16 ac, me1, cr, arb [76, 78] R55 me1 K20 me1, me2, me3 [76] R67 me1 K31 fo [82] S1 p [86] K59 me1, me2, fo [76, 84] Y51 oh [76] K77 me1 [76] Y88 oh K79 fo [82] *ac: Acetylation, me: Methylation, fo: Formylation, ho: Hydroxylation, cr: Crotonylation, p : Phosphorylation, ub: Ubiquitylation, su: Sumoylation, iso: Isomerisation, arb: ADP-ribosylation

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

36

Vichithra R. B. Liyanage, Robby M. Zachariah, Geneviève P. Delcuve et al.

These histone modifications are then recognized by effector proteins or “readers” that interpret these marks [69]. The reader protein can recuit other co-activator or co-repressor complexes, chromatin binding proteins and thereby change the chromatin structure and gene expression. Specific histone PTMs or combinations of different histone modifications result in the recruitment of chromatin-associating factors with specific domains capable of identifying various histone PTMs. Supporting this hypothesis, several proteins have been identified with specific domains capable of recognizing and binding to particular histone PTMs, an example is the Tudor domain family members, which are capable of recognizing methylated histone lysine residues and bromodomains that can recognize acetylated histone lysines [70]. Similar to DNA methylation, histone PTMs may have direct and indirect downstream effects. The combination of histone PTMs and effector proteins that are bound to these marks determine certain chromatin states such as heterochromatin and euchromatin states. The heterochromatin state is usually characterized by histone hypoacetylation and methylation at specific residues (H3K9, H3K27 methylation) that lead to a more compact chromatin structure. In contrast, the euchromatin or open chromatin structure is modulated through histone hyperacetylation and methylation at specific residues and this includes H3 acetylation, and H3K4 methylation [9, 71]. Certain histone PTMs such as acetylation and phosphorylation lead to decreased positive charge of histones, thereby altering the affinity of the modified histones towards DNA. For example, phosphorylation of H3S10 has been linked to chromatin condensation by alteration of chromatin structure [72]. The “erasers” of histone PTMs that are capable of removing specific histone modifications are also involved in chromatin structure determination and regulating gene expression. The erasers of histone PTMs include histone deacetylases and demethylases.

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

3.1. Types of Histone Post-Translational Modifications 3.1.1. Histone Acetylation Histone acetylation was one of the first reported histone modifications [65], which occurs at the lysine residues and is dynamically regulated by two classes of enzymes, Kacetyltransferases; (KATs) and histone deacetylases (HDACs). The KATs utilize acetyl CoA as cofactor and catalyze the transfer of an acetyl group to the ε-amino group of lysine side chains. KATs are classified as two groups, type-A KATs, which include CBP/p300, GNAT and MYST families of enzymes [87] and type-B KATs, which catalyze acetylation of histone H3 and H4 in the cytoplasm before they associate with newly synthesized chromatin [88]. In humans, HDACs are classified into four groups, primarily based on their homology to yeast (y) HDACs [89]. Class I HDACs (HDACs 1, 2, 3, and 8) are grouped together according to their homology to yRPD3. Class II HDACs (HDACs 4, 5, 6, 7, 9, 10) are homologous to yHDA1. Class III HDACs display high homology towards ySIR2, which is dependent on NAD+ co-factor for their activities. Only one member, HDAC 11 has been associated with class IV HDACs, and shows homology to class I and class II HDAC domains. Histone acetylation has both direct and indirect effects on chromatin structure and functions. Acetylation of lysine residues on the N-terminus of histones can disrupt their association with DNA and lead to more relaxed chromatin conformation, allowing accessibility to transcription factors [90]. Therefore, histone acetylation is mostly associated

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

Chromatin Structure and Epigenetics

37

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

with transcriptional activity. Histone acetylation can also lead to the recruitment of specific proteins capable of recognizing and binding to acetylated lysine residues, like proteins with bromodomains and PHD domains [46, 47, 91]. Certain bromodomain factors like Gcn5p exhibit KAT activity, implying that such ‘readers’ of acetylation could also be propagating the mark itself [92, 93]. In contrast, HDACs are generally linked with transcriptional repression and exert their biological effects by interacting with co-repressor complexes [94].

3.1.2. Histone Methylation Methylation of histones occurs at both lysine and arginine residues and is found on both histone H3 and H4. SUV39H1 was the first lysine methyl transferase (KMTs) to be discovered [95]. The SUV39H KMTs are specific for H3K9 methylation. Other KMTs have subsequently been identified, including G9a, DIM5 and Dot1 [96]. KMTs that mediate the methylation of N-terminal lysine residues are often characterized by a 130 amino acid-long SET domain [97]. Dot1, which methylates H3K79 within the globular core, is devoid of this domain. Lysine residues on histones can be methylated to varying degrees, adding an additional layer of complexity to this particular type of modification. For example, SET7/9 can only monomethylate H3K4 and DIM5 can only catalyze the trimethylation of H3K9 [98, 99]. The difference in the ability of the individual enzymes to confer different degrees of methylation seems to be dependent on the specific residues that are present in their lysine binding pockets [98, 100]. The methylation of arginine is catalyzed by two classes of enzymes named class-I and class-II enzymes that are collectively known as protein arginine N-methyl-transferase (PRMTs) [101]. The human PRMT family consists of 11 members that are capable of methylating arginine residues in both histone and non-histone proteins [102]. Similar to histone acetylation, methylation of histone residues can be reversed by specific enzymes. Lysine-specific demethylase 1 (LSD1) was the first K-demethylase (KDM) to be discovered. LSD1 forms a protein complex with Co-REST repressor and demethylates H3K4me1/2. LSD1 is also capable of demethylating H3K9 by interacting with the androgen receptor [103]. Subsequently, several other demethylating enzymes have been discovered, with the majority of them possessing a jumonji domain, being able to demethylate trimethylated residues [104]. A member of the jumonji protein family, JMJD6, is capable of demethylating arginine residues on H3R2 and H4R3 [105]. Indirect demethylation of methylated arginine also occurs via the conversion of arginine to citrulline by deimination [106]. There are many protein domains capable of recognizing histone methylation marks including chromo, WD40, Tudor, and PWWP domains [42]. The different degrees of methylation can influence the binding of these factors in two ways. First, the different methylation state could lead to the recruitment of different transcription factors. For example, mono-methylated and dimethylated forms of H4K20 recruit two different factors, Pdp1 and Crb2, respectively, resulting in different biological outcomes [107]. Alternatively, the different states of methylation might result in varying degrees of affinity to the same transcription factor. For instance, the affinity of Rpd3S to H3K36me increases with increased number of methyl groups [108]. Also, DNMT3A possesses an ADD domain capable of recognizing H4R3me2, potentially linking DNA methylation to histone modifications [109].

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

38

Vichithra R. B. Liyanage, Robby M. Zachariah, Geneviève P. Delcuve et al.

3.1.3. Other Modifications Other post-translational modifications of histones include phosphorylation, ADPribosylation, ubiquitination, isomerization, and crotonylation. Histone phosphorylation occurs at the serine, threonine and tyrosine residues, and is regulated by a variety of kinases and phosphatases [110]. ADP-ribosylation is catalyzed by PARP family of enzymes and is reversed by poly-ADP-ribose-glycohydrolase enzymes [111]. Histone ubiquitination is a similar modification and has been reported in both histone H2A and H2B. The ubiquitination of H2AK119ub1 is catalyzed by Bmi/Ring1A protein and this modification is associated with gene silencing [112, 113]. Ubiquitination of H2BK123 plays a vital role in transcriptional initiation and elongation [114, 115]. Ubiquitination of H2B has also been linked to chromatin compaction [116, 117]. Another form of PTMs is proline isomerization, which has been documented in yeast, where scFpr4 enzyme has been shown to isomerize H3P38 [118]. Recently, it has been shown that histones can also be subjected to modifications by the addition of β-N-acetylglucosamine (O-GlcNAc) sugar residues. Histone H2A, H2B and H4 have been shown to carry this specific modification [119]. Several other modifications continue to be discovered, one of the most recent modification identified is lysine crotonylation [76].

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

3.2. Crosstalk between Histone Post-Translational Modifications Different histone PTMs are known to regulate each other in either a synergistic or antagonistic manner. For example, in yeast, H3S10 phosphorylation promotes H3K14 acetylation by Gcn5 [120], whereas the same modification is capable of inhibiting H3K9 acetylation and methylation [121, 122]. Certain PTMs can also influence other modifications in cis or in trans. For instance, histone H3 acetylation promotes the H3K4 methylation by MLL1 SET domain in vitro [123]. MLL1 in turn, could also be involved in the trans acetylation of H4K16 via its association with Males-absent-On-the-First (MOF) KAT [124]. Perhaps the best-established trans-regulation of histone PTMs is the facilitation of H3K4 and H3K79 methylation by the monoubiquitination of H2BK123 [125].

3.3. Distribution of Histone PTMs within Genomic Domains Enrichment of histone PTMs can be observed in different genomic environments. Eukaryotic chromatin can be classified as heterochromatin and euchromatin, based on their composition of active or inactive genes. Heterochromatin represents chromosomal regions that are transiently or constantly maintained in a repressed state during the cell cycle. Heterochromatin can be further classified as facultative and constitutive heterochromatin. Facultative heterochromatin consists of genomic regions containing genes that are differentially expressed through development and are transiently silenced [126]. The inactive X-chromosome, which is a classical example for facultative heterochromatin, is enriched in H3K27me3. Constitutive heterochromatin contains permanently repressed genes in genomic regions such as the centromeres and telomeres and is characterized by relatively high levels of H3K9me3 [127, 128].

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

Chromatin Structure and Epigenetics

39

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

Although initially identified on the basis of their staining patterns, currently heterochromatin and euchromatin compartments are also identified by the distribution of specific histone PTMs in each region. Constitutive heterochromatin is mostly identified by the presence of monomethylated H3K27 and trimethylated H3K9 and H4K20. In addition, biotinylated H4K12 is highly enriched in heterochromatic regions [129]. Methylated H3K9 acts as a binding site for the chromodomain of HP1, which plays a vital role in heterochromatin formation and maintenance [130, 131]. The binding of HP1 to H3K9me can be inhibited by H3S10 phosphorylation and H3K14 acetylation during the cell cycle [132]. In contrast, euchromatic regions are often characterized by the abundance of acetylated H3K9 and H3K16 as well as trimethylation of H3K4, H3K36 and H3K79. But acetylation of histone residues alone cannot be used to predict transcriptional activity since in yeast, acetylated lysine has been found to be associated with heterochromatin and deacetylated lysine residues have been discovered in euchromatic regions [133]. Specific histone PTMs display enrichment at different sites of actively transcribed genes. For instance, monomethylated and dimethylated H3K4 are associated with the end and middle region of genes whereas trimethylated H3K4 is often linked to the transcription start sites of active genes [134, 135]. Monomethylated H3K4 is also considered to be a predictive mark of transcriptional enhancers [136]. Similarly, H3K36ac occurs in the promoters of actively transcribed genes whereas H3K36me is mainly associated with the coding regions of the gene [125]. Dimethylated and trimethylated H3K4 has also been implied to be associated with decondensed chromatin [137]. In summary, although many histone modifications have been identified so far, it is evident that much more modifications are yet to be discovered. Moreover, the complex relationship between histone modification crosstalks and their interactions with other epigenetic regulatory mechanisms are yet to be uncovered. Also, the various modes by which epigenetic traits are inherited have still not been determined. These observations highlight the significance of more intensive investigation in this exciting field of research.

4. DNA MODIFICATIONS AND CHROMATIN STRUCTURE 4.1. DNA Methylation and Demethylation 4.1.1. DNA Methylation Methylation of DNA molecules and histone proteins have particular relations with gene transcription. However, recent studies emphasize the role of DNA/histone methylation beyond gene transcription. Both DNA methylation and histone methylation have been implicated in chromatin structure, genomic stability and nuclear architecture [138]. In this section, we will focus on the link between DNA/histone modifications and chromatin architecture. DNA methylation is one of the major epigenetic mechanisms involved in gene silencing and heterochromatin formation. The first insight on the role of DNA methylation in chromatin architecture was reported in 1991 by Adrian Bird [139] based on observations reported by three independent research groups [140-144]. Since then biomolecular, cytogenetic and X-ray crystallographic studies have provided a significant evidence to support the fact that DNA

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

40

Vichithra R. B. Liyanage, Robby M. Zachariah, Geneviève P. Delcuve et al.

methylation is a key determinant of higher order chromatin structure. With the advancement of the field in relation to DNA methylation and transcriptional regulation, several new terms have been introduced to the field, such as “Methylome”- profile of all types of DNA modifications within the genome [145], “Methylomics”- comprehensive studies that connect histone code and DNA methylation in the genome (Methylomics.org) and “Gethylome” and “Gethylomics” - studies which link methylome and methylomics to the genome and genomics [146]. Collectively, all these areas of research will help to reconnect DNA modifications to gene expression and chromatin structure. In vertebrates, DNA methylation occurs at C5 position on cytosine (5-methylcytosine: 5mC) residues in the context of CpG dinucleotides (Figure 2). The 5mC modification is considered as the fifth base of the genome. This important epigenetic mark is usually established by DNA methyltransferases (DNMTs). Three DNMTs have been identified in mammals so far; DNMT1 which involves primarily in the maintenance of DNA methylation during DNA replication and de novo DNA methyl transferases DNMT3A and DNMT3B [147]. Nearly 70-80% of the CpG dinucleotides in the human genome are methylated [148]. DNA cytosine methylation is a major epigenetic mark that is usually associated with transcriptional silencing and chromatin remodelling that are important mechanisms in embryonic development and cellular differentiation [149]. The inheritable DNA mark is established and undergoes reprogramming during different stages of embryonic development. Waves of DNA methylation and demethylation have been reported during mammalian embryonic development. Soon after fertilization, DNA methylation in the whole maternal and paternal genomes is erased in a replication-dependent and -independent manner respectively, and after implantation, DNA methylation is re-established [150]. The mice deficient for these DNMTs are either embryonic lethal or subjected to premature death indicating the crucial role of establishment and maintenance of DNA methylation during development [151]. DNMTs are the most well known family of proteins involved in DNA methylation. Although several mammalian DNMTs have been identified so far, the detailed mechanisms of genome-wide DNA methylation during development are still not fully understood. DNA methyltransferase-like protein (DNMT3L) is reported to play a role in de novo DNA methylation [152] through stimulating the activity of DNMT3A and DNMT3B . However, DNML3L lacks the catalytic activity that is present in DNMT3A-B, yet plays a role in DNA methylation in imprinting [153]. Recently, Lsh a member of SNF2 family of chromatin remodelling proteins was shown to be involved in genome-wide cytosine methylation and influencing histone modifications in mammals [154]. Absence of Lsh is shown to cause abnormal chromatin organization and embryonic lethality [155]. Lsh is specifically involved in silencing embryonic stem cell related genes including Hox genes and Oct4 [154, 156]. Besides the well-known form of 5mC which occurs at the context of CpG dinucleotides, cytosine methylation has also been reported at non-CG context, in embryonic stem cells [157, 158] and in the central nervous system [159]. It has also been shown that CpH methylation is prevalent in pluripotent stem cells, whereas it is nearly absent in the differentiated somatic cells [160, 161]. The non-CpG methylation or CpH methylation (H=A/C/T) has been shown to be carried out by the known DNMTs, DNMT1,3A and 3B in vitro [162]. CpH Methylation in plant genome is associated with genomic imprinting and gene silencing [163]. Nevertheless, little was known about the CpH methylation in mammalian systems. During the last few years considerable amount of information has been added to our knowledge on CpH

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

Chromatin Structure and Epigenetics

41

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

methylation in mammalian stem cells and its possible roles in gene silencing [164]. Similar gene repression function in CpH methylation was demonstrated in mouse neurons [159].

Figure 2. DNA methylation and demethylation in mammals. DNA methyltransferases convert cytosine to 5-methylcytosine (5mC). Ten Eleven Translocation (TET) proteins carry out a series of oxidation steps to convert 5mC to 5-hydroxymenthylcytocine (5hmC), 5-formycytosine (5fC) and 5carboxylcytosine (5caC). Demethylation from 5mC to unmodified cytosine is suggested to occur through active or passive demethylation. Oxidized forms of 5mC are shown to be demethylated back to cytosine by thymine-DNA glycosylase (TDG) followed by Base excision repair (BER).

CpG islands (CGIs) are regions with high density of CpG dinucleotides largely devoid of DNA methylation but with high histone methylation (H3K4me3). CGIs are thought to be unmethylated until the discovery of another form of DNA methylation, referred to as 5hydroxymethyl cytosine (5hmC) (will be discussed later in this section) associated with some

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

42

Vichithra R. B. Liyanage, Robby M. Zachariah, Geneviève P. Delcuve et al.

of the CGIs in mouse embryonic stem cells [165]. In promoters which are embedded within CGIs with low DNA methylation and high histone methylation, a high enrichment of Cfp1 CpG binding protein is reported to be bound to the non-methylated CpGs. This study suggests a role of CpG binding proteins in influencing the chromatin structure and function [166]. There are several types of CpG binding proteins identified so far, including methyl binding proteins (MBDs), CXXC domain proteins and SRA domain proteins [167]. Recruitment of CXXC domain proteins such as Cfp1 to non-methylated CpG islands [166] and recruitment of methyl-CpG binding proteins to highly methylated CpG islands can modulate the local chromatin structure [168]. Until 2009, 5mC was thought to be the only form of DNA modification. The discovery of 5hmC by two separate scientific groups [169, 170] in 2009 was considered to be one of the greatest advances in the epigenetics field. These studies showed the presence of this new form of DNA cytosine modification in Purkinje neurons [169] and embryonic stem cells [170]. Since its discovery, 5hmC significantly drew the attention of the epigenetic field, being considered as the sixth base of the genome [171, 172]. The 5hmC is generated by oxidation of 5mC by α-ketoglutarate-dependent TET enzymes (Ten Eleven Translocation) (Figure 2). Recent reports show the genomic distribution of 5hmC during embryonic development, in adult brain and also in human embryonic stem cells [173-175]. The expanding knowledge on 5hmC distribution and function raises the importance of re-evaluation of the previous theories on the role of DNA methylation in chromatin structure and transcriptional regulation. Similar to 5mC, there are enough evidence to believe the role of 5hmC as a new epigenetic mark which recruits or prevents the recruitment of DNA binding proteins, plays a role in transcriptional regulation and modulating chromatin architecture. The 5hmC modifications are enriched in promoters, enhancers and gene bodies of actively transcribed genes [175]. Recent advances in chromatin research have led to the recognition of other oxidized derivatives of 5mC including 5-formylcytosine (5fC) and 5-carboxylcytosine (5caC) in vitro [176]. These modifications are generated by TET-catalyzed oxidation reaction (Figure 2) and are found in mouse embryonic stem cells [176] as well as in the zygote [177]. It is well known that during preimplantation, DNA methylation at 5mC is removed, but the reason for this erasure was not clear. The story of DNA methylation during preimplantation has been rewritten after the discovery of the 5mC loss during preimplantation, due to replacement by other DNA modifications namely, 5hmC [170], 5fC and 5caC [177, 178]. These suggest the key role of TET proteins in manipulation of DNA methylation and epigenetic reprogramming during embryonic development and stem cell differentiation [179, 180]. The original concept of gene repression role of DNA methylation (5mC) was considerably changed after the discovery of these other DNA methyl marks. Association of 5hmC with actively transcribed genes points towards more gene activation role of this modification. However, recent research reports imply broader roles for these methyl marks that extend beyond regulating gene expression. Distribution of these DNA mrks within the genome and the recruitment of a wide variety of regulatory proteins by these DNA methyl marks imply the role of these modifications in gene repression, activation, RNA splicing, chromatin remodeling and chromatin structure. For example, 5mC is able to recruit all five methyl binding proteins (MBP), MeCP2, MBD1-4 (Role of MBP in gene regulation and chromatin structure will be discussed in section 4.3) in mouse brain, neural precursors and embryonic stem cells [181, 182]. Both 5mC and 5hmC have been shown to bind to specific

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

Chromatin Structure and Epigenetics

43

MBP (MeCP2, MBD3 and MBD4), transcription regulator CREB, splicing factors such as SRSF suggesting their role in transcription, splicing and chromatin structure [181, 182]. 4.1.2. DNA Demethylation For more than three decades, DNA methylation at 5mC was believed to be a stable inheritable DNA modification. However, recent studies on DNA methylation have challenged this idea. It is now well esatbslihed that during embryonic development, DNA methylation is erased in the blastocyst stage and re-methylated in a programmed fashion during implantation, followed by cell- and stage-specific methylation that defines cellular identity [183]. This dynamic pattern of DNA methylation highlights the importance of DNA demethylation. Although the mechanism of DNA methylation is well known, the mechanisms by which DNA demethylation occurs were unclear until recently. The proposed mechanisms of DNA demethylation include activity of DNA demethylases, base excision repair (BER), deamination followed by BER, nucleotide excision repair and oxidative demethylation [150, 151]. Two recent reports on DNA demethylation by Ito et al [176] and He et al [178] changed the paradigm of DNA modifications bringing new insights on mechanisms of DNA demethylation. According to this mechanism, 5mC is first oxidized to 5hmC followed by subsequent oxidation to 5fC and 5caC by TET proteins. The 5hmC-mediated DNA demethylation is considered as an active demethylation mechanism as compared to passive demethylation mediated by DNA demethylases. Several mechanisms proposed for removal of the modified methyl group in mammalian cells are summarized in the Figure 2. The removal of methyl group from 5mC by active or passive demethylation is well described in plants and zebrafish [151, 184]. However the evidences of detailed mechanism of direct 5mC demethylation in mammals have not been reported. Nevertheless, several other alternative mechanisms of oxidative demethylation of 5mC via TET proteins have been demonstrated. In brief, 5mC is oxidised by TET proteins to form 5hmC, 5fC and 5caC. Then 5hmC is subjected to deamination by AID/APOBEC deaminases to form 5hmU. The 5hmC, 5fC and 5caC are demethylated by thymine-DNA glycosylase (TDG) followed by base excision repair. Therefore 5hmC has been proposed as an active intermediate in the demethylating pathways [185].

4.1.3 DNA modifications and chromatin structure The role of the DNA methyl modifications discussed earlier in this section (5mC, 5hmC, 5fC and 5caC) can be explained in different ways. DNA methylation is known to modulate chromatin organization through formation of heterochromatin and euchromatin structures as well as formation of higher order chromatin interactions. These modifications are either localized to the heterochromatin or euchromatin as a method of contributing to chromatin structure. However, distribution of DNA methyl marks in different genomic loci and the function associated with their localization seem to be context-dependent. Heterochromatin regions are usually enriched with 5mC. In mouse cells, the chromocenters that are basically clustered heterochromatin regions are enriched for 5mC and 5mC-binding proteins such as MeCP2 [186]. In contrast, hetrochromatin regions are highly devoid of 5hmC, unlike in euchromatin regions that contain transcriptionally active gene regions and are enriched for 5hmC [187]. The localization of 5caC on chromatin seems to be cell type-dependent where it is found in association with euchromatin in ovarian follicular cells [188], in mouse embryonic stem (ES) cells it is found in microsatellite regions (usually forms heterochromatin) [189]. The 5fC modifications have been shown to be localized to microsatellites in mouse ES cells,

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

44

Vichithra R. B. Liyanage, Robby M. Zachariah, Geneviève P. Delcuve et al.

similar to 5caC [189]. The higher order chromatin interactions are also mediated through DNA methylation-dependent binding of chromatin architectural proteins such as CTCF and MBP. The role of MBP as chromatin architectural proteins will be discussed in section 4.3. Moreover, DNA methylation contributes to chromatin strcture through its crosstalks or inetractions with histone PTMs which is discussed below.

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

4.2. Crosstalk between DNA Marks and Histone PTMs Several decades ago, DNA methylation, histone PTMs, transcriptional regulation and chromatin structure were considered as separate topics. The concept of “crosstalk” between these mechanisms has brought about new insights for better understanding of the chromatin structure as well as transcriptional regulation [190]. Within a decade of time, the picture of connecting DNA methylation and histone PTMs to transcription and chromatin structure have been modified considerably. According to the previous studies, these crosstalks can happen in two ways [191]. 1) DNA methylation directs histone methylation: DNA methylation pattern established by DNMTs will recruit MBP and HDACs, which deacetylase histones. This is followed by recruitment of histone methyltransferases, which are involved in histone methylation; 2) Histone methylation directs DNA methylation: methylated histones will recruit HP1 which in turn will signal for DNMTs directly or indirectly to carry out DNA methylation. Recent advancements on DNA modifications and histone modifications have added considerable amount of details to these two models on crosstalks. The crosstalks between these three separate mechanisms have led to a novel view of epigenetics called the “epigenetic code”. Epigenetic code is a combination of DNA and histone marks which determines the gene expression pattern within a given cell. It is composed of “writers” which introduce the epigenetic marks to the code, “erasers” which erase/remove these marks and “readers” who can recognize these modified codes and modulate the effectors functions [192]. DNA methylation and histone PTMs are established by writers- DNMTs and histone modifying enzymes, respectively. In the context of DNA methylation, DNA methyl marks are written by DNMTs, erased or modified by demethylases and TET proteins and read by methyl CpG binding proteins. Histone modifications are written by K-acetyl transferases (KATs), K-methyl transferases (KMTs) and read by histone binding proteins and erased by histone deacetylases (HDACs) and K-demethylases. As described in the previous section, the major DNA methyl marks are 5mC and 5hmC. Prior to the discovery of 5hmC, the epigenetic code in relation to 5mC was well established with the 5mC considered to be a repressive mark and reported to be associated with repressive histone marks such as H3K9me2/3, H4K20me3 and H3K27me3 [193, 194]. MBP play a major role in crosstalks between 5mC DNA methylation and histone modifications. Many MBP are reported to be associated with histone modifications as well as histone modification readers. For instance, MBD1 forms a stable complex with H3K9me3 methyltransferase SETDB1 [195] and methyl reader HP1 [196]. Further, MeCP2 is a well characterized protein [197] that links DNA methylation and histone methylation. MeCP2 mediates H3K9 methylation leading to the formation of repressed chromatin at the H19 locus [198]. All these interactions finally lead to the repressed heterochromatin formation.

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

Chromatin Structure and Epigenetics

45

With the discovery of 5hmC, a new chapter on epigenetic code and crosstalks was started. Recent studies report that 5hmC is usually associated with transcriptionally active euchromatin and are also found to have crosstalks with active histone marks including H3K4me1/2, H3K27ac in human embryonic stem cells [194]. Overall, 5hmC is behaving as an active methyl mark. Moreover, 5hmC has a potential role in demethylation by inhibiting DNA methylation maintenance carried out by DNMT1. Previous studies reported that MBP including MeCP2 cannot bind to 5hmC and thereby lead to gene activation and euchromatin formation [180]. Therefore, it was postulated before that 5hmC methylation can influence the transcriptional process and local chromatin structure in two ways; 1) by preventing the binding of methyl binding proteins and 2) by recruiting 5hmC specific binding proteins [199]. However, this concept was proven incorrect when recent studies demonstrated MeCP2 as a major protein bound to 5hmC in brain and MeCP2 binding to 5hmC was found in transcriptionally active gene regions. This finding also added evidence to the role of MeCP2 in transcriptional activation [200]. Since then, several other MBP (including MBD3 and MBD4) were shown to bind to 5hmC in mouse ES cells and mouse brain [181, 201]. Other regulatory proteins that can bind to 5hmC include CTCF (a major epigenetic modulator), even though its enrichment at 5hmC-containing regions seem to be dependent on the physical location of the regulatory element within a gene (promoter or gene body) [202, 203]. Supporting the role of 5hmC in gene activation, it has also been reported to be enriched within enhancers containing active histone marks such as H3K4me1 and H3K27ac in embryonic stem cells [202]. Overall, 5hmC crosstalks result in the formation of transcriptionally active euchromatin regions. However, contradicting the transcriptional activation role of 5hmC and MeCP2, a recent report suggested that MeCP2 binding to 5hmC at the promoters of GAD1 and RELN genes leads to repression of these genes [204].

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

4.3. MBP Function as Chromatin Architectural Proteins The Methyl binding protein family of proteins includes MBP 1 to 4, MeCP2 and Kaiso family proteins with methyl-CpG binding zinc-finger domains. As an epigenetic mechanism, DNA methylation leads to transcriptional repression exerting its function in two ways; 1) DNA methylation inhibits the access of transcription factor binding to the DNA, and 2) it recruits MBP followed by further recruitment of transcription repressor complexes. As discussed earlier, MBP can recognize and bind to the methylated DNA with high affinity and finally influence transcriptional regulation and chromatin structure. Over the last decade, large amount of evidence was accumulated that suggest MBP have key roles not only in transcriptional regulation but also in modulating chromatin architecture. MeCP2 is the prototype member of MBP family and is a major epigenetic player in brain [205, 206]. In human and mouse, there are two MeCP2 isoforms MeCP2E1 and MeCP2E2. Both isoforms are expressed highly in brain at different levels and in a brain region-specific manner [186, 207]. In mouse brain, neurons, astrocytes and oligodendrocytes both isoforms are localized to the chromocenters in the nucleus [186, 207] suggesting the involvement of both MeCP2 isoforms in chromatin architecture. MeCP2 regulates gene expression through DNA methylation while DNA methylation itself can regulate MeCP2 expression. Our recent studies show that DNA methylation at the Mecp2 promoter and intron 1 can influence the

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

46

Vichithra R. B. Liyanage, Robby M. Zachariah, Geneviève P. Delcuve et al.

expression of both Mecp2/MeCP2 isoforms in differentiating neural stem cells in vitro and in adult mouse brain regions in vivo [207, 208]. The MBP have been established as transcriptional repressors and are involved in the formation of silenced/repressed chromatin. Challenging the general role of MBP as transcription repressors, in 2008, MeCP2 was reported to be bifunctional both as a transcriptional repressor and a transcription activator [209]. Recent reports on MeCP2 binding to 5hmC [200] and its interactions with TET1 [210] further support the transcriptional activation role of MeCP2. Even though not reported in animals, AtMBD9 an MBD family protein in plants is also reported as a transcriptional activator [211]. Other than the established role of MBP in transcriptional regulation, recent studies point towards the role of MBP proteins as chromatin architectural proteins [212, 213]. MeCP2 is a well-studied protein as a chromatin architectural protein. Two in vivo chromatin binding studies have shown the role of MeCP2 in condensation of chromatin though formation of higher order oligomeric structures [214] and also in modulating long range chromatin interactions [215]. The interaction of MBD proteins with chromatin remodelling complexes further supports their role as chromatin architectural proteins. MeCP2 is known to interact directly or indirectly with repressor complexes containing DNMT1, NCoR/SMRT, c-SKI, CoREST, and chromatin remodellers such as ATRX and Brm1, SWI/SNF [216]. Not only MeCP2 but also MBD2 and MBD3 are shown to be associated with remodelling protein complexes such as NURD [217]. Furthermore, Kaiso proteins are found to be associated with NCoR remodelling complexes [218]. Recently, another member was added to the family of MBP bringing more interest to the methyl-DNA interactome. The new member is RBP-J which is found to be associated with NURD complexes [219]. It seems that methyl binding proteins are associated with ATP-dependent remodelling complexes in order to modulate transcription repression by influencing the local chromatin structure. Studies on heterochromatin associated proteins such as HP1 and H3K9 methylases have demonstrated that MBDs are interacting with these proteins and are involved in the formation of heterochromatin. For example, MBD1 has been shown to be associated with Suv39h1-HP1 heterochromatin complex [196]. Due to the reason that they colocalize with the condensed centromeric/pericentric heterochromatin regions known as chromocenters in mouse cells, MeCP2, MBD1, MBD2 are categorized as heterochromatin-associated proteins providing much evidences to their role as chromatin architectural proteins [220]. Through overexpression studies, it has been also shown that MeCP2 and other MBP are involved in large scale chromatin re-organization where they result in aggregation of heterochromatin regions also referred to as chromocenter clustering [221, 222]. Strengthening these previous findings, in 2010 Ghosh et al. reported that MeCP2 competes with histone H1 for binding to the chromatin and possibly involves in 30 nm fiber chromatin formation [223]. Recent reports on the association of MeCP2 in the linker DNA regions devoid of nucleosomes and mononucleosomes-containing methylated histones (H3K9me2 and H3K27me3) help to characterize MeCP2 as a chromatin architectural protein [224]. MeCP2 is capable of modulating chromatin architecture in the presence as well as absence of DNA methylation. Studies carried out with nucleosomal arrays demonstrate that MeCP2 can form secondary structures under unmethylated conditions [214]. MeCP2 has been reported to form chromatin loops [214, 225, 226] and DNA bridges [225], which induces either local or global changes in the higher order chromatin structure [227]. It is interesting that these higher order chromatin structures are altered in the presence of MeCP2 mutations,

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

Chromatin Structure and Epigenetics

47

for instance, in Rett syndrome [228, 229]. In spite of the presence of several evidences for the chromatin architectural role of MeCP2 in forming higher order chromatin structures, the function of other MBP as direct chromatin architectural proteins is not fully established. In summary, DNA methylation is one of the major epigenetic mechanisms, which was previously noted as a major transcription repression mechanism via heterochromatin formation. Recent finding of novel DNA methyl mark 5hmC has revolutionized the DNA methylation paradigm. With the presence of 5mC or 5hmC, DNA modifications can either function as transcription repressive mark or active marks by formation of heterochromatin or euchromatin. Modulation of chromatin structure and gene expression regulation by DNA methylation involves the recrutement of MBP and other regulatory proteins and crosstalks with histone PTMs. MBP proteins-dependent and independent of DNA methylation can influence higher order chromatin structures. Overall, DNA methylation controls gene expression and influences higher order chromatin structure through multiple epigenetic mechanisms

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

CONCLUSION Developments in cytological, molecular and biochemical techniques have merged as a leading topic to the recent advancements in the chromatin research. Since the discovery of chromatin and histone proteins, the field of chromatin research has matured significantly. Epigenetics is a new emerging area of research, which has provided much more meaning to the mechanisms of gene regulation and chromatin architecture. In this book chapter, we provided a comprehensive overview of the contributions of recent advancements in nucleosome remodelling, histone PTMs and DNA methylation in correspondence with gene expression and chromatin structure. Current discoveries in these fields have broadened our knowledge on the interplay between epigenetic mechanisms, transcriptional regulation and chromatin structure. However, despite intensive efforts our present understanding is not complete, and there are still remaining gaps that need much thorough investigations on this interesting field.

ACKNOWLEDGEMENTS We apologize that many excellent papers are not discussed here due to space limitation. The authors would like to thank Jeff Dixon for the artwork in Figure 2. Dr. Davie thanks the Manitoba Institute of Child Health for support of his research activities. Dr. Rastegar thanks NSERC, HSCF, SRCFC, MICH, MMSF, MHRC, and CIHR for financial support.

GRANT INFORMATION Grant sponsor: Canadian Institutes of Health Research (MOP-9186) to J.R.D. Grant sponsor: Canada Research Chair to J.R.D Grant sponsor: Canadian Breast Cancer Foundation to J.R.D.

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

48

Vichithra R. B. Liyanage, Robby M. Zachariah, Geneviève P. Delcuve et al.

Grant sponsor: CancerCare Manitoba Foundation to J.R.D. Grant sponsor: Canadian Institute of Health Research (TEC-128094) team grant to J.R.D., M.R. and other team members Grant sponsor: Canadian Institute of Health Research (CEN-132383) to M.R. and J.R.D. Grant sponsor: Health Sciences Centre Foundation (HSCF) to M.R. Grant sponsor: Manitoba Health Research Council (MHRC) (Establishment and Operating Funds) to M.R. Grant sponsor: Manitoba Institute of Child Health (MICH) to M.R. Grant sponsor: Manitoba Medical Service Foundation (MMSF) to M.R. Grant sponsor: Natural Sciences and Engineering Research Council of Canada (DG - 3724052009) to M.R. Grant sponsor: Scottish Rites Charitable Foundation of Canada (SRCFC - 10110) to M.R.

REFERENCES [1] [2] [3] [4] [5]

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

[6]

[7] [8] [9] [10] [11]

[12] [13] [14]

Flemming WZ, Kern und Zelltheilung (1882) (Verlag Vogel, Leipzig). Paweletz N (2001) Walther Flemming: pioneer of mitosis research. Nature reviews. Molecular cell biology 2(1):72-75. Watson JD & Crick FH (1953) The structure of DNA. Cold Spring Harbor symposia on quantitative biology 18:123-131. Oudet P, Gross-Bellard M, & Chambon P (1975) Electron microscopic and biochemical evidence that chromatin structure is a repeating unit. Cell 4(4):281-300. Richmond TJ, Finch JT, Rushton B, Rhodes D, & Klug A (1984) Structure of the nucleosome core particle at 7 A resolution. Nature 311(5986):532-537. Luger K, Mader AW, Richmond RK, Sargent DF, & Richmond TJ (1997) Crystal structure of the nucleosome core particle at 2.8 A resolution. Nature 389(6648):251260. Turner BM (1993) Decoding the nucleosome. Cell 75(1):5-8. Jenuwein T & Allis CD (2001) Translating the histone code. Science 293(5532):10741080. Delcuve GP, Rastegar M, & Davie JR (2009) Epigenetic control. Journal of cellular physiology 219(2):243-250. Li G & Reinberg D (2011) Chromatin higher-order structures and gene regulation. Current opinion in genetics & development 21(2):175-186. Eltsov M, Maclellan KM, Maeshima K, Frangakis AS, & Dubochet J (2008) Analysis of cryo-electron microscopy images does not support the existence of 30-nm chromatin fibers in mitotic chromosomes in situ. Proceedings of the National Academy of Sciences of the United States of America 105(50):19732-19737. Maeshima K, Hihara S, & Eltsov M (2010) Chromatin structure: does the 30-nm fibre exist in vivo? Current opinion in cell biology 22(3):291-297. Ahmed K, Li R, & Bazett-Jones DP (2009) Electron spectroscopic imaging of the nuclear landscape. Methods in molecular biology 464:415-423. Ahmed K, et al. (2010) Global chromatin architecture reflects pluripotency and lineage commitment in the early mouse embryo. PloS one 5(5):e10531.

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

Chromatin Structure and Epigenetics

49

[15] Dekker J (2008) Mapping in vivo chromatin interactions in yeast suggests an extended chromatin fiber with regional variation in compaction. The Journal of biological chemistry 283(50):34532-34540. [16] Lieberman-Aiden E, et al. (2009) Comprehensive mapping of long-range interactions reveals folding principles of the human genome. Science 326(5950):289-293. [17] Fussner E, Ching RW, & Bazett-Jones DP (2011) Living without 30nm chromatin fibers. Trends in biochemical sciences 36(1):1-6. [18] Fussner E, et al. (2012) Open and closed domains in the mouse genome are configured as 10-nm chromatin fibres. EMBO Rep 13(11):992-996. [19] Segal E & Widom J (2009) What controls nucleosome positions? Trends in genetics : TIG 25(8):335-343. [20] Radman-Livaja M & Rando OJ (2010) Nucleosome positioning: how is it established, and why does it matter? Developmental biology 339(2):258-266. [21] Zhang Z & Pugh BF (2011) High-resolution genome-wide mapping of the primary structure of chromatin. Cell 144(2):175-186. [22] Jiang C & Pugh BF (2009) Nucleosome positioning and gene regulation: advances through genomics. Nature reviews. Genetics 10(3):161-172. [23] Luco RF, Allo M, Schor IE, Kornblihtt AR, & Misteli T (2011) Epigenetics in alternative pre-mRNA splicing. Cell 144(1):16-26. [24] Van Holde KE (1988) Chromatin (Springer-Verlag, New York) 1 Ed. [25] Bell O, Tiwari VK, Thoma NH, & Schubeler D (2011) Determinants and dynamics of genome accessibility. Nature reviews. Genetics 12(8):554-564. [26] Bai L, Ondracka A, & Cross FR (2011) Multiple sequence-specific factors generate the nucleosome-depleted region on CLN2 promoter. Molecular cell 42(4):465-476. [27] Valouev A, et al. (2011) Determinants of nucleosome organization in primary human cells. Nature 474(7352):516-520. [28] Zhang Z, et al. (2011) A packing mechanism for nucleosome organization reconstituted across a eukaryotic genome. Science 332(6032):977-980. [29] Small EC, Xi L, Wang JP, Widom J, & Licht JD (2014) Single-cell nucleosome mapping reveals the molecular basis of gene expression heterogeneity. Proc Natl Acad Sci U S A 111(24):E2462-2471. [30] Ellaway C, Buchholz T, Smith A, Leonard H, & Christodoulou J (1998) Rett syndrome: significant clinical overlap with Angelman syndrome but not with methylation status. Journal of child neurology 13(9):448-451. [31] Clapier CR & Cairns BR (2009) The biology of chromatin remodeling complexes. Annual review of biochemistry 78:273-304. [32] Hargreaves DC & Crabtree GR (2011) ATP-dependent chromatin remodeling: genetics, genomics and mechanisms. Cell research 21(3):396-420. [33] Ho L, et al. (2009) An embryonic stem cell chromatin remodeling complex, esBAF, is an essential component of the core pluripotency transcriptional network. Proceedings of the National Academy of Sciences of the United States of America 106(13):5187-5191. [34] Krogan NJ, et al. (2003) A Snf2 family ATPase complex required for recruitment of the histone H2A variant Htz1. Molecular cell 12(6):1565-1576. [35] Kobor MS, et al. (2004) A protein complex containing the conserved Swi2/Snf2-related ATPase Swr1p deposits histone variant H2A.Z into euchromatin. PLoS biology 2(5):E131.

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

50

Vichithra R. B. Liyanage, Robby M. Zachariah, Geneviève P. Delcuve et al.

[36] Mizuguchi G, et al. (2004) ATP-driven exchange of histone H2AZ variant catalyzed by SWR1 chromatin remodeling complex. Science 303(5656):343-348. [37] Whitehouse I, Rando OJ, Delrow J, & Tsukiyama T (2007) Chromatin remodelling at promoters suppresses antisense transcription. Nature 450(7172):1031-1035. [38] Chi TH, et al. (2003) Sequential roles of Brg, the ATPase subunit of BAF chromatin remodeling complexes, in thymocyte development. Immunity 19(2):169-182. [39] Ho L & Crabtree GR (2010) Chromatin remodelling during development. Nature 463(7280):474-484. [40] Erdel F, Krug J, Langst G, & Rippe K (2011) Targeting chromatin remodelers: signals and search mechanisms. Biochimica et biophysica acta 1809(9):497-508. [41] Taverna SD, Li H, Ruthenburg AJ, Allis CD, & Patel DJ (2007) How chromatinbinding modules interpret histone modifications: lessons from professional pocket pickers. Nature structural & molecular biology 14(11):1025-1040. [42] Yun M, Wu J, Workman JL, & Li B (2011) Readers of histone modifications. Cell research 21(4):564-578. [43] Ruthenburg AJ, Li H, Patel DJ, & Allis CD (2007) Multivalent engagement of chromatin modifications by linked binding modules. Nature reviews. Molecular cell biology 8(12):983-994. [44] Ruthenburg AJ, et al. (2011) Recognition of a mononucleosomal histone modification pattern by BPTF via multivalent interactions. Cell 145(5):692-706. [45] Moriniere J, et al. (2009) Cooperative binding of two acetylation marks on a histone tail by a single bromodomain. Nature 461(7264):664-668. [46] Lange M, et al. (2008) Regulation of muscle development by DPF3, a novel histone acetylation and methylation reader of the BAF chromatin remodeling complex. Genes & development 22(17):2370-2384. [47] Zeng L, et al. (2010) Mechanism and regulation of acetylated histone binding by the tandem PHD finger of DPF3b. Nature 466(7303):258-262. [48] Glatt S, Alfieri C, & Muller CW (2011) Recognizing and remodeling the nucleosome. Current opinion in structural biology 21(3):335-341. [49] De Koning L, Corpet A, Haber JE, & Almouzni G (2007) Histone chaperones: an escort network regulating histone traffic. Nature structural & molecular biology 14(11):9971007. [50] Das C, Tyler JK, & Churchill ME (2010) The histone shuffle: histone chaperones in an energetic dance. Trends in biochemical sciences 35(9):476-489. [51] Hondele M & Ladurner AG (2011) The chaperone-histone partnership: for the greater good of histone traffic and chromatin plasticity. Current opinion in structural biology 21(6):698-708. [52] Tanae K, Horiuchi T, Matsuo Y, Katayama S, & Kawamukai M (2012) Histone chaperone Asf1 plays an essential role in maintaining genomic stability in fission yeast. PloS one 7(1):e30472. [53] Lin LJ & Schultz MC (2011) Promoter regulation by distinct mechanisms of functional interplay between lysine acetylase Rtt109 and histone chaperone Asf1. Proceedings of the National Academy of Sciences of the United States of America 108(49):1959919604. [54] Formosa T (2012) The role of FACT in making and breaking nucleosomes. Biochimica et biophysica acta 1819(3-4):247-255.

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

Chromatin Structure and Epigenetics

51

[55] Winkler DD & Luger K (2011) The histone chaperone FACT: structural insights and mechanisms for nucleosome reorganization. The Journal of biological chemistry 286(21):18369-18374. [56] Avvakumov N, Nourani A, & Cote J (2011) Histone chaperones: modulators of chromatin marks. Molecular cell 41(5):502-514. [57] Talbert PB & Henikoff S (2010) Histone variants--ancient wrap artists of the epigenome. Nature reviews. Molecular cell biology 11(4):264-275. [58] Elsaesser SJ, Goldberg AD, & Allis CD (2010) New functions for an old variant: no substitute for histone H3.3. Current opinion in genetics & development 20(2):110-117. [59] Goldberg AD, et al. (2010) Distinct factors control histone variant H3.3 localization at specific genomic regions. Cell 140(5):678-691. [60] Szenker E, Ray-Gallet D, & Almouzni G (2011) The double face of the histone variant H3.3. Cell research 21(3):421-434. [61] Altaf M, Auger A, Covic M, & Cote J (2009) Connection between histone H2A variants and chromatin remodeling complexes. Biochemistry and cell biology = Biochimie et biologie cellulaire 87(1):35-50. [62] Draker R, et al. (2012) A combination of H2A.Z and H4 acetylation recruits Brd2 to chromatin during transcriptional activation. PLoS Genet 8(11):e1003047. [63] Marino-Ramirez L, et al. (2011) The Histone Database: an integrated resource for histones and histone fold-containing proteins. Database : the journal of biological databases and curation 2011:bar048. [64] Rothbart SB & Strahl BD (2014) Interpreting the language of histone and DNA modifications. Biochimica et biophysica acta. [65] Allfrey VG, Faulkner R, & Mirsky AE (1964) Acetylation and Methylation of Histones and Their Possible Role in the Regulation of Rna Synthesis. Proceedings of the National Academy of Sciences of the United States of America 51:786-794. [66] Kouzarides T (2007) Chromatin modifications and their function. Cell 128(4):693-705. [67] Tjeertes JV, Miller KM, & Jackson SP (2009) Screen for DNA-damage-responsive histone modifications identifies H3K9Ac and H3K56Ac in human cells. The EMBO journal 28(13):1878-1889. [68] Dawson MA, et al. (2009) JAK2 phosphorylates histone H3Y41 and excludes HP1alpha from chromatin. Nature 461(7265):819-822. [69] Patel DJ & Wang Z (2013) Readout of epigenetic modifications. Annual review of biochemistry 82:81-118. [70] Bartke T, et al. (2010) Nucleosome-interacting proteins regulated by DNA and histone methylation. Cell 143(3):470-484. [71] Barber BA & Rastegar M (2010) Epigenetic control of Hox genes during neurogenesis, development, and disease. Annals of anatomy = Anatomischer Anzeiger : official organ of the Anatomische Gesellschaft 192(5):261-274. [72] Wei Y, Mizzen CA, Cook RG, Gorovsky MA, & Allis CD (1998) Phosphorylation of histone H3 at serine 10 is correlated with chromosome condensation during mitosis and meiosis in Tetrahymena. Proceedings of the National Academy of Sciences of the United States of America 95(13):7480-7484. [73] Clarke AS, Lowell JE, Jacobson SJ, & Pillus L (1999) Esa1p is an essential histone acetyltransferase required for cell cycle progression. Molecular and cellular biology 19(4):2515-2526.

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

52

Vichithra R. B. Liyanage, Robby M. Zachariah, Geneviève P. Delcuve et al.

[74] Khare SP, et al. (2012) HIstome--a relational knowledgebase of human histone proteins and histone modifying enzymes. Nucleic acids research 40(Database issue):D337-342. [75] Peterson CL & Laniel MA (2004) Histones and histone modifications. Current biology: CB 14(14):R546-551. [76] Tan M, et al. (2011) Identification of 67 histone marks and histone lysine crotonylation as a new type of histone modification. Cell 146(6):1016-1028. [77] Zhang Y, Griffin K, Mondal N, & Parvin JD (2004) Phosphorylation of histone H2A inhibits transcription on chromatin templates. The Journal of biological chemistry 279(21):21866-21872. [78] Messner S & Hottiger MO (2011) Histone ADP-ribosylation in DNA repair, replication and transcription. Trends in cell biology 21(9):534-542. [79] Wisniewski JR, Zougman A, Kruger S, & Mann M (2007) Mass spectrometric mapping of linker histone H1 variants reveals multiple acetylations, methylations, and phosphorylation as well as differences between cell culture and tissue. Molecular & cellular proteomics : MCP 6(1):72-87. [80] Zhang Y (2003) Transcriptional regulation by histone ubiquitination and deubiquitination. Genes & development 17(22):2733-2740. [81] Nathan D, et al. (2006) Histone sumoylation is a negative regulator in Saccharomyces cerevisiae and shows dynamic interplay with positive-acting histone modifications. Genes & development 20(8):966-976. [82] Kim SC, et al. (2006) Substrate and functional diversity of lysine acetylation revealed by a proteomics survey. Molecular cell 23(4):607-618. [83] Robzyk K, Recht J, & Osley MA (2000) Rad6-dependent ubiquitination of histone H2B in yeast. Science 287(5452):501-504. [84] Zhang L, Eugeni EE, Parthun MR, & Freitas MA (2003) Identification of novel histone post-translational modifications by peptide mass fingerprinting. Chromosoma 112(2):77-86. [85] Wisniewski JR, Zougman A, & Mann M (2008) Nepsilon-formylation of lysine is a widespread post-translational modification of nuclear proteins occurring at residues involved in regulation of chromatin function. Nucleic acids research 36(2):570-577. [86] Cheung WL, et al. (2005) Phosphorylation of histone H4 serine 1 during DNA damage requires casein kinase II in S. cerevisiae. Current biology : CB 15(7):656-660. [87] Hodawadekar SC & Marmorstein R (2007) Chemistry of acetyl transfer by histone modifying enzymes: structure, mechanism and implications for effector design. Oncogene 26(37):5528-5540. [88] Parthun MR, Widom J, & Gottschling DE (1996) The major cytoplasmic histone acetyltransferase in yeast: links to chromatin replication and histone metabolism. Cell 87(1):85-94. [89] Verdin E, Dequiedt F, & Kasler HG (2003) Class II histone deacetylases: versatile regulators. Trends in genetics : TIG 19(5):286-293. [90] Lee DY, Hayes JJ, Pruss D, & Wolffe AP (1993) A positive role for histone acetylation in transcription factor access to nucleosomal DNA. Cell 72(1):73-84. [91] Dhalluin C, et al. (1999) Structure and ligand of a histone acetyltransferase bromodomain. Nature 399(6735):491-496.

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

Chromatin Structure and Epigenetics

53

[92] Owen DJ, et al. (2000) The structural basis for the recognition of acetylated histone H4 by the bromodomain of histone acetyltransferase gcn5p. The EMBO journal 19(22):6141-6149. [93] Kuo MH, et al. (1996) Transcription-linked acetylation by Gcn5p of histones H3 and H4 at specific lysines. Nature 383(6597):269-272. [94] Gallinari P, Di Marco S, Jones P, Pallaoro M, & Steinkuhler C (2007) HDACs, histone deacetylation and gene transcription: from molecular biology to cancer therapeutics. Cell research 17(3):195-211. [95] Rea S, et al. (2000) Regulation of chromatin structure by site-specific histone H3 methyltransferases. Nature 406(6796):593-599. [96] Bannister AJ & Kouzarides T (2011) Regulation of chromatin by histone modifications. Cell research 21(3):381-395. [97] Jenuwein T (2001) Re-SET-ting heterochromatin by histone methyltransferases. Trends in cell biology 11(6):266-273. [98] Xiao B, et al. (2003) Structure and catalytic mechanism of the human histone methyltransferase SET7/9. Nature 421(6923):652-656. [99] Tamaru H, et al. (2003) Trimethylated lysine 9 of histone H3 is a mark for DNA methylation in Neurospora crassa. Nature genetics 34(1):75-79. [100] Zhang X, et al. (2003) Structural basis for the product specificity of histone lysine methyltransferases. Molecular cell 12(1):177-185. [101] Molina-Serrano D, Schiza V, & Kirmizis A (2013) Cross-talk among epigenetic modifications: lessons from histone arginine methylation. Biochemical Society transactions 41(3):751-759. [102] Wolf SS (2009) The protein arginine methyltransferase family: an update about function, new perspectives and the physiological role in humans. Cellular and molecular life sciences : CMLS 66(13):2109-2121. [103] Shi YJ, et al. (2005) Regulation of LSD1 histone demethylase activity by its associated factors. Molecular cell 19(6):857-864. [104] Mosammaparast N & Shi Y (2010) Reversal of histone methylation: biochemical and molecular mechanisms of histone demethylases. Annual review of biochemistry 79:155179. [105] Chang B, Chen Y, Zhao Y, & Bruick RK (2007) JMJD6 is a histone arginine demethylase. Science 318(5849):444-447. [106] Cuthbert GL, et al. (2004) Histone deimination antagonizes arginine methylation. Cell 118(5):545-553. [107] Org T, et al. (2008) The autoimmune regulator PHD finger binds to non-methylated histone H3K4 to activate gene expression. EMBO reports 9(4):370-376. [108] Li B, et al. (2009) Histone H3 lysine 36 dimethylation (H3K36me2) is sufficient to recruit the Rpd3s histone deacetylase complex and to repress spurious transcription. The Journal of biological chemistry 284(12):7970-7976. [109] Zhao Q, et al. (2009) PRMT5-mediated methylation of histone H4R3 recruits DNMT3A, coupling histone and DNA methylation in gene silencing. Nature structural & molecular biology 16(3):304-311. [110] Bode AM & Dong Z (2005) Inducible covalent posttranslational modification of histone H3. Science's STKE : signal transduction knowledge environment 2005(281):re4.

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

54

Vichithra R. B. Liyanage, Robby M. Zachariah, Geneviève P. Delcuve et al.

[111] Hassa PO, Haenni SS, Elser M, & Hottiger MO (2006) Nuclear ADP-ribosylation reactions in mammalian cells: where are we today and where are we going? Microbiology and molecular biology reviews : MMBR 70(3):789-829. [112] Wang D, et al. (2005) Direct identification of ubiquitination sites on ubiquitinconjugated CHIP using MALDI mass spectrometry. Journal of proteome research 4(5):1554-1560. [113] Wang H, et al. (2004) Role of histone H2A ubiquitination in Polycomb silencing. Nature 431(7010):873-878. [114] Lee JS, et al. (2007) Histone crosstalk between H2B monoubiquitination and H3 methylation mediated by COMPASS. Cell 131(6):1084-1096. [115] Kim J, et al. (2009) RAD6-Mediated transcription-coupled H2B ubiquitylation directly stimulates H3K4 methylation in human cells. Cell 137(3):459-471. [116] Chandrasekharan MB, Huang F, & Sun ZW (2009) Ubiquitination of histone H2B regulates chromatin dynamics by enhancing nucleosome stability. Proceedings of the National Academy of Sciences of the United States of America 106(39):16686-16691. [117] Shema E, et al. (2008) The histone H2B-specific ubiquitin ligase RNF20/hBRE1 acts as a putative tumor suppressor through selective regulation of gene expression. Genes & development 22(19):2664-2676. [118] Nelson CJ, Santos-Rosa H, & Kouzarides T (2006) Proline isomerization of histone H3 regulates lysine methylation and gene expression. Cell 126(5):905-916. [119] Sakabe K, Wang Z, & Hart GW (2010) Beta-N-acetylglucosamine (O-GlcNAc) is part of the histone code. Proceedings of the National Academy of Sciences of the United States of America 107(46):19915-19920. [120] Lo WS, et al. (2000) Phosphorylation of serine 10 in histone H3 is functionally linked in vitro and in vivo to Gcn5-mediated acetylation at lysine 14. Molecular cell 5(6):917926. [121] Edmondson DG, et al. (2002) Site-specific loss of acetylation upon phosphorylation of histone H3. The Journal of biological chemistry 277(33):29496-29502. [122] Fischle W, et al. (2005) Regulation of HP1-chromatin binding by histone H3 methylation and phosphorylation. Nature 438(7071):1116-1122. [123] Carmen AA, Milne L, & Grunstein M (2002) Acetylation of the yeast histone H4 N terminus regulates its binding to heterochromatin protein SIR3. The Journal of biological chemistry 277(7):4778-4781. [124] Dou Y, et al. (2005) Physical association and coordinate function of the H3 K4 methyltransferase MLL1 and the H4 K16 acetyltransferase MOF. Cell 121(6):873-885. [125] Shilatifard A (2006) Chromatin modifications by methylation and ubiquitination: implications in the regulation of gene expression. Annual review of biochemistry 75:243-269. [126] Huisinga KL, Brower-Toland B, & Elgin SC (2006) The contradictory definitions of heterochromatin: transcription and silencing. Chromosoma 115(2):110-122. [127] Trojer P & Reinberg D (2007) Facultative heterochromatin: is there a distinctive molecular signature? Molecular cell 28(1):1-13. [128] Fussner E, et al. (2011) Constitutive heterochromatin reorganization during somatic cell reprogramming. The EMBO journal 30(9):1778-1789.

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

Chromatin Structure and Epigenetics

55

[129] Camporeale G, Oommen AM, Griffin JB, Sarath G, & Zempleni J (2007) K12biotinylated histone H4 marks heterochromatin in human lymphoblastoma cells. The Journal of nutritional biochemistry 18(11):760-768. [130] Lachner M, O'Carroll D, Rea S, Mechtler K, & Jenuwein T (2001) Methylation of histone H3 lysine 9 creates a binding site for HP1 proteins. Nature 410(6824):116-120. [131] Bannister AJ, et al. (2001) Selective recognition of methylated lysine 9 on histone H3 by the HP1 chromo domain. Nature 410(6824):120-124. [132] Mateescu B, England P, Halgand F, Yaniv M, & Muchardt C (2004) Tethering of HP1 proteins to chromatin is relieved by phosphoacetylation of histone H3. EMBO reports 5(5):490-496. [133] Liu CL, et al. (2005) Single-nucleosome mapping of histone modifications in S. cerevisiae. PLoS biology 3(10):e328. [134] Pokholok DK, et al. (2005) Genome-wide map of nucleosome acetylation and methylation in yeast. Cell 122(4):517-527. [135] Barski A, et al. (2007) High-resolution profiling of histone methylations in the human genome. Cell 129(4):823-837. [136] Hon GC, Hawkins RD, & Ren B (2009) Predictive chromatin signatures in the mammalian genome. Human molecular genetics 18(R2):R195-201. [137] Koch CM, et al. (2007) The landscape of histone modifications across 1% of the human genome in five human cell lines. Genome research 17(6):691-707. [138] Black JC & Whetstine JR (2011) Chromatin landscape: methylation beyond transcription. Epigenetics : official journal of the DNA Methylation Society 6(1):9-15. [139] Lewis J & Bird A (1991) DNA methylation and chromatin structure. FEBS letters 285(2):155-159. [140] Razin A & Cedar H (1977) Distribution of 5-methylcytosine in chromatin. Proceedings of the National Academy of Sciences of the United States of America 74(7):2725-2728. [141] Solage A & Cedar H (1978) Organization of 5-methylcytosine in chromosomal DNA. Biochemistry 17(14):2934-2938. [142] Keshet I, Lieman-Hurwitz J, & Cedar H (1986) DNA methylation affects the formation of active chromatin. Cell 44(4):535-543. [143] Ball DJ, Gross DS, & Garrard WT (1983) 5-methylcytosine is localized in nucleosomes that contain histone H1. Proceedings of the National Academy of Sciences of the United States of America 80(18):5490-5494. [144] Antequera F, Macleod D, & Bird AP (1989) Specific protection of methylated CpGs in mammalian nuclei. Cell 58(3):509-517. [145] Beck S & Rakyan VK (2008) The methylome: approaches for global DNA methylation profiling. Trends in genetics : TIG 24(5):231-237. [146] Ibrahim MA (2012) An Insight into the Use of Genome, Methylome and Gethylome in Synthetic Biology. Asian Journal of Applied Sciences 5:67-73. [147] Kinney SR & Pradhan S (2011) Regulation of expression and activity of DNA (cytosine-5) methyltransferases in mammalian cells. Progress in molecular biology and translational science 101:311-333. [148] Jabbari K & Bernardi G (2004) Cytosine methylation and CpG, TpG (CpA) and TpA frequencies. Gene 333:143-149. [149] Huang K & Fan G (2010) DNA methylation in cell differentiation and reprogramming: an emerging systematic view. Regenerative medicine 5(4):531-544.

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

56

Vichithra R. B. Liyanage, Robby M. Zachariah, Geneviève P. Delcuve et al.

[150] Chen ZX & Riggs AD (2011) DNA methylation and demethylation in mammals. The Journal of biological chemistry 286(21):18347-18353. [151] Wu SC & Zhang Y (2010) Active DNA demethylation: many roads lead to Rome. Nature reviews. Molecular cell biology 11(9):607-620. [152] Bourc'his D, Xu GL, Lin CS, Bollman B, & Bestor TH (2001) Dnmt3L and the establishment of maternal genomic imprints. Science 294(5551):2536-2539. [153] Xu F, et al. (2010) Molecular and enzymatic profiles of mammalian DNA methyltransferases: structures and targets for drugs. Current medicinal chemistry 17(33):4052-4071. [154] Tao Y, et al. (2011) Lsh, chromatin remodeling family member, modulates genomewide cytosine methylation patterns at nonrepeat sequences. Proceedings of the National Academy of Sciences of the United States of America 108(14):5626-5631. [155] Briones V & Muegge K (2012) The ghosts in the machine: DNA methylation and the mystery of differentiation. Biochimica et biophysica acta. [156] Xi S, et al. (2009) Lsh participates in DNA methylation and silencing of stem cell genes. Stem cells 27(11):2691-2702. [157] Lister R, et al. (2009) Human DNA methylomes at base resolution show widespread epigenomic differences. Nature 462(7271):315-322. [158] Laurent L, et al. (2010) Dynamic changes in the human methylome during differentiation. Genome research 20(3):320-331. [159] Guo JU, et al. (2014) Distribution, recognition and regulation of non-CpG methylation in the adult mammalian brain. Nature neuroscience 17(2):215-222. [160] Ziller MJ, et al. (2011) Genomic distribution and inter-sample variation of non-CpG methylation across human cell types. PLoS genetics 7(12):e1002389. [161] Lister R, et al. (2011) Hotspots of aberrant epigenomic reprogramming in human induced pluripotent stem cells. Nature 471(7336):68-73. [162] Yokochi T & Robertson KD (2002) Preferential methylation of unmethylated DNA by Mammalian de novo DNA methyltransferase Dnmt3a. The Journal of biological chemistry 277(14):11735-11745. [163] Vanyushin BF & Ashapkin VV (2011) DNA methylation in higher plants: past, present and future. Biochimica et biophysica acta 1809(8):360-368. [164] Dyachenko OV, Schevchuk TV, Kretzner L, Buryanov YI, & Smith SS (2010) Human non-CG methylation: are human stem cells plant-like? Epigenetics : official journal of the DNA Methylation Society 5(7):569-572. [165] Booth MJ, et al. (2012) Quantitative sequencing of 5-methylcytosine and 5hydroxymethylcytosine at single-base resolution. Science 336(6083):934-937. [166] Thomson JP, et al. (2010) CpG islands influence chromatin structure via the CpGbinding protein Cfp1. Nature 464(7291):1082-1086. [167] Bostick M, et al. (2007) UHRF1 plays a role in maintaining DNA methylation in mammalian cells. Science 317(5845):1760-1764. [168] Skene PJ, et al. (2010) Neuronal MeCP2 is expressed at near histone-octamer levels and globally alters the chromatin state. Molecular cell 37(4):457-468. [169] Kriaucionis S & Heintz N (2009) The nuclear DNA base 5-hydroxymethylcytosine is present in Purkinje neurons and the brain. Science 324(5929):929-930. [170] Tahiliani M, et al. (2009) Conversion of 5-methylcytosine to 5-hydroxymethylcytosine in mammalian DNA by MLL partner TET1. Science 324(5929):930-935.

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

Chromatin Structure and Epigenetics

57

[171] Munzel M, Globisch D, & Carell T (2011) 5-Hydroxymethylcytosine, the sixth base of the genome. Angewandte Chemie 50(29):6460-6468. [172] Munzel M, et al. (2010) Quantification of the sixth DNA base hydroxymethylcytosine in the brain. Angewandte Chemie 49(31):5375-5377. [173] Ficz G, et al. (2011) Dynamic regulation of 5-hydroxymethylcytosine in mouse ES cells and during differentiation. Nature 473(7347):398-402. [174] Song CX, et al. (2011) Selective chemical labeling reveals the genome-wide distribution of 5-hydroxymethylcytosine. Nature biotechnology 29(1):68-72. [175] Wu H, et al. (2011) Genome-wide analysis of 5-hydroxymethylcytosine distribution reveals its dual function in transcriptional regulation in mouse embryonic stem cells. Genes & development 25(7):679-684. [176] Ito S, et al. (2011) Tet proteins can convert 5-methylcytosine to 5-formylcytosine and 5-carboxylcytosine. Science 333(6047):1300-1303. [177] Inoue A, Shen L, Dai Q, He C, & Zhang Y (2011) Generation and replicationdependent dilution of 5fC and 5caC during mouse preimplantation development. Cell research 21(12):1670-1676. [178] He YF, et al. (2011) Tet-mediated formation of 5-carboxylcytosine and its excision by TDG in mammalian DNA. Science 333(6047):1303-1307. [179] Wu H & Zhang Y (2011) Mechanisms and functions of Tet protein-mediated 5methylcytosine oxidation. Genes & development 25(23):2436-2452. [180] Ito S, et al. (2010) Role of Tet proteins in 5mC to 5hmC conversion, ES-cell selfrenewal and inner cell mass specification. Nature 466(7310):1129-1133. [181] Spruijt CG, et al. (2013) Dynamic readers for 5-(hydroxy)methylcytosine and its oxidized derivatives. Cell 152(5):1146-1159. [182] Iurlaro M, et al. (2013) A screen for hydroxymethylcytosine and formylcytosine binding proteins suggests functions in transcription and chromatin regulation. Genome biology 14(10):R119. [183] Cedar H & Bergman Y (2012) Programming of DNA Methylation Patterns. Annual review of biochemistry. [184] Gong Z & Zhu JK (2011) Active DNA demethylation by oxidation and repair. Cell research 21(12):1649-1651. [185] Branco MR, Ficz G, & Reik W (2012) Uncovering the role of 5-hydroxymethylcytosine in the epigenome. Nature reviews. Genetics 13(1):7-13. [186] Zachariah RM, Olson CO, Ezeonwuka C, & Rastegar M (2012) Novel MeCP2 isoformspecific antibody reveals the endogenous MeCP2E1 expression in murine brain, primary neurons and astrocytes. PloS one 7(11):e49763. [187] Kubiura M, Okano M, Kimura H, Kawamura F, & Tada M (2012) Chromosome-wide regulation of euchromatin-specific 5mC to 5hmC conversion in mouse ES cells and female human somatic cells. Chromosome research : an international journal on the molecular, supramolecular and evolutionary aspects of chromosome biology 20(7):837848. [188] Alioui A, et al. (2012) 5-Carboxylcytosine is localized to euchromatic regions in the nuclei of follicular cells in axolotl ovary. Nucleus 3(6):565-569. [189] Shen L, et al. (2013) Genome-wide analysis reveals TET- and TDG-dependent 5methylcytosine oxidation dynamics. Cell 153(3):692-706.

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

58

Vichithra R. B. Liyanage, Robby M. Zachariah, Geneviève P. Delcuve et al.

[190] Geiman TM & Robertson KD (2002) Chromatin remodeling, histone modifications, and DNA methylation-how does it all fit together? Journal of cellular biochemistry 87(2):117-125. [191] Li E (2002) Chromatin modification and epigenetic reprogramming in mammalian development. Nature reviews. Genetics 3(9):662-673. [192] Calvanese V, Lara E, & Fraga MF (2012) Epigenetic code and self-identity. Advances in experimental medicine and biology 738:236-255. [193] Kondo Y (2009) Epigenetic cross-talk between DNA methylation and histone modifications in human cancers. Yonsei medical journal 50(4):455-463. [194] Szulwach KE, et al. (2011) Integrating 5-hydroxymethylcytosine into the epigenomic landscape of human embryonic stem cells. PLoS genetics 7(6):e1002154. [195] Sarraf SA & Stancheva I (2004) Methyl-CpG binding protein MBD1 couples histone H3 methylation at lysine 9 by SETDB1 to DNA replication and chromatin assembly. Molecular cell 15(4):595-605. [196] Fujita N, et al. (2003) Methyl-CpG binding domain 1 (MBD1) interacts with the Suv39h1-HP1 heterochromatic complex for DNA methylation-based transcriptional repression. The Journal of biological chemistry 278(26):24132-24138. [197] Zachariah RM & Rastegar M (2012) Linking Epigenetics to Human Disease and Rett Syndrome: The Emerging Novel and Challenging Concepts in MeCP2 Research,. Neural Plasticity 2012:10. [198] Fuks F, et al. (2003) The methyl-CpG-binding protein MeCP2 links DNA methylation to histone methylation. The Journal of biological chemistry 278(6):4035-4040. [199] Kraus TF, et al. (2012) Low values of 5-hydroxymethylcytosine (5hmC), the "sixth base," are associated with anaplasia in human brain tumors. International journal of cancer. Journal international du cancer. [200] Mellen M, Ayata P, Dewell S, Kriaucionis S, & Heintz N (2012) MeCP2 binds to 5hmC enriched within active genes and accessible chromatin in the nervous system. Cell 151(7):1417-1430. [201] Yildirim O, et al. (2011) Mbd3/NURD complex regulates expression of 5hydroxymethylcytosine marked genes in embryonic stem cells. Cell 147(7):1498-1510. [202] Stroud H, Feng S, Morey Kinney S, Pradhan S, & Jacobsen SE (2011) 5Hydroxymethylcytosine is associated with enhancers and gene bodies in human embryonic stem cells. Genome biology 12(6):R54. [203] Gan H, et al. (2013) Dynamics of 5-hydroxymethylcytosine during mouse spermatogenesis. Nature communications 4:1995. [204] Zhubi A, et al. (2014) Increased binding of MeCP2 to the GAD1 and RELN promoters may be mediated by an enrichment of 5-hmC in autism spectrum disorder (ASD) cerebellum. Transl Psychiatry 4:e349. [205] Liyanage VR & Rastegar M (2014) Rett syndrome and MeCP2. Neuromolecular medicine 16(2):231-264. [206] Zachariah RM & Rastegar M (2012) Linking epigenetics to human disease and Rett syndrome: the emerging novel and challenging concepts in MeCP2 research. Neural plasticity 2012:415825. [207] Olson CO, Zachariah RM, Ezeonwuka CD, Liyanage VR, & Rastegar M (2014) Brain region-specific expression of MeCP2 isoforms correlates with DNA methylation within Mecp2 regulatory elements. PloS one 9(3):e90645.

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

Chromatin Structure and Epigenetics

59

[208] Liyanage VR, Zachariah RM, & Rastegar M (2013) Decitabine alters the expression of Mecp2 isoforms via dynamic DNA methylation at the Mecp2 regulatory elements in neural stem cells. Molecular autism 4(1):46. [209] Chahrour M, et al. (2008) MeCP2, a key contributor to neurological disease, activates and represses transcription. Science 320(5880):1224-1229. [210] Cartron PF, et al. (2013) Identification of TET1 Partners That Control Its DNADemethylating Function. Genes & cancer 4(5-6):235-241. [211] Saze H, Tsugane K, Kanno T, & Nishimura T (2012) DNA Methylation in Plants: Relationship with Small RNAs and Histone Modifications, and Functions in Transposon Inactivation. Plant & cell physiology. [212] Wade PA (2001) Methyl CpG binding proteins: coupling chromatin architecture to gene regulation. Oncogene 20(24):3166-3173. [213] Clouaire T & Stancheva I (2008) Methyl-CpG binding proteins: specialized transcriptional repressors or structural components of chromatin? Cellular and molecular life sciences : CMLS 65(10):1509-1522. [214] Georgel PT, et al. (2003) Chromatin compaction by human MeCP2. Assembly of novel secondary chromatin structures in the absence of DNA methylation. The Journal of biological chemistry 278(34):32181-32188. [215] Horike S, Cai S, Miyano M, Cheng JF, & Kohwi-Shigematsu T (2005) Loss of silentchromatin looping and impaired imprinting of DLX5 in Rett syndrome. Nature genetics 37(1):31-40. [216] Nan X, et al. (2007) Interaction between chromatin proteins MECP2 and ATRX is disrupted by mutations that cause inherited mental retardation. Proceedings of the National Academy of Sciences of the United States of America 104(8):2709-2714. [217] Lai AY & Wade PA (2011) Cancer biology and NuRD: a multifaceted chromatin remodelling complex. Nature reviews. Cancer 11(8):588-596. [218] Yoon HG, Chan DW, Reynolds AB, Qin J, & Wong J (2003) N-CoR mediates DNA methylation-dependent repression through a methyl CpG binding protein Kaiso. Molecular cell 12(3):723-734. [219] Bartels SJ, et al. (2011) A SILAC-based screen for Methyl-CpG binding proteins identifies RBP-J as a DNA methylation and sequence-specific binding protein. PloS one 6(10):e25884. [220] Craig JM, et al. (2003) Analysis of mammalian proteins involved in chromatin modification reveals new metaphase centromeric proteins and distinct chromosomal distribution patterns. Human molecular genetics 12(23):3109-3121. [221] Brero A, et al. (2005) Methyl CpG-binding proteins induce large-scale chromatin reorganization during terminal differentiation. The Journal of cell biology 169(5):733743. [222] Agarwal N, et al. (2007) MeCP2 interacts with HP1 and modulates its heterochromatin association during myogenic differentiation. Nucleic acids research 35(16):5402-5408. [223] Ghosh RP, Horowitz-Scherer RA, Nikitina T, Shlyakhtenko LS, & Woodcock CL (2010) MeCP2 binds cooperatively to its substrate and competes with histone H1 for chromatin binding sites. Molecular and cellular biology 30(19):4656-4670. [224] Thambirajah AA, et al. (2011) MeCP2 binds to nucleosome free (linker DNA) regions and to H3K9/H3K27 methylated nucleosomes in the brain. Nucleic acids research.

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

60

Vichithra R. B. Liyanage, Robby M. Zachariah, Geneviève P. Delcuve et al.

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

[225] Nikitina T, et al. (2007) Multiple modes of interaction between the methylated DNA binding protein MeCP2 and chromatin. Molecular and cellular biology 27(3):864-877. [226] Yasui DH, et al. (2007) Integrated epigenomic analyses of neuronal MeCP2 reveal a role for long-range interaction with active genes. Proceedings of the National Academy of Sciences of the United States of America 104(49):19416-19421. [227] Hansen JC, Ghosh RP, & Woodcock CL (2010) Binding of the Rett syndrome protein, MeCP2, to methylated and unmethylated DNA and chromatin. IUBMB life 62(10):732738. [228] Nikitina T, et al. (2007) MeCP2-chromatin interactions include the formation of chromatosome-like structures and are altered in mutations causing Rett syndrome. The Journal of biological chemistry 282(38):28237-28245. [229] Agarwal N, et al. (2011) MeCP2 Rett mutations affect large scale chromatin organization. Human molecular genetics 20(21):4187-4195.

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

In: New Developments in Chromatin Research Editors: Neil M. Simpson and Valerie J. Stewart

ISBN: 978-1-62081-816-9 © 2012 Nova Science Publishers, Inc.

Chapter 3

SPERM CHROMATIN INTEGRITY, DNA FRAGMENTATION AND MALE FERTILITY María Enciso and Dagan Wells Nuffield Department of Obstetrics and Gynaecology, University of Oxford, John Radcliffe Hospital, Oxford, UK

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

ABSTRACT During the last 15 years, largely as a result of the advent of assisted reproductive technology (ART), many research groups have focussed their attention on the study of sperm chromatin and its impact on reproductive outcome. Published studies on the topic have allowed for real progress in our understanding of elementary aspects of sperm chromatin structure and composition. Some have also shed some light on the impact of chromatin defects on sperm function and the ability to produce viable embryos. We are now beginning to understand how the sperm nucleus is configured and the implications of sperm genetic integrity on male fertility. As a result of the growing interest in this area, many novel tests to assess sperm chromatin composition and/or integrity have been developed. Currently available tests are directed to identify the presence of DNA and/or chromatin defects in the sperm nucleus, either by detecting DNA breaks or by assessing chromatin configuration in individual spermatozoa. A higher incidence of spermatozoa with chromatin defects has been found in samples from infertile subjects compared to those from fertile men, suggesting that sperm chromatin damage can be considered as a new biomarker of semen quality that may help in the identification and characterisation of men with fertility problems. Correlations between DNA damage in spermatozoa and adverse ART reproductive outcomes, such as reduced fertilization and conception rates, increased miscarriage and elevated incidence of birth defects have been described. It therefore seems that sperm genetic integrity is a requirement for successful fertilization and adequate embryo development. However, despite the advances made so far in the field of sperm chromatin integrity and male infertility, the clinical relevance of the data is still debated. More studies are needed in order to determine the specifics of sperm chromatin configuration and gain an improved understanding of the origin and implications of chromatin defects in spermatozoa. Many essential questions remain to be answered, further investigations on

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

62

María Enciso and Dagan Wells sperm chromatin structure, chromatin packaging and unpackaging during spermatogenesis and after fertilization, and the capacity of the oocyte to repair sperm DNA damage, are essential to have a better understanding of the genetic integrity of the male germ line and its significance on reproduction. This chapter reviews our present knowledge on the structure and composition of sperm chromatin, the existing information about the origin and aetiology of DNA damage in spermatozoa, the methods available for the analysis of sperm genetic integrity, and some of the most relevant clinical data produced over the last years about the correlations found between sperm chromatin defects and adverse reproductive outcomes.

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

1. SPERM CHROMATIN STRUCTURE Sperm DNA is extremely condensed; it is the most tightly packaged eukaryotic DNA known, six-fold more compact than DNA in mitotic chromosomes [1]. This extreme level of condensation is only possible due to its specific components and organisation, unique to this cell type and very different from that of somatic cells. This exclusive mode of chromatin packaging is thought to protect the paternal DNA on its way to the oocyte [2]. The DNA in somatic cells is packaged into discrete units called nucleosomes consisting of a protein core, composed of an octamer of histones, about which 200 base pairs (bp) of DNA is wrapped in two loops. Histones are small basic proteins with a high affinity for DNA. Small chains (40-50bp) of DNA associated with a linker histone connect the cores [3]. Linear series of these nucleosomes can then undergo further coiling forming a regular helix termed solenoid or 30 nm fibre [4]. Until the early 1980s the dominant idea was that sperm chromatin was organised in a similar way to that of somatic cells, in nucleosomes or nucleosome-like structures. However, mammalian spermatozoa do not contain enough volume to package their DNA this way. Studies on sperm nuclear dimensions and chromatin structure indicated that mammalian spermatozoa would require more than double the volume encompassed by an average sperm nucleus if they were to pack their DNA using nucleosomes [5]. Therefore, it was clear that a completely different type of DNA packaging must be present in sperm nuclei. The sperm DNA of most vertebrates is associated with a specific type of proteins called protamines. These are highly basic proteins half the size of histones (5-8 kDa) with a high content on arginine (from 50 to 70%), which facilitates strong DNA binding [6]. Protamine sequences are typically divided into three domains: a central arginine-rich DNA-binding domain flanked by two short N- and C-terminal peptide domains that do not bind to DNA [7]. Despite their relatively simple amino acid composition and in contrast to the high conservation level of histones in most eukaryotic organisms, protamines exhibit a high level of variability between species [8]. Protamines from different species differ in their amino acid sequence and, also, in the number of variants present in sperm. Spermatozoa from bull [9], boar [10], ram [11] and rat contain only one type of protamine whereas mice and humans contain two [12]. Apart from arginines, most mammalian protamines contain also a significant number of cysteine residues, very important for sperm chromatin compaction during the final stages of spermiogenesis [13, 14]. In the case of placental mammals, protamines present a variable number of cysteines depending on the species [15]. In contrast, most marsupial protamines do not contain any cysteine residues [16, 17]. The lack of cysteine residues in this group of

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

Sperm Chromatin Integrity, DNA Fragmentation and Male Fertility

63

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

mammals makes their spermatozoa more sensitive to DNA damage [15, 18]. Eutherian sperm protamines are thought to help stabilise and protect the DNA from damage [19]. The presence and lack of disulfide bonding in eutherian and metatherian spermatozoa, respectively, is likely to have an evolutionary significance associated with sperm transport and fertilisation. In eutherian species, the development of highly resistant sperm chromatin has been proposed as an adaptation to prevent damage to the sperm nucleus during migration of the spermatozoa along extensive male and female reproductive tracts and in the penetration of the thickened zona pellucida [20].

Balhorn’s Model While protamine composition varies widely between mammalian species, there is little variability in the modes of DNA packaging observed in spermatozoa. Sperm of all mammals use protamines to package most of their genome, only a small percent of the sperm DNA remains bound to histones [21, 22]. How DNA is bound to protamines and which types of interactions are established between different protamines in sperm nuclei was described by Balhorn in 1982. According to Balhorn’s model, protamines adopt an extended conformation and bind in their central polyarginine-rich segment to the minor groove of DNA. This binding neutralises the negatively charged phosphate groups on the DNA so that neighbouring DNA-protamine complexes can be packaged tightly together without charge repulsion [6, 23]. To minimise the volume, protamine-DNA complexes of one strand fit into the major groove of a neighbouring DNA strand, so that sperm DNA strands are packaged side by side in a linear array. In mammalian sperm, this structure is further stabilised by the establishment of inter and intraprotamines bonds. The carboxy and amino terminal residues of protamines participate in the formation of these intermolecular and intramolecular connexions. In this manner, sperm DNA can be tightly packaged in a very small volume. The idea that DNA strands in sperm chromatin are positioned side by side and that sperm DNA is not organised into nucleosomes is supported by the observation that DNA in sperm nuclei is not supercoiled [24, 25]. DNA in somatic cells is negatively supercoiled, mainly because it is packaged into nucleosomes; the coils of DNA around the histone octamers induce supercoils into the double helix. According to Balhorn’s model, protamines do not induce such supercoiling and hence DNA in sperm is organised in a more compact but less coiled structure [6].

Toroids The linear arrays of DNA and protamines are then organised in 3-dimensional loop domains attached to a protein scaffold called nuclear matrix [26]. This structure of loops associated with a matrix is also present in the chromatin of somatic cells. In these cells, the 30nm fibre is attached to the nuclear matrix every 60kb [27]. Sperm DNA loops are smaller than those of somatic cells containing approximately 50kb [25]. Each loop is thought to be folded in a concentric circular structure of approximately 900-Å outer diameter, 200-Å thickness and 150-Å diameter hole called toroid [28, 29]. This structure is the fundamental packing unit of sperm chromatin. Sperm DNA arranged in toroids is very tightly compacted and consequently resistant to nucleases and sonication [30, 31]. Toroids are linked by chromatin segments called toroid linkers, very sensitive to damaging agents such as DNAse I [32, 33]. Protamine toroids are thought to be stacked side by side, the most efficient way of condensing toroids into a highly protective structure.

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

64

María Enciso and Dagan Wells

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

Evidence for this has been recently provided by Mudrak et al. in 2009 [34], however, variations of this model are also possible as this continues to be an area of active investigation.

Histone Bound DNA Although most of the DNA in mammalian spermatozoa is bound to protamines and folded into toroids, a small fraction of sperm chromatin remains wrapped around histones and packed into nucleosomes. The percentage of sperm DNA bound to histones varies from 2 to 15% depending on the species [35]. In humans, the histone-packaged DNA fraction is 1015% [21, 36]. The role and precise distribution of these histone-associated chromatin fractions is still not very well understood. Data obtained so far suggest that histone-bound chromatin is distributed in two ways in human spermatozoa. First, in large domains of DNA from 10 to 100kb that might constitute whole DNA loop domains; and, second, in small fragments interspersed throughout the genome with properties similar to toroid linkers [36, 37]. These sperm histone-portions seem to be associated with specific sequences within sperm chromatin. Some authors have identified some of these histone fractions at the telomeres [38, 39]. Others have proposed that histone-bound chromatin regions are located in the sites of attachment of DNA loops to the nuclear matrix [21, 40]. Several studies have described specific DNA sequences such as genes for epsilon and gamma globin [41] or paternally imprinted genes [42] to be associated with histones in spermatozoa. A recent study has suggested that genes important for cell differentiation and early embryo development remain bound to histones [36]. These include the promoters of a number of genes expressing signalling proteins important for the initial steps of embryonic development and genes that produce transcription factors such as those in the HOX family. The non-random distribution of histones in the mature sperm nucleus and its association with specific DNA sequences suggests a defined role for this feature of sperm chromatin organisation [2]. The fact that genes important for embryo development remain bound to histones suggest that the retention of these histones may be aimed at assuring the accessibility of certain genes in the male nucleus to be activated immediately after fertilization [43, 44]. Additionally, the association of histones with a variety of imprinted genes may indicate that these nucleosomal domains may also play a role in epigenetic programming in the embryo [45]. Shortly after fertilisation, protamines in the sperm nucleus are actively removed and replaced with histones provided by the oocyte. Recent studies have shown that in regions of histone-bound sperm chromatin replacement does not take place and, as a result, paternally derived histones persist into embryo development [46, 47]. This finding raises the possibility that spermatozoa might carry an epigenetic signature to the egg, defined by chromatin configuration, which may be crucial for normal embryo development. Differences in structure between histone-bound and protamine-bound fractions of the sperm chromatin may lead to differences in resistance to DNA damage. The protamine-bound component, condensed into toroids, is less easily reached by DNA damaging agents compared with DNA folded into nucleosomes, protecting against degradation by nucleases [31], sonication [48] and the action of reactive oxygen species (ROS) [15, 49].

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

Sperm Chromatin Integrity, DNA Fragmentation and Male Fertility

65

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

Chromatin Remodelling during Spermatogenesis During the extensive chromatin remodelling that occurs during meiosis, somatic histones are substituted by testis-specific histones [50]. These testis-specific histones are then replaced by protamines in a process facilitated by proteins termed transition proteins because they only remain associated with DNA for a short period of time [51, 52]. These transition proteins bind to DNA and initiate transformations in the organisation of sperm chromatin. Part of these changes includes the acetylation, methylation and/or phosphorylation of specific chromatin domains together with the production of cuts on the DNA to relax the supercoiled structure and facilitate the exchange of histones by protamines [53-57]. These breaks are then repaired by a poorly understood mechanism during the condensation process [53, 58]. By the time transition protein deposition is completed, the chromatin is uniformly condensed, with protamines integrated throughout the genome and few nucleosome-like structures remaining. The next step of sperm chromatin condensation is the formation of large numbers of disulfide cross-links between protamine molecules. These cross-links are formed between the thiol groups of adjacent protamines after the spermatozoa have exited the caput epididymis en route to the cauda epididymis [13, 14]. During epididymal transit almost 1.5 billion disulfide bonds are formed per individual sperm, confering great stability to sperm chromatin [59]. Chromosome Territories Chromosomes in somatic cells are not randomly distributed in the nucleus, instead they are organized in distinct territories. Several studies have shown that each individual chromosome occupies a specific domain inside the cell nucleus [60, 61]. A similar pattern of chromosome organisation has been observed in spermatozoa [62, 63]. Studies have revealed that individual chromosomes occupy specific areas in the sperm nucleus and that the relative positioning of chromosomes is not random [64, 65]. Chromosomes compartmentalization in the nucleus seems to influence the access of the transcription machinery to specific genes and has been proposed as a higher order mechanism for gene expression regulation [66]. It is thought that specific nuclear positioning of chromosome territories in sperm is required for successful fertilisation and adequate embryo development [67]. It may be that sperm genome architecture provides epigenetic information for the unpacking and ordered activation of the male genome during fertilization and early embryo development [68]. Furthermore, it is possible that changes in the nuclear topology of sperm chromosomes may impact sperm function and embryo development. In support of this hypothesis several studies have explored the genome architecture of sperm nuclei from subfertile men. Most of the studies performed so far have reported an altered positioning of chromosomes in infertile patients including those with increased incidence of aneuploidy or carriers of reciprocal translocations [69-71].

2. SPERM CHROMATIN INTEGRITY, DNA FRAGMENTATION AND MALE FERTILITY Recent studies have shown that adequate sperm chromatin structure is crucial for normal fertilization and correct embryo development. Sperm chromatin abnormalities have been

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

66

María Enciso and Dagan Wells

associated with reduced fertilizing ability of males, poor embryo development [72], increased incidence of miscarriage [73] and negative effects in the health of the offspring [74]. Within the abnormalities found in sperm chromatin, one of the most studied is sperm DNA damage. During the last 15 years, the integrity of sperm DNA has emerged as a new parameter of semen quality and has been proposed by some scientists as a potential fertility predictor. Sperm DNA damage, also known as sperm DNA fragmentation, refers to the presence of breaks in the DNA of spermatozoa. A fraction of spermatozoa from males of a large number of species have been shown to present DNA breaks [75]. This feature has been found in both fertile and infertile males, however, its incidence has been shown to be higher in infertile or subfertile subjects compared to fertile men [76, 77].

Origin of Sperm DNA Fragmentation The mechanism by which DNA damage is produced in spermatozoa is not entirely known; however several likely origins have been proposed. DNA fragmentation could be (i) the result of an incomplete repair of DNA breaks during chromatin packaging [78, 79], (ii) a consequence of aberrant protamination during spermiogenesis [80, 81], (iii) caused by a defective apoptotic mechanism [82, 83] or (iv) induced by the excessive production of reactive oxygen species in the ejaculate [84, 85].

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

Incomplete Repair of DNA Breaks during Chromatin Remodelling Failure to repair the nicks in the DNA, produced by transition proteins during the process of replacing histones with protamines, would allow some sperm to reach the ejaculate with fragmented DNA. The presence of DNA breaks in spermatozoa could be, therefore, an indication of an incomplete maturation process [86, 87]. Aberrant Protamination Sperm nuclei with defective protamination have been associated with increased levels of sperm DNA fragmentation [88]. Protamines are thought to protect the DNA from damage, and hence an abnormal level of protamination is likely to result in the presence of DNA breaks in sperm. In addition, this DNA fragmentation associated to aberrant protamination could be the result of a faulty maturation process, leading to unresolved DNA breaks and/or defective replacement of protamines [81]. Defective Apoptosis Apoptosis is a programmed cell death, a natural process required to remove defective cells [89]. It involves, in addition to other features, plasma membrane changes and DNA fragmentation [90]. During spermiogenesis apoptosis plays a key role in adjusting the adequate number of proliferating germ cells and in eliminating defective spermatozoa [91]. Failure to complete apoptosis would allow morphologically abnormal sperm, with irregular biochemical functions and/or with DNA damage to reach the ejaculate [83].

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

Sperm Chromatin Integrity, DNA Fragmentation and Male Fertility

67

Excessive Production of ROS in the Ejaculate In the male reproductive tract, a balanced oxidative stress status (OSS) normally exists. This equilibrium of reactive oxygen species (ROS) levels is maintained by the precise regulation of ROS production and antioxidant activity [92]. Small physiological levels of ROS are essential for the regulation of normal sperm functions [93]. However, these levels can rise due to leukocytospermia, the presence of abnormal spermatozoa or by the reduction of the antioxidant capacity of seminal plasma and result in oxidative stress [85]. ROS are extremely powerful DNA damaging agents; studies suggest that ROS attack the integrity of DNA in the sperm nucleus by causing base modifications, DNA strand breaks, and chromatin cross-linking [94]. High levels of ROS have been found in infertile patients with increased sperm DNA fragmentation [95].

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

Other Factors Other factors that have been described to cause DNA damage in spermatozoa are: high temperature due to fever [96] or work environment [97], exposure to chemical agents including therapeutic drugs [98], air pollutants [99] or tobacco [100]. Another important source of sperm DNA damage is advanced age. Some studies have reported that older men present higher levels of DNA fragmentation in their sperm compared to younger subjects [101]. Obesity is also considered a factor influencing sperm DNA quality. Recent studies have shown an association between high body mass index and reduced DNA integrity [102]. The proposed mechanisms may not act independently. The most likely situation is that the presence of DNA damage in sperm may be the result of the combination of some of the processes described. Aitken and De Iuliis [103] have proposed a two-step hypothesis where faulty spermatogenesis can lead to defective chromatin remodelling with the DNA being more sensitive to a variety of damaging agents. It is also conceivable that ROS-generated DNA damage may be associated with an apoptotic process or that sperm presenting DNA breaks as a result of defective spermatogenesis may be labelled to undergo apoptosis.

Methods of Evaluation of Sperm DNA Fragmentation A series of methods have been designed in recent years to evaluate chromatin integrity and DNA damage in sperm. These include: Sperm Chromatin Structure assay (SCSA) [104]; Terminal deoxynucleotidyl transferase-mediated deoxyUridine triphosphate-Nick End Labeling (TUNEL) assay [105]; Single-Cell Gel Electrophoresis (SCGE) or Comet Assay [106]; and Sperm Chromatin Dispersion test (SCDt) [107].

Sperm Chromatin Structure Assay (SCSA) This assay was one of the first tests developed for the evaluation of sperm DNA damage [108]. SCSA measures the susceptibility of sperm DNA to acid denaturation in situ. It is assumed that chromatin presenting DNA damage is more susceptible to denaturation than chromatin with intact DNA. The denaturation level is measured by the use of acridine orange (AO). This is a selective metachromatic dye that interacts with DNA by intercalation or electrostatic attractions [109]. AO binds to double-stranded DNA motifs as a monomer emitting green fluorescence and to single-stranded DNA forming non-ordered aggregates and

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

68

María Enciso and Dagan Wells

emitting red fluorescence [110]. The level of DNA damage of a sample is established by measuring the shift from green to red fluorescence detected by a flow cytometer and analysed by specific software. The extent of DNA denaturation is expressed as DNA fragmentation index (DFI). Another parameter produced by the analysis software is HDS that refers to the fraction of high DNA stainable cells and is thought to represent immature spermatozoa.

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

Terminal Deoxytransferase Mediated deoxyUridine Triphosphate Nick End Labelling (TUNEL) Terminal deoxytransferase mediated deoxyUridine triphosphate (dUTP) Nick End Labelling, also known as TUNEL is another commonly used test to assess DNA integrity in sperm and other cell types. The test detects both single and double-strand DNA breaks in an enzymatic reaction catalysed by a terminal deoxynucleotidyl transferase that incorporates labelled nucleotides to 3’ hydroxyl free ends [105, 111]. The higher the level of labelled nucleotides incorporated, the higher the number of DNA breaks present in a nucleus. Results of this test can be assessed by bright-field/fluorescence microscopy or flow cytometry. Comet Assay In this method, sperm cells are included in an agarose microgel, lysed to remove membranes and proteins and subjected to electrophoresis. During this process, damaged-DNA is released from the nucleus and migrates towards the anode resulting in the formation of a comet tail emerging from the nucleoid. The amount of DNA damage is quantified by measuring the length and density of the comet tail; the longer/denser the tail, the higher the amount of DNA damage present in the sperm nucleus. Three versions of this assay have been developed: (i) the neutral comet [112], in which DNA migrates under neutral conditions, for identification of double-stranded DNA breaks (DSB); (ii) the alkaline comet, in which DNA is mobilized under alkaline conditions for DNA denaturation and detects both single and double-stranded DNA breaks without distinguishing between the two [113]; and the twotailed comet assay, that combines both neutral and alkaline versions allowing the simultaneous identification of both single and double-strand breaks in individual cells [114]. Sperm Chromatin Dispersion Test The SCD test is a fast and simple method based on a controlled DNA denaturation and protein depletion. In this method, sperm included in a microgel, are exposed to an acid denaturation solution and then to a lysis to remove membranes and protamines. This procedure gives rise to a ‘halo’ of chromatin dispersion surrounding sperm nuclei. The size of the halo is inversely related to the amount of sperm DNA damage. Sperm nuclei with intact DNA show large or medium-sized halos, whereas nuclei containing DNA fragmentation appear with a small or no halo of dispersed DNA loops [107, 115]. Some variants of this test have been developed and applied to spermatozoa of animal species other than humans [75, 116]. All of these assays are already in clinical use in some infertility/andrology centers. Even though they present many methodological differences, moderate to high correlations have been reported between the different methods [117]. Each technique has its own advantages and limitations, but, at the moment, there is still no consensus in terms of which is the most robust and clinically informative [118]. Therefore, the choice of the evaluation method, in

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

Sperm Chromatin Integrity, DNA Fragmentation and Male Fertility

69

most cases, depends on the limitation of time to obtain results, the access to specific equipment or the availability of qualified personnel. While all of the DNA integrity tests outlined above are able to provide information about the percentage of DNA-damaged sperm cells in a given ejaculate, none can be used to select intact spermatozoa that could be subsequently used for fertilisation. All the techniques currently available involve the destruction of the sperm tested. Very recently a promising approach to overcome this limitation has been proposed [119]. The strategy involves the use of synthetic peptides that mimic protein domains known to bind to specific epitopes [120]. In most cases, peptides of this type do not have any impact on cell viability when used in vivo to target living cells [121, 122] so, with this method, the selection of DNA-intact sperm for further use in fertilization may be feasible [119].

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

Impact of Sperm Nuclear Integrity on Male Fertility Infertility is the inability to conceive a child after 12 months of regular sexual intercourse without contraception. According to the World Health Organization, infertility affects between 8 and 12% of couples worldwide in reproductive age, this is between 50 and 80 million people [123]. Among these couples, male factor infertility accounts for approximately 50 percent of the cases [124]. Male infertility is a multifactorial problem encompassing a wide range of disorders that can be due to a variety of genetic and acquired factors [125]. However, for a substantial proportion of the cases, the cause of their infertility remains unknown. Infertility in men is initially diagnosed by traditional semen analysis, i.e. assessment of sperm concentration, motility and morphology. Although several advances have been made in the understanding of sperm physiology, and new measures have been proposed, these parameters continue to be the most important and widely used means of evaluating male factor infertility [126]. However, it is generally accepted that these measures convey only a limited degree of prognostic and diagnostic information [127]. In some cases, conventional semen analysis is unable to detect the presence of subtle alterations in spermatozoa that might affect functionality. Therefore, there is a need for new markers allowing a more accurate diagnosis of male infertility and a more reliable prediction of the likelihood of pregnancy and of miscarriage risk. As discussed above, the measurement of sperm DNA integrity has been proposed as a new and complementary measure of semen quality and male fertility. Some studies indicate that sperm DNA damage is associated with anomalies in the conventional semen parameters [128, 129]. Others, however, have shown that sperm DNA integrity is independent from these parameters and suggest that its evaluation could provide valuable additional information [130]. There is good evidence to show that infertile men present substantially higher levels of sperm DNA damage than do fertile men, although a percentage of spermatozoa from fertile men also possess detectable DNA damage [131, 132]. Sperm DNA damage has been recognized as a possible explanation for a high percentage of idiopathic infertility cases [76]. Apart from studying the relationship between sperm chromatin abnormalities and infertility or subfertility in men, there has also been an interest in analysing the link between sperm chromatin defects and other andrological pathologies such as varicocele [133], infections [134] or cancer [135]. An abnormally high percentage of DNA damaged sperm is found in

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

70

María Enciso and Dagan Wells

varicocele patients. In these patients, heat and oxidative stress characteristics of the pathology may be responsible of a high incidence of sperm DNA fragmentation [133]. Bacterial infections have been also linked to increased levels of DNA fragmentation in sperm. Antibiotic therapy in these cases has resulted in improvement of sperm DNA integrity [134]. In addition, results from studies performed on patients presenting testicular cancer have indicated that the oncologic process itself might damage the DNA of sperm since high DNA fragmentation levels have been found in patients even before the application of any anticancer therapy [135]. Other pathologies where a high level of DNA damage in sperm have been reported are thalassemia major [136], spinal cord injury [137] and type I diabetes mellitus [138].

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

Impact of Sperm Nuclear Integrity on Reproduction The evaluation of the fertility potential of a couple is a very challenging task. To date, methods lack accuracy to identify and predict the outcome of natural reproduction or assisted reproduction procedures. Since the birth of the first test-tube baby around 30 years ago, the use of assisted reproduction has transformed the treatment of infertility. The application of these technologies has become increasingly common over recent years, with an increase of 5-10% in the number of cycles performed per annum in the last 5 years [139]. Assisted reproductive technology refers to a variety of treatments or procedures involving in vitro handling of human gametes and embryos for the purpose of establishing a pregnancy [140]; these include intrauterine insemination (IUI), in vitro fertilisation (IVF) and intracytoplasmic sperm injection (ICSI). In IUI, previously washed sperm is placed into the female´s uterus by the use of a catheter with the aim of achieving a successful pregnancy. IVF process involves extracorporeal fertilisation. For this purpose, the ovulatory process of the woman is hormonally controlled, so many ova can be removed at an adequate stage of maturation to be fertilised in vitro by sperm. The fertilised oocyte (zygote) is then transferred to the patient's uterus with the intent to establish a pregnancy. ICSI procedure is a variant of in vitro fertilisation in which a single spermatozoon is directly injected into the cytoplasm of an oocyte. Similarly to IVF, the successfully fertilised egg is then transferred to the uterus with the hope of embryo implantation and a positive pregnancy. Several studies have examined the relationship between sperm DNA damage and reproductive outcomes in both natural and ART pregnancies. Sperm DNA fragmentation has been associated with low natural, IUI and IVF pregnancy rates [141]. In contrast, no such results have been reported in the case of ICSI. No clear association between sperm DNA or chromatin defects and pregnancy rates following ICSI has been found [142]. However, studies relating sperm DNA quality with the risk of pregnancy loss have indicated that high levels of SDF are associated with an increased risk of miscarriage in couples undergoing IVF and/or ICSI [143].

Natural Conception Results from three studies show a negative impact of sperm DNA fragmentation on natural conception [131, 144, 145]. These studies demonstrated that, in the general New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

Sperm Chromatin Integrity, DNA Fragmentation and Male Fertility

71

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

population, the chance of natural pregnancy decreased when DFI exceeded 20-30%. In couples where the DFI was over 30%, the probability of pregnancy was significantly lower than couples with a DFI under 30%.

ART Conception Data from several studies have reported an association between sperm DNA damage and reduced IUI pregnancy rates [146-148]. According to these studies, couples with high levels of SDF should proceed to IVF and/or ICSI rather than IUI. In contrast, a study performed by Muriel et al. in 100 Spanish couples reported no correlation between DNA integrity and pregnancy outcome [149]. With regards to IVF, results from more than 20 studies demonstrate that SDF is associated with a modest but significant reduction in the IVF pregnancy rate [150-152]. Most of these studies identified thresholds of sperm DNA fragmentation over which the likelihood of pregnancy was significantly reduced. In the case of ICSI however, a recent review of the literature indicates that SDF is not related to pregnancy rates [141, 153, 154]. Data from the studies presented suggest that sperm DNA fragmentation is predictive of natural, IUI and IVF outcomes but is not clinically valuable in predicting ICSI outcomes. Interestingly, high levels of sperm DNA fragmentation have been linked to an enhanced risk of pregnancy loss following IVF/ICSI. Pregnancy loss refers to the spontaneous end of a pregnancy before the fetus has reached a viable gestational stage which usually corresponds to 20-22 weeks. SDF is associated with a significantly higher rate of pregnancy loss after IVF or ICSI [143, 154, 155]. Perhaps one of the main concerns associated with these results is whether the offspring originated from a successful pregnancy achieved with a DNA-damaged spermatozoon would have any negative long-term effects. The ASRM (American Society for Reproductive Medicine), published in 2006 and 2008 a series of guidelines on the clinical utility of sperm DNA damage evaluation. In these publications, ASRM stated that the existing data on the relationship between abnormal DNA integrity and reproductive outcomes are limited and hence routine DNA integrity testing in the evaluation of infertility is not recommended [156, 157]. The impact of SDF in reproduction and the clinical utility of its evaluation is still a very controversial topic. There is insufficient evidence to recommend routine DNA integrity testing in the clinical laboratory, however, it seems likely that specific conditions would benefit from such analysis. This is the case for couples with idiopathic infertility or recurrent pregnancy loss. Sperm DNA integrity testing may help understand the underlying basis of pregnancy loss and provide prognostic information regarding the couple´s potential risk of miscarriage following assisted reproduction treatment. In any case, larger, well-designed, prospective studies are certainly needed to elucidate the clinical significance of sperm chromatin defects and to confirm, clarify and expand the results obtained so far.

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

72

María Enciso and Dagan Wells

3. FUTURE PERSPECTIVES Despite the advances made during the last few years in the field of sperm chromatin and male fertility, clinical results are still debated. Key questions regarding fundamental aspects of sperm composition or function and of male infertility diagnosis and treatment remain to be answered. Future efforts should be directed to (i) increase the basic and applied research done in the field, (ii) standardize sperm DNA integrity tests to allow comparison of the results obtained in different labs, (iii) understand the importance of the extent and location of the damage and of the oocyte´s ability to repair it and, finally, (iv) initiate follow-up studies to explore the impact of sperm chromatin defects in the long-term health of the offspring.

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

Fundamental Research Is Essential Significant questions about the way the sperm nucleus is organised and the impact of this organisation on its function need to be answered. A detailed understanding of the process of packing and unpacking the DNA within the sperm nucleus taking place during spermatogenesis and fertilisation is also crucial. An improved insight into the kind of lesions that the different DNA damage evaluation methods are measuring would also be of help. We are now only at the beginning of our understanding of these aspects, further fundamental research is absolutely essential if we are to fully comprehend sperm physiology and its impact on reproduction. Standardization of the Methods for Sperm DNA Damage Evaluation Methods to assess sperm DNA integrity present clear differences in their protocols. Each of the techniques currently available has its own specificity and limitations. Although there have been studies reporting a moderate to high correlation between all these methods [117], it is still not clear what exactly is being measured by each test and hence there is a lack of standardization in the methods. This makes the comparison of results obtained by the different laboratories very difficult. Wide variations in sperm DNA fragmentation data obtained from different laboratories have been reported [118]. Standardized methods may allow comparison of results obtained by different labs and facilitate the correct interpretation of the data obtained. Questions Concerning Factors Influencing the Predictive Value of SDF Where is sperm DNA damage located? Is it affecting a coding or a non-coding regions? How does the oocyte recognize and repair the damage? What amount of DNA can be repaired by the oocyte? Is there a degree of damage beyond the oocyte´s ability to repair? These are crucial questions to answer if the predictive value of SDF is to be accurately defined [158]. No studies so far have addressed the issue of the location of sperm DNA damage in the male genome, all current publications have focused on the amount of damage more than the type and position of the sequences affected. This is an interesting research area. In contrast, a few recently published studies have shed some light into the oocyte’s ability to repair sperm DNA. Derrijck et al. [159] explored the fate of damaged sperm DNA when exposed to oocytes with different quality DNA-repair mechanisms. Their results indicate that the combination of DNA-damaged sperm and oocytes with suboptimal DNA repair mechanism favors reciprocal translocation induction in the paternal chromosome complement. Another

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

Sperm Chromatin Integrity, DNA Fragmentation and Male Fertility

73

study published in 2011 reported that the impact of sperm DNA fragmentation on pregnancy outcome following ART depends on oocyte quality [160]. These studies indicate that the impact of sperm DNA fragmentation on reproduction depends, on a variety of factors. The question of the impact of SDF should, thus, not be regarded as a male feature alone; instead it should be considered in combination with the female counterpart.

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

Long-Term Follow Up of ART Children Another important question still unanswered is whether sperm DNA damage has any impact on the health of children born trough ART. The increased use of ART and particularly ICSI has raised some concerns about the effect of bypassing natural biological barriers and of the impact of fertilisation with sperm containing DNA damage or other chromatin abnormalities that can be transmitted to the embryo. Animal studies have shown clear and strong associations between the presence of DNA damage in the paternal genome and embryo development, including negative effects on the health of the new born and subsequent generations [74, 161]. Although such studies have not been performed in humans, some findings pointing out similar results have been reported. Studies have related paternal smoking and sperm DNA damage being passed from the father to the offspring following ART [162]. An association between paternal smoking and increased risk of childhood cancer in the offspring has also been reported [163]. We cannot overlook the results of these studies as they provide links between DNA damage in sperm and negative effects in embryo development and/or offspring health. Long-term follow-up of children born through ART is required to ascertain the safety of the assisted reproduction procedures currently used [118].

REFERENCES [1] [2]

[3] [4]

[5]

[6] [7]

Ward, WS; Coffey, DS. DNA packaging and organization in mammalian spermatozoa: comparison with somatic cells. Biology of reproduction, 1991 Apr 44(4), 569-74. Miller, D; Brinkworth, M; Iles, D. Paternal DNA packaging in spermatozoa: more than the sum of its parts? DNA, histones, protamines and epigenetics. Reproduction, 2010 Feb 139(2), 287-301. Finch, JT; Lutter, LC; Rhodes, D; Brown, RS; Rushton, B; Levitt, M, et al. Structure of nucleosome core particles of chromatin. Nature, 1977 Sep 1 269(5623), 29-36. Finch, JT; Klug, A. Solenoidal model for superstructure in chromatin. Proceedings of the National Academy of Sciences of the United States of America, 1976 Jun 73(6), 1897-901. Pogany, GC; Corzett, M; Weston, S; Balhorn, R. DNA and protein content of mouse sperm. Implications regarding sperm chromatin structure. Experimental Cell Research, 1981 Nov 136(1), 127-36. Balhorn, R. A model for the structure of chromatin in mammalian sperm. The Journal of Cell Biology, 1982 May 93(2), 298-305. Balhorn, R. The protamine family of sperm nuclear proteins. Genome Biology, 2007 Sep 8(9), 227.

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

74 [8]

[9]

[10]

[11] [12]

[13]

[14] [15]

[16]

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

[17]

[18] [19]

[20]

[21] [22] [23] [24] [25]

María Enciso and Dagan Wells Ausio, J. Histone H1 and the evolution of the nuclear sperm-specific proteins. In: Jamieson BGM, Ausió J, Justine JL, editors. Advances in Spermatozoal Phylogeny and Taxonomy. Paris: Mémoires du Muséum National d’Histoire Naturelle; 1995; 447-62. Coelingh, JP; Monfoort, CH; Rozijn, TH; Leuven, JA; Schiphof, R; Steyn-Parve, EP, et al. The complete amino acid sequence of the basic nuclear protein of bull spermatozoa. Biochimica et Biophysica Acta, 1972 Nov 28 285(1), 1-14. Tobita, T; Suzuki, H; Soma, K; Nakano, M. Differential cleavages of disulfide crosslinks of protamines in boar sperm nuclei. Biochimica et Biophysica Acta, 1983 Nov 14 748(3), 461-4. Loir, M; Lanneau, M. An electrophoretic analysis of the basic nuclear proteins of ram spermatids. Experimental Cell Research, 1975 May 92(2), 509-12. Calvin, HI. Comparative analysis of the nuclear basic proteins in rat, human, guinea pig, mouse and rabbit spermatozoa. Biochim. Biophys. Acta, 1976 Jun 15 434(2), 37789. Golan, R; Cooper, TG; Oschry, Y; Oberpenning, F; Schulze, H; Shochat, L, et al. Changes in chromatin condensation of human spermatozoa during epididymal transit as determined by flow cytometry. Human Reproduction, 1996 Jul 11(7), 1457-62. Haidl, G. Epididymal maturation of human spermatozoa. Fortschritte Der Medizin, 1994 Dec 112(34), 492-5. Enciso, M; Johnston, SD; Gosalvez, J. Differential resistance of mammalian sperm chromatin to oxidative stress as assessed by a two-tailed comet assay. Reproduction Fertility and Development, 2011 May 23(5), 633-7. Retief, JD; Krajewski, C; Westerman, M; Winkfein, RJ; Dixon, GH. Molecular phylogeny and evolution of marsupial protamine P1 genes. Proceedings of the Royal Society - Biological Sciences, 1995 Jan 259(1354), 7-14. Retief, JD; Rees, JS; Westerman, M; Dixon, GH. Convergent evolution of cysteine residues in sperm protamines of one genus of marsupials, the Planigales. Molecular Biology and Evolution, 1995 Jul 12(4), 708-12. Cummins, JM. Decondensation of sperm nuclei of australian marsupials: Effects of air drying and of calcium and magnesium. Gamete Research, 1980 May 3(4), 351-67. Bennetts, LE; Aitken, RJ. A comparative study of oxidative DNA damage in mammalian spermatozoa. Molecular Reproduction and Development, 2005 May 71(1), 77-87. Bedford, JM. The coevolution of mammalian gametes. In: Dunbar BS, O´Rand MG, editors. A comparative overwiew of mammalian fertilization. New York: Plenum Press; 1991; 3-39. Wykes, SM; Krawetz, SA. The structural organization of sperm chromatin. The Journal of Biological Chemistry, 2003 Aug 8 278(32), 29471-7. Ward, WS. Function of sperm chromatin structural elements in fertilization and development. Molecular Human Reproduction, 2010 Jan 16(1), 30-6. Prieto, MC; Maki, AH; Balhorn, R. Analysis of DNA-protamine interactions by optical detection of magnetic resonance. Biochemistry, 1997 Sep 30 36(39), 11944-51. Risley, MS; Einheber, S; Bumcrot, DA. Changes in DNA topology during spermatogenesis. Chromosoma, 1986 Sept 94(3), 217-27. Ward, WS; Partin, AW; Coffey, DS. DNA loop domains in mammalian spermatozoa. Chromosoma, 1989 Sep 98(3), 153-9.

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

Sperm Chromatin Integrity, DNA Fragmentation and Male Fertility

75

[26] Sotolongo, B; Ward, WS. DNA loop domain organization: the three-dimensional genomic code. Journal of Cellular Biochemistry, 2000 Jan Suppl 35, 23-6. [27] Pienta, KJ; Coffey, DS. A structural analysis of the role of the nuclear matrix and DNA loops in the organization of the nucleus and chromosome. Journal of Cell Science, 1984 Dec 1, 123-35. [28] Hud, NV; Allen, MJ; Downing, KH; Lee, J; Balhorn, R. Identification of the elemental packing unit of DNA in mammalian sperm cells by atomic force microscopy. Biochemical and Biophysical Research Communications, 1993 Jun 193(3), 1347-54. [29] Hud, NV; Vilfan, ID. Toroidal DNA condensates: unraveling the fine structure and the role of nucleation in determining size. Annual Review of Biophysics and Biomolecular Structure, 2005 Jun 34, 295-318. [30] Tateno, H; Kimura, Y; Yanagimachi, R. Sonication per se is not as deleterious to sperm chromosomes as previously inferred. Biology of Reproduction, 2000 Jul 63(1), 341-6. [31] Sotolongo, B; Lino, E; Ward, WS. Ability of hamster spermatozoa to digest their own DNA. Biology of Reproduction, 2003 Dec 69(6), 2029-35. [32] Yamauchi, Y; Shaman, JA; Boaz, SM; Ward, WS. Paternal pronuclear DNA degradation is functionally linked to DNA replication in mouse oocytes. Biology of reproduction, 2007 Sep 77(3), 407-15. [33] Yamauchi, Y; Shaman, JA; Ward, WS. Topoisomerase II-mediated breaks in spermatozoa cause the specific degradation of paternal DNA in fertilized oocytes. Biology of reproduction, 2007 Apr 76(4), 666-72. [34] Mudrak, O; Chandra, R; Jones, E; Godfrey, E; Zalensky, A. Reorganisation of human sperm nuclear architecture during formation of pronuclei in a model system. Reproduction, Fertility, and Development, 2009 May 21(5), 665-71. [35] Bench, GS; Friz, AM; Corzett, MH; Morse, DH; Balhorn, R. DNA and total protamine masses in individual sperm from fertile mammalian subjects. Cytometry, 1996 Apr 23(4), 263-71. [36] Hammoud, SS; Nix, DA; Zhang, H; Purwar, J; Carrell, DT; Cairns, BR. Distinctive chromatin in human sperm packages genes for embryo development. Nature, 2009 Jul 460(7254), 473-8. [37] Arpanahi, A; Brinkworth, M; Iles, D; Krawetz, SA; Paradowska, A; Platts, AE, et al. Endonuclease-sensitive regions of human spermatozoal chromatin are highly enriched in promoter and CTCF binding sequences. Genome Research, 2009 Aug 19(8), 133849. [38] Gineitis, AA; Zalenskaya, IA; Yau, PM; Bradbury, EM; Zalensky, AO. Human sperm telomere-binding complex involves histone H2B and secures telomere membrane attachment. The Journal of Cell Biology, 2000 Dec 151(7), 1591-8. [39] Zalenskaya, IA; Bradbury, EM; Zalensky, AO. Chromatin structure of telomere domain in human sperm. Biochemical and Biophysical Research Communications, 2000 Dec 279(1), 213-8. [40] Pittoggi, C; Renzi, L; Zaccagnini, G; Cimini, D; Degrassi, F; Giordano, R, et al. A fraction of mouse sperm chromatin is organized in nucleosomal hypersensitive domains enriched in retroposon DNA. Journal of Cell Science, 1999 Oct 112(20), 3537-48. [41] Gardiner-Garden, M; Ballesteros, M; Gordon, M; Tam, PP. Histone- and protamineDNA association: conservation of different patterns within the beta-globin domain in human sperm. Molecular and Cellular Biology, 1998 Jun 18(6), 3350-6.

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

76

María Enciso and Dagan Wells

[42] Banerjee, S; Smallwood, A. Chromatin modification of imprinted H19 gene in mammalian spermatozoa. Molecular Reproduction and Development, 1998 Aug 50(4), 474-84. [43] Kopecny, V; Pavlok, A. Autoradiographic study of mouse spermatozoan arginine-rich nuclear protein in fertilization. Journal of Experimental Zoology, 1975 Jan 191(1), 8596. [44] Ajduk, A; Yamauchi, Y; Ward, MA. Sperm Chromatin Remodeling after Intracytoplasmic Sperm Injection Differs from That of In Vitro Fertilization. Biology of Reproduction, 2006 Sep 75(3), 442-51. [45] Hammoud, SS; Nix, DA; Hammoud, AO; Gibson, M; Cairns, BR; Carrell, DT. Genome-wide analysis identifies changes in histone retention and epigenetic modifications at developmental and imprinted gene loci in the sperm of infertile men. Human Reproduction, 2011 Sep 26(9), 2558-69. [46] van der Heijden, GW; Derijck, AA; Ramos, L; Giele, M; van der Vlag, J; de Boer, P. Transmission of modified nucleosomes from the mouse male germline to the zygote and subsequent remodeling of paternal chromatin. Developmetal Biology, 2006 Oct 298(2), 458-69. [47] van der Heijden, GW; Ramos, L; Baart, EB; van den Berg, IM; Derijck, AA; van der Vlag, J, et al. Sperm-derived histones contribute to zygotic chromatin in humans. BMC Developmental Biology, 2008 Mar 8, 34. [48] Kuretake, S; Kimura, Y; Hoshi, K; Yanagimachi, R. Fertilization and development of mouse oocytes injected with isolated sperm heads. Biology of Reproduction, 1996 Oct 55(4), 789-95. [49] De Iuliis, GN; Thomson, LK; Mitchell, LA; Finnie, JM; Koppers, AJ; Hedges, A, et al. DNA damage in human spermatozoa is highly correlated with the efficiency of chromatin remodeling and the formation of 8-hydroxy-2'-deoxyguanosine, a marker of oxidative stress. Biology of Reproduction, 2009 Sep 81(3), 517-24. [50] Churikov, D; Zalenskaya, IA; Zalensky, AO. Male germline-specific histones in mouse and man. Cytogenetic and Genome Research, 2004 Jan 105(2-4), 203-14. [51] Kistler, WS; Henriksen, K; Mali, P; Parvinen, M. Sequential expression of nucleoproteins during rat spermiogenesis. Experimental Cell Research, 1996 Jun 15 225(2), 374-81. [52] Steger, K; Klonisch, T; Gavenis, K; Drabent, B; Doenecke, D; Bergmann, M. Expression of mRNA and protein of nucleoproteins during human spermiogenesis. Molecular Human Reproduction, 1998 Oct 4(10), 939-45. [53] Pradeepa, MM; Rao, MR. Chromatin remodeling during mammalian spermatogenesis: role of testis specific histone variants and transition proteins. Society for Reproduction and Fertility, 2007 63, 1-10. [54] Pivot-Pajot, C; Caron, C; Govin, J; Vion, A; Rousseaux, S; Khochbin, S. Acetylationdependent chromatin reorganization by BRDT, a testis-specific bromodomaincontaining protein. Molecular and Cellular Biology, 2003 Aug 23(15), 5354-65. [55] Sims, RJ, 3rd; Nishioka, K; Reinberg, D. Histone lysine methylation: a signature for chromatin function. Trends in Genetics, 2003 Nov 19(11), 629-39. [56] Prigent, C; Dimitrov, S. Phosphorylation of serine 10 in histone H3, what for? Journal of Cell Science, 2003 Sep 116(Pt 18), 3677-85.

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

Sperm Chromatin Integrity, DNA Fragmentation and Male Fertility

77

[57] Boissonneault, G. Chromatin remodeling during spermiogenesis: a possible role for the transition proteins in DNA strand break repair. FEBS Letters, 2002 Mar 514(2-3), 1114. [58] Caron, N; Veilleux, S; Boissonneault, G. Stimulation of DNA repair by the spermatidal TP1 protein. Molecular Reproduction and Development, 2001 Apr 58(4), 437-43. [59] Chapman, JC; Michael, SD. Proposed mechanism for sperm chromatin condensation/decondensation in the male rat. Reproductive Biology and Endocrinology, 2003 Feb 1, 20. [60] Stack, SM; Brown, DB; Dewey, WC. Visualization of interphase chromosomes. Journal of Cell Science, 1977 Aug 26, 281-99. [61] Cremer, T; Cremer, C. Chromosome territories, nuclear architecture and gene regulation in mammalian cells. Nature Reviews Genetics, 2001 Apr 2(4), 292-301. [62] Haaf, T; Ward, DC. Higher order nuclear structure in mammalian sperm revealed by in situ hybridization and extended chromatin fibers. Experimental Cell Research, 1995 Aug 219(2), 604-11. [63] Zalensky, AO; Allen, MJ; Kobayashi, A; Zalenskaya, IA; Balhorn, R; Bradbury, EM. Well-defined genome architecture in the human sperm nucleus. Chromosoma, 1995 May 103(9), 577-90. [64] Hazzouri, M; Rousseaux, S; Mongelard, F; Usson, Y; Pelletier, R; Faure, AK, et al. Genome organization in the human sperm nucleus studied by FISH and confocal microscopy. Molecular Reproduction and Development, 2000 Mar 55(3), 307-15. [65] Zalenskaya, IA; Zalensky, AO. Non-random positioning of chromosomes in human sperm nuclei. Chromosome Research, 2004 12(2), 163-73. [66] Cremer, T; Cremer, M. Chromosome territories. Cold Spring Harbor Perspectives in Biology, 2010 Mar 2(3), a003889. [67] Greaves, IK; Rens, W; Ferguson-Smith, MA; Griffin, D; Marshall Graves, JA. Conservation of chromosome arrangement and position of the X in mammalian sperm suggests functional significance. Chromosome Research, 2003 Jul 11(5), 503-12. [68] Zalensky, A; Zalenskaya, I. Organization of chromosomes in spermatozoa: an additional layer of epigenetic information? Biochemical Society Transactions, 2007 Jun 35(3), 609-11. [69] Finch, KA; Fonseka, KG; Abogrein, A; Ioannou, D; Handyside, AH; Thornhill, AR, et al. Nuclear organization in human sperm: preliminary evidence for altered sex chromosome centromere position in infertile males. Human Reproduction, 2008 Jun 23(6), 1263-70. [70] Olszewska, M; Wiland, E; Kurpisz, M. Positioning of chromosome 15, 18, X and Y centromeres in sperm cells of fertile individuals and infertile patients with increased level of aneuploidy. Chromosome Research, 2008 16(6), 875-90. [71] Wiland, E; Zegalo, M; Kurpisz, M. Interindividual differences and alterations in the topology of chromosomes in human sperm nuclei of fertile donors and carriers of reciprocal translocations. Chromosome Research, 2008 Feb 16(2), 291-305. [72] Ahmadi, A; Ng, SC. Developmental capacity of damaged spermatozoa. Human Reproduction, 1999 Sep 14(9), 2279-85. [73] Zini, A; Boman, JM; Belzile, E; Ciampi, A. Sperm DNA damage is associated with an increased risk of pregnancy loss after IVF and ICSI: systematic review and metaanalysis. Human Reproduction, 2008 Dec 23(12), 2663-8.

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

78

María Enciso and Dagan Wells

[74] Fernández-González, R; Moreira, PN; Pérez-Crespo, M; Sánchez-Martín, M; Ramirez, MA; Pericuesta, E, et al. Long-term effects of mouse intracytoplasmic sperm injection with DNA-fragmented sperm on health and behavior of adult offspring. Biology of Reproduction, 2008 Apr 78(4), 761-72. [75] Gosálvez, J; López-Fernández, C; Fernández, JL; Gouraud, A; Holt, WV. Relationships between the dynamics of iatrogenic DNA damage and genomic design in mammalian spermatozoa from eleven species. Molecular Reproduction and Development, 2011 Dec 78(12), 951-61. [76] Saleh, RA; Agarwal, A; Nelson, DR; Nada, EA; El-Tonsy, MH; Alvarez, JG, et al. Increased sperm nuclear DNA damage in normozoospermic infertile men: a prospective study. Fertility and Sterility, 2002 Aug 78(2), 313-8. [77] Zini, A; Fischer, MA; Sharir, S; Shayegan, B; Phang, D; Jarvi, K. Prevalence of abnormal sperm DNA denaturation in fertile and infertile men. Urology, 2002 Dec 60(6), 1069-72. [78] Marcon, L; Boissonneault, G. Transient DNA strand breaks during mouse and human spermiogenesis new insights in stage specificity and link to chromatin remodeling. Biology of Reproduction, 2004 Apr 70(4), 910-8. [79] McPherson, S; Longo, FJ. Chromatin structure-function alterations during mammalian spermatogenesis: DNA nicking and repair in elongating spermatids. European Journal of Histochemistry, 1993 37(2), 109-28. [80] Oliva, R. Protamines and male infertility. Human Reproduction Update, 2006 Jul-Aug 12(4), 417-35. [81] Carrell, DT; Emery, BR; Hammoud, S. The aetiology of sperm protamine abnormalities and their potential impact on the sperm epigenome. International Journal of Andrology, 2008 Dec 31(6), 537-45. [82] Gorczyca, W; Traganos, F; Jesionowska, H; Darzynkiewicz, Z. Presence of DNA strand breaks and increased sensitivity of DNA in situ to denaturation in abnormal human sperm cells: analogy to apoptosis of somatic cells. Experimental Cell Research, 1993 Jul 207(1), 202-5. [83] Sakkas, D; Moffatt, O; Manicardi, GC; Mariethoz, E; Tarozzi, N; Bizzaro, D. Nature of DNA damage in ejaculated human spermatozoa and the possible involvement of apoptosis. Biology of Reproduction, 2002 Apr 66(4), 1061-7. [84] Kodama, H; Yamaguchi, R; Fukuda, J; Kasai, H; Tanaka, T. Increased oxidative deoxyribonucleic acid damage in the spermatozoa of infertile male patients. Fertility and Sterility, 1997 Sep 68(3), 519-24. [85] Aitken, RJ; Gordon, E; Harkiss, D; Twigg, JP; Milne, P; Jennings, Z, et al. Relative impact of oxidative stress on the functional competence and genomic integrity of human spermatozoa. Biology of Reproduction, 1998 Nov 59(5), 1037-46. [86] Manicardi, GC; Bianchi, PG; Pantano, S; Azzoni, P; Bizzaro, D; Bianchi, U, et al. Presence of endogenous nicks in DNA of ejaculated human spermatozoa and its relationship to chromomycin A3 accessibility. Biology of Reproduction, 1995 Apr 52(4), 864-7. [87] Ollero, M; Gil-Guzman, E; Lopez, MC; Sharma, RK; Agarwal, A; Larson, K, et al. Characterization of subsets of human spermatozoa at different stages of maturation: implications in the diagnosis and treatment of male infertility. Human Reproduction, 2001 Sep 16(9), 1912-21.

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

Sperm Chromatin Integrity, DNA Fragmentation and Male Fertility

79

[88] Simon, L; Castillo, J; Oliva, R; Lewis, SE. Relationships between human sperm protamines, DNA damage and assisted reproduction outcomes. Reproductive Biomedicine Online, 2011 Dec 23(6), 724-34. [89] Kerr, JF; Wyllie, AH; Currie, AR. Apoptosis: a basic biological phenomenon with wide-ranging implications in tissue kinetics. British Journal of Cancer, 1972 Aug 26(4), 239-57. [90] Nagata, S. Apoptotic DNA fragmentation. Exp. Cell Res., 2000 Apr 10 256(1), 12-8. [91] Billig, H; Chun, SY; Eisenhauer, K; Hsueh, AJ. Gonadal cell apoptosis: hormoneregulated cell demise. Human Reproduction Update, 1996 Mar-Apr 2(2), 103-17. [92] Sikka, SC; Rajasekaran, M; Hellstrom, WJ. Role of oxidative stress and antioxidants in male infertility. Jornal of Andrology, 1995 Nov-Dec 16(6), 464-8. [93] Agarwal, A; Saleh, RA. Role of oxidants in male infertility: rationale, significance, and treatment. Urologic Clinics of North America, 2002 Nov 29(4), 817-27. [94] Lopes, S; Jurisicova, A; Sun, JG; Casper, RF. Reactive oxygen species: potential cause for DNA fragmentation in human spermatozoa. Human Reproduction, 1998 Apr 13(4), 896-900. [95] Mahfouz, R; Sharma, R; Thiyagarajan, A; Kale, V; Gupta, S; Sabanegh, E, et al. Semen characteristics and sperm DNA fragmentation in infertile men with low and high levels of seminal reactive oxygen species. Fertility and Sterility, 2010 Nov 94(6), 2141-6. [96] Evenson, DP; Jost, LK; Corzett, M; Balhorn, R. Characteristics of human sperm chromatin structure following an episode of influenza and high fever: a case study. Journal of Andrology, 2000 Sep-Oct 21(5), 739-46. [97] Oliva, A; Spira, A; Multigner, L. Contribution of environmental factors to the risk of male infertility. Human Reproduction, 2001 Aug 16(8), 1768-76. [98] Morris, ID. Sperm DNA damage and cancer treatment. International Journal of Andrology, 2002 Oct 25(5), 255-61. [99] Evenson, DP; Wixon, R. Environmental toxicants cause sperm DNA fragmentation as detected by the Sperm Chromatin Structure Assay (SCSA). Toxicology and Applied Pharmacology, 2005 Sep 207(2 Suppl), 532-7. [100] Potts, RJ; Newbury, CJ; Smith, G; Notarianni, LJ; Jefferies, TM. Sperm chromatin damage associated with male smoking. Mutation Research, 1999 Jan 423(1-2), 103-11. [101] Wyrobek, AJ; Eskenazi, B; Young, S; Arnheim, N; Tiemann-Boege, I; Jabs, EW, et al. Advancing age has differential effects on DNA damage, chromatin integrity, gene mutations, and aneuploidies in sperm. Proceedings of the National Academy of Sciences of the United States of America, 2006 Jun 103(25), 9601-6. [102] Chavarro, JE; Toth, TL; Wright, DL; Meeker, JD; Hauser, R. Body mass index in relation to semen quality, sperm DNA integrity, and serum reproductive hormone levels among men attending an infertility clinic. Fertility and Sterility, 2010 May 93(7), 222231. [103] Aitken, RJ; De Iuliis, GN. On the possible origins of DNA damage in human spermatozoa. Molecular Human Reproduction, 2010 Jan 16(1), 3-13. [104] Evenson, D; Jost, L. Sperm chromatin structure assay: DNA denaturability. Methods in Cell Biology, 1994 42 Pt B, 159-76. [105] Gorczyca, W; Gong, J; Darzynkiewicz, Z. Detection of DNA strand breaks in individual apoptotic cells by the in situ terminal deoxynucleotidyl transferase and nick translation assays. Cancer Research, 1993 Apr 53(8), 1945-51.

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

80

María Enciso and Dagan Wells

[106] Ostling, O; Johanson, KJ. Microelectrophoretic study of radiation-induced DNA damages in individual mammalian cells. Biochemical and Biophysical Research Communications, 1984 Aug 123(1), 291-8. [107] Fernandez, JL; Muriel, L; Rivero, MT; Goyanes, V; Vazquez, R; Alvarez, JG. The sperm chromatin dispersion test: a simple method for the determination of sperm DNA fragmentation. Journal of Andrology, 2003 Jan-Feb 24(1), 59-66. [108] Evenson, DP; Darzynkiewicz, Z; Melamed, MR. Relation of mammalian sperm chromatin heterogeneity to fertility. Science, 1980 Dec 210(4474), 1131-3. [109] Mitsuaki, S; Keitaro, H; Kazuyuki, A. Kinetic studies of interaction between acridine orange and DNA. Biopolymers, 1971 10, 1003-12. [110] Kasten, FH. Cytochemical studies with acridine orange and the influence of dye contaminants in the staining of nucleic acids. International Review of Cytology, 1967 21, 141-202. [111] Gavrieli, Y; Sherman, Y; Ben-Sasson, SA. Identification of programmed cell death in situ via specific labeling of nuclear DNA fragmentation. Journal of Cell Biology, 1992 Nov 119(3), 493-501. [112] Olive, PL; Wlodek, D; Banath, JP. DNA double-strand breaks measured in individual cells subjected to gel electrophoresis. Cancer Research, 1991 Sep 51(17), 4671-6. [113] Singh, NP; McCoy, MT; Tice, RR; Schneider, EL. A simple technique for quantitation of low levels of DNA damage in individual cells. Experimental Cell Research, 1988 Mar 175(1), 184-91. [114] Enciso, M; Sarasa, J; Agarwal, A; Fernandez, JL; Gosalvez, J. A two-tailed Comet assay for assessing DNA damage in spermatozoa. Reproductive Biomedicine Online, 2009 May 18(5), 609-16. [115] Fernandez, JL; Muriel, L; Goyanes, V; Segrelles, E; Gosalvez, J; Enciso, M, et al. Simple determination of human sperm DNA fragmentation with an improved sperm chromatin dispersion test. Fertility and Sterility, 2005 Oct 84(4), 833-42. [116] Enciso, M; Lopez-Fernandez, C; Fernandez, JL; Garcia, P; Gosalbez, A; Gosalvez, J. A new method to analyze boar sperm DNA fragmentation under bright-field or fluorescence microscopy. Theriogenology, 2006 Jan 65(2), 308-16. [117] Chohan, KR; Griffin, JT; Lafromboise, M; De Jonge, CJ; Carrell, DT. Comparison of chromatin assays for DNA fragmentation evaluation in human sperm. Journal of Andrology, 2006 Jan-Feb 27(1), 53-9. [118] Barratt, CL; Aitken, RJ; Bjorndahl, L; Carrell, DT; de Boer, P; Kvist, U, et al. Sperm DNA: organization, protection and vulnerability: from basic science to clinical applications--a position report. Human Reproduction, 2010 Apr 25(4), 824-38. [119] Enciso, M; Pieczenik, G; Cohen, J; Wells, D. Development of a novel synthetic oligopeptide for the detection of DNA damage in human spermatozoa. Human Reproduction, 2012 in press. [120] Merrifield, B. Life during a Golden Age of peptide Chemistry-The Concept and Development of Solid-Phase Peptide Synthesis. Oxford: Oxford University Press; 2001. [121] Pasqualini, R; Ruoslahti, E. Organ targeting in vivo using phage display peptide libraries. Nature, 1996 Mar 380(6572), 364-6. [122] Pieczenik, G; Garrisi, J; Cohen, J. Inhibition of human spermatozoa-zona pellucida binding by a combinatorially derived peptide from a synthetic target. Reproductive Biomedicine Online, 2006 Sep 13(3), 361-7.

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

Sperm Chromatin Integrity, DNA Fragmentation and Male Fertility

81

[123] World Health Organization. Infertility: a tabulation of available data on prevalence of primary and secondary infertility. Geneva: WHO Press; 1991. [124] McLachlan, RI; de Kretser, DM. Male infertility: the case for continued research. Medical Journal of Australia, 2001 Feb 174(3), 116-7. [125] Ferlin, A; Arredi, B; Foresta, C. Genetic causes of male infertility. Reproductive Toxicology, 2006 Aug 22(2), 133-41. [126] World Health Organization. WHO Laboratory Manual for the Examination and processing of Human Semen. 5th ed. Geneva: WHO Press; 2010. [127] Lewis, SE. Is sperm evaluation useful in predicting human fertility? Reproduction, 2007 Jul 134(1), 31-40. [128] Acharyya, S; Kanjilal, S; Bhattacharyya, AK. Does human sperm nuclear DNA integrity affect embryo quality? Indian Journal of Experimental Biology, 2005 Nov 43(11), 1016-22. [129] Irvine, DS; Twigg, JP; Gordon, EL; Fulton, N; Milne, PA; Aitken, RJ. DNA integrity in human spermatozoa: relationships with semen quality. Journal of Andrology, 2000 JanFeb 21(1), 33-44. [130] Giwercman, A; Richthoff, J; Hjollund, H; Bonde, JP; Jepson, K; Frohm, B, et al. Correlation between sperm motility and sperm chromatin structure assay parameters. Fertility and Sterility, 2003 Dec 80(6), 1404-12. [131] Evenson, DP; Jost, LK; Marshall, D; Zinaman, MJ; Clegg, E; Purvis, K, et al. Utility of the sperm chromatin structure assay as a diagnostic and prognostic tool in the human fertility clinic. Human Reproduction, 1999 Apr 14(4), 1039-49. [132] Zini, A; Bielecki, R; Phang, D; Zenzes, MT. Correlations between two markers of sperm DNA integrity, DNA denaturation and DNA fragmentation, in fertile and infertile men. Fertility and Sterility, 2001 Apr 75(4), 674-7. [133] Enciso, M; Muriel, L; Fernandez, JL; Goyanes, V; Segrelles, E; Marcos, M, et al. Infertile men with varicocele show a high relative proportion of sperm cells with intense nuclear damage level, evidenced by the sperm chromatin dispersion test. Journal of Andrology, 2006 Jan-Feb 27(1), 106-11. [134] Gallegos, G; Ramos, B; Santiso, R; Goyanes, V; Gosalvez, J; Fernandez, JL. Sperm DNA fragmentation in infertile men with genitourinary infection by Chlamydia trachomatis and Mycoplasma. Fertility and Sterility, 2008 Aug 90(2), 328-34. [135] Stahl, O; Eberhard, J; Cavallin-Stahl, E; Jepson, K; Friberg, B; Tingsmark, C, et al. Sperm DNA integrity in cancer patients: the effect of disease and treatment. International Journal of Andrology, 2009 Dec 32(6), 695-703. [136] Perera, D; Pizzey, A; Campbell, A; Katz, M; Porter, J; Petrou, M, et al. Sperm DNA damage in potentially fertile homozygous beta-thalassaemia patients with iron overload. Human Reproduction, 2002 Jul 17(7), 1820-5. [137] Brackett, NL; Ibrahim, E; Grotas, JA; Aballa, TC; Lynne, CM. Higher sperm DNA damage in semen from men with spinal cord injuries compared with controls. Journal of Andrology, 2008 Jan-Feb 29(1), 93-9; discussion 100-1. [138] Agbaje, IM; McVicar, CM; Schock, BC; McClure, N; Atkinson, AB; Rogers, D, et al. Increased concentrations of the oxidative DNA adduct 7,8-dihydro-8-oxo-2deoxyguanosine in the germ-line of men with type 1 diabetes. Reproductive Biomedicine Online, 2008 Mar 16(3), 401-9.

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

82

María Enciso and Dagan Wells

[139] Nyboe Andersen, A; Goossens, V; Bhattacharya, S; Ferraretti, AP; Kupka, MS; de Mouzon, J, et al. Assisted reproductive technology and intrauterine inseminations in Europe, 2005: results generated from European registers by ESHRE. Human Reproduction, 2009 June 24(6), 1267-87. [140] Zegers-Hochschild, F; Adamson, GD; de Mouzon, J; Ishihara, O; Mansour, R; Nygren, K, et al. The International Committee for Monitoring Assisted Reproductive Technology (ICMART) and the World Health Organization (WHO) Revised Glossary on ART Terminology, 2009. Human Reproduction, 2009 Nov 24(11), 2683-7. [141] Collins, JA; Barnhart, KT; Schlegel, PN. Do sperm DNA integrity tests predict pregnancy with in vitro fertilization? Fertility and Sterility, 2008 Apr 89(4), 823-31. [142] Zini, A; Sigman, M. Are tests of sperm DNA damage clinically useful? Pros and cons. Journal of Andrology, 2009 May-Jun 30(3), 219-29. [143] Zini, A; Boman, JM; Belzile, E; Ciampi, A. Sperm DNA damage is associated with an increased risk of pregnancy loss after IVF and ICSI: systematic review and metaanalysis. Human Reproduction, 2008 Dec 23(12), 2663-8. [144] Spano, M; Bonde, JP; Hjollund, HI; Kolstad, HA; Cordelli, E; Leter, G. Sperm chromatin damage impairs human fertility. The Danish First Pregnancy Planner Study Team. Fertility and Sterility, 2000 Jan 73(1), 43-50. [145] Giwercman, A; Lindstedt, L; Larsson, M; Bungum, M; Spano, M; Levine, RJ, et al. Sperm chromatin structure assay as an independent predictor of fertility in vivo: a casecontrol study. International Journal of Andrology, 2010 Feb 33(1), e221-7. [146] Duran, EH; Morshedi, M; Taylor, S; Oehninger, S. Sperm DNA quality predicts intrauterine insemination outcome: a prospective cohort study. Human Reproduction, 2002 Dec 17(12), 3122-8. [147] Saleh, RA; Agarwal, A; Nada, EA; El-Tonsy, MH; Sharma, RK; Meyer, A, et al. Negative effects of increased sperm DNA damage in relation to seminal oxidative stress in men with idiopathic and male factor infertility. Fertility and Sterility, 2003 Jun 79(3), 1597-605. [148] Bungum, M; Humaidan, P; Axmon, A; Spano, M; Bungum, L; Erenpreiss, J, et al. Sperm DNA integrity assessment in prediction of assisted reproduction technology outcome. Human Reproduction, 2007 Jan 22(1), 174-9. [149] Muriel, L; Meseguer, M; Fernandez, JL; Alvarez, J; Remohi, J; Pellicer, A, et al. Value of the sperm chromatin dispersion test in predicting pregnancy outcome in intrauterine insemination: a blind prospective study. Human Reproduction, 2006 Mar 21(3), 738-44. [150] Boe-Hansen, GB; Fedder, J; Ersboll, AK; Christensen, P. The sperm chromatin structure assay as a diagnostic tool in the human fertility clinic. Human Reproduction, 2006 Jun 21(6), 1576-82. [151] Benchaib, M; Lornage, J; Mazoyer, C; Lejeune, H; Salle, B; Francois Guerin, J. Sperm deoxyribonucleic acid fragmentation as a prognostic indicator of assisted reproductive technology outcome. Fertility and Sterility, 2007 Jan 87(1), 93-100. [152] Frydman, N; Prisant, N; Hesters, L; Frydman, R; Tachdjian, G; Cohen-Bacrie, P, et al. Adequate ovarian follicular status does not prevent the decrease in pregnancy rates associated with high sperm DNA fragmentation. Fertility and Sterility, 2008 Jan 89(1), 92-7.

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

Sperm Chromatin Integrity, DNA Fragmentation and Male Fertility

83

[153] Gandini, L; Lombardo, F; Paoli, D; Caruso, F; Eleuteri, P; Leter, G, et al. Full-term pregnancies achieved with ICSI despite high levels of sperm chromatin damage. Human Reproduction, 2004 Jun 19(6), 1409-17. [154] Lin, MH; Kuo-Kuang Lee, R; Li, SH; Lu, CH; Sun, FJ; Hwu, YM. Sperm chromatin structure assay parameters are not related to fertilization rates, embryo quality, and pregnancy rates in in vitro fertilization and intracytoplasmic sperm injection, but might be related to spontaneous abortion rates. Fertility and Sterility, 2008 Aug 90(2), 352-9. [155] Zini, A; Meriano, J; Kader, K; Jarvi, K; Laskin, CA; Cadesky, K. Potential adverse effect of sperm DNA damage on embryo quality after ICSI. Human Reproduction, 2005 Dec 20(12), 3476-80. [156] The Practice Committee of the American Society for Reproductive Medicine. The clinical utility of sperm DNA integrity testing. Fertility and Sterility, 2006 Nov 86(5, Supplement), S35-S7. [157] The Practice Committee of the American Society for Reproductive Medicine. The clinical utility of sperm DNA integrity testing. Fertility and Sterility, Nov 2008 90, S178-S80. [158] Bungum, M. Sperm Chromatin and ART (IUI, IVF and ICSI) Pregnancy. In: Zini A, Agarwal A, editors. Sperm chromatin: Biological and Clinical Applications in Male Infertility and Assisted Reproduction. New York: Springer; 2011; 441-56. [159] Derijck, A; van der Heijden, G; Giele, M; Philippens, M; de Boer, P. DNA doublestrand break repair in parental chromatin of mouse zygotes, the first cell cycle as an origin of de novo mutation. Human Molecular Genetics, 2008 Jul 17(13), 1922-37. [160] Meseguer, M; Santiso, R; Garrido, N; Garcia-Herrero, S; Remohi, J; Fernandez, JL. Effect of sperm DNA fragmentation on pregnancy outcome depends on oocyte quality. Fertility and Sterility, 2011 Jan 95(1), 124-8. [161] Delbes, G; Hales, BF; Robaire, B. Toxicants and human sperm chromatin integrity. Molecular Human Reproduction, 2010 Jan 16(1), 14-22. [162] Zenzes, MT. Smoking and reproduction: gene damage to human gametes and embryos. Human Reproduction Update, 2000 Mar-Apr 6(2), 122-31. [163] Chang, JS; Selvin, S; Metayer, C; Crouse, V; Golembesky, A; Buffler, PA. Parental smoking and the risk of childhood leukemia. Americal Journal of Epidemiology, 2006 Jun 163(12), 1091-100.

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved. New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

In: New Developments in Chromatin Research Editors: Neil M. Simpson and Valerie J. Stewart

ISBN: 978-1-62081-816-9 © 2012 Nova Science Publishers, Inc.

Chapter 4

THE CHROMATIN STATE OF PLURIPOTENT STEM CELLS Mehdi Shafa and Derrick E. Rancourt Department of Biochemistry and Molecular Biology, University of Calgary, Calgary, AB, Canada

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

ABSTRACT Pluripotent stem cells (PSCs) including embryonic stem cells (ESCs) and induced pluripotent stem cells (iPSCs) can indefinitely self-renew and contribute to all tissue types of the adult organism. PSC-based therapeutic approaches hold enormous promise for the cure of regenerative diseases. In the past few years, several studies have attempted to decipher the important role of a core network of transcription factors and their cognate epigenetic regulatory signals in maintaining pluripotency, but the exact underlying mechanisms have yet to be identified. Among the epigenetic factors, chromatin function and structure have been found to contribute greatly to the maintenance of pluripotency and regulation of differentiation in PSCs. These modifications include: covalent histone modifications, histone bivalents and chromatin remodeling, and DNA methylation. Studies in ESCs have showed that genes associated with early development are arranged within a bivalent chromatin structure. This is thought to be a “poised yet repressed” situation, which can be activated upon differentiation. The breakthrough of iPSCs has opened a new era in stem cell biology. During reprogramming, the chromatin state of differentiated cells is reset to an embryonic form via a largely undetermined mechanism. Since epigenetic changes are key factors in human health and disease, there is hope that understanding the mechanism of stem cell epigenome regulation will aid in more effective treatment of human degenerative disorders in the near future. In this review, the fundamental impact of chromatin dynamics in ESCs as well as its critical role in the generation of iPSCs will be discussed.

Keywords: Embryonic Stem cell, induced Pluripotent Stem cell, Chromatin, Epigenetics



E-mail: [email protected]. Phone: (403) 220-2888. Fax: (403) 210-3949.

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

86

Mehdi Shafa and Derrick E. Rancourt

INTRODUCTION Mouse and human ESCs are usually derived from the inner cell mass (ICM) of the blastocyst [1, 2]. They have the capability to remain undifferentiated and proliferate indefinitely in vitro. ESCs also have the capacity to differentiate into all three embryonic germ layers, both in vivo and in vitro [1, 3]. Being pluripotent, they are a unique tool to inform us about the earliest molecular and cellular processes that regulate normal development. ESCs may also provide us a model to study the pathways involved in both pluripotency and self-renewal. Induced pluripotent stem cells (iPSCs) are another source of pluripotent stem cells (PSCs) that have been recently derived by forcing the expression of transcription factors regulating pluripotency [4, 5]. They share similar characteristics with ESCs, which make them an extraordinary cell source for therapeutic application and basic research. iPSCs also provide the potential of modeling human degenerative disorders and producing patient specific PSCs for tissue engineering and regenerative medicine. Recent insight into the mechanisms by which chromatin structure regulates ESC selfrenewal and differentiation, as well as somatic cell reprogramming, have had a major impact on our understanding of developmental biology. There is now a growing body of evidence, which shows the crucial role of epigenetic changes and chromatin remodeling factors in the activation or repression of genes during embryogenesis and in maintaining pluripotency within PSCs.

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

Regulation of Pluripotency in ESCs The significant characteristics of ESCs, including self-renewal, maintenance of pluripotency and differentiation to different adult lineages, necessitate the existence of specific molecular mechanisms during early development. The mechanism by which ESCs choose between pluripotency and differentiation seems to rely on specific molecular factors. Progression from the pluripotent state to a differentiated phenotype is usually accompanied by distinguished alterations in cellular function, which are predetermined by global gene expression patterns during early development. Importantly, the genes responsible for selfrenewal are down-regulated, while most of the lineage-specific genes are up-regulated. The regulatory mechanisms that control self-renewal are not yet fully understood; however the critical role of “core” transcription factors like Oct4, Sox2 and Nanog has been elucidated [6]. Oct4 and Nanog were found as key pluripotency regulators and are necessary for maintaining ESC self-renewal and its pluripotent state [7]. Oct4 makes a heterodimer with Sox2 in ESCs [8], thus placing Sox2 as an additional “elite” pluripotency factor along with others including Rex1, Dax1 and Tcl1. The core transcription factors act together to: 1) positively control their own expression, 2) activate the expression of other pluripotency factors essential for maintaining a stable ESC state, and 3) repress cell lineage-specific transcription factors. Proteomic and genetic screens demonstrate a regulated protein-protein network wherein the core factors are interacting with one another, with DNA, and with many other chromatin-related complexes. Until recently, most of the studies have focused on the transcriptional network and its regulation of ESC self renewal. However, several recent lines

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

The Chromatin State of Pluripotent Stem Cells

87

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

of evidence emphasize that ESC differentiation and early development largely rely on the flexibility of epigenetic modifications [9]. Epigenetic signatures also function to stabilize the identity of differentiated cells. Therefore, the mechanism of gene regulation during development is not only dependent upon a network of transcription factors, but also on epigenetic machineries, such as the covalent alterations of histones [10], ATP-dependent chromatin remodeling [11], exchange of histones and histone variants [12], cohesin/condensing protein complexes [13], DNA methylation at CpG islands [14], RNAmediated gene regulation including RNAi pathways and non-protein coding RNAs (ncRNA) [15, 16], all of which has been found to play fundamental roles in preserving pluripotency and blocking differentiation ( figure 1).

Regulation of gene expression largely relies on transcription factor circuitry and chromatin modifications. Different histone modifications occur as cells differentiate resulting in a transcriptionally less-permissive chromatin. Histone modifications (methylation (M), acetylation (A), ubiquitination (U), and phosphorylation (P)) have to be re-set as differentiated cells are reprogrammed to induced pluripotency. HAT: histone acetyl transferase, K4-HMT: histone lysine H3 (K) 4 methyl transferase, K9-HMT: histone lysine H3 (K) 9 methyl transferase, HDAC: histone deacetylase, K4-HDM: histone lysine H3 (K) 4 demethylase. Figure 1. Histone modifications during development and cellular reprogramming.

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

88

Mehdi Shafa and Derrick E. Rancourt

To better understand the mechanisms involved in the maintenance of pluripotency in ESCs, the regulation of epigenetic factors and their relation to pluripotency are discussed below.

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

Higher-order Chromatin Architecture in ESCs Plenty of evidence shows that the nucleus in eukaryotes has a distinct compartmentalized organization, which is important for proper genome function [17]. Genomes in higher organisms are non-randomly arranged inside the nucleus with each chromosome and the genes within it occupying specific regions in interphasic cells. Mammalian cells have distinguished nuclear sub-compartments, which are composed of specific proteins with definite transcriptional and RNA processing properties. This global architectural integrity is important for proper gene activity. This structure is mainly determined by chromosome territories (CTs) and interchromatin compartments (ICs) [18, 19]. Based upon this organizational composition, there is a three-dimensional network of various channels and cavities, which originate from the nuclear pores [20]. It is clear that genes may also be relocated towards their regulatory elements or other genes by corresponding chromosomal loops through distinctive spatial intra- and inter-chromosomal interactions [21]. This, in turn, may have an impact on gene silencing or expression in the eukaryotic genome. As part of the epigenetic mechanism, nuclear architecture and chromatin state play important roles in regulating gene expression in specialized eukaryotic cells. For a better understanding of higher order nuclear arrangements, it is crucial to compare this architecture between stem cells and their differentiated progeny. Although studies demonstrate nuclear rearrangements in differentiating cells, nuclear organization in stem cells, especially ESCs is lacking in detail. Several studies propose that nuclear structures experience huge morphological alterations during early differentiation, including the nucleolus and heterochromatin [22], nuclear speckles (domains enriched in splicing factors) [23], and nuclear lamina. It has been found that gene and chromosome activity has a direct relationship to their spatial positioning within the nucleus, which may undergo enormous changes during early differentiation [24, 25]. Wiblin et al. showed that human ESCs have a general chromosomal compartmentalization, but found that chromosomal regions and loci containing pluripotency genes such as Nanog and Oct4 have distinctive nuclear localization [26]. The Oct4 gene loops out to a position outside its CT, while clustered pluripotency genes on chromosome 12, such as Nanog, have a more central localization compared to fibroblasts. They concluded that human ESCs have a specific nuclear structure compared to differentiated cells. This emphasizes the idea that pluripotency may be regulated by global nuclear organization and vice versa. Recently, it has been revealed that there are major overall differences human ESC nucleo-architectural landscape including: nuclear envelope (NE) lamins, the size and shape of nuclei, and chromatin organizational components such as Promyelocytic Leukemia Bodies (PML NBs) [27]. Presently, it is unknown if transcriptional changes during differentiation induce these positional effects or whether higher-order chromatin composition is necessary to elicit this gene regulation. If nuclear reorganization is required for proper gene expression, then it may have a deterministic role in development, as cells commit to a defined lineage.

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

The Chromatin State of Pluripotent Stem Cells

89

More studies are needed to reveal the exact mechanism of gene regulation by higher chromatin organization in ESCs. To elucidate the role of nuclear three-dimensional (3D) architecture in maintaining pluripotency, different experimental approaches such as fluorescent in situ hybridization (FISH), immunostaining and advanced imaging approaches should be applied to compare nuclear compartmentalization of resting and differentiating ESCs. Identification of nuclear proteins involved in this reorganization during differentiation (and reprogramming) should be a priority.

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

Chromatin Structure in ESCs In eukaryotes, genomic DNA is organized into DNA/protein complexes known as chromatin. The fundamental unit of chromatin is the nucleosome, which consists of a family of small, basic proteins called histones. The nucleosome is comprised of two copies each of four histone proteins termed H2A, H2B, H3 and H4 with a ~146 base pair of DNA wound around its surface [28]. These bead-like core proteins are often associated with a 15-55bp sequence of linker DNA and a fifth histone, H1. Higher order chromatin structure is characterized by condensed heterochromatin and relatively extended euchromatin regions within the genome [29]. It has been believed that heterochromatin is transcriptionally inactive compared to euchromatin. However, many recent studies have cast doubt on the model of heterochromatin as being a transcriptionally silent part of chromatin. Some reports have shown that transcription of heterochromatin is essential for its own repression. In addition to a few protein-coding genes in heterochromatic regions [30, 31], RNAs expressed in telomeric and pericentric regions have been also reported in different species [32, 33]. Specific residues in the N-terminal tails of histones, which stick out from the nucleosome surface, are prone to numerous reversible post-translational modifications including acetylation, methylation, demethylation, ubiquinitation and phosphorylation [34]. These modifications are achieved via different chromatin modifying enzyme complexes with opposing functions, which are responsible for the dynamic behavior of chromatin. The “histone code” hypothesis is attributed to the different states of chromatin achieved by these modifying complexes [35]. Generally, regions of transcriptional activity are marked by lysine acetylation facilitated by histone acetyltranferases (HATs). Alternatively, histone deacetylases (HDACs), which mediate lysine deacetylation, are associated with regions of transcriptional inactivity. Global chromatin dynamism is also of interest in ESCs, as recent studies emphasize its crucial role in maintaining pluripotency and gene regulation [36]. Several studies indicate that ESCs are characterized by open chromatin and greater transcriptional activity compared to differentiated cells and the ratio of euchromatin to heterochromatin is higher than somatic cells [37]. As differentiation advances, chromatin assumes a repressed and inactive state [38]. For instance, during differentiation ESCs accumulate highly compacted heterochromatin in the pericentric regions of some chromosomes, which is not observed in pluripotency [26, 39]. Similarly, the size, number, and distribution of highly condensed heterochromatin foci are altered during ESC neural differentiation [40, 41]. Another important determinant of gene expression in ESCs is histone and DNA methylation. DNA methylation takes place at the 5’ site of the cytosine nucleotide of CpG

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

90

Mehdi Shafa and Derrick E. Rancourt

regions. However, non-CpG methylation like in CpT and CpA motifs can also occur in ESCs through methytransferase 3a [42]. Although DNA methylation at promoter regions inversely correlates with gene activity, this inverse relationship is dependent upon the amount of CpG motifs within promoters. Furthermore, there is no obvious correlation between gene activity and methylation in promoters without distinct CpG content [43]. Methylated CpG islands are found within promoters of certain tissue-specific genes [44], but they are not found within other regions of the genome. DNA methylation patterns are directed and conserved by the DNA methyl transferase (DNMT) family, while the effects of DNA methylation are mediated by methyl-CpG-binding domain (MBD) family, which recognize DNA sequences with high CpG content [45]. There is strong evidence that the DNA methylation pattern in differentiated cells is persistent and heritable. Cells gain this pattern gradually as they move towards their specific lineage during early development. As the zygote divides, paternal and maternal forms of methylation are removed via down-regulation of Dnmt1 gene expression within the nucleus [46]. This is followed by re-establishment of a new DNA methylation pattern during embryogenesis and germ layer formation. During this period, the epigenome status of ESCs inside the ICM is restored to redefine pluripotency. The role of different DNMTs in mouse ESCs has been elucidated using homozygous mutants. Dnmt1-/- ESCs can multiply when cultured as undifferentiated cells, indicating the hypomethylated state can maintain self-renewal. These ESCs retain their ability to express pluripotency markers such as Oct4 and Nanog upon differentiation. It is believed that the Xist-mediated X chromosome inactivation causes an increase in apoptosis in differentiated Dnmt mutant ESCs [47]. Evidence has shown that the CpG motif within the Oct4 promoter is highly methylated in different somatic cells, but not in pluripotent ESCs. Down-regulation of Oct4 and Nanog expression during differentiation of NT2 cells, a neuronally committed human teratocarcinoma cell line, is related to methylation of 5’-flanking regions of both these genes [48]. ESCs have the potential ability to dictate their pluripotent epigenetic status to differentiated cells upon fusion. For example, when terminally differentiated cells are fused with ESCs, resulting heterokaryons adopt the pluripotent state [49]. It has been believed that lineage-specific cells lose this capacity to reverse the epigenetic status of other nuclei; this capacity is largely restricted to early embryonic cells including ESCs. However, in a recent study by Zhang et al. skeletal muscle cells were found to have the instruction to reprogram the epigenetic structure of epidermal keratinocyte cells by targeting active regions of CpG methylation and demethylation within heterokaryons [50]. A recent study on Xist gene in fusion hybrids further supported this result [51].

Chromatin Bivalency in ESCs Several lines of evidence have shown that histone methylation is mediated by several protein complexes. The significant role of thrithorax and polycomb (PcG) multiprotein complexes in lineage specific gene regulation has been demonstrated by several studies in Drosophila. Thrithorax proteins act to control gene expression through regulation of chromatin activity by catalyzing or interacting with H3K4 methylation (H3K4me3). Other members of this family can initiate ATP-dependent chromatin remodeling. Polycomb proteins

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

The Chromatin State of Pluripotent Stem Cells

91

(PcG) have the opposite effect, repressing gene activity by controlling trimethylation of lysine 27 at histone H3 (H3K27me3) and inducing a silent state of gene expression. PcG proteins repress many developmental and signaling genes by mediating methylation of H3K27. Two major PcG complexes, including PRC1 and PRC2, have been found to facilitate gene silencing in mammals. Both H3K27me3 and H3K27me2 methylation is mediated by PRC2 through its Ezh2, Suz12 and EeD subunits [52, 53]. PRC2 is proposed to be responsible for gene suppression by ubiquitination of H2A at lysine 119 leading to induction of chromatin compaction [54]. In 2006, two studies suggested that PcG protein complexes play a regulatory role in maintaining ESC pluripotency [55-57]. PcG gene function is important for both mouse development and ESC self-renewal, as no lines can be derived from Ezh2 deficient mice [58]. The PcG repressor complex targets a number of developmentally important genes in ESCs [59, 60]. Interestingly, a significant number of these sites are also occupied by Oct4, Nanog and Sox2 [59]. This is somehow confusing, since it appears that the promoters of these early developmental regulatory genes are governed by activators and repressors at the same time. This may indicate that ESCs control their chromatin structure by an uncommon and complex mechanism compared to somatic cells. Recent studies suggest that ESCs employ a novel and unusual mechanism for controlling gene expression of lineage specific genes, which is silent in pluripotent ESCs, but may be expressed upon differentiation. Recently, a “histone bivalent” model (active and inactive histone modifications) has been proposed for ESCs. According to this model, some lineage specific genes are simultaneously marked with both repressive and active modifications. Using a quantitative sequential chromatin immune-precipitation (ChIP) approach in mouse ESCs, Azuara et al. found that several important silent developmental genes such as Pax3, Irx3, Sox1 and Nkx2.2 were simultaneously enriched by suppressive modifications (H3K27me3) and activating marks (H3K4me3 and H3K9ac3) in their promoters at the same time [55]. This group also demonstrated that ESCs defective in the Eed-dependent methytransferase enzyme, expressed lineage-specific genes. They concluded that H3K27 methylation in ESCs helps maintain pluripotency and suppress developmental gene expression. Bernstein et al. confirmed this bivalent model by showing that promoter regions of lineage-control genes including POU, Pax, Sox and Hox are marked by both repressing (H3K27me3) and activating (H3K4me3) modifications [56]. They demonstrated that these opposite histone modifications occur at the same chromosomal sites within the same ESC population. They also found that most of these unusual bivalent patterns of histone modification were erased upon ESC differentiation into neural progenitor cells. Specifically, the neural specific genes remained active (H3K4me3), and lost their repressing (H3K27me) histone modifications. Conversely, silent pluripotent genes maintained the repressor mark (H3K27me3), while losing the activator (H3K4me3) modification. They concluded that key developmental-control genes are present in a “primed or poised status” in ESCs as defined by opposite combinations of histone alterations. Other studies revealed that this conflicting histone pattern can also be found at later stages in development, suggesting that specialized cells are able to gain some characteristics of ESCs [61, 62]. The number of bivalent domains in ESCs is about 2000-3000 genes, whereas fewer domains are observed in differentiated cells [63-65]. These studies postulate that this chromatin state might, in part, be responsible for ESC pluripotency since this

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

92

Mehdi Shafa and Derrick E. Rancourt

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

modification down-regulates the expression of genes in ESCs due to the dominant effect of H3K27me3 over H3K4me3. In comparison to differentiated cells, lineage-specific genes are kept silent by chromatin modification, but may be poised for subsequent rapid induction, as ESCs choose between embryonic lineages. This bivalent model supports the notion that ESC pluripotency and self-renewal is maintained by the activity of differentiation genes, which are in a silent but poised state. Histone demethylases may also play a crucial role in ESC epigenetics and pluripotency. Only recently has the exact mechanism of histone demethylation been elucidated [34, 66, 67]. Several studies have demonstrated specific H3K27 tri-methylation removal by two enzyme families: jumonji (JMJD) and UTX [61, 68, 69]. These two groups have the opposite functions in affecting gene expression within PcG complexes and are important in early development and differentiation. Jmjd1a and Jmjd2c genes, which are responsible for H3K9me2 and H3K9me3 demethylation are up-regulated by Oct4. Expression of ESC specific genes increases upon depletion of either Jmjd1a or Jmjd2c, while a corresponding decrease in lineage-specific gene expression occurs. Up-regulation of Nanog, a key pluripotency factor in ESCs is also induced by Jmjd2a, whereas Jmjd1a acts by demethylating of H3K9me2 at the promoter region of Tc11, Zfp57 and Tcfcp211, among others [70]. Overall, histone demethylases play an important role in self-renewal and pluripotency. They are an important part of the ESC transcriptional network coordinating the transcription circuitry to chromatin structure during early development, and later within tissue specific differentiation. Recently, a new role for the histone proteolysis during ESC differentiation has also been suggested as a potential mechanism of bivalent chromatin structure. Duncan et al showed that the cleavage of the histone H3 N-terminal by Cathepsin L occurs during mouse ESC differentiation and acts as an epigenetic modifier. This cleavage is further regulated positively and negatively by covalent modifications on the histone H3 tail [71].

ATP-Dependent Chromatin Remodeling ESCs are rich in euchromatin, having a more diffused heterochromatin. This chromatin state undergoes structural remodeling toward a highly condensed and compact heterochromatin form during differentiation. This switch from a lower to a higher order chromatin state is mediated by several categories of chromatin remodeling protein complexes. Either the remodeling enzymes have the ability to alter the N-terminal characteristics of histones by adding or removing acetyl, methyl, ubiquitin and sumo groups or the remodeling proteins are composed of ATP-dependent enzymes which use energy to transiently separate the association between DNA and histones. These modifications, in turn, may induce a conformational change in nucleosome and chromatin condensation state. This kind of ATPmediated remodeling provides an accessible DNA, which is more prone to gene activation or repression by the transcriptional apparatus [72]. One example of these enzymes in mammals is the SWI/SNF (switch/sucrose non fermentable) protein complex, which is composed of several different subunits such as snf2. Consistent with the notion of structural chromatin remodeling during differentiation, different ATP-dependent chromatin remodeling enzymes are highly expressed in mouse ESCs and are down-regulated after LIF removal [73]. Several studies have demonstrated the important role

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

The Chromatin State of Pluripotent Stem Cells

93

of ATP-mediated chromatin remodeling during the development of pluripotent cells and differentiation [74]. In fact, the SWI/SNF complex collaborates with a variety of differentiation regulators to intimately control a number of cellular differentiation events that occur in mammals [75]. A number of studies have indicated that null mice lacking remodeling proteins SNF2H [76], BRG1 [77], SNF5 [78] or SSRP [79] die before implantation. Importantly, in all cases, fatality happens during the blastocyst stage; suggesting that these proteins may play a critical role in orchestrating epigenetic modifications. The mechanism by which ATP-dependent chromatin remodeling proteins modify their target is not very well understood and requires further investigation. Furthermore, the mechanism by which ESC pluripotency is regulated by SWI/SNF proteins is not clear. In one study, Gao et al. demonstrated that the SWI/SNF chromatin remodeling component, BAF250, is necessary for ESC pluripotency and lineage differentiation [80]. Dysfunction of BAF250b decreases expression of pluripotency factors and up-regulates lineage markers such as Gata2. In mouse ESCs, the chromatin-remodeling enzyme complex NuRD, plays a prominent role in differentiation [81]. This complex has the ability to remodel the nucleosome and to affect histone deacetylation. In some instances, these proteins are capable of interacting with other chromatin enzymes to activate or suppress genes through generation of a “histone code” in the genome [82]. In other studies, nucleosome sliding and eviction has been proposed for chromatin remodeling, which is also mediated by SWI/SNF complex [83, 84]. The exact mechanism for the reciprocal interactions of these remodeling proteins and their role in chromatin remodeling and displacement requires further investigation. Indeed, elucidating their role in histone acetylation and deacetylation may also shed light on how ESCs regulate their self-renewal as well as differentiation.

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

Histone Variants and Exchange of Histones An interesting characteristic of chromatin is the existence of chromatin variants. In addition to the four conserved histone proteins (H2A, H2B, H3 and H4), several other replacement variants for H2A (H2A.X, H2A.Z, H2A-Bbd, MacroH2A) and H3 (H3.1, H3.2, H3.3, CenpA) have been identified. Unlike core histones, these variants are transcribed from a polyA mRNA and their assembly into chromatin is regulated independently of DNA replication. The vast majority of the histone variants are found at specific developmental periods and at defined chromatin structures. MacroH2A is found at the inactive Xchromosome [85] and functions like a repressor variant [86]. H2A.Z protects euchromatin from the ectopic spread of silent heterochromatin by mediating stabilization of the nucleosome [87]. Histone H2A-Bbd has the opposite effect of destabilizing the nucleosome complex. Some studies emphasize the role of histone variants in regulating ESC differentiation. For example, H2A.Z is highly expressed in human embryonic carcinoma cell lines, but its expression is down-regulated in differentiated cells [88]. In ESCs Tip60-p400, a chromatin remodeling protein, functions as a transcriptional enhancer by adding the H2A.Z to target promoters [89]. It can be hypothesized that H2A.Z may help ESCs to maintain their open chromatin state, which is indispensable for pluripotency. To test the hypothesis, it is crucial to understand how different histone variants like H2A.Z localize to target genes in ESCs and

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

94

Mehdi Shafa and Derrick E. Rancourt

how they may contribute to the expression or suppression of specific genes during ESCs selfrenewal and differentiation. Meshorer et al. investigated the exchange rate of various chromatin proteins in mouse ESCs and their differentiated progeny using fluorescent recovery after photobleaching (FRAP) [41]. They found that the histone structure in ESCs is highly dynamic in that different histone variants interact with chromatin transiently and rapidly from a few seconds to a few minutes. They also demonstrated that a large number of specific histone variants (25%) attach loosely to chromatin in ESCs, as compared to differentiated cells. Recently, Ng and Gurdon confirmed the significant role of histone H3.3 variants in cellular memory in Xenopus [90]. They provide evidence that the epigenetic memory of a transcriptionally active state is dependent upon histone H3.3 in chromatin. So, DNA methylation is not the only mechanism involved in cellular memory. This new discovery may explain how ESCs can transmit their identity to their daughter cells after division, thereby preserving self-renewal. These results have given rise to the hyperdynamic (“breathing”) theory of chromatin structure in ESCs. Chromatin hyperdynamics is a unique characteristic of ESCs and is important in maintaining ESC self-renewal and pluripotency, as differentiated and nonpluripotent cells do not exhibit this property [41]. This poised chromatin architecture, which is partly based on histone variants, allows ESCs to rapidly differentiate into any cell type of the body.

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

Role of Chromatin in iPSC Generation In 2007, a milestone was achieved by artificially creating pluripotent stem cells from human adult somatic cells. In two independent studies led by Thomson and Yamanaka, ESlike cells called “induced pluripotent stem (iPS) cells” were generated from adult human somatic cells by viral transduction of four defined pluripotency transcription factor genes [4, 91]. Yamanaka’s group used Oct4, Klf4, c-Myc and Sox2, while Thomson’s group applied Nanog and Lin28 instead of c-Myc and Klf4. These iPSCs morphologically resemble ESCs; they express cell surface markers characteristic of ESCs, have a normal karyotype, express telomerase and demonstrate multi-lineage differentiation in both embryoid bodies and teratomas. Since 2007, the field has expanded to generate iPSCs from various mouse and human somatic cells using different approaches, as well as using various forms of gene transformation and protein transduction [92-97]. Several lines of evidence emphasize the importance of epigenetic marks during the generation of iPSCs and the concomitant reversal of cell fate [98, 99]. It has been postulated that cell destiny can be reset through alteration of lineage–limited epigenetic patterns such as histone acetylation/methylation and DNA methylation. Experimental data suggests that mouse derived-iPSCs have the ability to acquire the chromatin signature of pluripotent ESCs and can be transmitted through the germline [100]. The role of each reprogramming factor has been investigated in more detail since the initial iPSC studies. Although, the application of Oct4 and Sox2 are indispensible for iPSC generation, c-Myc and Klf4 significantly increase the efficiency. Due to large differences in epigenetic status between ESCs and their differentiated progeny, Oct4 and Sox2 cannot find their targets in somatic cells. It has been proposed that c-Myc and Klf4 gene networks alter

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

The Chromatin State of Pluripotent Stem Cells

95

the structure of chromatin, enabling these two core factors access to their targets, and thereby increasing the expression of downstream pluripotency genes [5]. For example, among the four Yamanaka factors, c-Myc is a well-characterized oncogene transcription activator and a modulator of DNA replication. It has been shown that c-Myc induces the up-regulation of Gcn5 (Histone acetyl transferase gene), which is a key player in histone structure, and therefore might improve the accessibility of target genes to Oct4. Klf4 is also acetylated by p300 (acetyl transferase protein) and has the ability to control gene transcription through regulation of histone acetylation [101]. These results are in agreement with the open chromatin theory of ESC self-renewal and pluripotency. Using cDNA microarray and ChIP approaches, it has been proposed that Oct4 regulates the expression of over 350 genes in ESCs including several epigenetic modifiers [102]. As mentioned earlier, two histone demethylases, Jmjd1a and Jmjd2c have been identified to be part of the groups of the genes regulated by Oct4 [70]. This study also confirmed that Jmdj2c is recruited to the Nanog promoter (a key component of the ESC transcriptional network) and demonstrated that upon depletion of Jmdj2c subsequent differentiation could only be rescued by ectopic expression of Nanog. These results clearly show that Oct4 both directly and indirectly controls genes required for maintaining the open, accessible chromatin state required for self-renewal and pluripotency. They also suggest a positive feedback loop between transcriptional circuitry and epigenetic modification. In this way, ESC transcription factors regulate the expression of chromatin remodeling genes and, in turn, help to unveil chromatin conformation in promoter regions of target genes allowing for self-regulation of the epigenetic network. The reactivation of randomly silenced X chromosome during cellular reprogramming demonstrates another clue about the direct involvement of reprogramming factors (Oct4, Sox2, Klf4 and C-Myc) in chromatin modifications. Following the introduction of pluripotency factors in female mouse cells, the epigenetic imprint of inactive X chromosomes is erased; hence the derived iPSCs are similar to the pluripotent inner cell mass of female blastocysts (XaXa pattern). Induction of differentiation of these iPSCs triggers random inactivation of paternal and maternal X chromosome (XCI) [103]. It has been reported that the Xi reactivation occurs during the late stages of reprogramming, when the pluripotency circuitry is activated. This shows a close relationship between pluripotency state and XaXa, since the pluripotency factors suppress expression of the large non-coding RNA Xist [104].

Epigenetic Regulation during iPSC Generation In 1942, Waddington first mentioned “epigenetics” to describe how genetic interactions may contribute to phenotype. It’s important to emphasize that the definition of a gene as a unit of heredity had not been identified yet in the 1940s. He later proposed his famous “epigenetic landscape” model in 1957 by comparing the early developmental differentiation with a ball travelling down a canal which starts from a fertilized totipotent embryo and ends up as different lineage-committed cells. According to this developmental concept, cells move through different one-way branched valleys inside the canal and select their ultimate irreversible cellular fates during this trip [105]. As they reach the end of each valley (lineage), they are obliged to stay in that valley and cannot jump over boundaries into other branches or return to their starting point. With regard to iPSC generation, it has been suggested that the

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

96

Mehdi Shafa and Derrick E. Rancourt

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

four reprogramming transcription factors push cells backward in this canal by removing specific epigenetic hurdles, which under normal conditions stabilize cells in their differentiated status/valley [106]. Based on Waddington’s epigenetic model, Yamanaka proposed a stochastic model for iPSC generation (Figure 2). This model is based on a concept, which is the exact opposite of that proposed by Waddington. Specifically, cells experience four different events during reprogramming.

The model proposed by Yamanaka [106] is based on the Waddington model. (A) Reprogrammed cells may encounter four possible scenarios. One group of cells is blocked by epigenetic barriers and begins self-renewal. (B) Other cells are trapped inside a semi-reprogrammed state due to inefficient epigenetic modification and travel back down their valley in the absence of ectopic expression of pluripotency factors. (C) Some cells may move to other neighboring valleys and transdifferentiate into other cell types, due to inefficient expression of reprogramming factors. (D) The final group experience apoptosis or cellular senescence. Figure 2. The stochastic model for iPSC generation.

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

The Chromatin State of Pluripotent Stem Cells

97

As they are rolling back the slope toward pluripotency, some cells are prevented from moving back up the slope by some epigenetic bump and hence they will have the ability to self-renew. The second group of cells will be partially reprogrammed and without continuous expression of exogenous factors, they lose their pluripotency and roll back towards a specific lineage. The third group may trans-differentiate due to insufficient and improper expression of ectopic factors. The fourth group doesn’t begin to travel but instead undergoes apoptosis or cellular senescence. According to this scenario and based on a stochastic view of ESCs, any gene or molecule, which has the capability to facilitate this movement up the slope and prevent the cell from rolling back would enhance the derivation of iPSCs. The endogenous loci of all reprogramming factors are heavily methylated in somatic cells, yet are hypomethylated in ESCs and iPSCs [107]. For iPSC derivation, all of these promoters need to be reactivated by demethylation enzymes. Since the factors used in direct reprogramming do not have known demethylating activity, this event requires other downstream activated epigenetic modifiers. Based on CpG methylation differences between lineage-specific cells and ESCs, one group demonstrated an essential role for CpG methylation as an epigenetic modifier in iPSC generation. Doi et al found that CpG methylation can discriminate iPSCs, ESCs and fibroblasts. They suggested that epigenetic reprogramming involves the same differentially methylated regions (DMRs) of CpG island “shores” that mark normal differentiation [108]. It has been also revealed that specific loci in iPSCs remain semi-reprogrammed, which means that the methylation pattern of iPSCs differs from ESCs. Another obstacle toward iPSC generation is the requirement for histone modification and remodeling during reprogramming. Although, it has been shown that histone H4 within the promoters of reprogramming genes is deacetylated in somatic cells, it is hyperacetylated in iPSCs and ESCs. Several studies indicate that the H3 and H4 histones within the Oct4 and Nanog promoters are hyperacetylated [109, 110]. Among the four factors, only c-Myc has the ability to modify chromatin. It mediates chromatin modification by increasing the expression of Gcn5, recruiting it for the modification of target genes [111]. Another factor in the derivation of iPSCs is the state of histone methylation. ESCs and iPSCs are tagged by activator histone modifications, which are marked by H3K4me3 and demethylation of lysine 9 within pluripotency genes. These two histone modifications show the bivalent chromatin characteristics of pluripotent genes, which are accomplished by simultaneous methylation at H3K27me3 and H3K4me3. For efficient generation of iPSCs, it is required that this histone modification be achieved either through genetic approaches or with the aid of some small molecules. Reflecting on the role of chromatin remodeling during reprogramming, researchers have recently applied small molecules to circumvent these epigenetic blocks and enhance the generation of iPSCs. Several different chemical inhibitors for histone deacetylases, as well as DNA and histone methyltransferases have been used in combination with genetic factors [112, 113] (Table 1). Kubicek et al. found a small-molecule inhibitor of G9a histone methyltransferase, BIX-01294, could enhance the induction of reprogramming in neural stem cells, while replacing Oct4 [114].

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

98

Mehdi Shafa and Derrick E. Rancourt Table 1. Chemicals with epigenetic modification properties used to enhance iPSC generation Name RG-108

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

BIX-01294

Function DNA methyl transferase inhibitor G9 histone methyl transferase inhibitor

VPA

Histone deacetylase inhibitor

SAHA

Histone deacetylase inhibitor

Trichostatin-A

Histone deacetylase inhibitor

5-azacytidine

Methyl transferase inhibitor

Parnate

lysine-specific demethylase 1

Effects Promote MEFs reprogramming Reprogramming of neural progenitor cells and MEFs Enhanced reprogramming of mouse and human fibroblasts Enhances reprogramming of mouse fibroblasts Enhances reprogramming of mouse fibroblasts Enhanced reprogramming of mouse fibroblasts Promote the reprogramming of human keratinocytes

Reference [136] [115, 136]

[115, 136]

[113]

[113]

[113, 137]

[138]

Since G9a is a down-regulator of Oct4 during early development, they suggested that BIX-01294 enhances iPSC formation by inhibiting G9a and subsequently releasing Oct4 from negative regulation. This group also generated iPSCs from mouse embryonic fibroblasts (MEFs) with only two factors; Oct4 and Klf4 in the presence of BIX-01294. Interestingly, valproic acid (VPA) increased the efficiency and kinetics of reprogramming by 100-fold in a four factor system. VPA could also replace either Klf4 or c-Myc in reprogramming and enabled iPSC generation with only Oct4 and Sox2 from human fibroblasts [115]. These results imply that DNA methylation, histone methylation and histone deacetylation contribute to epigenetic hurdles, which have to be overcome for successful iPSC generation. An important insight into the epigenetic regulation during iPSC generation comes from the recent studies that, although iPSCs are highly similar to ESCs, there are some transcriptional differences between ESCs and iPSCs [116, 117]. Mouse and human iPSCs appear to keep a chromatin state and DNA methylation memory from their original ancestor cells [118-120]. These observations showed that the difference in transcriptional profile is more prominent during early passages of iPSCs and with serial passaging using chromatinmodifying drugs; it becomes more similar to their ESCs counterparts, suggesting that the some sort of epigenetic changes happens even after the establishment of pluripotency. The epigenetic memory in iPSCs is believed to be mediated by chromatin modifications and DNA methylation, suggesting the crucial impact of epigenetic changes on chromatin re-opening

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

The Chromatin State of Pluripotent Stem Cells

99

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

during cellular reprogramming. Elucidating the exact mechanism of chromatin changes and cellular memory will shed light not only on the process of iPSC derivation but also on cellular differentiation during early development. The carcinogenic capacity of undifferentiated pluripotent cells such as ESCs and iPSCs remains a challenging hurdle toward their clinical cell-replacement therapy. Recently, an alternative roadmap to direct cell lineage conversion has been developed that can circumvent the possibility of tumor formation upon transplantation. The idea of reprogramming across various lineages may provide a variety of immunologically matched cells directly from patients. In this approach, one type of mature differentiated somatic cell such as a fibroblast is directly transformed into another cell type without passing through the fully pluripotent iPSC state. Successful trans-differentiation of mouse and human somatic cells has been reported for different types of cells including cardiomyocytes [121, 122], neurons [123, 124], dopaminergic neurons [125, 126], spinal motor neurons [127, 128], blood progenitors [129], chondrogenic [130, 131], EpiSC [132] and hepatocytes [133, 134]. The mechanism of direct reprogramming relies largely on the chromatin remodeling factors. Ectopic expression of transcription factors probably function to induce a developmentally more open chromatin state and act upstream of chromatin modification elements to activate repressed genes in a silent chromatin [135]. The insufficient expression of reprogramming factors or the expression of lineage-specific transcription factors may remove the epigenetic hurdles, and hence assist cells to trans-differentiate between developmentally distinct lineages. The technique of direct dedifferentiation appears to be easier than the iPSC derivation process and can therefore shorten the reprogramming period. Direct cell fate conversion also reduces the number of required factors and hence may contribute to the production of safer reprogrammed cells.

CONCLUSION Early development and ESC differentiation involve complex interactions between different transcription factors and epigenetic modifications, such as histone modifying proteins and chromatin remodeling enzymes. Based on what is currently known about this interplay, it seems that chromatin dynamics is one of the most critical determinants for maintaining ESC pluripotency and self-renewal. iPSC generation has resulted in a paradigm shift in cell biology. However, this breakthrough has raised numerous questions about the exact mechanism of reprogramming and the role of epigenetics. Currently, there is uncertainty regarding the epigenetic status of cells during the iPSC procedure. For example, do iPSCs have any “memory” of their original epigenetic state? If so, is this memory beneficial or harmful for future clinical applications? Advancements in understanding the role of epigenetic barriers will definitely move this field toward establishing simpler and more efficient methods. If we can change the epigenetic status of somatic cells without interfering with their genetic unity, we will be one step closer toward the clinical application of these cells in the near future.

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

100

Mehdi Shafa and Derrick E. Rancourt

REFERENCES [1] [2] [3] [4] [5]

[6] [7] [8] [9] [10] [11]

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

[12] [13]

[14] [15] [16] [17] [18] [19]

[20]

Thomson, J.A., et al., Embryonic stem cell lines derived from human blastocysts. Science, 1998. 282(5391): p. 1145-7. Evans, M.J. and M.H. Kaufman, Establishment in culture of pluripotential cells from mouse embryos. Nature, 1981. 292(5819): p. 154-6. Reubinoff, B.E., et al., Embryonic stem cell lines from human blastocysts: somatic differentiation in vitro. Nat. Biotechnol., 2000. 18(4): p. 399-404. Takahashi, K., et al., Induction of pluripotent stem cells from adult human fibroblasts by defined factors. Cell, 2007. 131(5): p. 861-72. Takahashi, K. and S. Yamanaka, Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors. Cell, 2006. 126(4): p. 66376. Silva, J. and A. Smith, Capturing pluripotency. Cell, 2008. 132(4): p. 532-6. Chambers, I. and A. Smith, Self-renewal of teratocarcinoma and embryonic stem cells. Oncogene, 2004. 23(43): p. 7150-60. Masui, S., et al., Pluripotency governed by Sox2 via regulation of Oct3/4 expression in mouse embryonic stem cells. Nat. Cell Biol., 2007. 9(6): p. 625-35. Reik, W., Stability and flexibility of epigenetic gene regulation in mammalian development. Nature, 2007. 447(7143): p. 425-32. Iizuka, M. and M.M. Smith, Functional consequences of histone modifications. Curr. Opin. Genet. Dev., 2003. 13(2): p. 154-60. Lusser, A. and J.T. Kadonaga, Chromatin remodeling by ATP-dependent molecular machines. Bioessays, 2003. 25(12): p. 1192-200. Ahmad, K. and S. Henikoff, Histone H3 variants specify modes of chromatin assembly. Proc. Natl. Acad. Sci. U S A, 2002. 99 Suppl 4: p. 16477-84. Fazzio, T.G. and B. Panning, Condensin complexes regulate mitotic progression and interphase chromatin structure in embryonic stem cells. Journal of Cell Biology, 2010. 188(4): p. 491-503. Bird, A.P. and A.P. Wolffe, Methylation-induced repression--belts, braces, and chromatin. Cell, 1999. 99(5): p. 451-4. Almeida, R. and R.C. Allshire, RNA silencing and genome regulation. Trends in Cell Biology, 2005. 15(5): p. 251-258. Bartel, D.P., MicroRNAs: Genomics, biogenesis, mechanism, and function. Cell, 2004. 116(2): p. 281-297. Francastel, C., et al., Nuclear compartmentalization and gene activity. Nat. Rev. Mol. Cell Biol., 2000. 1(2): p. 137-43. Cremer, T. and C. Cremer, Chromosome territories, nuclear architecture and gene regulation in mammalian cells. Nat. Rev. Genet., 2001. 2(4): p. 292-301. Cremer, T., et al., Chromosome territories, interchromatin domain compartment, and nuclear matrix: an integrated view of the functional nuclear architecture. Crit. Rev. Eukaryot. Gene Expr., 2000. 10(2): p. 179-212. Cremer, T., et al., Higher order chromatin architecture in the cell nucleus: on the way from structure to function. Biol. Cell., 2004. 96(8): p. 555-67.

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

The Chromatin State of Pluripotent Stem Cells

101

[21] Branco, M.R. and A. Pombo, Intermingling of chromosome territories in interphase suggests role in translocations and transcription-dependent associations. PLoS Biol., 2006. 4(5): p. e138. [22] Park, S.H., et al., Ultrastructure of human embryonic stem cells and spontaneous and retinoic acid-induced differentiating cells. Ultrastruct. Pathol., 2004. 28(4): p. 229-38. [23] Constantinescu, D., et al., Lamin A/C expression is a marker of mouse and human embryonic stem cell differentiation. Stem Cells, 2006. 24(1): p. 177-85. [24] Kim, S.H., et al., Spatial genome organization during T-cell differentiation. Cytogenet. Genome. Res., 2004. 105(2-4): p. 292-301. [25] Marshall, W.F., Gene expression and nuclear architecture during development and differentiation. Mech. Dev., 2003. 120(11): p. 1217-30. [26] Wiblin, A.E., et al., Distinctive nuclear organisation of centromeres and regions involved in pluripotency in human embryonic stem cells. J. Cell Sci., 2005. 118(Pt 17): p. 3861-8. [27] Butler, J.T., et al., Changing nuclear landscape and unique PML structures during early epigenetic transitions of human embryonic stem cells. J. Cell Biochem., 2009. 107(4): p. 609-21. [28] Luger, K., et al., Crystal structure of the nucleosome core particle at 2.8 A resolution. Nature, 1997. 389(6648): p. 251-60. [29] Horn, P.J. and C.L. Peterson, Heterochromatin assembly: a new twist on an old model. Chromosome Res., 2006. 14(1): p. 83-94. [30] Yasuhara, J.C. and B.T. Wakimoto, Oxymoron no more: the expanding world of heterochromatic genes. Trends Genet., 2006. 22(6): p. 330-8. [31] Smith, C.D., et al., The Release 5.1 annotation of Drosophila melanogaster heterochromatin. Science, 2007. 316(5831): p. 1586-91. [32] Pezer, Z. and D. Ugarkovic, RNA Pol II promotes transcription of centromeric satellite DNA in beetles. PLoS One, 2008. 3(2): p. e1594. [33] Li, F., et al., Nuclear non-coding RNAs are transcribed from the centromeres of Plasmodium falciparum and are associated with centromeric chromatin. J. Biol. Chem., 2008. 283(9): p. 5692-8. [34] Kouzarides, T., Chromatin modifications and their function. Cell, 2007. 128(4): p. 693705. [35] Jenuwein, T. and C.D. Allis, Translating the histone code. Science, 2001. 293(5532): p. 1074-80. [36] Boyer, L.A., D. Mathur, and R. Jaenisch, Molecular control of pluripotency. Curr. Opin. Genet. Dev., 2006. 16(5): p. 455-62. [37] Gaspar-Maia, A., et al., Open chromatin in pluripotency and reprogramming. Nat. Rev. Mol. Cell Biol., 2011. 12(1): p. 36-47. [38] Kashyap, V., et al., Regulation of stem cell pluripotency and differentiation involves a mutual regulatory circuit of the NANOG, OCT4, and SOX2 pluripotency transcription factors with polycomb repressive complexes and stem cell microRNAs. Stem Cells Dev., 2009. 18(7): p. 1093-108. [39] Williams, R.R., et al., Neural induction promotes large-scale chromatin reorganisation of the Mash1 locus. J. Cell Sci., 2006. 119(Pt 1): p. 132-40. [40] Meshorer, E. and T. Misteli, Chromatin in pluripotent embryonic stem cells and differentiation. Nat. Rev. Mol. Cell Biol., 2006. 7(7): p. 540-6.

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

102

Mehdi Shafa and Derrick E. Rancourt

[41] Meshorer, E., et al., Hyperdynamic plasticity of chromatin proteins in pluripotent embryonic stem cells. Dev. Cell, 2006. 10(1): p. 105-16. [42] Ramsahoye, B.H., et al., Non-CpG methylation is prevalent in embryonic stem cells and may be mediated by DNA methyltransferase 3a. Proc. Natl. Acad. Sci. U S A, 2000. 97(10): p. 5237-42. [43] Weber, M., et al., Distribution, silencing potential and evolutionary impact of promoter DNA methylation in the human genome. Nat. Genet., 2007. 39(4): p. 457-66. [44] Suzuki, Y., et al., Identification and characterization of the potential promoter regions of 1031 kinds of human genes. Genome Res., 2001. 11(5): p. 677-84. [45] Hendrich, B. and S. Tweedie, The methyl-CpG binding domain and the evolving role of DNA methylation in animals. Trends Genet., 2003. 19(5): p. 269-77. [46] Reik, W., W. Dean, and J. Walter, Epigenetic reprogramming in mammalian development. Science, 2001. 293(5532): p. 1089-93. [47] Jackson, M., et al., Severe global DNA hypomethylation blocks differentiation and induces histone hyperacetylation in embryonic stem cells. Mol. Cell Biol., 2004. 24(20): p. 8862-71. [48] Deb-Rinker, P., et al., Sequential DNA methylation of the Nanog and Oct-4 upstream regions in human NT2 cells during neuronal differentiation. J. Bio. Chem., 2005. 280(8): p. 6257-60. [49] Do, J.T., D.W. Han, and H.R. Scholer, Reprogramming somatic gene activity by fusion with pluripotent cells. Stem Cell Rev., 2006. 2(4): p. 257-64. [50] Zhang, F., et al., Active tissue-specific DNA demethylation conferred by somatic cell nuclei in stable heterokaryons. Proc. Natl. Acad. Sci. U S A, 2007. 104(11): p. 4395400. [51] Do, J.T., et al., Reprogramming of Xist against the pluripotent state in fusion hybrids. J. Cell Sci., 2009. 122(Pt 22): p. 4122-9. [52] Schuettengruber, B., et al., Genome regulation by polycomb and trithorax proteins. Cell, 2007. 128(4): p. 735-45. [53] Kirmizis, A., et al., Silencing of human polycomb target genes is associated with methylation of histone H3 Lys 27. Genes Dev., 2004. 18(13): p. 1592-605. [54] Wang, H., et al., Role of histone H2A ubiquitination in Polycomb silencing. Nature, 2004. 431(7010): p. 873-8. [55] Azuara, V., et al., Chromatin signatures of pluripotent cell lines. Nat. Cell Biol., 2006. 8(5): p. 532-8. [56] Bernstein, B.E., et al., A bivalent chromatin structure marks key developmental genes in embryonic stem cells. Cell, 2006. 125(2): p. 315-26. [57] Jorgensen, H.F., et al., Stem cells primed for action: polycomb repressive complexes restrain the expression of lineage-specific regulators in embryonic stem cells. Cell Cycle, 2006. 5(13): p. 1411-4. [58] O'Carroll, D., et al., The polycomb-group gene Ezh2 is required for early mouse development. Mol. Cell Biol., 2001. 21(13): p. 4330-6. [59] Lee, T.I., et al., Control of developmental regulators by Polycomb in human embryonic stem cells. Cell, 2006. 125(2): p. 301-13. [60] Boyer, L.A., et al., Polycomb complexes repress developmental regulators in murine embryonic stem cells. Nature, 2006. 441(7091): p. 349-53.

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

The Chromatin State of Pluripotent Stem Cells

103

[61] De Santa, F., et al., The histone H3 lysine-27 demethylase Jmjd3 links inflammation to inhibition of polycomb-mediated gene silencing. Cell, 2007. 130(6): p. 1083-94. [62] Roh, T.Y., et al., The genomic landscape of histone modifications in human T cells. Proc. Natl. Acad. Sci. U S A, 2006. 103(43): p. 15782-7. [63] Mikkelsen, T.S., et al., Genome-wide maps of chromatin state in pluripotent and lineage-committed cells. Nature, 2007. 448(7153): p. 553-60. [64] Pan, G., et al., Whole-genome analysis of histone H3 lysine 4 and lysine 27 methylation in human embryonic stem cells. Cell Stem Cell, 2007. 1(3): p. 299-312. [65] Barski, A., et al., High-resolution profiling of histone methylations in the human genome. Cell, 2007. 129(4): p. 823-37. [66] Shi, Y. and J.R. Whetstine, Dynamic regulation of histone lysine methylation by demethylases. Mol. Cell, 2007. 25(1): p. 1-14. [67] Seward, D.J., et al., Demethylation of trimethylated histone H3 Lys4 in vivo by JARID1 JmjC proteins. Nat. Struct. Mol. Biol., 2007. 14(3): p. 240-2. [68] Agger, K., et al., UTX and JMJD3 are histone H3K27 demethylases involved in HOX gene regulation and development. Nature, 2007. 449(7163): p. 731-4. [69] Lee, M.G., et al., Demethylation of H3K27 regulates polycomb recruitment and H2A ubiquitination. Science, 2007. 318(5849): p. 447-50. [70] Loh, Y.H., et al., Jmjd1a and Jmjd2c histone H3 Lys 9 demethylases regulate selfrenewal in embryonic stem cells. Genes Dev., 2007. 21(20): p. 2545-57. [71] Duncan, E.M., et al., Cathepsin L proteolytically processes histone H3 during mouse embryonic stem cell differentiation. Cell, 2008. 135(2): p. 284-94. [72] Sif, S., ATP-dependent nucleosome remodeling complexes: enzymes tailored to deal with chromatin. J. Cell Biochem., 2004. 91(6): p. 1087-98. [73] Kurisaki, A., et al., Chromatin-related proteins in pluripotent mouse embryonic stem cells are downregulated after removal of leukemia inhibitory factor. Biochem. Biophys. Res. Commun., 2005. 335(3): p. 667-75. [74] Kaji, K., J. Nichols, and B. Hendrich, Mbd3, a component of the NuRD co-repressor complex, is required for development of pluripotent cells. Development, 2007. 134(6): p. 1123-32. [75] de la Serna, I.L., Y. Ohkawa, and A.N. Imbalzano, Chromatin remodelling in mammalian differentiation: lessons from ATP-dependent remodellers. Nat. Rev. Genet., 2006. 7(6): p. 461-73. [76] Stopka, T. and A.I. Skoultchi, The ISWI ATPase Snf2h is required for early mouse development. Proc. Natl. Acad. Sci. U S A, 2003. 100(24): p. 14097-102. [77] Bultman, S., et al., A Brg1 null mutation in the mouse reveals functional differences among mammalian SWI/SNF complexes. Mol. Cell, 2000. 6(6): p. 1287-95. [78] Klochendler-Yeivin, A., et al., The murine SNF5/INI1 chromatin remodeling factor is essential for embryonic development and tumor suppression. EMBO Rep., 2000. 1(6): p. 500-6. [79] Cao, S., et al., The high-mobility-group box protein SSRP1/T160 is essential for cell viability in day 3.5 mouse embryos. Mol. Cell Biol., 2003. 23(15): p. 5301-7. [80] Gao, X., et al., ES cell pluripotency and germ-layer formation require the SWI/SNF chromatin remodeling component BAF250a. Proc. Natl. Acad. Sci. U S A, 2008. 105(18): p. 6656-61.

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

104

Mehdi Shafa and Derrick E. Rancourt

[81] Kaji, K., et al., The NuRD component Mbd3 is required for pluripotency of embryonic stem cells. Nat. Cell Biol., 2006. 8(3): p. 285-92. [82] Blossey, R., Regulating chromatin: on code and dynamic models. Eur Phys J. E. Soft Matter, 2006. 19(3): p. 371-3. [83] Li, B., M. Carey, and J.L. Workman, The role of chromatin during transcription. Cell, 2007. 128(4): p. 707-19. [84] Gutierrez, J.L., et al., Activation domains drive nucleosome eviction by SWI/SNF. Embo J., 2007. 26(3): p. 730-40. [85] Csankovszki, G., et al., Conditional deletion of Xist disrupts histone macroH2A localization but not maintenance of X inactivation. Nat. Genet., 1999. 22(4): p. 323-4. [86] Angelov, D., et al., The histone variant macroH2A interferes with transcription factor binding and SWI/SNF nucleosome remodeling. Mol. Cell, 2003. 11(4): p. 1033-41. [87] Meneghini, M.D., M. Wu, and H.D. Madhani, Conserved histone variant H2A.Z protects euchromatin from the ectopic spread of silent heterochromatin. Cell, 2003. 112(5): p. 725-36. [88] Hatch, C.L. and W.M. Bonner, An upstream region of the H2AZ gene promoter modulates promoter activity in different cell types. Biochim. Biophys. Acta., 1996. 1305(1-2): p. 59-62. [89] Squatrito, M., C. Gorrini, and B. Amati, Tip60 in DNA damage response and growth control: many tricks in one HAT. Trends Cell Biol., 2006. 16(9): p. 433-42. [90] Ng, R.K. and J.B. Gurdon, Epigenetic memory of an active gene state depends on histone H3.3 incorporation into chromatin in the absence of transcription. Nat. Cell Biol., 2008. 10(1): p. 102-9. [91] Yu, J., et al., Induced pluripotent stem cell lines derived from human somatic cells. Science, 2007. 318(5858): p. 1917-20. [92] Stadtfeld, M., et al., Induced pluripotent stem cells generated without viral integration. Science, 2008. 322(5903): p. 945-9. [93] Okita, K., et al., Generation of mouse induced pluripotent stem cells without viral vectors. Science, 2008. 322(5903): p. 949-53. [94] Soldner, F., et al., Parkinson's disease patient-derived induced pluripotent stem cells free of viral reprogramming factors. Cell, 2009. 136(5): p. 964-77. [95] Kaji, K., et al., Virus-free induction of pluripotency and subsequent excision of reprogramming factors. Nature, 2009. [96] Woltjen, K., et al., piggyBac transposition reprograms fibroblasts to induced pluripotent stem cells. Nature, 2009. [97] Zhou, H., et al., Generation of induced pluripotent stem cells using recombinant proteins. Cell Stem Cell, 2009. 4(5): p. 381-4. [98] Zaehres, H. and H.R. Scholer, Induction of pluripotency: from mouse to human. Cell, 2007. 131(5): p. 834-5. [99] Rodriguez, R.T., et al., Manipulation of OCT4 levels in human embryonic stem cells results in induction of differential cell types. Exp. Biol. Med. (Maywood), 2007. 232(10): p. 1368-80. [100] Okita, K., T. Ichisaka, and S. Yamanaka, Generation of germline-competent induced pluripotent stem cells. Nature, 2007. 448(7151): p. 313-7.

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

The Chromatin State of Pluripotent Stem Cells

105

[101] Evans, P.M., et al., Kruppel-like factor 4 is acetylated by p300 and regulates gene transcription via modulation of histone acetylation. J. Biol. Chem., 2007. 282(47): p. 33994-4002. [102] Matoba, R., et al., Dissecting Oct3/4-regulated gene networks in embryonic stem cells by expression profiling. PLoS One, 2006. 1: p. e26. [103] Maherali, N., et al., Directly reprogrammed fibroblasts show global epigenetic remodeling and widespread tissue contribution. Cell Stem Cell, 2007. 1(1): p. 55-70. [104] Navarro, P., et al., Molecular coupling of Xist regulation and pluripotency. Science, 2008. 321(5896): p. 1693-5. [105] Waddington, C., The strategy of the genes.1957, london: Allen and Unwin. [106] Yamanaka, S., Elite and stochastic models for induced pluripotent stem cell generation. Nature, 2009. 460(7251): p. 49-52. [107] Imamura, M., et al., Transcriptional repression and DNA hypermethylation of a small set of ES cell marker genes in male germline stem cells. BMC Dev. Biol., 2006. 6: p. 34. [108] Doi, A., et al., Differential methylation of tissue- and cancer-specific CpG island shores distinguishes human induced pluripotent stem cells, embryonic stem cells and fibroblasts. Nat. Genet., 2009. 41(12): p. 1350-3. [109] Hattori, N., et al., Epigenetic control of mouse Oct-4 gene expression in embryonic stem cells and trophoblast stem cells. J. Biol. Chem., 2004. 279(17): p. 17063-9. [110] Kimura, H., et al., Histone code modifications on pluripotential nuclei of reprogrammed somatic cells. Mol Cell Biol, 2004. 24(13): p. 5710-20. [111] Knoepfler, P.S., et al., Myc influences global chromatin structure. Embo J., 2006. 25(12): p. 2723-34. [112] Shi, Y., et al., A combined chemical and genetic approach for the generation of induced pluripotent stem cells. Cell Stem Cell, 2008. 2(6): p. 525-8. [113] Huangfu, D., et al., Induction of pluripotent stem cells by defined factors is greatly improved by small-molecule compounds. Nat. Biotechnol., 2008. 26(7): p. 795-7. [114] Kubicek, S., et al., Reversal of H3K9me2 by a small-molecule inhibitor for the G9a histone methyltransferase. Mol. Cell, 2007. 25(3): p. 473-81. [115] Huangfu, D., et al., Induction of pluripotent stem cells from primary human fibroblasts with only Oct4 and Sox2. Nat. Biotechnol., 2008. 26(11): p. 1269-75. [116] Chin, M.H., et al., Induced pluripotent stem cells and embryonic stem cells are distinguished by gene expression signatures. Cell Stem Cell, 2009. 5(1): p. 111-23. [117] Chin, M.H., et al., Molecular analyses of human induced pluripotent stem cells and embryonic stem cells. Cell Stem Cell, 2010. 7(2): p. 263-9. [118] Bar-Nur, O., et al., Epigenetic memory and preferential lineage-specific differentiation in induced pluripotent stem cells derived from human pancreatic islet beta cells. Cell Stem Cell, 2011. 9(1): p. 17-23. [119] Jandial, R. and M.L. Levy, Cellular alchemy: induced pluripotent stem cells retain epigenetic memory. World Neurosurg., 2011. 75(1): p. 5-6. [120] Kim, K., et al., Epigenetic memory in induced pluripotent stem cells. Nature, 2010. 467(7313): p. 285-90. [121] Efe, J.A., et al., Conversion of mouse fibroblasts into cardiomyocytes using a direct reprogramming strategy. Nature Cell Biology, 2011. 13(3): p. 215-U61.

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

106

Mehdi Shafa and Derrick E. Rancourt

[122] Ieda, M., et al., Direct reprogramming of fibroblasts into functional cardiomyocytes by defined factors. Cell, 2010. 142(3): p. 375-86. [123] Ambasudhan, R., et al., Direct reprogramming of adult human fibroblasts to functional neurons under defined conditions. Cell Stem Cell, 2011. 9(2): p. 113-8. [124] Pfisterer, U., et al., Efficient induction of functional neurons from adult human fibroblasts. Cell Cycle, 2011. 10(19): p. 3311-6. [125] Pfisterer, U., et al., Direct conversion of human fibroblasts to dopaminergic neurons. Proc. Natl. Acad. Sci. U S A, 2011. 108(25): p. 10343-8. [126] Caiazzo, M., et al., Direct generation of functional dopaminergic neurons from mouse and human fibroblasts. Nature, 2011. 476(7359): p. 224-7. [127] Son, E.Y., et al., Conversion of mouse and human fibroblasts into functional spinal motor neurons. Cell Stem Cell, 2011. 9(3): p. 205-18. [128] Berry, N., D.B. Gursel, and J.A. Boockvar, Direct conversion of human fibroblasts to functional neurons in one step. Neurosurgery, 2011. 69(6): p. N18. [129] Szabo, E., et al., Direct conversion of human fibroblasts to multilineage blood progenitors. Nature, 2010. 468(7323): p. 521-6. [130] Outani, H., et al., Induction of chondrogenic cells from dermal fibroblast culture by defined factors does not involve a pluripotent state. Biochem. Biophys. Res. Commun., 2011. 411(3): p. 607-12. [131] Hiramatsu, K., et al., Generation of hyaline cartilaginous tissue from mouse adult dermal fibroblast culture by defined factors. J. Clin. Invest., 2011. 121(2): p. 640-57. [132] Han, D.W., et al., Direct reprogramming of fibroblasts into epiblast stem cells. Nature Cell Biology, 2011. 13(1): p. 66-U153. [133] Swenson, E.S., Direct conversion of mouse fibroblasts to hepatocyte-like cells using forced expression of endodermal transcription factors. Hepatology, 2012. 55(1): p. 3168. [134] Sekiya, S. and A. Suzuki, Direct conversion of mouse fibroblasts to hepatocyte-like cells by defined factors. Nature, 2011. 475(7356): p. 390-3. [135] Artyomov, M.N., A. Meissner, and A.K. Chakraborty, A model for genetic and epigenetic regulatory networks identifies rare pathways for transcription factor induced pluripotency. PLoS Comput. Biol., 2010. 6(5): p. e1000785. [136] Shi, Y., et al., Induction of pluripotent stem cells from mouse embryonic fibroblasts by Oct4 and Klf4 with small-molecule compounds. Cell Stem Cell, 2008. 3(5): p. 568-74. [137] Mikkelsen, T.S., et al., Dissecting direct reprogramming through integrative genomic analysis (vol 454, pg 49, 2008). Nature, 2008. 454(7205): p. 794-794. [138] Li, W., et al., Generation of human-induced pluripotent stem cells in the absence of exogenous Sox2. Stem Cells, 2009. 27(12): p. 2992-3000.

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

In: New Developments in Chromatin Research Editors: Neil M. Simpson and Valerie J. Stewart

ISBN: 978-1-62081-816-9 © 2012 Nova Science Publishers, Inc.

Chapter 5

MITF MEETS CHROMATIN IN MELANOMA Jiri Vachtenheim* and Lubica Ondrušová Laboratory of transcription and cell signaling, Institute of Medical Biochemistry and Laboratory Diagnostics, Charles University in Prague, First Faculty of Medicine, Czech Republic

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

ABSTRACT SWI/SNF chromatin remodeling complexes contain either Brm (Brahma) or Brg1 (Brahma-related gene 1) as the ATPase subunits. These ATP-dependent complexes are specialized protein machineries which remodel the nucleosomes to make the DNA accessible during processes like transcription, DNA repair and DNA replication. MITF (microphthalmia-associated transcription factor) is a pivotal protein required for the survival and proliferation of normal melanocytes and melanoma cells. MITF activates transcription of many genes regulating proliferation, apoptosis and invasiveness of melanoma cells and is a potential target for gene therapy of melanoma, an aggressive malignant tumor for which no effective therapy exists when metastases occur. It has been shown that many MITF target genes require SWI/SNF remodeling complex for expression. Importantly, expression of MITF itself is absolutely dependent on this complex, and both Brg1- or Brm-containing complexes are sufficient to support MITF gene transcription. Additionally, especially Brg1 complex seems to support tumor growth even independently of the MITF axis. Thus, SWI/SNF complexes appear to be crucial determinants of melanoma development and progression.

Keywords: SWI/SNF, MITF, melanoma, Brg1, Brm, INI1

* Correspondence: Jiri Vachtenheim, Laboratory of transcription and cell signaling, Institute of Medical Biochemistry and Laboratory Diagnostics, First Faculty of Medicine, Charles University in Prague, Kateřinská 32, Prague 2, 12108, Czech Republic, Tel.: 420-224964110, fax: 420-224964152, E-mail: [email protected]. New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

108

Jiri Vachtenheim and Lubica Ondrušová

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

INTRODUCTION Melanoma is known for its aggressive biological and clinical behavior and resistance to conventional anticancer therapies (Miller and Mihm, 2006; Gray-Schopfer et al., 2007). Although melanoma may have various rare locations, it is predominantly localized in the skin. It originates from melanocytes, specialized pigmented cells that are found mainly in the skin and eyes, where they produce pigments melanins, which are responsible for skin and hair colour. In the skin, melanocytes normally reside in the basal layer of the epidermis surrounded by skin keratinocytes and in the hair follicles. The benign precursors of skin melanoma are nevi, lesions composed of specific neval melanocytes which rarely develop to malignant tumor. However, studies postulate the presence of a specific nevus type, a dysplastic (atypical) nevus, as a factor associated with increased risk of developing skin melanoma. The risk factors for melanoma are a family history of melanoma, multiple benign or atypical nevi, and intermittent exposure to UV irradiation. Transformation of melanocytes and subsequent tumor progression from superficially spreading melanoma to metastatic disease are thought to be governed by a complex of changes involving the accumulation of genetic alterations and epigenetic changes in chromatin structure. BRAF (V600E) is a predominant activating mutation in sporadic melanoma that has been identified ten years ago (Davies et al., 2002). About 60-70% of melanomas carry this mutation. However, mutated N-Ras was the first oncogene identified in melanoma in the 1980s and is present in around 10–25% of all tumors. The mutation in N-Ras is mainly a L61Q substitution. Either BRAF or N-Ras (acting through CRAF) mutation is found in tumor samples and both constitute a strong activation signal for the MEK/ERK pathway, which is invariantly deregulated in melanomas (Davies et al., 2002; Gray-Schopfer et al., 2007). Targeting mutated BRAF or mitogen-activated protein kinase (MAPK) pathway by small molecule inhibitors are therefore believed to be promising approaches to treatment of melanoma (Bollag et al., 2010). Interestingly, cells in benign nevi already contain BRAF (or N-Ras) mutation that confers senescence to these cells by a mechanism called oncogeneinduced senescence, thus preventing malignant transformation (Michaloglou et al., 2005). Mainly p16(INK4A) tumor suppressor protein is thought to be responsible for the senescent status (Michaloglou et al., 2005), although other genes may be possibly involved because senescence does not strictly require p16 (or p14ARF) (Haferkamp et al., 2009; Yu et al., 2009) and expression of p16 is lost in a large proportion of benign nevi (Michaloglou et al., 2005; Scurr et al., 2011). Thus, melanocytes require additional genetic changes (e.g., abrogation of the p16 function or inactivation of p53 or p14ARF) to bypass the senescent state and develop melanoma (Delmas et al., 2007; Yu et al., 2009). Mutation in the p16(INK4A) gene is a long known germline lesion predisposing to melanoma and occurring in a large portion of familial melanomas (Hughes-Davies, 1998). Loss of this protein may thus likely cooperate with BRAF mutation in the pathogenesis of primary melanomas arising from nevi (Hansson, 2010; Scurr et al., 2011). It should be noted that, besides p16, germline activating mutations in the CDK4 (cyclin-dependent kinase 4) might occur in the familial form of melanoma (Zuo et al., 1996). This review will focus on another aspect of melanoma progression, an epigenetic mechanism that is now becoming to appear to govern pivotal roles in melanoma cell transcription. We will describe the function of the mammalian SWI/SNF chromatin

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

MITF Meets Chromatin in Melanoma

109

remodeling complex in melanoma cells and suggest this complex as a possible target for gene therapy.

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

MITF and Melanoma The MITF gene encodes a member of the large number of the basic helix-loop-helix zipper transcription factors. The small MITF subfamily of these factors (the MiT family) includes also related transcription factors TFEC, TFE3 and TFEB. MITF has many isoforms which differ in their N-termini because of the nine different promoters and differential splicing across the different first exons into a common second exon (Hou and Pavan, 2008). The M-isoform (named MITF-M, referred to as MITF throughout this chapter) is expressed exclusively in the melanocyte lineage. The melanocyte-specific promoter of MITF has been cloned (Fuse et al., 1996) and is functional exclusively only in pigmented cells. Of the many tissue-specific promoters of MITF, promoter for MITF-M is located most proximally to the first exon. Several transcription factors were shown to activate MITF expression. These include Sox10, Pax3, Lef-1 and CREB (Goding, 2000; Vachtenheim and Borovansky, 2010). The catenin pathway, which has been reported to require SWI/SNF remodeling complex for the activation of target genes (Barker et al., 2001), is a prominent activator of MITF expression and its melanoma pro-proliferative activity is dependent on MITF (Widlund et al., 2002), and significantly contributes to melanoma progression and chemoresistance (Sinnberg et al., 2011). The p300/CBP transcriptional coactivators are histone acetyltransferase enzymes with extensive structure homology (Kalkhoven, 2004) and high conservation between species. They were described to function as cofactors for expression of MITF downstream genes already before many years. P300/CBP interact with MITF in vitro and in cells and are believed to activate the transcription of MITF targets, possibly by acetylating the histones in nucleosomes within the target promoters (Sato et al., 1997; Price et al., 1998). Alternatively, acetylation of MITF itself by p300 and PCAF (p300/CBP-associated factor) might affect its transcriptional activities (our unpublished observation). Controversially, however, we blocked the cotranscriptional function of p300 with the N-terminus of the adenoviral E1A oncogene and did not achieve the repression of MITF activity. Interestingly, the E1A CR1 domain (which alone is insufficient to bind and block p300 function) was sufficient for repression (Vachtenheim et al., 2007). This observation that the p300-non-binding E1A mutants still activate an endogenous MITF target (tyrosinase evoked by transfected MITF in U-2 OS cells) weakens the necessity of p300/CBP as a MITF cofactor. Furthermore, the mutation of serine 73, the phosphorylation of which is required for p300 interaction at least after the Kit signaling (Hemesath et al., 1998), and the N-terminus truncated mutants (up to aa. 105) of MITF were fully capable of activating its responsive promoter-reporter and endogenous targets (Vachtenheim et al., 2007). These results do not necessarily exclude p300/CBP as coactivators of MITF but imply that possibly another cofactor different from p300/CBP might be important for MITF especially in the chromosomal context of the endogenous promoters. In pigment cells, it is nevertheless believed that p300/CBP coactivators participate in the expression of MITF target genes and perhaps MITF itself. On the other hand, inhibitors of HDACs (histone deacetylases) like sodium butyrate, TSA, SAHA, and LBH589 were

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

110

Jiri Vachtenheim and Lubica Ondrušová

effective in suppressing growth of melanoma cell lines and tumors in nude mice (Yokoyama et al., 2008). This was associated with transcriptional downregulation of the M-MITF promoter and MITF expression. Consequently, therapeutic applications either alone or in combination with other means of MITF suppression may have consequences for melanoma therapy. Inhibitors of HDAC have pleiotropic effects on cell metabolism and their effects cannot be simply explained as p300/CBP activators. First, HDACs can regulate activity of a number of non-histone proteins and second, histone acetylation regulates not only transcription, but also other fundamental processes such as DNA replication or mitosis. Inhibitors of HDACs are generally considered as promising drugs for cancer treatment, especially in combination with other agents (Lindemann et al., 2004; Rothhammer and Bosserhoff, 2007). MITF regulates expression of a large set of pigmentation-specific genes (Goding, 2000; Vachtenheim and Borovansky, 2010) and genes promoting proliferation and invasion of melanoma. High expression of MITF has been associated with proliferation and survival of melanoma cells via its target genes Bcl-2, livin (ML-IAP), c-met, CDK2, and HIF1 (McGill et al., 2002; Du et al., 2004; Busca et al., 2005; McGill et al., 2006; Dynek et al., 2008). However, MITF upregulates also genes with opposite function which are cell cycle inhibitors (p21 nad p16) (Carreira et al., 2005; Loercher et al., 2005) and it is thought that their transregulation is functional mainly in normal melanocytes. Detailed information on MITF target genes and MITF posttranslational modifications are beyond the scope of this review and can be found elsewhere (Goding, 2000; Steingrimsson et al., 2004; Goding and Meyskens, 2006; Vachtenheim and Borovansky, 2010). MITF does not regulate only pigmentation and melanoma proliferation-related genes. It has been demonstrated that MITF possibly regulates transcription of nine miRNAs, some of which have been previously associated with melanoma. The promoters of these miRNAs contain evolutionary conserved MITF-binding nucleosome-free E-box motifs (Ozsolak et al., 2008). Although more miRNAs were associated with melanoma biology, MITF is required for expression of the miRNA-211 and its expression is regulated coordinately with the MITF target gene melastatin (TRPM1) (miRNA-211 resides in the sixth intron of TRPM1). MiRNA-211 was demonstrated to be a direct negative regulator of the proinvasive gene KCNMA1 (Mazar et al., 2010). Thus, as TRPM1, miRNA-211 reduces growth and invasiveness of melanoma. MiRNA-148 upregulated MITF expression (Haflidadóttir et al., 2010), while miRNA-137 and miRNA-340 reduced the expression of MITF (Bemis et al., 2008; Goswami et al., 2010). Possibly other miRNAs may regulate MITF (Ozsolak et al., 2008; Haflidadóttir et al., 2010). MITF is regarded as a melanoma oncogene because mutations and amplifications were found in patients´ samples (Garraway et al., 2005; Cronin et al., 2009). Moreover, BRAF mutation and p16 inactivation accompanied amplification of MITF in melanoma cell lines and ectopic MITF in conjunction with the BRAF(V600E) mutant transformed primary human melanocytes. Thus MITF can function as a melanoma oncogene (Garraway et al., 2005; Garraway and Sellers, 2006; Levy et al., 2006). In another study, two of twenty six mutations in samples of primary melanomas were identified in the MITF coding sequence whereas four out of 50 analyzed metastatic samples showed mutations (Cronin et al., 2009). Moreover, 6 mutations of 55 samples of the metastatic lesions were demonstrated in the SOX10 gene, an upstream positive regulator of MITF, taking together about 20% abnormalities in the MITF pathway in melanomas. It has been also demonstrated that combined repression of

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

MITF Meets Chromatin in Melanoma

111

BRAF(V600) and MITF by shRNAs inhibited melanoma growth even in cell lines that were more resistant to MITF downregulation alone, as melanoma lines may display differentially sensitive to MITF-M depletion (Kido et al., 2009). Recently, novel E318K MITF mutation has been identified. This mutation is a germline allele variant (Yokoyama et al., 2011). E318K MITF encodes an allele that has impaired sumoylation and differentially regulates several MITF targets; specifically, it enhances MITF protein binding to the HIF1 promoter, a MITF known target, and increases its transcriptional activity (Bertolotto et al., 2011; Yokoyama et al., 2011). The presence of this allele constitutes more than fivefold risk factor for melanoma and renal cell carcinoma. Further, the mutant protein enhanced melanocytic and renal cell carcinoma clonogenicity, migration and invasion, further implicating this MITF variant as a cancer risk factor for these two cancers (Bertolotto et al., 2011). Concerning amplifications, Garraway et al. (2005) found that MITF amplification occured in 3 of 30 primary cutaneous melanomas (10%) and 7 of 32 (21%) metastatic tumours. No amplifications were observed in the ten benign nevi tested (Garraway et al., 2005). Four MITF genomic amplifications out of 50 metastatic melanoma samples were described in an independent observation (Cronin et al., 2009).

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

The SWI/SNF Complex The chromatin remodeling complexes are multisubunit protein machines which are capable of changing the local structure of chromatin. The energy for remodeling is provided by ATP and each of the complexes shares an ATPase subunit. Generally, the complexes function in a broad range of basic cell processes that include mainly regulation of transcription, DNA replication and repair, and homologous recombination (Neely and Workman, 2002; Lusser and Kadonaga, 2003; Hota and Bartholomew, 2011). The SWI/SNF nucleosome remodeling complex (the switch in mating type/sucrose nonfermenting complex in yeast) is highly conserved throughout evolution from yeast to human and the mammalian SWI/SNF is best characterized among other remodeling complexes. The SWI/SNF is strongly implicated in human cancer, as several SWI/SNF subunits has been reported missing or strongly downregulated in tumor cell lines and tumor samples, and numerous experimental findings suggest that this complex functions as a tumor suppressor (reviewed by KlochendlerYeivin et al., 2002; Roberts and Orkin, 2004; Reisman et al., 2009; Halliday et al., 2009; Wilson and Roberts, 2011). In the cell, there exist several types of SWI/SNF complexes, but principally the main two are predominant and are characterized by the presence of an ATPase subunit, which is either Brm (SMARCA2, brahma, BAF190B) or Brg1 (SMARCA4, brahmarelated gene 1, BAF190A). The BAF subcomplex can be assembled with either Brm or Brg1, while PBAF subcomplex contains only Brg1. BAF complex contains BAF250A or BAF250B (ARID1A or B) as diagnostic subunits, while PBAF contains BAF180 (PBRM1, also known as polybromo) and BAF200 (ARID2, polybromo-associated factor) as specific components (reviewed by Reisman et al., 2009). Other subunits are called BAFs and are shared by both complexes; they include BAF47/INI1/SNF5 (SMARCB1), BAF53A (ACTL6A) or BAF53B (ACTL6A), BAF57 (SMARCE1), BAF60A (SMARCD1) (or BAF60B, SMARCD2), BAF155 (SMARCC1), BAF170 (SMARCC2), and actin (ACTB). SWI/SNF, as other complexes, utilizes the energy provided by ATP hydrolysis to disrupt histone-DNA contacts of nucleosomes and alter nucleosome positions on DNA, resulting in the alteration of spacing

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

112

Jiri Vachtenheim and Lubica Ondrušová

of nucleosomes, repositioning or disassembling nucleosomes. SWI/SNF thus activates genes by epigenetic mechanisms involving remodeling the local nucleosomes. However, in some instances, the complex is also capable of repressing genes, and especially Brg1 can enter several repressive complexes (besides BAF and PBAF) which contain additional proteins, which are typical cellular transrepressors, e.g. HDACs, mSin3a, Rb, or REST (Trotter and Archer, 2008). The presence of particular ATPase in SWI/SNF may confer substrate specificity to the complex (Kadam and Emerson, 2003). Thus, Brg1 or Brm may have synergistic and antagonistic effects on the SWI/SNF complexes, depending on the tissue and promoter context. Both can have antagonistic effects on the regulation of some genes (Marshall et al., 2003; Xu et al., 2007; Shen et al., 2008; Flowers et al., 2009), but are also interchangeable in some instances (Strobeck et al., 2002; Xu et al., 2007).

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

SWI/SNF IN DIFFERENTIATION AND CANCER Numerous reports implicate the SWI/SNF complex as a crucial determinant of differentiation of many cell lineages (Simone, 2006; de la Serna et al., 2006a). For example, complexes with specific composition (npBAF) operate in neural development (Yoo and Crabtree, 2009). Important role plays the SWI/SNF in muscle formation (de la Serna et al., 2001; Ohkawa et al., 2007). The Brg1 ATPase and the muscle-specific transcription regulator MyoD are required in early stages of myogenesis (in developing embryonic tissue), whereas myogenin and Brg1 are critical for the expression of late genes during terminal muscle differentiation (Ohkawa et al., 2007). Also cardiac muscle growth and differentiation need the Brg1 function (Hang et al., 2010). Furthermore, various aspects of differentiation and maintenance of neural stem cells, the astrocyte and oligodendrocyte differentiation and switch from neurogenesis to normal gliogenesis in mice embryos have been shown to require Brg1 (Matsumoto et al., 2006). In addition to the above mentioned tissues, the proper osteogenesis (Young et al., 2005), erythropoiesis (Griffin et al., 2008), development of T-cells (Chi et al., 2002) and adipocytes (Salma et al., 2004) were reported to require the SWI/SNF complex. It has been demonstrated that specialized complexes (esBAF), defined by the presence of Brg1, BAF155, and BAF60A, and the absence of Brm, BAF170, and BAF60C are necessary for self-renewal and pluripotency of mouse ES cells (Ho et al., 2009). As shown recently in several articles and described in this chapter, the SWI/SNF complex is also essential for the maintenance and progression of melanoma cells. It might be envisaged that it can provide a similar crucial role in the embryonic development of the melanocyte lineage as well. Two components of SWI/SNF, Brg1 and INI1, are often mutated or deleted in human tumors and cell lines, and are therefore regarded as tumor suppressors. A core SWI/SNF subunit, INI1, is inactivated in aggressive pediatric renal rhabdoid tumors, rhabdomyosarcomas, and some brain tumors (Versteege et al., 1998). Brg1, Brm or both are downregulated or inactivated in cancer cell lines and tumor samples derived mostly from non small-cell lung cancer (NSCLC) (Reisman et al., 2003; Glaros et al., 2007), but a variety of other cell types carry mutations or loss of expression of one of these two ATPases (Decristofaro et al., 2001). Medina et al. (2008) reported that about 25% of lung cancer cell lines carried homozygous mutation in Brg1, most of which predicted truncated protein. Vast majority of these mutations were in NSCLC cells. About 50% of intraductal papillary

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

MITF Meets Chromatin in Melanoma

113

mucinous pancreatic neoplasms, precursors of adenocarcinoma of the pancreas, also showed low immunohistochemical staining of Brg1, indicating protein loss (Dal Molin et al., 2011). The notion that Brg1 is a tumor suppressor in lung tumorigenesis was further substantiated by the observation that lung-specific heterozygous conditional knockout of Brg1 in mice developed increased number of carcinogen ethyl carbamate induced lung tumors. However, biallelic inactivation of Brg1 could not initiate tumor, indicating that transformation de novo required one Brg1 allele. Remarkably, when Brg1 was inactivated in mice exposed to the carcinogen, the tumor development was potentiated and some cells that were devoid of Brg1 formed larger and faster proliferating tumors (Glaros et al., 2008). Contrasting to Brg1, Brm expression is inactivated by epigenetic mechanisms (Glaros et al., 2007; Reisman et al., 2009). Surprisingly, some types of cancer cells (gastric, prostate, colorectal, melanoma) display increased Brg1 or other SWI/SNF components. In colorectal cancer, expression of Brg1, but not Brm, was frequently increased, by immunohistochemical staining, and Brg1 knockdown suppressed proliferation by downregulating PTEN with subsequent activation of the Akt pathway and increased cyclin D1 levels (Watanabe et al., 2011). Notably, BAF155 is subject to interaction and phosphorylation by activated Akt, which might prove to be one of the potentialy regulatory mechanisms of SWI/SNF by activated signaling pathways (Foster et al., 2006). Prostate cancer cells revealed increased Brg1 (Sun et al., 2007) and androgen receptor required SWI/SNF for the expression of at least two of its targets (Marshall et al., 2003). Moreover, another SWI/SNF subunit, BAF57, substantially increased the androgen receptor activity, thus implicating this factor as molecular target for prostate cancer (Link et al., 2008). In gastric cancer, loss or decrease of Brm expression was observed in a large portion of tumor samples (Yamamichi et al., 2007) whereas increased Brg1 level was also implicated in pathogenesis of this malignancy (Sentani et al., 2001). There exist numerous impelling data suggesting that INI1 may have SWI/SNF independent function, and SWI/SNF complexes lacking INI1 might provide autonomous functions other than fully assembled INI1-containing complexes. First, spectrum of tumors arising in monoallelically mutant Brg1 or INI1 mice are different, even though both proteins are regular components of the SWI/SNF complex (reviewed by Reisman et al., 2009; Wilson and Roberts, 2011), However, biallelic knockout of either gene is similar and is embryonically lethal at the peri-implantation stage (Klochendler-Yeivin et al., 2000; Roberts et al., 2000; Bultman et al., 2000). Second, some genes are upregulated by Brg1 in the absence of INI1, suggesting that the integral SWI/SNF complex is not essential for transcription, at least for some genes. These genes include for example CSF1, SPARC, HP8, and ID3 (Liu et al., 2001; Doan et al., 2004). Moreover, the complex is surprisingly fully assembled without the presence of INI1 (Doan et al., 2004). Thus, some genes require INI1 for transcription while other do not, implying that the INI1-deficient SWI/SNF complex can have yet unknown, INI1-dispensable cellular function. Third, paradoxically, INI1-deficient cancer cell lines are dependent on residual Brg1 activity. Ablation of Brg1 in these cells prevents tumor formation and therefore presumably INI1-deficient cancers disrupt INI1independent (but Brg1-dependent) targets which may be the mechanism by which tumor formation is blocked (Wang et al., 2009). In normal diploid cells, INI1 loss causes cell death, so it is similar to embryonic lethality. On the other hand, hereditary MRT (malignant rhabdoid tumors) tumors survive and proliferate under complete loss of INI1. Thus, it can be suggested from these results that some yet unknown targets of Brg1 may probably enable

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

114

Jiri Vachtenheim and Lubica Ondrušová

cancer cells to survive upon INI1 loss. Fourth, although the INI1 protein alone is capable of inhibiting cell cycle arrest by downregulating expression of several cell cycle activating proteins in MRT cells, it requires intact Rb protein for this ability. On the contrary, functional INI1 is not needed for Rb protein-mediated cell cycle arrest in these cells (Versteege et al., 2002). Further results have shown that ectopic Rb protein requires Brg1 for cell cycle arrest in Rb-compromised cells (Zhang et al., 2000; Versteege et al., 2002), thus clearly discriminating the role of INI1 and Brg1 in Rb-mediated cell cycle blockade. All these data together suggest the nonsynergistic role of INI1 and Brg1 in cancer cell formation.

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

MITF and SWI/SNF in Melanoma Results from recent years indicate that melanoma is a tumor in which the pivotal transcriptional regulator MITF requires the SWI/SNF complex for the expression of its downstream genes as well as for its own expression. These findings placed SWI/SNF together with MITF on the central crossroad in the melanoma transcriptional network, influencing the basic processes of melanoma biology. Mouse fibroblasts are capable of expressing pigment specific genes after transfer of ectopic MITF. Mouse fibroblasts inducibly expressing dominant negative (DN) forms of Brg1 or Brm were previously constructed and demonstrated to inhibit, upon induction, the activation of genes that normally require SWI/SNF enzymes. Inhibition of pigment cellspecific genes expression was observed after introduction of exogenous MITF in these cells (de la Serna et al., 2006b). This indicates the importance of SWI/SNF for MITF-directed gene expression in this heterologous cell model. Several melanocyte-specific markers such as tyrosinase, TRP1, TRP2 (tyrosinase-related proteins 1 and 2), and Pmel17 were downregulated. Strikingly, the function of cell cycle inhibitors p21 and p16, which are also MITF targets, was not affected by DN Brg1 or Brm, suggesting that SWI/SNF selectively promotes only pigment cell-specific genes in this experimental model. The TRP1 promoter was shown to bind MITF and it has been shown that Brg1 was associated (by chromatin immunoprecipitation) with this promoter together with MITF. Brg1 and MITF coimmunoprecipitated, and Brg1 colocalized with MITF in the nucleus of B16 melanoma cells (de la Serna et al., 2006b). In the zebrafish model, Brg1-mutated embryos showed defects in the development of pigment cells and retina, the tissues expressing MITF. This work suggests that Brg1 is involved in neural crest induction, and consequently in the development of neurons, glia, and pigment cells (Eroglu et al., 2006). We have previously described prominent epigenetic mechanism in the tumorigenesis of melanoma by demonstrating that the expression of MITF is absolutely dependent on the functional SWI/SNF complex (Vachtenheim et al., 2010). We have shown generally high expression of SWI/SNF protein components in melanoma cell lines and have found only one cell line, SK-MEL-5, with the loss of the Brg1 gene expression. Brm has been shown to be present in all melanoma cell lines tested (Vachtenheim et al., 2010). However, other authors observed very low Brm expression in two melanoma cell lines tested (Keenen et al., 2010). Together, the components of SWI/SNF are generally well expressed in malignant melanocytes and at least one ATPase is always present in melanoma cell lines. Because MITF critically requires SWI/SNF for its expression, knockdown of Brg1, Brm, or both with specific shRNAs has been performed in several melanoma lines. Although the

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

MITF Meets Chromatin in Melanoma

115

proliferation and survival have been transiently compromised in Brg1 knockdowned cells, melanoma cells recovered and continued proliferation, presumably because of the persistent expression of Brm. However, sequential knockdown of both Brm and Brg1 in 501mel cells completely abolished proliferation (Vachtenheim et al., 2010). In SK-MEL-5 melanoma cells, which do not express Brg1, depletion of Brm alone was sufficient to abrogate MITF expression and cell proliferation. When both Brg1/Brm knockdown was performed simultaneously, the transfected or lentivirus-infected cells were grossly deteriorated and a small number of remaining viable cells presumably survived due to an incomplete block of expression, which occurred when common Brg1/Brm shRNA was used. In chromatin immunoprecipitation assays, both Brg1 and Brm were capable of binding to the melanocytespecific promoter of MITF (Vachtenheim et al., 2010). Expectedly, the expression of tested MITF targets (melastatin, CDK2, and tyrosinase) were decreased, much more prominently in the Brg1 knockdown experiments than in the Brm knockdown (Vachtenheim et al., 2010). These results together showed that either Brg1 or Brm in the SWI/SNF complex was able to support MITF expression, albeit Brg1 seemed to be more important ATPase. It should be noted that SWI/SNF may function in the expression of MITF through the upstream transcription factor LEF1, the -catenin pathway effector, because -catenin interacts with Brg1 and requires it for promoting the target genes in -catenin signaling (Barker et al., 2001). The -catenin pathway is frequently deregulated in melanoma (Widlund et al., 2002; Delmas et al., 2007; Sinnberg et al., 2011). The dependence of several MITF targets on the SWI/SNF complex was confirmed recently to exist also in melanoma cells. As with MITF expression, some of its target genes strictly required the functional SWI/SNF. Similarly as in the mouse model (de la Serna et al., 2006b), Brg1 was detected on the promoters of genes that encode enzymes needed for melanogenesis, like tyrosinase, TRP1, TRP2, and RAB27A, and also proapoptotic gene livin (ML-IAP), however Brg1 did not bind to CDK2, Bcl-2, or Tbx2 promoters (Keenen et al., 2010; Saladi et al., 2010a). Furthermore, re-introduction of Brg1 in SK-MEL-5 cells, which express only Brm, enhanced expression of melanocyte-specific MITF target genes and increased pigmentation. As in the mouse cells, Brg1 interacted with MITF and was required for MITF target gene expression in melanoma cells. Importantly, re-expression of Brg1 in SK-MEL-5 cells significantly increased resistance to cisplatin and cell survival. Since SWI/SNF is required for MITF expression (see above), it should be noted that some of the effects ascribed to SWI/SNF or Brg1 in this work (Keenen et al., 2010), may have been produced by the manipulation with MITF level, through Brg1. Together all the results show that Brg1 might be the first ATPase in the expression of MITF and its downstream targets but it can be quite readily substituted by Brm. Probably both ATPases can participate in the expression of MITF and its endogenous targets in melanoma cells. In any case, at least one functional SWI/SNF ATPase would be required for survival of melanoma cells. A large microarray approach which examined the nucleosome positioning in promoters, combined with the data from the chromatin immunoprecipitation analyses, revealed that MITF predominantly binds nucleosome-free regions, supporting the model that the presence of nucleosomes is a limiting factor for the accessibility of MITF to the promoters (Ozsolak et al., 2007). These data are entirely consistent with the requisite need of SWI/SNF-mediated remodeling for many of the MITF-driven promoters.

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

116

Jiri Vachtenheim and Lubica Ondrušová

Tumor samples from melanoma patients were also investigated for the expression of Brg1, Brm and INI1 by immunochemical analysis. INI1 staining was reduced in tumor samples and correlated with poor prognosis (Lin et al., 2010, see below). The expression of Brg1 was found increased in the majority of biopsies and was found even in the first stages of melanoma development (primary melanomas). Staining was higher in all stages of tumor development. A significant difference in Brg1 expression was observed even between dysplastic nevi or primary melanoma when compared with controls (Lin et al., 2010). Moreover, the authors performed knockdown of Brg1 in melanoma cell lines by means of siRNA and revealed significantly reduced cell proliferative ability. This finding was due to G1 phase block and downregulation of cyclin D1. The data are concordant with the above described results on cell lines and further implicate Brg1 in melanoma initiation and pathogenesis. However, Becker et al. (2009) described low Brg1 immunohistochemical staining of primary and metastatic melanomas while Brm protein level was decreased only in ~20% of cases. This is a singular observation in melanoma and is in the contrast with other results. Perhaps Brg1 might be downregulated at later stages of tumor progression. Brm expression was mostly preserved, so Brm might become a critical remaining ATPase maintaining the expression of MITF in melanoma cells in vivo when Brg1 is lost. These authors also found an association between p16 and Brg1 but the functional molecular connection is unclear as Brg1 is not required for p16/INK4a-induced cell cycle inhibition (Becker et al., 2009). In contrast to melanotic lesions, squamous cell carcinomas of the skin had lowered levels of both Brm and Brg1. Brm protein showed low levels of mRNA and Brg1 protein loss appeared to be a post-translational event. In contrast, possible squamous cell carcinoma precursor, actinic keratosis, revealed normal levels of both proteins. Brm and Brg1 may be therefore novel tumour suppressor genes for human non-melanoma skin cancer, as they are downregulated during tumor progression (Bock et al., 2011). Expression of INI1, estimated by IHC, was shown downregulated during progression of melanoma (from nevus to metastatic lesions), and its low or negative expression correlated with poor patients prognosis as an independent prognostic factor. Moreover, INI1 knockdown in melanoma cells increased the resistance of tumor cells to chemotherapeutics like doxorubicin, etoposide, and camptothecin. The downregulation of INI1 expression reduced drug-induced apoptosis in melanoma cells, while cell cycle was not appreciably affected by INI1 loss (Lin et al., 2009). However, in view of the above results showing the importance of Brg1 in melanoma cell survival, this observation is not so surprising as the SWI/SNF complex, as mentioned above, may have dual function, depending on either presence or absence of INI1. In this connection, one could speculate that the effect of INI1 was due to lower repression effect of INI1 on GLI1 transcription factor, an effector of the Hedgehog pathway (Jagani et al., 2010), which can be a crucial mechanism for the proliferation of INI1deficient human malignant rhabdoid tumors (MRTs). It remains to be proven if this mechanism is valid also for melanoma cells, for which the Hedhehog-GLI1 signaling is also pivotal and positively regulates the proliferation and survival of human melanomas (Stecca et al., 2007). The senescence and apoptosis induced by BRAF(V600E) in normal melanocytes has been revealed to be mediated by IGFBP7 (insulin growth factor binding protein 7). It has been further shown that this secreted protein upregulates BNIPL (BCL2/adenovirus E1B 19kD interacting protein 2-like protein). The BNIPL transcription required the SWI/SNF complex with Brg1 and INI1 recruited to the BNIPL promoter after the stimulation by

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

MITF Meets Chromatin in Melanoma

117

recombinant IGFBP7 (Wajapeyee et al., 2008). Because expression of IGFBP7 is lost by promoter hypermethylation in BRAF(V600E) melanomas, the restoration of the pathway was achieved by addition of recombinant IGFBP7 to melanoma cells, after which increased expression of BAF47 allowed recruitment of Brg1 to the BNIPL promoter. Thus, SWI/SNF seems to be involved even in the basic BRAF-MEK-ERK axis important for melanoma progression. This also might be the reason why INI1 level is often decreased in melanomas (Lin et al., 2009), possibly allowing the constitutive activation of the MAPK pathway. Brg1, Brm, or INI1 mutations were previously not analyzed in melanoma samples, so it is unknown whether such mutations can occur in any stage of melanoma. However, infrequent somatic single-allele Brm mutations were found in non-melanoma skin tumors (in one of ten squamous cell and two of six basal cell carcinoma samples) (Moloney et al., 2009), consisting of uniform G:C to T:A transversions which are typical mutations occurring following UV irradiation. The transversion resulted in a substitution of glutamine by lysine at codon 203 (Q203K) in the conserved region of exon 4 of the Brm gene. Also, a Q228P polymorphism in the Brm gene locus was identified in the non-melanoma lesions (Moloney et al., 2009). The Brm mutation is a rare observation because epigenetic silencing is responsible for Brm repression in tumors (Glaros et al., 2007; Yamamichi et al., 2007; Reisman et al., 2009; Gramling et al., 2011). Another important function of Brg1 in melanoma progression may come from the scarce recent findings indicating that it might support transcription of genes outside the MITF axis. One such situation has been described above, showing the Brg1 participation in the expression of BNIPL gene in the BRAF pathway (Wajapeyee et al., 2008). It has been further found that Brg1 modulates the expression of a subset of extracellular matrix enzymes and adhesion proteins (Saladi et al., 2010b). Further, Brg1 level was increased in primary melanomas, advanced melanoma, and melanoma cell lines. Activation of the enzyme metalloproteinase (MMP) 2 expression contributed to the Brg1 induced increase in melanoma invasiveness. Brg1 also bound the MMP2 promoter, indicating a direct regulation by SWI/SNF. Although Brg1 activated some genes with the antiproliferative activities like Ecadherin, the overall effect of Brg1 in SK-MEL-5 cells was proinvasive (Saladi et al. 2010b; Keenen et al., 2010). Remarkably, it was referred that Brg1, together with p300 may be required to restrict p53 activity in wild-type p53 tumors (Naidu et al., 2009). Depletion of Brg1, but not Brm, led to the activation of endogenous wt p53 and cell senescence. Although not described in melanoma cells, this mechanism might also contribute to the prosurvival role of Brg1 in melanomas, which do not have mutated p53. Interestingly, we performed cDNA microarray analysis of shRNA-mediated knockdown of Brg1 in 501mel melanoma cells (Ondrušová et al., submitted). Longer cultivation deteriorated these sh-Brg1 cells but the cells later recovered probably because Brm replaced lost Brg1 function, suggesting that Brm is the surrogate ATPase supporting MITF expression (Vachtenheim et al., 2010). We have studied changes shortly after the complete inhibition of Brg1, ensuring that the change in expression pattern was due exclusively to Brg1 loss. Besides the profound downregulation of MITF and its target genes, we found that among the strongly repressed genes were also insulin growth factor 1 (IGF1) and osteopontin (OPN) (Ondrušová et al., submitted). These proteins are known to have proliferative and proinvasive activity in many cancers, including melanoma (Zhou et al, 2005; Hilmi et al., 2008). Further, survivin, TGF2, and also SOX10, an upstream MITF regulator important for embryonic development of the melanocyte lineage, were also downregulated. Decrease of all these

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

118

Jiri Vachtenheim and Lubica Ondrušová

proteins were verified by RT-PCR and W. blotting (Ondrušová et al., submitted). OPN promoter was recently shown to be a target of activated Hedgehog pathway (Das et al., 2009), a signaling activated in melanoma (Stecca et al., 2007). Our data thus provide another evidence that the prosurvival role of Brg1 can be provided, besides activating the MITF axis, also through MITF-independent mechanisms in melanoma.

CONCLUSION In conlusion, there may exist principally two types of cancer cells. For most cancers, SWI/SNF complex is a clear tumor suppressor (malignant rhabdoid tumors, non small-cell lung cancer, non-melanoma skin cancer, pancreatic cancer, and many other tumors, reviewed by Wilson and Roberts, 2011). For other types (prostate cancer, gastric and colorectal cancer, and melanoma), the SWI/SNF complex, or at least some of its components (mostly Brg1), seems to be a tumor promoter, probably by activating essential genes required for proliferation, antiapoptotic activity, invasivity or other characteristics of cancer cells.

ACKNOWLEDGMENTS Grant support: This work was supported by a grant NT/11229-3 (to J.V.) from the Ministry of Health (IGA, MH). L.O. participates in the PhD program at Charles University in Prague, Third Faculty of Medicine, Czech Rep.

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

CONFLICT OF INTEREST The authors state no conflict of interest.

REFERENCES Barker, N; Hurlstone, A; Musisi, H et al. The chromatin remodelling factor Brg-1 interacts with beta-catenin to promote target gene activation. EMBO J, 2001, 20, 4935-4943. Becker, TM; Haferkamp, S; Dijkstra, MK et al. The chromatin remodelling factor BRG1 is a novel binding partner of the tumor suppressor p16INK4a. Mol Cancer, 2009, 8, 4. Bemis, LT; Chen, R; Amato, CM et al. MicroRNA-137 targets microphthalmia-associated transcription factor in melanoma cell lines. Cancer Res, 2008, 68, 1362-1368. Bertolotto, C; Lesueur, F; Giuliano, S et al. A SUMOylation-defective MITF germline mutation predisposes to melanoma and renal carcinoma. Nature, 2011, 480, 94-98. Bock, VL; Lyons, JG; Huang, XX et al. BRM and BRG1 subunits of the SWI/SNF chromatin remodelling complex are downregulated upon progression of benign skin lesions into invasive tumours. Br J Dermatol, 2011, 164, 1221-1227. Bollag, G; Hirth, P; Tsai, J et al. Clinical efficacy of a RAF inhibitor needs broad target blockade in BRAF-mutant melanoma. Nature, 2010, 467, 596-599.

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

MITF Meets Chromatin in Melanoma

119

Bultman, S; Gebuhr, T; Yee, D et al. A Brg1 null mutation in the mouse reveals functional differences among mammalian SWI/SNF complexes. Mol Cell, 2000, 6, 1287-1295. Busca, R; Berra, E; Gaggioli, C et al. Hypoxia-inducible factor 1{alpha} is a new target of microphthalmia-associated transcription factor (MITF) in melanoma cells. J Cell Biol, 2005, 170, 49-59. Carreira, S; Goodall, J; Aksan, I et al. Mitf cooperates with Rb1 and activates p21Cip1 expression to regulate cell cycle progression. Nature, 2005, 433, 764-769. Chi, TH; Wan, M; Zhao, K et al. Reciprocal regulation of CD4/CD8 expression by SWI/SNFlike BAF complexes. Nature, 2002, 418, 195-199. Cronin, JC; Wunderlich, J; Loftus, SK et al. Frequent mutations in the MITF pathway in melanoma. Pigment Cell Melanoma Res, 2009, 22, 435-444. Dal Molin, M; Hong, S-M; Hebbar, S et al. Loss of expression of the SWI/SNF chromatin remodeling subunit BRG1/SMARCA4 is frequently observed in intraductal papillary mucinous neoplasms of the pancreas. Hum Pathol, 2011, 43, 585-591. Das, S; Harris, LG; Metge, BJ et al. The hedgehog pathway transcription factor, GLI1 promotes malignant behavior of cancer cells by upregulating osteopontin. J Biol Chem, 2009, Davies, H; Bignell, GR; Cox, C et al. Mutations of the BRAF gene in human cancer. Nature, 2002, 417, 949-954. de la Serna, I; Carlson, KA; Imbalzano, AN. Mammalian SWI/SNF complexes promote MyoD-mediated muscle differentiation. Nat Genet, 2001, 27, 187-190. de la Serna, I; Ohkawa, Y; Imbalzano, AN. Chromatin remodelling in mammalian differentiation: lessons from ATP-dependent remodellers. Nat Rev Genet, 2006a, 7, 461473. de la Serna, I; Ohkawa, Y; Higashi, C et al. The microphthalmia-associated transcription factor requires SWI/SNF enzymes to activate melanocyte-specific genes. J Biol Chem, 2006b, 281, 20233-20241. Decristofaro, MF; Betz, BL; Rorie, CJ et al. Characterization of SWI/SNF protein expression in human breast cancer cell lines and other malignancies. J Cell Physiol, 2001, 186, 136145. Delmas, V; Beermann, F; Martinozzi, S et al. Beta-catenin induces immortalization of melanocytes by suppressing p16INK4a expression and cooperates with N-Ras in melanoma development. Genes Dev, 2007, 21, 2923-2935. Doan, DN; Veal, TM; Yan, Z et al. Loss of the INI1 tumor suppressor does not impair the expression of multiple BRG1-dependent genes or the assembly of SWI/SNF enzymes. Oncogene, 2004, 23, 3462-3473. Du, J; Widlund, HR; Horstmann, MA et al. Critical role of CDK2 for melanoma growth linked to its melanocyte-specific transcriptional regulation by MITF. Cancer Cell, 2004, 6, 565-576. Dynek, JN; Chan, SM; Liu, J et al. Microphthalmia-associated transcription factor is a critical transcriptional regulator of melanoma inhibitor of apoptosis in melanomas. Cancer Res, 2008, 68, 3124-3132. Eroglu, B; Wang, G; Tu, N et al. Critical role of Brg1 member of the SWI/SNF chromatin remodeling complex during neurogenesis and neural crest induction in zebrafish. Dev Dyn, 2006, 235, 2722-2735.

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

120

Jiri Vachtenheim and Lubica Ondrušová

Flowers, S; Nagl, NG, Jr.; Beck, GR, Jr. et al. Antagonistic roles for BRM and BRG1 SWI/SNF complexes in differentiation. J Biol Chem, 2009, 284, 10067-10075. Foster, KS; McCrary, WJ; Ross, JS et al. Members of the hSWI/SNF chromatin remodeling complex associate with and are phosphorylated by protein kinase B/Akt. Oncogene, 2006, 25, 4605-4612. Fuse, N; Yasumoto, K; Suzuki, H et al. Identification of a melanocyte-type promoter of the microphthalmia-associated transcription factor gene. Biochem Biophys Res Commun, 1996, 219, 702-707. Garraway, LA; Widlund, HR; Rubin, MA et al. Integrative genomic analyses identify MITF as a lineage survival oncogene amplified in malignant melanoma. Nature, 2005, 436, 117-122. Garraway, LA; Sellers, WR. Lineage dependency and lineage-survival oncogenes in human cancer. Nat Rev Cancer, 2006, 6, 593-602. Glaros, S; Cirrincione, GM; Muchardt, C et al. The reversible epigenetic silencing of BRM: implications for clinical targeted therapy. Oncogene, 2007, 26, 7058-7066. Glaros, S; Cirrincione, GM; Palanca, A et al. Targeted knockout of BRG1 potentiates lung cancer development. Cancer Res, 2008, 68, 3689-3696. Goding, C; Meyskens, FL, Jr. Microphthalmic-associated transcription factor integrates melanocyte biology and melanoma progression. Clin Cancer Res, 2006, 12, 1069-1073. Goding, CR. Mitf from neural crest to melanoma: signal transduction and transcription in the melanocyte lineage. Genes Dev, 2000, 14, 1712-1728. Goswami, S; Tarapore, RS; Teslaa, JJ et al. MicroRNA-340-mediated degradation of microphthalmia-associated transcription factor mRNA is inhibited by the coding region determinant-binding protein. J Biol Chem, 2010, 285, 20532-20540. Gramling, S; Rogers, C; Liu, G et al. Pharmacologic reversal of epigenetic silencing of the anticancer protein BRM: a novel targeted treatment strategy. Oncogene, 2011, 30, 32893294. Gray-Schopfer, V; Wellbrock, C ; Marais, R. Melanoma biology and new targeted therapy. Nature, 2007, 445, 851-857. Griffin, CT; Brennan, J; Magnuson, T. The chromatin-remodeling enzyme BRG1 plays an essential role in primitive erythropoiesis and vascular development. Development, 2008, 135, 493-500. Haferkamp, S; Scurr, LL; Becker, TM et al. Oncogene-induced senescence does not require the p16(INK4a) or p14ARF melanoma tumor suppressors. J Invest Dermatol, 2009, 129, 1983-1991. Haflidadottir, BS; Bergsteinsdottir, K; Praetorius, C et al. miR-148 regulates Mitf in melanoma cells. PLoS One, 2010, 5, e11574. Halliday, GM; Bock, VL; Moloney, FJ et al. SWI/SNF: a chromatin-remodelling complex with a role in carcinogenesis. Int J Biochem Cell Biol, 2009, 41, 725-728. Hang, CT; Yang, J; Han, P et al. Chromatin regulation by Brg1 underlies heart muscle development and disease. Nature, 2010, 466, 62-67. Hansson, J. Familial cutaneous melanoma. Adv Exp Med Biol, 2010, 685, 134-145. Hemesath, TJ; Price, ER; Takemoto, C et al. MAP kinase links the transcription factor Microphthalmia to c-Kit signalling in melanocytes. Nature, 1998, 391, 298-301.

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

MITF Meets Chromatin in Melanoma

121

Hilmi, C; Larribere, L; Giuliano, S et al. IGF1 promotes resistance to apoptosis in melanoma cells through an increased expression of BCL2, BCL-X(L), and survivin. J Invest Dermatol, 2008, 128, 1499-1505. Ho, L; Ronan, JL; Wu, J et al. An embryonic stem cell chromatin remodeling complex, esBAF, is essential for embryonic stem cell self-renewal and pluripotency. Proc Natl Acad Sci U S A, 2009, 106, 5181-5186. Hota, SK; Bartholomew, B. Diversity of operation in ATP-dependent chromatin remodelers. Biochim Biophys Acta, 2011, 1809, 476-487. Hou, L; Pavan, WJ. Transcriptional and signaling regulation in neural crest stem cell-derived melanocyte development: do all roads lead to Mitf? Cell Res, 2008, 18, 1163-1176. Hughes-Davies, TH. CDKN2A mutations in multiple primary melanomas. N Engl J Med, 1998, 339, 347-348. Jagani, Z; Mora-Blanco, EL; Sansam, CG et al. Loss of the tumor suppressor Snf5 leads to aberrant activation of the Hedgehog-Gli pathway. Nat Med, 2010, 16, 1429-1433. Kadam, S; Emerson, BM. Transcriptional specificity of human SWI/SNF BRG1 and BRM chromatin remodeling complexes. Mol Cell, 2003, 11, 377-389. Kalkhoven, E. CBP and p300: HATs for different occasions. Biochem Pharmacol, 2004, 68, 1145-1155. Keenen, B; Qi, H; Saladi, SV et al. Heterogeneous SWI/SNF chromatin remodeling complexes promote expression of microphthalmia-associated transcription factor target genes in melanoma. Oncogene, 2010, 29, 81-92. Kido, K; Sumimoto, H; Asada, S et al. Simultaneous suppression of MITF and BRAF V600E enhanced inhibition of melanoma cell proliferation. Cancer Sci, 2009, 100, 1863-1869. Klochendler-Yeivin, A; Fiette, L; Barra, J et al. The murine SNF5/INI1 chromatin remodeling factor is essential for embryonic development and tumor suppression. EMBO Rep, 2000, 1, 500-506. Klochendler-Yeivin, A; Muchardt, C; Yaniv, M. SWI/SNF chromatin remodeling and cancer. Curr Opin Genet Dev, 2002, 12, 73-79. Levy, C; Khaled, M; Fisher, DE. MITF: master regulator of melanocyte development and melanoma oncogene. Trends Mol Med, 2006, 12, 406-414. Lin, H; Wong, RP; Martinka, M et al. Loss of SNF5 expression correlates with poor patient survival in melanoma. Clin Cancer Res, 2009, 15, 6404-6411. Lin, H; Wong, RP; Martinka, M et al. BRG1 expression is increased in human cutaneous melanoma. Br J Dermatol, 2010, 163, 502-510. Lindemann, RK; Gabrielli, B; Johnstone, RW. Histone-deacetylase inhibitors for the treatment of cancer. Cell Cycle, 2004, 3, 779-788. Link, KA; Balasubramaniam, S; Sharma, A et al. Targeting the BAF57 SWI/SNF subunit in prostate cancer: a novel platform to control androgen receptor activity. Cancer Res, 2008, 68, 4551-4558. Liu, R; Liu, H; Chen, X et al. Regulation of CSF1 promoter by the SWI/SNF-like BAF complex. Cell, 2001, 106, 309-318. Loercher, AE; Tank, EM; Delston, RB et al. MITF links differentiation with cell cycle arrest in melanocytes by transcriptional activation of INK4A. J Cell Biol, 2005, 168, 35-40. Lusser, A; Kadonaga, JT. Chromatin remodeling by ATP-dependent molecular machines. Bioessays, 2003, 25, 1192-1200.

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

122

Jiri Vachtenheim and Lubica Ondrušová

Marshall, TW; Link, KA; Petre-Draviam, CE et al. Differential requirement of SWI/SNF for androgen receptor activity. J Biol Chem, 2003, 278, 30605-30613. Matsumoto, S; Banine, F; Struve, J et al. Brg1 is required for murine neural stem cell maintenance and gliogenesis. Dev Biol, 2006, 289, 372-383. Mazar, J; DeYoung, K; Khaitan, D et al. The regulation of miRNA-211 expression and its role in melanoma cell invasiveness. PLoS One, 2010, 5, e13779. McGill, GG; Horstmann, M; Widlund, HR et al. Bcl2 regulation by the melanocyte master regulator Mitf modulates lineage survival and melanoma cell viability. Cell, 2002, 109, 707-718. McGill, GG; Haq, R; Nishimura, EK et al. c-Met expression is regulated by Mitf in the melanocyte lineage. J Biol Chem, 2006, 281, 10365-10373. Medina, PP; Romero, OA; Kohno, T et al. Frequent BRG1/SMARCA4-inactivating mutations in human lung cancer cell lines. Hum Mutat, 2008, 29, 617-622. Michaloglou, C; Vredeveld, LC; Soengas, MS et al. BRAFE600-associated senescence-like cell cycle arrest of human naevi. Nature, 2005, 436, 720-724. Miller, AJ; Mihm, MC, Jr. Melanoma. N Engl J Med, 2006, 355, 51-65. Moloney, FJ; Lyons, JG; Bock, VL et al. Hotspot mutation of Brahma in non-melanoma skin cancer. J Invest Dermatol, 2009, 129, 1012-1015. Naidu, SR; Love, IM; Imbalzano, AN et al. The SWI/SNF chromatin remodeling subunit BRG1 is a critical regulator of p53 necessary for proliferation of malignant cells. Oncogene, 2009, Neely, KE; Workman, JL. The complexity of chromatin remodeling and its links to cancer. Biochim Biophys Acta, 2002, 1603, 19-29. Ohkawa, Y; Yoshimura, S; Higashi, C et al. Myogenin and the SWI/SNF ATPase Brg1 maintain myogenic gene expression at different stages of skeletal myogenesis. J Biol Chem, 2007, 282, 6564-6570. Ozsolak, F; Song, JS; Liu, XS et al. High-throughput mapping of the chromatin structure of human promoters. Nat Biotechnol, 2007, 25, 244-248. Ozsolak, F; Poling, LL; Wang, Z et al. Chromatin structure analyses identify miRNA promoters. Genes Dev, 2008, 22, 3172-3183. Price, ER; Ding, HF; Badalian, T et al. Lineage-specific signaling in melanocytes. C-kit stimulation recruits p300/CBP to microphthalmia. J Biol Chem, 1998, 273, 17983-17986. Reisman, D; Glaros, S; Thompson, EA. The SWI/SNF complex and cancer. Oncogene, 2009, 28, 1653-1668. Reisman, DN; Sciarrotta, J; Wang, W et al. Loss of BRG1/BRM in human lung cancer cell lines and primary lung cancers: correlation with poor prognosis. Cancer Res, 2003, 63, 560-566. Roberts, CW; Galusha, SA; McMenamin, ME et al. Haploinsufficiency of Snf5 (integrase interactor 1) predisposes to malignant rhabdoid tumors in mice. Proc Natl Acad Sci U S A, 2000, 97, 13796-13800. Roberts, CW; Orkin, SH. The SWI/SNF complex--chromatin and cancer. Nat Rev Cancer, 2004, 4, 133-142. Rothhammer, T; Bosserhoff, AK. Epigenetic events in malignant melanoma. Pigment Cell Res, 2007, 20, 92-111. Saladi, SV; Marathe, H; de, lS, I. SWItching on the transcriptional circuitry in melanoma. Epigenetics, 2010a, 5, 469-475.

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

MITF Meets Chromatin in Melanoma

123

Saladi, SV; Keenen, B; Marathe, HG et al. Modulation of extracellular matrix/adhesion molecule expression by BRG1 is associated with increased melanoma invasiveness. Mol Cancer, 2010b, 9, 280. Salma, N; Xiao, H; Mueller, E et al. Temporal recruitment of transcription factors and SWI/SNF chromatin-remodeling enzymes during adipogenic induction of the peroxisome proliferator-activated receptor gamma nuclear hormone receptor. Mol Cell Biol, 2004, 24, 4651-4663. Sato, S; Roberts, K; Gambino, G et al. CBP/p300 as a co-factor for the Microphthalmia transcription factor. Oncogene, 1997, 14, 3083-3092. Scurr, LL; McKenzie, HA; Becker, TM et al. Selective loss of wild-type p16(INK4a) expression in human nevi. J Invest Dermatol, 2011, 131, 2329-2332. Sentani, K; Oue, N; Kondo, H et al. Increased expression but not genetic alteration of BRG1, a component of the SWI/SNF complex, is associated with the advanced stage of human gastric carcinomas. Pathobiology, 2001, 69, 315-320. Shen, H; Powers, N; Saini, N et al. The SWI/SNF ATPase Brm is a gatekeeper of proliferative control in prostate cancer. Cancer Res, 2008, 68, 10154-10162. Simone, C. SWI/SNF: the crossroads where extracellular signaling pathways meet chromatin. J Cell Physiol, 2006, 207, 309-314. Sinnberg, T; Menzel, M; Ewerth, D et al. beta-Catenin signaling increases during melanoma progression and promotes tumor cell survival and chemoresistance. PLoS One, 2011, 6, e23429. Stecca, B; Mas, C; Clement, V et al. Melanomas require HEDGEHOG-GLI signaling regulated by interactions between GLI1 and the RAS-MEK/AKT pathways. Proc Natl Acad Sci U S A, 2007, 104, 5895-5900. Steingrimsson, E; Copeland, NG ; Jenkins, NA. Melanocytes and the microphthalmia transcription factor network. Annu Rev Genet, 2004, 38, 365-411. Strobeck, MW; Reisman, DN; Gunawardena, RW et al. Compensation of BRG-1 function by Brm: insight into the role of the core SWI-SNF subunits in retinoblastoma tumor suppressor signaling. J Biol Chem, 2002, 277, 4782-4789. Sun, A; Tawfik, O; Gayed, B et al. Aberrant expression of SWI/SNF catalytic subunits BRG1/BRM is associated with tumor development and increased invasiveness in prostate cancers. Prostate, 2007, 67, 203-213. Trotter, KW; Archer, TK. The BRG1 transcriptional coregulator. Nucl Recept Signal, 2008, 6, e004. Vachtenheim, J; Sestakova, B; Tuhackova, Z. Inhibition of MITF transcriptional activity independent of targeting p300/CBP coactivators. Pigment Cell Res, 2007, 20, 41-51. Vachtenheim, J; Ondrusova, L; Borovansky, J. SWI/SNF chromatin remodeling complex is critical for the expression of microphthalmia-associated transcription factor in melanoma cells. Biochem Biophys Res Commun, 2010, 392, 454-459. Vachtenheim, J; Borovansky, J. "Transcription physiology" of pigment formation in melanocytes: central role of MITF. Exp Dermatol, 2010, 19, 617-627. Versteege, I; Sevenet, N; Lange, J et al. Truncating mutations of hSNF5/INI1 in aggressive paediatric cancer. Nature, 1998, 394, 203-206. Versteege, I; Medjkane, S; Rouillard, D et al. A key role of the hSNF5/INI1 tumour suppressor in the control of the G1-S transition of the cell cycle. Oncogene, 2002, 21, 6403-6412.

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

124

Jiri Vachtenheim and Lubica Ondrušová

Wajapeyee, N; Serra, RW; Zhu, X et al. Oncogenic BRAF induces senescence and apoptosis through pathways mediated by the secreted protein IGFBP7. Cell, 2008, 132, 363-374. Wang, X; Sansam, CG; Thom, CS et al. Oncogenesis caused by loss of the SNF5 tumor suppressor is dependent on activity of BRG1, the ATPase of the SWI/SNF chromatin remodeling complex. Cancer Res, 2009, 69, 8094-8101. Watanabe, T; Semba, S; Yokozaki, H. Regulation of PTEN expression by the SWI/SNF chromatin-remodelling protein BRG1 in human colorectal carcinoma cells. Br J Cancer, 2011, 104, 146-154. Widlund, HR; Horstmann, MA; Price, ER et al. Beta-catenin-induced melanoma growth requires the downstream target Microphthalmia-associated transcription factor. J Cell Biol, 2002, 158, 1079-1087. Wilson, BG; Roberts, CW. SWI/SNF nucleosome remodellers and cancer. Nat Rev Cancer, 2011, 11, 481-492. Xu, Y; Zhang, J; Chen, X. The activity of p53 is differentially regulated by Brm- and Brg1containing SWI/SNF chromatin remodeling complexes. J Biol Chem, 2007, 282, 3742937435. Yamamichi, N; Inada, K; Ichinose, M et al. Frequent loss of Brm expression in gastric cancer correlates with histologic features and differentiation state. Cancer Res, 2007, 67, 1072710735. Yokoyama, S; Feige, E; Poling, LL et al. Pharmacologic suppression of MITF expression via HDAC inhibitors in the melanocyte lineage. Pigment Cell Melanoma Res, 2008, 21, 457463. Yokoyama, S; Woods, SL; Boyle, GM et al. A novel recurrent mutation in MITF predisposes to familial and sporadic melanoma. Nature, 2011, 480, 99-103. Yoo, AS; Crabtree, GR. ATP-dependent chromatin remodeling in neural development. Curr Opin Neurobiol, 2009, 19, 120-126. Young, DW; Pratap, J; Javed, A et al. SWI/SNF chromatin remodeling complex is obligatory for BMP2-induced, Runx2-dependent skeletal gene expression that controls osteoblast differentiation. J Cell Biochem, 2005, 94, 720-730. Yu, H; McDaid, R; Lee, J et al. The role of BRAF mutation and p53 inactivation during transformation of a subpopulation of primary human melanocytes. Am J Pathol, 2009, 174, 2367-2377. Zhang, HS; Gavin, M; Dahiya, A et al. Exit from G1 and S phase of the cell cycle is regulated by repressor complexes containing HDAC-Rb-hSWI/SNF and Rb-hSWI/SNF. Cell, 2000, 101, 79-89. Zhou, Y; Dai, DL; Martinka, M et al. Osteopontin expression correlates with melanoma invasion. J Invest Dermatol, 2005, 124, 1044-1052. Zuo, L; Weger, J; Yang, Q et al. Germline mutations in the p16INK4a binding domain of CDK4 in familial melanoma. Nat Genet, 1996, 12, 97-99.

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

In: New Developments in Chromatin Research Editors: Neil M. Simpson and Valerie J. Stewart

ISBN: 978-1-62081-816-9 © 2012 Nova Science Publishers, Inc.

Chapter 6

THE STATE OF CHROMATIN AS AN INTEGRATIVE INDICATOR OF CELL STRESS Yuriy Shckorbatov

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

Institute of Biology, Kharkiv National University, Kharkiv, Ukrain

The terms heterochromatin and euchromatin and conception of connection of heteropicnotic state of chromosomes and parts of chromosomes with genetically inert regions of chromosomes was introduced by Emil Heitz [1,2]. The history of his outstanding findings is described in detail in [3]. These findings were made practically at the same time with findings of Dmitry Nassonov, who was interested in the non-specific cell reactions to different environmental factors, and defined the main traits of these reactions [4-6]. Among the main features of non-specific cell reactions to environmental factors which he defined as “paranecrosis” and we call “stress reaction”, Nassonov outlined the reaction of cell nucleus defined as gelatinization. Nassonov noted that this response might be reversible [5]. In modern terminology it corresponds to reversible process of heterochromatinization. Since 1996 the research group in the Department of Genetics of the Institute of Biology at the Kharkiv National University have been investigating the role of euchromatinheterochromatin transitions in cell nucleus in reaction to stress. Among the laboratory models of cell stress was selected 1) the influence of electromagnetic fields (including microwaves, magnetic fields, ultraviolet and laser light), 2) the influence of biologically active substances. Investigations of the state of chromatin in human cells in relation to the state of organism were conducted using cells obtained from subjects involved in active sports training. We chose human buccal epithelium cells as an object of experimental study. Morphology of these cells simplify greatly the observations of microscopic changes in chromatin structure because of very large diameter of the cell nucleus – about 10 µm. The nuclei in young epithelial cells have a disc–like or ellipsoid-like appearance. In aged cells they become a rod-like [7]. All the experiments were performed using young cells with round or ellipsoidal nuclei. Before the experiment cells were extracted from the organism with a bunt sterile spatula and placed into solution of the following composition: 3,03 mM phosphate buffer with addition of 2,89 mM of CaCl2. Initially the process of heterochromatinization was assessed by determining the

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

126

Yuriy Shckorbatov

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

number of heterochromatin granules located near the nuclear membrane, followed by assessing heterochromatin granules in a whole nucleus. The percentage of nuclei containing heterochromatin granules located near the inner nuclear envelope (we called it NEH – nearenvelope heterochromatin) was investigated. The quantity of heterochromatin granules was scored in 100 nuclei in 10 cell samples (total number 100x10=100) and the mean volume of this parameter was calculated. Such approach was utilized in the studies of microwaveinduced changes in human buccal epithelium cells [8,9]. In these and the other experiments with isolated buccal epithelium cells, the cells were placed in 3,03 mM phosphate buffer solution (pH=7,0) with addition of 2,89 mM CaCl2 [9]. A thin layer of cell suspension (approximately 0,5 mm) was placed on the surface of preparation glass and exposed to electromagnetic radiation of 42,2 GHz frequency and of surface power density of 0,2 mW/cm2, for different periods of time: from 1 to 60 seconds. The cells in suspension were placed for microwave exposure in the free space of horn antenna. The effects of microwaves investigated in these experiments produced no significant thermal effect; the calculated temperature increase in cells was about 0,001 degree centigrade. The NEH was determined 5 min after cell exposure [9]. The microphotographs of human buccal epithelium cells before (a) and after (b) exposure to microwaves are presented in Fig. 1. Electron microscopic images of the nucleus of buccal epithelium cell are presented in Fig. 2. After the microwave irradiation in the cell nuclei is observed the chromatin condensation located near nuclear envelope (Fig. 2b).

a

b

Figure 1. Cell of human buccal epithelium before (a) and after (b) exposure to microwaves (100 μW/cm2, 10 seconds).

The cell exposure to microwaves induced the NEH increase in cells of almost all donors (Fig. 3). Cells of one of the tested donors (donor E) revealed no reaction of NEH to microwave irradiation, but in cells of four other donors (A-D) the NEH got increased. This result was interpreted as an increase of chromatin condensation induced by microwave exposure, which was to some extent unexpected, because the other authors have demonstrated

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

The State of Chromatin as an Integrative Indicator of Cell Stress

127

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

a decrease of chromatin condensation induced by microwave exposure [10, 11]. In cells of donors A-D that demonstrated NEH reaction to microwaves, NEH got increased with exposure time, but the dependence of reaction on exposure time was different. The NEH increases almost monotonously till 60-second exposure in cells of donor C, however in cells of other donors it reaches maximum at different exposure times – 5 seconds (cells of donor B), 15 seconds (cells of donor D), and 30 seconds (cells of donor A). The cells of donor E do not reveal any significant reaction of NEH to microwaves, and this seems natural, because the cells of donor E demonstrated a very high initial level of NEH (97,7%). As there are obvious the individual differences in reaction of cells of different donors to microwaves, this justifies, in our opinion, using NEH as a tool for investigating individual sensitivity to microwaves. As a possible cause of the microwave-induced chromatin condensation we proposed the decrease of the electric charge of chromatin compounds and aggregation of nucleoprotein supramolecular complexes [9]. The argument in favor of such supposition is the correlation between heterochromatinization and decrease of the number of negatively charged nuclei induced by microwaves [8, 9]. This methodological approach was also used to investigate the cells subjected to electric field [12]. It was shown that electric field induces an opposite process – chromatin decondensation in human cells (Fig. 4). The isolated buccal epithelium cells were placed into electrophoretic cell in the described above solution for 5 minutes. Parameters of alternating electric field applied were: frequency – 50 Hz, field strength was 5, 10, 15, 20, 40, 63, 85, 110 V/cm. Donors of cells were men of different age - Donor A (23), Donor B (24), Donor C (52), Donor D (53), Donor E (72), and Donor F (73).

a

b

Figure 2. The nucleus of buccal epithelium cell at magnification x 12000 in control (a) and after microwave radiation exposure (b). Microwave exposure conditions: Frequency 42,2 GHz, power density 0,2 mW/cm2, exposure time 60 s.

As seen in Fig. 4, the initial level of NEH is higher in cells of donors of advanced age (donors E and F). The NEH level in cells of younger donors (A-D) in control is significantly lower. This observation is in a good agreement with our data about the age-related chromatin condensation in human buccal epithelium cells [13] which we discuss in more details below

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

128

Yuriy Shckorbatov

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

in this chapter. The plausible cause of the process of chromatin decondensation under the influence of external electric field may be an electric field-induced decrease of electrostatic bonds between chromatin supramolecular complexes. The argument in favor of such interpretation is the fact that changes in microscopic chromatin structure are fast (changes are observed immediately after the influence of electric field) and correlated with increase of cell nucleus electric charge [12].

Figure 3. The percentage of cells with near-envelope heterochromatin granules (NEH) in human buccal epithelium cells after microwave exposure (frequency 42,2 GHz and surface power density 0,2 mW/cm2)

In the next series of experiments the level of chromatin condensation was assessed by scoring the quntity of heterochromatin granules in human cell nuclei stained with 2% orcein in 45% acetic acid. The heterochromatin granules quantity (HGQ) was assessed by counting the number of heterochromatin granules in 30 or 50 nuclei and calculating the average value. 30 nuclei was experimentally established as an optimal number because the increase in this number did not result in significant decrease of the standard error (SE) of the HGQ. This method was described in [14]. The experiments revealed that microwave radiation exposure induced chromatin condensation in buccal epithelium cell nuclei, which was manifested by the increase of the HGQ [15-17]. In the Fig. 5 (a and b) one can see the results of the cell exposure to microwave radiation of frequencies 42,25 GHz and 187,5 GHz and surface power density of 0,2 mW/cm2.

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

The State of Chromatin as an Integrative Indicator of Cell Stress

129

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

Figure 4. The percentage of cells with near-envelope heterochromatin granules (NEH) in human buccal epithelium cells after cell exposure to electric field of different strength.

a

b

Figure 5. The heterochromatin granules quantity (HGQ) in the nuclei of buccal epithelium cells of four female 21 years old donors after the cell exposure to microwaves of frequency 37,5 GHz (a) and 18,75 GHz (b) with surface power density 0,2 mW/cm2 (data from [15]).

The Fig. 5 (a, b) shows that there are no major differences in cell reaction to exposure to microwaves of different frequencies but the same power and duration. Microwaves induce HGQ increase or heterochromatinization in cells of all donors. From these data we may conclude that 15 second exposure to microwaves of energy 0,2 mW/cm2 is close to or higher than “threshold” level of stimulus that increases HGQ. Reaction of cells of different donors was the same: 1 and 5 second exposure did not induce chromatin condensation and in some

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

130

Yuriy Shckorbatov

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

donors (A and B) at 1 and 5 second exposure even chromatin decondensation was observed at 1 and 5 second exposure. The cells of donor B revealed the relative stability of HGQ to microwaves of frequency 37,5 GHz. In [16] it was demonstrated that 10 min exposure of buccal epithelium cells to radiation of mobile phone induced the significant HGQ increase.

Figure 6. The heterochromatin granules quantity (HGQ) in nuclei of buccal epithelium cells of man of different age - A (21), B (51) after cell exposure (10 seconds) to microwaves of the frequency 35 GHz and surface power density 30 µW/cm2 (data from [17]).

In our experiments the chromatin condensation was observed at different regimes of microwave irradiation, for instance, at 35 GHz frequency 10 second exposure and power density of 30 µW/cm2 (Fig. 6). Cell donors were male, non-smokers. Donor A was 21 years old, donor B – 51 years old. In these experiments we also investigated the role of the polarization of electromagnetic waves in microwave-induced heterochromatinization. In order to obtain elliptically polarized radiation we used a grating polarizer. The elliptically polarized electromagnetic field can be interpreted as a result of superposition of two linearly polarized mutually orthogonal waves of identical frequency, but shifted in the phase. Thus, the circularly polarized field is the special case of the elliptically polarized field. In this study the source of microwave radiation generated the linearly polarized wave, which was transformed by the grating polarizer into elliptically polarized with the coefficient of elliptisity E min/Emax = 0,65. As one can see in Fig. 6, even the short exposure (10 seconds) induces the increase in HGQ parameter. In control in cells in elder donor B initial level of HGQ parameter was higher than that in cells of donor A that is in a good agreement with our previous results

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

The State of Chromatin as an Integrative Indicator of Cell Stress

131

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

indicating the age-related condensation of chromatin [13]. These and the other data, obtained from the cells of different donors, indicate that in some experiments the right- and leftpolarized microwaves induced approximately equal biological effects, but in some cases the left-polarized electromagnetic waves induced weaker effect than right-polarized one. As a rule, the linearly polarized microwaves induced more pronounced effect than circularly polarized ones, and in some cases the linearly polarized irradiation appears to have a weaker effect than a circularly polarized one [17]. The effect of microwaves on the chromatin state was also investigated in the cultured human cells – diploid fibroblasts [18]. The cells were subjected to a radiation of frequency f=36,65 GHz, the power density on the surface of exposed object was P=1, 10, 30, and 100 µW/cm2. Some of the experimental data are presented in Fig. 7.

Figure 7. The heterochromatin granules quantity (HGQ) in nuclei of human fibroblast cells after cell exposure (10 s) to microwaves (36,65 GHz) of surface power density of 10 and 100 µW/cm 2 (data from [18]).

The results of this investigation shows that cells exposed to microwave intensity of 10 and 30 μW/cm2 produced almost the same effect on HGQ, but the irradiation intensity of 100 μW/cm2 has a stronger effect. Effects of microwaves on HGQ of the right elliptical polarization are more pronounced than of the left or of the linear polarization. These differences become more apparent from the data in Table 1, which summarizes the results of experiments in triplicates. These data indicate that the effect of polarized radiation on cell nucleus depends on the state of polarization of electromagnetic waves. As shown in Table 2, the effect of the polarization is statistically significant. At the intensities 10 and 100 μW/cm2 the right-polarized radiation is more effective than the left polarized (Fig. 7).

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

132

Yuriy Shckorbatov

Table 1. ANOVA test for assessment of the influence of differently polarized microwave irradiation (10 μW/cm2) on the state of chromatin in cell nucleus (A – independent factor of polarization 1 – right, 2 – left, 3 – linear polarization; B – dependent factor - 1-3 experiment). Variants with probability level P>0,95 are marked in bold [19]

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

10 μW/cm2 A B B*A 30 μW/cm2 A B B*A 100 μW/cm2 A B B*A

F

P

4.93 1.73 0.29

0.01 0.18 0.88

2.64 0.05 0.20

0.08 0.95 0.94

13.22 0.03 0.08

0.00 0.97 0.99

We believe that this difference is due to the differential absorption of energy of polarized electromagnetic waves by asymmetric macromolecules and macromolecular complexes (including DNA and DNA-protein complexes) in the cell nucleus. Our experimental data indicating a higher sensitivity of cells to right-polarized microwave irradiation may be interpreted in connection with asymmetry of DNA. It is known that DNA molecule is a right helix and therefore its interaction with differently circularly polarized microwaves may be the result of DNA molecule asymmetry. Comparing the present data on differences in the activity of differently polarized microwaves with the results obtained in human buccal epithelium cells [17], one can conclude that the reaction of chromatin to the right- and left-polarized microwaves is cell type-specific. More pronounced effect of the right-polarized radiation is shown in the cells of human fibroblasts. In human buccal epithelial cells linearly polarized radiation appears to be more efficient, but this effect was not demonstrated in human fibroblasts. The process of recovery of cell structure after microwave radiation was investigated in cells of buccal epithelium exposed to microwaves of frequency 36,64 GHz of intensities 10, 100, and 400 µW/cm2 for 10 seconds, the donors of cells were 6 healthy men [19]. The results obtained for cells of one donor are presented in Fig. 8. As it may be seen from Fig. 8, the HGQ increased in all variants of cell exposure to microwaves. After a period of recovery, HGQ decreased to the control level. Number of heterochromatin granules decreased to its initial level after 0.5 hour (10 µW/cm2) and 2 hours (100 and 400 µW/cm2) after the cell exposure. To assess the influence of different factors, such as irradiation power, time of recovery, individual differences of donors, on HGQ we applied ANOVA test. In the Table 2, the results of ANOVA test are presented (T – independent factor of time of recovery, P – independent factor of power of irradiation B – dependent factor of individual differences of donors). As one can see, such independent factors as time of recovery (T) and power of irradiation (P) have significant influence on the state of chromatin. The fact that the interaction of these factors (T*P) is also significant indicates that the process of chromatin recovery after microwave exposure depends upon the

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

The State of Chromatin as an Integrative Indicator of Cell Stress

133

surface density of energy of microwave radiation. Chromatin state also depends on individual differences between donors (B) [19].

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

Figure 8. The heterochromatin granules quantity (HGQ) in nuclei of buccal epithelium cells of 53 years old donor after cell exposure (10 s) to microwaves of the frequency 36,64 GHz and surface power densities 10, 100 and 400 µW/cm2 (data from [19]).

Table 2. ANOVA test for assessment of the influence of factors of microwave irradiation on the state of chromatin and its recovery (T – independent factor of time of recovery: 1 – 30 sec, 2 – 30 min, 3 – 1 h, 4 – 2 h, 5 – 3 h; P – independent factor of power of irradiation: 1 – control, 2 – 10 µW/cm2, 3 – 100 µW/cm2, 4 –400 µW/cm2; B – dependent factor of individual differences of donors). Variants with probability level P>0,95 are marked in bold (data from [19])

T P T*P B B*T B*P B*T*P

F 1973.2 3131.9 471.9 168.2 13.7 9.2 10.2

p 0.00 0.00 0.00 0.00 0.00 0.00 0.00

Among different kinds of EMF not only microwave irradiation induces changes in chromatin structure. As show results obtained from cells of five donors, the ultra wideband radiation also proved to be very biologically active [20]. Our experimental data show the increase of HGQ immediately after cell sample exposure to ultra wideband pulse irradiation (Fig. 9).

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

134

Yuriy Shckorbatov

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

Figure 9. The heterochromatin granules quantity (HGQ) in nuclei of buccal epithelium in cells of donors A (21) and B (51) after ultra wideband pulse irradiation at different intensities of surface power densities (1 and 10 mW/cm2) (data from [20]).

As one can see, the low-intensity ultra wideband pulse radiation (E= 10-4 – 10-3 W/cm2, irradiation exposure – 10 s) induced increase in the quantity of heterochromatin granules in the interphase nuclei in the cells of all donors (A, B). Exposition of cells of donors A and B to irradiation of intensity 10 mW/cm2 induced the less pronounced effect than exposition to 1 mW/cm2. The results of this investigation indicate that the chromatin granule formation increases with the enhancement of the irradiation intensity within only limited intervals of power density [20]. We also investigated the process of HGQ recovery after ultra wideband pulse irradiation. After irradiation at intensity 1 mW/cm2 chromatin condensation is decreased 1 h after cell sample exposure, and radiation-induced effects disappear after 2 h of cell recovery (Fig. 9). The effects of radiation-induced HGQ increase after more intensive irradiation (10 mW/cm2) are more stable. The absence of full HGQ recovery after 2 h may be connected to severe cell damage by irradiation. The possibility of recovery indicates viability of exposed cells and transitory character of low-level irradiation influence on chromatin state, and dependence of the recovery process on power density of irradiation [20]. To investigate the changes in the electric charge of cell nucleus under the influence of microwaves, the method of staining of chromatin by positively charged molecules of vital stain methyl blue was applied. The data presented in [21] show that microwave radiation causes an increase in staining of the nuclei of cells of pea. Increased exposure time led to an increase in the degree of staining of the cell nucleus. The maximum effect was observed with an electromagnetic field irradiation for 10 min. These data indicate the increase of negatively charged groups in chromatin after exposure of pea roots to microwaves. These results are in some contradiction to the results of the decrease of the negative charge of human cell nuclei

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

The State of Chromatin as an Integrative Indicator of Cell Stress

135

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

induced by microwave radiation as revealed by the method of intracellular microelectrophoresis [8,9]. The possible explanation of this contradiction is that different methods give different results because they measures different characteristics – intracellular microelectrophoresis measures the changes in the electrophoretically active surface of cell nucleus and staining by vital dyes measures changes in the whole nucleus, including changes in internal areas of cell nucleus which are not assed by the method of intracellular microelecthrophoresis. Magnetic field also induces euchromatin-heterochromatin transitions. In our experiments the HGQ parameter increased after the cell exposure to magnetic field of intensity 50 mT for 10 minutes. In these experiments magnetic field was applied in different ways: constant magnetic field and magnetic field rotating clockwise and counterclockwise. The effect of magnetic field on chromatin condensation was more pronounced after cell exposure to magnetic field rotating clockwise than counterclockwise [22]. Magnetic field effects on chromatin condensation were also investigated in brine shrimp Artemia sp. [23]. Dry Artemia cysts were processed by magnetic field as follows: magnetic field in zone of object was B=25 mT, exposure time was 10 minutes. We applied different variants of magnetic field treatment: clockwise and counterclockwise rotating magnetic field with a northern (N) or southern (S) pole of magnet proximal to the probe. The control sample was not exposed to magnetic field.

Figure 10. Heterochromatin granules quantity (HGQ) in Artemia cells after constant and rotating magnetic field influence (the southern pole of magnet is proximal). Each column presents mean data of 3 independent experiments ± standard error (data from [23]).

Each experimental group was studied in triplicates. After a definite period of irradiation (20 days) the cysts were incubated in marine water (salinity 35‰, temperature +250 C). After 48 hours we analyzed the percentage of hatching by a standard method determining the number of Artemia larvae (nauplia) hatching from 100 eggs in three independent experiments. All experiments were conducted in a “blind” manner. The data obtained in this study

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

136

Yuriy Shckorbatov

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

demonstrate non-thermal effects of magnetic fields manifested in the increase of Artemia hatching percentage and chromatin condensation in new-born nauplia (Fig. 10). All tested variants of magnetic field induced chromatin condensation but the biological activity of different modifications of magnetic field was different. The right-sided (clockwise) rotation of magnetic field proved to be less effective if the northern pole of magnet was proximal to the sample, but if the southern pole was proximal to the sample the left-sided (counterclockwise) variant of magnetic field rotation was less effective. The data obtained may have the following interpretation. The magnetic field effects on hatching percentage are connected with its effect as a non-specific stressor that may promote the process of activation of dormant blastula of Artemia cyst. This suggestion is supported by the data of magnetic field-induced chromatin granule formation in Artemia nauplia. In our opinion, the basic mechanisms of chromatin change under the influence of EMF may be a result of the following processes: 1. Direct EMF-induced changes in the DNA-protein interactions in the chromatin. Such process may be connected with rearrangement of electrons in the DNA molecules under the influence of external electric field. The so-called electromagnetic response elements (EMREs) in DNA may be the primary receptors of EMF influence [24]. 2. Modifications of chromatin proteins, primarily histones. For instance, it is known, that histone deacetylation leads to a decrease in transcriptional activity and chromatin condensation [25]. 3. Of particular importance is, in our opinion, an increase in the intracellular concentration of calcium ions. The permeability of cell membrane increases to vital dyes [19] and ions [26] under the influence of EMF. It is known that concentration of calcium in cytoplasm increases significantly under the action of microwaves [27] and low-frequency electromagnetic fields [28]. It is known that calcium ions play role in signal transmission from cell membrane to intracellular system of regulation. Increase in calcium composition induces chromatin condensation and reduces accessibility of proteins to chromatin [29], so EMF-induced calcium increase in cytoplasm may induce chromatin condensation. The first of the mentioned causes of EMF-induced chromatin condensation is specific, and the others are non-specific and supposedly are innate to the processes of stress-induced chromatin condensation produced by different agents. The microwave-induced chromatin condensation was also demonstrated in published research from I.Y. Belyaev laboratory. Human lymphocytes were exposed to microwaves using as a source of microwave radiation a GSM900 mobile telephone. By the method of anomalous viscosity time dependence (AVTD) after 915 MHz cell exposure the chromatin condensation was demonstrated in cells of 5 persons of 10 tested, and the chromatin decondensation (one person of 10 tested), or no effects at all (4 persons). After cell exposure at the frequency of 905 MHz was observed either significant condensation in cells (one person), or chromatin decondensation (one person), or no effects [30]. The microwave exposure also affected the number of foci containing tumor suppressor p53-binding protein 1 (53BP1) and phosphorylated histone H2AX (γ-H2AX) in cell nuclei. The 53BP1/γ-H2AX foci have been shown to colocalize in foci with DNA double-strand breaks (DSBs). Neither cells from control (non-hypersensitive to EMF subjects) nor cells from hypersensitive

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

The State of Chromatin as an Integrative Indicator of Cell Stress

137

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

subjects responded to 915 MHz by induction of 53BP1/γ-H2AX foci. The responses to 905 MHz were not consistent among subjects, and increase, decrease, or no effect on the number of foci, was observed, dependingt on the subject. The numbers of 53BP1 and γ-H2AX foci were not significantly different between cells from controls and hypersensitive to EMF subjects, and 53BP1 and γ-H2AX foci formation depended on microwave frequency. These effects suggest induction of stress response and/or DNA damage [30].

Figure 11. The heterochromatin granules quantity (HGQ) in buccal epithelium cell nuclei of donors A, B, C (age 22 years) 5 min after ultra violet light exposure (unpublished data).

It was demonstrated that microwave radiation of mobile phones using Global System for Mobile Communication (GSM) and the Universal Global Telecommunications System (UMTS) inhibit formation of endogenous 53BP1 foci in human primary fibroblasts and mesenchymal stem cells (MSCs). Microwaves of mobile phones inhibited formation of 53BP1 foci in human primary fibroblasts and mesenchymal stem cells. Importantly, the same GSM carrier frequency (915 MHz) and UMTS frequency band (1947.4 MHz) were effective for all cell types. Exposure at 905 MHz did not inhibit 53BP1 foci in differentiated cells, either fibroblasts or lymphocytes, whereas some effects were seen in stem cells at 905 MHz. Contrary to fibroblasts, stem cells did not adapt to chronic exposure during 2 weeks. The obtained results indicate that stem cells the more sensitive to microwave exposure than are differentiated human cells, lymphocytes, and fibroblasts, whereas fibroblasts are the least sensitive. Inhibitory effects of microwave exposure on DSB repair in stem cells may result in formation of chromosomal aberrations and therefore development of cancer [31]. Our results demonstrate the increase of HGQ after cell exposure to ultraviolet (UV) light. The apparatus for luminescent diagnostics OLD-41 (Sverdlovsk, Russia) was used as a source

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

138

Yuriy Shckorbatov

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

of UV light. Light characteristics: maximal light intensity at wavelength 360 nm, surface power of light 0,75 mW/cm2. Donors of buccal epithelium cells were women of age 22. Results of the experiment are presented in Fig. 11. As one can see, the cell exposure to UV light at exposure time 15 - 60 seconds results in elevation of HGQ. The less exposure times provoked HGQ increase only in cells of one donor - Donor A. Such individual differences may be connected with individual resistance of different donors to UV light.

Figure 12. The heterochromatin granules quantity (HGQ) in buccal epithelium cell nuclei of donors A (18), B (19), C (20), and D (78) after laser light exposure (data partly from [14]).

Helium-neon laser light also affect the HGQ in isolated human buccal epithelium cells, as it can be seen from the data of Fig. 12. In this figure are presented data obtained in the experiment on cells of four male donors: Donor A – 18 years, Donor B – 19 years, Donor C – 20 years, and Donor D – 78 years. The source of laser light (LGN-120, Russia) produced illumination of 1 mW/cm2 at the surface of illuminated object. The exposure time was 1; 4,5; 9; 18; 37; 75; 150, and 300 seconds. It may be seen that HGQ stably increases in cells of all donors only at cell exposure during 75 seconds and more. At shorter exposure the manner of HGQ changes is individual for cells of different donors. This may be connected with low hazard effect of laser light to cells (in contrast to UV light), and thus the stress reaction of cells is not distinctly manifested. It was demonstrated that the state of chromatin condensation depended upon the temperature of the incubation medium. This dependence demonstrate some donor-related peculiarities, but as a rule the minimal level of HGQ is registered at 36 degree centigrade. The increase of the temperature of the medium to 40, 44, and 48 oC resulted in the significant

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

The State of Chromatin as an Integrative Indicator of Cell Stress

139

progressive increase of HGQ. The decrease of the temperature of the incubation medium to 32 and 15 oC also resulted in the significant HGQ increase [32].

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

Figure 13. The heterochromatin granules quantity (HGQ) in buccal epithelium cell nuclei of female donor (23), after stress hormone exposure of isolated cells during 5-60 minutes (data from [32])

The treatment of human buccal epithelium cells with a so-called stress hormones increased HGQ [33]. The experimental data obtained from the cells of one female 22-years old donor are presented in Fig. 13. The concentrations of adrenalin (epinephrine) and hydrocortisone applied in these experiments are close or slightly higher to these in human blood serum in the state of stress provoked by the sport exercises [34]. As it may be seen from presented data, adrenalin induces heterochromatin condensation progressing with exposure time in both applied concentrations (2,89 and 4,55 nM). Hydrocortisone acts in more complex manner – 5-15 min cell exposure induces increase in HGQ, but the further increase of exposure time results in the relative decrease of HGQ as compared to 15 – min exposure level. In the experiments with good-will donors executing sportive exercises it was shown that the HGQ parameter changes during the training exercises and in the recovery period [33]. The donors of cells were students of the Kharkiv Institute of Air Forces of Ukraine (men). Cell were obtained from donors in field conditions and analyzed in laboratory. The training walks lasted for 8 – 10 hours. The mean speed during the every walk was approximately 5-6 km/h. During performing training walks in every stage of the walk the energy waste for one person was approximately 1 MJ. As one can see from the data of Fig. 14, the training charges induced a significant increase of HGQ in all donors. After the period of rest during 16 h (sleep) the HGQ decreased in cells of four donors to the control level but increased in cells of donor С. Interestingly, that on the stage 3 of training or 4 for one donor, the HGQ relatively decreases which may be related to the process of adaptation to training charges.

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

140

Yuriy Shckorbatov

Figure 14. The heterochromatin granules quantity (HGQ) in buccal epithelium cell nuclei of five donors, after sportive training (data from [32]).

* M=14.5 s=0.7

16

* M=15.0 s=0.6

14 12

HGQ

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

18

M=11.8 s=0.5

10 8 6 4 2 0 control

stage 1

stage 2

Stage of training

Figure 15. Influence of the dosed physical activity on the state of chromatin in buccal epithelium cells. Mean data for 13 donors (data from [34]).

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

The State of Chromatin as an Integrative Indicator of Cell Stress

141

Systolic an diastolyc pressure, mm Hg pulse and breathing frequency, number/min

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

In the experiment in sport hall with donors – students of Kharkiv National Medical Unisersity was results obtained also indicated the increase of HGQ after training [35]. Students were divided in two groups, investigated in different days: group 1 (8 students) and group 2 (5 students). Sport exercises on stationary training bicycle VE02 (Kiev) of power 400 W during 1 min were performed twice with a period of rest 30 min. The following physiological indexes were determined: arterial blood pressure by Кorotkov’s method with the use of manometer of OTK H87, pulse frequency, and frequency of breathing by the standard count. All indexes, and also the test on buccal epithelium cells were measured before physical activity and directly after physical activity. The summarized data are presented in the Fig. 15. So, the results of this experiment indicate that the physical stress produced by the dosed physical activity causes the considerable increase of degree of heterochromatinization in the nuclei of cells of human buccal epithelium. As a rule, the level of heterochromatinization increases after first stage of training, but in some donors it increases significantly only after the second stage of training. In parallel with HGQ investigation we analyzed the influence of the physical activity on some physiological parameters (Fig. 16).

180 160

*

*

*

*

control stage 1

140

stage 2

120 100 80

*

*

60 *

40

*

20 0 Systolyc pressure

Diastolyc pressure

Pulse frequency

Breathing frequency

Physiological parameter

Figure 16. Some physiological parameters measured in parallel with HGQ (data from [34]).

As one can see from the data, the physical activity caused the considerable increase of indexes of arterial blood pressure, pulse frequency and breathing frequency that is related to activation of the sympathoadrenal system and to formation of the first phase of stress according to H. Selye [36]. We also investigated changes in HGQ in cells of 31 goodwill donors after executing some activity connected with reading and playing computer games during 40 minutes. It was demonstrated that visual charges connected with reading induced the HGQ increase, on the contrary playing computer games induced HGQ decrease [37].

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

142

Yuriy Shckorbatov

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

Previously we have shown that in practically healthy people the HGQ changes with age [13]. The approximated dependence of HGQ of age among 55 male donors is presented in Fig. 17. As one can see, the HGQ increased after 30 years but the process of HGQ increase with age is not monotonous but S-shaped. The stabilization and even decrease of the process of hetrochromatinization in buccal cell nuclei in the group of donors of age after 70 may be related to different processes. One of them is the process of age-related ‘natural selection’ (not in a Darwinian sense) of persons with a low HGQ level.

Figure 17. HGQ in persons of different age.

The HGQ parameter differs from control group in people with illness. For instance, such difference is shown for subjects with multiple sclerosis. It was demonstrated that HGQ among people with multiple sclerosis is significantly higher than among practically healthy people. Therefore, the processes of heterochromatinization and the decrease of functional activity of nuclei among the people with multiple sclerosis are more pronounced and their biologic age is higher [38]. Summarizing, the relative degree of heterochromatinization in cell nuclei changes rapidly in reaction to different external factors: of electromagnetic nature (EMF or UV and laser light), temperature, and of chemical nature - physiologically active substances. This parameter also rapidly changes with changes of physiological state of human organism. The new insight into the problem of chromatin granule formation in cell nucleus under the influence of environmental stress factors was made in the work [39] in which the role of protein Heat Shock Factor 1 (HSF-1) in formation of chromatin granules was demonstrated. Within 30 minutes of heat shock (42 OC), HSF1 granules ranging in size from 0.5 to 1.5 μm

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

The State of Chromatin as an Integrative Indicator of Cell Stress

143

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

.

were detected in 80-90% of HeLa cells, and by 60 minutes of heat shock, 95% of the cells exhibited brightly staining HSF1 granules. Up through two hours of heat shock, HSF1 granules were ubiquitous in all cells. Analysis of the size distribution of the granules in HeLa cells heat shocked at 42°C for 2 hours revealed that they can be described as two populations of which 60% of the foci correspond to smaller (0.5 to 1.5 mm) During continuous exposure to heat shock, both the fluorescence intensity and the numbers of HSF1 foci increased. Comparison to the level of HSF1 DNA binding activity reveals that the appearance of HSF1 granules correlates closely with both the acquisition of HSF1-DNA binding activity and the phosphorylated state of HSF1. After 2 hours of continuous heat shock, the fraction of cells which exhibit HSF1 granules rapidly declined [39]. In normal fibroblasts, HSF1 foci can be classified in three major groups according to their morphology (Fig. 1B to D): 77% of HSF1 foci consisted of a cluster of up to ten granules which sometimes displayed a necklace or ring-like shape, 11% of the foci appeared as large foci in which granules could not be distinguished, and 12% of HSF1 foci appeared as two unique punctate signals [40]. The stress granules are formed in distinct sites on chromosomes, in human cells one of them is 9q12 locus. HSF1 binds to satellite III repeated elements and drives the RNA polymerase II-dependent transcription of these sequences into stable RNAs which remain associated with the 9q12 locus for a certain time after synthesis. Other proteins, in particular splicing factors, were also shown to relocalize to the granules upon stress [41]. The role of satellite III DNA transcripts in cell reaction to stress is analyzed in [42]. It has been proposed that sequestration of splicing factors within the granules through their association with nuclear satellite III transcripts could regulate splicing function during stress. In resent years are elucidated many molecular aspects of composition of age-related nuclear granules of facultative heterochromatin, or so-called Senescence-Associated Heterochromatin Foci (SAHF) [43], but some aspects of formation of nuclear or chromatin granules in relation to various stress factors remain uninvestigated. The area of potential applications of chromatin granules as a very sensitive indicator of the state of human organism remains almost completely unexplored. We believe that this indicator may be used in different areas of health-related research as well as occupational and sport medicine.

REFERENCES [1] [2] [3]

[4] [5]

Heitz E. Das Heterochromatin des Moose. I. Jar Wiss Bot, 1928, B.69, S. 762-818. Heitz E. Heterochromatin, Chromozentren, Chromomeren. Berl Deut Bot Ges, 1929, B.47, S. 274-284. Passarge E. Emil Heitz and the Concept of Heterochromatin: Longitudinal Chromosome Differentiation was Recognized Fifty Years Ago. Am J Hum Genet, 1979, 31, 106-115. Nassonov D.N. Uber den Einfluss des Oxidationsprocesse auf die Verteilung von Vitalfarbs toffen in Zelle // Ztschr Zellforsch mikrosk Anat, 1930, B.11, S. 179-217. Nassonov D.N. Uber die Ursachen der reversiblen Gelatinierung des Zellkernes. Protoplasma, 1932, B.15, S. 239-267.

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

144 [6]

[7] [8]

[9]

[10]

[11]

[12]

[13]

[14]

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

[15]

[16]

[17]

[18]

[19]

Yuriy Shckorbatov Nasonov D.N. & Alexandrov V.A. (1940) The reaction of living matter to external influences. Moscow - Leningrad: Publishing House of USSR Academy of Science (in Russian). Bhattacharya P.K., Russo V.M., Pappelis A.J. Changes in the nucleic acid and protein contents in nuclei of human buccal cells. Anal Quant Cytol, 1983, v. 5, 124-128. Shckorbatov Y.G., Shakhbazov V.G., Grigorieva N.N., Bogoslavski A.M. The influence of millimeter range irradiation on the state of human cell nuclei. 13th International Wroclaw Symposium and Exhibition on Electromagnetic Compatibility. Wroclaw, 1996, 136-138. Shckorbatov Y.G., Shakhbazov V.G., Grigoryeva N.N., Grabina V.A. Microwave irradiation influences on the state of human cell nuclei. Bioelectromagnetics, 1998, v. 19, 414-419. Belyaev I.Y., Alipov Y.D., Shcheglov V.S., Lystsov V.N. Resonance effect of microwaves on the genome conformational state of E. coli cells. Z Naturforsch [C], 1992, v. 47, 621-627. Belyaev I.Y., Shcheglov V.S., Alipov Y.D., Polunin V.A. Resonance effect of millimeter waves in the power range from 10(-19) to 3 x 10(-3) W/cm2 on Escherichia coli cells at different concentrations, Bioelectromagnetics, 1996, v. 17, 312-321. Shckorbatov Y.G., Shakhbazov V.G., Rudenko A.O. Modification of electrokinetic properties of nuclei in human buccal epithelium cells by electric fields. Bioelectromagnetics, 2001, v. 22, 106-111. Shckorbatov Y.G. Age-related changes in the state of chromatin in human buccal epithelium cells. The XVII Word Congress of Gerontology. Book of Abstracts. Vancouver, 2001. Gerontology, 2001, v. 47, Suppl. 1, 617-618. Shckorbatov Y.G. He-Ne laser light induced changes in the state of chromatin in human cells. Naturwissenschaften, 1999, v. 86, 452-453. Shckorbatov Y.G., Sakhbazov V.G., Navrotska V.V., Zhuravliova L.A., Gorobets N.N., Kiyko V.I., Fisun A.I., Sirenko S.P. Changes in the state of chromatin in human cells under the influence of microwave radiation. Sixteenth International Wroclaw Symposium and Exhibition on Electromagnetic Compatibility,Wroclaw,2002, Part 1, 87-88. Shckorbatov Y.G., Trofimov S.V., Shakhbazov V.G., Grabina V.A., Gorobets N.N. The influence of microwaves with different state of polarization upon the state of chromatin and viability of Drosophila. The Second International workshop “Ultrawideband and ultrashort impulse signals” (UWBUSIS’04), Sevastopol, 2004, 246-247. Shckorbatov Y.G., Pasiuga V.N., Kolchigin N.N., Grabina V.A., Batrakov D.O., Kalashnikov V.V., Ivanchenko D.D., Bykov V.N. The influence of differently polarized microwave radiation on chromatin in human cells. International Journal of Radiation Biology, 2009, v. 85, 322-329. Shckorbatov Y. G., Pasiuga V. N., Goncharuk E. I., Petrenko T. Ph., Grabina V. A., Kolchigin N. N., Ivanchenko D. D., Bykov V. N., Dumin O. M. Effects of differently polarized microwave radiation on the microscopic structure of the nuclei in human fibroblasts. Journal of Zhejiang University-SCIENCE B (Biomedicine & Biotechnology), 2010, v. 11(10), 801-805. Shckorbatov Y.G., Pasiuga V.N., Kolchigin N.N., Grabina V.A., Ivanchenko D.D., Bykov V.I., Dumin O.M. Cell nucleus and membrane recovery after exposure to

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

The State of Chromatin as an Integrative Indicator of Cell Stress

[20]

[21]

[22]

[23]

[24] [25] [26] [27]

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

[28]

[29] [30]

[31]

[32]

[33]

145

microwaves // Proceedings of the Latvian Academy of Sciences. Section B, 2011, v. 65 (672/673), 13–20. Shckorbatov Y.G., Pasiuga V.N., Kolchigin N.N., Batrakov D.O., Kazansky O.V., Kalashnkov V.V. Changes in the human nuclear chromatin induced by ultra wideband pulse irradiation. Central European Journal of Biology, 2009, v. 4, 97-106. Shckorbatov Y.G., Derenko O.S., Grabina V.A., Bykov V.N. Influence of microwave radiation on the binding of the cationic dye methylene blue by nuclei of pea cells. Herald of Kharkiv National Agrarian University, 2010, No 2, 83-87 (in Russian). Shckorbatov Y.G., Badun O.V., Trofimov S.V. Grabina V.A., Shakhbazov V.G. Influence of microwave radiation, constant and rotating magnetic field on the state of chromatin in human buccal epithelial cells and viability of Drosophila melanogaster. Proceedings of XXII International scientific and practical. Conference Lasers Application in Medicine and Biology, Yalta, 2004, 120-121 (in Russian). Shckorbatov Y.G., Rudneva I.I., Pasiuga V.N., Grabina V.A., Kolchigin N.N., Ivanchenko D.D., Kazanskiy O.V., Shayda V.G., Dumin O.M. Electromagnetic fields effects on Artemia hatching and chromatin state. Central European Journal of Biology, 2010, v. 5, 785-790. Blank M., Goodman R. Initial interactions in electromagnetic field-induced biosynthesis. Journal of cellular physiology, 2004, 199, 359–363. Deal R. B., Henikoff S. Capturing the dynamic epigenome. Genome Biology, 2010, 11:218 http://genomebiology.com/2010/11/10/218. Alekseev S.I., Ziskin M.C. Millimeter microwave effect on ion transport across lipid bilayer membranes. Bioelectromagnetics, 1995, v. 16, 124-131. Cho M.R., Thatte H.S., Silvia M.T., Golan D.E. Transmembrane calcium influx induced by ac electric fields. The FASEB Journal, 1999, v. 13, 677-683. Pazur A., Rassadina V. Transient effect of weak electromagnetic fields on calcium ion concentration in Arabidopsis thaliana. BMC Plant Biology, 2009, v. 9:47 doi:10.1186/1471-2229-9-47. Martin R. M., Cardoso M.C. Chromatin condensation modulates access and binding of nuclear proteins. FASEB J, 2010, 24(4), 1066–1072. Markovà E., Hillert L., Malmgren L., Persson B.R.R., Belyaev I.Y. Microwaves from GSM mobile telephones affect 53BP1 and γ-H2AX foci in human lymphocytes from hypersensitive and healthy persons. Environ Health Perspect, 2005, v.113, 1172–1177. Markovà E., Malmgren L., Belyaev I.Y. Microwaves from Mobile Phones Inhibit 53BP1 focus formation in Hhuman stem cells more strongly than in differentiated cells: Possible mechanistic link to cancer risk. Environmental Health Perspectives, 2010, v. 118, 394-399. Zhuravleva L.A., Shckorbatov Y.G., Shakhbazov V.G. Changes in the degree of compaction of chromatin in nuclei of human buccal epithelium cells under the influence of high and low positive temperature incubation. Proceedings on Basic and Applied Genetics. Issue 2. Kharkov, 2003, 289-296 (in Russian). Shckorbatov Y.G., Zhuravleva L.A., Navrotskaya V.V., Miroshnichenko E.V., Montvid P.Y., Shakhbazov V.G., Sutushev T.A. Chromatin structure and the state of human organism. Cell Biol. Internat. 2005, v. 29, 77-81.

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

146

Yuriy Shckorbatov

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

[34] Hartley L.H., Mason J.W., Hogan R.P., Jones L.G., Kotchen T.A., Mougey E.H., Wherry F.E., Pennington L.L., Rickets P.T.J. Multiple hormonal responses to prolonged exercise in relation to physical training. J Appl Physiol, 1978, v. 33, 607-610. [35] Shckorbatov Y., Samokhvalov V., Bevziuk D., Kovaliov M. Changes in chromatin state in donors subjected to physical stress. arXiv:0902.0089 [pdf] Tue 3 Feb 09 Comments: 8 pages, 3 figures, 4 tables. [36] Selye H., Stress Without Distress, New York, Lippencott, 1974. [37] Shckorbatov Y.G., Kochina M.L., Poletova N.P., Magda I.Y. Application of cytological characteristics for assessment of fatigue in vision charges. Materials of XI International Conference on Bionics, Biocybernetics and Applied Biophysics. Kyiv, 2010, November 4-6, 90 (in Russian). [38] Voloshina N.P., Shckorbatov Y.G., Gaponov I.K. The state of chromatin in the nuclei of buccal epithelium as a marker of multiple sclerosis. Ukrainian Neurology Journal (Ukrayinsky nevrologіchny zhurnal). 2010, No 2, 47-52 (in Russian). [39] Cotto J.J., Fox S.G., Morimoto R.I. HSF1 granules: a novel stress-induced nuclear compartment of human cells. Journal of Cell Science 1997, v.110, 2925-2934. [40] Jolly C., Morimoto R.I., Robert-Nicoud M., Vourc’h C. HSF1 transcription factor concentrates in nuclear foci during heat shock: relationship with transcription sites. Journal of Cell Science, 1997, 110, 2935-2941. [41] Metz A., Soret J., Vourc’h C., Tazi J., Jolly C. A key role for stress-induced satellite III transcripts in the relocalization of splicing factors into nuclear stress granules. Journal of Cell Science, 2004, v. 117, 4551-4558. [42] Ugarkovic D. Functional elements residing within satellite DNAs. EMBO reports, 2005, v. 6, 1035-1039. [43] Adams P.D. Remodeling of chromatin structure in senescent cells and its potential impact on tumor suppression and aging. Gene, 2007, v. 397, 84–93.

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

In: New Developments in Chromatin Research Editors: Neil M. Simpson and Valerie J. Stewart

ISBN: 978-1-62081-816-9 © 2012 Nova Science Publishers, Inc.

Chapter 7

A GENOMICS APPROACH TO ANALYSING DNA DAMAGE AND ITS REPAIR THROUGHOUT ENTIRE GENOMES Yumin Teng1, Mark Bennett1, Katie E. Evans1, Huayun Zhuang-Jackson1, Andy Higgs2, Simon H. Reed1 and Raymond Waters,1 1

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

Department of Medical Genetics, Haematology and Pathology, School of Medicine, Cancer Genetics Building, Cardiff University, Heath Park, Cardiff, UK 2 Agilent Technologies UK Limited, Winnersh Triangle, Wokingham, Berkshire, UK

ABSTRACT DNA damage occurs via endogenous and exogenous genotoxic agents; it compromises a genome’s integrity and unrepaired DNA damage can result in mutation and cell death. Knowing where damage occurs within a genome is crucial to understanding the repair mechanisms which protect this integrity. Here we describe a new development based on microarray technology which uses ultraviolet light induced DNA damage as a paradigm to determine the position and frequency of DNA damage and its subsequent excision repair throughout the entire yeast genome. One of these excision repair mechanisms is nucleotide excision repair (NER) which is well conserved during evolution. In humans a NER deficiency predisposes affected individuals to a cancer-prone genetic disorder, xeroderma pigmentosum. NER removes a wide range of DNA lesions, and often recognizes damages that distort the DNA helical structure including ultraviolet light (UV) induced cyclobutane pyrimidine dimers (CPDs). More than 30 repair proteins have been identified as having roles in NER on naked DNA templates in vitro. In cells, DNA is tightly packaged as chromatin and this poses a barrier 

To whom correspondence should be addressed. Tel:+44 29 20687336; Fax:+44 29 20687343; Email: [email protected].

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

148

Yumin Teng, Mark Bennett, Katie E. Evans et al.

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

to the operation of these core proteins. The roles of these core proteins were identified in part via studies with Saccharomyces cerevisiae, and where NER has many homologous steps to the mechanism in humans. How NER operates in the context of chromatin remains elusive, although some inroads have been made in this area often by employing methods to examine DNA damage and repair in specific regions of a genome. Technologies are available to examine DNA damage and repair in selected genes and certain damages can be analyzed at nucleotide resolution in some of those genes. However, none of these approaches are designed to examine repair events throughout genomes at a high resolution in order to identify the variations in repair rate and reveal any correlation of this with changes in chromatin structure. A whole genome high resolution approach would enable one to examine the global influence of factors on repair: for example, the accessibility of DNA damage in chromatin to repair proteins and the chromatin modification factors that facilitate damage repair. To address this there was a need to develop a new approach to rapidly screen entire genomes for DNA damage and to measure their repair. DNA microarrays were developed decades ago for whole genome transcription profiling. The combination of these and chromatin immunoprecipitation, namely ChIP on chip, was an extension that enabled the identification of the binding sites of DNA-binding proteins and the covalent modifications to nucleosomes on a genome-wide basis. Here, we describe a genome wide approach that employs microarrays to monitor UV-induced DNA damage (CPDs) and its repair. Quality control measure included using the mitochondrial DNA probes as a control, as this genome does not undertake NER and CPDs persist within it, and also analysing events in a yeast rad4 mutant which is defective in much of the NER genome – wide. Hence our approach enables us to identify the UV-induced changes in chromatin and the chromatin modifications that facilitate and influence repair throughout an entire genome.

INTRODUCTION Organisms on earth have been constantly exposed to agents that damage the genetic material and life on earth could not have survived unless DNA repair mechanisms had evolved [1]. In fact, evolution has had to deal with a delicate balance; driving the repair of most DNA damages, but allowing some to be converted to mutations so as evolution could occur [1]. It is estimated that each cell in a human body can have tens of thousands of DNA damages induced each day [1]. All organisms have a spectrum of DNA repair mechanisms to process DNA damage. Many of these have been highly conserved throughout evolution, so further highlighting the essential role that these processes play in maintaining life. This feature has enabled researchers to employ a spectrum of genetically tractable organisms to unravel how the various DNA repair mechanisms operate, and then to apply that knowledge to quickly elucidate as to whether and how they function in humans [1]. DNA damage occurs via endogenous and exogenous genotoxic agents, generating base losses and modifications, strand breaks, DNA-DNA crosslinks, bulky chemical adducts and other DNA alterations [1]. If DNA damage damage remains unrepaired, it will impact on DNA metabolism, and result in abnormal cellular activity. This in turn can cause mutation or cell death. One of the DNA repair mechanisms is nucleotide excision repair (NER), and in

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

A Genomics Approach to Analysing DNA Damage …

149

humans a NER deficiency predisposes affected individuals to a cancer-prone genetic disorder, xeroderma pigmentosum [1]. XP patients have a 2000-fold increased risk of melanoma and patients must avoid exposure to sunlight, the primary causative agent of this cancer [1]. NER removes a wide range of DNA lesions, and often recognizes damages that distort the DNA helical structure, including ultraviolet light (UV) induced cyclobutane pyrimidine dimers (CPDs). The analysis of the repair of this damage has contributed considerably to our understanding of how NER functions. More than 30 repair proteins have been identified as having roles in NER on naked DNA templates in vitro [1]. The roles of these core proteins were identified in part via studies with Saccharomyces cerevisiae, and where NER has many homologous steps to the mechanism in humans [1]. In eukaryotic cells, DNA is tightly packaged as chromatin and this poses a barrier to the operation of these core proteins [1]. For example, in humans each microscopic cell contains about 2 metres of DNA packaged to fit into the cell nucleus. How NER operates in the context of chromatin remains elusive although some inroads have been made in this area [2,3] often by employing methods to examine DNA damage and repair in specific regions of a genome. The early observations of Smerdon and co-workers showed that histone acetylation played a role in facilitating efficient NER [4,5]. More recently, technologies became available to examine DNA damage and repair in selected genes (reviewed in 1) and certain damages can be analyzed at nucleotide resolution in some of those genes (reviewed in 6,7). These methods have enabled correlations to be made with how the DNA damage-induced covalent modifications of histones and the SwiSnf activities of enzymes that can move nucleosomes in cis and trans on the DNA impinge on NER (reviewed in 2). Employing these methods has uncovered correlations between NER and histone H3 acetylation at lysines K9 and K14 [8-10]. This is primarily mediated by the histone acetyltransferease (HAT) Gcn5. The role of Gcn5 in efficient NER was first demonstrated in yeast [8-10], and more recently the same relationship has been described in human cells [11]. There are also roles for Histone H4 actylation in facilitating efficient NER in some genome regions such as the repressed subtelmoreic regions of yeast chromosomes [12]. Intriguingly, here, both histone H4 and H3 DNA damage induced acetylations are suppressed via the action of a histone deacetylase (Sir2) which ensures such regions remain tightly repressed at the expense of more efficient NER. [12]. In addition to histone acetylations, histone ubiquitylation has also been implicated in efficient NER.. Cells from XP-E patients are defective in the UV-damaged DNA-binding protein complex (UV-DDB), involved in the damage recognition for NER. UV-DDB comprises two subunits, encode by the DDB1 and DDB2 genes. The UV-DDB complex is a component of two individual E3 ligases, DDB1CUL4A(DDB2) and DDB1-CUL4B(DDB2) [13-15]. Such ligases recognize and mediate the ubiquitination of their substrates to regulate protein activity. Mutations in DDB2 alter the formation and binding activity of the DDB1-CUL4ADDB2 ligase, and impair monoubiquitination of histone H2A after UV. The loss of monoubiquitinated histone H2A at the sites of UV-damaged DNA is associated with decreased global genome repair in XP-E cells, suggesting that this histone modification facilitates the initiation of NER. However, more recent research shows that although UV induced monoubiquitylation of histone H2A in the vicinity of DNA lesions is dependent on functional NER, it occurs after the incision of the damaged strand [16]. This depended on the DNA damage signaling kinase ATR but not on the related kinase ATM. The UV-induced H2AX phosphorylation has been observed in human primary fibroblasts under growth-arrested conditions and this reaction absolutely

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

150

Yumin Teng, Mark Bennett, Katie E. Evans et al.

depends on NER [17]. Despite an obvious connection to NER, precise details remain elusive as to how such changes impinge on the rates of this repair mechanism at specific locations of the human genome and at what stages of the process they occur. A potential role in NER for Swi/Snf factors which employ ATP to relocate nucleosomes in cis or trans came from our work in S. cerevisiae at the repressed MFA2 locus [9]. Here we showed that there was a role for the SWI2 gene product in affording accessibility to restriction sites in DNA at nucleosome cores in cells exposed to UV light. Further to this, it was shown in a detailed study that Snf6 and Snf5, two subunits of the SWI/SNF chromatin-remodelling complex, co-immunoprecipitate with the NER damage-recognition complex Rad4–Rad23 [18]. Although this interaction between SWI/SNF and Rad4–Rad23 is stimulated by UV radiation, it remains unclear how this interaction precisely influences damage removal. NER in the transcriptionally silent, nucleosome-loaded HML alpha locus is reduced in cells lacking functional SWI/SNF. Using a similar restriction enzyme accessibility assay to ours [9], it was observed that UV light-induced nucleosome rearrangement at the silent HML alpha locus was markedly attenuated when SWI/SNF was inactivated. By studying SWI/SNF-independent (Sin) mutants in yeast which have single amino acid changes at specific DNA contacts of histones H3 and H4, Nag and colleagues [19] reported that the Sin mutation at R45 of histone H4 renders yeast cells more resistant to UV light induced DNA damage and enhances NER of CPDs at specific loci. Furthermore, the authors have shown that the H4 R45C mutation increases the accessibility of nucleosomal DNA in chromatin to exogenous nucleases and may expedite nucleosome rearrangements during NER. These results indicate that the increased repair observed in Sin mutants is a direct effect of the altered chromatin landscape caused by the mutation, suggesting that such subtle changes in the conserved histone residues may influence the “conversation” between DNA repair factors and chromatin. It was proposed that the SWI/SNF chromatin-remodeling complex is recruited to DNA lesions by damage-recognition proteins to increase DNA accessibility for NER in chromatin [19]. However, it could not be excluded that the relationship between these factors occurred following other UV induced histone modifications. Hence, it is still very unclear as to the temporal order of recruitment of various factors associated with enabling the efficient NER of DNA damage in chromatin and as to how these events might vary throughout a genome. None of the approaches employed in these studies were designed to examine repair events throughout genomes at a high resolution. This is needed to identify variations in repair rate and reveal any correlation of repair with changes in chromatin structure, which in turn varies throughout a genome. An approach that enabled entire genomes to be analysed at high resolution would enable one to examine the global influence of factors on repair: for example, the accessibility of repair proteins to DNA damage in chromatin and the chromatin modification factors that facilitate DNA repair. To address this, we decided to develop a new approach that enabled researchers to rapidly screen entire genomes for DNA damage and to measure their repair. DNA microarrays were developed decades ago for whole genome transcription profiling. The combination of these and chromatin immunoprecipitation, namely ChIP on chip, was an extension that enabled the identification of the binding sites of DNA-binding proteins and the covalent modifications to nucleosomes on a genome-wide basis [20, 21]. Here, we describe a genome wide ChIP on Chip approach that employs microarrays to monitor UV-induced DNA damage (CPDs) and its repair. Consequently, this enables us to identify the UV-induced

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

A Genomics Approach to Analysing DNA Damage …

151

changes in chromatin and the chromatin modifications that facilitate repair throughout an entire genome.

MATERIALS AND METHODS UV Irradiation Yeast cells were collected from an overnight culture in Yeast Complete Medium (YPD) at a density of 2x107 cells/ml. Pre-chilled PBS (137mM NaCl, 2.7mM, KCl, 4.3mM Na2HPO4, 1.47mM KH2PO4) was used to resuspend the cells at a density of 2x107cells/ml. A fraction of cells (200 ml at 2x107cells/ml) was kept on ice for the non-irradiated control sample (U). The number of cells for each sample was always the same and a non-irradiated control sample was always taken for each strain in every experiment. A batch of 50 ml of cell suspension was placed in a Pyrex dish (14 cm in diameter) and irradiated with 254nm UV light at a dose of 50 J/m2. The irradiated cells were kept in the dark in a sterile flask on ice. This irradiation step was repeated for the rest of the cell suspension. The same volume of UV treated cells taken for the U sample was collected to serve as a 0 sample with no repair time. The remainder of the UV-treated cells was collected by centrifugation and re-suspended in a flask of fresh YPD at 2x107cells/ml and incubated at 300C in the dark with vigorous shaking for subsequent DNA repair analysis. At the 2 h repair time point the same number of cells as for the U sample was taken from the repairing culture.

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

DNA Preparation Cells collected at each point were resuspended in 5 ml of sorbitol solution [0.9M sorbitol, 0.1M Tris–HCl (pH 8.0), 0.1M EDTA]. 0.5 ml of zymolyase 20T (10 mg/ml in sorbitol solution, ICN Biochemicals, Inc.) and 0.5 ml of 0.28M b-mercaptoethanol was added to each sample and mixed well by shaking. Cells were incubated at 300C for 1 h in a shaking incubator. Spheroplasts were gently centrifuged at 3000 rpm for 5 min and resuspended in 5 ml of lysis buffer [4MUrea, 200mM NaCl, 100mM Tris–HCl (pH 8.0), 10mM CDTA, 0.5% (w/v) N-Lauroyl Sarcosine]/ PBS 1:1(v/v) solution. 0.5 ml of DNase-free RNase A at 3 mg/ml in TE buffer (Sigma-Aldrich, from bovine pancreas, prepared as a 10 mg/ml stock solution in 10mM sodium acetate buffer pH 5.2, and boiled for 15 min at 1000C) was added to each sample. The samples were vortexed and incubated at 370C for 1 h. Following this 0.5 ml of proteinase K (5 mg/ml in TE buffer, freshly made, Amresco) solution was added. The samples were incubated at 370C for 1 h and then at 650C for 1 h with occasional shaking. Phenol/chloroform (6 ml) and chloroform (6 ml) extractions were carried out prior to DNA precipitation with two volumes (12 ml) of pre-chilled 100% ethanol. DNA pellets were collected by centrifugation and resuspended in 1 ml of TE buffer. After being completely dissolved, the DNA samples were checked by non-denaturing agarose gel electrophoresis and UV spectrophotometry (ND-1000, NanoDrop Technologies Thermo scientific).

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

152

Yumin Teng, Mark Bennett, Katie E. Evans et al.

Fragmenting DNA by Sonication A bioruptor sonicator (Diagenode) was used to fragment DNA with the water temperature in the sonication tank kept at 40C by a water circulation system. 1.5 ml Eppendorf tubes containing 300 ml of DNA samples in TE buffer were placed in a 1.5 ml microtube unit. Power was set to the ‘High’ position. Sonication was carried out for 20 s on and 40 s off for 12 cycles. Fragmented DNA was analyzed via agarose gel electrophoresis, and the average fragment size was 400 bp (data not shown and http://www.diagenode.com/ media/documents/downloads/posters/PO-BR-A3-V2_22_06_10.pdf).

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

Immunoprecipitation (IP) An amount of 50 ml of Dynabeads (Mouse lgG, Invitrogen) per sample were washed three times with 500 ml PBS-BSA (0.1%) per sample. The washed Dynabeads were resuspended in 100 ml of PBS-BSA (0.1%) per sample with the addition of the CPD antibody (Kamiya Biomedical Company, Seattle Anti-Thymine Dimer Clone KTM53 50 ml Dynabeads with 2–3 ml of the provided CPD antibody). The mixture was incubated at 300C for 30 min at 1300 rpm in an Eppendorf Thermomixer. Dynabeads were collected and washed three times with 500 ml of PBS–BSA (0.1%), 40C, and resuspended in 50 ml PBS-BSA (0.1%)/sample. The suspension was separated into 50 ml aliquots in fresh tubes and the supernatant removed. An amount of 100 ml of sonicated DNA samples were added to each tube containing the Dynabeads. An amount of 50 ml of 10x PBS–BSA (10 mg/ml) was added to each sample, and the final volume was adjusted to 500 ml with PBS. Samples were incubated at 210C for 2 h at 1300 rpm in an Eppendorf Thermomixer followed by a wash with 500 ml of freshly prepared FA/SDS buffer (50mM HEPES KOH pH 7.5, 150mM NaCl, 1mM EDTA, 1% Triton X-100, 0.1% Deoxycholate Na, 0.1% SDS, 1mM PMSF). Further washes were as follows: three times wash with 1 ml of FA/SDS+NaCl (adjust the NaCl concentration to 500 mM); one wash with 500 ml of Li solution (100mM Tris–Cl pH 9.0, 500mM LiCl, 1% NP40, 1% deoxycholic Na), one wash with 500 ml of cold TE. DNA was eluted off the Dynabeads with 100 ml of Pronase (Promega) buffer (25mM Tris pH 7.5, 5mM EDTA, 0.5% SDS) at 650C at 900 rpm for 20 min. An amount of 6.25 ml of Pronase (20 mg/ml, in H 2O) was added to each sample and incubated at 370C for 1 h, then at 650C in a water bath, overnight. The volume of the input samples (20 ml), was adjusted with TE buffer to 100 ml followed by the addition of 25 ml of Pronase buffer (125mM Tris pH 7.5, 25mM EDTA, 2.5% SDS, 6.25ml of Pronase at 20 mg/ml). They were then incubated as the IP samples. An amount of 1 ml of the DNase-free RNase A at 10 mg/ml was added to the IP and input samples followed by incubation at 370C for 1 h. DNA was purified using the Qiagen PCR purification kit and eluted with 50 ml elution buffer.

Repair of DNA Damages Prior to PCR Amplification Immunoprecipitated DNA fragments obtained using the CPD antibody will contain CPD damage which will block DNA synthesis during the following PCR amplification step. Therefore, any damage has to be removed prior to PCR. The PreCR DNA repair kit (New

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

A Genomics Approach to Analysing DNA Damage …

153

England Biolabs) removes many DNA damages including CPDs. An amount of 40 ml of the IP samples and 1 ml of input samples diluted into 40 ml with H2O, were subjected to repair treatment using the PreCR DNA repair kit as per instructions. DNA was purify via a Qiagen PCR kit and eluted in 50 ml of elution buffer. DNA end blunting and linker ligation. These were undertaken as described in the Agilent ChIP on chip protocol for Yeast http://www.chem.agilent.com/Library/usermanuals/Public/ChIP-on-chip_Yeast_9.2.pdf). In brief, 70 ml of a mixture of T4 DNA Pol Buffer (11 ml, NEB buffer 2 included with the T4 polymerase). BSA (10 mg/ml, 0.5 ml), dNTP (10mM, 1.0 ml), T4 DNA polymerase (0.2 ml from New England Biolabs (NEB). Catalog # MO203S), H2O (57.8 ml) were added to 50 mlof IP sample or input sample on ice. The samples were mixed by pipetting and then incubated at 120C in a water bath for 20 min. An amount of 11.5 ml of NaAc (3 M, pH5.2) and 0.5 ml of Glycogen (20 mg/ml) were added into each sample. After phenol/chloroform extraction, the DNA was precipitated with absolute ethanol (-800C for 10 min). DNA was pelleted by centrifugation and washed once with cold 75% ethanol and resuspended in 25 ml of H2O. An amount of 25 ml of ligation mix (13 ml of H2O, 5 ml of DNA ligase buffer, 6.7 ml of linker hybrid, 0.5 ml of T4 DNA ligase) was added into each tube and mixed for overnight ligation at 160C in a water bath. An amount of 6 ml of NaAc (3M) was added to the ligation mixture and the DNA was precipitated with absolute ethanol at -800C for 10 min. DNA was pelleted by centrifugation, washed once with cold 75% ethanol and resuspended in 25 ml of H2O.

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

PCR Amplification Two steps of PCR were carried out as described in the Agilent ChIP on chip protocol with modifications. We did this so as we could archive reasonable amounts of each sample after the first PCR and re-analyze samples if required. For the first PCR, 15 ml of PCR mix (8 ml of Buffer, 1.25 ml of 10mM dNTP, 1.25 ml of 40mM Oligo 102, 4.5 ml of H2O) was added to each sample, and incubated at 550C for 4 min in a PCR block. After the first 2 min incubation, the program was paused. An amount of 10 ml of Phusion DNA polymerase mixture (1 ml of Phusion Polymerase (New England Biolabs), 2 ml of Buffer, 7 ml of H2O) were added to each tube while the tube was kept in the heating block. The program was resumed and followed by 3 min incubation at 720C. After a 1 min 980C denaturing step, 25 cycles of PCR were applied as 10 s at 980C, 30 s at 550C and 1 min at 720C, and the final step was 5 min at 720C. Ten times dilution was made to each PCR by adding 450 ml of H2O. This can be stored frozen for future use. A second PCR reaction with 5 ml of first PCR dilution and 45 ml of PCR mix (10 ml of _Buffer, 1.25 ml of 10mM dNTP, 1.25 ml of 40mM Oligo 102, 0.5 ml of Phusion DNA Pol, 32 ml of H2O) was carried out using conditions of 980C 1 min, 25 cycles of (980C 10s, 550C 30s, 720C 1 min), 720C 5 min. DNA was precipitated with the addition of 25 ml of 7.5M Ammonium Acetate and 225 ml of absolute ethanol at -800C for 10 min. DNA was pelleted by centrifugation and washed once with cold 75% ethanol and resuspended in 20 ml of H2O. The concentration of DNA was measured with the NanoDrop spectrophotometer and all samples normalized to100 ng/ml with H2O.

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

154

Yumin Teng, Mark Bennett, Katie E. Evans et al.

Labelling The BioPrime Total Genomic Labeling System (Invitrogen) was used to label the DNA for ChIP on chip. Generally the IP samples were labelled with Alexa Fluor 5 (cy5) and the Input samples were labelled with Alexa Fluor 3 (cy3). An amount of 17.6 ml of amplified DNA samples (100 ng/ml) and 4.4 ml of 5mM EDTA were placed in a 0.5 ml PCR tube. An amount of 25 ml of Alexa Fluor 5 Reaction Mix or Alexa Fluor 3 Reaction Mix were added into the tube and mixed. The samples were incubated at 950C in the dark for 5 min and immediately cooled on ice for 5 min. While on ice, 3 ml of Exo-Klenow Fragment (40 units/ml and part of the BioPrime Total Genomic Labeling Module, Invitrogen) was added to each tube (total 50 ml) and mixed. Samples were incubated at 370C for 2 h in a heating block in the dark. After the incubation, DNA was purified using an Invitrogen column provided in the labelling system and eluted in 55 ml of elution buffer. Labelling efficiency was determined using the MicroArray Measurement Module on the Nanodrop ND-1000 Spectrophotometer. The NanoDrop software facilitates the measurement of DNA concentration and dye labelling effectiveness. The NanoDrop ND-1000 Spectrophotometer measures the absorbance of the fluorescent dye, allowing detection at dye concentration as low as 0.2 pmol/ml. (http://www .nanodrop.com/Library/nd-1000-v3.7-users-manual-8.5x11.pdf pg 30 for more details). An amount of 50 ml of labelled IP sample and 50 ml of labelled input samples were combined, and precipitated by the addition of 12 ml of NaAc (3M), 5 ml of Polyacrylamide (2.5 mg/ml) and 290 ml of absolute ethanol at -800C for 10 min. DNA was pelleted by centrifugation, washed once with cold 75% ethanol, and resuspended in 37.5 ml of H2O.

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

Hybridization To the 37.5 ml of labelled samples were added 12.5 ml of Human Cot-1 DNA (1.0 mg/ml, Invitrogen), 12.5 ml of Agilent Blocking Agent (10) and 62.5 ml of Agilent Hybridization Buffer (2x). 110ml of this hybridization mixture was applied to each Agilent yeast microarray (4_44k) http://www.genomics.agilent.com/CollectionSubpage .aspx?PageType=ProductandSubPageType=ProductData andPageID=1476) for hybridization for 24 h at 650C as described in the Agilent ChIP on chip protocol. Washing and scanning: After hybridization the microarrays were washed and scanned as described in the Agilent ChIP on chip protocol.

Feature Extraction The scanned image was analyzed by Agilent Feature extraction software. Red and green background subtracted signals were used for data analysis.

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

A Genomics Approach to Analysing DNA Damage …

155

RESULTS

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

Detecting CPDs Throughout the Entire Yeast Genome Yeast cells were irradiated with 50 J/m 2 of UV at 260 nm and then sampled either immediately or allowed a 2 h repair period. DNA purified from an unirradiated control (U), immediately after UV (0) and after UV with the 2 h repair period was sonicated to generate short fragments ranging from 200 to 800 bp and averaging 400 bp (input samples). Immunoprecipitation with the CPD antibody was carried out for unirradiated and UV irradiated samples (IP samples). We consistently detected over a 50-fold enrichment of DNA in the UV exposed samples compared with the unirradiated samples. We processed the IP and the input samples for microarray analysis employing the Agilent 4_44K yeast microarrays by labelling the IP sample with cy5 and the input sample with cy3. The ratio of the signals between the IP and the input samples for each probe on the microarray indicates the relative level of CPDs detected at the region the probe locates. The scanned images were processed with Agilent’s Feature Extraction software (version 9.5.1) to convert the fluorescence signals to numerical values. The red (cy5, IP) and green (cy3, input) background subtracted signals were loaded into R (version 2.12.1) [22] using the limma package [23] The log2 IP:input ratios were used for all subsequent analyses. Pre-processing of the data was carried out to remove any data points across all datasets which have the potential to generate spurious results. The first stage of this process is to remove data corresponding to probes designed to hybridise to DNA from genes which have been deleted from the strain used in the assays. The Agilent array contains probes covering the whole yeast genome. However, the BY4742 yeast strain background used in this investigation has four deleted genes: LYS2; HIS3; LEU2 and URA3, together covering 6741 bp. There are 26 probes on the microarray which are complementary to sites within these regions. As these probes still produce values from background fluorescence they need to be removed to prevent the values being incorrectly interpreted. The second stage is to remove values that are absent in one dataset from all other datasets. As the IP: input ratios are converted to log2 values absent values can be introduced if the initial ratio is less than or equal to zero. If this occurs it suggests a potential problem with the probe value because the initial ratio would not be expected to fall below zero. It may also introduce problems in further analyses if, for example, a repair rate calculation is attempted where one of the time points contains a missing value. To overcome this all values for the probe are removed across all the datasets so that at the end of the pre-processing each still contains the same number of probes. There are enough probes on the array that the removal of a small number in this way is not detrimental to the final results. Following pre-processing all replicate datasets were quantile normalised using the preprocessCore package in R [24] which imposes the same empirical distribution of intensities to each array. This works on the principle that a quantile-quantile plot will form a straight, diagonal line with slope 0 and intercept 1 if the two data vectors have the same distribution. This can be extended to n dimensional space, where n is the number of datasets, so that all datasets of the same distribution fall on the same line in this space if they all have the same distribution. The quantile normalisation procedure coerces the data points to form this pattern by separately ordering all the data points of the replicate datasets, replacing all

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

156

Yumin Teng, Mark Bennett, Katie E. Evans et al.

values in each row of these ordered datasets by the mean of the row values and returning the datasets to their original orders. The full procedure is detailed in [24]. This method of normalisation cannot be applied between datasets from different time points because it would act to cancel out any differences. For this reason it is applied only to replicate datasets. Figure 1 shows a snapshot of CPD induction in part of chromosome 4 following 50 J/m2 of UV. The data are the average of two independent experiments. The black line indicates the relative CPD level detected with the CPD antibody using the log2 ratio of the IP and the input sample signals, with the peaks representing high levels and the troughs low levels of CPDs. Error bars shown on the black line are 1 SD from the mean from the two individual experiments The theoretical CPD distribution throughout the same region is shown by the red line. UV light, specifically at or near to 254 nm, is close to the maximum absorption wavelength of DNA. This UV radiation can generate many lesions, mainly at adjacent pyrimidine sites. Two adjacent pyrimidines in the same polynucleotide chain can absorb UV energy to form a four-membered ring structure, a CPD, resulting from saturation of the C=C double bonds. CPDs form solely at adjacent pyrimidine sites, and their position is determined by the DNA sequence. The yield is influenced by the nucleotide composition of DNA and the quantitative ratio of CPD formation after UV irradiation at TT, TC, CT, CC sites is 68:16:13:3 as measured with plasmid DNA [26] or human cells [27]. Based on this ratio, we mathematically modelled the theoretical CPD distribution for the whole yeast genome from its sequence by taking account of the mean sheared average DNA fragment size of 400 bp. A Perl script was written to generate a predicted binding level for each probe on the microarray based on the frequency of dipyrimidine sequences in the genomic region surrounding the 60-nt region complementary to the probe sequence. At each complementary probe location the genomic region able to bind that probe was analyzed. This was calculated as the length of the mean sheared DNA fragment size up and downstream of the end and start of the complementary probe region, giving a sequence twice the length of the mean sheared DNA fragment size minus the probe size (Figure 2). For each probe sequence region, a value was calculated for all dipyrimidines which were summed to assign a value to the probe, using the following Formula 1.

Figure 1. The CPD distribution in a part of Chromosome 4. Black: CPD level detected by the CPD antibody. Error bars shown on the black line are 1 SD from the mean from the two individual experiments. Red: theoretical CPD distribution. For the genome representations here and in the supplementary figures in the Teng et al publication [25]: yellow boxes show ORF positions (arrows indicate direction of transcription), green boxes are ARSs and blue boxes are centromeres and telomeres. Grey dots show probe positions.

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

A Genomics Approach to Analysing DNA Damage …

157

Formula 1. Calculation of CPD probe values. s=dipyrimidine site, n=number of dipyrimidine sites, f=mean fragment length, d=distance of dipyrimidine site from probe, P=probability of a CPD occurring at the dipyrimidine site (TT/AA=0.68, TC/GA=0.16, CT/AG=0.13, CC/GG=0.03).

Figure 2. An outline showing the detectable genomic region for a probe (not to scale). All detectable fragments are in blue.

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

Plotting the predicted CPD distribution from the sequence (red line) against the detected CPD values (black line) in part of the chromosome 4 (Figure 1) and for the entire genome [25] show a remarkably good relationship. The Spearman rank correlation co-efficient (a nonparametric test) is 0.83 for the probes in Figure 1 and 0.77 for the entire genome, both with P100 fraction, which is low in repetitive sequences and high in specific sequences, as a template to successfully obtain a RAPD marker that links to the cyst-nematode resistance gene on chromosome 2D. In rye, which has a larger genome size, there are no chromosome-specific RAPD markers besides γ-cecalin-linked RAPD on chromosome 2R [13]. After that, as with other crops, SSRs have come to represent the markers of choice for breeding applications [14]. In an attempt to increase the limited number of functional SSR assays in rye, Khlestkina et al. [15, 16] developed SSR markers from rye ESTs (expressed sequence tags) and also transferred the wheat-originating SSRs [17, 18] to the rye genetic maps. However, development of SSR markers is laborious and costly [19], especially for taxa containing large amounts of repetitive sequences [19-21]. Genotypic data of Single nucleotide polymorphism (SNP) in the rye genome were also under development by using barley genomic resources [22]. As a consequence, and despite the progress that has been achieved towards developing sequence-specific markers [22-27, 15, 16], the number of markers in the rye genome has remained limited, leaving large gaps in sub-genome regions. It is therefore necessary to design DNA markers, in addition to present markers, appropriate for the structure of the rye genome. From this standpoint, the author’s group has been seeking genome-specific elements, which offer effective landmark of the rye genome and has developed novel DNA marker applications [28-32].

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

Recent Patent on Revolver-2

165

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

RYE GENOME SPECIFIC TRANSPOSON-LIKE GENE-FAMILY REVOLVER In the higher plants, the percentage of gene required for life maintenance is just a few percent of genome [33-38], and transposable elements and the sequence derived from them are scattered in the other tremendous repetitive DNA region [39-43]. The transposable elements are classified into the class type I factor (retrotransposon), which uses a transcript as a template and transfers replicatively [44, 45] and class type II factors (transposon), which DNA itself transfers by cut-and-paste method [46, 47]. It is considered that class I type LTR type retrotransposon and class II type MITE are the major components of the plant genome [48-55]. The transposable elements are used for the source of mutation for DNA marker development or gene functional analysis, the transposable elements with the high number of copies becomes the entry points of PCR for DNA marker development, and the transposable elements that cause gene disruption contribute to tagging of gene and functional genome research [56-63]. Among the Triticeae tribe, rye (Secale cereale) has been an important gene source, offering stress resistance useful for wheat (Triticum aestivum L.) and triticale breeding. The rye genome has a 1C DNA content 3.9 Gb, the highest among the Triticeae, and repetitive sequences comprise 92% of the genome [2]. Cot analysis estimates 24% of the rye genome to be rye specific [33]. Rye-specific repetitive sequences have been useful molecular probes for the determination of introgressed genomes and the genomic constitution of wheat–rye hybrids [64, 65]. However, the region of repetitive DNA except for known transposable elements is still unknown sequence and in the region of repetitive DNA regarded as Junk DNA, it has been found that the RNA genes that perform expression regulation of gene epigenetically are also scattered [66-70]. The investigation of the unknown factors of repetitive DNA region is important also as a key that understands the control mechanism of genome and phenotypic expression. The author has sought novel active genomic components that might be useful as molecular tools. The author intended to obtain genome-specific elements regardless of the methylation state and used genomic deletion of sequences common to wheat and rye [28, 29]. A part of reiterated sequence (89 bp) specific to rye genome was cloned by the genome subtraction technique, which deducts the sequence that is common in bread wheat from rye genome. Repetitive sequences from wheat species were intricately differentiated by combining units of different repetitive sequences [71-75]. To obtain minimum repetitive-sequence units, the genomic DNA was digested into 2-kb fragments or less using restriction enzyme MboI, which recognizes four nucleotides, and then the author established a DNA library in which the sequences common to wheat sequence are subtracted (deleted) from the rye-chromosomeaddition wheat genome [28, 29]. The genomic DNA of wheat randomly cleaved by sonication was excessively mixed with the restricted products of rye-addition wheat. The doublestranded nucleotides were denatured at high temperature into single strands and then annealed as the double-stranded DNA in PERT reaction mixture to recover rye-specific DNA elements restored with cohesive terminals [29]. The deletion-enrichment scheme was described originally for obtaining mouse Y-chromosome genes [76] and has not been reported for plant genomes. Using genomic subtraction, the author successfully isolated rye-specific DNA elements [28, 29]. A library including DNA fragments specific for the rye genome was

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

166

Motonori Tomita

constructed by subtracting wheat genomic DNA from genomic DNA of the rye chromosomeaddition-wheat line. From this library, 77 plasmid DNAs were screened by differential dot hybridization, and 14 clones hybridized strongly to rye DNA but did not hybridize to wheat DNA. Among them, seven clones belong to the tandem 350 bp family [73, 77], and one clone belongs to the dispersed R173 family [78, 79], both of which are rye-specific repetitive sequences. On the other hand, a single clone contained an 89 bp unknown sequence [28]. These results indicate that deletion of sequences common to wheat and rye was effective, and the 89 bp sequence was used for further characterization. In order to determine the entire structure of this reiterated sequence, the λ FixII genomic library of rye inbred line is screened using 89 bp of the repetitive clone as a probe, and the nucleotide sequence about the region of 21.6 kb of three lambda clones was decoded [28]. The plaque hybridization analysis found approximately 800 positive plaques for the membranes of 5 × 104 plaques of the rye genomic DNA library (Figure 1). Six positive lambda clones were chosen at random, and the restriction sites of Bam HI and Sac I were mapped differently on the six insertions (Figure 1), which are therefore derived from different areas of the rye genome. Three lambda clones were sequenced in full. As a result, the insertion type consensus sequence (92% of homology) with full length of 3,041 bp sandwiched by 20 bp of the inverted repeat sequence was determined [28]. Twenty bp of the inverted repeat sequence at both ends is a new sequence different from the known transposon represented by hAT [47], CACTA [80], and Mutator [81] and 10 bp of the tandemly repeated sequence has repeated also in the subterminal region. The transposable element includes TIRs and often also sequence motifs in the subterminal regions. These findings indicate that a transposon-like 3 kb element is dispersed throughout the rye genome. Despite extensive characterization of the repetitive elements in the rye genome, the 3 kb element does not show similarity to any known rye repetitive element: the 350 bp family [73,77], the 120 bp family [73, 82], the 5.3H3 family [83], the R173 family [78, 79] or pSc250 [84]. The entire structure of the 3 kb transposon-like element does not share whole identity with class I or class II transposable elements. This new transposon-like factor was named Revolver [28]. Northern blot analysis showed that Revolver was actively transcribed into a number of RNA in rye [28]. Then, as a result of screening cDNA library of rye inbred line produced by λ ZAPII, 726 bp of cDNA, which has homologous region with Revolver, was obtained. Structure comparison of genome DNA and cDNA showed it consisted of three exons (342 bp, 91 bp, 293 bp) and two introns (750 bp, 1,237 bp) [28]. Splicing site sequence exists between exon and intron. A putative TATA box is located at base 221, with a cap site at base 261 and a possible polyadenylation signal AATAAA at base 2918. Moreover, 89 bp sequence first obtained by the subtraction technique was equivalent to the second exon. The cDNA of Revolver contains one open reading frame of deduced 139 amino acid residue. Furthermore, the cDNA of Revolver, which has the same ORF, is obtained from Triticum monocaccum, Aegilops squarrosa, and Dasypyrum villosum besides the species of rye by RT-PCR method [28, 31]. It turned out that the ORF of Revolver was saved in Triticeae beyond the species. The ORF does not show homology to known transposases; however, the predicted Revolver product shows similarity to a transcriptional regulator family of AsnC/Lrp or a glycerol-3-phosphate transporter and includes a DDE motif [28].

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

Recent Patent on Revolver-2 a)

b)

167

c)

Figure 1. Quantitative and structurally divergent distribution of Revolver gene family in the rye genome. (A) The plaque hybridization detected approximately 800 positive plaques of Revolver genes for the membranes of 5×104 plaques of the rye genomic DNA library. (B) Divergent restriction length polymorphisms of positive lambda clones containing Revolver genes. (C) Six positive Revolvercontaining lambda-clones chosen at random, which were derived from different areas of the rye genome showed the differently mapped restriction sites of Bam HI and Sac I.

Because of the presence of terminal inverted repeats and encoding a DNA binding-like protein, Revolver was considered to be a class II transposable element. The inverted repeated sequence determining the family identity of a transposon and the encoding gene are unique sequences that are quite different from known class II transposons. Moreover, the entire structure of Revolver does not share whole identity with either class I or class II autonomous transposable elements. Above all, the length of Revolver is 3,041 bp, and it has 20 bp of specific Terminal Inverted Repeat (TIR) at both ends and contains one gene that codes for ORF of the deduced 139 amino acid residue actively transcribed into mRNA.

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

HIGHLY QUANTITATIVE AND STRUCTURAL DIVERSITY OF REVOLVER The number of copies in Triticeae was computed by southern blot analysis and slot blotting technique using cDNA of Revolver as the probe [31]. Consequently, extremely high number of Revolvers exist in D.villosum and Secale with 20,000 copies, and also it exists in diploid species such as Triticum monococcum, which is the ancestor species of bread wheat and tetraploid species such as emmer wheat with around 10,000 copies, but it is extremely low in hexaploid bread wheat. With the most amplified rye, Revolver is strongly hybridized throughout the chromosome by FISH method, and it is scattered throughout the genome [28]. An unusually high transcription activity of Revolver and its high-copy number accumulation occurred also on rye B chromosomes [85]. The accumulation of mobile elements on B chromosomes can have functional and evolutionary implications, because B chromosomes encode a low number of genes; their accumulation does not interfere with the normal life of the plant. On the other hand, four kinds of Revolver family were investigated in six species of the genus Secale [86]. As a result, during the evolution of the genus Secale from wild to cultivated accessions, some Revolver-like sequences became shorter mainly because of the deletion of a trinucleotide tandem repeating unit, whereas the other Revolver-like sequences became longer in the second intron. Some Revolver-like sequences showed evolutionary elimination at specific chromosomal locations from wild species to cultivated species [86]. Therefore, as Revolver is amplified in some species in the process of Triticeae evolution and

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

168

Motonori Tomita

it is disappeared in bread wheat, it makes a big change quantitatively. Revolver is peculiar to Triticeae, and its quantitative variation between species is large. Then, on Triticum dicoccoides, the copy numbers of Revolver of 209 native lines, which were collected in various 18 ecosystems in Israel close to the origin and with various weather and geographical conditions [87-89], were analyzed for the quantitative variation by ecological stress [31]. Consequently, an average of 6,000 or more copies of Revolver existed in the native line of the area, which has much precipitation and around 20℃ of average yearly temperature, and there was a kind that reached 20,000 copies just like rye wheat. On the other hand, only hundreds copies existed in the large majority of the line in the area where the hotdry monsoon occurred frequently 85 days per year and the area where the number of sultry night reached 80 days per year. The remarkable quantitative difference between the ecosystems of Revolver in such same species shows the strong amplification activity within the last 10,000 years. In the genomic DNA clone of rye, which shows homology to Revolver, a big structural variation in the region ranging from the first exon to the first intron had arisen and four sequences considered to be the nonautonomous elements of Revolver were found [30]. The full length of nonautonomous elements is 2665~4269 bp, and nonautonomous elements have 37~149 bp of homologous region in the upstream of the transcription start site containing TIR at 5' end and 1294~2112 bp of the region covering from around the second exon to 3' end on the 3' side, but 549 ~2007 bp of the region located between them equivalent to the region from the first exon to the first intron is destroyed. The elements similar to these Revolver-like nonautonomous elements exists also in barley [30]. Although the insertion sequence of barley LARD (large retro-transposon derivative) [90, 91], whose length is 4,322 bp has the region, which shows 60% of homology to Revolver in 123 bp portion at 5' end of Revolver and in 2,146 bp portion from the middle of the first intron to 3' end, 124 ~2,176 bp of the central region does not have homology to Revolver, the first exon is lacked, and ORF is destroyed The configurations of Revolver-like nonautonomous elements and LARD are similar as both contain 370 bp of the region, which shows 65% of homology on 3' side and is not in Revolver. In rye and barley, the nonautonomous elements that share each end with Revolver are considered to exist. Revolver that produces 0.7 kb of mRNA coding for the ORF of 139 amino acid residue is saved in Triticeae. When the author analyzed 30 clones of cDNA of a multi-gene family, which were expressed in mature leaves of the pure S. cereale line, IR10, they could be classified into the following four classes: classes I to III, which were 665~723 bp long and had different exon structures, and 395 bp-long class IV, which had a third exon region and a nonhomologous exon on the 5' side [31]. Analysis of each exon's homology showed that the second (89~92 bp) and the third (293 bp) were highly homologous (91~95%) between the classes. On the other hand, the first exon (282~341 bp) was highly homologous within each class (I: 98%, II: 99% and III: 99%), but its interclass homology was low, within the 60% level (I and II: 63%, I and III: 64%, II and III: 67%). Among these three classes, the first exon had partial deletions and insertions of sequences, and their lengths were different. In a Southern blot analysis of genus rye plants, the multi-gene-family cDNA probe showed strong hybridization to three rye genera (S. cereale, S. fragile and S. silvestre), and homologous sequences were also detected in Triticum monococcum, Aegilops squarrosa and Dasypyrum villosum [28]. Furthermore, we determined the cDNA structures of the multi-gene family, which were obtained from mature leaves of S. fragile, S. silvestre, T. monococcum, Ae.

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

Recent Patent on Revolver-2

169

squarrosa and D. villosum, using RT-PCR [31]. The results showed that the majority of them belonged to class I (27%) or class II of S. cereale, suggesting that these two main classes of the first exon may be maintained across different species. This multi-gene family has different numbers of copies in different species and is attracting attention as a sign of evolution in the Triticeae genome. There were 58 clones that partially show the homology to Revolver among EST 440,000 clones sourced from bread wheat [31]. In these Revolver-like EST, whose length is 360 ~744 bp, the portion after the second exon was saved (65-79% of homology), but the first exon portion had mutually low homology, the mutation classified into 12 kinds had arisen, and did not have EST with ORF. Since ORF is saved in the species with the high number of copies of Revolver, the relation between the collapse of ORF and the number reduction of copies in bread wheat is inferred.

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

CHROMOSOME TAGS BY USING REVOLVER PCR was performed using the 3'-flanking region derived from a typical genomic clone of Revolver (Revolver-2 located on the rye 7R chromosome) as a single primer, and four DNA fragments (2.3 kb, 2.8 kb, 3.3 kb, and 4.3 kb) were amplified from the rye genome, but nothing was amplified from the wheat genome [30, 31]. The genome of rye and that of wheat can be easily distinguished by this primer. Furthermore, when PCR was performed with the same primer using genomic DNA from rye chromosome addition lines, DNA fragments of 2.8 kb, 3.6 kb, and 4.3 kb were amplified from 1R, 5R, and 6R chromosomal addition lines, respectively (Figure 2) [31, 32]. By PCR with this single primer, rye chromosomes 1R, 5R, and 6R can be simultaneously identified. Each DNA fragment derived from chromosome addition lines and four types of DNAs, amplified from the rye genome, were sequenced. As a result, these variants have the downstream region of the second intron, but they have structural modifications at the 5' first exon region (Figure 2). Such a difference in length in Revolver allows the development of rye chromosome markers [31]. Revolver-3 comprises a total length of 4,269 bp, and at the 3'-end it has a region of 2,112 bp from the middle of the first intron of Revolver through the third exon and reaching to the 3' terminal region (Figure 2). At the 5' end, it has the homologous region of 150 bp, including the inverted repeat sequence. However, in the 2 kb between these sequences, Revolver-3 lacks the region from the first exon to the middle of the first intron. Revolver-3 was localized on the 6R chromosome because it was amplified with the 3'-flanking region primer of Revolver-2 only from the rye 6R chromosome addition line [31]. Revolver-4 consists of 3,219 bp, and at the 3' end, it has the region of 1,806 bp ranging from immediately before the second exon to the 3' terminal of Revolver (Figure 2). However, at the 5' side, the region homologous to Revolver is limited to only 101 bp at the 5’terminal [28]. Furthermore, Revolver-5 located on the rye 1R chromosome [28, 31] has a total length of 2,665 bp, and at the 3' side it has a region of 1,826 bp from immediately before the second exon to the 3' terminal of Revolver (Figure 2). At its 5' side, the region homologous to Revolver is limited to only 37 bp at the terminal region, but the region of about 670 bp is homologous to Revolver-4 [28]. Finally, Revolver-6 located on the rye 5R chromosome

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

170

Motonori Tomita

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

(Figure 2) has a total length of 3,503 bp, and at the 3' side, it has the region of 1,294 bp from the middle of the second intron to the 3' terminal of Revolver [30, 31]. However, at the 5' side, there is no region homologous to Revolver, and 121 bp at the 5' terminal is homologous to Revolver-4 and Revolver-5 (Figure 2). As mentioned above, the 3’-flanking region of a typical genomic clone of Revolver-2 used as a single PCR primer amplified 4 DNA fragments (2.3 kb, 2.8 kb, 3.3 kb, and 4.3 kb) of the Revolver-family from rye genome. By PCR with this single primer, rye chromosomes 1R, 5R, and 6R can be simultaneously identified. The structural divergences of Revolver family were utilized for chromosome tags and patented as US No. 7,351,536 [32]. The members of the Revolver family showed considerable length variation, which was attributed to structural changes at the first exon. Such a divergence in length is also found in some transposons, CACTA family [80] and MITE family [81, 54], but no homology was detected between Revolver and each of them. If the Revolver family is a transposable element, these variants are assumed to be non-autonomous elements. Revolver showed a considerable variance quite larger than them. By the PCR primers comprising the sequences flanking the length variants of Revolver scattering in the genome, the chromosome on which each Revolver is located can be determined or tagged, and such PCR primers can be utilized for detection and identification of the chromosomes.

Figure 2. Length polymorphisms of the Revolver gene family useful as DNA makers of rye chromatins introgressed into the wheat genome. The 3’-flanking region of Revolver-2 used as a single PCR primer amplified 4 DNA fragments (2.3 kb, 2.8 kb, 3.3 kb, and 4.3 kb) of the Revolver-family from the rye genome but produced no fragments from the wheat genome. By PCR with this single primer, rye chromosomes 1R, 5R, and 6R can be simultaneously identified in the wheat genome. These nonautonomous element of Revolver family shared the downstream region of the second intron, but they varied structurally at the 5’first exon. Modified from Tomita et al. (2011) [31].

CURRENT AND FUTURE DEVELOPMENT Widely distributed transposable elements are the most rapidly evolving fraction of the eukaryotic genome [92], because the methylated and heterochromatic states of most highly repetitive elements suffer from sequence change more readily than genes [93, 94]. In general,

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

Recent Patent on Revolver-2

171

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

the genomes of higher eukaryotes contain thousands, even millions, of seemingly inactive transposable elements, which have been suggested as a source of interspecific sequence divergence. Species-specific repetitive elements serve as genetic tools for developing DNA markers, and PCR entry points are dispersed throughout the genome [95]. Revolver is enriched in the genomes of wild wheat relatives but rare in the bread wheat genome. Cultivated rye (Secale cereale L.) has been used as a gene source for wheat and triticale breeding by interspecific chromosome introgression and rearrangement: translocation or substitution. A representative achievement of this type of manipulation is the introduction of a stem rust-resistant gene into wheat. The rye genome still has a gene resource potential for future improvement of wheat. Rye-specific repeated sequences have been useful as probes to determine alien chromatins and chromosome constitutions in wheat–rye cross-breeding [64, 65]. Revolver shows extremely structural diversities, especially around the first exon and considerable quantitative variations through the evolution in Triticeae plants. By the PCR primers comprising the sequences flanking the length variants of Revolver scattering in the genome, the chromosome on which each Revolver is located can be determined or tagged. Revolver is an effective tool for developing molecular tags for transferring useful germplasm of wheat relatives, rye, and Dasypyrum into the wheat genome. Although Revolver decreases in bread wheat, it amplifies in related species such as rye. Then, the transposon display of the rye chromosome addition wheat line was performed by the SSAP method using Revolver distributed to the rye genome as the primer. As a result, 150-270 bp of the DNA fragment amplified from the rye 1R chromosome definitely had Revolver and the primer of adapter at both ends. In the days ahead, with Revolver as the starting point of the SSAP method, the development of the molecule marker scattered in the related species genomes of wheat will be expected. Revolver offer FISH, Southern probe for genotyping, and dispersed PCR entry points to amplify rye-specific multiple genomic fragments [28, 31, 32]. Revolver is attractive as an index of genomic evolution and as a marker of chromosomes useful for evaluating evolutionary relationships among the tribe Triticeae.

ACKNOWLEDGMENTS The author acknowledges the Japanese Ministry of Education, Culture, Sports, Science and Technology (MEXT) for the Grant-in-Aid for Scientific Research (No. 1360006, No.16580004 and No. 22580005) to M. Tomita that supported this work.

REFERENCES [1] [2] [3]

Madej, L. J. (1996). Worldwide trends in rye growing and breeding. Vortr Pflanzenzüecht 35:1–6. Flavell, R. B., Bennett, M. D., Smith, J. B., and Smith, D. B. (1974). Genome size and the proportion of repeated sequence DNA in plants. Biochem. Genet. 12:257-269. Saiki, R. K., Gelfand, D. H., Stoffel, S., Scharf, S., Higuchi, R. H., Horn, G. T., Mullis, K. B., and Erlich, H. A. (1988). Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase. Science 239:487-491.

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

172 [4]

[5]

[6] [7] [8]

[9]

[10]

[11] [12]

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

[13]

[14]

[15]

[16]

[17] [18]

Motonori Tomita Williams, J. G. K., Kubelik, A. R., Livak, J., Rafalski, J. A., and Tingey, S. V. (1990). DNA polymorphisms amplified by arbitrary primers are useful as genetic markers. Nucleic Acids Res. 18:6531-6536. Halward, T., Stalker LaRue, T. E., and Kochert, G. (1992). Use of single-primer DNA amplifications in genetic studies of peanut (Arachis hypogaea L.). Plant Mol. Biol. 18:315-325. Wilkie, S. E., Isaac, P. G. and Slater, R. J. (1993). Random amplified polymorphic DNA (RAPD) markers for genetic analysis in Allium. Theor. Appl. Genet. 86:497-504. Vierling, R. A. and Nyuyen, H. T. (1992). Use of RAPD markers to determine the genetic diversity of diploid, wheat genotypes. Theor. Appl. Genet. 84:835-838. Reiter, R. S., Williams, J. G. K., Feldmann, K. A., Rafalski, J. A., Tingey, S. V., and Scolnik, P. A. (1992). Global and local genome mapping in Arabidopsis thaliana by using recombinant inbred lines and random amplified polymorphic DNAs. Proc. Natl. Acad. Sci. USA 89:1477-1481. Peltier, D., Farcy, E., Dulieu, H., and Bervill, A. (1994). Origin, distribution and mapping of RAPD markers from wild Petunia species in Petunia hybrida hort lines. Theor. Appl. Genet. 88:637-645. Quiros, C. F., Hu, J., This, P., and Chevre, A. M. (1991). Delseny M. Development and chromosomal localization of genome-specific markers by polymerase chain reaction in Brassica. Theor. Appl. Genet. 82:627-632. Devos, K. M. and Gale, M. D. (1992). The use of random amplified polymorphic DNA markers in wheat. Theor. Appl. Genet. 84:567-572. Eastwood, R. F., Lagudah, E. S., and Appels, R. (1994). A directed search for DNA sequences tightly linked to cereal cyst nematode resistance genes in Triticum tauschii. Genome 37:311-319. Lee, J. H., Graybosc, R. A. and Lee, D. J. (1993). Detection of rye chromosome 2R using the polymerase chain reaction and sequence-specific DNA primers. Genome 37:19-22. Gupta, P. K. and Varshney, R. K. (2000). The development and use of microsatellite markers for genetic analysis and plant breeding with emphasis on bread wheat. Euphytica 113:163–165. Khlestkina, E. K., Than, M. H., Pestsova, E. G., Roder, M. S., Malyshev, S. V., Korzun, V., and Borner, A. (2004). Mapping of 99 new microsatellite-derived loci in rye (Secale cereale L.) including 39 expressed sequence tags. Theor. Appl. Genet. 109:725–732. Khlestkina, E. K., Than, M. H., Pestsova, E. G., Roder, M. S., Malyshev, S. V., Korzun, V., and Borner, A. (2005). Erratum: Mapping of 99 new microsatellite-derived loci in rye (Secale cereale L.) including 39 expressed sequence tags. Theor. Appl. Genet. 110:990–991. Röder, M. S., Korzun, V., Wendehake, K., Plaschke, J., Tixier, M., Leroy, P., and Ganal, M. W. (1998). A microsatellite map of wheat. Genetics 149:2007–2023. Röder, M. S., Huang, X.Q. and Ganal, M. W. (2004). Wheat microsatellites: potential and implications. In: Lörz, H., and Wenzel, G. (Eds.), Biotechnology in Agriculture and Forestry, Molecular Marker Systems, vol. 55 (pp. 255–266). Heidelberg, Springer.

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

Recent Patent on Revolver-2

173

[19] Squirrell, J., Hollingsworth, P. M., Woodhead, M., Russell, J., Lowe, A. J., Gibby, M., and Powell, W. (2003). How much effort is required to isolate nuclear microsatellites from plants? Mol. Ecol. 12:1339–1348. [20] Temnykh, S., DeClerck, G., Lukashova, A., Lipovich, L., Cartinhour, S., and McCouch, S. (2001). Computational and experimental analysis of microsatellites in rice (Oryza sativa L.): frequency, length variation, transposon associations, and genetic marker potential. Genome Res. 11:1441–1452. [21] Tero, N., Neumeier, H., Gudavalli, R., and Schlötterer, C. (2006). Silene tatarica microsatellites are frequently located in repetitive DNA. J. Evol. Biol. 19:1612–1619. [22] Varshney, R. K., Beier, U., Khlestkina, E. K., Kota, R., Korzun, V., Graner, A., and Börner, A. (2007). Single nucleotide polymorphisms in rye (Secale cereale L.): discovery, frequency, and applications for genome mapping and diversity studies. Theor. Appl. Genet. 114:1105–1116. [23] Saal, B. and Wricke, G. (1999). Development of simple sequence repeat markers in rye (Secale cereale L.). Genome 42:964–972. [24] Korzun, V., Malyshev, S., Voylokov, A. V., and Börner, A. (2001). A genetic map of rye (Secale cereale L.) combining RFLP, isozyme, protein, microsatellite and gene loci. Theor. Appl. Genet. 102:709–717. [25] Hackauf, B. and Wehling, P. (2005). Approaching the self-incompatibility locus Z in rye (Secale cereale L.) via comparative genetics. Theor. Appl. Genet. 110:832–845. [26] Nagy, E. D. and Lelley, T. (2003). Genetic and physical mapping of sequence-specific amplified polymorphic (SSAP) markers on the 1RS chromosome arm of rye in a wheat background. Theor. Appl. Genet. 107:1271–1277. [27] Kofler, R., Bartoš, J., Gong, L., Stift, G., Suchánková, P., Šimková, H., Berenyi, M., Burg, K., Doležel, J., and Lelley, T. (2008). Development of microsatellite markers specific for the short arm of rye (Secale cereale L.) chromosome 1. Theor. Appl. Genet. 117:915-926. [28] Tomita, M., Shinohara, K., and Morimoto, M. (2008). Revolver is a new class of transposon-like gene composing the Triticeae genome. DNA Res. 15:49-62. [29] Tomita, M., Akai, K. and Morimoto, T. (2009). Genomic subtraction recovers ryespecific DNA elements enriched in the rye genome. Mol. Biotechnol. 42:160-167. [30] Tomita, M., Noguchi, T. and Kawahara, T. (2009). Quantitative variation of Revolver transposon-like genes in synthetic wheat and their structural relationship with LARD element. Breeding Science 59:629-636. [31] Tomita, M., Okutani, A., Beiles, A., and Nevo, E. (2011). Genomic, RNA, and ecological divergences of the Revolver transposon-like multi-gene family in Triticeae. BMC Evolutionary Biology 11:269, doi:10.1186/1471-2148-11-269. [32] Tomita, M. (2008). Revolver-2: a novel transposon-like element from rye. US Patent No.7,351,536B2. [33] Flavell, R. B., Rimpau, J. R. and Smith, D. B. (1977). Repeated sequence DNA relationships in four cereal genomes. Chromosoma 63:205-222. [34] Grandbastien, M. A. (1992). Retroelements in higher plants. Trends Genet. 8:103-108. [35] Barakat, A., Carels, N. and Bernardi, G. (1997). The distribution of genes in the genomes of Gramineae. Proc. Natl. Acad. Sci. USA 94:6857-6861.

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

174

Motonori Tomita

[36] Panstruga, R., Buschges, R., Piffanelli, P., and Schulze-Lefert, P. (1998). A contiguous 60 kb genomic stretch from barley reveals molecular evidence for gene islands in a monocot genome. Nucleic Acids Res. 26:1056-1062. [37] Stein, N. (2007). Triticeae genomics: advances in sequence analysis of large genome cereal crops. Chromosome Res. 15:21-31. [38] Wicker, T., Narechania, A., Sabot, F., Stein, J., Vu, G. T. H., Graner, A., Ware, D., and Stein, N. (2008). Low-pass shotgun sequencing of the barley genome facilitates rapid identification of genes, conserved non-coding sequences and novel repeats. BMC Genomics 9:518, doi: 10.1186/1471-2164-9-518. [39] Flavell, A. J., Pearce, S. R. and Kumar, A. (1994). Plant transposable elements and the genome. Curr. Opin. Genet. Dev. 4:838-844. [40] SanMiguel, P. and Bennetzen, J. L. (1998). Evidence that a recent increase in maize genome size was caused by the massive amplification of intergene retrotransposons. Ann. Bot. 82:37-44. [41] Bennetzen, J. L. (2000). Transposable element contribution to plant gene and genome evolution. Plant Mol. Biol. 42: 251-269. [42] Myers, B. C., Tingey, S. V. and Morgante, M. (2001). Abundance, distribution, and transcriptional activity of repetitive elements in the maize genome. Genome Res. 11:1660-1676. [43] Bennetzen, J. L., Ma, J. and Devos, K. M. (2005). Mechanisms of recent genome size variation in flowering plants. Annals Botany 95:127-132. [44] Boeke, J. D. and Chapman, K. B. (1991). Retrotransposition mechanisms. Curr. Opin. Cell Biol. 3:502-507. [45] Kumar, A. and Bennetzen, J. L. (1999). Plant retrotransposons. Annu. Rev. Genet. 33:479-532. [46] Finnegan, D. J. (1992). Transposable elements. Curr. Opin. Genet. Dev. 2: 861-867. [47] Kunze, R. and Well, C. F. (2002). The hAT and CACTA superfamilies of plant transposons. In: Craig, N. L., Craigie, R., Gellert, M. and Lambowitz, M. (Eds.), Mobile DNA II (pp. 565-610). Washington, DC., American Society of Microbiology. [48] Flavell, A. J., Dunbar, E., Anderson, R., Pearce, S. R., Hartley, R., and Kumar, A. (1992). Ty1-copia group retrotransposons are ubiquitous and heterogeneous in higher plants. Nucleic Acids Res. 20:3639-3644. [49] Voytas, D. F., Cummings, M. P., Konieczny, A. K., Ausubel, F. M., and Rodermel, S. R. (1992). Copia-like retrotransposons are ubiquitous among plant. Proc. Natl. Acad. Sci. USA 89: 7124-7128. [50] Suoniemi, A., Tanskanen, J. and Schulman, A. H. (1998). Gypsy-like retrotransposons are widespread in the plant kingdom. Plant J. 13:699-705. [51] Vicient, C. M., Calendars, R. and Schulman, A. H. (2001). Envelope-class retroviruslike elements are widespread, transcribed and spliced, and insertionally polymorphic in plants. Genome Res. 11:2041-2049. [52] Wessler, S. R., Bureau, T. E. and White, S. E. (1995). LTR-retrotransposons and MITEs; important players in the evolution of plant genomes. Curr. Opin. Genet. Dev. 5:814-821. [53] Bureau, T. E., Ronald, P. C. and Wessler, S. R. (1996). A computer-based systematic survey reveals the predominance of small inverted-repeat elements in wild-type rice genes. Proc. Natl. Acad. Sci. USA 93:8524-8529.

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

Recent Patent on Revolver-2

175

[54] Zhang, X., Jiang, N., Feschotte, C., and Wessler, S. R. (2004). PIF- and Pong-like transposable elements: distribution, evolution and relationship with Tourist-like miniature inverted-repeat transposable elements. Genetics 166:971-986. [55] Feschotte, C. and Wessler, S. R. (2002). Mariner-like transposases are widespread and diverse in flowering plants. Proc. Natl. Acad. Sci. USA 99:280-285. [56] Bennetzen, J. L. (1996). The Mutator transposable element system of maize. Curr. Top Microbiol. Immunol. 204:195-229. [57] Hirochika, H., Sugimoto, K., Otsuki, Y., Tsugawa, H., and Kanda, M. (1996). Retrotransposons of rice involved in mutations induced by tissue culture. Proc. Natl. Acad. Sci. USA 93:7783-7788. [58] Bennetzen, J. L. (1996). The contribution of retroelements to plant genome organization, function and evolution. Trends Microbiol. 4:347-353. [59] Grandbastien, M. A. (1998). Activation of plant retrotransposons under stress conditions. Trends. Plant Sci. 3:181-187. [60] Kumar, A. and Hirochika, H. (2001). Applications of retrotransposons as genetic tools in plant biology. Trends Plant Sci. 6:127-134. [61] Manninen, I. and Schulman, A. H. (1993). BARE-1, a copia-like retroelement in barley (Hordeum vulgare L.). Plant Mol. Biol. 22:829-846. [62] Suoniemi, A., Anamthawat-Jonsson, K., Arna, T., and Schulman, A. H. (1996). Retrotransposon BARE-1 is a major, dispersed component of the barley (Hordeum vulgare L.) genome. Plant Mol. Biol. 30:1321-1329. [63] Vicient, C. M., Suoniemi, A., Anamthawat-Jonsson, K., Tanskanen, J., Beharav, A., Nevo, E., and Schulman, A. H. (1999). Retrotransposon BARE-1 and its role in genome evolution in the genus Hordeum. Plant Cell 11:1769-1784. [64] Guidet, F., Rogowsky, P., Taylor, C., Song, W., and Langridge, P. (1991). Cloning and characterization of a new rye-specific repeated sequence. Genome 34:81-87. [65] Cuadrado, A., Vitellozzi, F., Jouve, N., and Ceoloni, C. (1997). Fluorescence in situ hybridization with multiple repeated DNA probes applied to the analysis of wheat-rye chromosome pairing. Theor. Appl. Genet. 94:347-355. [66] Hamilton, A., Voinnet, O., Chappell, L., and Baulcombe, D. (2002). Two classes of short interfering RNA in RNA silencing. EMBO J. 21:4671-4679. [67] Llave, C., Kasschau, K. D., Rector, M. A., and Carrington, J. C. (2002). Endogenous and silencing-associated small RNAs in plants. Plant Cell 14:1605-1619. [68] Sunker, R., Girke, T. and Zhu, J. K. (2005). Identification and characterization of endogenous small interfering RNAs from rice. Nucleic Acids Res. 33:4443-4454. [69] Feschotte, C. (2008). Transposable elements and the evolution of regulatory networks. Nat. Rev. Genet. 9:397-405. [70] Siomi, H. and Siomi, M. C. (2008). Interactions between transposable elements and Argonautes have (probably) been shaping the Drosophila genome throughout evolution. Curr. Opin. Genet. Dev. 18:181-187. [71] Flavell, R. B. and Smith, D. B. (1976). Nucleotide organization in the wheat genome. Heredity 37:231-252. [72] Smith, D. B. and Flavell, R. B. (1977). Nucleotide sequence organization in the rye genome. Biochim. Biophys. Acta 474:82-97. [73] Bedbrook, J. R., Jones, J., O'Dell, M., Thompson, R. D., and Flavell, R. B. (1980). A molecular description of telomeric heterochromatin in Secale species. Cell 19:545-560.

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

176

Motonori Tomita

[74] Flavell, R. B., O’Dell, M. and Hutchinson, J. (1981). Nucleotide sequence organization in plant chromosomes and evidence for sequence translocation during evolution. Cold Spring Harbor Symp. Quant. Biol. 45:501-506. [75] McIntyre, C. L., Clarke, B. C. and Appels, R. (1988). Amplification and dispersion of repeated DNA sequences in the Triticeae. Plant Syst. Evol. 160:39-59. [76] Lamar, E. E. and Palmer, E. (1984). Y-encoded, species-specific DNA in mice: Evidence that the Y chromosome exists in two polymorphic forms in inbred strains. Cell 37:171-177. [77] Appels, R., Dennis, E. S., Smyth, D. R., and Peacock, W. J. (1981). Two repeated DNA sequences from the heterochromatic regions of rye (Secale cereale) chromosomes. Chromosoma 84:265-277. [78] Rogowsky, P. M., Manning, S., Liu, J. Y., and Langridge, P. (1991). The R173 family of rye-specific repetitive DNA sequences: a structural analysis. Genome 34:88-95. [79] Rogowsky, P. M., Liu, J. Y., Manning, S., Taylor, C., and Langridge, P. (1992). Structural heterogeneity in the R173 family of rye-specific repetitive DNA sequences. Plant Mol. Biol. 20:95-102. [80] Wicker, T., Sabot, F., Hua-Van, A., Bennetzen, J. F., Capy, P., Chalhoub, B., Flavell, A., Leroy, P., Morgante, M., Panaud, O., Paux, E., Sanmiguel, P., and Schulman, A. H. (2007). A unified classification system for eukaryotic transposable elements. Nat. Rev. Genet. 8:973-982. [81] Lisch, D. (2002). Mutator transposons. Trends Plant Sci. 7:498-504. [82] McIntyre, C. L., Pereira, S., Moran, L. B., and Appels, R. (1990). New Secale cereale (rye) DNA derivatives for the detection of rye chromosome segments in wheat. Genome 33:635-640. [83] Appels, R., Moran, L. B. and Gustafson, J. P. (1986). Rye heterochromatin. I. Studies on clusters of the major repeating sequence and the identification of a new dispersed repetitive sequence element. Can. J. Genet. Cytol. 28:645-657. [84] Vershinin, A. V., Schwarzacher, T. and Heslop-Harrison, J. S. (1995). The large-scale genomic organization of repetitive DNA families at the telomeres of rye chromosomes. Plant Cell 7:1823-1833. [85] Carchilan, M., Kumke, K., Mikolajewski, S., and Houben, A. (2009). Rye B chromosomes are weakly transcribed and might alter the transcriptional activity of A chromosome sequences. Chromosoma 118:607-616. [86] Tang, Z. X., Fu, S. L., Ren, Z. L., Zhang, T., Zou, Y. T., Yang, Z. J., Li, G. R., Zhou, J. P., Zhang, H. Q., Yan, B. J., Zhang, H. Y., and Tan, F. Q. (2011). Diversity and evolution of four dispersed repetitive DNA sequences in the genus Secale. Genome 54:285-300. [87] Nevo, E. and Beiles, A. (1989). Genetic diversity of wild emmer wheat in Israel and Turkey. Theor. Appl. Genet. 77:21-455. [88] Nevo, E., Korol, A. B., Beiles, A., and Fahima, T. (2002). Evolution of Wild Emmer and Wheat Improvement. Population Genetics, Genetic Resources, and Genome Organization of Wheat's Progenitor, Triticum dicoccoides. Pp 364. Berlin, Springer. [89] Peng, J., Ronin, Y. I., Fashima, T., Roder, M. S., Li, Y., Nevo, E., and Korol, A. B. (2003). Domestication quantitative trait loci in Triticum dicoccoides, the progenitor of wheat. Proc. Natl. Acad. Sci. USA 100:2489-2494.

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

Recent Patent on Revolver-2

177

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

[90] Shirasu, K., Schulman, A. H., Lahaye, T., and Schuze-Lefert, P. (2000). A contiguous 66-kb barley DNA sequence provides evidence for reversible genome expansion. Genome Res. 10:908-915. [91] Kalendar, R., Vicient, C. M., Peleg, O., Anamthawat-Jonsson, K., Bolshoy, A., and Schulman, A. H. (2004). Large retrotransposon derivatives: abundant, conserved but nonautonomous retroelements of barley and related genomes. Genetics 166:1437-1450. [92] Von Strenberg, R. M., Novick, G. E., Gao, G. P., and Herrera, R. J. (1993). Genome canalization: the co-evolution of transposable and interspersed repetitive elements with single copy DNA. In: McDonald, J. F. (Ed.), Transposable Elements and Evolution (pp. 108-139). Dordrecht, Kluwer Academic Publishers. [93] Marillonnet, S. and Wessler, S. R. (1998). Extreme structural heterogeneity among the members of a maize retrotransposon family. Genetics 150:1245-1246. [94] SanMiguel, P., Gaut, B. S., Tikhonov, A., Nakajima, Y., and Bennetzen, J. L. (1998). The paleontology of intergene retrotransposons of maize. Nature Genet. 20:43-45. [95] Kumar, A., Pearce, S. R., McLean, K., Harrison, G., Heslop-Harrison, J. S., Waugh, R., and Flavell, A. J. (1997). The Ty1-copia group of retrotransposons in plants: genomic organisation, evolution, and use as molecular markers. Genetica 100:205-217.

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved. New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

In: New Developments in Chromatin Research Editors: Neil M. Simpson and Valerie J. Stewart

ISBN: 978-1-62081-816-9 © 2012 Nova Science Publishers, Inc.

Chapter 9

THE REMOVAL OF DNA DAMAGE IS PROMOTED BY THE YEAST GLOBAL GENOME NUCLEOTIDE EXCISION REPAIR FACTOR RAD16 Shirong Yu, Yumin Teng, Raymond Waters and Simon Reed Department of Medical Genetics, Haematology and Pathology School of Medicine, Cardiff University, Heath Park, Cardiff, UK

ABSTRACT Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

In response to UV radiation induced DNA damage, increased histone H3 acetylation at lysine 9 and 14 correlates with changes in chromatin structure and these alterations are associated with efficient global genome nucleotide excision repair (GG-NER) in yeast. We showed that both these changes occur in response to UV radiation in the absence of functional GG-NER. More recently we reported that although these changes occur independently of functional NER, they do depend on the Rad16 GG-NER protein. Remarkably, we showed that constitutive hyperacetylation of histone H3 can suppress the requirement for both the Rad7 and Rad16 GG-NER proteins during DNA repair. These observations hinted at a possible mechanistic link between the Rad7 and Rad16 proteins and the process of chromatin remodelling required for efficient DNA repair. In this chapter we reveal how UV induced histone H3 acetylation is regulated during GG-NER, and show that this activity promotes the chromatin remodelling necessary for efficient repair of DNA damage. Our studies demonstrate that yeast Rad7 and Rad16 proteins drive UV induced chromatin remodelling required for DNA repair by controlling histone H3 acetylation levels in chromatin. This is achieved via the concerted action of the ATPase, and C3HC4 RING domains of Rad16, which combine to regulate the occupancy of histone acetyl transferases on chromatin in response to UV damage.



Email: [email protected]; Tel:+44 29 20687334; Fax:+44 29 20687343.

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

180

Shirong Yu, Yumin Teng, Raymond Waters et al.

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

INTRODUCTION DNA repair is a central facet of DNA metabolism, and nucleotide excision repair (NER) is an important component of a complex cellular response that prevents the loss of genetic information caused by DNA damage. Its importance for the repair of ultraviolet (UV) light induced DNA lesions is dramatically illustrated in humans who suffer from the autosomal recessive disease xeroderma pigmentosum (XP). Defective NER in these individuals severely predisposes them to sunlight-induced skin cancers [1]. The removal of lesions from nontranscribed regions of the genome involves the global genome nucleotide excision repair (GG-NER) pathway, which in yeast requires the Rad7 and Rad16 GG-NER proteins [1]. Many of the core enzymatic activities associated with NER have been determined in some detail, but an understanding of how the process functions in relation to chromatin structure is still in its infancy. DNA in eukaryotic cells is packaged into nucleosomes that form as a result of the wrapping of DNA around histone octamers. Higher-order chromatin structures are formed when nucleosomal arrays are further compacted. Chromatin has a major impact on DNA metabolic processes by controlling the functional interaction of proteins with regulatory and other elements in the DNA [2, 3]. Chromatin remodelling and histone modification are two major mechanisms that contribute to this regulation. Both processes have roles in controlling gene transcription [4, 5] and in NER [6-8]. GG-NER in S.cerevisiae requires both the Rad7 and Rad16 proteins [9-11]. Rad16 is a member of the SWI/SNF super-family of chromatin remodelling factors [12]. This superfamily of proteins exhibits ATPase activity that is stimulated by DNA or chromatin [13, 14], and all SWI/SNF-like proteins generate superhelical tension in linear DNA fragments via a DNA translocase activity associated with their ATPase function [15, 16]. The generation of superhelicity in DNA is a common mechanism of SWI/SNF-like chromatin remodelling complexes for altering chromatin structure [15]. We recently reported that a Rad7 and Rad16 containing protein complex also has DNA translocase activity. However, it is unable to slide nucleosomes unlike some SWI/SNF superfamily complexes [17]. Although Rad16 is a member of the SWI/SNF super-family, direct evidence of a role in chromatin remodelling is lacking. In this study we have addressed how GG-NER functions during DNA repair in chromatin. Previously we showed that following UV irradiation, the histone acetyl transferase Gcn5, and histone H3 (H3Ac) acetylation promotes efficient NER of UV-induced cyclobutane pyrimidine dimers (CPDs) both globally and in the MFA2 gene [6, 18]. Histone H3 acetylation at lysine 9 and 14 (K9, K14) in response to UV irradiation does not require a functioning NER pathway, since H3Ac after UV can be detected in NER defective cells. However, UV induced histone H3 acetylation depends on the presence of the Rad16 GG-NER protein. We revealed that constitutively elevating histone H3 acetylation levels in the MFA2 gene suppresses the requirement for Rad7 and Rad16 during GG-NER [8]. Gene regulation of MFA2 involves the yeast general repressor complex Ssn6-Tup1 [19]. Deletion of TUP1 results in elevated histone H3 acetylation and modified chromatin structure at the promoter of the MFA2 gene [20-22]. Remarkably, Rad7 and Rad16 independent GG-NER occurs in the promoter region of MFA2 in TUP1 deleted cells. This suggested that Rad7 and Rad16

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

The Removal of DNA Damage is Promoted by the Yeast Global Genome ...

181

regulate chromatin structure in response to UV damage during GG-NER, possibly via the control of histone H3 acetylation levels. Rad16 mediates UV induced histone H3 acetylation required for efficient GG-NER at MFA2 [8], and UV irradiation promotes accessibility of restriction enzyme sites in nucleosomal DNA at the MFA2 promoter [6]. Here, we uncover the mechanistic link between these two observations. Our studies define a series of UV induced, Rad7 and Rad16 dependent events that control histone H3 acetylation and drive chromatin remodelling necessary for efficient GG-NER in yeast. Rad7 and Rad16 control histone H3 acetylation status of MFA2 by modifying the occupancy of the Gcn5 histone acetyl transferase at MFA2 in response to UV irradiation. We reveal that these UV induced histone H3 modifications ultimately result in chromatin remodelling necessary for efficient GG-NER in the region.

MATERIALS AND METHODS

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

Plasmids and Yeast Strains Plasmids or yeast strains

Characteristics or Genotype

pRAD16

pRS315-RAD16

pK216A

pRS315-RAD16K216A

pC552AH554A

pRS315-RAD16C552A,H554A

pK216AC552AH554A

pRS315-RAD16K216A,C552A,H554A

PSY316 a

MATa ade2-101 ura3-52 leu2-3,112 his3-200 lys2 trp1 MATα ade2-101 ura3-52 leu2-3,112 his3-200 lys2 trp1 MATα ade2-101 ura3-52 leu2-3,112 his3-200 lys2 trp1tup1::HIS3 MATα ade2-101 ura3-52 leu2-3,112 his3-200 lys2 trp1 MATα ade2-101 ura3-52 leu2-3,112 his3-200 lys2 trp1 rad16::URA3 MATα ade2-101 ura3-52 leu2-3,112 his3-200 lys2 trp1rad7::TRP1 MATα ade2-101 ura3-52 leu2-3,112 his3-200 lys2 trp1tup1::HIS3 rad16::URA3 MATα ade2-101 ura3-52 leu2-3,112 his3-200 lys2 trp1tup1::HIS3 rad7::TRP1 MATα ade2-101 ura3-52 leu2-3,112 his3-200 lys2 trp1tup1::HIS3 MATα ade2-101 ura3-52 leu2-3,112 his3-200 lys2 trp1 tup1::HIS3 rad16::URA3 MATα his31 leu20 lys20 ura30

PSY316 α PSY316tup1 PSY316gcn5 PSY316rad16 PSY316rad7 PSY316tup1rad16 PSY316tup1rad7 PSY316tup1 gcn5 PSY316tup1rad16gcn5 BY4742 (WT)

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

182

Shirong Yu, Yumin Teng, Raymond Waters et al. Plasmids or yeast strains

Characteristics or Genotype

BY4742rad16

MATα his31 leu20 lys20 ura30 rad16:: kanMX4 MATα his31 leu20 lys20 ura30 rad7:: kanMX4 MATα his31 leu20 lys20 ura30 GCN5:: myc9-URA3 MATα his31 leu20 lys20 ura30 rad16:: kanMX4 GCN5::myc9-URA3 MATα his31 leu20 lys20 ura30 rad7:: kanMX4 GCN5::myc9-URA3 MATα his31 leu20 lys20 ura30 rad16:: kanMX4 GCN5::myc9-URA3 pRAD16 MATα his31 leu20 lys20 ura30 rad16:: kanMX4 GCN5::myc9-URA3 pK216A MATα his31 leu20 lys20 ura30 rad16:: kanMX4 GCN5::myc9-URA3 pC552AH554A

BY4742rad7 BY4742GCN5/myc BY4742rad16GCN5/myc BY4742rad7GCN5/myc BY4742GCN5/myc pRAD16 (WT) BY4742GCN5/myc pK216A (rad16-K216A) BY4742GCN5/myc pC552A,H554A (rad16C552A,H554A) BY4742GCN5/myc pK216A,C552A,H554A (rad16K216A,C552A,H554A)

MATα his31 leu20 lys20 ura30 rad16 :: kanMX4 GCN5::myc9-URA3 pK216AC552H554A

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

UV Survival Assays Cells were grown in synthetic complete medium with leucine dropout (SC-leu-) to midlog phase (around 2107 cells/ml). Following mild sonication, cells were plated on SC-leuagar plates, then irradiated with the germicidal UV lamp at the indicated UV doses. Following irradiation, plates were immediately wrapped in foil and incubated for 3 days at 30°C. Survival was derived from the number of colonies relative to that in the unirradiated control. Experiments were performed in triplicate.

Chromatin Immunoprecipitation (CHIP) This was performed as in Yu et al, 2005 [6] with modifications. In brief, proteins were cross-linked to DNA by addition of formaldehyde to 100 ml yeast cells (about 2  109 cells) to a final concentration of 1% for 20 min at room temperature. 5.5 ml of Glycine (2.5 M) was added to stop cross-linking. Cells were lysed by the addition of 0.5ml of glass beads (Sigma), and vortexed for 30 min on a Disruptor Genie at 4 ºC. The cell lysate was sonicated to generate DNA fragments ranging from 200–500 bps in length. Sonication was carried out using the Bioruptor (Diagenode) following the manufacturer’s instruction at 4ºC, power position “H”, 20 seconds on and 40 seconds off for 6 cycles. 50 μl of pre-washed pan mouse or anti-rabbit IgG Dynabeads was incubated with 2.5 µg of mouse anti-Myc (9E11, Abcam) antibody, or 2.5 µl of rabbit anti-acetyl histone H3 (at K9 and K14, Upstate Biotechnology) at 30 C for 30 min, then the antibody bound Dynabeads were subsequently incubated with 100 µl sheared chromatin solution equivalent to 108 cells in a total volume of 0.5 ml for 3 hours at

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

The Removal of DNA Damage is Promoted by the Yeast Global Genome ...

183

21 C. After elution with pronase buffer (125 mM Tris pH7.5, 25 mM EDTA, 2.5 % SDS) from Dynabeads beads, formaldehyde cross-linking was reversed by incubating the eluate at 65°C overnight in the presence of 125 g of pronase. Finally, DNA was purified with PCR purification kit (QIAGEN). 50 µl of chromatin solution was taken as input control for each sample. Quantitative PCR was performed in real time using iQ SYBR Green Supermix (BioRad) and diluted DNA in the Bio-Rad MyiQ. PCR was performed in triplicate for each sample, and melting curves were executed to ensure single PCR products. Primers for amplifying nucleosome N-2 in the promoter region of MFA2 are: primer 1, AAAGCAGCATGTTTTCATTTGAAACA; primer2, TATGGGCGTCCTATGCATGCAC.

Chromatin Preparation, Mnase Digestion, and the High-Resolution Nucleosome Mapping These were carried out as described previously [23]

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

Restriction Enzyme Accessibility Chromatin was prepared as described in Teng et al, [23] with modifications. In brief, cells from 200 ml YPD (2-4109 cells) were pelleted, washed in cold PBS and 1M Sorbitol, and spheroplasted in 1m lysis solution (1 M Sorbitol, 5 mM 2-mercatoethanol) containing 20 mg of Zymolyase-20T per 1 g of cells for 20 min at 30C. Spheroplasts were washed with cold 1M Sorbitol, and lysed in 7 ml Ficoll solution (18 % Ficoll, 20 mM KH2PO4, pH6.8, 1 mM MgCl2, 0.25 mM EGTA, 0.25 mM EDTA) per 1 g cell. Collecting nuclei by centrifugation, and washing the pellet with RsaI restriction enzyme reaction buffer, chromatin from 4108 cells was incubated with 300 units of RsaI for 3 hours at 37°C. Purified DNA from the digest was subjected to a secondary digestion by HaeIII and then resolved on 1.5% agarose gel in 1TAE buffer. Southern transfer of DNA to GeneScreen Plus Hybridization Transfer Membrane (Perkin Elmer) preparation was described previously [18].

Preparation of Radioactive Probes for Southern Blot Analysis These were undertaken as described in Teng et al, [18].

UV Treatment of Yeast Cells, DNA Isolation and High Resolution Mapping of CPD Sites These were undertaken as described by Reed et al, [24] and Teng et al, [25].

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

184

Shirong Yu, Yumin Teng, Raymond Waters et al.

RESULTS UV Induced Histone H3 Acetylation (K9, K14) Requires Both Rad7 and Rad16 Acetylation of histone H3 after UV irradiation depends on the presence of Rad16 and this process is necessary for efficient GG-NER [8]. Figure 1A shows that UV induced histone H3 acetylation (K9, K14) at the regulatory region of the MFA2 gene also requires the GG-NER factor Rad7.

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

Rad7 and Rad16 Control H3Ac Status by Regulating Gcn5 Occupancy at MFA2 Rad7 and Rad16 control UV induced histone H3 acetylation at MFA2 and these proteins are not required for GG-NER when histone H3 acetylation is constitutively elevated in the region. So we reasoned that during GG-NER Rad7 and Rad16 mediate changes in histone H3 acetylation after UV. We speculated that Rad7 and Rad16 achieve this by controlling the accessibility of the histone acetyl transferase Gcn5, which regulates histone H3 acetylation at MFA2. To test this we performed Gcn5 chromatin immunoprecipitation (ChIP) experiments in the promoter of the MFA2 gene. Figure 1B shows the relative levels of Gcn5 binding at the repressed MFA2 promoter in the absence of UV irradiation (U) or following UV irradiation at the times indicated (0, 15 and 60 minutes) in wild type, rad7 and rad16 strains. In the absence of UV irradiation, background levels of Gcn5 occupancy are detected in all three strains. However, in response to UV irradiation, a rapid increase in Gcn5 occupancy is observed in the wild type, but not in the rad7 or rad16 strains. In wild type cells, decreasing levels of Gcn5 occupancy at MFA2 were observed with increasing time after UV irradiation as repair occurred. Therefore in wild type cells Gcn5 occupies the promoter of the MFA2 gene at low levels, preventing histone H3 acetylation at MFA2 in the absence of UV. Following UV, a Rad7 and Rad16 dependent increase in Gcn5 occupancy (Figure 1B) and histone H3 acetylation (Figure 1A) is observed at MFA2. Therefore Rad7 and Rad16 regulate histone H3 acetylation status at MFA2 by controlling the occupancy of the Gcn5 histone acetyl transferase at MFA2. Next we examined whether UV induced acetylation alters local chromatin structure at MFA2. Therefore Rad7 and Rad16 function in combination to increase H3Ac levels at MFA2 in response to UV. UV induced H3Ac correlates with efficient GG-NER and elevated levels of H3Ac in the MFA2 promoter in a strain where Tup1 is absent; this suppresses the requirement for Rad7 and Rad16 during GG-NER [8), and so poses the question as to how Rad7 and Rad16 control histone H3 acetylation.

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

The Removal of DNA Damage is Promoted by the Yeast Global Genome ...

185

Figure 1 (A). Histone H3 acetylation and occupancy of Gcn5 at the MFA2 promoter. ChIP analysis of Histone H3 acetylation (H3Ac) at the MFA2 promoter using H3Ac (Lys 9 and Lys 14) antibody was performed in wild type (WT), rad7 and rad16 cells. U: untreated samples; 0: cells received 100 J/m2 of ultraviolet without repair; 1 and 2: cells were irradiated with ultraviolet and then allowed to repair in YPD medium for one or two hours respectively. Acetylation level shown is the fold change relative to unirradiated cells. Data are the average of at least three independent experiments ± SD. (B). ChIP with anti-myc antibody was performed in WT, rad7 and rad16 cells. Gcn5 binding is presented as the fold change relative to untreated cells. Data are the average of at least three independent experiments ± SD.

Histone H3 Acetylation Regulates Chromatin Structure at the Promoter of MFA2 We measured chromatin changes at MFA2 in TUP1 deleted -cells where histone H3 is hyperacetylated and where the requirement for Rad7 and Rad16 during GG-NER is abrogated. Tup1 is a component of a repressor complex that regulates gene expression at MFA2. In  mating type cells where the chromatin is repressed, the deletion of TUP1 correlates with altered chromatin structure in MFA2 and other TUP1 regulated genes [8, 21, 23]. To confirm this we compared the MNase sensitive sites in naked DNA and chromatin from wild type and tup1 α-cells at high resolution on both DNA strands of the MFA2 promoter region (Figure 2 A and B). Figure 2 A and B reveal that the MNase digestion pattern is almost identical between tup1 α-cell chromatin and naked DNA, whereas chromatin from wild type α-cells exhibited a significantly reduced MNase digestion pattern due to protection by the positioned

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

186

Shirong Yu, Yumin Teng, Raymond Waters et al.

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

nucleosomes designated N-1 and N-2. Therefore chromatin structure is altered in TUP1 deleted -cells. To further explore the effect of histone acetylation on chromatin structure we examined the accessibility of the restriction enzyme RsaI to nucleosomal core DNA. Chromatin samples were treated with RsaI restriction enzyme and purified DNA was digested using HaeIII. Restriction with HaeIII generated a 599 bp DNA fragment (Figure 2C). A double restriction digest with RsaI and HaeIII of naked DNA generated a smaller fragment of 419 bp (Figure 2C). In wild type α-cells MFA2 is repressed by positioned nucleosomes and RsaI has only limited access to the DNA at its restriction site located within nucleosome N-2. RsaI digests only 8.7 ± 1.9 % of the total MFA2 fragments (Figure 2D, Lane 2). However, in wild type acells and tup1 α-cells (Figure 2D, Lanes 1 and 5) where MFA2 is derepressed, RsaI cuts in both strains to the extent of 60.3 ± 1.0% and 74.5 ± 2.2% of the total HaeIII fragments, respectively. Therefore, restriction enzyme sites are masked in chromatin from wild type αcells, but are highly accessible in chromatin from wild type a-cells and tup1 α-cells.

Figure 2. (A and B) Densitometric scan of MNase sensitive regions of the MFA2 promoter. Relative MNase sensitivity is expressed graphically by scanning the sequencing gels shown in (26). Trace A: transcribed strand (TS); Trace B: non-transcribed strand (NTS). The positioned nucleosomes observed in WT cells are represented by ellipses N-1 and N-2. (C) Schematic representation of the assay in D. The middle of nucleosome N-2 of MFA2 promoter has a single RsaI restriction site within the HaeIII restriction fragment. The probe shown detects either the full-length 599bp of HaeIII fragment or 419bp of RsaI and HaeIII double digested fragment. The protection rendered by nucleosome N-2 limits the accessibility of RsaI to the site. (D) Southern blot analysis of RsaI accessibility to the MFA2 promoter N-2 site. Lane −: naked DNA digested by HaeIII only; lane +: naked DNA digested by both HaeIII and RsaI. Lanes 1-8 represent HaeIII degisted DNA purified from RsaI digested chromatin samples from the strains listed. The lower panel shows the data graphically.

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

The Removal of DNA Damage is Promoted by the Yeast Global Genome ...

187

Increased Histone H3 Acetylation Levels at MFA2 in TUP1 Deleted  Cells Is Dependent on Gcn5 and Rad16

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

The relationship between chromatin accessibility and histone H3 acetylation status was examined by measuring the histone H3 acetylation levels in the MFA2 promoter in the absence of and following UV irradiation. In Figure 1A, and in Figure 3, a two to three fold UV induced histone H3 acetylation is observed in wild type -cells. In the tup1Δ strain an eight to ten-fold elevation in constitutive histone H3 acetylation is observed and no further increase in H3 acetylation is seen following UV irradiation. A similar result was noted in the tup1Δrad16Δ -cells. Intriguingly, in tup1Δgcn5Δ -cells, histone H3 acetylation remains constitutively high, despite the loss of the Gcn5 histone acetyl transferase in this strain. One possibility is that other HATs can compensate. However, this putative redundancy is dependent on Rad16 since the tup1Δgcn5Δrad16 triple mutant strain abolishes histone H3 acetylation (Figure 3).

Figure 3. Histone H3 acetylation at MFA2. ChIP analysis of Histone H3 acetylation (H3Ac) was performed using H3Ac (Lys 9 and Lys 14) antibodies. U: untreated samples; 0: cells received 100 J/m 2 of UV without repair; 1, 2 or 4: cells were irradiated with ultraviolet and then were allowed to repair in YPD for the number of hours indicated. Acetylation level is presented as the fold change relative to unirradiated WT cells. Data are the average of at least three independent experiments ± SD.

Increased Chromatin Accessibility at MFA2 in TUP1 Deleted  Cells Depends on Rad16 and Gcn5 Next we examined the effects of Rad16 and the histone acetyl transferase Gcn5 on chromatin accessibility. Figure 2D lanes 3 and 4 demonstrate that in RAD16 or GCN5 deleted -cells chromatin structure remains closed as evidenced by the low-level of RsaI cutting observed (8.2% ± 2.3% and 9.0% ± 2.6% respectively), a similar level to that seen in WT cells (Figure 2D, Lane 2). In tup1rad16 double mutant -cells, open chromatin structure is retained as high levels of restriction enzyme cutting are observed (73.1% ± 3.4%) (Figure 2D,

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

188

Shirong Yu, Yumin Teng, Raymond Waters et al.

Lane 7), similar to levels seen in tup1 -cells (Figure 2D, Lane 5). Open chromatin structure was also seen in tup1gcn5 -cells shown in lane 8 (75.1% ± 1.0% RsaI enzyme cutting). This was an unexpected observation, since the histone acetyl transferase Gcn5 is deleted in this strain. But the result is consistent with the constitutively high histone H3 acetylation level detected in these cells (Figure 3). This explains the increased chromatin accessibility observed in this strain (Figure 2D, lane 8). Note that deleting RAD16 in tup1gcn5 -cells to create a tup1rad16gcn5 triple mutant strain results in significantly reduced restriction enzyme cutting indicating the presence of a repressed chromatin structure at the site (45.2% ± 3.4% RsaI enzyme cutting) (Figure 2D, lane 6).

Increased Histone H3 Acetylation Levels and Open Chromatin Structure are Required for Rad7 and Rad16 Independent GG-NER

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

Rad7 and Rad16 independent GG-NER occurs in genomic regions where constitutively elevated levels of H3Ac are observed, such as the promoter of MFA2 in tup1 α-cells (Figure 4 and 26). The absence of CPD repair at MFA2 in the tup1Δ,rad14Δ mutant proves that repair in the tup1,rad16 α-cells occurs unequivocally via Rad7 and Rad16 independent GG-NER [8]. This suggested that Rad7 and Rad16 mediated UV induced histone H3 acetylation is necessary for efficient GG-NER. We examined this by measuring repair of CPDs in the promoter of MFA2 in tup1rad16 α-cells and in tup1rad16gcn5 α-cells, where the histone acetyl transferase Gcn5 is absent.

Figure 4. Repair of CPDs at the MFA2 promoter. Time to remove 50% of the initial CPDs (T50%) at the sites indicated. T50% of a single CPD or a clustered group of CPDs with similar repair rates was calculated as described previously (18). The T50% of unrepaired CPDs (T50% ≥ 8 h) were represented at the 8 h level on the graph.

Figure 4 shows the time taken for removing 50% of the CPDs (T50%) from the nontranscribed strand at the positions indicated. As seen previously, GG-NER in tup1rad16 α-cells, or tup1rad7α is restored to near wild type levels compared to the lack of repair seen in the rad16 α single mutant cells (Figure 4). Therefore Rad7 and Rad16 are no longer required for GG-NER in the MFA2 promoter region when histone H3Ac levels

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

The Removal of DNA Damage is Promoted by the Yeast Global Genome ...

189

are elevated creating an open chromatin structure (Figure 3 and Figure 2D, lane 5). To determine the significance of UV induced H3Ac levels and chromatin structure on efficient GG-NER we examined repair in tup1rad16gcn5 α-cells. Figure 4 reveals that loss of H3Ac which causes reduced chromatin accessibility [See Figure 3 and Figure 2D, lane 6] in this triple mutant strain, results in significantly reduced GG-NER in the region (Figure 4: open diamonds). Therefore, the Rad7 and Rad16 independent GG-NER observed at MFA2 in TUP1 deleted cells occurs due to the constitutively elevated levels of histone H3 acetylation and open chromatin structure in the region.

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

The Atpase and RING Domains of Rad16 Both Contribute to Efficient UV Survival Rad16 has two identified catalytic functions: a DNA translocase activity associated with the ATPase domain [17], and an E3 ubiquitin ligase activity associated with the C3HC4 RING domain embedded within the ATPase domain [see Figure 5A] [27, 28]. We introduced point mutations into each of the catalytic domains of Rad16 to examine their effect on GGNER. The ATPase activity was tested by mutating the conserved Walker A box catalytic residue lysine 216 to alanine (K216A). This mutation creates an ATPase null mutant [27]. We call this the RAD16 ATPase mutant. We also mutated the RING domain of Rad16 to test the role of the E3 ligase activity. RING domains have conserved cysteine and histidine residues that coordinate two zinc atoms. A conserved hydrophobic residue is also essential for the interaction between the RING domain and specific E2 ubiquitin conjugating enzymes. We made two point mutations in conserved cysteine and histidine residues; cysteine 552 to alanine and histidine 554 to alanine (C552A,H554A). We call this the RAD16 RING mutant. Finally, we tested the effect of mutating both the ATPase and RING domains of Rad16 by introducing these mutations (K216A,C552A,H554A) into a single strain. We tested the UV sensitivity associated with each of these three point mutated strains. Figure 5B compares the UV survival curves of these strains with the parental wild type strain, and the Rad16 deleted strain. Figure 5B shows that the individual RAD16 ATPase and RING mutant strains show intermediate UV sensitivity. Combining the two mutants to create a RAD16 ATPase, RING double mutant strain results in the same level of UV sensitivity as the RAD16 deleted strain. These observations confirm previous findings that both the ATPase and RING E3 ligase catalytic activities contribute independently to efficient GG-NER and UV survival [27, 28].

The Atpase and RING Domains of Rad16 Are Both Required for UV Induced Gcn5 Occupancy and Histone H3 Acetylation We examined the effect of the RAD16 point mutations on the level of histone H3 acetylation and Gcn5 occupancy at MFA2. We performed histone H3 acetylation (K9, K14) ChIP experiments in the promoter of MFA2. Figure 5C shows the relative levels of acetylated histone H3 at the repressed MFA2 in the absence of UV (U) or after UV irradiation at the times indicated (0, 15 and 60 minutes) in the strains indicated.

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

190

Shirong Yu, Yumin Teng, Raymond Waters et al.

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

In the absence of UV irradiation, background levels of histone H3 acetylation are detected in all four strains. However, in response to UV irradiation, a rapid increase in histone H3 acetylation is observed in the wild type strain and in the single RAD16 ATPase and RING mutated strains, but not in the RAD16 ATPase, RING double mutant strain, where UV induced histone H3 acetylation is abolished. Similar results were obtained when Gcn5 occupancy was examined in these strains, Figure 5D.

Figure 5. (A) The main domain structure of Rad16. (B) UV survival curves of the strains indicated. The result shows the average of three independent experiments. (C) Histone H3 acetylation at the MFA2 promoter. ChIP analysis of Histone H3 acetylation (H3Ac) was performed using H3Ac (Lys 9 and Lys 14) antibody. U: untreated samples; 0: cells received 100 J/m2 of ultraviolet without repair; 15 and 60: cells were irradiated with UV and then were allowed to repair in medium for the times indicated. Acetylation level shown as the fold change relative to unirradiated cells. Data are the average of at least three independent experiments ± SD. (D). The occupancy of Gcn5 at the MFA2 promoter. ChIP was performed with anti-myc antibody. Gcn5 binding is presented as the fold change relative to untreated cells. Data are represented as average of at least three independent experiments ± SD.

The Atpase and RING Domains of Rad16 Are Both Required for Efficient GG-NER Finally, we examined the repair of CPDs in the promoter region of MFA2 in wild type and each of the point mutated strains described above (Figure 6A and 26). In Figure 6A repair was expressed as the time taken to remove 50% of the CPDs (T50%) from the nontranscribed strand at the nucleotide positions indicated. As seen previously, GG-

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

The Removal of DNA Damage is Promoted by the Yeast Global Genome ...

191

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

NER in the nontranscribed strand of MFA2 proceeds efficiently in wild type cells (Figure 6A). Mutating either the ATPase domain or the RING domain of RAD16 individually impairs UV lesion removal, but GG-NER continues to function less efficiently. This correlates with the near wild type levels of histone H3 acetylation, Gcn5 occupancy (Figure 5C and D), and the intermediate UV sensitivity (Figure 5B) observed in these single mutant domain strains. GG-NER in the ATPase, RING domain double mutated strain is abolished over almost the whole of the MFA2 promoter region and occurs at a level seen in the RAD16 deleted strain (Figure 6A and Figure 4).

Figure 6. Repair of CPDs at the MFA2 promoter. Time to remove 50% of the initial CPDs (T50%) at given sites. T50% of a single CPD or a clustered group of CPDs with a similar repair rate was calculated as described previously (18). The T50% of unrepaired CPDs (T50% ≥ 8 h) were represented at the 8 hour level on the graph. See also Supplemental Figure 3. (B) Southern blot analysis of RsaI accessibility to the MFA2 promoter N-2 nucleosomal DNA, as described in legend to Figure 2D.

This correlates with the lack of UV induced histone H3 acetylation and Gcn5 occupancy in the region (Figure 5C and D), and the high level of UV sensitivity (Figure 5B) observed in this double mutant strain. A small region at the TATA box of MFA2 showed reduced rather than totally defective repair in this double mutant strain. These observations demonstrate that the ATPase and RING domains of Rad16 function in combination to regulate UV induced Gcn5 occupancy and histone H3 acetylation status, which ultimately controls chromatin

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

192

Shirong Yu, Yumin Teng, Raymond Waters et al.

structure at MFA2 in response to DNA damage. In Figure 6B we demonstrate the lack of UV induced chromatin remodelling observed in the ATPase, RING double mutated strain compared to the remodelling observed in the wild type strain using the restriction enzyme accessibility assay described earlier in Figure 2 C and D. This confirms the importance of chromatin remodelling to the GG-NER process.

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

DISCUSSION We’ve shown that Rad7 and Rad16 proteins are required for UV induced histone H3 acetylation at the MFA2 gene. These GG-NER factors regulate the acetylation status at MFA2 by controlling the occupancy of the histone acetyl transferase Gcn5 at this locus. In unirradiated cells only background levels of Gcn5 are detected at the promoter of MFA2. Following UV irradiation of WT cells increased Gcn5 occupancy is seen at MFA2. This correlates with increased acetylation of histone H3 observed in WT cells in response to UV. In Rad7 and Rad16 deleted cells no increased Gcn5 occupancy or increased histone H3 acetylation are observed at MFA2 in response to UV. This indicates that both events are Rad7 and Rad16 dependent in WT cells. Increased histone acetylation levels have long been associated with changes in chromatin structure, particularly with respect to generating an open chromatin structure needed for gene transcription [6]. To address the impact of histone H3 acetylation on chromatin structure at MFA2 in response to UV, we employed two methods: a high-resolution nucleosome mapping assay, and a restriction enzyme accessibility assay. We examined these events in TUP1 deleted cells since Tup1 is a component of the Ssn6-Tup1 general repressor complex, which regulates gene expression in a range of genes including MFA2. In  mating type yeast cells MFA2 is repressed, but in TUP1 deleted -cells histone H3 levels at MFA2 are constitutively elevated which results in an open chromatin structure at MFA2. We found that cells with elevated levels of histone H3 acetylation such as TUP1, TUP1,RAD16 and TUP1,GCN5 deleted -cells also had open chromatin structure as demonstrated in the restriction enzyme accessibility assay in Figure 2D. We were surprised to detect elevated levels of histone H3 acetylation, and open chromatin structure in TUP1,GCN5 deleted cells since the histone acetyl transferase Gcn5 is known to function at MFA2 in wild-type cells is absent in this strain [6]. We speculate that in GCN5 deleted cells, an alternative histone acetyl transferase can substitute for GCN5. This putative substitution is dependent on Rad16, since in tup1rad16gcn5 triple mutant cells, histone H3 acetylation and open chromatin structure is lost. To determine the significance of histone H3 acetylation at MFA2 on lesion removal during GG-NER we examined repair in TUP1 deleted cells. To determine whether the elevated levels of histone H3 acetylation and open chromatin structure observed in TUP1,RAD16 deleted cells contributes to the repair observed in these cells, we examined repair in the tup1rad16gcn5 triple mutant strain where histone H3 levels are diminished to background levels, and chromatin accessibility is significantly reduced.

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

The Removal of DNA Damage is Promoted by the Yeast Global Genome ...

193

We found that the wild type level of repair observed in the TUP1,RAD16 deleted cells was significantly reduced in the tup1rad16gcn5 mutant cells indicating the importance of histone H3 acetylation and chromatin structure to the repair observed in the region. Finally, we investigated whether either of the known activities associated with Rad16 was responsible for controlling this series of events. We made strains that carried point mutations in the ATPase or the C3HC4 RING domain of Rad16, or a double mutant strain that carried both these mutations. Previous studies showed that the Rad16 ATPase mutant has no detectable ATPase function [25], and the Rad16 RING mutant has no detectable E3 ligase activity. UV survival experiments showed an intermediate UV sensitivity for the Rad16 ATPase and RING domain single mutants, while the double domain mutant showed the high UV sensitivity seen in the RAD16 deleted strain (Figure 5). Therefore both the ATPase and E3 ligase functions of Rad16 contribute to efficient GGNER, and this conclusion agrees with previous studies [24, 25]. We also showed that both Rad16 domains contribute to efficient lesion removal during GG-NER. Our data shows reduced levels of CPD removal from the nontranscribed strand of the MFA2 promoter in each of the single domain mutant strains [26], and defective lesion removal only in the double domain mutant strain (Figure 6A). This observation correlates with the level of Gcn5 occupancy and histone H3 acetylation levels observed in these strains (Figure 5C and D). Loss of UV induced Gcn5 occupancy and histone H3 acetylation is again only observed in the double mutant strain suggesting that the ATPase and RING domains of Rad16 contribute to efficient chromatin remodelling during GG-NER. Figure 6B confirms that efficient GG-NER observed in the wild type strain is dependent on UV induced chromatin remodelling since failure to remodel chromatin in the ATPase, RING double mutant strain results in defective repair. Collectively our results demonstrate that during GG-NER the Rad7 and Rad16 proteins promote efficient repair by regulating histone acetyl transferase occupancy on chromatin in response to UV. This explains how histone H3 acetylation status and chromatin structure is controlled in response to DNA damage, and that this is necessary for efficient GG-NER. At this point it is not understood how the Rad16 E3 ligase contributes to chromatin remodeling during GG-NER. One possibility is that ubiquitination of key NER or other chromatin-associated factors is necessary to efficiently initiate Rad7 and Rad16 dependent histone H3 acetylation in response to UV. We are currently examining UV induced posttranslational modifications to several components of the GG-NER complex to address this question. Our results are consistent with our proposed model for UV induced chromatin modifications described in Figure 7, and where histone acetylation drives chromatin remodelling for efficient global genome repair. Here, these changes in the transcriptionally silent chromatin enable GG-NER but prevent transcription initiation because they do not render the TATA box accessible to TATA box binding protein, a step essential for triggering transcription.

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

194

Shirong Yu, Yumin Teng, Raymond Waters et al.

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

Figure 7. Model for UV induced chromatin remodeling during GG-NER. Top panel. In the absence of UV, basal levels of histone acetyl transferase occupancy is observed, histone H3 tails remain unacetylated and chromatin is repressed. Lower Panel. Following UV the DNA translocase [1] and E3 ligase [2] activities of Rad16 in the GG-NER complex promote increased histone acetyl transferase occupancy [3] and histone H3 acetylation [4] that drives chromatin remodelling [5]. Failure of the GGNER complex to slide nucleosomes may prevent transcription factor binding explaining the continued repression of MFA2 transcription [6] despite chromatin remodelling. GG-NER dependent chromatin remodelling promotes efficient lesion removal [7].

It was recently reported that Gcn5 is recruited to sites of UV induced DNA damage in human cells [29]. However, its role in chromatin remodelling was not determined. The high extent of homology of NER from S.cerevisiae to humans suggest that our studies with yeast will likely provide important insight into how chromatin is remodelled to facilitate efficient GG-NER following UV induced DNA damage in human cells. It remains to be seen if the functional homologue(s) of Rad16, have a similar role in that species.

ACKNOWLEDGMENTS This work was supported by a MRC Career Establishment Grant to SHR and a MRC Programme Grant to RW. Shirong Yu and Yumin Teng contributed equally to the work.

REFERENCES [1] [2]

Friedberg, E, Walker, GC, Siede, W, Wood, RD, Schultz, RA, Ellenberger, T (2005) DNA Repair And Mutagenesis: ASM Press. Wolffe, A (2000) Chromatin Structure and Function: Academic Press, San Diego,CA.

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

The Removal of DNA Damage is Promoted by the Yeast Global Genome ... [3] [4] [5] [6]

[7]

[8]

[9] [10]

[11]

[12]

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

[13] [14]

[15]

[16]

[17]

[18]

[19]

195

Ataian, Y, Krebs, JE (2006) Five repair pathways in one context: chromatinmodification during DNA repair. Biochem. Cell Biol. 84: 490-504. Wu, J, Grunstein, M (2000) 25 years after the nucleosome model: chromatin modifications. Trends Biochem. Sci 25: 619-623. Waterborg, JH (2002) Dynamics of histone acetylation in vivo. A function for acetylation turnover? Biochem Cell Biol. 80: 363-378. Yu, Y, Teng, Y, Liu, H, Reed, SH, Waters R (2005) UV irradiation stimulates histone acetylation and chromatin remodeling at a repressed yeast locus. Proc. Natl. Acad. Sci. U S A 102: 8650-8655. Gong, F, Fahy, D, Smerdon, MJ (2006) Rad4-Rad23 interaction with SWI/SNF links ATP-dependent chromatin remodeling with nucleotide excision repair. Nat. Struct. Mol. Biol. 13: 902-907. Teng, Y, Liu, H, Gill, HW, Yu, Y, Waters, R, Reed, SH (2008) Saccharomyces cerevisiae Rad16 mediates ultraviolet-dependent histone H3 acetylation required for efficient global genome nucleotide-excision repair. EMBO Rep 9: 97-102. Li, S, Smerdon, MJ (2004) Dissecting transcription-coupled and global genomic repair in the chromatin of yeast GAL1-10 genes. J. Biol. Chem. 279: 14418-14426. Reed, SH, Akiyama, M, Stillman, B, Friedberg, EC (1999) Yeast autonomously replicating sequence binding factor is involved in nucleotide excision repair. Genes Dev. 13: 3052-3058. Verhage, RA, van Gool, AJ, de Groot, N, Hoeijmakers, JH, van de Putte, P, et al. (1996) Double mutants of Saccharomyces cerevisiae with alterations in global genome and transcription-coupled repair. Mol. Cell Biol. 16: 496-502. Bang, DD, Verhage, R, Goosen, N, Brouwer, J, van de Putte, P (1992) Molecular cloning of RAD16, a gene involved in differential repair in Saccharomyces cerevisiae. Nucleic. Acids Res. 20: 3925-3931. Eisen, JA, Sweder, KS, Hanawalt, PC (1995) Evolution of the SNF2 family of proteins: subfamilies with distinct sequences and functions. Nucleic. Acids Res. 23: 2715-2723. Whitehouse, I, Flaus, A, Cairns, BR, White, MF, Workman, JL, et al. (1999) Nucleosome mobilization catalysed by the yeast SWI/SNF complex. Nature 400: 784787. Havas, K, Flaus, A, Phelan, M, Kingston, R, Wade, PA, et al. (2000) Generation of superhelical torsion by ATP-dependent chromatin remodeling activities. Cell 103: 1133-1142. Van Komen, S, Petukhova, G, Sigurdsson, S, Stratton, S, Sung, P (2000) Superhelicitydriven homologous DNA pairing by yeast recombination factors Rad51 and Rad54. Mol. Cell 6: 563-572. Yu, S, Smirnova, JB, Friedberg, EC, Stillman, B, Akiyama, M, et al. (2009) ABF1binding Sites Promote Efficient Global Genome Nucleotide Excision Repair. J. Biol. Chem. 284: 966-973. Teng, Y, Yu, Y, Waters, R (2002) The Saccharomyces cerevisiae histone acetyltransferase Gcn5 has a role in the photoreactivation and nucleotide excision repair of UV-induced cyclobutane pyrimidine dimers in the MFA2 gene. J. Mol. Biol. 316: 489-499. Keleher, CA, Redd, MJ, Schultz, J, Carlson, M, Johnson, AD (1992) Ssn6-Tup1 is a general repressor of transcription in yeast. Cell 68: 709-719.

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

196

Shirong Yu, Yumin Teng, Raymond Waters et al.

[20] Bone, JR, Roth, SY (2001) Recruitment of the yeast Tup1p-Ssn6p repressor is associated with localized decreases in histone acetylation. J. Biol. Chem. 276: 18081813. [21] Cooper, JP, Roth, SY, Simpson, RT (1994) The global transcriptional regulators, SSN6 and TUP1, play distinct roles in the establishment of a repressive chromatin structure. Genes Dev. 8: 1400-1410. [22] Malave, TM, Dent, SY (2006) Transcriptional repression by Tup1-Ssn6. Biochem. Cell Biol. 84: 437-443. [23] Teng, Y, Yu, S, Waters, R (2001) The mapping of nucleosomes and regulatory protein binding sites at the Saccharomyces cerevisiae MFA2 gene: a high resolution approach. Nucleic. Acids Res. 29: E64-64. [24] Reed, SH, Boiteux, S, Waters, R (1996) UV-induced endonuclease III-sensitive sites at the mating type loci in Saccharomyces cerevisiae are repaired by nucleotide excision repair: RAD7 and RAD16 are not required for their removal from HML alpha. Mol. Gen. Genet. 250: 505-514. [25] Teng, Y, Li S, Waters, R, Reed, SH (1997) Excision repair at the level of the nucleotide in the Saccharomyces cerevisiae MFA2 gene: mapping of where enhanced repair in the transcribed strand begins or ends and identification of only a partial rad16 requisite for repairing upstream control sequences. J. Mol. Biol. 267: 324-337. [26] Yu et al plos genetics. [27] Gillette TG, Yu S, Zhou Z, Waters R, Johnston SA, Reed, S.H. (2006) Distinct functions of the ubiquitin-proteasome pathway influence nucleotide excision repair. EMBO J. 25: 2529-2538. [28] Ramsey, KL, Smith, JJ, Dasgupta, A, Maqani, N, Grant, P, et al. (2004) The NEF4 complex regulates Rad4 levels and utilizes Snf2/Swi2-related ATPase activity for nucleotide excision repair. Mol. Cell Biol. 24: 6362-6378. [29] Guo, R., Chen, J., Mitchell, D. L. and Johnson, D. G. GCN5 and E2F1 stimulate nucleotide excision repair by promoting H3K9 acetylation at sites of damage Nucleic Acids Research Advance Access published October 23, 2010 Nucleic. Acids Research, 2010, 1–8 doi:10.1093/nar/gkq983.

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

In: New Developments in Chromatin Research Editors: Neil M. Simpson and Valerie J. Stewart

ISBN: 978-1-62081-816-9 © 2012 Nova Science Publishers, Inc.

Chapter 10

CHROMATIN CONDENSATION IN INFERTILE SPERM Sirikul Manochantr Division of Cell Biology, Department of Preclinical Sciences, Faculty of Medicine, Thammasat University, Pathumthani, Thailand

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

ABSTRACT Normal chromatin condensation has been recognized as one of the vital determinants of normal fertilization and embryo growth in both natural and assisted conception. The various spermatozoa types present in an ejaculate differ in their motility and morphology. However, little is known about nuclear maturity of these spermatozoa and their relationship with morphological and motile characteristics. Routine semen analysis does not identify defects in sperm chromatin structure. Therefore, the investigations of chromatin condensation and DNA integrity in spermatozoa of infertile men are necessary. The ultrastructural analysis of spermatozoa from infertile men showed heterogeneity in sperm nuclear morphology. Some spermatozoa displayed a round nucleus with incomplete chromatin condensation. Immuno-reactivity with anti-transitional protein and anti-protamine antibodies indicated nuclear maturation defect in the spermatozoa of infertile men. Spearman’s correlation analysis indicated the positive correlation between the percentages of CMA3- and TUNEL- positive spermatozoa. In addition, these 2 parameters were negatively correlated with concentration, motility and normal morphology. It is possible that the men with abnormal semen parameters carrying higher loads of protamine deficiency and DNA-damaged spermatozoa. Therefore, the evaluation of chromatin integrity appears to be a useful tool for assessing male fertility potential.

Keywords: Male infertility, chromatin condensation, protamine deficiency, DNA integrity

INTRODUCTION Normally, the sperm chromatin is a highly organized, compact structure which protects genetic integrity and facilitates transport of the paternal genome through the male and female reproductive tracts (Mudrak, Chandra, Jones, Godfrey, and Zalensky, 2009). The biochemical

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

198

Sirikul Manochantr

and ultrastructural changes in sperm nuclei occur as spermatids develop into mature spermatozoa. Histones present in fine granular chromatin of spherically shaped nuclei are replaced by more basic proteins, the transitional proteins, in elongating and condensing nuclei. These basic nucleoproteins are then replaced by even more basic sperm-specific nucleoproteins, the protamines, in spermatozoa with condense chromatin( Dadoune and Alfonsi, 1989). It has been suggested that the functional status of ejaculated sperm nuclei could result from these complex structural and biochemical alterations. Thus, penetration through the oocyte vestments could be facilitated for elongated spermatozoa with dramatically condensed chromatin (Zhang, San Gabriel, and Zini, 2006). Any form of sperm chromatin abnormalities or DNA damage may result in male infertility, and subsequently abortion in the early stages of embryogenesis (Lin et al., 2008). Various reports in mammalian species support the hypothesis of a close relationship between nuclear maturity and fertility of ejaculated spermatozoa (Nasr-Esfahani et al., 2005). The assessment of chromatin status is very important when evaluating the ability of spermatozoa to fertile. The elimination of spermatozoa with DNA damage and abnormal chromatin condensation would be one of the key success factors of clinical pregnancy after ICSI treatments.

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

CHROMATIN CONDENSATION DURING SPERMATOGENESIS Spermatogonia divide by mitosis and differentiate until they become primary spermatocytes, which will be arrested at leptotene stage until puberty. At puberty, primary spermatocytes begin to divide by meiosis and go into prophase stage which is subdivided into six phases, i.e., leptotene, zygotene, pachytene, diplotene, diakinesis and metaphase. In the leptotene stage, the chromosomes appear as thin, delicate filaments, which are attached to the nuclear envelope at the periphery and intertwined together in the center. Each chromosome is composed of two sister chromatids. In the subsequent zygotene stage, there is intimate pairing of homologous chromosomes; in human each of 23 homologous chromosomes are paired by trilaminar structures called the synaptonemal complexes (Solari, 1970). In the pachytene stage, there are exchanges of genetic material between homologous chromosomes mediated by the synaptonemal complex. In the diplotene stage, desynapsis occurs and the areas where there have been exchanges of genetic material are clearly seen at the connecting sites called chiasmata (Solari, 1969, 1970). In the final stage, diakinesis, the separated chromosomes become condensed into large blocks. The cells then proceed into metaphase where the paired chromatids are aligned at the equatorial plate. Chiasmata separate and the homologous chromosomes move to opposite poles of the cell during anaphase. In telophase, cytokinesis occurs and two separate daughter cells are derived. At the end of this first meiotic division, the cells have differentiated into secondary spermatocytes (Stern and Hotta, 1985). There is a very short interphase between the first and second meiotic divisions, and no DNA synthesis occurs during this period. Almost immediately, the second division begins with the secondary spermatocyte progressing from prophase through metaphase, anaphase and telophase. The second division closely resembles mitosis metaphase where there is a separation of sister chromatids along the centromere. At the end of the second division, a secondary spermatocyte gives rise to two spermatids. The spermatid undergoes a dramatic metamorphosis, a process called spermiogenesis, during which its chromatin becomes

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

Chromatin Condensation in Infertile Sperm

199

increasingly condensed until the highly packed chromatin in the spermatozoon appears (Lalli and Clermont, 1981). One of the last structural changes to occur during spermiogenesis in mammals is the repackaging of the spermatid genome. This process is initiated by the synthesis and deposition of a highly basic nuclear proteins called protamines in late step spermatids (Agarwal and Said, 2003); and this is accompanied by a dramatic change in the chromatin condensation (Dooher and Bennett, 1973). Subtle changes in the structure and semi-condensed state of chromatin could be observed prior to this time, but the final and most dramatic event in DNA compaction is induced when protamines bind to DNA and displaces all other basic nuclear chromatin proteins. It has been assumed that this process of DNA condensation must play a critical role in reprogramming the sperm genome, since changes in the proportion of particular protamines, and the alterations that disrupt histones removal appear to lead to male infertility (Balhorn, Reed, and Tanphaichitr, 1988).

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

DNA PACKAGING IN MAMMALIAN MALE GERM CELLS Unlike the somatic cells, the sperm nucleus is too small to have sufficient volume to contain DNA in the nucleosomal organization. Therefore, the sperm of most vertebrates, especially mammals, are known to possess a unique type of DNA packaging by virtue of the unique associations among the DNA, nuclear matrix, and sperm nuclear proteins (protamines) (Balhorn, 1982). The DNA of spermatozoa is extremely compact, being about six folds more than mitotic chromosomal DNA (Balhorn, Corzett, Mazrimas, and Watkins, 1991). Accompanying this compaction is the extensive structural re-organization of DNA, accomplished by the sequential replacement of somatic histones by nuclear packaging proteins, the transition proteins, and the protamines (Balhorn, Weston, Thomas, and Wyrobek, 1984). In addition to the normal complements of histones present in somatic cells and in pre-meiotic male germ cells, the nuclei of primary spermatocytes also contains a vast array of testis-specific histones, including variants of histone H2A, H2B, and H1 invariably named TH2A, TH2B and TH1 (Meistrich, Bucci, Trostle-Weige, and Brock, 1985). During spermiogenesis in mammals, somatic and testis specific histones are replaced by several transitional proteins (TP), small lysine- and arginine-rich proteins that help transform the nucleosomal chromatin into smooth condensed chromatin fibers (Oko, Jando, Wagner, Kistler, and Hermo, 1996). As the nucleosomal organization disappears in the middle stages of spermatids, transcription terminates, despite the finding that late-stage male germ cells contain 1000 folds more TATA-binding protein than somatic cells (Schmidt and Schibler, 1997). During the last stages of spermatids, the protamines, small basic nuclear proteins containing over 60% arginines, replace the transition proteins and facilitate the molecular remodeling and species-specific compaction of the male genome within the differentiating spermatid nucleus (Balhorn, et al., 1984). Protamines are relatively small, highly basic proteins found in spermatozoa of most vertebrates. There are two types of protamines, i.e. protamine-1, which is found in nearly all mammals (Queralt et al., 1995), and protamine-2, which is confined to relatively few species that include human (McKay, Renaux, and Dixon, 1986), mouse (Bellve, McKay, Renaux, and Dixon, 1988), and stallion (Pirhonen, Valtonen, Linnala-Kankkunen, Heiskanen, and Maenpaa, 1990). The protamines can bind to the minor groove of DNA. Their positive

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

200

Sirikul Manochantr

charges are believed to neutralize the negatively charged phosphate groups in the DNA backbone (Balhorn, 1982). The intermolecular and intramolecular disulfide cross-links between the cysteine-rich protamines are responsible for the compaction and stabilization of the sperm nucleus, and it is thought that this nuclear compaction is important to protect the sperm genome from external stresses such as oxidation or temperature elevation in the female reproductive tract. Paradoxically, the protamines and associated sulfhydryl groups may have an important role in the process of decondensation during fertilization (Kosower, Katayose, and Yanagimachi, 1992). Interestingly, the DNA in human sperm chromatin is partitioned into both a nucleohistone and a nucleoprotamine fraction with 15% of the DNA is packaged by histones in sequence-specific areas (Gatewood, Cook, Balhorn, Bradbury, and Schmid, 1987). The histone-bound DNA sequences are less tightly compacted (and hence, more likely to be readily decondensed early in fertilization). Presumably these DNA sequences and/or genes may be involved in fertilization and early embryo development (Balhorn, 1982). The retained histones are associated with telomeric sequences that may be among the first structures in the sperm nucleus to respond to oocyte signals for pronucleus formation (Gineitis, Zalenskaya, Yau, Bradbury, and Zalensky, 2000). Telomere-microtubule complexes are formed in cells and may be involved in the movement of the male pronucleus (Carrell and Liu, 2001). It is unknown whether the sequence-specific chromatin packaging is preserved in spermatozoa of infertile men, but a significant percentage of spermatozoa in these men possess a greater proportion of retained histones (Carrell and Liu, 2001).

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

HUMAN MALE INFERTILITY Approximately 15% of couples attempting their first pregnancy meet with failure. Most authorities define these patients as primarily infertile if they have been unable to achieve a pregnancy after one year of unprotected intercourse. Conception normally is achieved within twelve months in 80-85% of couples who use no contraceptive measures, and persons presenting after this time should therefore be regarded as possibly infertile and should be evaluated. Data available over the past twenty years reveal that in approximately 30% of cases pathology is found in the man alone, and in another 20% both the man and woman are abnormal. Therefore, the male factor is at least partly responsible in about 50% of infertile couples.

ETIOLOGY OF SPERM DNA DAMAGE The etiology of sperm DNA damage, much like male infertility, is multifactorial and may be due to intra-testicular, post-testicular, or external factors. Sperm DNA damage is clearly associated with male infertility (and abnormal spermatogenesis), but a small percentage of spermatozoa from fertile men also possess detectable levels of DNA damage (Zini, Bielecki, Phang, and Zenzes, 2001). It is unknown whether a single factor or multiple factors (possibly acting in a cascade) are responsible for sperm DNA damage. The following is a list of potential etiologic factors: protamine deficiency; apoptosis; drugs, chemotherapy, and

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

Chromatin Condensation in Infertile Sperm

201

radiotherapy; reactive oxygen species; cigarette smoking; post-testicular factors; and varicoceles.

Protamine Deficiency A frequent abnormality of sperm chromatin is a relative or complete deficiency of sperm protamines (the principal sperm nuclear proteins) (Carrell and Liu, 2001). An important subset of infertile men (~5% to 15%), but not of fertile men, possesses a complete protamine deficiency, and some of the affected individuals have a genetic mutation in the protamine gene cluster (Carrell and Liu, 2001). Although studies on transgenic animal models with targeted protamine deficiency suggest a link among protamine deficiency, sperm DNA damage, and poor fertilizing capacity at in vitro fertilization (IVF), no such associations have been studied in humans (Cho et al., 2003). A single case report indicated that a febrile illness can cause a transient increase in the nuclear histone/protamine ratio and associated abnormalities of sperm chromatin structure (Evenson, Jost, Corzett, and Balhorn, 2000).

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

Apoptosis Apoptosis or programmed cell death during normal mammalian spermatogenesis results in the destruction of up to 75% of potential spermatozoa (Sinha Hikim and Swerdloff, 1999). It is the selective apoptosis of these early germ cells that prevents over proliferation of germ cells and selectively aborts abnormal spermatozoal forms (Sinha Hikim and Swerdloff, 1999). This allows the fixed Sertoli cell population to support adequately a specified number of germ cells that are undergoing clonal expansion through several rounds of mitosis. It has been postulated that this clonal expansion is specifically controlled by the production of the cell surface protein Fas (Lee, Richburg, Younkin, and Boekelheide, 1997). This mediator of sperm cell apoptosis allows the Fas ligand to bind to Fas and induce cell death. It has been proposed that some of the spermatozoa with DNA damage have initiated and then subsequently escaped apoptosis (abortive apoptosis) (Sakkas, Seli, Bizzaro, Tarozzi, and Manicardi, 2003). This theory has been challenged by other investigators (Muratori et al., 2000). Some controversy exists as to whether spermatozoa have the capacity to undergo apoptosis, because these specialized cells have no real capacity for the controlled production of new proteins.

Drugs, Chemotherapy, and Radiotherapy Young men with cancer typically have poor semen parameters before cancer-specific therapy, experience cumulative dose damage, and are often rendered sterile after therapy. Before therapy, these men may already have high levels of sperm DNA damage (Morris, 2002). It has been shown that systemic chemotherapy is associated with sperm DNA damage (Chatterjee, Haines, Perera, Goldstone, and Morris, 2000). The rapidly dividing germinal epithelium of the testis is a natural target for cytotoxic medications. Both radiotherapy and chemotherapy inflict similar damage and both are dependent on the duration of exposure and

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

202

Sirikul Manochantr

the dose of the exposure (Morris, 2002). The recovery of spermatogenesis may occur months to years after therapy, but evidence of sperm DNA damage will often persist even longer (Bucci and Meistrich, 1987).

Reactive Oxygen Species Although low levels of reactive oxygen species (ROS) in semen may be important for normal sperm maturation, studies have shown that high levels of ROS can adversely affect multiple sperm functions and sperm DNA integrity (Twigg, Fulton, Gomez, Irvine, and Aitken, 1998; Zini, De Lamirande, and Gagnon, 1995). High levels of ROS are detected in the semen of ~25% of infertile men but not in the semen of fertile men (Zini, de Lamirande, and Gagnon, 1993). The retention of cytoplasmic droplets, a morphologic feature associated with ROS production and a sign of sperm immaturity, is positively correlated with sperm DNA damage (Fischer, Willis, and Zini, 2003). Leukocytospermia is also associated with high levels of sperm DNA damage, likely secondary to elaboration of ROS by these cells. ROS may also cause hypercondensation of the sperm nucleus as a result of excessive oxidation of protein sulfhydryl groups.

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

Cigarette Smoking Studies have shown that cigarette smoking is associated with lower sperm counts and motility and an increase in abnormal forms (Kunzle et al., 2003). It has been postulated that smoking causes increased leukocyte-derived ROS production, with adverse effects on developing and mature sperm (Potts, Newbury, Smith, Notarianni, and Jefferies, 1999). It has been shown that the level of sperm DNA damage is greater in smokers than in nonsmokers (Potts, et al., 1999).

Post-Testicular Factors Sperm DNA damage may also be caused by post-testicular and systemic factors. Posttesticular, genital tract infection and idiopathic genital tract inflammation, both resulting in leukocytospermia, have been associated with increased numbers of immature germ cells in semen. The immature sperm cells of these men have been examined and found to have increased levels of DNA damage compared with the sperm of normal male donors. A febrile illness has been shown to cause an increase in DNA damage and the histone/protamine ratio in these immature spermatozoa (Evenson, et al., 2000).

Varicoceles Varicoceles have recently been associated with sperm DNA damage (Saleh et al., 2003). The level of sperm DNA damage is related to the high levels of oxidative stress found in the

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

Chromatin Condensation in Infertile Sperm

203

semen of these infertile men (Zini, Defreitas, Freeman, Hechter, and Jarvi, 2000). Varicoceles are associated with the abnormal retention of sperm cytoplasmic droplets and that these retained droplets are correlated with sperm DNA damage in these infertile men (Fischer, et al., 2003).

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

MECHANISMS OF SPERM DNA DAMAGE Normally, sperm DNA is very stable in the nucleus because of its distinctive organization (Agarwal and Said, 2003). The sperm DNA damage could occur in the testis as part of the apoptotic process. Ejaculated sperm with damaged DNA might be derived from germ cells whose apoptotic process in the testis has not been completed. (Sakkas et al., 1999). These ejaculated sperm demonstrate high expression of Fas receptors (Sakkas, Mariethoz, and St John, 1999), as well as the presence of ultrastructural apoptosis-like features such as cytoplasmic vacuoles (Baccetti et al., 1997). DNA damage may also occur during the replacement of histones by protamines, as part of the process that leads to DNA condensation (Marcon and Boissonneault, 2004). DNA damage generation is important to reduce the torsional stress in a DNA helix, thereby facilitating histone disassembly. The enzyme responsible for creating DNA nicks is likely to be topoisomerase II, which is able to induce both single- and double-stranded breaks (Marcon and Boissonneault, 2004). Topoisomerase II is also the main enzyme of the DNA repair system for elongating spermatids (Leduc, Maquennehan, Nkoma, and Boissonneault, 2008). Topoisomerase II is inhibited by poly(ADP-ribose) polymerase enzymes, which are activated as a consequence of DNA strand break formation (Meyer-Ficca et al., 2011). It is likely that any alteration occurring in the complex DNA repair process can have dramatic consequences for the DNA integrity of the sperm. Emerging evidence indicates that DNA fragmentation mainly occurs after sperm release from the testis (Moskovtsev et al., 2010). After spermiation and during transit in the male reproductive tract, oxidative stress is thought to be the main mechanism responsible for the occurrence of DNA damage and DNA base oxidation (Muratori et al., 2003). Excessive intrinsic ROS production may result from the presence of immature spermatozoa retaining cytoplasmic droplets (Aitken, Krausz, and Buckingham, 1994). The positive relationship between intrinsic ROS production and DNA fragmentation in semen samples (Henkel et al., 2005), and the prevention of DNA damage following treatment with ROS scavengers and antioxidants (Agarwal, Makker, and Sharma, 2008; Greco et al., 2005) serve as indirect evidence that oxidative stress can cause DNA fragmentation.

EVALUATION OF SPERM DNA DAMAGE Currently, various techniques are reported to measure sperm DNA defects in human spermatozoa. The use of these tools has been driven largely by the growing use of assisted reproductive technology and awareness that the integrity of the male genome plays an important role in IVF.

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

204

Sirikul Manochantr

The Comet Assay The comet assay allows the measurement of DNA damage in individual cells by means of single-cell gel electrophoresis. Electrophoresis causes abnormal chromatin structure with DNA breaks to migrate away from the central DNA core (Aravindan, Bjordahl, Jost, and Evenson, 1997). The basic methodology including a sperm sample in an agarose gel slide and submit it to a lysis solution containing a reducer of sulfhydryl groups that are in the sperm protamines, as for example DTT (dithiothreitol). Following electrophoresis, the gels are transferred to a dish containing fluorescent stain as DAPI (4, 6 diamidino-2-phenylindole) or PI (Propidium Iodine). Those sperm that posses fragmented DNA exhibit the characteristic formation of comets. The staining intensity of the comet tail represents the amount of migrated DNA, indicating different degrees of DNA fragmentation (Singh, McCoy, Tice, and Schneider, 1988).

Terminal dUTP Nick-End Labeling (TUNEL) Assay

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

The ends of fragmented DNA, either single or double-stranded, are tagged to labeled nucleotides. The reaction is catalyzed, in situ, by a terminal transferase. This enzyme incorporates deoxyuridine modified with biotin or digoxigenin, at the 3'-OH end of the affected chain. Later, modified nucleotides are detected by a fluorochromed antibody. The nucleotide can be directly marked by the fluorochrome. Theoretically, the sign obtained by every sperm would increase in agreement with the number of DNA breaks (Chohan, Griffin, Lafromboise, De Jonge, and Carrell, 2006; Lopes, Sun, Jurisicova, Meriano, and Casper, 1998).

Sperm Chromatin Structure Assay (SCSA) The SCSA is considered a reference in the analysis of sperm DNA fragmentation. This flow cytometric assay relies on the fact that abnormal sperm chromatin are highly susceptible to physical induction of partial DNA denaturation in situ (Evenson, Darzynkiewicz, and Melamed, 1980). The extent of DNA denaturation following heat or acid treatment is based on the metachromatic characteristics of acridine orange. This fluorochrome emitting green fluorescence when intercalated into double-stranded DNA, and red fluorescence when associated with denatured or single stranded DNA. The most important parameter of the SCSA is the DNA fragmentation index (%DFI), which represents the population of cells with DNA damage (Evenson, Larson, and Jost, 2002). This technique is widely accepted to correlate DNA fragmentation and fertility.

Toluidine Blue Staining DNA damage can also be assessed indirectly by means of sperm chromatin integrity assays. Toluidine blue is a nuclear basic stain that has metachromatic reactivity with

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

Chromatin Condensation in Infertile Sperm

205

chromatin. Toluidine blue binds histone rich-chromatin, with abundance of lysine, it presents a violet-bluish intense coloration, whereas when it bind to protamine rich-chromatin, it presents a blue–pale coloration (Andreetta, Stockert, and Barrera, 1995). It would test chromatin condensation, so that sperms with immature chromatin would have more DNA breaks.

Chromomycin A3 (CMA3) Assay DNA damage can also be assessed by evaluation of nuclear protein levels. Chromomycin A3 is a fluorochrome that anchors specifically to rich guanine-cytosine regions and competes for the same places in the DNA as protamines. Therefore, when sperms present an intense CMA3 staining, is interpreted that this cellular population shows protamine deficiency. This technique reveals sperms that have a incomplete chromatin condensation (Manicardi et al., 1995).

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

ULTRASTRUCTURE OF SPERMATOZOA FROM INFERTILE MEN The ultrastructural analysis of spermatozoa from infertile men reveals heterogeneity in sperm nuclear morphology with some spermatozoa showing the round nucleus and other spermatozoa showing a more elongated nucleus. In immature spermatozoa, the nuclei are irregular-shaped with uncondensed chromatin. Spermatozoa from infertile men also have multiple defects involving acrosomal disorders, cytoplasmic residues, lack of central or peripheral microtubules, additional axoneme and midpiece abnormalities. Binucleated spermatozoa are frequently observed. The tail is often rolled up into cytoplasmic droplets with the disorganized fibrous sheath and accessory fibers, and mitochondrial helix is badly assembled (Manochantr, Chiamchanya, and Sobhon, 2011).

CLINICAL SIGNIFICANCE OF SPERM DNA DAMAGE The sperm chromatin condensation is being considered a new parameter of seminal quality. In natural conception, diverse studies indicate that damage to sperm DNA may adversely affect reproductive outcomes. Anomalies in DNA packaging, which take place during spermatogenesis, might inevitably affect sperm chromatin decondensation, which appears to be detrimental to fertility in human and has been related to impaired embryo cleavage (Morris, 2002), higher miscarriage rates (Evenson et al., 1999), significantly increased risk of pregnancy loss after IVF and ICSI (Zini, Boman, Belzile, and Ciampi, 2008), lower embryo quality (Tomsu, Sharma, and Miller, 2002) and blastulation rates (Seli, Gardner, Schoolcraft, Moffatt, and Sakkas, 2004). The information obtained with TUNEL and SCSA assays offer significant differences in the levels of DNA damaged sperm among males considered being fertile and those considered infertile (Sergerie, Laforest, Bujan, Bissonnette, and Bleau, 2005). The threshold for DNA fragmentation value certifies that the probability of fertilization in vivo is near to zero if the proportion of damaged sperms exceeds

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

206

Sirikul Manochantr

30% (Evenson, et al., 1999). Though the establishment of a threshold number to predict fertility, there is the confidence that seminal quality, the capacity of fertilization, the quality of the embryo and the development to blastocyst, might be influenced by the frequency of fragmented DNA in the sperm (Agarwal and Allamaneni, 2004). Significantly higher percentage of CMA3 positive spermatozoa are recorded in infertile men with morphologically normal spermatozoa 30% (Manochantr, et al., 2011). In addition, there is a high correlation between the percentages of CMA3 positive spermatozoa and TUNEL positive spermatozoa (Manochantr, et al., 2011). Nevertheless, the TUNEL and the CMA3 assays have demonstrated an inverse correlation between the percentage of fragmented DNA sperms, the sperm motility, the concentration and the morphologic parameters related to abnormal forms (Manochantr, et al., 2011). The damaged DNA also contributes to be failure of chromatin decondensation and resulted in failure of fertilization (Agarwal and Allamaneni, 2004). Therefore, evaluation of protamine deficiency is essential for prediction of fertilization outcome. In addition, it appears that elimination or reduction of spermatozoa with abnormal chromatin packaging (especially high CMA3 positivity) or abnormal morphology is essential for achieving normal and higher fertilization in IVF and ICSI.

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

CONCLUSION In conclusion, mammalian fertilization involves the direct interaction of the sperm and oocyte, fusion of the cell membranes, and union of male and female gamete genomes. The completion of this process and subsequent embryo development depend in part on the inherent integrity of the sperm DNA. A threshold of sperm DNA damage (i.e., DNA fragmentation, abnormal chromatin packaging, protamine deficiency) appears to exist beyond which fertilization and embryo development are impaired. Clinical evidence has now shown that human sperm DNA damage may adversely affect reproductive outcomes and that the spermatozoa of infertile men possess substantially more DNA damage than the spermatozoa of fertile men. The knowledge on abnormal DNA packaging in the infertile spermatozoa might be affected the fertilizing capability of spermatozoa. At molecular level, it will provide the understanding of how paternal genome is abnormally packaged in an infertile person and the pattern could be used as one criterion in diagnosis of human infertility.

REFERENCES Agarwal, A., and Allamaneni, S. S. (2004). The effect of sperm DNA damage on assisted reproduction outcomes. A review. Minerva Ginecol., 56(3), 235-245. Agarwal, A., Makker, K., and Sharma, R. (2008). Clinical relevance of oxidative stress in male factor infertility: an update. Am. J. Reprod. Immunol., 59(1), 2-11. Agarwal, A., and Said, T. M. (2003). Role of sperm chromatin abnormalities and DNA damage in male infertility. Hum. Reprod. Update, 9(4), 331-345. Aitken, J., Krausz, C., and Buckingham, D. (1994). Relationships between biochemical markers for residual sperm cytoplasm, reactive oxygen species generation, and the

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

Chromatin Condensation in Infertile Sperm

207

presence of leukocytes and precursor germ cells in human sperm suspensions. Mol. Reprod. Dev., 39(3), 268-279. Andreetta, A. M., Stockert, J. C., and Barrera, C. (1995). A simple method to detect sperm chromatin abnormalities: cytochemical mechanism and possible value in predicting semen quality in assisted reproductive procedures. Int. J. Androl., 18 Suppl 1, 23-28. Aravindan, G. R., Bjordahl, J., Jost, L. K., and Evenson, D. P. (1997). Susceptibility of human sperm to in situ DNA denaturation is strongly correlated with DNA strand breaks identified by single-cell electrophoresis. Exp. Cell Res., 236(1), 231-237. Baccetti, B., Strehler, E., Capitani, S., Collodel, G., De Santo, M., Moretti, E., et al. (1997). The effect of follicle stimulating hormone therapy on human sperm structure (Notulae seminologicae 11). Hum. Reprod., 12(9), 1955-1968. Balhorn, R. (1982). A model for the structure of chromatin in mammalian sperm. J. Cell Biol., 93(2), 298-305. Balhorn, R., Corzett, M., Mazrimas, J., and Watkins, B. (1991). Identification of bull protamine disulfides. Biochemistry, 30(1), 175-181. Balhorn, R., Reed, S., and Tanphaichitr, N. (1988). Aberrant protamine 1/protamine 2 ratios in sperm of infertile human males. Experientia, 44(1), 52-55. Balhorn, R., Weston, S., Thomas, C., and Wyrobek, A. J. (1984). DNA packaging in mouse spermatids. Synthesis of protamine variants and four transition proteins. Exp. Cell Res., 150(2), 298-308. Bellve, A. R., McKay, D. J., Renaux, B. S., and Dixon, G. H. (1988). Purification and characterization of mouse protamines P1 and P2. Amino acid sequence of P2. Biochemistry, 27(8), 2890-2897. Bucci, L. R., and Meistrich, M. L. (1987). Effects of busulfan on murine spermatogenesis: cytotoxicity, sterility, sperm abnormalities, and dominant lethal mutations. Mutat. Res., 176(2), 259-268. Carrell, D. T., and Liu, L. (2001). Altered protamine 2 expression is uncommon in donors of known fertility, but common among men with poor fertilizing capacity, and may reflect other abnormalities of spermiogenesis. J. Androl., 22(4), 604-610. Chatterjee, R., Haines, G. A., Perera, D. M., Goldstone, A., and Morris, I. D. (2000). Testicular and sperm DNA damage after treatment with fludarabine for chronic lymphocytic leukaemia. Hum. Reprod., 15(4), 762-766. Cho, C., Jung-Ha, H., Willis, W. D., Goulding, E. H., Stein, P., Xu, Z., et al. (2003). Protamine 2 deficiency leads to sperm DNA damage and embryo death in mice. Biol. Reprod., 69(1), 211-217. Chohan, K. R., Griffin, J. T., Lafromboise, M., De Jonge, C. J., and Carrell, D. T. (2006). Comparison of chromatin assays for DNA fragmentation evaluation in human sperm. J. Androl., 27(1), 53-59. Dadoune, J. P., and Alfonsi, M. F. (1989). Nuclear changes during spermiogenesis in man and the monkey. Prog. Clin. Biol. Res., 296, 165-170. Dooher, G. B., and Bennett, D. (1973). Fine structural observations on the development of the sperm head in the mouse. Am. J. Anat., 136(3), 339-361. Evenson, D. P., Darzynkiewicz, Z., and Melamed, M. R. (1980). Relation of mammalian sperm chromatin heterogeneity to fertility. Science, 210(4474), 1131-1133.

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

208

Sirikul Manochantr

Evenson, D. P., Jost, L. K., Corzett, M., and Balhorn, R. (2000). Characteristics of human sperm chromatin structure following an episode of influenza and high fever: a case study. J. Androl., 21(5), 739-746. Evenson, D. P., Jost, L. K., Marshall, D., Zinaman, M. J., Clegg, E., Purvis, K., et al. (1999). Utility of the sperm chromatin structure assay as a diagnostic and prognostic tool in the human fertility clinic. Hum. Reprod., 14(4), 1039-1049. Evenson, D. P., Larson, K. L., and Jost, L. K. (2002). Sperm chromatin structure assay: its clinical use for detecting sperm DNA fragmentation in male infertility and comparisons with other techniques. J. Androl., 23(1), 25-43. Fischer, M. A., Willis, J., and Zini, A. (2003). Human sperm DNA integrity: correlation with sperm cytoplasmic droplets. Urology, 61(1), 207-211. Gatewood, J. M., Cook, G. R., Balhorn, R., Bradbury, E. M., and Schmid, C. W. (1987). Sequence-specific packaging of DNA in human sperm chromatin. Science, 236(4804), 962-964. Gineitis, A. A., Zalenskaya, I. A., Yau, P. M., Bradbury, E. M., and Zalensky, A. O. (2000). Human sperm telomere-binding complex involves histone H2B and secures telomere membrane attachment. J. Cell Biol., 151(7), 1591-1598. Greco, E., Iacobelli, M., Rienzi, L., Ubaldi, F., Ferrero, S., and Tesarik, J. (2005). Reduction of the incidence of sperm DNA fragmentation by oral antioxidant treatment. J. Androl., 26(3), 349-353. Henkel, R., Kierspel, E., Stalf, T., Mehnert, C., Menkveld, R., Tinneberg, H. R., et al. (2005). Effect of reactive oxygen species produced by spermatozoa and leukocytes on sperm functions in non-leukocytospermic patients. Fertil. Steril., 83(3), 635-642. Kosower, N. S., Katayose, H., and Yanagimachi, R. (1992). Thiol-disulfide status and acridine orange fluorescence of mammalian sperm nuclei. J. Androl., 13(4), 342-348. Kunzle, R., Mueller, M. D., Hanggi, W., Birkhauser, M. H., Drescher, H., and Bersinger, N. A. (2003). Semen quality of male smokers and nonsmokers in infertile couples. Fertil. Steril., 79(2), 287-291. Lalli, M., and Clermont, Y. (1981). Structural changes of the head components of the rat spermatid during late spermiogenesis. Am. J. Anat., 160(4), 419-434. Leduc, F., Maquennehan, V., Nkoma, G. B., and Boissonneault, G. (2008). DNA damage response during chromatin remodeling in elongating spermatids of mice. Biol. Reprod., 78(2), 324-332. Lee, J., Richburg, J. H., Younkin, S. C., and Boekelheide, K. (1997). The Fas system is a key regulator of germ cell apoptosis in the testis. Endocrinology, 138(5), 2081-2088. Lin, M. H., Kuo-Kuang Lee, R., Li, S. H., Lu, C. H., Sun, F. J., and Hwu, Y. M. (2008). Sperm chromatin structure assay parameters are not related to fertilization rates, embryo quality, and pregnancy rates in in vitro fertilization and intracytoplasmic sperm injection, but might be related to spontaneous abortion rates. Fertil. Steril., 90(2), 352-359. Lopes, S., Sun, J. G., Jurisicova, A., Meriano, J., and Casper, R. F. (1998). Sperm deoxyribonucleic acid fragmentation is increased in poor-quality semen samples and correlates with failed fertilization in intracytoplasmic sperm injection. Fertil. Steril., 69(3), 528-532. Manicardi, G. C., Bianchi, P. G., Pantano, S., Azzoni, P., Bizzaro, D., Bianchi, U., et al. (1995). Presence of endogenous nicks in DNA of ejaculated human spermatozoa and its relationship to chromomycin A3 accessibility. Biol. Reprod., 52(4), 864-867.

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

Chromatin Condensation in Infertile Sperm

209

Manochantr, S., Chiamchanya, C., and Sobhon, P. (2011). Relationship between chromatin condensation, DNA integrity and quality of ejaculated spermatozoa from infertile men. Andrologia. Marcon, L., and Boissonneault, G. (2004). Transient DNA strand breaks during mouse and human spermiogenesis new insights in stage specificity and link to chromatin remodeling. Biol. Reprod., 70(4), 910-918. McKay, D. J., Renaux, B. S., and Dixon, G. H. (1986). Human sperm protamines. Aminoacid sequences of two forms of protamine P2. Eur. J. Biochem., 156(1), 5-8. Meistrich, M. L., Bucci, L. R., Trostle-Weige, P. K., and Brock, W. A. (1985). Histone variants in rat spermatogonia and primary spermatocytes. Dev. Biol., 112(1), 230-240. Meyer-Ficca, M. L., Lonchar, J. D., Ihara, M., Meistrich, M. L., Austin, C. A., and Meyer, R. G. (2011). Poly(ADP-ribose) polymerases PARP1 and PARP2 modulate topoisomerase II beta (TOP2B) function during chromatin condensation in mouse spermiogenesis. Biol. Reprod., 84(5), 900-909. Morris, I. D. (2002). Sperm DNA damage and cancer treatment. Int. J. Androl., 25(5), 255-261. Moskovtsev, S. I., Jarvi, K., Mullen, J. B., Cadesky, K. I., Hannam, T., and Lo, K. C. (2010). Testicular spermatozoa have statistically significantly lower DNA damage compared with ejaculated spermatozoa in patients with unsuccessful oral antioxidant treatment. Fertil. Steril., 93(4), 1142-1146. Mudrak, O., Chandra, R., Jones, E., Godfrey, E., and Zalensky, A. (2009). Reorganisation of human sperm nuclear architecture during formation of pronuclei in a model system. Reprod. Fertil. Dev., 21(5), 665-671. Muratori, M., Maggi, M., Spinelli, S., Filimberti, E., Forti, G., and Baldi, E. (2003). Spontaneous DNA fragmentation in swim-up selected human spermatozoa during long term incubation. J. Androl., 24(2), 253-262. Muratori, M., Piomboni, P., Baldi, E., Filimberti, E., Pecchioli, P., Moretti, E., et al. (2000). Functional and ultrastructural features of DNA-fragmented human sperm. J. Androl., 21(6), 903-912. Nasr-Esfahani, M. H., Salehi, M., Razavi, S., Anjomshoa, M., Rozbahani, S., Moulavi, F., et al. (2005). Effect of sperm DNA damage and sperm protamine deficiency on fertilization and embryo development post-ICSI. Reprod. Biomed. Online, 11(2), 198-205. Oko, R. J., Jando, V., Wagner, C. L., Kistler, W. S., and Hermo, L. S. (1996). Chromatin reorganization in rat spermatids during the disappearance of testis-specific histone, H1t, and the appearance of transition proteins TP1 and TP2. Biol. Reprod., 54(5), 1141-1157. Pirhonen, A., Valtonen, P., Linnala-Kankkunen, A., Heiskanen, M. L., and Maenpaa, P. H. (1990). Primary structures of two protamine 2 variants (St2a and St2b) from stallion spermatozoa. Biochim. Biophys. Acta, 1039(2), 177-180. Potts, R. J., Newbury, C. J., Smith, G., Notarianni, L. J., and Jefferies, T. M. (1999). Sperm chromatin damage associated with male smoking. Mutat. Res., 423(1-2), 103-111. Queralt, R., Adroer, R., Oliva, R., Winkfein, R. J., Retief, J. D., and Dixon, G. H. (1995). Evolution of protamine P1 genes in mammals. J. Mol. Evol., 40(6), 601-607. Sakkas, D., Mariethoz, E., Manicardi, G., Bizzaro, D., Bianchi, P. G., and Bianchi, U. (1999). Origin of DNA damage in ejaculated human spermatozoa. Rev. Reprod., 4(1), 31-37.

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

210

Sirikul Manochantr

Sakkas, D., Mariethoz, E., and St John, J. C. (1999). Abnormal sperm parameters in humans are indicative of an abortive apoptotic mechanism linked to the Fas-mediated pathway. Exp. Cell Res., 251(2), 350-355. Sakkas, D., Seli, E., Bizzaro, D., Tarozzi, N., and Manicardi, G. C. (2003). Abnormal spermatozoa in the ejaculate: abortive apoptosis and faulty nuclear remodelling during spermatogenesis. Reprod. Biomed. Online, 7(4), 428-432. Saleh, R. A., Agarwal, A., Sharma, R. K., Said, T. M., Sikka, S. C., and Thomas, A. J., Jr. (2003). Evaluation of nuclear DNA damage in spermatozoa from infertile men with varicocele. Fertil. Steril., 80(6), 1431-1436. Schmidt, E. E., and Schibler, U. (1997). Developmental testis-specific regulation of mRNA levels and mRNA translational efficiencies for TATA-binding protein mRNA isoforms. Dev. Biol., 184(1), 138-149. Seli, E., Gardner, D. K., Schoolcraft, W. B., Moffatt, O., and Sakkas, D. (2004). Extent of nuclear DNA damage in ejaculated spermatozoa impacts on blastocyst development after in vitro fertilization. Fertil. Steril., 82(2), 378-383. Sergerie, M., Laforest, G., Bujan, L., Bissonnette, F., and Bleau, G. (2005). Sperm DNA fragmentation: threshold value in male fertility. Hum. Reprod., 20(12), 3446-3451. Singh, N. P., McCoy, M. T., Tice, R. R., and Schneider, E. L. (1988). A simple technique for quantitation of low levels of DNA damage in individual cells. Exp. Cell Res., 175(1), 184-191. Sinha Hikim, A. P., and Swerdloff, R. S. (1999). Hormonal and genetic control of germ cell apoptosis in the testis. Rev. Reprod., 4(1), 38-47. Solari, A. J. (1969). Changes in the sex chromosomes during meiotic prophase in mouse spermatocytes. Genetics, 61(1), Suppl:113-120. Solari, A. J. (1970). The behaviour of chromosomal axes during diplotene in mouse spermatocytes. Chromosoma, 31(2), 217-230. Stern, H., and Hotta, Y. (1985). Molecular biology of meiosis: synapsis-associated phenomena. Basic Life Sci., 36, 305-316. Tomsu, M., Sharma, V., and Miller, D. (2002). Embryo quality and IVF treatment outcomes may correlate with different sperm comet assay parameters. Hum. Reprod., 17(7), 18561862. Twigg, J., Fulton, N., Gomez, E., Irvine, D. S., and Aitken, R. J. (1998). Analysis of the impact of intracellular reactive oxygen species generation on the structural and functional integrity of human spermatozoa: lipid peroxidation, DNA fragmentation and effectiveness of antioxidants. Hum. Reprod., 13(6), 1429-1436. Zhang, X., San Gabriel, M., and Zini, A. (2006). Sperm nuclear histone to protamine ratio in fertile and infertile men: evidence of heterogeneous subpopulations of spermatozoa in the ejaculate. J. Androl., 27(3), 414-420. Zini, A., Bielecki, R., Phang, D., and Zenzes, M. T. (2001). Correlations between two markers of sperm DNA integrity, DNA denaturation and DNA fragmentation, in fertile and infertile men. Fertil. Steril., 75(4), 674-677. Zini, A., Boman, J. M., Belzile, E., and Ciampi, A. (2008). Sperm DNA damage is associated with an increased risk of pregnancy loss after IVF and ICSI: systematic review and metaanalysis. Hum. Reprod., 23(12), 2663-2668.

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

Chromatin Condensation in Infertile Sperm

211

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

Zini, A., de Lamirande, E., and Gagnon, C. (1993). Reactive oxygen species in semen of infertile patients: levels of superoxide dismutase- and catalase-like activities in seminal plasma and spermatozoa. Int. J. Androl., 16(3), 183-188. Zini, A., De Lamirande, E., and Gagnon, C. (1995). Low levels of nitric oxide promote human sperm capacitation in vitro. J. Androl., 16(5), 424-431. Zini, A., Defreitas, G., Freeman, M., Hechter, S., and Jarvi, K. (2000). Varicocele is associated with abnormal retention of cytoplasmic droplets by human spermatozoa. Fertil. Steril., 74(3), 461-464.

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved. New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

In: New Developments in Chromatin Research Editors: Neil M. Simpson and Valerie J. Stewart

ISBN: 978-1-62081-816-9 © 2012 Nova Science Publishers, Inc.

Chapter 11

GLUCOCORTICOID-INDUCED CHROMATIN REMODELING: A NOVEL MOLECULAR MECHANISM OF TRAUMATIC STRESS Lei Zhang, He Li, Xian-Zhang Hu, Xiao Xia Li, Stanley Smerin and Robert Ursano Center for the Study of Traumatic Stress, Department of Psychiatry, Uniformed Services University of the Health Sciences, Bethesda, MD, US

ABSTRACT Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

While the actions of glucocorticoids (GCs) on brain function have been comprehensively studied, understanding of the underlying genomic mechanisms is advancing slowly. Recent evidence shows that the transcriptional activation of the GC target gene is mediated by remodeling of chromatin. Such chromatin remodeling may specifically occur in the GC receptor-regulated promoter region of the target genes. Chromatin remodeling is complex and essential in numerous cellular processes. It may play a role in response to psychological stress. In this chapter, we will review information regarding the role of chromatin remodeling in responding to traumatic stress. As an example we will discuss chromatin remodeling in GC-induced gene expression of p11, a traumatic stress-related molecule. We discuss how GC regulates the expression of p11 in an animal model and in a culture cell line. We will present the evidence showing that the ligand-activated glucocorticoid receptor (GR) interacts with two glucocorticoid response elements (GREs) in the p11 gene promoter region to up-regulate the p11. We also demonstrate that RU486, a glucocorticoid receptor antagonist, and mutation of GREs both block glucocorticoid-induced p11 over-expression, suggesting that glucocorticoidinduced p11 over-expression is mediated by GR and GREs. Thus, the p11 gene can be transcriptionally activated. We discuss the first step toward identifying chromatin modifications leading to the expression of the p11 gene in the brain of animals in rodent stressed model. A recently developed method that examines protein–DNA interactions 

Corresponding author: Lei Zhang, M.D., Center for the Study of Traumatic Stress, Department of Psychiatry, Uniformed Services University of the Health Sciences, Bethesda, MD 20814. Tel: 301-295-0921, FAX: 301295-0923. E-mail: [email protected].

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

214

Lei Zhang, He Li, Xian-Zhang Hu et al. within the context of living cells, i.e., chromatin immunoprecipitation, has been performed to study the binding of GR to DNA in brain. This method has been used to examine the dynamics of the binding of steroid receptors to DNA and the role of coregulators in the effect of glucocorticoids on gene expression particularly in the brain. Glucocorticoid regulation of gene expression occurs via GR and the mechanisms are varied and complex. Ligand-activated GR can regulate gene expression by binding to transcription factors to trans-activate or trans-repress expression of genes that lack functional GRE cis-elements in their promoter region. Ligand-activated GR also recruits various coactivators or corepressors to the promoters of GR targeted genes, which contribute to chromatin remodeling, as does histone acetylation and deacetylation by histone deacetylases (HDAC). The characteristics of glucocorticoids indicate that their regulation of the expression of the p11 gene might be at the chromatin level. In this chapter we will discuss the possible molecular mechanism of gene regulation associated with chromatin remodeling. We translate this information into the knowledge required to examine the possibility of using a histone deacetylase inhibitor (HDACi), such as valproic acid (VPA), to treat post-traumatic disorder (PTSD). Therefore, these studies in stress-induced chromatin remodeling provide not only the information for understanding the molecular mechanisms in the glucocorticoid-mediated gene expression, but also identify a new therapeutic target, chromatin modeling, for stress related mental diseases, such as PTSD and depressive disorders.

Keywords: Brain, chromatin glucocorticoids, stress, PTSD

immunoprecipitation,

p11,

glucocorticoid

receptor,

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

INTRODUCTION PTSD is a type of anxiety disorder first listed in the Diagnostic and Statistic Manual (DSM-III) in 1980's. To date, however, relatively little work has been carried out to elucidate the molecular mechanisms for this disease (Zhang et al. 2010). Most studies focus on the stress or stress-induced hormone response (Cohen et al. 2006). Several studies have implicated the hypothalamus-pituitary-adrenal axis (HPA axis) as the key substrate in the pathogenic processes underlying the PTSD (Belda et al. 2008), although these studies do not always report changes in the same direction (Yehuda et al. 1995; Lindauer et al. 2006). For example, holocaust survivors with PTSD have low urinary cortisol excretion (Yehuda et al. 1995), whereas early morning salivary cortisol levels are high in police officers with PTSD (Lindauer et al. 2006). Bereaved children suffering the death of a parent in the September 11, 2001 terrorist attacks had high morning and afternoon baseline cortisol concentrations as compared to children who were not bereaved (Pfeffer, Altemus, Heo and Jiang 2007). Low cortisol in PTSD patients was not related to overall psychiatric symptomatology; however, PTSD diagnosis was associated with lower cortisol levels. An adaptation of the HPA to chronic stress was inferred (McEwen 2001). On the other hands, PTSD patients with low glucocorticoid levels may have GR receptors with high sensitivity to glucocorticoid stimulation (Yehuda, Golier, Yang and Tischler 2004). It is well-documented that traumatic stress elevates plasma glucocorticoid (Pollard, White, Bassett and Cairncross 1975) which in turn mediates stress-induced gene expression (Li, Han, Liu and Shi 2010; Amador-Arjona et al. 2010). For example, acute restraint stress increases 5-HT7 receptor mRNA expression in the rat hippocampus (Yau, Noble and Seckl

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

Glucocorticoid-Induced Chromatin Remodeling

215

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

2001). Postnatal handling increases the expression of cAMP-inducible transcription factors in the rat hippocampus (Meaney et al. 2000). Of particular interest in this regard is a recent study demonstrating that dexamethasone (Dex), a synthetic glucocorticoid, can up-regulate p11, an S-100 calcium-binding protein (Zhang et al. 2008). The protein encoded by p11 gene on chromosome 1q21 is a member of the S100 family of proteins (13 members) containing 2 EF-hand calcium-binding motifs. It expresses in both the cytoplasm and nucleus of a wide range of cells, including neuronal cells in the brain. It regulates a number of cellular processes such as cell cycle progression and differentiation. This protein may function in exocytosis and endocytosis. The level of p11 expression was lower in patients with depression (Svenningsson et al. 2006), a common co-morbid disorder in PTSD (Caspi, Saroff, Suleimani and Klein 2008) (Ginzburg, Ein-Dor and Solomon 2010), as compared with non-psychiatric controls. In rats, three days of inescapable shock increased both p11 mRNA levels in the prefrontal cortex (PFC) and corticosterone levels in blood (Zhang et al. 2008). Consistent with the animal studies, it has been found that p11 expression is up-regulated in the cortex of patients with PTSD (Zhang et al. 2008). The possible molecular mechanisms for stress- or stress hormone-induced over-expression of p11 have been studied (Zhang et al. 2008). These studies have demonstrated that Dex up-regulates p11 expression through GREs within the p11 promoter; this process can be attenuated by administering the glucocorticoid receptor antagonist, RU486, or by mutating two of the three glucocorticoid response elements (GRE2 and GRE3) in the p11 promoter (Zhang et al. 2008). These findings suggest that both stress and PTSD are associated with increased p11 expression, which is regulated by glucocorticoids through GREs within the p11 gene promoter. The rationale for this study is that understanding the mechanisms of p11 gene expression, a preliminary to formulating therapeutic interventions in PTSD. One of the targets for PTSD treatment might be chromatin remodeling.

CHROMATIN REMODELING Chromatin is a highly organized and dynamic nuclear protein-DNA complex. Its primary functions are packaging DNA into a smaller volume to fit in the cell, strengthening the DNA to allow mitosis and meiosis, preventing DNA damage and controlling gene expression and DNA replication. The primary protein components of chromatin are histones that compact the DNA. Modifications in chromatin structure play an important role in gene regulation at a higher level and are often referred to as an epigenetic mechanism. There are a total of six classes of histones (H1, H2A, H2B, H3, H4, and H5) classified into two super classes, core histones - H2A, H2B, H3 and H4 and linker histones - H1 and H5. The histones first level of organization is defined by nucleosomes, which contain 146 bp of DNA coiled around an octamer of two molecules, each made of small histone proteins - H2A, H2B, H3 and H4. Acetylation of the N-terminal tails of the core histones by histone acetyl transferases (HAT) results in increased DNA accessibility to RNA polymerases and basal transcription factors, thereby facilitating transcription (Perry and Chalkley 1982; Nightingale, Wellinger, Sogo and Becker 1998). The current paradigms of eukaryotic transcriptional control entail modifications in chromatin structure playing a critical role in transcriptional regulation and that this modification is context and gene specific. There is an ordered recruitment of HATs,

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

216

Lei Zhang, He Li, Xian-Zhang Hu et al.

transcription factors and coactivators to the promoter of a target gene that mediates transcriptional activation (Urnov and Wolffe 2001). Conversely, histone deacetylase (HDAC) removes acetyl-groups from the histones, stimulating histone tails to wrap around the complex, making the DNA inaccessible to transcription factors (Adcock, Ito and Barnes 2004; Barnes, Adcock and Ito 2005). There are18 HDACs that are not redundant in function in human (Dokmanovic, Clarke and Marks 2007). The 18 HDAC proteins are classified into three main classes based on their homology to yeast proteins (Table 1). The first two classes are the now classical HDACs, and their activities are inhibited by trichostatin A (TSA). However, the third group is a family of NAD+-dependent proteins, which are not affected by TSA. Homologues to all three groups are found in yeast having the names “reduced potassium dependency 3” (Rpd3), which corresponds to class 1; “histone deacetylase 1” (hda1), which corresponds to class 2; and “silent information regulator 2”(Sir2), which corresponds to class3 (Sengupta and Seto 2004). Within the class I mammalian HDACs, HDAC 1, 2 and 8 are primarily found in the nucleus, whereas HDAC 3 is found both in the nucleus, cytoplasm and membrane. HDAC 1 and HDAC 2 regulate chromatin structure during transcription. HDACs catalyze the removal of acetyl groups from lysine residues of histones and other cellular proteins. Class II HDACs (HDAC 4, 5, 6, 7 9 and 10) are able to shuttle in and out of the nucleus depending on different signals (de Ruijter et al. 2003; Dokmanovic et al. 2007). HDAC 6, a cytoplasmic, microtubule-associated enzyme, forms complexes with other partner proteins and is therefore involved in a variety of biological processes (Valenzuela-Fernandez, Cabrero, Serrador and Sanchez-Madrid 2008). Changed histone acetylation, as catalyzed by HDACs is associated with changes in gene expression and transcriptional silencing.

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

CHROMATIN REMODELING, P11 AND PTSD Previously, there was no information reported on the histone modifications that occur when histone-modifying enzymes are recruited by the transcriptional machinery to p11 genes following exposure of neuronal cells to glucocorticoids. No chromatin modifications have been reported for p11 gene expression at all, as far as we are aware (Kuendgen et al. 2006). A method that examines protein–DNA interactions within the context of living cells, i.e., chromatin immunoprecipitation (Weinmann and Farnham 2002), has been performed to study the binding of GR to DNA in brain (van der Laan et al. 2008). This method allows us to examine the dynamics of the binding of steroid receptors to DNA, including p11 DNA and the role of co-regulators in the regulation of glucocorticoids-induced gene expression particularly in the brain (Morsink et al. 2006). Table 1. Classes of HDACs Classes Class I Class II Class III

Human HDAC1, HDAC2, HDAC3, HDAC8 HDAC4, HDAC5, HDAC6, HDAC7A, HDAC9, Sir2 (whose homolog in mammals is known as SIRT1, SIR2L1 or Sir2α)

References (Dokmanovic, Clarke and Marks 2007) (de Ruijter et al. 2003) (Longworth and Laimins 2006)

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

Glucocorticoid-Induced Chromatin Remodeling

GR GR GR

GR GR GR GR

deacetylation

P11 PROMOTER H1-4

r cto

AC

GR GR

fa Co-

HD

Nucleus Membrane

AC

GR

r cto

HD

GRGR

fa Co-

Stress Glucocorticoids

217

HDACs

Histone acetylation

P11

Nucleosome P11 activation

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

Figure 1. Modifications that induce chromatin remodeling of the p11 gene during gluocorticoid-induced over expression are mediated by GR, which translocates to the nucleus. Chromatin modifications open up the chromatin structure for stress- or glucocorticoid-induced activation of p11 transcription. Histone acetylation and deacetylation pla an important role in stress-induced p11 over expression.

The characteristics of glucocorticoids indicate that their regulation of the expression of the p11 gene might be at the chromatin level. Being steroids, glucocorticoids are small hydrophobic molecules that easily diffuse through cell membranes where they bind to cytoplasmic GR. The resultant ligand-activated GR exerts multifactorial effects on cells. Classically, ligand-activated GR translocates to the nucleus where it binds to GRE ciselements on target genes to up-regulate or repress gene expression (Figure 1). Several major mechanisms have been advanced to explain the GR-mediated expression of genes activated during stress (Fig1). The first focuses on cis-activation of target genes that have GRE cis-elements. Ligand-activated GR dimmers bind directly to GRE cis-elements and directly or indirectly recruit molecules with HAT activity, resulting in acetylation of lysines on H4 or H3, which opens up chromatin and facilitates gene transcription. Coactivators with HAT activity include the CREB binding protein (CBP) and the p300/CBP-associated factor (PCAF)(Bannister and Kouzarides 1996; Ogryzko et al. 1996). These coactivators can also recruit other HATs (Yang et al. 1996; Barnes, Adcock and Ito 2005). The second of the mechanisms advanced to explain the GR-mediated expression of genes activated during stress focuses on genes that lack GRE cis-sites in their promoters, but have functional NFB or AP1 cis-sites that bind transcription factors (Pelaia et al. 2003; Schoneveld, Gaemers and Lamers 2004). Ligand-activated GR binds to these activated transcription factors, thereby blocking their binding to target cis-sites. Ligand-activated GRs also bind to and inhibit coactivators with intrinsic HAT activity, resulting in inhibition of HAT activity, recruitment of HDACs, a decrease in histone acetylation, and a reduction in gene expression (Barnes, Adcock and Ito 2005). A third possible mechanism to explain the GR-mediated expression of genes activated during stress is found in the repression of the glutathioneS-transferase gene by GR. In this

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

218

Lei Zhang, He Li, Xian-Zhang Hu et al.

mechanism GR acts on a silencing mediator for retinoid and thyroid hormones receptors (SMRT) (Ki, Cho, Choi and Kim 2005), which inactivates C/EBP and NRf2, which in turn repress glutathione S-transferase gene. It is likely this mechanism, like GR-mediated cisactivation and trans-repression, is also mediated by chromatin remodeling and might play a role in depression, which has been shown to down-regulate p11 in the cortex. To further understand the role of chromatin-remodeling in the GC-induced p11 expression, we have directly determined the ordered temporal recruitment of GR and HDAC to the p11 promoter after Dex exposure (Zhang et al., Abstract, Biological Psychiatry, 2009). We found that H2 over expressed, while HDAC3 was down regulated in the GR/HDAC complex, suggesting the distinct role of GR, H2 and HDAC2 in p11 gene expression. The detailed molecular mechanism of chromatin in one neuropsychological disorder has been studied recently (Skene et al. 2010). It was found that MeCP2, a protein binding to methylated DNA and acting as a gene-specific transcriptional repressor, was involved in Rett Syndrome, a neurodevelopmental disorder of the grey matter of the brain that almost exclusively affects females. A larger, global role for MeCP2 was identified in neurons, localizing to sites of DNA methylation throughout the genome. Deficiency of MeCP2 dramatically increased the levels of histone acetylation and alterations of chromatin structure on a wide scale. Data indicate that MeCP2 functions on a genome-wide level, regulating chromatin structure and canceling out transcriptional noise. However, its role in the regulation of p11 expression and in PTSD has not been tested.

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

CHROMATIN, MEMORY AND DEPRESSION There are several reports demonstrating a link between chromatin biology and memory loss (Gupta et al. 2010; Sweatt 2010). For example, using aging mice to determine the alteration of histone modifications in the hippocampus, a correlation has been found between learning and acetylation of histone H4 at lysine 12. Aged mice showed a decline in lysine 12 acetylation, which coincided with a failure to establish a pattern of gene expression in the hippocampus associated with memory formation. Treatment with histone deacetylase inhibitors maintained lysine 12 acetylation in the hippocampus of aging mice and allowed these mice to recover cognitive function. This finding suggested that HDAC inhibitors might be a therapeutic agent for Alzheimer’s disease, retaining the component of memory lost with age. Previously it was found that PTSD increased the risk of Alzheimer’s disease and affected the retrieval of memory (Tsolaki, Eleftheriou and Karavida 2009). This association of PTSD with Alzheimer’s disease suggests that drugs that have shown success in clinical trials for Alzheimer’s and Huntington’s diseases, such as HDACi, may also be useful in treating PTSD (Tsolaki, Eleftheriou and Karavida 2009). Valproic acid (VPA) inhibits both class I and II HDACs, with a high potency for class I HDACs. VPA inhibits HDAC activity in vitro, most likely by binding to the catalytic center of HDACs (Gottlicher et al. 2001; Kuendgen et al. 2006; Atmaca et al. 2007). Fischer et al found that HDAC blockers enhance learning and memory tasks even in wild type mice. Fear conditioning is enhanced in HDAC2 knockout mice. It is of great importance to examine whether spatial learning, short and long term memory, or memory retrieval is also altered. The specific HDAC inhibitor SAHA (suberoylanilide hydroxamic acid) could block

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

Glucocorticoid-Induced Chromatin Remodeling

219

activation of HDAC1 and HDAC2. Over-expression of HDAC2 in neurons impaired performance in fear conditioning, open field tests, and spatial learning tasks, but not over expression of HDAC1. Only a few specific lysine residues of histone protein C-terminal tail show increased acetylation, suggesting that HDAC2 may specifically act on a certain group of lysine residues of histone protein, which may play critical roles in regulating target gene expression. If HDAC2 represses transcriptional activation repressor, it is logical to deduce that HDAC2 regulates gene expressions related to a variety of learning and memory, including p11 and brain-derived neurotrophic factor (BDNF). Since HDAC2 binds to several transcriptional factor, such as CREB and CBP in the promoters of target genes, HDAC2 may contribute to a well-established CREB-CBP pathway to regulate activity- dependent gene expression and learning and memory (Qiu 2009). In addition, chronic social defeat stress in mice causes a transient decrease, followed by a persistent increase, in levels of acetylated histone H3 in the nucleus accumbens, an important limbic brain region. Such an increase in H3 acetylation is associated with decreased levels of HDAC2. Decreased levels of HDAC were also observed in the nucleus accumbens of depressed humans studied postmortem. In animals, infusion of HDAC inhibitors into the nucleus accumbens, which increases histone acetylation, exerts robust antidepressant-like effects in the social defeat paradigm and other behavioral assays. HDAC inhibitor [N-(2aminophenyl)-4-[N-(pyridine-3-ylmethoxy-carbonyl)aminomethyl]benzamide (MS-275)] infusion reverses the effects of chronic defeat stress on global patterns of gene expression in the nucleus accumbens (Simonini et al. 2006). These findings provide new insight into the underlying molecular mechanisms of depression and antidepressant action, and support the antidepressant potential of HDAC inhibitors and perhaps other agents that act at the level of chromatin structure. In another animal study, it is found that VPA enhances long-term memory for both acquisition and extinction of cued-fear. VPA enhances renewal of the original conditioned fear, suggesting that it relates to a reconsolidation-like process since a single CS reminder in the presence of VPA can enhance long-term memory for the original fear in the context in which fear conditioning takes place. By modifying the intertrial interval during extinction training, VPA can strengthen reconsolidation of the original fear memory or enhance long-term memory for extinction such that it becomes independent of context. These findings indicate HDACi can be used for phobia and anxiety disorders (Bredy and Barad 2008). Contextual fear conditioning upregulated trimethylation of histone H3 at lysine 4 (H3K4), an active mark for transcription in hippocampus and increased dimethylation of histone H3 at lysine 9 (H3K9), a molecular marker associated with transcriptional silencing (Gupta et al.2010). Mice deficient in the H3K4-specific histone methyltransferase displayed deficits in contextual fear conditioning relative to wild-type animals, suggesting that histone methylation was associated with fear memories (Gupta et al. 2010). It is also found that extinction of conditioned fear is accompanied by a significant increase in histone H4 acetylation around the BDNF P4 gene promoter and increases in BDNF exon I and IV mRNA expression in PFC. VPA potentiates the effect of weak extinction training on histone H4 acetylation around both the BDNF P1 and P4 gene promoters and on BDNF exon IV mRNA expression (Bredy et al. 2007). These results suggest a relationship between histone H4 modification, epigenetic regulation of BDNF gene expression, and long-term memory for extinction of conditioned fear.

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

220

Lei Zhang, He Li, Xian-Zhang Hu et al.

CONCLUSION GC-induced chromatin remodeling may play an important role in the transcriptional activation of the GC target gene. Such chromatin remodeling may specifically occur in the GC receptor-regulated promoter region. Chromatin remodeling is complex and may be essential in numerous cellular processes and in response to psychological stress. The example of chromatin and p11 studies suggest that p11 gene expression is mediated at a higher level by chromatin modifications and chromatin remodeling. This information is new knowledge and may be useful for developing novel compounds such as HDACi and VPA to treat PTSD. Several HDAC inhibitors have been approved by the FDA for treating cutaneous T-cell lymphoma in patients with progressive, persistent or recurrent disease (Dokmanovic, Clarke and Marks 2007). Thus, it is possible to test whether these compounds have any new indication for PTSD treatment. This fast testing track and this knowledge of the mechanisms by which HDAC inhibitors exhibit their effects on memory and fear can be translated to clinical utility. Therefore, these studies in stress-induced chromatin remodeling provide not only the information for understanding the molecular mechanisms in glucocorticoid-mediated gene expression, but also identify a new therapeutic target, chromatin modeling for stressrelated disorders such as PTSD and depression.

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

REFERENCES Adcock, I. M., K. Ito and P. J. Barnes (2004). Glucocorticoids: effects on gene transcription. Proc. Am. Thorac. Soc. 1(3): 247-254. Amador-Arjona, A., R. Delgado-Morales, X. Belda, H. Gagliano, X. Gallego, M. E. Keck, A. Armario and M. Dierssen (2010) Susceptibility to stress in transgenic mice overexpressing TrkC, a model of panic disorder. J. Psychiatr. Res. 44(3): 157-167. Atmaca, A., S. E. Al-Batran, A. Maurer, A. Neumann, T. Heinzel, B. Hentsch, S. E. Schwarz, S. Hovelmann, M. Gottlicher, A. Knuth and E. Jager (2007). Valproic acid (VPA) in patients with refractory advanced cancer: a dose escalating phase I clinical trial. Br. J. Cancer 97(2): 177-182. Bannister, A. J. and T. Kouzarides (1996). The CBP co-activator is a histone acetyltransferase. Nature 384(6610): 641-643. Barnes, P. J., I. M. Adcock and K. Ito (2005). Histone acetylation and deacetylation: importance in inflammatory lung diseases. Eur. Respir. J. 25(3): 552-563. Belda, X., D. Rotllant, S. Fuentes, R. Delgado, R. Nadal and A. Armario (2008). Exposure to severe stressors causes long-lasting dysregulation of resting and stress-induced activation of the hypothalamic-pituitary-adrenal axis. Ann. N. Y. Acad. Sci. 1148: 165-173. Bredy, T. W. and M. Barad (2008). The histone deacetylase inhibitor valproic acid enhances acquisition, extinction, and reconsolidation of conditioned fear. Learn. Mem. 15(1): 3945. Bredy, T. W., H. Wu, C. Crego, J. Zellhoefer, Y. E. Sun and M. Barad (2007). Histone modifications around individual BDNF gene promoters in prefrontal cortex are associated with extinction of conditioned fear. Learn. Mem. 14(4): 268-276.

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

Glucocorticoid-Induced Chromatin Remodeling

221

Caspi, Y., O. Saroff, N. Suleimani and E. Klein (2008). Trauma exposure and posttraumatic reactions in a community sample of Bedouin members of the Israel Defense Forces. Depress Anxiety 25(8): 700-707. Cohen, H., J. Zohar, Y. Gidron, M. A. Matar, D. Belkind, U. Loewenthal, N. Kozlovsky and Z. Kaplan (2006). Blunted HPA axis response to stress influences susceptibility to posttraumatic stress response in rats. Biol. Psychiatry 59(12): 1208-1218. de Ruijter, A. J., A. H. van Gennip, H. N. Caron, S. Kemp and A. B. van Kuilenburg (2003). Histone deacetylases (HDACs): characterization of the classical HDAC family. Biochem. J. 370(Pt 3): 737-749. Dokmanovic, M., C. Clarke and P. A. Marks (2007). Histone deacetylase inhibitors: overview and perspectives. Mol. Cancer Res. 5(10): 981-989. Dokmanovic, M., G. Perez, W. Xu, L. Ngo, C. Clarke, R. B. Parmigiani and P. A. Marks (2007). Histone deacetylase inhibitors selectively suppress expression of HDAC7. Mol. Cancer Ther. 6(9): 2525-2534. Ginzburg, K., T. Ein-Dor and Z. Solomon (2010) Comorbidity of posttraumatic stress disorder, anxiety and depression: a 20-year longitudinal study of war veterans. J. Affect. Disord. 123(1-3): 249-257. Gottlicher, M., S. Minucci, P. Zhu, O. H. Kramer, A. Schimpf, S. Giavara, J. P. Sleeman, F. Lo Coco, C. Nervi, P. G. Pelicci and T. Heinzel (2001). Valproic acid defines a novel class of HDAC inhibitors inducing differentiation of transformed cells. Embo J. 20(24): 6969-6978. Gupta, S., S. Y. Kim, S. Artis, D. L. Molfese, A. Schumacher, J. D. Sweatt, R. E. Paylor and F. D. Lubin (2010) Histone methylation regulates memory formation. J. Neurosci. 30(10): 3589-3599. Ki, S. H., I. J. Cho, D. W. Choi and S. G. Kim (2005). Glucocorticoid receptor (GR)associated SMRT binding to C/EBPbeta TAD and Nrf2 Neh4/5: role of SMRT recruited to GR in GSTA2 gene repression. Mol. Cell Biol. 25(10): 4150-4165. Kuendgen, A., M. Schmid, R. Schlenk, S. Knipp, B. Hildebrandt, C. Steidl, U. Germing, R. Haas, H. Dohner and N. Gattermann (2006). The histone deacetylase (HDAC) inhibitor valproic acid as monotherapy or in combination with all-trans retinoic acid in patients with acute myeloid leukemia. Cancer 106(1): 112-119. Li, X., F. Han, D. Liu and Y. Shi (2010) Changes of Bax, Bcl-2 and apoptosis in hippocampus in the rat model of post-traumatic stress disorder. Neurol. Res. Lindauer, R. J., M. Olff, E. P. van Meijel, I. V. Carlier and B. P. Gersons (2006). Cortisol, learning, memory, and attention in relation to smaller hippocampal volume in police officers with posttraumatic stress disorder. Biol. Psychiatry 59(2): 171-177. Longworth, M. S. and L. A. Laimins (2006). Histone deacetylase 3 localizes to the plasma membrane and is a substrate of Src. Oncogene 25(32): 4495-4500. McEwen, B. S. (2001). Plasticity of the hippocampus: adaptation to chronic stress and allostatic load. Ann. N. Y. Acad. Sci. 933: 265-277. Meaney, M. J., J. Diorio, D. Francis, S. Weaver, J. Yau, K. Chapman and J. R. Seckl (2000). Postnatal handling increases the expression of cAMP-inducible transcription factors in the rat hippocampus: the effects of thyroid hormones and serotonin. J. Neurosci. 20(10): 3926-3935.

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

222

Lei Zhang, He Li, Xian-Zhang Hu et al.

Morsink, M. C., M. Joels, R. A. Sarabdjitsingh, O. C. Meijer, E. R. De Kloet and N. A. Datson (2006). The dynamic pattern of glucocorticoid receptor-mediated transcriptional responses in neuronal PC12 cells. J. Neurochem. 99(4): 1282-1298. Nightingale, K. P., R. E. Wellinger, J. M. Sogo and P. B. Becker (1998). Histone acetylation facilitates RNA polymerase II transcription of the Drosophila hsp26 gene in chromatin. Embo J. 17(10): 2865-2876. Ogryzko, V. V., R. L. Schiltz, V. Russanova, B. H. Howard and Y. Nakatani (1996). The transcriptional coactivators p300 and CBP are histone acetyltransferases. Cell 87(5): 953959. Pelaia, G., A. Vatrella, G. Cuda, R. Maselli and S. A. Marsico (2003). Molecular mechanisms of corticosteroid actions in chronic inflammatory airway diseases. Life Sci. 72(14): 15491561. Perry, M. and R. Chalkley (1982). Histone acetylation increases the solubility of chromatin and occurs sequentially over most of the chromatin. A novel model for the biological role of histone acetylation. J. Biol. Chem. 257(13): 7336-7347. Pfeffer, C. R., M. Altemus, M. Heo and H. Jiang (2007). Salivary cortisol and psychopathology in children bereaved by the september 11, 2001 terror attacks. Biol. Psychiatry 61(8): 957-965. Pollard, I., B. M. White, J. R. Bassett and K. D. Cairncross (1975). Plasma glucocorticoid elevation and desynchronization of the estrous cycle following unpredictable stress in the rat. Behav. Biol. 14(01): 103-108. Qiu, Z. (2009). Histone modifier, the gatekeeper of good memory. Cell Res 19(8): 920-921. Schoneveld, O. J., I. C. Gaemers and W. H. Lamers (2004). Mechanisms of glucocorticoid signalling. Biochim. Biophys. Acta 1680(2): 114-128. Sengupta, N. and E. Seto (2004). Regulation of histone deacetylase activities. J. Cell Biochem. 93(1): 57-67. Simonini, M. V., L. M. Camargo, E. Dong, E. Maloku, M. Veldic, E. Costa and A. Guidotti (2006). The benzamide MS-275 is a potent, long-lasting brain region-selective inhibitor of histone deacetylases. Proc. Natl. Acad. Sci. USA 103(5): 1587-1592. Skene, P. J., R. S. Illingworth, S. Webb, A. R. Kerr, K. D. James, D. J. Turner, R. Andrews and A. P. (2010) Bird Neuronal MeCP2 is expressed at near histone-octamer levels and globally alters the chromatin state. Mol. Cell 37(4): 457-468. Svenningsson, P., K. Chergui, I. Rachleff, M. Flajolet, X. Zhang, M. El Yacoubi, J. M. Vaugeois, G. G. Nomikos and P. Greengard (2006). Alterations in 5-HT1B receptor function by p11 in depression-like states. Science 311(5757): 77-80. Sweatt, J. D. (2010) Neuroscience. Epigenetics and cognitive aging. Science 328(5979): 701702. Tsolaki, M., M. Eleftheriou and N. Karavida (2009). Alzheimer's dementia and post-traumatic stress disorder differences and similarities in neuroimaging. Hell. J. Nucl. Med. 12(1): 41-46. Urnov, F. D. and A. P. Wolffe (2001). Chromatin remodeling and transcriptional activation: the cast (in order of appearance). Oncogene 20(24): 2991-3006. Valenzuela-Fernandez, A., J. R. Cabrero, J. M. Serrador and F. Sanchez-Madrid (2008). HDAC6: a key regulator of cytoskeleton, cell migration and cell-cell interactions. Trends Cell Biol. 18(6): 291-297.

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

Glucocorticoid-Induced Chromatin Remodeling

223

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

van der Laan, S., R. A. Sarabdjitsingh, M. F. Van Batenburg, S. B. Lachize, H. Li, T. F. Dijkmans, E. Vreugdenhil, E. R. de Kloet and O. C. Meijer (2008). Chromatin immunoprecipitation scanning identifies glucocorticoid receptor binding regions in the proximal promoter of a ubiquitously expressed glucocorticoid target gene in brain. J. Neurochem. 106(6): 2515-2523. Weinmann, A. S. and P. J. Farnham (2002). Identification of unknown target genes of human transcription factors using chromatin immunoprecipitation. Methods 26(1): 37-47. Yang, X. J., V. V. Ogryzko, J. Nishikawa, B. H. Howard and Y. Nakatani (1996). A p300/CBP-associated factor that competes with the adenoviral oncoprotein E1A. Nature 382(6589): 319-324. Yau, J. L., J. Noble and J. R. Seckl (2001). Acute restraint stress increases 5-HT7 receptor mRNA expression in the rat hippocampus. Neurosci. Lett. 309(3): 141-144. Yehuda, R., J. A. Golier, R. K. Yang and L. Tischler (2004). Enhanced sensitivity to glucocorticoids in peripheral mononuclear leukocytes in posttraumatic stress disorder. Biol. Psychiatry 55(11): 1110-1116. Yehuda, R., B. Kahana, K. Binder-Brynes, S. M. Southwick, J. W. Mason and E. L. Giller (1995). Low urinary cortisol excretion in Holocaust survivors with posttraumatic stress disorder. Am. J. Psychiatry 152(7): 982-986. Zhang, L., X.-Z. Hu, X. Li, H. Li and R. Ursano (2010). PTSD and Current Translational Research. Anxiety Disorder, INTIECH Publicher. Zhang, L., H. Li, T. P. Su, J. L. Barker, D. Maric, C. S. Fullerton, M. J. Webster, C. J. Hough, X. X. Li and R. Ursano (2008). p11 is up-regulated in the forebrain of stressed rats by glucocorticoid acting via two specific glucocorticoid response elements in the p11 promoter. Neuroscience 153(4): 1126-1134.

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved. New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

INDEX

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

A acetic acid, 128 acetylation, x, xii, 65, 87, 89, 93, 94, 95, 105, 109, 110, 149, 160, 161, 179, 180, 181, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 214, 216, 217, 218, 219, 220, 222 acid, xii, 62, 67, 68, 98, 101, 204, 207, 209, 214, 218, 220, 221 actinic keratosis, 116 acute myeloid leukemia, 221 adaptation, 63, 139, 214, 221 adenocarcinoma, 113 adhesion, 19, 117, 123 aetiology, viii, 62, 78 allele, 2, 111, 113, 117 alters, 184, 222 amino acid, 5, 62, 74, 150, 161, 166, 167, 168 androgen, 113, 121, 122 aneuploidy, vii, 1, 4, 21, 27, 65, 77 ANOVA, 132, 133 antibody, 152, 155, 156, 182, 185, 190, 204 anti-cancer, 70, 159 antioxidant, 67, 208, 209 anxiety disorder, 214, 219 APC, 3, 6, 7, 8, 13, 17 apoptosis, ix, 23, 66, 67, 78, 79, 90, 96, 97, 107, 116, 119, 121, 124, 200, 201, 203, 208, 210, 221 Arabidopsis thaliana, 145, 164, 172 arginine, 62, 76, 199 arrest, 4, 114, 121, 122 assessment, 69, 82, 132, 133, 146, 198 assisted reproductive technology (ART), viii, 61 asymmetry, 132

atomic force, 75 ATP, ix, 87, 90, 92, 93, 100, 103, 107, 111, 119, 121, 124, 150, 161, 195 aurora kinases, vii, 15 autosomal recessive, 180

B barriers, 73, 96, 99 basal cell carcinoma, 117 basal layer, 108 base, x, 62, 67, 89, 148, 163, 164, 166, 203 base pair, 62, 89, 164 basic research, 86 benign, 108, 111, 118 biological activity, 136 biological processes, 15, 216 biosynthesis, 145 blood, 99, 106, 139, 141, 215 body mass index, 67 bonds, 63, 65, 128 brain, xi, 112, 213, 214, 215, 216, 218, 219, 222, 223 breast cancer, 4, 119 breathing, 94, 141 breeding, 164, 165, 171, 172 buccal epithelium, 125, 126, 127, 128, 129, 130, 132, 133, 134, 137, 138, 139, 140, 141, 144, 145, 146

C calcium, 74, 136, 145, 215 cancer cells, 2, 21, 113, 114, 118, 119 cancer progression, 6, 12 cancer therapy, 2, 7

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

226 carboxyl, 23 carcinogen, 113 carcinogenesis, vii, 120 carcinoma, 93, 111, 116, 118, 124 cardiac muscle, 112 cartilaginous, 106 case study, 79, 208 CBP, 109, 121, 122, 123, 217, 219, 220, 222, 223 C-C, 3, 7, 8, 17 cDNA, 95, 117, 166, 167, 168 cell biology, ix, 85, 99 cell cycle, 4, 8, 83, 110, 114, 116, 119, 121, 122, 123, 124, 215 cell death, ix, 66, 80, 113, 147, 148, 201 cell differentiation, 64, 101 cell division, 5, 6, 16 cell fate, 94, 99 cell invasiveness, 122 cell line, xi, 86, 90, 93, 99, 102, 110, 111, 112, 113, 114, 116, 117, 118, 119, 122, 213 cell membranes, 206, 217 cell metabolism, 110 cell nucleus, vii, ix, 65, 100, 125, 128, 131, 132, 134, 142, 149 cell signaling, 107 cell surface, 94, 201 centigrade, 126, 138 Central Europe, 145 centromere, 5, 6, 8, 23, 25, 26, 77, 198 centrosome, vii, 1, 2, 4, 6, 14, 15, 16, 17, 18, 19, 20, 21 chemical, viii, 67, 97, 105, 142, 148 chemotherapy, 200, 201 childhood cancer, 73 children, 73, 214, 222 Chlamydia trachomatis, 81 chloroform, 151, 153 chromatid, 25 Chromatin, v, vi, vii, xi, 20, 29, 31, 33, 34, 39, 45, 48, 49, 50, 51, 54, 55, 58, 59, 61, 62, 65, 66, 67, 68, 75, 76, 77, 78, 79, 83, 85, 88, 89, 90, 92, 94, 100, 101, 102, 103, 107, 119, 120, 121, 122, 125, 133, 145, 162, 180, 182, 183, 185, 186, 187,188, 194, 197, 198, 204, 209, 213, 215, 216, 217, 218, 220, 222, 223 chromatin defects, viii, 61, 62, 69, 70, 71, 72 chromatin state, vii, ix, 85, 88, 91, 92, 93, 95, 98, 99, 103, 131, 134, 145, 146, 222 chromosome, vii, x, 1, 2, 6, 10, 11, 12, 13, 14, 15, 16, 19, 22, 24, 25, 27, 28, 65, 72, 75, 77, 88, 93, 95, 101, 156, 157, 158, 163, 164, 165, 167, 169, 170, 171, 172, 173, 175, 176, 198, 215 cigarette smoking, 201, 202

Index circulation, 152 classes, 168, 175, 215, 216 classification, 176 cleavage, 11, 12, 92, 205 cleavages, 74 clinical application, 80, 99 clinical trials, 218 clone, x, 163, 166, 168, 169, 170 cloning, vii, x, 16, 163, 195 coding, 72, 87, 89, 95, 101, 110, 120, 158, 168, 174 codon, 117 cognitive function, 218 colorectal cancer, 21, 113, 118 community, 221 compaction, 25, 62, 91, 145, 199, 200 comparative advantage, 164 complex interactions, 99 complexity, 122 composition, viii, 61, 62, 63, 72, 88, 112, 125, 136, 143, 156 compounds, 105, 106, 127, 220 comprehension, x, 163 conception, viii, ix, xi, 61, 70, 125, 197, 205 condensation, xi, 10, 25, 62, 65, 74, 77, 92, 126, 127, 128, 129, 130, 131, 134, 135, 136, 138, 139, 145, 197, 198, 199, 203, 205, 209 conditioning, 218, 219 configuration, viii, 61, 64 conflict of interest, 118 conjugation, 24 consensus, 68, 166 conservation, 62, 75, 109 construction, 5 contradiction, 134 control group, 142 controversial, 9, 71 convergence, 2 correlation, x, xi, 12, 71, 72, 90, 122, 127, 148, 150, 157, 197, 206, 208, 218 correlation analysis, xi, 197 correlations, viii, 62, 68, 149 cortex, 215, 218 cortisol, 214, 222, 223 covering, 155, 159, 168 CPC, 6, 7, 8, 9, 14, 22, 23 crops, 164, 174 CT, 88, 120, 156, 157 cultivation, 117 culture, xi, 100, 106, 151, 175, 213 cure, viii, 85 cycles, 70, 152, 153, 182

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

Index cyclobutane pyrimidine dimers (CPDs), ix, 147, 149, 180 cyst, 136, 164, 172 cysteine, 62, 74, 189, 200 cytokinesis, vii, 1, 11, 12, 14, 22, 23, 25, 27, 28, 198 cytometry, 68, 74 cytoplasm, 70, 136, 206, 215, 216 cytosine, 89, 205 cytoskeleton, 222 cytotoxicity, 207 Czech Republic, 107

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

D damages, iv, ix, 147, 148, 149, 159 data analysis, 154 deacetylation, xii, 89, 93, 98, 136, 214, 217, 220 defects, vii, viii, xi, 1, 2, 12, 61, 62, 69, 70, 71, 72, 114, 197, 203, 205 deficiency, ix, xi, 147, 149, 197, 200, 201, 205, 206, 207, 209 degradation, 3, 4, 5, 6, 8, 17, 20, 64, 75, 120 dementia, 222 denaturation, 67, 68, 78, 81, 204, 207, 210 deoxyribonucleic acid, 78, 82, 208 dephosphorylation, 8 depolymerization, 10, 26 deposition, 65, 199 depression, 215, 218, 219, 220, 221, 222 derivatives, 176, 177 destruction, 17, 69, 201 desynchronization, 222 detectable, 69, 157, 193, 200 detection, 22, 74, 80, 154, 164, 170, 176 diakinesis, 198 diamonds, 189 digestion, 183, 185 diploid, 113, 131, 167, 172 diplotene, 198, 210 discrimination, 19 diseases, viii, xii, 85, 214, 218, 222 disorder, ix, xii, 147, 149, 214, 215, 218, 221, 223 dispersion, 68, 80, 81, 82, 176 displacement, 93 dissociation, 25 distribution, 4, 64, 89, 143, 155, 156, 157, 161, 167, 172, 173, 174, 175 divergence, 170, 171 diversity, 163, 173, 176 DNA damage, vii, viii, ix, x, 61, 62, 63, 64, 66, 67, 68, 69, 70, 71, 72, 73, 74, 76, 77, 78, 79,

227 80, 81, 82, 83, 104, 137, 147, 148, 149, 150, 153, 158, 159, 160, 161, 179, 180, 192, 193, 194, 198, 200, 201, 202, 203, 204, 205, 206, 207, 208, 209, 210, 215 DNA lesions, ix, 147, 149, 150, 180 DNA ligase, 153 DNA Methylation, 29, 39, 55, 56, 57, 59 DNA polymerase, 153, 171 DNA repair, ix, xi, 72, 77, 107, 148, 150, 151, 152, 159, 160, 161, 179, 180, 195, 203 DNA strand breaks, 67, 78, 79, 207, 209 DNAs, 146, 169, 172 DNase, 151, 152 domain structure, 190 donors, 77, 126, 127, 129, 130, 131, 132, 133, 134, 137, 138, 139, 140, 141, 142, 146, 202, 207 dopaminergic, 99, 106 double bonds, 156 double helix, 63 down-regulation, 90 Drosophila, 2, 4, 5, 16, 17, 18, 19, 20, 21, 25, 90, 101, 144, 145, 175, 222 drugs, 67, 98, 110, 200, 218 dyes, 135, 136 dynamism, 89

E electric charge, 127, 128, 134 electric field, 127, 128, 129, 136, 144, 145 electromagnetic fields, 125, 136, 145 electromagnetic waves, 130, 131, 132 electrophoresis, 68, 80, 151, 152, 204, 207 embryogenesis, 86, 90, 198 embryonic stem cells, viii, 85, 100, 101, 102, 103, 104, 105 embryonic stem cells (ESCs), viii, 85 encoding, x, 163, 167 endonuclease, 196 energy, 92, 111, 129, 132, 133, 139, 156 environmental factors, ix, 79, 125 environmental stress, 142 enzyme, 3, 89, 91, 92, 93, 97, 99, 103, 109, 114, 115, 117, 119, 120, 123, 149, 159, 186, 188, 189, 192, 203, 204, 216 epidermis, 108 epididymis, 65 epigenetic mechanisms, vii, 112, 113 epigenetic modification, 76, 87, 93, 95, 96, 98, 99 epigenetic silencing, 117, 120 epigenetics, 73, 92, 95, 99

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

228

Index

Epigenetics, v, 29, 47, 49, 55, 56, 58, 85, 122, 222 epinephrine, 139 epithelial cells, 12, 125, 132, 145 epithelium, 126, 132, 141, 201 epitopes, 69 equatorial plate, 198 equilibrium, 67 ESCs, viii, 85, 86, 88, 89, 90, 91, 92, 93, 94, 95, 97, 98, 99 EST, 169 ethanol, 151, 153, 154 etiology, 200 euchromatin, ix, 89, 92, 93, 104, 125, 135 Euchromatin, 29 eukaryotic, 62, 88, 149, 170, 176, 180, 215 evidence, xi, 9, 10, 11, 12, 13, 14, 15, 69, 71, 77, 86, 87, 88, 90, 94, 118, 174, 176, 177, 180, 202, 203, 206, 210, 213 evolution, ix, 74, 111, 147, 148, 167, 169, 171, 174, 175, 176, 177 exchange rate, 94 excision, ix, x, 104, 147, 148, 160, 161, 179, 180, 195, 196 excretion, 214, 223 exocytosis, 215 exons, 109, 166 exposure, 67, 108, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 143, 144, 149, 201, 216, 218, 221 expressed sequence tag, 164, 172 external influences, 144 extinction, 219, 220 extracellular matrix, 117, 123 extraction, 153, 154 extracts, 9

F families, 92, 176 family history, 108 FDA, 220 fear, 219, 220 fertility, viii, xi, 61, 66, 69, 70, 72, 80, 81, 82, 197, 198, 204, 205, 207, 208, 210 fertilization, viii, xi, 61, 62, 64, 65, 69, 74, 76, 82, 83, 197, 200, 201, 205, 206, 208, 209, 210 fever, 67, 79, 208 fibers, 77, 199, 205 fibroblasts, 88, 97, 98, 100, 104, 105, 106, 114, 131, 132, 137, 143, 144, 149, 160 field tests, 219 flexibility, 87, 100

fluorescence, 67, 68, 80, 143, 155, 204, 208 follicle stimulating hormone, 207 forebrain, 223 formaldehyde, 182 formation, 2, 4, 5, 12, 15, 19, 20, 63, 65, 68, 75, 76, 90, 98, 99, 103, 112, 113, 123, 134, 136, 137, 141, 142, 143, 145, 149, 156, 200, 203, 204, 209 fragments, x, 64, 152, 155, 157, 163, 165, 169, 170, 171, 180, 182, 186 functional analysis, 165 functional bipolar spindle, vii, 1, 13 fusion, 90, 102, 206

G gamete, 206 gel, 80, 151, 152, 183, 204 gene expression, vii, xi, 65, 86, 87, 88, 89, 90, 91, 92, 105, 114, 115, 122, 124, 185, 192, 213, 214, 215, 216, 217, 218, 219, 220 gene promoter, xi, 104, 213, 215, 219, 220 gene regulation, xii, 77, 87, 88, 89, 90, 100, 103, 214, 215 gene silencing, 88, 91, 103 gene therapy, ix, 107, 109 genes, viii, ix, x, xi, 7, 64, 65, 74, 75, 85, 86, 88, 89, 90, 91, 92, 93, 94, 95, 97, 99, 101, 102, 105, 107, 108, 109, 110, 112, 113, 114, 115, 117, 118, 119, 121, 148, 149, 155, 159, 160, 164, 165, 167, 170, 172, 173, 174, 185, 192, 195, 200, 209, 213, 214, 216, 217, 219, 223 genetic alteration, 12, 108, 123 genetic diversity, 172 genetic factors, 97 genetic information, 180 genetic linkage, 164 genetic marker, 172, 173 genetics, 173, 196 genome, vii, ix, x, 1, 63, 64, 65, 72, 73, 77, 88, 89, 90, 93, 100, 101, 103, 144, 147, 148, 149, 150, 155, 156, 157, 158, 159, 161, 163, 164, 165, 166, 167, 169, 170, 172, 173, 174, 175, 177, 179, 180, 193, 195, 197, 199, 200, 203, 206, 218 genomic DNA library, 166, 167 genomic instability, 2, 12 genomic regions, 188 genomics, 154, 174 genotyping, 171 genus, 74, 164, 167, 168, 175, 176 germ cells, 2, 66, 199, 201, 202, 203, 207 germ layer, 86, 90

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

Index germ line, viii, 62 glia, 114 glucocorticoid, vii, xi, 213, 214, 215, 217, 220, 222, 223 glucocorticoid receptor, xi, 213, 214, 222, 223 glutamine, 117 glutathione, 218 glycerol, 166 granules, 126, 128, 129, 130, 131, 132, 133, 134, 135, 137, 138, 139, 140, 142, 143, 146 graph, 188, 191 growth, xi, 6, 18, 104, 110, 111, 112, 116, 117, 119, 124, 149, 197 growth arrest, 6 growth factor, 116, 117 guanine, 205

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

H hair follicle, 108 halos, 68 HDAC, xii, 87, 110, 124, 214, 216, 218, 219, 220, 221 health, 66, 72, 73, 78, 143 hepatocytes, 99 hepatoma, 4 heredity, 95 heterochromatin, ix, 25, 88, 89, 92, 93, 101, 104, 125, 128, 129, 130, 131, 132, 133, 134, 135, 137, 138, 139, 140, 143, 175, 176 Heterochromatin, 29, 38, 43, 101, 135, 143 heterochromatinization, ix, 125, 127, 129, 130, 141, 142 heterogeneity, xi, 80, 176, 177, 197, 205, 207 hippocampus, 214, 218, 219, 221, 223 histidine, 189 histone deacetylase, xii, 87, 89, 97, 109, 149, 159, 214, 216, 218, 220, 221, 222 histone deacetylase inhibitor (HDACi), xii, 214 Histone PTMs, 29, 34, 38, 44 histones, 62, 63, 64, 65, 66, 73, 76, 87, 89, 92, 93, 97, 109, 136, 149, 150, 199, 200, 203, 215, 216 holocaust survivors, 214 homologous chromosomes, 198 hormone, 79, 123, 139, 214, 218, 221 HPA axis, 214, 221 hTERT, 7 human, ix, 3, 4, 5, 7, 9, 15, 16, 18, 20, 21, 24, 25, 64, 70, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 85, 86, 88, 90, 93, 94, 98, 99, 100, 101, 102, 103, 104, 105, 106, 110, 111, 112, 116, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128,

229 129, 131, 132, 134, 137, 138, 139, 141, 142, 143, 144, 145, 146, 148, 149, 156, 157, 159, 160, 161, 194, 198, 199, 200, 203, 205, 206, 207, 208, 209, 210, 211, 216, 223 human body, 148 human genome, 102, 103, 150 human health, ix, 85 hyaline, 106 hybrid, 153, 164 hybridization, 154, 166, 167, 168 hydrocortisone, 139 hydrolysis, 111 hydroxyl, 68 hypermethylation, 105, 117 hypothalamus, 214 hypothesis, 15, 65, 67, 89, 93, 198

I iatrogenic, 78 ID, 75, 79 identification, viii, x, 61, 68, 148, 150, 170, 174, 176, 196 identity, 87, 94, 166, 167 idiopathic, 69, 71, 82, 202 illumination, 138 image, 154 images, 126, 155 immunoprecipitation, x, xii, 114, 115, 148, 150, 158, 184, 214, 216, 223 in situ hybridization, 77, 89, 175 in vitro, ix, 5, 6, 9, 11, 14, 70, 82, 83, 86, 100, 109, 147, 149, 201, 208, 210, 211, 218 in vivo, 69, 80, 82, 86, 103, 116, 195, 205 incidence, viii, 61, 65, 66, 70, 208 incompatibility, 173 incubator, 151 individual differences, 127, 132, 133, 138 individuals, ix, 77, 147, 149, 180, 201 induced pluripotent stem cells (iPSCs), viii, 85 inducible protein, 6 induction, 72, 91, 92, 97, 101, 104, 106, 114, 119, 123, 137, 156, 158, 204 infancy, 180 infection, 81, 202 infertility, viii, 15, 61, 68, 69, 70, 71, 72, 78, 79, 81, 82, 197, 198, 199, 200, 206, 208 inflammation, 103, 202 influenza a, 79, 208 inhibition, 4, 6, 9, 12, 13, 21, 23, 103, 116, 117, 121, 217 inhibitor, xii, 4, 5, 6, 9, 13, 20, 97, 98, 105, 118, 119, 214, 218, 219, 220, 221, 222

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

230

Index

initiation, 116, 149, 193 insertion, 166, 168 insulin, 116, 117 integration, 104 integrity, vii, viii, ix, xi, 1, 5, 61, 62, 66, 67, 68, 69, 70, 71, 72, 78, 79, 81, 82, 83, 88, 147, 197, 202, 203, 204, 206, 208, 209, 210 intercourse, 200 interphase, 23, 77, 100, 101, 134, 198 intron, x, 110, 163, 166, 167, 168, 169, 170 ion transport, 145 ions, 136 irradiation, 126, 130, 131, 132, 133, 134, 135, 144, 145, 151, 161, 180, 181, 182, 184, 187 isozymes, 164, 173

K karyotype, 94 keratinocyte(s), 90 98, 108 kidney, 12 kinase activity, 6, 7, 11, 13, 23, 24, 27 kinetics, 79, 98 kinetochore, 10, 11, 14, 16, 20, 24, 26, 27 KOH, 152

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

L landscape, 88, 95, 101, 103, 150 larvae, 135 lead, 2, 11, 12, 64, 67, 121, 199 learning, 218, 221 learning task, 219 legend, 191 leptotene, 198 lesions, 72, 108, 110, 116, 117, 118, 156, 180 leukemia, 83, 103 leukocytes, 207, 208, 223 ligand, xi, 201, 213, 217 light, vii, viii, ix, 1, 5, 15, 61, 72, 93, 99, 125, 137, 138, 142, 144, 147, 149, 150, 180 lipid peroxidation, 210 localization, 2, 5, 7, 8, 10, 11, 12, 13, 14, 15, 16, 26, 88, 104, 172 loci, 76, 88, 97, 150, 172, 173, 176, 196 locus, 101, 117, 143, 150, 160, 173, 192, 195 longitudinal study, 221 long-term memory, 219 lung cancer, 6, 112, 118, 120, 122 lung disease, 220 lymphocytes, 136, 137, 145 lymphoma, 220

lysine, x, 76, 87, 89, 91, 97, 98, 103, 117, 179, 180, 189, 199, 205, 216, 218, 219 lysis, 68, 151, 183, 204

M machinery, 13, 65, 216 macromolecules, 132 magnesium, 74 magnet, 135, 136 magnetic field, 125, 135, 136, 145 magnetic field effect, 136 magnetic resonance, 74 majority, 2, 93, 112, 116, 168, 169 malignancy, 113 malignant cells, 122 malignant melanoma, 120, 122 mammal, 63 mammalian cells, 16, 77, 80, 100 mammals, 2, 62, 63, 91, 92, 199, 209, 216 man, 76, 130, 200, 207 manipulation, 115, 171 mapping, 122, 160, 164, 172, 173, 192, 196 marker genes, 105 mass, 67, 79, 86, 95 matrix, 4, 63, 64, 75, 100, 199 maturation process, 66 measurement, 69, 154, 204 MeCP2, 29, 42, 43, 44, 45, 46, 56, 57, 58, 59, 60, 218, 222 media, 152 medicine, 143 meiosis, vii, 25, 65, 198, 210, 215 MEK, 108, 117, 123 melanoma, vii, ix, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 149 membranes, 68, 145, 166, 167 memory, 94, 98, 99, 104, 105, 218, 219, 220, 221, 222 memory formation, 218, 221 memory loss, 218 memory retrieval, 218 mesenchymal stem cells, 137 messengers, 14 meta-analysis, 77, 82, 210 metabolism, 148, 180 metalloproteinase, 117 metamorphosis, 198 metaphase, 7, 8, 10, 11, 14, 23, 27, 198 metastatic disease, 108 methodology, 204 Methyl Binding Proteins, 29

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

Index methylation, vii, viii, 65, 76, 85, 87, 89, 90, 91, 92, 94, 97, 98, 102, 103, 105, 161, 165, 218, 219, 221 methylene blue, 145 mice, 12, 62, 91, 93, 110, 112, 113, 122, 176, 207, 208, 218, 219, 220 microarray technology, ix, 147, 158 microphotographs, 126 microsatellites, 172, 173 microscopy, 68, 75, 77, 80 microwave radiation, 127, 128, 130, 132, 133, 134, 136, 137, 144, 145 microwaves, 125, 126, 129, 130, 131, 132, 133, 134, 136, 144, 145 migration, 63, 111, 222 miscarriage, viii, 61, 66, 69, 70, 71, 205 mitochondria, 161 mitochondrial DNA, x, 148, 157, 158, 161 mitogen, 108 mitosis, vii, 1, 2, 3, 4, 5, 8, 9, 10, 11, 12, 13, 14, 15, 16, 18, 19, 22, 23, 24, 25, 28, 110, 198, 201, 215 MMP, 117 mobile phone, 130, 137 model system, 5, 75, 209 models, 104, 125, 159, 201 modifications, vii, viii, x, xii, 67, 85, 87, 89, 91, 92, 95, 97, 98, 100, 101, 103, 105, 110, 136, 148, 149, 150, 153, 159, 181, 182, 183, 193, 195, 213, 215, 216, 217, 218, 220 molecules, 15, 65, 97, 134, 136, 215, 217 morphology, xi, 69, 143, 197, 205, 206 motif, 11, 90, 166 motor neurons, 99, 106 MR, 76, 80 mRNA, 7, 76, 93, 116, 120, 167, 168, 210, 214, 219, 223 multiple factors, 200 multiple sclerosis, 142, 146 mutant, x, 90, 110, 111, 113, 118, 148, 157, 187, 188, 189, 190, 191, 192, 193 mutation, ix, xi, 2, 15, 79, 83, 103, 108, 109, 110, 111, 112, 117, 118, 119, 121, 122, 123, 124, 147, 148, 150, 161, 165, 169, 175, 189, 193, 201, 207, 213 myogenesis, 112, 122

N NaCl, 151, 152 NAD, 216 National Academy of Sciences, 16, 17, 20, 24, 73, 79

231 natural pregnancy, 71 natural selection, 142 negative effects, 66, 73 nematode, 164, 172 neural development, 112, 124 neuroblastoma, 7 neurogenesis, 112, 119 neuroimaging, 222 neuronal cells, 215, 216 neurons, 99, 106, 114, 218, 219 nevus, 108, 116 nitric oxide, 211 Nrf2, 221 nuclear genome, 157 nuclear maturity, xi, 197, 198 nuclear membrane, 16, 126 nucleation, 4, 75 nuclei, 62, 63, 65, 66, 68, 74, 77, 88, 90, 102, 105, 125, 126, 127, 128, 129, 130, 131, 133, 134, 136, 137, 138, 139, 140, 141, 142, 144, 145, 146, 183, 198, 199, 205, 208 nucleic acid, 80, 144 nucleolus, 88 nucleoprotein, 127 nucleosome, vii, 29, 31, 33, 49, 51, 62, 65, 73, 89, 92, 93, 101, 103, 104, 110, 111, 115, 124, 150, 159, 160, 161, 183, 186, 192, 195 nucleosome remodelling, vii nucleotide excision repair (NER), ix, 147, 148, 180 nucleotide sequence, 166 nucleotides, 68, 165, 204 nucleus, vii, viii, ix, xi, 25, 61, 62, 63, 64, 65, 67, 68, 72, 75, 77, 88, 90, 100, 114, 125, 126, 127, 128, 131, 132, 134, 142, 144, 149, 197, 199, 200, 202, 203, 205, 215, 216, 217, 219 null, 9, 93, 103, 119, 189

O OH, 204 oncogenes, 7, 12, 120 oocyte, viii, 20, 62, 64, 70, 72, 83, 198, 200, 206 organelle, 16, 157 organism, viii, 85, 125, 142, 143, 145, 159 organize, 25 ovarian cancer, 21 oxidation, 200, 202, 203 oxidative stress, 67, 70, 74, 76, 78, 79, 82, 202, 203, 206 oxygen, 79, 211

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

232

Index

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

P p53, 6, 7, 12, 17, 20, 21, 108, 117, 122, 124, 136, 161 pachytene, 198 pairing, 175, 195, 198 paleontology, 177 pancreas, 113, 119, 151 pancreatic cancer, 118 panic disorder, 220 paradigm shift, 99 pathogenesis, 108, 113, 116 pathology, 70, 200 pathways, 2, 3, 6, 7, 8, 13, 14, 15, 86, 87, 106, 123, 124, 195 PCR, x, 118, 152, 153, 154, 159, 163, 164, 165, 166, 169, 170, 171, 183 PCT, 159 peptide, 62, 69, 80 peri-implantation stage, 113 permeability, 136 pH, 126, 151, 152, 153 phenotype, 86, 95 phosphate, 63, 125, 166, 200 phosphorylation, 3, 4, 5, 6, 7, 8, 9, 11, 12, 16, 17, 19, 20, 22, 23, 24, 25, 27, 28, 65, 87, 89, 109, 113, 149, 161 physical activity, 140, 141 physiology, 69, 72, 123, 145 pigmentation, 110, 115 plants, 165, 168, 171, 173, 174, 175, 177 plaque, 166, 167 plasma membrane, 7, 66, 221 plasmid DNA, 156, 166 playing, 6, 141, 215 pluripotent stem cells (PSCs), vii, viii, 85, 86, 94, 100, 104, 105, 106 PM, 75 point mutation, 189, 193 polarization, 130, 131, 132, 144 police, 214, 221 polycomb repressive complex, 101, 102 polymerase, 143, 153, 164, 172, 203, 222 polymerase chain reaction, 164, 172 polymerization, 10 polymorphisms, 164, 167, 170, 172, 173 population, 71, 91, 201, 204, 205 positive correlation, xi, 197 post-traumatic stress disorder (PTSD), xii, 214, 215, 216, 218, 221, 222, 223 potassium, 216 precipitation, 91, 151, 168 prefrontal cortex, 215, 220

pregnancy, 69, 70, 71, 73, 77, 82, 83, 198, 200, 205, 208, 210 preparation, 126, 183 primary function, vii, 215 probability, 71, 132, 133, 157, 205 probe, x, 135, 155, 156, 157, 158, 163, 166, 167, 168, 171, 186 progenitor cells, 91, 98 progesterone, 20 prognosis, 12, 116, 122 proliferation, ix, 107, 110, 113, 115, 116, 118, 121, 122, 201 promoter, xi, 75, 90, 91, 92, 95, 102, 104, 109, 110, 111, 112, 114, 115, 116, 117, 118, 120, 121, 180, 181, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 213, 214, 215, 216, 218, 220, 223 prophase, 2, 7, 10, 198, 210 prostate cancer, 113, 118, 121, 123 proteasome, 196 protection, 80, 185, 186 protein components, 114, 215 protein kinases, 2, 16 protein sequence, 3 proteinase, 151 proteins, vii, ix, xi, 1, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 14, 15, 16, 23, 62, 64, 65, 66, 68, 73, 74, 76, 77, 88, 89, 90, 92, 93, 94, 99, 102, 103, 110, 112, 113, 114, 116, 117, 136, 143, 145, 147, 148, 149, 150, 159, 179, 180, 182, 184, 192, 193, 195, 198, 199, 201, 207, 209, 215, 216 proteolysis, 17, 92 psychological stress, xi, 213, 220 psychopathology, 222 PTEN, 113, 124 purification, 152, 183 pyrimidine, ix, 147, 149, 156, 160, 161, 180, 195

R radiation, xi, 80, 126, 128, 130, 131, 132, 133, 134, 135, 161, 179 Radiation, 144 radiotherapy, 201 reactions, ix, 125, 221 reactive oxygen, 64, 66, 67, 79, 201, 202, 206, 208, 210 reactivity, xi, 197, 204 reading, 141, 166 real time, 183 receptors, xii, 136, 203, 214, 216, 218 reciprocal interactions, 93

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

Index reciprocal translocation, 65, 72, 77 recognition, 17, 149, 150, 159 recombinant proteins, 104 recovery, 18, 94, 132, 133, 134, 139, 144, 202 recovery process, 134 recruiting, 8, 9, 97 redundancy, 187 regenerative medicine, 86 relevance, viii, 4, 61, 206 remodelling, vii, xi, 65, 67, 103, 118, 119, 120, 124, 150, 160, 179, 180, 181, 192, 193, 194, 210 renal cell carcinoma, 111 repackaging, 199 repair, vii, viii, ix, x, 62, 66, 72, 77, 78, 83, 111, 137, 147, 148, 149, 150, 151, 153, 155, 157, 158, 159, 160, 161, 179, 180, 184, 185, 187, 188, 190, 191, 192, 193, 195, 196, 203 replication, vii, ix, 75, 93, 95, 107, 110, 111, 215 repression, 86, 89, 92, 100, 105, 109, 110, 116, 117, 194, 196, 217, 221 repressor, 91, 93, 103, 124, 180, 185, 192, 195, 196, 218, 219 reproduction, viii, 62, 70, 71, 72, 73, 75, 79, 82, 83, 206 reproductive age, 69 RES, 112 researchers, 14, 97, 148, 150, 158 residues, 5, 9, 62, 63, 74, 89, 150, 189, 205, 216, 219 resistance, 28, 64, 74, 108, 115, 116, 121, 138, 164, 165, 172 resolution, x, 25, 101, 103, 148, 149, 150, 158, 159, 160, 161, 185, 192, 196 resources, 164 response, ix, x, xi, 104, 125, 136, 179, 180, 181, 184, 190, 192, 193, 208, 213, 214, 215, 220, 221, 223 restoration, 117 restriction enzyme, 150, 165, 181, 183, 186, 187, 192 retina, 114 retinoblastoma, 123 retrovirus, 174 ribose, 203, 209 risk, 69, 70, 71, 73, 77, 79, 82, 83, 108, 111, 145, 149, 205, 210, 218 risk factors, 108 RNA, vii, 87, 88, 95, 100, 101, 143, 165, 166, 173, 175, 215, 222 RNA processing, 88 RNAi, 87 RNAs, 87, 89, 101, 143, 175

233 room temperature, 182 Russia, 137, 138

S safety, 73 SAHA, 98, 109, 218 salinity, 135 saturation, 156 scattering, 170, 171 scavengers, 203 sclerosis, 142 segregation, vii, 1, 2, 10, 11, 12, 13, 15, 16, 24, 25, 28 self-regulation, 95 semen, viii, xi, 61, 66, 69, 79, 81, 197, 201, 202, 203, 207, 208, 211 senescence, 96, 97, 108, 116, 117, 120, 122, 124 sensing, 10 sensitivity, 78, 127, 132, 186, 189, 191, 193, 214, 223 sequencing, 159, 174, 186 serine, 76, 109 serotonin, 221 serum, 79, 139 severe stress, 220 sex chromosome, 77, 210 sexual intercourse, 69 shock, 142, 146, 215 shores, 97, 105 showing, xi, 91, 116, 117, 157, 164, 205, 213 signal transduction, 120 signaling pathway, vii, 1, 14, 15, 20, 113, 123 signalling, 19, 64, 120, 222 signals, viii, 14, 85, 143, 144, 154, 155, 156, 157, 200, 216 siRNA, 116 skeletal muscle, 90 skin, 108, 116, 117, 118, 122, 161, 180 skin cancer, 116, 118, 122, 161, 180 smoking, 73, 79, 83, 202, 209 SNP, 164 sodium, 109, 151 software, 68, 154, 155 solubility, 222 solution, 68, 125, 127, 151, 152, 182, 183, 204 somatic cell, 62, 63, 65, 73, 78, 86, 89, 90, 91, 94, 97, 99, 102, 104, 105, 199 Southern blot, 168, 186, 191 spatial learning, 218 species, 2, 62, 63, 64, 66, 67, 68, 78, 79, 89, 109, 164, 165, 166, 167, 168, 169, 171, 172, 175,

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

234 176, 194, 198, 199, 201, 202, 206, 208, 210, 211 spectrophotometry, 151 sperm, viii, xi, 16, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 197, 199, 200, 201, 202, 203, 204, 205, 206, 207, 208, 209, 210, 211 sperm function, viii, 61, 65, 67, 202, 208 sperm nucleus, viii, 61, 62, 63, 64, 65, 67, 68, 72, 77, 199, 200, 202 spermatid, 198, 199, 208 spermatocyte, 198 spermatogenesis, viii, 16, 62, 67, 72, 74, 76, 78, 200, 201, 202, 205, 207, 210 spinal cord, 70, 81 spindle, vii, 1, 2, 4, 5, 6, 7, 8, 9, 10, 11, 13, 14, 16, 17, 18, 19, 20, 22, 23, 24, 25, 27, 28 spontaneous abortion, 83, 208 squamous cell carcinoma, 116 SS, 75, 76 stability, 3, 5, 17, 65, 130 stabilization, 7, 93, 142, 200 standard error, 128, 135 standardization, 72 state, vii, ix, 20, 85, 86, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 102, 103, 104, 106, 108, 118, 124, 125, 131, 132, 133, 134, 138, 139, 140, 142, 143, 144, 145, 146, 165, 199, 222 stem cell differentiation, 101, 103 stem cell lines, 100, 104 stem cells, vii, viii, 85, 86, 88, 94, 97, 100, 104, 105, 106, 112, 137, 145 sterile, 125, 151, 201 steroids, 217 stimulation, 116, 122, 214 stimulus, 129 stochastic model, 96, 105 stress, vii, ix, xi, 67, 125, 136, 137, 138, 139, 141, 143, 146, 165, 168, 175, 203, 213, 214, 217, 219, 220, 221, 222, 223 stress factors, 143 stress granules, 143, 146 stress response, 137 structural changes, 170, 199 structural modifications, 169 structural variation, 168 structure, vii, viii, ix, x, xi, 16, 21, 61, 62, 63, 64, 65, 73, 75, 77, 78, 79, 81, 82, 83, 85, 86, 88, 89, 90, 91, 92, 94, 95, 100, 101, 102, 105, 108, 109, 111, 122, 125, 128, 132, 133, 144, 145, 146, 147, 148, 149, 150, 156, 159, 163, 164, 166, 167, 179, 180, 184, 185, 186, 187, 189,

Index 192, 193, 196, 197, 199, 201, 204, 207, 208, 215, 216, 217, 218, 219 substitution, 108, 117, 171, 192 substrate, 2, 4, 5, 10, 11, 13, 14, 19, 20, 24, 112, 149, 214, 221 subtraction, x, 163, 165, 166, 173 sucrose, 92, 111 Sun, 21, 24, 25, 79, 83, 113, 123, 204, 208, 220 suppression, 17, 91, 94, 103, 110, 121, 124, 146 surveillance, 10 survival, ix, 21, 107, 110, 115, 116, 120, 121, 122, 123, 161, 189, 190, 193 survivors, 223 susceptibility, 67, 221 suspensions, 207 SWI/SNF, ix, 92, 93, 103, 104, 107, 108, 109, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 150, 161, 180, 195 synthesis, 143, 152, 160, 161, 198

T T cell, 103 target, ix, xi, 5, 6, 7, 17, 69, 80, 93, 95, 97, 102, 107, 109, 110, 111, 113, 115, 117, 118, 119, 121, 124, 159, 201, 213, 214, 216, 217, 219, 220, 223 taxa, 164 techniques, vii, 69, 72, 203, 208 technology, viii, 61, 70, 82, 159, 203 telephone, 136 telephones, 145 telomere, 75, 208 telophase, 3, 7, 9, 10, 11, 14, 198 temperature, 67, 126, 135, 138, 142, 145, 152, 164, 165, 168, 200 tension, 10, 11, 26, 180 terminals, 165 terrorist attack, 214 testicular cancer, 70 testing, 15, 71, 83, 159, 220 testis, 16, 65, 76, 199, 201, 203, 208, 209, 210 TGF, 117 thalassemia, 70 therapeutic approaches, viii, 85 therapeutic interventions, 215 therapy, ix, 7, 12, 70, 99, 107, 110, 120, 201, 207 threonine, 8, 15, 20, 22 thyroid, 12, 218, 221 TIR, 167, 168 tissue, viii, 79, 85, 86, 90, 92, 102, 105, 106, 109, 112, 175 tobacco, 67

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.

Copyright © 2012. Nova Science Publishers, Incorporated. All rights reserved.

Index training, 125, 139, 140, 141, 146, 219 traits, ix, 125 transcription, vii, viii, ix, x, xii, 6, 64, 65, 85, 86, 87, 89, 92, 94, 95, 96, 99, 101, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 115, 116, 117, 118, 119, 120, 121, 123, 124, 143, 146, 148, 150, 156, 158, 160, 167, 168, 180, 192, 193, 194, 195, 199, 214, 215,216, 217, 219, 220, 221, 222, 223 transcription factors, viii, xii, 64, 85, 86, 95, 96, 99, 101, 106, 109, 123, 214, 215, 217, 221, 223 transformation, 6, 12, 17, 21, 27, 94, 108, 113, 124 translocation, 7, 171, 176 transmission, 136 transplantation, 99 transport, 63, 197 transposases, 166, 175 treatment, ix, 70, 71, 72, 78, 79, 81, 85, 108, 110, 120, 121, 135, 139, 153, 203, 204, 207, 208, 209, 210, 215, 220 trichostatin A, 216 triggers, 95, 161 tumor, ix, 6, 7, 14, 17, 19, 21, 28, 99, 103, 107, 108, 111, 112, 113, 114, 116, 118, 119, 120, 121, 123, 124, 136, 146 tumor cells, 116 tumor development, 113, 116, 123 tumor growth, ix, 107 tumor necrosis factor, 6 tumor progression, 108, 116 tumorigenesis, 2, 6, 7, 12, 15, 17, 27, 113, 114 tumors, 12, 108, 110, 112, 113, 116, 117, 118, 122 tumour suppressor genes, 116 tumours, 111, 118 twist, 101 type 1 diabetes, 81

235 UV irradiation, 108, 117, 156, 160, 180, 181, 184, 187, 189, 190, 192, 195 UV light, 138, 150, 151, 156 UV radiation, x, 150, 156, 179

V valproic acid (VPA), xii, 98, 214 variations, x, 64, 72, 148, 150, 171 vertebrates, 62, 199 viral vectors, 104 viscosity, 136 vision, 146 vulnerability, 80

W waste, 139 water, 135, 152, 153 web, 159 wild type, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 218 work environment, 67 World Health Organization (WHO) , 69, 81, 82, worldwide, 69

X X chromosome, 90, 95 xeroderma pigmentosum, ix, 147, 149, 157, 160, 180

Y Y chromosome, 176 yeast, ix, xi, 15, 16, 25, 111, 147, 148, 149, 150, 154, 155, 156, 157, 159, 160, 161, 179, 180, 181, 182, 192, 194, 195, 196, 216

U ubiquitin, 3, 4, 6, 8, 10, 14, 22, 92, 160, 189, 196 UK, 61, 147, 159, 179 Ukraine, 139 underlying mechanisms, viii, 85 United States (USA), 73, 79, 160, 161, 172, 173, 174, 175, 176, 213, 222

Z zinc, 189 zygote, 70, 76, 90

New Developments in Chromatin Research, edited by Neil M. Simpson, and Valerie J. Stewart, Nova Science Publishers, Incorporated, 2012.