Multiethnicity and Migration at Teopancazco: Investigations of a Teotihuacan Neighborhood Center [1 ed.] 9780813052786

Citation preview

Multiethnicity and Migration at Teopancazco

University Press of Florida Florida A&M University, Tallahassee Florida Atlantic University, Boca Raton Florida Gulf Coast University, Ft. Myers Florida International University, Miami Florida State University, Tallahassee New College of Florida, Sarasota University of Central Florida, Orlando University of Florida, Gainesville University of North Florida, Jacksonville University of South Florida, Tampa University of West Florida, Pensacola

Multiethnicity and Migration at Teopancazco Investigations of a Teotihuacan Neighborhood Center

Edited by Linda R. Manzanilla

University Press of Florida Gainesville · Tallahassee · Tampa · Boca Raton Pensacola · Orlando · Miami · Jacksonville · Ft. Myers · Sarasota

Copyright 2017 by Linda R. Manzanilla All rights reserved Printed in the United States of America on acid-free paper This book may be available in an electronic edition. 22 21 20 19 18 17

6 5 4 3 2 1

ISBN 978-0-8130-5428-5 Library of Congress Control Number: 2017930126 The University Press of Florida is the scholarly publishing agency for the State University System of Florida, comprising Florida A&M University, Florida Atlantic University, Florida Gulf Coast University, Florida International University, Florida State University, New College of Florida, University of Central Florida, University of Florida, University of North Florida, University of South Florida, and University of West Florida. University Press of Florida 15 Northwest 15th Street Gainesville, FL 32611-2079 http://upress.ufl.edu

Contents

List of Figures vii List of Tables xiii Preface and Acknowledgments xv List of Abbreviations xix 1. Teopancazco: A Multiethnic Neighborhood Center in the Metropolis of Teotihuacan 1 Linda R. Manzanilla

2. Funerary Patterns, Sex and Age Profiles, Paleopathology, and Activity Markers of the People in Teopancazco 49 Luis Adrián Alvarado and Linda R. Manzanilla

3. Dietary and Food Patterns of the Teopancazco Population 70 Gabriela I. Mejía Appel

4. Paleodiet Reconstruction Based on Carbon and Nitrogen Isotopes of Teeth from Burials in Teopancazco 84 Isabel Casar, Pedro Morales, Edith Cienfuegos, Linda R. Manzanilla, and Francisco Otero

5. Geographic Origins and Migration Histories of the Teopancazco Population: Evidence from Stable Oxygen Isotopes 119 Pedro Morales, Isabel Casar, Edith Cienfuegos, Linda R. Manzanilla, and Francisco Otero

6. Migrants in Teopancazco: Evidence from Strontium Isotopic Studies 143 Gabriela Solís Pichardo, Peter Schaaf, Teodoro Hernández Treviño, Becket Lailson, Linda R. Manzanilla, and Peter Horn

7. Genetic Analysis of Teopancazco Burials: Inferences on Multiethnicity 164 Brenda A. Álvarez Sandoval, Linda R. Manzanilla, and Rafael Montiel

8. The Children of Teopancazco: Genetic Analysis and Archaeological Interpretations 175 Brenda A. Álvarez Sandoval, José Ramón Gallego, Linda R. Manzanilla, and Rafael Montiel

9. Faces of Ethnicity at Teotihuacan: Facial Approximation of Five Classic Period Skulls from Teopancazco 187 Lilia Escorcia, Linda R. Manzanilla, and Fabio Barba

10. The Multiethnic Population of Teopancazco: Final Comments 201 Linda R. Manzanilla

Appendix: Analytical Methods 215 References Cited 217 List of Contributors 253 Index 255

Figures

1.1. Location of Teopancazco in the Teotihuacan metropolis 3 1.2. Hypothesized concentric rings of Teotihuacan 4 1.3. Four proposed districts in Teotihuacan, corresponding to co-rulers 5 1.4. Layout of Teopancazco with locations of burials 8 1.5. Main mural painting from Teopancazco 12 1.6. Goggled figurine found in the early temple 18 1.7. Female figurine with a feline face found in the early temple 19 1.8. Destroyed Tlamimilolpa temple in northeastern sector of compound 19 1.9. Vessel with a cosmogram found in AA214B under the decapitated temple and associated with burials 20 1.10. Burial vessel made with paste from Ocotelulco, Tlaxcala, found in AA217 20 1.11. Painted tripod vessel depicting a serpent carrying a heron, broken in a termination ritual in C206 21 1.12. Painted tripod vessel depicting three-tassel headdresses, broken in a termination ritual in C206 21 1.13. Lacquered orange vessel found in C206 22 1.14. Pits under the floor of C162F before excavation 23 1.15. Decapitated individuals in the largest pit (AA142–144) 23 1.16. Perinatal infants on top of decapitated adults in pit AA142–144 24 1.17. Lacquered vessel, mica disks, and miniatures accompanying adolescent male and female 25 1.18. The main Xolalpan period ritual plaza and altar in Teopancazco 26 1.19. Tripod vessel (AA66) with four-petaled flowers, from the Early Xolalpan garment-making workshop 27

viii · Figures

1.20. Portico and patio of the possible administrator’s residence (room C267) 28 1.21. Large crater with appliqued heads (room C159B AA50, Late Xolalpan) 29 1.22. Tlaloc vase found in room C25, AA16, Xolalpan period 29 1.23. Fire God sculpture whose facial traits were destroyed in Late Xolalpan 29 1.24. Southwestern sector of Teopancazco with traces of the great fire 30 1.25. Excavation of Metepec phase rooms in the northeastern sector 31 1.26. Nineteenth-century photo of potter José María Barrios 31 1.27. Basket with skull under the destroyed Tlamimilolpa temple 35 1.28. Restored basket with spirals united by cotton threads 36 1.29. Figurine in military attire from burial 4 in a Xolalpan courtyard C19 42 1.30. Figurine of an elite male deposited in burial 4 42 1.31. Figurine with butterfly headdress from Late Tlamimilolpa temple C161 43 1.32. Butterfly headdress figurine found in room C60 43 2.1. Right maxilla of burial 2 with tooth wear due to fiber processing 53 2.2. Fragment of left maxilla of burial 2 with tooth wear due to fiber processing 53 2.3. Tooth of burial 78 with wear from cords or fibers 53 2.4. Bone rim on the first phalanx of burial 78 caused by sewing or painting 54 2.5. Vertebra of burial 78 with bone rim caused by carrying heavy weights 54 2.6. Vertebra of burial 78 with deviation due to carrying burdens on the head 55 2.7. Right fibula of burial 78 with a moderate insertion mark indicating extensive squatting 55 2.8. Mark of the large flexor muscle of the left big toe of burial 78 55 2.9. Distal fragment of the left humerus of burial 2 with activity marker of throwing 56 2.10. Burial 21 with auditory exostosis from immersion in cold water 56 2.11. Burial 18 with hyperostosis 58

Figures · ix

2.12. 2.13. 2.14. 2.15. 2.16. 2.17. 2.18. 2.19. 2.20. 2.21. 2.22. 2.23. 2.24. 3.1. 3.2. 3.3. 3.4. 3.5. 3.6. 4.1. 4.2. 4.3. 4.4. 4.5. 4.6. 4.7. 4.8. 4.9. 5.1. 5.2.

Burial 36 with hyperostosis 58 Hypoplasia on the teeth of burial 69 59 Clavicle of burial 20 with cut marks 62 Rib of burial 23 with cut marks 62 Burial 5 with intentional fractures to separate the cranial vault 63 Burial 79 with deliberate skull perforations 64 Skull of burial 46, lateral view, showing oblique tabular cranial deformation 65 Dorsal view of the skull of burial 46 66 Skull of burial 92, lateral view, with tabular oblique cranial deformation 66 Dorsal view of the skull of burial 92 67 Burial 67 with a T-shaped dental mutilation 67 Burial 81 with a T-shaped dental mutilation 68 Burial 23 with dental pyrite disk incrustation 68 Log (Ba/Sr) values in the bone samples of Teopancazco 73 Plants and animals represented in Teotihuacan murals 75 Frequency of ichthyofaunal remains at Teopancazco in chronological phases 76 Examples of ichthyofaunal species identified at Teopancazco 77 Burial 78 81 Burials 105 and 108 82 Stable isotopic analyses of individuals from Teotihuacan, Puebla, and Oaxaca 102 Oxygen enamel analysis for the Teopancazco burials 104 Carbon enamel and age analysis for the Teopancazco burials 105 Oxygen enamel and age analysis for the Teopancazco burials 106 Bivariate carbon analysis for the Teopancazco population 107 Bivariate carbon analysis for Teopancazco and modern Maya populations 108 F1 and F2 discriminant functions for burials and fauna from Teopancazco 110 F1 and F2 discriminant functions from high-maize-consuming populations 112 Average isotopic composition of enamel bioapatite and dentine collagen for Teopancazco burials across time periods 114 Surface wind climatology in August, the Mexican rainy season 125 Ocean surface wind climatology in February, the Mexican dry season 127

x · Figures

5.3. Oxygen isotopes in bone bioapatite phosphates of individuals from Teotihuacan 133 5.4. Oxygen isotopes in enamel phosphates of individuals from Teotihuacan and enamel carbonates of individuals from Teopancazco 135 5.5. δ18O enamel bioapatite values across time periods and various burial sites 136 5.6. Altitude map of the Central Highlands with trade routes and key allied sites 140 5.7. Oxygen isotopes in bones and enamel from all inhabitants of Teotihuacan across all periods 141 6.1. Molar with caries extracted from burial 9 145 6.2. Aerial photograph of the Teotihuacan archaeological site and map of the Teopancazco neighborhood center 146 6.3. Laboratory pretreatment and leaching protocol for enamel and bone samples 147 6.4. Histogram plotting bone and enamel strontium isotopes for all 27 individuals from Teopancazco 153 6.5. Inverse strontium concentration versus 87Sr/86Sr 156 6.6. 87Sr/86Sr ratios for different bone types compared to values for leached molars 157 6.7. Histogram of strontium isotope ratio values from 16 archaeological sites 160 6.8. Map of south central Mexico with fields and isolines for 87Sr/86Sr 161 7.1. Photo of the DNA extraction process 166 7.2. Bioanalyzer High Sensitivity DNA Assay of Teopancazco samples 168 7.3. Native American mtDNA haplogroups 170 7.4. Preliminary overview of genetic diversity in Teopancazco 173 8.1. Pit burial of a young child (burial 4) 178 8.2. Perinatal infant buried on top of decapitated individuals (burial 51) 178 8.3. Two toddlers buried under an early altar 179 8.4. HRM analysis diagram, distinguishing male from female 180 8.5. Proportion of males and females in the child and global populations of Teopancazco 182 8.6. Ancient DNA degradation pattern in the Teopancazco samples 182

Figures · xi

8.7. Sex determination by HRM analysis of two male infants 183 8.8. Sex determination by HRM analysis of a female infant 183 9.1. Graphic reconstruction of missing bone tissue by mirror symmetry 191 9.2. Basic facial approximation 192 9.3. Frontal views of the four adult skulls 193 9.4. Reconstructed faces of the four adult males 193 9.5. Profile view of the four adult skulls 194 9.6. Reconstructed facial profiles of the four adult males 194 9.7. Sketches of the male child 194

Tables

2.1. Burials with Osteological Alterations Due to Nutritional Deficiencies 61 3.1. Burials Sampled for Paleodietary Analysis, with Log (Ba/Sr) Results 73 4.1. Isotopic Composition of Enamel Bioapatite and Dentine Collagen of Teopancazco 87 4.2. δ13CVPDB Collagen in Samples from Individuals with a Probable Monoisotopic C4 Diet 92 4.3. Carbon and Nitrogen Isotopic Composition of Archaeological and Modern Maize 99 5.1. Isotopic Data and Characteristics of Key Sites Allied to Teotihuacan 138 6.1. 87Sr/86Sr in Teeth (Enamel) and Bones of Individuals from Teopancazco 149 87 6.2. Sr/86Sr Ratios in Soils, Plants, and Rocks between the Central Plateau and Gulf Coast 158 7.1. Mitochondrial Haplogroups Found in Teopancazco Burials 169 7.2. Frequency of mtDNA Haplogroups in Teopancazco and Reference Populations 171 7.3. Haplogroup Frequencies from Teopancazco Burials across All Periods 171 8.1. Profiles of the Children Analyzed 181 8.2. Sex Determination of the Children by HRM Analysis 184 9.1. Age, Sex, Lesions, and Bone Markings of Each Skull 189 9.2. Indices and Classification of Certain Facial Features of the Adult Skulls 190 9.3. Facial Features of the Adult Males 196 10.1. Burial Samples from Teopancazco Compiling Data from All Chapters 204

Preface and Acknowledgments

Few urban development are so heterogeneous, complex, and exceptional as Teotihuacan in central Mexico. During the first six centuries AD a wellplanned orthogonal metropolis housed a multiethnic and corporate society. The most dynamic elements of this society are the neighborhoods headed by the intermediate elite of Teotihuacan. My project, “Teotihuacan: Elite and Rulership,” was in part centered at Teopancazco. Situated to the south of the Ciudadela in one moderately elite neighborhood, it provided a perfect sample of buried and sacrificed individuals for studying multiethnicity. Through 13 field seasons of excavation (1997–2005), my team and I investigated a complex and multiethnic society with strong links to the ocean, particularly the Gulf Coast of Mexico, and the regions between Teotihuacan and the coast. In this book we analyze this interesting multiethnic neighborhood center in the southeastern sector of Teotihuacan and the population buried in it. We examine its multiethnic character, the migratory status of many of its residents, their trophic levels, the tasks in which they were involved, their paleopathologies, and the genetic groups to which they belonged. We study this multiethnic population using a variety of perspectives. In chapter 2 we review standard approaches to skeletal samples, including funerary patterns, age and sex, paleopathologies, activity markers, and cultural modifications. In chapters 3 and 4 we assess paleodiet using trace elements and stable isotopes, respectively. The next five chapters focus on the origins and ethnicities of the population, using stable and strontium isotopes to identify migrants (chapters 5 and 6), ancient DNA (chapters 7 and 8), and facial reconstructions of five individuals buried at Teopancazco (chapter 9). Chapter 10 offers a summation of the main characteristics of this population. Chapter 7 is revised from Brenda A. Álvarez-Sandoval, Linda R. Manzanilla, Mercedes González-Ruiz, Assumpció Malgosa, and Rafael Montiel,

xvi · Preface and Acknowledgments

“Genetic Evidence Supports the Multiethnic Character of Teopancazco, a Neighborhood Center of Teotihuacan, Mexico (AD 200-600),” PLoS One 10, no 7 (2015) e0132371. Chapter 10 is revised from Linda R. Manzanilla, “Cooperation and Tensions in Multiethnic Corporate Societies Using Teotihuacan, Central Mexico, as a Case Study, Proceedings of the National Academy of Sciences 112(30):9210–9215. A complex, systematic project like “Teotihuacan: Elite and Rulership” would not have been possible without the enthusiasm and expertise of professionals from multiple disciplines, including archaeologists (most of whom were my students), osteologists, odontologists, biologists, chemists, physicists, geophysicists, geologists (most of whom work or study at the National Autonomous University of Mexico, UNAM), scientific personnel from the National Institute of Anthropology and History (INAH), geneticists from the Center for Advanced Studies of the National Polytechnic Institute (CINVESTAV), and many generations of students from the National School of Anthropology and History (ENAH). I am grateful to the participants in my project for their support and expertise, particularly Luis Adrián Alvarado (ENAH) for the osteological analysis of the Teopancazco burials and Liliana Torres Sanders (INAH) for her support in this analysis. Citlali Funes provided the odontological data. Numerous collaborators in the “Teotihuacan: Elite and Rulership” project participated in the excavation, classification, and handling of the samples. Bernardo Rodríguez Galicia, of the Laboratory of Paleozoology at the Institute for Anthropological Research at UNAM, and Roberto Rodríguez Suárez, of the School of Biological Sciences at the University of Havana, Cuba, both provided helpful advice for the research presented in chapter 3. Peter Schaaf, Gabriela Solís, Becket Lailson, and Teodoro Hernández were in charge of the strontium isotope analysis; and Pedro Morales, Isabel Casar, Edith Cienfuegos, Francisco Otero, and José Ramón Gallego (UNAM) contributed the stable isotope data. Brenda Álvarez Sandoval and Rafael Montiel (Langebio-CINVESTAV) provided the ancient DNA data. Georgina Nieto Mora provided the dental tools. Hilda E. Ramos Aboites and Christian E. Martínez Guerrero provided technical support for the research presented in chapters 7 and 8. Lilia Escorcia (UNAM) and Fabio Barba supplied the facial re-creations discussed in chapter 9. Thanks to Lilia Orozco Ramírez for help with the figures and tables in chapter 6, and to Tanya Meyer and Debra Nagao for the English revision. Several reviewers offered critical comments that substantially improved

Preface and Acknowledgments · xvii

this manuscript. Thanks are due to Dr. Rebecca Storey, Dr. Cynthia Robin, and Dr. Ian Farrington for their suggestions. The 13 field seasons at Teopancazco (1997–2005) were financed by CONACyT grants 25563H, 0082596, 152340, and G36050H, and UNAM grants DGAPA IN307398, IN406199, and IN404213. The research reported in chapters 7 and 8 was supported by CONACyT grant no. CB 2008-01105481 to Rafael Montiel. Brenda Álvarez Sandoval was supported by a CONACyT fellowship (300750). INAH granted a federal archaeological permit for each field season as well as for all sample analysis.

Abbreviations

87Sr/86Sr

AA aDNA AMEL bp δ18O

CAM CINVESTAV CONACyT CRS FTIR HRM HVS INAH LSVEC mtDNA NBS neAA PCR PIXE rCRS TIMS

ratio of strontium-86 to strontium-87 isotopes activity area ancient deoxyribonucleic acid amelogenin gene base pairs relative difference between the ratio of oxygen-18 to oxygen-16 isotopes in a given sample and in a known standard as parts per million (ppm) Crassulacean acid metabolism Center for Investigation and Advanced Studies of the National Polytechnic Institute Mexican National Council for Science and Technology Cambridge Reference Sequence Fourier Transform Infrared high resolution melting hypervariable segment National Institute for Anthropology and History lithium carbonate mitochondrial deoxyribonucleic acid National Bureau of Standards nonessential amino acids polymerase chain reaction particle-induced X-ray emission revised Cambridge Reference Sequence thermal ionization mass spectrometer

xx · Abbreviations

TMVB UNAM USB VPDB VSMOW

Trans-Mexican Volcanic Belt National Autonomous University of Mexico ultrasonic bath Vienna PeeDee belemnite limestone Vienna standard mean ocean water

1 Teopancazco A Multiethnic Neighborhood Center in the Metropolis of Teotihuacan Linda R. Manzanilla

Few preindustrial urban settlements may be cited as key sites for their regions; in ancient times Chang’an, Rome, Constantinople, Alexandria, and Teotihuacan are perhaps the greatest urban developments. Yet few of these urban developments are as complex, corporate, exceptional, and multiethnic as Teotihuacan in central Mexico. René Millon (1973, 1981, 1988, 1993) brilliantly unveiled the urban grid and orthogonal plan of Teotihuacan, identifying its likely foreign wards and craft production areas. During the Classic period, the first six centuries AD, this huge metropolis housed a corporate society involved in impressive construction activities, massive production of craft goods, and extensive movement of sumptuary pieces along trade routes (Manzanilla 2001b, 2006a, 2006b, 2009a, 2011b, 2015). A number of features make Teotihuacan exceptional in Mesoamerica (Manzanilla 1997, 2007b): 1. Its large physical layout, urban planning, and grid (20 km2) (Millon 1973) (Figure 1.1). 2. Its multiethnic society, evident by foreign neighborhoods on the periphery (the Oaxaca Barrio, the Merchants’ Barrio, the Michoacán Compound, and probably others) (Figure 1.2), as well as foreign labor fostered by the intermediate elites of the neighborhood centers (Manzanilla, ed. 2012; Manzanilla 2015). 3. Its polarized settlement pattern with a huge metropolis along with numerous scattered villages and hamlets in the Basin of Mexico where the food producers lived. 4. Its corporate organization, evidenced in multifamily apartment compounds housing independent families that shared a particular

2 · Linda R. Manzanilla

task, and perhaps also evident in an apparent system of corulership by four lords, representing the four administrative sectors of the city (Manzanilla 2009a) (Figure 1.3). 5. As the capital of a peculiar type of state that I have called “the octopus type,” where the head is represented by a great planned city and the tentacles are the corridors of allied sites extending toward regions where sumptuary goods and raw materials are found, most of them consumed by elites (Manzanilla 2006d, 2007c, 2009a). The eruptions of the Popocatépetl volcano in the first century AD (Plunket and Uruñuela 1998, 2000) stimulated the arrival of large groups of people from Puebla and Tlaxcala to a Teotihuacan Valley already dotted with Formative period villages, such as Cuanalan (Manzanilla 1985, 2001b). As Millon has pointed out, the Teotihuacan Valley offered several advantages: an abundance of freshwater springs; volcanic raw materials for construction (e.g., volcanic scoria, andesite, basalt, volcanic tuff); obsidian deposits in Otumba and Pachuca (obsidian being the main raw material from which the lithic technology in central Mexico was produced); a location on the most direct route from the Gulf Coast to the Basin of Mexico, skirting the high Sierra Nevada (Manzanilla 2001b; Millon 1973). Beginning in the Tlamimilolpa phase (AD 200–350) the great orthogonal city was aligned 15° 17' east of north; before this time we find large building complexes in different parts of the valley that might represent migrant groups or factions who participated in the construction of the three main pyramids at the site over long periods. During the Tlamimilolpa phase construction modules appear for the first time: there were multifamily apartment compounds and foreign neighborhoods; the streets and buildings were arranged at right angles; the San Juan River was channeled to follow the urban grid plan; there was an east-west avenue that crossed the Street of the Dead at right angles and may have divided the city into four quarters (Millon 1973). Just as fifteenth-century Tenochtitlan was divided into four campan, or districts, the city of Teotihuacan may have had four sectors (see Figure 1.3) corresponding to the administrative seats for the state and corulership system (see Manzanilla 2009a). My team and I have wondered if the area named La Ventilla 92–94, in the southwestern sector of the city, is a neighborhood center or the administrative center of the southwestern district of the city. It seems unusual for its planning, its functional formalization, and the location of a huge administrative space in the Glyph Courtyard (Gómez Chávez 2000; Gómez Chávez et al. 2004).

Figure 1.1. Location of Teopancazco in the Teotihuacan metropolis (base map by René Millon 1973; redrawn by Rubén Gómez).

Figure 1.2. Hypothesized concentric rings of Teotihuacan: the outer ring contains foreign wards, the inner ring contains multiethnic neighborhoods headed by intermediate elites of Teotihuacan (drawing by Linda R. Manzanilla and Rubén Gómez; see Manzanilla 2009a:Figure 2.15).

Figure 1.3. Four proposed districts in Teotihuacan, from which the four co-rulers may have come (drawing by Linda R. Manzanilla, Rubén Gómez, and César Fernández; see Manzanilla 2009a:Figure 2.17).

6 · Linda R. Manzanilla

Around AD 350 there may have been a crisis in the city, as evidenced by various termination rituals (the destruction of numerous pots and objects at ritual sites; the decapitation of a large number of adults and deposition of their heads in vessels at Teopancazco; the destruction of the Pyramid of the Feathered Serpent in the Ciudadela); and the building of the Xolalpan city on top of the former construction phase (Manzanilla 2002b, 2006b). There are at least two potential causes of this crisis: (1) a possible eruption of the Xitle volcano in the southern sector of the Basin of Mexico (Siebe 2000:Table I) and the resulting demographic displacements it entailed; and/or (2) a political crisis that climaxed with the destruction and burning of the Temple of the Feathered Serpent, the construction of another platform that concealed its facade, and the possible expulsion of its adepts. I hypothesize that a rivalry between two groups in the corporate corulership system—jaguars and serpents—may have provoked a struggle that weakened the serpent group (Manzanilla 2002c, 2008a). I believe this conflict might be depicted in the Mural of the Mythological Animals, which shows different animals (felines, canids, birds) attacking serpents. In addition, the presence of two prehispanic tunnels under the main axis of the two pyramids whose facades face west (the Pyramid of the Sun and the Pyramid of the Feathered Serpent) may indicate that these two factions were competing to claim control of the axis mundi, or center of the cosmos, at their power base (Manzanilla 2009c, 2010). The new construction phase (Xolalpan, AD 350–550; Beramendi Orosco, González, and Soler Arechalde 2012; Beramendi Orosco, González Hernández, et al. 2009; Manzanilla 2009b) was built on top of its predecessor; the monochrome red painting of this phase contrasts with the polychrome mural paintings of the Tlamimilolpa phase. The great city seems to have been the capital of a powerful and organized state; each building in the city fell within a planned urban grid, and one might assume that the society was highly controlled. This may have been the case early on, with attempts to articulate ethnic and social diversities through state ritual, neighborhood ceremonies, and domestic ritual. An examination of Teotihuacan’s internal structure reveals a variety of neighborhoods (many of which may have represented the original enclaves of groups of different proveniences that arrived in the valley) where the intermediate elites orchestrated relations, production, and movements in the pursuit of particular interests. My hypothesis is that at the end of Teotihuacan’s history, the contradiction between the corporate structure of the state and the exclusionary

Teopancazco: A Multiethnic Neighborhood Center in the Metropolis of Teotihuacan · 7

structure of the strong “houses” that ruled the different neighborhoods reached a breaking point, and the social and political fabric that had once seemed highly resistant revealed its fragility and was torn. In fact, Teotihuacan may have been founded as the result of a multiethnic pact, a weak coalition formed for massive craft production and movement of sumptuary goods. The homelands of the ethnic groups that actively participated in this work eventually pulled out of Teotihuacan’s centripetal force (Manzanilla 2011a). The intermediate elites who managed the neighborhood centers were intensively involved in organizing trade and craft production activities, which required a large labor force. Each neighborhood procured sumptuary goods and workers from a particular region in Mesoamerica. The city was the central destination for cotton cloth, exotic animals, hides, pigments, minerals, rocks, semiprecious stones, and minerals, not to mention the people who carried the goods, expert craftspeople who served different functions, and perhaps others who were sacrificed. I believe that in the Tlamimilolpa and Xolalpan phases, Teotihuacan was more or less a cluster of neighborhoods, each with a central hub and various functional sectors: a ritual space, an administrative sector, a military area for the guard, a specialized craft production area, probably a medical and childbirth sector, and a series of kitchens and storerooms to feed the workers. These neighborhood centers may have been headed by the intermediate elite of Teotihuacan, who had relative autonomy of movement and were involved in bringing expert craftspeople (including garment makers, painters, and lapidary experts) from other regions to make attire and headdresses, as well as importing sumptuary objects and raw materials (Manzanilla 2006b, 2007a, 2009a, 2015). These nobles sponsored caravans that traveled along a route of allied sites toward enclaves on the Gulf Coast, in the Bajío region and western Mexico, in southeastern Mexico, and other areas (Manzanilla, 1992, 2001b, 2011b), bringing feline hides, feathers, cotton cloth, pigments, cosmetics, slate, mica, onyx, travertine, greenstone, jadeite, and other goods to the great metropolis (Manzanilla 2001b). Teopancazco was one such neighborhood, divided into functional sectors devoted to administration, ritual, garment making, medical care, food preparation for workers, and housing of military personnel (Figure 1.4; see also Manzanilla 2006a, 2006b, 2009a, 2012c; Manzanilla et al. 2011), as discussed below. This chapter opens with an overview of current knowledge about Teopancazco, an interesting multiethnic neighborhood center situated south

(a)

Figure 1.4. Layout of Teopancazco: (a) Teopancazco with its functional sectors (drawing by Linda R. Manzanilla and Rubén Gómez);(b, page 9) locations of Tlamimilolpa-phase burials in the Teopancazco compound (drawing by Agustín Ortiz); (c, page 10) locations of Xolalpan- and Metepec-phase burials in the Teopancazco compound (drawing by Agustín Ortiz).

(b)

(c)

Teopancazco: A Multiethnic Neighborhood Center in the Metropolis of Teotihuacan · 11

of the Ciudadela in the southeastern area of Teotihuacan. This information provides a context to analyze the population buried in the neighborhood, its multiethnic character, the migratory status of many of the individuals, their trophic levels, the activities in which they were engaged, their paleopathologies, and the genetic groups to which they belonged (see Figures 1.4b and 1.4c). My project at Teopancazco has provided the perfect sample of buried and sacrificed individuals for studying multiethnicity. In this book we study this particular multiethnic population from a variety of perspectives: chapter 2 takes standard approaches to skeletal samples (funerary patterns, age and sex, paleopathologies, activity markers, and cultural modifications). Chapters 3 and 4 address paleodiet using trace elements and stable isotopes. The remaining chapters analyze the migrant population using stable and strontium isotopes (chapters 5 and 6), ancient DNA (chapters 7 and 8), and facial reconstructions of individuals buried at Teopancazco (chapter 9). A summary of the main characteristics of this population is given in chapter 10.

The Teopancazco Neighborhood Center Teopancazco is located in the modern town of San Sebastián Xolalpan, south of the town church. It stands in the northwestern sector of square S2E2, structure 1-NE of Millon’s 1973 map (see Figure 1.1). Around 1886, a potter from San Sebastián Xolalpan named José María Barrios happened upon some now-famous mural paintings located on his land, and archaeologist Leopoldo Batres was summoned to explore the southern sector of the compound where these murals were found. By 1894 Antonio Peñafiel had photographed the paintings and Adela Breton had made drawings of them, preserving images that are now heavily damaged by salts (Figure 1.5). Mural painting 1 (Martínez García et al. 2012) is located in room 7 (C7), which belongs to a section of rooms along the southern border of the main ritual courtyard in a level that was partially demolished to build the next phase of construction (Cabrera 1995:157); from Batres’s excavation we have the first plan of various rooms. The main mural painting, located on the southern wall, depicts two priests sowing seeds while walking toward an altar decorated with a net design. This mural is flanked on the western wall by an image of some warriors with painted faces carrying arrows without points and a stick (Cabrera 1995, vol. I, part 1:159–160, lám. 1–4).

12 · Linda R. Manzanilla

Figure 1.5. The main mural painting from Teopancazco (original drawing by Adela Breton; current drawing based on Gamio 1922).

In 1913 Seler reported on the mural paintings Batres had unearthed at “Teopancaxco,” and described some elements of these paintings: a disc on an altar with cords of two intertwined colors forming ollin signs; two priestly figures wearing serpent headdresses and green discs in their cheeks (like those in depictions of the goddesses of the moon and the earth) walk toward the altar (Seler 1913:199–200). Flowery speech scrolls emanate from them. Each carries an incense bag and, with the right hand, spills a liquid, perhaps pulque. Gamio (1922, part 1:156–157) reproduces both the plan of Batres’s excavation and some of the paintings uncovered; he calls the site variously “Teopancalco,” “Barrios’s House,” or “the Potter’s house.” According to him, at that time the walls were preserved to a height of 60 cm. He also describes the altar as a circle with 22 rays on a red ground; framing it is a strip decorated with flowers and conch shells. In 1894 Frederick Starr published various fragments of mural paintings from the rooms around room C7 of Teopancazco (see also De la Fuente 1996, vol. II:43, 53; Gamio 1922, part 1:156–157; Kubler 1967, Figure 45). Many of these depict priests in the act of sowing. After Batres, no further work was conducted at Teopancazco until the 1960s, when Paula Krotser and Evelyn Rattray dug a pit in room 8 in order to obtain the construction sequence for René Millon’s project (Krotser and Rattray 1980). Surprisingly, their sequence does not correspond with the results we obtained from 13 field seasons of excavation. In fact, it does not even correlate with the sequence we obtained from a pit 40 cm away from theirs.

Teopancazco: A Multiethnic Neighborhood Center in the Metropolis of Teotihuacan · 13

In 1968 Paula Krotser (n.d.) dug a 1 m by 2 m pit (TE-20) in the northeastern corner of the platform where the mural paintings were found. She reported the following stratigraphic sequence, down to a depth of 1.88 m. There were various superimposed floors: the first was superficial and had a fill of volcanic tuff; a hearth was detected at 40 cm, and another stucco floor (no. 2) with volcanic tuff fill was found at 94 cm. Walls were found at 80 cm. Two more stucco floors were unearthed at 1.20 m and 1.53 m, respectively. A second hearth was found at 1.80 m. Sherds ranging from Tzacualli to Metepec phases were found, and the chronology assigned to the floor was Early Xolalpan to Metepec. In contrast, Millon (1973:56) states that the occupation was Tlamimilolpa. In our extensive excavations at Teopancazco (1997–2005), we conducted a program of radiocarbon and archaeomagnetic dating to date the different events at the site (Beramendi Orosco, González, and Soler Arechalde 2012; Beramendi Orosco, González Hernández, et al. 2009; Hueda Tanabe et al. 2004; Manzanilla 2009b; Soler Arechalde et al. 2006). The original occupation at Teopancazco may have started by AD 100–150, a date that correlates with various foundational events at Teotihuacan (for example, at Xalla; Manzanilla 2008a). This occupation may have been restricted to early temples and adjacent huts. The Tlamimilolpa period (AD 200–350) is represented by an early ritual area in the northeastern sector, which was destroyed during a transitional phase to the Xolalpan period (AD 320–370). This transition is represented in several termination rituals (29 decapitated individuals in the northeastern sector, as well as broken pots and objects in the northwestern corner of the ritual courtyard). The Early Xolalpan construction phase (AD 350–420) is represented by a second construction level, and the Late Xolalpan (AD 420–550), by a third. Near the surface, the most recent construction phase dates from the Metepec (AD 550–650). There are also some Epiclassic and Late Postclassic traces.

Methodological Goals of the Teopancazco Study After conducting extensive excavations of Formative houses in the village of Cuanalan, in the southern part of the Teotihuacan Valley, with Marcella Frangipane in 1974–1975 (Manzanilla 1985), from 1985 to 1988 I directed an interdisciplinary project on the northwestern periphery of the city of Teotihuacan. This project excavated an apartment compound (Oztoyahualco 15B:N6W3) that housed three low-status households involved in

14 · Linda R. Manzanilla

the preparation and use of stucco during the Classic period (Manzanilla 1996, 2009a; Manzanilla, ed. 1993). Like forensic detectives we integrated geophysical data from the surface with pollen, phytoliths, botanical macrofossils, faunal remains, chemical traces in the floors, and human remains to understand burial practices and demographic profiles; in addition, we prepared distributional maps of all types of archaeological debris and objects: pottery, lithics, bone instruments, shell objects, figurines, sculpture, and so forth. In the process, we revealed the anatomy of a low-status apartment compound from the fifth century AD, and established a systematic, strong, and interdisciplinary methodology for evaluating activity areas and past living conditions (Manzanilla 1988–1989, 1993, 1996, 2009a; Manzanilla and Barba 1990, 1994; Manzanilla ed., 1993). At that time, however, we had no information on how the Teotihuacan elite lived, their activities and organization, or the ethnic group they belonged to. It was unclear who and how many individuals headed the neighborhoods and ruled the city—whether one ruler or a ruling council—and what activities they engaged in. We also did not know whether they lived in multifamily apartment compounds or palatial structures or some other type of residence. After the successful interdisciplinary experience at Oztoyahualco 15B: N6W3, I considered the value of applying a similar, strict methodology to study a moderately high-status compound in the southeast and a palatial structure related to the ruling elite in the northeast, in order to establish the class-based differences in resource access, activities, specialization, organization, ethnic composition, and hierarchical relations (Manzanilla 2006d, 2008b). In 1997 I launched the “Teotihuacan: Elite and Rulership” project and had the opportunity to study simultaneously Teopancazco and Xalla, a huge and exceptional palatial compound (ca. 50,787 m2). The latter compound is located between the Pyramids of the Sun and the Moon but not along the Street of the Dead, in Millon’s square N4E1 (Manzanilla 2008a; Manzanilla and López Luján 2001; Manzanilla, López Luján, and Fash 2005). Although there was diverse evidence of both prehispanic and modern looting at the site, no one had excavated it before, so it offered an opportunity to evaluate the living conditions, as well as the administrative and ruling activities, of the elite (Manzanilla 2007c, 2008b). As stated, the primary goal of this project was to compare two sites associated with groups of different status: the intermediate elite represented by Teopancazco and the ruling elite at Xalla. Initially, we believed that

Teopancazco: A Multiethnic Neighborhood Center in the Metropolis of Teotihuacan · 15

Teopancazco was a residential compound (Manzanilla 2003c; Millon 1976), but our perception changed as we integrated data from different disciplines and compared data from our excavations at Teopancazco versus the domestic multifamily apartment compound of Oztoyahualco 15B and neighborhood centers such as La Ventilla 92–94 (Gómez Chávez 2000; Gómez Chávez et al. 2004). The excavation strategy I chose for Teopancazco and Xalla was extensive excavation with a 1 m by 1 m grid designed to detect different types of activity areas (Manzanilla 2008b), along with systematic sampling of earth for pollen, phytoliths, flotation, and chemical analyses in each square meter of floor and in each activity area. In each activity area other analyses—obsidian hydration, radiocarbon, archaeomagnetic dating, and paleointensities—were also undertaken to provide a chronology of each event (Beramendi Orosco, González, and Soler Arechalde 2012; Beramendi Orosco, González Hernández, et al. 2009; Hueda Tanabe et al. 2004; Manzanilla 1988–1989, 2007c, 2009b; Rodríguez Ceja et al. 2012; Soler Arechalde et al. 2006). Over the 13 field seasons (1997–2005), we unearthed different sectors of Teopancazco (Manzanilla 2012b, 2012c). In some areas (the southwestern sector, for example), only two construction levels were excavated. The later of these levels was built using roof beams from trees originally cut in Tlamimilolpa times (AD 200–350) and damaged in the Big Fire of late Xolalpan times (ca. AD 550) at the same time that buildings along the Street of the Dead were destroyed (Beramendi Orosco, González, and Soler Arechalde 2012; Beramendi Orosco, González Hernández, et al. 2009; Hueda Tanabe et al. 2004; Manzanilla 2009b; Soler Arechalde et al. 2006). In the northeastern sector and some others, we excavated four superposed construction levels (see Manzanilla 2012b). The most recent was most probably Metepec with reoccupations from the Epiclassic and Aztec periods: carbon in activity areas dated from ca. AD 1400 lay on top of floors from the latest Teotihuacan period; beneath this was a Late Xolalpan construction level, under which was an Early Xolalpan level, and under that a Tlamimilolpa level. Some rooms in the northeastern sector were dated even earlier, yielding archaeomagnetic dates around the Miccaotli–Early Tlamimilolpa period (ca. AD 150), when the alluvial soil in this part of the valley was first populated. In order to sequence excavation spots in time and space, the rooms, porticoes, and patios of the most recent construction level, which generally belong to the Metepec period (AD 550–650), were numbered from 1 to 99. Those belonging to the second most recent construction level (Late

16 · Linda R. Manzanilla

Xolalpan), with some exceptions, were numbered from 100 to 199 (corresponding with 500–600 in the kitchens-storerooms on the northern periphery, in what is today a street). The next lower construction level was numbered from 201 to 299, and mainly dated to the Early Xolalpan period. Finally, the earliest construction level (Tlamimilolpa) was numbered in the 300s. Rooms superimposed on one another corresponded numerically: 61 above 161, 161 above 261, and so on. Contrary to our original hypothesis that Teopancazco was a local residential compound, we now know that few people actually dwelled in this large compound (ca. 4,000 m2). Instead, it was the coordination center for a multiethnic neighborhood (see Figure 1.4), dedicated, among other things, to painting and lacquering pottery, elaborating nets and baskets, and manufacturing attire and headdresses for nobles of the intermediate elite of this particular neighborhood, who had strong ties to the Gulf Coast around Nautla, Veracruz, and to the corridor of allied sites between Teotihuacan and Nautla (Manzanilla 2006b, 2009a, 2011b, 2012c, 2015; Manzanilla et al. 2011). Based on the careful documentation of activity areas and construction units, we came to recognize that the site was exceptional for the presence of a very extensive variety and quantity of marine fish from the coastal lagoons of the Gulf Coast (Rodríguez Galicia 2006, 2010; Rodríguez Galicia and Valadez Azúa 2013a); the largest collection in Teotihuacan of marine mollusks from all the coasts of Mexico (Velázquez Castro et al. 2012); and for a foreign population that immigrated from various sites and altitudes along the corridor between Teotihuacan and Nautla. A variety of raw materials from other Mesoamerican regions were processed and consumed in this neighborhood center (Manzanilla 2006a, 2006b, 2006c, 2007a, 2009a, 2011b, 2012c, 2015; Manzanilla et al. 2011). These materials included travertine, onyx, greenstone, serpentine, green quartz, flint, slate, mica, galena, cinnabar, and various pigments (Doménech Carbó et al. 2012; López Juárez et al. 2012; Martínez García, Ruvalcaba, et al. 2002, 2005; Martínez García, Ruvalcaba Sil, et al. 2012; Melgar Tísoc et al. 2012; Pérez Roldán et al. 2012; Vázquez de Ágredos Pascual et al. 2012; Velázquez Castro et al. 2012). Another foreign association is a serpentine funerary mask possibly found by Batres at Teopancazco in the nineteenth century (now on display in the Site Museum of the Archaeological Zone of Teotihuacan) (see Gamio 1922, vol. 1, part 1, lám. 23). Perhaps this find is related to important burials excavated at the site in the nineteenth century.

Teopancazco: A Multiethnic Neighborhood Center in the Metropolis of Teotihuacan · 17

Teopancazco through Time As we mapped the different types of archaeological materials and ecofacts, little by little we developed a picture of a neighborhood center managed by an intermediate elite who were strongly connected with the Gulf Coast. In this chapter we rely heavily on our interdisciplinary perspective to describe how this multiethnic neighborhood center functioned over time (Álvarez Sandoval 2013; Manzanilla 2012c; Manzanilla et al. 2012; Mejía Appel 2011, 2012; Morales Puente et al. 2012; Schaaf et al. 2012). The Miccaotli (AD 100–200) and Tlamimilolpa (AD 200–350) Periods Some early pits containing trash of possible ritual character (for example, AA206 in room 260) were dug into the alluvium until they reached the volcanic tuff underlying it; this is the bedrock on which the foundations of nearly all the buildings of Teotihuacan rest. It is possible that the Teopancazco neighborhood center grew up around an original temple (C313), built in the Miccaotli phase in the alluvium of the valley where depressions may have collected pluvial water (see Figures 1.6 and 1.7 for objects associated with this early temple; for archaeomagnetic dating evidence see Beramendi Orosco, González, and Soler Arechalde 2012). To the north and south of this temple were formal rooms (such as C362C or C362G), and there are some traces of impermanent structures built with poles near the stone-and-stucco temple. The earliest of the four construction levels excavated in the northeastern area of the compound provided hints as to the distribution of space in the Miccaotli and Tlamimilolpa phases. To the north of what later became the main ritual plaza of Teopancazco (C6), there was previously another ritual space with a courtyard (C362F), an altar (C284 AA216), and a temple with a west-facing facade (C181B-261) (Figure 1.8). The subsequent main temple of the compound (C313-213-113-13) emulated this orientation but was situated in a larger ritual courtyard farther south. The earlier Tlamimilolpa– phase temple held important burials (see Figure 1.4b) and adjoined a room (C367)–portico (C362G)–patio (C362F) group to its west. The original Tlamimilolpa temple was “decapitated,” leaving only the lowest level, in which pits of important burials were dug (nos. 105–108, 112; see Figure 1.9). After the original temple was destroyed, 9 decapitated individuals were placed on top of it, and 20 others were buried in pits in front of it (see below). It is still unclear whether this termination ritual of ca. AD 350 resulted from

18 · Linda R. Manzanilla

Figure 1.6. Goggled figurine found in the early temple of the Tlamimilolpa period (C313) (photo by Linda R. Manzanilla).

a confrontation between factions or ethnic groups or was merely a ritual terminating the Tlamimilolpa phase. Other burials were found around the temple, among them an infant placed inside a tripod vessel decorated with negative designs (Figure 1.10); based on neutron activation analysis the paste for this vessel came from the Ocotelulco region of Tlaxcala (Neff, personal communication).

Figure 1.7. Female figurine with a feline face found in the early temple (C313) (drawing by Fernando Botas).

Figure 1.8. Destroyed Tlamimilolpa temple in the northeastern sector of the Teopancazco compound (photo by Linda R. Manzanilla).

20 · Linda R. Manzanilla

Figure 1.9. Vessel with a cosmogram, found in AA214B under the decapitated temple and associated with burials nos. 111 and 112 (photo by Rafael Reyes).

Figure 1.10. Vessel made with paste from Ocotelulco, Tlaxcala, found in AA217 and housing burial no. 101 (Tlamimilolpa) (drawing by Fernando Botas).

It appears that two different construction developments took place, one to the north, the other to the south of the main ritual plaza (C6) of Teopancazco. These were probably related to two different groups: to the northeast, the site we excavated extensively through four different construction levels was inhabited by migrants coming from along the corridor to the Gulf Coast. To the south lived the Teotihuacan intermediate elite, whom we know only from Batres’s nineteenth-century excavation and stratigraphic pits.

Teopancazco: A Multiethnic Neighborhood Center in the Metropolis of Teotihuacan · 21

Termination Rituals in the Tlamimilolpa–Xolalpan Transition (ca. AD 350) A variety of termination rituals mark the end of the Tlamimilolpa period in Teotihuacan. Perhaps these phenomena may have been related to a time of crisis, such as the eruption of the Xitle volcano, demographic displacements, or climatic disturbances. In the northwestern section of the main ritual courtyard (C6) at Teopancazco we identified not only the intentional destruction of many vessels (including two painted tripod vessels shown in Figures 1.11 and 1.12, see also Figure 1.13), but also the intentional decapitation of 29 individuals, mostly males in the northeastern sector of the

Above: Figure 1.11. Painted tripod vessel depicting a serpent carrying a heron from the Gulf Coast on its back, broken in a termination ritual. Found in C206, in the northwestern portion of the ritual courtyard (photo by Rafael Reyes). Left: Figure 1.12. Painted tripod vessel depicting three-tassel headdresses, also broken as part of the termination ritual in C206 (photo by Rafael Reyes).

22 · Linda R. Manzanilla

Figure 1.13. Lacquered orange vessel found in C206 (photo by Rafael Reyes).

compound. Most of the heads were deposited in bell-shaped vessels (of San Martin Orange ware) and topped with a curvo-divergent bowl, or tapaplato. Many of the heads were covered with cinnabar and some with maize pollen, which implies maize flowers were blooming at the time (Emilio Ibarra, personal communication, 2005). Under the floor of room C162F we found a total of 20 skulls: a few small pits holding one or two heads each, and one large pit containing 17 skulls with 6 perinatal infants placed on top (see Figures 1.14–1.16). The other 9 decapitated individuals lay on top of the destroyed early temple (C181B-261). The sole parallel known for this extraordinary ritual is from Cerro de las Mesas, Veracruz (Drucker 1943), where many bell-shaped vessels, each containing an infant’s head, were found under a floor. The main pit (AA142–144) of room C162F contained an extraordinary burial sequence. The topmost remains were six perinatal or neonatal infants (burials 45, 49, 51, 56, 57, and 61; Manzanilla 2012c). Under them were buried 17 skulls, each placed in a vessel, with the vessels arranged in the overall shape of an inverted cone. The topmost level immediately under the infants contained seven vessels (burials 46, 47, 48, 50, 52, 53, and 55). The second layer contained six vessels (burials 65, 66, 67, 69, and 70); and the third level, three (burials 81, 82, and 83); lastly, the bottom level contained two (burials 93 and 94) (Alvarado Viñas and Manzanilla, in press). Several of the burials have interesting features. The first four skulls (burials 46, 47, 48, 50) show intentional cranial deformation (Alvarado Viñas and Manzanilla, in press), and the first skull (46) is one of two showing oblique tabular cephalic modification, which is rare at Teotihuacan. The

Figure 1.14. Pits under the floor of C162F before excavation (photo by Linda R. Manzanilla).

Figure 1.15. The largest pit (AA142–144) in the ritual courtyard, where 17 decapitated young adults were found (photo by Linda R. Manzanilla).

24 · Linda R. Manzanilla

Figure 1.16 Perinatal infants placed on top of decapitated adults in pit AA142–144 (photo by Linda R. Manzanilla).

individual in burial 65, in the middle of the pit, came from near sea level, perhaps the coastal plain in Veracruz, whereas those in burials 67 and 82 came from intermediate altitudes lower than Teotihuacan but higher than the coastal plain (Morales Puente et al. 2012). Based on 87Sr/86Sr isotopic analysis, burials 55 and 70 in the first two levels were inverse migrants; that is, Teotihuacanos who lived far away for very long periods of time and came back to die in the city (Schaaf et al. 2012). Many of the decapitated individuals come from the corridor of allied sites toward the Gulf Coast, and some, such as burial 65, are from markedly low altitudes (see Morales Puente et al. 2012; Schaaf et al. 2012). In keeping with the pattern at Teopancazco, most of the decapitations were males, perhaps guards, craftspeople, carriers, or ballplayers. Their necks were severed immediately below the third cranial vertebra. The presence of cinnabar and cranial deformations (Alvarado Viñas and Manzanilla in press; Gazzola 2004) are signs of elite origin. In addition, a few theater-type censer masks with facial paint were found, objects that are generally related to military rituals. The other main burial site was the destroyed temple (C181B-261). Under the nine aforementioned decapitated individuals were pits containing

Teopancazco: A Multiethnic Neighborhood Center in the Metropolis of Teotihuacan · 25

Figure 1.17. Lacquered vessel, mica disks, and miniatures accompanying adolescent male and female (burials 105 and 108) under the destroyed Tlamimilolpa temple (photo by Linda R. Manzanilla).

important burials. One of these (AA227) contained two seated adolescents: burial 105 was a male based on DNA (see chapter 8), and burial 108 was a female by DNA. Accompanying them were a lacquered vessel, multiple mica discs and geometric mica figures (Figure 1.17; see also Rosales de la Rosa and Manzanilla 2011), and miniature vessels containing cosmetics and aromatic substances (Doménech Carbó et al. 2012; Vázquez de Ágredos Pascual et al. 2012). These adolescents had high status in the neighborhood center, as evidenced by their seated position, signs of fire in the lower part of the pit (burial 105 sat on top of a dismembered and incomplete puppet figurine), and the presence of mica objects (a raw material controlled by the Teotihuacan state; see Rosales de la Rosa and Manzanilla 2011). The Xolalpan Period (AD 350–550) It is highly possible that in the Xolalpan period Teopancazco became a neighborhood center with a large ritual plaza and temple, what is clearly a garment-making workshop in the northeastern sector, and a row of kitchen-storerooms to feed the workers. It also developed a concentration

26 · Linda R. Manzanilla

Figure 1.18. The main Xolalpan period ritual plaza and altar in Teopancazco (photo by Linda R. Manzanilla).

of foreign raw materials and goods coming mainly from the corridor toward Nautla. The ritual activity evolved in the main central plaza, which had an altar and great temple located on the eastern side (Figure 1.18), replacing the former northeastern ritual sector, which was buried under later construction levels. Chemical analyses of the stucco floor of the central ritual plaza revealed cholesterol of animal origin in the southwestern corner (Pecci et al. 2010). This fact suggests that there was a functional differentiation in the new plaza: The altar zone in the center of the courtyard appears to have been devoted to planting rituals: phosphate anomalies give evidence of the movements of priests throwing organic liquids toward the altar, up to the temple, and in the four cardinal directions. Fishing rituals may also have occurred here, as suggested by the net depicted on the altar and fish bones buried in pits surrounding it. In contrast, the southwestern corner of the main courtyard was apparently the site for decapitation and dismemberment of animals and humans (Manzanilla 2006b; Pecci et al. 2010). In the southwestern sector of the compound excavated to date, we have identified two zones: one to the south has Teotihuacan-style walls with stucco and red paint; the other to the north has a patio with clayish floors or

Teopancazco: A Multiethnic Neighborhood Center in the Metropolis of Teotihuacan · 27

work surfaces (C19), some rooms with floors of crushed volcanic tuff (C37), and walls made of small stones. The last sector we call the military sector because it is where the neighborhood guards stood (see the “Neighborhood Guard” section for supporting evidence); it contains a small stepped sanctuary (C23) with a female buried in a seated position (burial 2; see Manzanilla 2009a), as well as burial 4, containing a young boy (described below). The garment-makers’ workshop was located in rooms C251–C251A, dating from the Early Xolalpan period, and room C151 from the Late Xolalpan (Manzanilla 2009a, 2012c; Manzanilla et al. 2011). Undoubtedly it was a sector where skilled craftspeople of foreign origin made the attire and headdresses of the intermediate elite that headed the neighborhood; the iconography of four-petaled flowers on tripod vessels in this sector attests to the close supervision of this craft, as this representation is often found in sectors such as Xalla, related to the ruling elite of Teotihuacan (Figure 1.19). We suspect that the garments the intermediate elite of this neighborhood wore characterized the identity of this noble house and had symbolic importance (see Figure 1.5). Therefore, these complex garments made of cotton with marine elements attached or hanging from them had to be sewn under close supervision. In the northeastern sector there is a roomportico-patio unit that may have housed the administrator and his family (Figure 1.20; see also Pecci et al. 2010).

Figure 1.19. Tripod vessel (AA66) decorated with four-petaled flowers, an elite symbol, found in the Early Xolalpan garment-making workshop (photo by Rafael Reyes).

28 · Linda R. Manzanilla

Figure 1.20. Portico and patio of the residence that may have housed the administrator of the northern sector (room C267) (photo by Linda R. Manzanilla).

At this time the southern administrative sector of Teopancazco also seems to have been functioning and using stamp seals (see Manzanilla 2009a, 2011b). It is also possible that the previously described main mural painting of Teopancazco, situated in room C7, originated in the Xolalpan period. There is evidence of the use of ritual objects (Figure 1.21), some of which were intentionally destroyed during two episodes: ca. AD 420, at the end of the Early Xolalpan (Figure 1.22), and ca. AD 550 (Figure 1.23), at the end of the Late Xolalpan period. At this time, the southwestern sector and the main courtyard were burned (Figure 1.24). In rooms C14, 15–16, and 18 we identified wooden roof beams from trees originally cut in the Tlamimilolpa period, which were reused in the Xolalpan and stood carbonized on top of a Late Xolalpan floor. Even though some floors of other sectors showed traces of burning, only in this southwestern sector could we recover parts of the roof with carbonized beams (Beramendi Orosco, González, and Soler Arechalde 2012; Beramendi Orosco, González Hernández, et al. 2009).

Above: Figure 1.21. Large crater with appliqued heads (room C159B AA50, Late Xolalpan period) (photo by Rafael Reyes). Center: Figure 1.22. Tlaloc vase found in room C25, AA16, Xolalpan period (photo by Rafael Reyes). It was intentionally shattered. Below: Figure 1.23. Fire God sculpture whose facial features were destroyed during the Late Xolalpan period, before the abandonment of the compound (photo by Rafael Reyes).

30 · Linda R. Manzanilla

Figure 1.24. Southwestern sector of Teopancazco, showing traces of a great fire (Late Xolalpan, ca. AD 550) (photo by Linda R. Manzanilla).

The fact that both this sector and structures on the Street of the Dead show evidence of fire in AD 550 suggests that maybe the heads of the neighborhood occupied this area during the collapse of the city. Originally, in Tlamimilolpa and Early Xolalpan times, the administrators may have resided in the northeastern sector (rooms C367, C267), near a former ritual sector. The Metepec Period (AD 550–650) The Metepec period corresponded with a new construction level, which we studied in the northeastern corner of the compound (Figure 1.25), where we excavated small rooms whose walls were constructed with small stones. On top of some of these floors, we detected Epiclassic and Aztec reoccupations. We also observed this type of architecture in courtyard C19 and a small sanctuary (C23) in the southwestern corner of the excavation. The nineteenth-century activity of José María Barrios left evidence of his molds and instruments, some traces of his kiln, a water well (AA6), some ritual activity areas, and ovens on top of the Teotihuacan occupation (Figure 1.26).

Figure 1.25. Excavation of Metepec phase rooms in the northeastern sector (photo by Linda R. Manzanilla).

Figure 1.26. A nineteenth-century photo of potter José María Barrios with a sample of his wares (photo in Gamio 1922).

32 · Linda R. Manzanilla

Teopancazco as a Neighborhood Center It is possible that the three-temple plazas in the northern sector of the city may have been the original neighborhood centers at Teotihuacan (Manzanilla 1997). The three likely neighborhood centers located thus far are in La Ventilla, Tepantitla, and Zacuala. Excavations at La Ventilla 92–94 by Rubén Cabrera and Sergio Gómez have yielded additional data on the structure of a neighborhood (or district) center; specifically, La Ventilla contained a ritual component, an administrative center in the Glyphs Compound, and houses for the craftspeople (Gómez Chávez 2000; Gómez Chávez et al. 2004). The Main Characteristics of Neighborhood Centers Analysis of the data from Teopancazco, which unlike the aforementioned neighborhood centers, is in the southeastern portion of the city, has expanded the list of functional sectors in a neighborhood center (Manzanilla 2006b, 2006c, 2006d, 2009a, 2012c). 1. These centers generally have large congregational courtyards (>170 m2 in area) and large rooms on top of temple platforms (>55 m2 in area); these rooms are larger than those found in residential and apartment compounds such as Tetitla or Oztoyahualco 15B:N6W3 (Manzanilla 1996). 2. In neighborhood centers explicit food preparation activity areas are not dispersed throughout the compound, in individual household apartments, often associated with a storeroom (Manzanilla 1996). Instead, we are more likely to find a series of aligned kitchensstorerooms designed to feed large groups of people, presumably workers of the neighborhood center (Manzanilla 2006b, 2009a, 2012c; Pecci et al. 2010). 3. It is possible that each center functioned under the leadership of a strong noble “house” belonging to the Teotihuacan intermediate elite. This elite would have organized rituals; overseen highly specialized craft activities, such as the production of elite attire and headdresses unique to the neighborhood; managed neighborhood activities; and sponsored trade caravans to areas providing sumptuary goods (Manzanilla 2006b, 2007a, 2009a, 2011b). 4. Some neighborhood centers have large open areas attached to them. As Aveleyra (1963) and Gómez Chávez et al. (2004) suggested for La Ventilla, these were probably sites where ballgames

Teopancazco: A Multiethnic Neighborhood Center in the Metropolis of Teotihuacan · 33

took place (see also Uriarte 2006). Whereas Gillespie (1991:341) proposed ballcourts served to maintain ethnic frontiers, they may in fact have been mechanisms of multiethnic integration. These spaces may also have provided campsites for pilgrims or villagers related to the workers of the neighborhood center, as well as areas for cloth dyeing and the gathering of coprolites. The Ritual Sector It is highly possible that the different sectors in the city of Teotihuacan were occupied by groups of people attached to different temples and immigrants those groups attracted. Teopancazco may have grown up by attracting craftspeople and bearers who moved sumptuary goods to the main temple. Courtyard Rituals We hypothesize that the main mural painting of Teopancazco, which depicts two richly dressed priests walking toward a central altar decorated with a net while scattering liquid and seeds (Figure 1.5), represents one of the planting rituals common in neighborhood administrative sectors (Valdez Bubnova 2012). Such ceremonies may have taken place in the main ritual courtyard (C6) of Teopancazco, perhaps especially during times of crisis, food shortages, or droughts. This interpretation is supported by the altar in the center of the courtyard, the chemical concentrations present in this ritual space, and the Salvia seeds found in the northwestern sector of the plaza (Martínez Yrízar and Manzanilla 2005). Other rituals revolve around destruction and termination. Dismemberment and decapitation activities may have taken place in the southwestern corner of the ritual courtyard (Pecci et al. 2010), the byproducts of which are evident in the aforementioned decapitation termination ritual (ca. AD 350) as well as the large quantity of human and animal bones dispersed throughout the compound. In contrast, a different type of termination ritual (also dated to ca. AD 350) may have occurred in the northwestern corner of the ritual courtyard, involving the destruction of instruments, sumptuary objects, and different types of vessels (two of which were outstanding polychrome tripod vessels [Manzanilla 2000]) (see Figures 1.11–1.13). In the northeastern and western sectors of the ritual courtyard, we found pits containing fine sand; this may be one element relating Teopancazco to the ocean, as may the marine shells and animals on the priests’ attire in the main mural painting. Rituals involving net fishing, as well as ritual or communal banquets of fish from Nautla may also have taken place in the

34 · Linda R. Manzanilla

main ritual courtyard. We have uncovered the middens of these banquets in pits in the courtyard itself, and discovered net-making tools in the compound (see Manzanilla et al. 2011). Moreover, the stucco floors were made with volcanic glass from the Altotonga area in Veracruz (Barca et al. 2013), probably to underscore this relationship. During various periods other, smaller ritual courtyards were located at various sites throughout Teopancazco: in the western (military) area (C19) during the Late Xolalpan and Metepec periods, in the east (C247B) during the Xolalpan period, and in the north (C362F with altar C284) during the Tlamimilolpa period. In C19 we found termination rituals from Late Xolalpan times, identified by the presence of shattered vessels—both stone and pottery—and candeleros (Manzanilla 2002b, 2003a, 2003b). Significant differences in ritual practice distinguish apartment compounds from neighborhood centers. In multifamily apartment compounds such as Oztoyahualco 15B:N6W3, each household worshipped its patron god within its own apartment, in a ritual courtyard containing sculptures representing gods, altar models, figurines, and theater-type censers (Barba et al. 2007; Manzanilla 1996; Manzanilla, ed. 1993). In Teopancazco we find altars like that standing in the middle of the ritual courtyard (AA55); however, the main deities are found in more private rooms (the Fire God sculpture in room C17—see Figure 1.23—or the Tlaloc vase in room C25—see Figure 1.22). Liliana Torres and colleagues are studying rituals entailing the dismemberment of humans, animals, and figurines. At Teopancazco, abundant dispersed human remains have been found, many of which bear traces of violent severance, boiling, and exposure to fire. We have also found numerous animals with traces of dismemberment (Rodríguez Galicia 2006), as well as pottery figurines with their arms, legs, torsos, and heads detached (Jiménez González 2008). Funerary Rituals There are approximately 116 formal burials at Teopancazco (see Manzanilla 2015; Manzanilla et al. 2012). Teotihuacan-type formal burials are placed in pits under stucco or earth floors, in a flexed or seated position, and normally with one person in each pit (burials 105 and 108 are the only cases where we have found two adolescents seated in the same pit). Other Teotihuacan-type burials are the perinatal and neonatal infants placed in a flexed position inside vessels set into small pits, and the two toddlers, still with traces of their headbands, buried in a flexed position under a

Teopancazco: A Multiethnic Neighborhood Center in the Metropolis of Teotihuacan · 35

Figure 1.27. Basket containing the skull of Tlamimilolpa phase burial 112 in a pit under the destroyed Tlamimilolpa temple (photo by Linda R. Manzanilla).

Tlamimilolpa-period altar. Isotopic readings indicate most of these burials were local people (see chapters 5 and 6) who belonged to different genetic groups (see chapters 7 and 8). There are other exceptional ritual burials, including a pit in the northeastern sector of the main ritual sector (C6) containing a female (burial 102) whose dismembered skull is surrounded by her long bones. Her stable isotope data suggest she was born at a slightly higher altitude than Teotihuacan (see chapter 5), and the 87Sr/86Sr isotope data (see chapter 6) suggest perhaps she came from the Perote (Veracruz) or Pachuca (Hidalgo) regions (Morales Puente et al. 2012; Schaaf et al. 2012). Another unusual burial is 112, a skull either originally buried inside a basket or wearing a basketry headdress placed in a Late Tlamimilolpa pit (Figure 1.27). This individual may have come from the Ixcaquixtla region in Puebla, regarded as the source area of Thin Orange Ware and perhaps also travertine and onyx (Morales Puente et al. 2012; Schaaf et al. 2012). The basketwork is formed from spirals of reeds or grasses bound with blue cotton strings (see Figure 1.28). We propose it may have been a three-tasseled

36 · Linda R. Manzanilla

Figure 1.28. Basket as restored by Alfonso Cruz, with spirals united by cotton threads (photo by Rafael Reyes).

headdress associated with the Teotihuacan elite that traveled afar, accompanying the caravans that brought sumptuary goods and raw materials to the city (Manzanilla 2012c). The same type of headdress is depicted on one of the polychrome vessels found in the termination ritual of C6 (Manzanilla 2000). The garment-makers workshop sector contains some burials of immigrants hailing from closer to Teotihuacan. These individuals may have come from allied sites in the corridor leading to Nautla. Given that the burials are associated with bone needles, these are probably garment makers who manufactured attire for the intermediate elite of the neighborhood. As mentioned previously, the most uncommon ritual for Teotihuacan is decapitation. Two extraordinary group burials in Teopancazco were described earlier in the “Teopancazco Neighborhood Center” section.

Teopancazco: A Multiethnic Neighborhood Center in the Metropolis of Teotihuacan · 37

Ritual Actions Starr (1894) published various fragments of mural paintings from Teopancazco (see also Martínez García et al. 2012). These depict different priestly figures wearing elaborate garb (which may have been crafted in the garment-makers workshop), as well as military personnel carrying arrows without points (De la Fuente 1996; Manzanilla 2009a). Some of the priests throw flowers; others, Salvia seeds; yet others, larger beanlike seeds. As stated, this appears to depict a planting ritual, but we do not know the circumstances under which it was conducted. Based on evidence found in large pits surrounding the ritual courtyard, particularly one in the northern sector of the compound, we concluded, as stated before, that communal or ritual feasting took place, during which fish from the coastal lagoons of Veracruz were consumed, particularly the bobo fish (Joturus pichardi) (Rodríguez Galicia 2010; Rodríguez Galicia and Valadez Azúa 2013a). The presence of marine mollusks and fauna suggest that such events may have reenacted origin myths related to the ocean. They may have been accompanied by musicians, as suggested by the presence of different types of musical instruments at Teopancazco (particularly whistles and flutes; Adje Both and Francisca Zalaquett, personal communications). We also conjecture there may have been dances in which some adolescents (burials 105 and 108) represented jaguars, given that they were buried with such jaguar symbols as four-petaled seals and miniature jars of yellow, orange, and gray cosmetics (jarosite, cinnabar, and lead) (Doménech Carbó et al. 2012; Vázquez de Ágredos Pascual et al. 2012). The Medical Facility One surprising discovery during fieldwork was a series of burials of newborn babies aligned on a north-south axis in the northeastern sector of Teopancazco, particularly room C353A. Another was the six perinatal infants buried in the top layer of the pit in C162F containing the 17 decapitated adults. In this sector, two individuals with severe pathologies were also buried: a deformed infant in C253A and an adult who may have had osteomyelitis in C161. In rooms C181B–261 immediately to the north of this sector, we found the aforementioned cosmetics that contained various toxic substances (lead and mercury in galena and cinnabar) mixed with other materials to reduce toxicity. These were found in miniature vessels accompanying the two adolescents (burials 105 and 108) (Natahi 2013).

38 · Linda R. Manzanilla

Management of the Neighborhood Center Some members of the intermediate elite in charge of neighborhood centers may also have played important roles in the city administration, and may have used stamp seals with iconography such as the Thunder God (Tlaloc, the state deity of Teotihuacan), the Fire God, and the four-petaled flower (a possible emblem glyph for the city, as López Austin 1989 suggested) (Manzanilla 2007a, 2009a, 2011b). We suggest however that these leaders and others from different neighborhoods became sufficiently autonomous to sponsor caravans to the Gulf Coast, Michoacán, the Bajío, and other regions in order to bring sumptuary goods, raw materials, and people back to Teotihuacan. The neighborhood centers may have attracted multiethnic labor to serve as craftspeople, bearers, masons, guards, and other specialized workers. These individuals apparently did not live on the premises, but the series of kitchens along the periphery of these centers suggests they were fed there (Manzanilla 2011b). Following this line of reasoning, we analyzed the quantity and distribution of a specific type of rounded pottery object found at Teopancazco whose function is not yet clear. These are similar in appearance to net weights but lack the lateral notches used to affix weights. Some of these objects have been called tejos (game pieces), suggesting they were used for recreation. Yet we found an unusually large number (more than 530) of such objects at Teopancazco, which suggests that they may have had another function related to the multiethnic labor force working at the neighborhood center. The roundels come in small, medium, and large sizes, most commonly the medium size. Some sizes are also replicated on pigment tablets. The number of medium pottery roundels (530) is likely high enough to represent each common craft worker at Teopancazco. We also found roundels of other, more prized raw materials—slate, shell, and mica—which may have been allotted to specialized personnel such as soldiers and priests. The roundels come in complete, half, and fractional forms. I have proposed that the different professionals working in the neighborhood center may have exchanged these tokens for specific quantities of food rations (including tortillas and other maize-based foods), and that the raw material of the roundel correlated to the status or office of the bearer. The equivalence of pottery roundels with tortilla-type plaques was evident in the theater-type

Teopancazco: A Multiethnic Neighborhood Center in the Metropolis of Teotihuacan · 39

censer I found at Oztoyahualco 15B: N6W3 (Manzanilla and Carreón 1991), in which tortillas are represented as sustenance together with corncobs, squash, squash blossoms, tamales, cotton, and other products. The size of the roundel might have been related to the bearer’s position as a worker or supervisor within the cuadrilla (team), whereas the fractions might have corresponded to rations for men, women, and children; or to workers from Teotihuacan, Veracruz, and Puebla-Tlaxcala; or even to full-time, halftime, and occasional workers (Manzanilla 2011b). The spatial distribution of pottery roundels at Teopancazco suggests teams may have worked in the temple sector, the ritual courtyard, and the garment-makers workshop. The large roundels coexist with larger numbers of medium-sized and small roundels, suggesting a hierarchy of workers, or cuadrilla organizations, for the production of specialized crafts, performance of rituals, and other activities. The most common roundels have a diameter of 2–3 cm, and the second most common diameters are 1–2 cm on one side and 3–4 cm on the other. The fact that these two standardized sizes are represented in pottery, mica, and slate may indicate either that the pottery roundels were used as molds to cut the other disks, or that the three types represent different classes of people in the neighborhood center. Mica and slate were both foreign raw materials; mica, which came from Oaxaca, was strictly controlled by the Teotihuacan state (Rosales de la Rosa and Manzanilla 2011). The mica discs occur only in burials 105 and 108, which replicate the highly complex funerary rite found in main burials in other sectors of Teotihuacan (see Manzanilla and Serrano, eds. 1999). In sum, we suggest that the pottery, slate, and mica roundels were primarily used to identify each worker in the neighborhood center according to ethnicity, status, and profession. The pottery ones might have represented laborers (530 workers in 500 years); served as templates to cut other roundels in softer raw materials (mica, slate, shell); or been exchanged for daily food rations at the kitchens on the northern periphery. Other categories of tokens seem to have existed in Teopancazco, including biconical shapes; cones; “phalanx,” or roughly biconical pottery objects; spheres; and others. The spheres have been interpreted as blowgun projectiles used in hunting small birds, as depicted in murals, particularly in the painting in the Palace of the Sun (De la Fuente 1996). At Teopancazco, 251 small pottery spheres have been found; these may have been used in hunting as well as to represent people who hunted ducks, cardinals, quails,

40 · Linda R. Manzanilla

falcons, eagles, owls, buzzards, and other small and medium-sized birds found in the compound (Rodríguez Galicia 2006; Rodríguez Galicia and Valadez Azúa 2013a). The phalanxes frequently come in clusters of four or more, and individual phalanxes may be detached from the cluster. They have been found associated with cosmetics and pigments (Vázquez de Ágredos Pascual et al. 2012), particularly in burials 105–108, so we believe they might be stamps used to apply body paint in patterns that simulate a jaguar’s spots. We still do not know the function of the conical and biconical pieces, although we tentatively suggest they are associated with liquid rations. Specialized Crafts: Garments, Hides and Skins, Basketry, and Paintings on Walls and Vessels Teopancazco is not a foreign neighborhood, like the Merchants’ Barrio or the Oaxaca Barrio, but rather a multiethnic neighborhood center containing a large and varied quantity of goods and raw materials from the Gulf Coast and the corridor linking it to the metropolis. Such goods were used to craft attire and headdresses for priests and military personnel; that is, the intermediate elite of the neighborhood (Manzanilla et al. 2011). This sort of attire is depicted in the famous mural paintings found at the site (see De la Fuente 1996, vol. II:43, 53; Gamio 1922:156–157; Kubler 1967, Figure 45; Starr 1894) (see Figure 1.5). Apart from the diversity of bone instruments such as pins, needles, and awls; the shell and pottery buttons; and the stamps for imprinting cloth, a wide variety of animal products were brought to the compound to provide feathers, skins, hides, and plaques to be attached or sewn onto cotton cloth, which came from Veracruz, along with pottery and different types of animals. Marine shells from the Gulf, Pacific, and Caribbean coasts were worked at Teopancazco, and some were used as pendants affixed to attire (Velázquez Castro et al. 2012; Manzanilla et al. 2011). Kubler (1967:6) stated that starfish and shells evoke the ocean, and served as symbolic expressions in murals and other representations. Thus, perhaps priests wore marine fauna—such as fish bones; crab pincers; turtle, crocodile, and armadillo plaques; and coastal bird feathers (a particular type of heron)—to indicate their connection to water or marine environments. In addition, various species of coastal lagoon fish from Veracruz (such as the bobo mullet, red snapper, grouper, barracuda, sardine, and catfish) were consumed (Rodríguez Galicia 2006, 2010; Rodríguez Galicia and Valadez Azúa 2013a). Facial

Teopancazco: A Multiethnic Neighborhood Center in the Metropolis of Teotihuacan · 41

structures of weasels and canids were found at Teopancazco; as depicted in the main mural painting at the site these may have been mounted on headdresses (Manzanilla 2006b; Manzanilla et al. 2011). Analyses of the multiple examples of worked bone at Teopancazco provided evidence of the existence of paintbrushes, as well as instruments to work hides and skins and manufacture nets (Manzanilla et al. 2011; Padró Irizarri 2002; Padró Irizarri and Manzanilla 2004; Pérez Roldán et al. 2012). The fact that we found baskets in the compound suggests that they were also crafted on-site and may have served for packing the goods transported by the caravans (see Figure 1.28). The Neighborhood Guard Flanking the main mural painting of Teopancazco (in room C7) are paintings depicting individuals carrying arrows without points, who may represent the neighborhood guard. They wear unusual headdresses, although some authors have suggested that their odd features derive from inaccuracies in the copying of the painting in the nineteenth and early twentieth centuries. To the west of rooms C1 to C7 is a sector with no stucco floors (courtyard C19, sanctuary C23, and surrounding rooms) that may have been devoted to the military personnel of this neighborhood based on associated finds. Burial 4 in C19 held a seven-year-old boy (see chapter 8) who was destined to be a soldier: he was buried with a miniature theater-type censer as well as a soldier figurine with removable attire (Manzanilla 2009a) (Figure 1.29). Another elite male figurine also accompanied him (Figure 1.30), perhaps representing a ballplayer. Fonseca Ibarra (2008) mentions finding male figurines with military headdresses, particularly butterfly headdresses, in this sector. Similar figurines are also deposited with the decapitated individuals in the destroyed Late Tlamimilolpa–Early Xolalpan temple (C261) (Figure 1.31), perhaps suggesting that one of the functions of the decapitated males was to serve as symbolic soldiers or guards. This style of headdress was also found to the north of the compound, in C258C from the Xolalpan period. Similar figurines with butterfly headdresses occur in the Metepec-phase occupation of Teopancazco, toward the northeast (Figure 1.32), emphasizing that the military function was important in the neighborhood center and perhaps suggesting that the military personnel stayed after the Great Fire that marked the beginning of the city’s decline (see Soler Arechalde et al. 2006). It is likely that these guards not only suppressed conflict inside

Figure 1.29. Figurine wearing military attire deposited with burial 4 in a pit in the Xolalpan phase courtyard C19 (photo by Enah Fonseca). Figure 1.30. Figurine of an elite male, possibly a ballplayer, deposited with burial 4 (photo by Enah Fonseca).

Teopancazco: A Multiethnic Neighborhood Center in the Metropolis of Teotihuacan · 43

Figure 1.31. Figurine with butterfly headdress deposited together with decapitated individuals in C161, the destroyed Late Tlamimilolpa–Early Xolalpan temple (photo by Enah Fonseca). Figure 1.32. Butterfly headdress figurine found in room C60 of the Metepec period (photo by Enah Fonseca).

the neighborhood, but also accompanied the trade caravans to Nautla and back, to protect the sumptuary goods from robbers and to ensure that the craftspeople from other regions reached the neighborhood center safely. The Residential Sectors One of the few residential sectors at Teopancazco, dating to the Tlamimilolpa period, is located in the northern part of the compound, in a room, portico, and courtyard complex (C367) (Pecci et al. 2010). Later on, toward the end of the Xolalpan period, there may have been a residential sector for the administrators in the southwestern quadrant, adjacent to the mural rooms. Here we also uncovered room-portico-patio groups with very wellconstructed walls painted red.

44 · Linda R. Manzanilla

Kitchens and Storerooms A row of kitchens and storerooms was located on the northern periphery (500s and 600s series rooms), as evidenced by the chemical analyses of stucco floors (Pecci et al. 2010) and the presence of large globular jars containing concentrations of ecofacts suggesting storage or cooking functions (see Manzanilla 2009a, 2012b, 2012c). These were identified during archaeological salvage work that I proposed for the street that separates the church of San Sebastián Xolalpan from Teopancazco. Such a row of kitchens-storerooms is uncommon in Teotihuacan, because normally, in domestic multifamily compounds, each apartment has a household kitchen and storeroom attached to it (Manzanilla 1996, 2009a; Manzanilla, ed. 1993). This alignment of communal kitchens is however a characteristic of neighborhood centers, where a large amount of food (particularly tortillas and perhaps tamales and atole) was needed to feed the workers in the compound. This is a key feature that distinguishes neighborhood centers from apartment compounds. Open Space to the East To the east of the Teopancazco compound is an open area (C244) that may have served multiple purposes: to play ritual ballgames (as Gómez Chávez et al. 2004 suggest), and also to accumulate debris from craft production and food consumption, to dye cloth, to provide campsites for pilgrims or relatives of the compound workers during festivals, to serve as a sort of marketplace for the barter of products and raw materials (tianguis), to gather coprolites for use as fuel or fertilizers, and so forth. The only clear limiting wall at Teopancazco is one separating the compound from this open space. A second limiting wall may have been identified in archaeological salvage excavations to the south of Teopancazco (Ortiz et al. 2012).

Multiethnicity The population consisted of three main ethnicities: the local people, those who came from the Tlaxcala-Hidalgo-Puebla corridor, and those who came from farther away, particularly the coastal plain (Manzanilla 2015). This conclusion is based on a hierarchical cluster analysis of 38 burials (Manzanilla et al. 2012) using trace element analysis (Mejía Appel 2012), stable isotopes (Morales Puente et al. 2012), and 87Sr/86Sr isotopes (Schaaf et al. 2012) to determine paleodiet and ethnic origin. Burials belonging to

Teopancazco: A Multiethnic Neighborhood Center in the Metropolis of Teotihuacan · 45

each of these groups are located in separate sectors of the compound, but all three are present in the northeastern part. Interestingly, DNA analysis reveals four haplogroups (A, B, C, and D) in the compound (see chapter 7). Thus, Teopancazco was multiethnic from the Tlamimilolpa period on through the fall of Teotihuacan. This multiethnic neighborhood differs from the mono-ethnic neighborhoods on the periphery in that members of the local Teotihuacan intermediate elite are present in it. Perhaps these elites headed a “house” society in which people from different origins were integrated through ritual, emblems and other symbols, attire, feasting, craftwork identifying this house, and trade in sumptuary goods. The individuals buried in the garment-makers workshop area are male migrants from the corridor and are accompanied by the tools of their trade (needles and pins; Manzanilla et al. 2011; Schaaf et al. 2012). It is well known that Teotihuacan was a multiethnic city. Apart from multiethnic neighborhood centers such as Teopancazco and La Ventilla, there are three ethnic enclaves on the periphery of the city: Tlailotlacan, or the Oaxaca Barrio, to the southwest (Spence 1990, 1996); the Michoacán Compound to the west (Gómez Chávez 1998); and the Merchants’ Barrio connected to Veracruz, to the east (Rattray 1988, 1989). The ethnic identity of these enclaves is evident in distinct funerary practices unlike those of the Teotihuacanos (urns, body positions, type of tomb or burial, use of stelae, and so on; see Manzanilla and Serrano, eds. 1999). In the Merchants’ Barrio we even see a different type of domestic construction. We have proposed that ethnic identity may be distinguished archaeologically through culinary practices; clothing and personal decoration (pendants, necklaces, earrings, insignia); body and face paint; and domestic and funerary rituals and practices. All these cultural markers are correlated with data from 87Sr/86Sr and stable isotopes, ancient DNA, trace elements of human remains, and burial offerings to reconstruct ethnic identity (Manzanilla 2007c). Beyond the neighborhoods, the city may have been divided into four quarters mirroring the tetra-partite division of the Mesoamerican cosmos (Manzanilla 1997), and the co-rulers might have come from these districts (Manzanilla 2008a, 2009a). Paulinyi (1981) suggested there were five to seven residential districts in the city, the most important of which stood to the west of the Great Compound (which is located to the west of the Ciudadela). I propose instead four districts following the two main axes of the city—the Street of the Dead and the East-West Avenue. Several elements also evoke the four-petaled flower (perhaps the emblem-glyph of

46 · Linda R. Manzanilla

the city, as López Austin 1989 suggests). There is a tunnel under the Pyramid of the Sun that ends in a hollow with four small chambers; the main plaza of the Xalla palace compound (located north of the Pyramid of the Sun) has four equivalent structures positioned in the cardinal directions (Manzanilla 2008a); and a famous vessel found by Sigvald Linné (1942) near Calpulalpan depicts four elite figures, each with a different emblem (a three-tasseled headdress, a serpent, a bird of prey, and a coyote). On this evidence I propose Teotihuacan was governed by a council of four co-rulers (see Figure 1.3; also Manzanilla 2001a, 2001b, 2002a, 2002c, 2008a, 2009a).

Long-Distance Exchange: The Teotihuacan-Nautla Corridor As previously described, at Teopancazco we located substantial quantities of raw materials and goods from other regions of Mesoamerica, particularly the Gulf Coast. These included roughly 14 varieties of lagoon fish that probably arrived smoked or salted (Rodríguez Galicia 2010; Rodríguez Galicia and Valadez Azúa 2013a), crabs, crocodiles, a coastal heron, cotton cloth, and marine shells (not only from the Gulf Coast, but also from the Caribbean and the Pacific). Adrián Velázquez and his team have identified an exceptional number and variety of marine shells at Teopancazco, the largest variety found in any compound at Teotihuacan. They reported 32 families of gastropods and 13 bivalves; 28 species came from the Pacific, 30 from the Gulf Coast, and 4 from the Caribbean (Velázquez Castro et al. 2012). We have also found a large variety of lapidary raw materials and objects (Melgar Tísoc et al. 2012), particularly greenstone and travertine; pigments and cosmetics (Doménech Carbó et al. 2012; Martínez García et al. 2012; Vázquez de Ágredos Pascual et al. 2012); volcanic glass from Altotonga, Veracruz (Barca et al. 2013), and even foreign wares, such as Thin Orange ware from south-central Puebla, Granular ware from GuerreroMorelos, Gray wares from Oaxaca, Orange Lacquer from the Gulf Coast, and pottery from the Ocotelulco region in Tlaxcala (Aguayo Ortiz 2012; Manzanilla 2011b). Ángel García Cook (1981) proposed the existence of corridors of Teotihuacan-allied sites in Tlaxcala and Puebla. Stemming from this original proposition, other scholars have done additional research to elucidate these corridors (Carballo and Pluckhan 2007; Manzanilla 2011b). One can easily imagine caravans heading from neighborhood centers such as Teopancazco toward regions where sumptuary raw materials and goods were sourced, stopping at sites such as Calpulalpan or Xalasco, near Huamantla

Teopancazco: A Multiethnic Neighborhood Center in the Metropolis of Teotihuacan · 47

in Tlaxcala (Manzanilla and Bautista 2009). At Xalasco structures constructed with slabs and large pieces of volcanic glass xalnenes have been found, sometimes with feline imagery; this seems to have been a multiethnic site where the caravans stopped on their way to Nautla. During a 2008 excavation at Xalasco, we found the same pottery roundel token system already described for Teopancazco. Of 203 pottery roundels found at Xalasco, only 11.33 percent were whole; 16.25 percent were half rounds, and quarter rounds predominated at 47.29 percent. By comparison, of the 530 roundels found at Teopancazco, 81.88 percent were complete and only 12.21 percent were halves (Manzanilla 2011b). Perhaps this pattern implies that the local people of Xalasco are represented by quarter roundels and their counterparts at Teopancazco by complete roundels, respectively. Half roundels were found in the garment-makers workshop at Teopancazco, perhaps suggesting the garment makers originated elsewhere in the corridor of allied sites. Another route that headed to central-southern Puebla (sites such as Ixcaquixtla) may have connected to the corridor of allied sites, such as Xalasco, and thus raw materials and sumptuary goods may have moved through Tlaxcala and Puebla to the Gulf Coast or back to Teotihuacan. Thin Orange ware, travertine, onyx, perhaps some greenstone, and other raw materials and goods came to Teotihuacan from the Ixcaquixtla region (Manzanilla 2011b). Given that Xalasco is directly north of Ixcaquixtla, it may have functioned as a multiethnic trading post for caravans bound for Veracruz. Granular ware, greenstone, and maybe some slate (López Juárez et al. 2012) may have been sourced from Guerrero; jarosite, galena, and cinnabar may have come from the Taxco region, where these pigments are found together with specular red hematite (Doménech Carbó et al. 2012; Salas 1980; Vázquez de Ágredos Pascual et al. 2012). At Teopancazco, cinnabar is present in pottery paint (Martínez García et al. 2012), in miniatures containing cosmetics that accompanied important burials (Doménech Carbó et al. 2012; Vázquez de Ágredos Pascual et al. 2012), and on top of many of the decapitated individuals buried in the transitional (Tlamimilolpa–Xolalpan) termination ritual of ca. AD 350 (Manzanilla 2009a, 2012c). Pigment tablets of the same size as the majority of the pottery roundels also reached Teopancazco from unknown areas (Manzanilla 2011b; Vázquez de Ágredos Pascual et al. 2012). Many of the Pacific shells may have come from Guerrero. We still do not know if these various goods came directly to the neighborhood center or through other compounds in the city, or even via

48 · Linda R. Manzanilla

allied sites such as Xalasco that connected to other routes in the GuerreroMorelos-Puebla region. The interdisciplinary perspective with which our project was developed, enriched by the integration of data from diverse disciplines (Manzanilla, ed. 2012), was fruitful for understanding how a multiethnic neighborhood center such as Teopancazco functioned, and its role as a place where foreign goods were provisioned for the elite. In this book, we focus on the population buried in the compound, drawing on numerous contributions from archaeology, physical anthropology, trace element analysis, isotopic studies, DNA, and forensics.

2 Funerary Patterns, Sex and Age Profiles, Paleopathology, and Activity Markers of the People in Teopancazco Luis Adrián Alvarado and Linda R. Manzanilla

Different types of buildings in Teotihuacan may offer new insights into paleo-demographic profiles and burial patterns (see Manzanilla and Serrano, eds. 1999). Apartment compounds give us an idea of burials in domestic contexts. In Oztoyahualco 15B:N6W3, for example, we find a balance of male and female adults and a large proportion of perinatal babies (Civera 1993; see Manzanilla, ed. 1993). In other compounds that, like Teopancazco, may have been neighborhood centers we find a clear predominance of male adults, while the proportion of male to female infants is equal (see chapter 8; Manzanilla 2009a, 2012c; Manzanilla, ed. 2012). In large palace complexes there seem to be fairly few burials, perhaps because these structures functioned primarily as decision-making and administrative centers, rather than residences; such is the case for Xalla, north of the Pyramid of the Sun (Manzanilla 2008a; Manzanilla and López Luján 2001). Finally, the principal pyramidal structures at Teotihuacan may have been locations of major consecration rituals where sacrificial victims were interred (Sugiyama 2005; Sugiyama and López Luján 2006). It is important to stress here how distinct the pattern of burials is at neighborhood centers such as Teopancazco. Neighborhood centers would appear to have been settings for primarily male activities. This would explain the disparity between numbers of adult males versus females. This chapter introduces the paleo-demographic, paleopathological, and activity marker profiles of the individuals found in the 13 field seasons (1997–2005) of extensive excavations at Teopancazco, Teotihuacan, headed by Linda R. Manzanilla (Manzanilla 2012b, 2015; Manzanilla, ed. 2012).

50 · L. Adrián Alvarado and L. Manzanilla

Funerary Patterns We located 116 formal burials (associated with a total of approximately 129 identified individuals) in different sectors of the neighborhood center, particularly in the northeast (where an early ritual area was located, and where craft activities and medical practices were concentrated) and in the central ritual courtyard (chapter 10; Figures 1.4b and 1.4c; also see Manzanilla 2012b, 2012c, 2015; Manzanilla et al. 2012). Several burial styles were identified: 1. There are formal Teotihuacan-style burials (Manzanilla and Serrano, eds. 1999) belonging to three subtypes: a. Adults and children buried in a flexed or seated position in pits under stucco floors; 8 examples found. b. Perinatal infants (38–40 weeks gestation, following Hill and Choi 2006) placed inside vessels in subfloor pits; 13 examples found. c. Young children placed in altars; 2 children (2–4 years of age) found in a Tlamimilolpa altar. 2. There are exceptional ritual burials that depart from patterns seen elsewhere at Teotihuacan. For example, burial 102, set in the northeastern corner of the ritual courtyard, contained a female migrant whose skull was surrounded by her long bones arranged in a square (see chapters 5 and 6). Another is burial 112, a skull of a migrant individual either buried inside a basket or originally wearing a basketry headdress. These individuals’ status as immigrants was determined with 87/86Sr isotope analysis for burial 102 and with 18/16O isotope analysis for burial 112. 3. In the garment-making workshop there are some individuals buried with bone needles; these subjects, some of which are represented by partial burials, came from the corridor of sites linking Teotihuacan to the Gulf Coast (see chapters 5 and 6). 4. An unusually high total of 38 decapitated individuals were uncovered at Teopancazco. This is an exceptional phenomenon for Teotihuacan because of the large number of individuals involved and the deposition of their skulls inside vessels. In a termination ritual dated ca. AD 350 29 individuals were decapitated and each head was placed in a vessel covered with another vessel. A similar practice was however identified at Cerro de las Mesas in Veracruz. 5. Finally, there are a few multiple burials, found in rooms C247B (burial 24), C145 (burials 28–33), and C161 (burial 74).

Funerary Patterns, Sex and Age Profiles, Paleopathology, and Activity Markers · 51

In general across the different construction phases, 72 burials were flexed or seated in pits; 18 were incomplete skeletons, and 38 were decapitated, 29 of them during a single termination ritual dated to ca. AD 350. Of the decapitated individuals, 7 were sub-adults (12–20 years, 2 of whom were females); 28 were young adults (21–35 years, 3 of whom were females); 2 were middle-aged adults (36–50 years); and only 1 woman was more than 50 years of age (Alvarado Viñas 2013). Among the ritual decapitations at Teopancazco 76 percent of the skulls are male. The majority of individuals are located in two clusters. The first group of 20 individuals was placed in pits under the floor of room 162F; and the second, consisting of 9 individuals, was set on top of a destroyed Tlamimilolpa temple to the east (C261) (see Figure 1.8; also see Manzanilla, ed. 2012); 22 of these are males and 7 are females. Many are migrants (see chapters 5 and 6). Of the 29 decapitated individuals killed during the Tlamimilolpa–Xolalpan transition, 15 are topped with cinnabar (4 females and 11 males), and 13 of them are set inside the large pit designated AA144 (Manzanilla 2012c). As will be discussed below, only 7 of the 29 display cranial deformation: 5 have the erect type and 2 (one elderly male and one young adult male), the oblique type (Alvarado Viñas 2013; Alvarado Viñas and Manzanilla, in press). As stated, 20 decapitated individuals were deposited in pits in room C162F (Figure 1.14): some small pits contained only one or two skulls, whereas 17 adults were placed together in the large pit (AA144), topped by 6 perinatal infants (see Figure 1.16). There are also other isolated decapitated individuals in rooms surrounding C161 and C162F.

Sex and Age Profiles A variety of age ranges are represented at Teopancazco, but two predominate: perinatal infants (22 of the 36 children in the neighborhood center) and young adults (around 20 to 25 years of age). The presence of juveniles is noteworthy for Teotihuacan, as discussed later. According to Storey (2010) the perinatal infants died at or near birth of genetic causes, complications during pregnancy, or problems with the mothers’ health. Besides the 22 neonates, there were other babies buried in Teopancazco: one was a 1.5–2 month-old-infant (burial 101), another was less than a year old (burial 43). We also identified four young children between 2 and 5 years of age (burials 24b, 63, 99, and 100), and four more between 5 and 12 years of age (burials 19b, 87a, 87b, and 114).

52 · L. Adrián Alvarado and L. Manzanilla

With respect to sex, there is a marked disparity between men and women at Teopancazco. Sexed individuals are mainly male, and females represent only 17.82 percent of the overall sample (Alvarado Viñas 2013) and 14.15 percent of the adults. The high incidence of males may be related to the fact that Teopancazco was a neighborhood center, not a residential compound. It is striking to compare the age groups at Teopancazco with those at other neighborhood centers such as La Ventilla B (Serrano and Lagunas 1999), La Ventilla 92–94 (Gómez Chávez and Núñez Hernández 1999), and Tlajinga 33, another neighborhood on the southern periphery of Teotihuacan (Storey and Widmer 1999). Significantly, adolescents and juveniles are present only at Teopancazco, and two of them came from one of the most important burials. What role could these young individuals have played in the life of a neighborhood center such as Teopancazco?

Activity Markers Occupational stress marks resulting from everyday activities can be detected at specific muscle attachment sites, or entheses, where tendons and ligaments attach to the surface of the bone. When an intense tensile force is repeatedly exerted, it generates microtraumas that cause pits or grooves on the insertion site, producing changes in the bone’s internal and external architecture. Luis Adrián Alvarado (2013) has recognized different activity markers in 25 individuals from the sample. Roughness and asymmetry in certain articulations and joints signal vertebral deformations caused by carrying heavy burdens. Patterns of wear on the front teeth are caused by smoothening or softening fibers, cords, or tissues with the teeth. Other patterns result from sewing or weaving for long periods, squatting, or throwing nets or spears. Nevertheless, it is of utmost importance to take into account data from the archaeological context (associated instruments, debris, raw materials, and objects), as well as evidence from the functional sector where the individuals were buried to confirm hypotheses based on activity markers detected in osteological remains. Activity markers caused by smoothening or softening fibers, cords, or tissues with the front teeth were detected in 25 individuals. Four of these were women (burial nos. 2, 47, 65, and 67); and 21 were male (burial nos. 5, 10, 12, 15, 21, 23, 28-33e, 46, 66, 70, 74, 75, 78, 81, 82, 83, 84, 85, 88, 90, and 92) (Figures 2.1–2.3; Alvarado Viñas 2013). Sixteen of these individuals had

Funerary Patterns, Sex and Age Profiles, Paleopathology, and Activity Markers · 53

Left: Figure 2.1. Right maxilla of burial 2 (female) showing tooth wear due to fiber processing (photo by Rafael Reyes). Bottom left: Figure 2.2. Fragment of left maxilla of burial 2 (female), also showing tooth wear due to fiber processing (photo by Rafael Reyes). Bottom right: Figure 2.3. Tooth of burial 78 (male) with wear caused by passing cords or fibers between the teeth (photo by Rafael Reyes).

been decapitated. At Teopancazco, these activity markers may have been connected to producing nets, which were important not only because of the significance of marine fish for the group (Rodríguez Galicia and Valadez Azúa 2013a), but for ideological reasons as well (see the altar with an interwoven net design in the main mural painting [De la Fuente 1996:157, 159]). Seven men (nos. 8, 14, 23, 24a, 54, 78, and 105) and one woman (60), were involved in sewing or painting for long periods, producing evident rugosities on their phalanxes (Figure 2.4; Alvarado Viñas 2013). This offers independent support that two of the main craft activities in this neighborhood

54 · L. Adrián Alvarado and L. Manzanilla

Figure 2.4. The bone rim on the first phalanx of burial 78 (male) is an indication the man did extensive sewing or painting (photo by Rafael Reyes).

center were the production of attire and headdresses for the intermediate elite (see Manzanilla et al. 2011), and the lacquering and painting of pottery (Manzanilla 2000, 2006b; Martínez Yrízar and Manzanilla 2005). Another activity marker is vertebral deformation caused by carrying heavy weights (Figures 2.5 and 2.6); this is observed in 18 individuals: 14 males (nos. 7, 13b, 14, 17, 23, 24a, 48, 70, 73, 78, 89, 90, 105, 116) and 4 females (nos. 2, 60, 98, and 102) (Alvarado Viñas 2013). The heavy importation of foreign goods into Teopancazco has already been noted (Manzanilla 2011b, Figure 2.5. Vertebra of burial 78 showing a bone rim caused by carrying heavy weights (photo by Rafael Reyes).

Funerary Patterns, Sex and Age Profiles, Paleopathology, and Activity Markers · 55

Figure 2.6. Vertebra of burial 78 showing deviation due to carrying burdens on the head (photo by Rafael Reyes).

2015). Of the 18 aforementioned men and women, 16 spent long periods squatting: females nos. 2, 60, 98, 103, and 108; and males nos. 4, 6, 7, 15, 17, 28-33e, 73, 78, 86, 105, and 116), suggesting they might have been involved in craft production as well (Figures 2.7 and 2.8; Alvarado Viñas 2013). Nine individuals (females nos. 2, 60, and 98; males nos. 7, 15, 73, 78, 86, and 105) had activity markers of having thrown nets or spears (Figure 2.9; Alvarado Viñas 2013). This suggests they participated in fishing or hunting,

Above: Figure 2.7. Right fibula of burial 78 with a moderate insertion mark of the extensor muscle of the foot phalanxes, indicating time spent squatting (photo by Rafael Reyes). Left: Figure 2.8. Mark of the large flexor muscle on the left big toe of burial 78 (photo by Rafael Reyes).

56 · L. Adrián Alvarado and L. Manzanilla

Left: Figure 2.9. Distal fragment of the left humerus of burial 2 with insertion in the supracondylar crest, indicating throwing activities (photo by Rafael Reyes). Below: Figure 2.10. Burial 21 showing auditory exostosis due to immersion in cold waters (photo by Rafael Reyes).

important roles given the abundance of marine fish remains found at the site (Rodríguez Galicia and Valadez Azúa 2013a). Three cases of auditory exostosis resulting from diving in cold waters were detected at Teopancazco; namely, burials 21 (Figure 2.10), 71, and 75, representing two males and a female. Many species among the large quantity and diversity of marine shells found at the site could only be obtained by diving, which evidently was the occupation of these individuals.

Funerary Patterns, Sex and Age Profiles, Paleopathology, and Activity Markers · 57

Paleopathologies An analysis of health indicators following Goodman and Martin (2002) was conducted on the human bone remains found in formal burials at Teopancazco. Goodman and Martin propose that a population’s health is determined by cultural systems that provide resources to attenuate or counteract stress factors generated in the local environment. An adequate adaptation to the environment produces a favorable response and equilibrium, whereas health detriments result in death. Some diseases leave traces on the skeleton, as discussed next. In the present collection from Teopancazco, we assessed the presence and frequency of porotic hyperostosis and cribra orbitalia of the skull, and enamel hypoplasia of the teeth, which are linked to stages of nutritional deficiencies. These nutritional stress indicators mark bones during childhood, and the degree to which they may be observed in adulthood depends on the person’s age of death, sex, and other disease conditions. Porotic Hyperostosis Porotic hyperostosis results from one or multiple periods of anemic stress during childhood; common causes are inadequate nourishment, deficiencies in iron assimilation, poor hygiene in food preparation, and deficient assimilation of nutrients due to gastrointestinal infections, continual diarrhea, or metabolic disorders. It is often present in populations for whom maize is a staple, because maize inhibits iron assimilation (Krenzer 2005). Observations of porotic hyperostosis in adult skulls are a sign that these individuals experienced and overcame nutritional stress during childhood (Stuart-Macadam 1991). This pathology is recognized by porosity resembling an orange peel on three cranial bones, as a response to the expansion of the diploe and the consequent slimming of the external layer (Torres et al. 2009:103). Porotic hyperostosis is present in 7 of 38 decapitated individuals (nos. 9, 26, 48, 67, 68, 72, and 76), 10 of 25 adults with activity markers (nos. 2, 18, 25, 28, 28-33e, 28-33f, 36, 60, 78, and 117), and two incomplete sets of remains. Of the 17 formal burials, 5 were infants (Figures 2.11–2.12). We conclude that some 29 percent of the individuals in the neighborhood center experienced nutritional stress during infancy and were able to overcome it.

Left: Figure 2.11. Burial 18 showing signs of hyperostosis (photo by Rafael Reyes). Below: Figure 2.12. Burial 36 showing signs of hyperostosis. This burial dates from the postTeotihuacan Mazapa period (photo by Rafael Reyes).

Funerary Patterns, Sex and Age Profiles, Paleopathology, and Activity Markers · 59

Cribra Orbitalia A nutritional deficiency of iron produces porosities in the roof of the ocular cavity (Cornero and Puche 2002:171); this condition may also be caused by infectious diseases and metabolic disorders. A small degree of nutritional stress in the form of cribra orbitalia was present in five individuals (nos. 43, 46, 60, 74, and 101). One of them is female (no. 60), another (no. 43) is a baby less than 12 months of age with hyperostosis in the frontal, parietal, and temporal bones, suggesting that this infant died of malnutrition. A third is a girl less than five years of age. This pathology may have been present in more cases, but unfortunately the majority of burials were missing the supraorbital roof of the ocular cavity. Enamel Hypoplasias Enamel hypoplasias were present in seven adults (nos. 39, 47, 69, 83, 84a, 88, and 89), two of whom were females (nos. 47 and 69) (Figure 2.13). Enamel hypoplasia results from metabolic stress and nutritional problems that hinder nutrient assimilation, particularly of vitamin D. The first indicator is a horizontal yellowish discoloration on the tooth, followed by the appearance of lines, particularly on the incisors and canines (Ortega Muñoz 2008:138). Such lines were clearly visible in burials 69 and 89.

Figure 2.13. Hypoplasia on the teeth of burial 69 (photo by Rafael Reyes).

60 · L. Adrián Alvarado and L. Manzanilla

Scurvy Five males (decapitated individuals nos. 39, 50, 55, and 75 and burial 15 from the garment-makers workshop) displayed scorbutic disease due to a lack of assimilation of vitamin C and inadequate ingestion of vegetables and fruits. Scurvy manifests skeletally as porosity in the palatine region, in the basal part of the skull, and in the alveolar zone. Table 2.1 separates the Teopancazco burials by groups (rows) and skeletal alterations (columns); the cells represent the number of alterations divided by the number of burials in that group. A high percentage of the decapitated individuals and those with activity markers had paleopathologies. Perhaps this is due to the better skeletal preservation of these individuals, and these traces suggest these individuals overcame stress periods during childhood due to adequate adaptation to the environment, or as StuartMacadam (1991) proposes, to an appropriate immune system response during growth. Other Conditions Minor caries were evident in 61 of the 84 adults and juveniles; 18 more had moderate tooth decay, and 5 had severe dental problems. Citlali Funes Canizález (2008) identified one example of facial paralysis in our sample; it is represented by burial 91.

Bone Fractures, Cut Marks, Impacts, and Thermal Exposure There is extensive information on the use of human bones in Mesoamerica to manufacture instruments, sumptuary goods, and ritual objects (Pérez Roldán 2013; Pérez Roldán et al. 2012). Raw bone material for crafts were obtained during the antemortem phase in human sacrifice; during the perimortem phase in dismemberment and ritual consumption, and during the postmortem disarticulation of the body. At Teopancazco many dispersed human bones display cultural activity, in some cases for the manufacture of bone instruments. Of the formal human burials, however, 6 individuals exhibit cut marks; 4, intentional fractures; 9, impacts; 4, perforations; 5, direct thermal exposure after death, and 7, indirect thermal exposure. The high incidence of decapitated individuals, along with the cultural manipulation of some of these bone remains may indicate the presence of foreign cultural and craft practices in this neighborhood center. Only

Funerary Patterns, Sex and Age Profiles, Paleopathology, and Activity Markers · 61

Table 2.1. Burials with Osteological Alterations Due to Nutritional Deficiencies Group Decapitated With activity markers Infants Total

Porotic Hyperostosis

Cribra Orbitalia

Enamel Hypoplasia

7/38 (18.4%) 10/25 (40.0%) 5/36 (13.8%)

2/38 (5.3%) 1/25 (4.0%) 2/36 (5.5%)

7/38 (18.4%) —

22/99 (22.2%)

5/99 (5.0%)

7/99 (7.0%)

—

Probable Scurvy

Males

Females

Indefinite

4/38 14/38 (10.5%) (36.8%) 1/25 (4.0%) 9/25 (36.0%) 2/36 (5.5%) —

5/38 1/38 (2.6%) (13.1%) 3/25 — (12.0%) — 9/36 (25%)

7/99 (7.0%)

8/99 (8.0%)

23/99 (23.2%)

10/99 (10.1%)

at Cerro de las Mesas, Veracruz, has a similar ritual been detected, where Drucker (1943) reports infant human heads, each in a bell-shaped vessel, aligned under a floor. Recall that around AD 350 at Teopancazco, 20 heads of young adults, each in a bell-shaped vessel topped with another vessel, were set in pits under a floor, and nine other heads interred following a similar ritual procedure were placed in a destroyed temple dating to the end of the Tlamimilolpa period. The rest of the body might have been employed in the manufacture of instruments or used for other purposes (perhaps ritual cannibalism, as suggested in chapter 4). It may have been that after death the body was dehumanized and considered merely a source of raw material (Terrazas 2007a). Following the categories of lesions created by Pijoan and Mansilla (2007), at Teopancazco we find the following traces. Cut Marks A sharp edge is needed to separate flesh from bone and bones from joints or skin. Such cut marks are seen in the clavicle of burial 20, which also presents with indirect thermal exposure and intentional fractures (see Figure 2.14). It seems that this individual may have been skinned and the flesh removed; the fractures and bruises are evidence of the disarticulation of the collarbone from the rest of the body. A rib from burial 23 shows both cut marks and a fracture suggestive of torsion of the bone due to detachment of the osseous surface from the opposite face of the rib (Pijoan and Lizarraga 2004:22); this damage was inflicted in the perimortem stage, when the bone was fresh and somewhat elastic (Figure 2.15). The same effect may be accomplished by boiling the bone to hydrate it.

62 · L. Adrián Alvarado and L. Manzanilla

Figure 2.14. Clavicle of burial 20 with cut marks suggesting removal of the flesh (photo by Rafael Reyes).

Figure 2.15. Rib of burial 23 with cut marks from flesh removal (photo by Rafael Reyes).

Intentional Fractures These are the outcome of using bones for the manufacture of instruments or sumptuary objects. One example is seen in burial 5, where most of the facial portion remains (Figure 2.16). The frontal bone shows signs of postmortem horizontal impacts that created irregular fractures along the bone in order to separate the cranial vault for use as a polisher or similar object.

Funerary Patterns, Sex and Age Profiles, Paleopathology, and Activity Markers · 63

Figure 2.16. Burial 5 with intentional fractures to separate the cranial vault from the frontal bone (photo by Rafael Reyes).

Another example is the right clavicle of burial 10d which displays small cut marks and evidence of having been boiled to soften it and enable shaping into a pointed instrument, probably an awl. Impacts Impacts provide evidence the bone was hit with another object; these appear on the epiphyses of long bones, on vertebrae, and in general, at joints. One example is the jawbone of individual no. 74, which displays several modifications (lesions, fractures, cut marks, and the insertion of another object into the temporomandibular joint to detach the jawbone. Perforations Perforations are holes in a bone created through wear or with a perforating instrument. The skull of burial 79 was perforated in the left frontal and parietal bones and was directly exposed to fire (Figure 2.17). It may have been a trophy. Thermal Exposure Pijoan and colleagues define indirect thermal exposure as when the bone is cooked in a humid environment (boiled or steamed), producing a smooth

64 · L. Adrián Alvarado and L. Manzanilla

Figure 2.17. The skull of burial 79 with deliberate perforations of the bone (photo by Rafael Reyes).

and oily surface with a yellowish or orange color (Pijoan and Lizarraga 2004; Pijoan and Mansilla 2004). In the Teopancazco collection the bones that were subjected to indirect thermal exposure also have cut marks, perforations, intentional fractures, or impacts. All these cases are from incomplete burials. The bones are vertebrae, ribs, the bases of skulls, coxal bones, scapulae, or foot and hand bones, such as the phalanges of individual C251A-B. None of these is normally used as an instrument. Other individuals showed direct thermal exposure as part of a funerary ritual due to their high status. Direct thermal exposure is normally related to funerary bundles. Such is the case for male juvenile no. 105, who was placed in a seated position in front of female juvenile no. 108; the male was seated on top of a dismembered incomplete puppet figurine, and his legs and feet in particular were affected by fire. Another case is burial 4, a male child who was probably destined to become a warrior, based on the warrior figurine and the miniature theater-type censer buried with him; the bones of the left side were thermally altered to a greater degree than those on the right side.

Cranial Deformation and Dental Mutilation As previously described, 38 decapitated individuals were found at Teopancazco. Seven of these individuals had cranial deformations (Alvarado Viñas and Manzanilla, in press). These deformations are the result of various

Funerary Patterns, Sex and Age Profiles, Paleopathology, and Activity Markers · 65

techniques that compress the head between two surfaces during infancy to permanently alter its morphology. As Yépez and Arzápalo (2007) point out, any modification of the body has a symbolic purpose, because it involves physical signs that have a meaning for the group to which the individual belongs. In general there are three types of deformations: oblique tabular, erect tabular, and annular or circular. The first two types result from two small boards being applied to the infant’s head and held in place with strings or occasionally compression bands. In the erect type, the headset is applied in the lambda region; and in the oblique type, it is applied under the lambda, parallel to the frontal plane. The annular form is attained using bands that compress the head, creating an elongated form (see Tiesler 1999:202; 2012:73). Seven individuals at Teopancazco had intentional cranial modifications (nos. 26, 46, 47, 48, 50, 75, and 92). Five of these had the erect tabular type, whereas the other two (males nos. 46 and 92), had different variants of a fronto-occipital oblique tabular type, which is uncommon for Teotihuacan but common for Veracruz (Figures 2.18–2.21). It is possible that this oblique type may be related specifically to high status. Dental mutilation involves abrading the tooth to produce a particular form or to inlay a round inorganic object. Following Javier Romero’s (1974)

Figure 2.18. Lateral view of the skull of burial 46, showing oblique tabular cranial deformation (photo by Rafael Reyes).

Figure 2.19. Dorsal view of the skull of burial 46 (photo by Rafael Reyes).

Figure 2.20. Lateral view of the skull of burial 92, showing tabular oblique cranial deformation (photo by Rafael Reyes).

Funerary Patterns, Sex and Age Profiles, Paleopathology, and Activity Markers · 67

Figure 2.21. Dorsal view of the skull of burial 92 (photo by Rafael Reyes).

classification system, in the Teopancazco collection we found three cases of abrading of type B5 in the central incisors. These were burial 47, a decapitated young female; burial 67, another decapitated female with a T-shaped dental mutilation; and burial 81, a decapitated male subadult, also with a T-shaped mutilation. In Mesoamerica the T-shaped mutilation is related symbolically to the sun god (Figures 2.22–2.23). Burial 23 (an adult male) was the only case with a pyrite disk incrustation with an E1 shape (Figure 2.24). Figure 2.22. Burial 67 with a T-shaped dental mutilation (photo by Rafael Reyes).

68 · L. Adrián Alvarado and L. Manzanilla

Figure 2.23. Burial 81 with a Tshaped dental mutilation (photo by Rafael Reyes).

Figure 2.24. Burial 23 with dental pyrite disk incrustation (photo by Rafael Reyes).

Final Remarks Cult and craft production were the predominant activities at Teopancazco: cult practices occupied the large open ritual courtyard; garment- and headdress-making was performed in the northeastern sector, where many bone implements were used. There are also hints of the preparation of animal hides, the weaving of baskets and nets, the painting and lacquering of pottery, and the manufacture of shell pendants and decorative lapidary objects. The individuals working and interacting in this southern neighborhood center were a mix of locals and immigrants who came from different sites along the corridor leading to the Gulf Coast. Their ties to the ocean are apparent in the attire depicted in the main mural painting from Teopancazco. Nearly 50 percent of the decapitated individuals had nutritional deficiencies; five of the infants had hyperostosis. It appears however that most adults were able to overcome nutritional stress periods experienced during

Funerary Patterns, Sex and Age Profiles, Paleopathology, and Activity Markers · 69

childhood. Perhaps this suggests that the immigrants came to the city with the trade caravans moving along the corridor of Teotihuacan-linked sites to the Gulf Coast in search of work opportunities and daily food provisions, given that neighborhood centers may have provided food rations to the workers (Manzanilla 2011b). The city needed labor and presented itself as a land of opportunity and abundance. Nevertheless, some of these workers appear to have been attached to the neighborhood center as full-time craft workers, who often remained many hours in a squatting position with no exposure to the sun.

3 Dietary and Food Patterns of the Teopancazco Population Gabriela I. Mejía Appel

This chapter summarizes research conducted in collaboration with José Luis Ruvalcaba Sil of the Physics Institute of the National Autonomous University of Mexico (UNAM), who analyzed soil and human bone samples to identify trace elements. The aim of this team effort bringing together two very different disciplines is to shed greater light on the diet of the population of Teopancazco. These data complement information in other chapters of this book to yield a better understanding of how people lived in this neighborhood center of Teotihuacan almost 2,000 years ago. Paleodiet developed as a subfield of archaeology several decades ago and has made considerable strides through refinements in scanning technology and sample preparation. Moreover, the discussion and interpretation of results have been enriched by interdisciplinary endeavors. As T. Douglas Price (personal communication 2013) points out however, a number of factors can have a significant impact on analyses; therefore, special care must be taken in extrapolating from trace element data to the diet of an ancient population. For example, the amounts of minerals in the soil vary based on regional characteristics and the effects of diagenesis. Nevertheless, when such potential distortions are eliminated, paleodiet analyses can lend support to conclusions from other archaeological research. At the same time, joint research ventures and comparative analyses encourage investigators to solve new problems by evaluating results in light of the contributions of other researchers, while also taking advantage of the perspectives and expertise of professionals from different fields. The goal of this particular study was to identify how Teopancazco residents’ or workers’ diets varied based on differences in their social status or ethnic background. Another aim was to determine whether any changes in

Dietary and Food Patterns of the Teopancazco Population · 71

food trends may have occurred during the time this neighborhood center was occupied in the Mesoamerican Classic period (the first six centuries AD).

Paleodietary Analysis A paleodietary analysis of trace elements was conducted on bone samples from 18 individuals of different ages, sexes, social statuses, and chronological contexts who lived or worked at Teopancazco, Teotihuacan, using particle induced X-ray emission (PIXE). Of the 18 subjects, 15 lived between AD 200 and 650, and the remaining three came from Mazapa-phase contexts (AD 850–1000). Two children were also analyzed for purposes of comparing their results with those of the adult population. The bone samples were prepared following procedures described by Lambert and colleagues (1989) and Price and colleagues (1992). The process consisted of washing the samples with tap water and distilled water, mechanical cleaning to remove between 1 and 3 mm from the outermost layer of the compact bone, three quick chemical washes with a 1 N acetic acid solution, and then a 24-hour immersion in the same solution. These steps were designed to prevent contamination from the diagenesis that affects biological remains from the moment they come in contact with the ground matrix (Lambert et al. 1989). Subsequently, the bone was dried in an oven at 110°C and milled in a porcelain mortar to break up large pieces, then in an agate mortar for fine grinding. The perfectly ground bone powder was incinerated in an electric muffle furnace for six hours at a temperature of 725°C, and finally, bone pellets were formed in a mechanical press and irradiated for PIXE analysis. Note that for purposes of this analysis, the typical order of steps in the cleansing process was modified due to the small amount of bone material available, the preservation conditions of the samples, and the need to remove the outer layer and spongy tissue from the bone. Bernardo Rodríguez Galicia suggested it would be more practical to clean the samples before grinding, to avoid loss of material during the distilled water and acetic acid cleansing phases. The samples were analyzed with a Pelletron accelerator in the form of direct radiations into the atmosphere with an external proton beam with incident energy of 3 MeV for five minutes each; detectors captured the characteristic X-rays of silicon and germanium, respectively. The reference materials employed were Portland 18IIa, Montana 2711, Buffalo 2704,

72 · Gabriela I. Mejía Appel

and 1412 Glass; the X-ray intensities were calculated with an AXIL program while the elemental composition was determined with a PIXEINT program. Roberto Rodríguez Suárez suggested obtaining the Ca/P index as a means of confirming the preservation status of the bones, and of verifying that the measurements obtained were not tainted by the effects of diagenesis or the modification in the cleansing technique. A value equal to or close to 2.15 percent is considered a good register of preservation (Burton 2008), whereas 2.5 is a typical value for diagenesis (Rodríguez Suárez 2004). The results revealed that all samples were in the 2.12–2.28 range. Although this finding cannot guarantee there was no addition, substitution, loss, or exchange of substances between the bone and the soil matrix, it does indicate that the likelihood of observing an appropriate biogenic signal is high. The soil associated with the burials was also examined using the PIXE technique in order to assess the possible diagenetic interaction between the matrix and bone. For this analysis, the soil samples were finely ground in an agate mortar and formed into pellets, which were irradiated under the same conditions as the bone pellets. The results showed it was highly unlikely there had been any interaction between the soil matrix and the bones that could significantly affect the analysis. In order to reveal dietary patterns in ancient populations, it is necessary to compare PIXE results with previously established consumption rates. Log (Ba/Sr) rates, which are used to distinguish between marine and terrestrial diets, indicate that there are three different groups in the sample from Teopancazco (Table 3.1). The first one is represented in burials 3, 7, 17, 28, 34, 35, 36, and 73 and displays values between -0.7 and 0. According to Burton and Price (1990; Figure 1), these values indicate a non-desert inland terrestrial diet. The second group (burials 2, 4, 13, and 102) presents values between -1.1 and -0.7, which means that these individuals were consumers of terrestrial dietary components. Finally, the third group (burials 78, 98, 105, 108, and 116) shows values between -1.8 and -1.3, which indicates some consumption of marine dietary resources (Figure 3.1). These results can be compared with Valadez Azúa and colleagues’ (2005) trace element study of archaeological and contemporary fauna samples from the Teotihuacan region. Based on these data, the Teopancazco population consumed a predominantly carnivorous diet similar to that of the coyote, a carnivore that includes some vegetables in its diet. However, two burials diverge from this pattern: 13A and 35; the first is located in the same range as a rabbit, eating a predominantly herbivorous diet, while the

Table 3.1. Burials Sampled for Paleodietary Analysis, with Log (Ba/Sr) Results Burial 2A 3 4 7A 13A 17 28-33A 34 35 36 60 73 78 98 102 105 108 116

Sex Female Female (by DNA) Male (by DNA Male Male Male Male Male Male Male Female Probably male Male Probably female Probably female Male Female Male

Age

Time Period

25–35 7–10 5–7 20–24 25–30 Young adult 20–25 30–35 30–35 35–40 25–35 35–40 30–35 40 35–40 16–20 10–15 20–25

Late Xolalpan–Metepec Late Xolalpan–Metepec Late Xolalpan Metepec(?) Metepec(?) Late Xolalpan Late Xolalpan Mazapa(?) Mazapa(?) Mazapa Tlamimilolpa–Xolalpan transition Tlamimilolpa–Xolalpan transition Tlamimilolpa Xolalpan Xolalpan Tlamimilolpa Tlamimilolpa Tlamimilolpa

Log Ba/Sr -1.087 -0.686 -0.812 -0.636 -0.957 -0.611 -0.195 -0.468 -0.634 -0.377 -0.223 -0.568 -1.682 -1.737 -0.966 -1.692 -1.387 -1.366

Figure 3.1. Log (Ba/Sr) values in the bone samples of Teopancazco (the labels are burial numbers). The group that ate some marine dietary resources is circled.

74 · Gabriela I. Mejía Appel

second correlated with the lynx in having a completely carnivorous diet. Because humans are omnivorous by nature it is virtually impossible to establish a separation between carnivorous and herbivorous diets; however, the Sr/Ca levels provide data about the prevalence of foods with higher mineral contents, be they of animal or vegetable origin. By cross-checking these values against the resources available to the social group, it is possible to tentatively determine which foodstuffs formed an individual’s diet.

Natural Resources and Cultural Decisions about Food Before further discussion, it is important to mention that generally throughout the prehispanic period Teotihuacanos’ diets consisted of a number of plant and animal elements that formed an abundant and varied diet (Bourges Rodríguez 2002:121). Most of the population had access to all the essential nutrients, but these were not necessarily obtained from foods that are common today. The flora of the study area is characterized by desert coppice, oak woodland, and grassland (González et al. 1993), while the fauna was vast. The Basin of Mexico hosted some 540 species of vertebrates in all five classes (fish, amphibians, reptiles, birds, and mammals) (Rodríguez Galicia 2006). A considerable quantity of archaeological remains have been found in food-processing contexts; viewed as a whole they form a useful comparative record of the foods eaten by the Teotihuacan population (Manzanilla 1996). Cultural contexts, such as murals, offer confirmation of important resources (Figure 3.2). Among the autochthonous and allochthonous animal resources consumed were rabbits, hares, white-tailed deer, ducks, doves, quail, dogs, turkeys, different kinds of fish, mollusks, and insects (McClung de Tapia 1987, 1993; Rodríguez Galicia 2006; Valadez Azúa 1993). Plant resources that have been identified are corn, various species of bean, runner bean, squash (Cucurbita sp.), pepper, tomato, purslane, amaranth, chenopods (huauzontle, epazote), Mexican hawthorn, white zapote, plum, avocado, and garambullo cactus. A wider range of possible plant resources whose remains might not have survived in the archaeological record would include, among others, cocoa, peanut, sweet potato, prickly pear, and various species of wild mushroom (González et al. 1993; McClung de Tapia 1987, 1993). Furthermore, a body of archaeological evidence gathered over decades of research conducted at Teotihuacan has revealed a variety of food resources

Dietary and Food Patterns of the Teopancazco Population · 75

Figure 3.2. Plants and animals represented in Teotihuacan murals. Redrawn from illustrations in La pintura mural prehispánica en México. Teotihuacan (De la Fuente 1996).

that its inhabitants could have consumed during the Classic period. The surface survey conducted by Sanders and colleagues (1979) showed that Teotihuacan had a system of terraces and irrigation and drainage canals organized in accordance with the urbanized layout of the city, suggesting an intensive hydraulic technology to support agricultural production capable of feeding large numbers of people. The preceding evidence indicates Teotihuacanos consumed an effective diet, based on a variety of grains, legumes, vegetables, fruits, meat, and fish that could easily have met their nutritional requirements. Different segments of the population could however have imported foreign resources or experienced differential access to food related to their social and cultural characteristics, their ethnicity, their activities, and their position in the complex urban structure of Teotihuacan. Given that trace element analysis suggests inhabitants of Teopancazco in the earliest phase of occupation—the Tlamimilolpa phase (AD 200–350)— may have included seafood in their diet, it was important to determine what proportion of marine fauna remains date to this time versus later phases. Bernardo Rodríguez Galicia’s (2010) research provided a foundation for this assessment, because he identified all the faunal remains in the compound, devoting special attention to the ichthyofauna because such

Figure 3.3. Frequency of ichthyofaunal remains at Teopancazco in different chronological phases. This graph represents only the remains that could be unambiguously dated to a chronological phase.

Dietary and Food Patterns of the Teopancazco Population · 77

Figure 3.4. Examples of ichthyofaunal species identified at Teopancazco.

large amounts of coastal fish have not been found anywhere else in Teotihuacan to date. A count was made by searching for fish bones and quantifying their relative presence or absence according to the date of the room. Figure 3.3 indicates that the quantity of marine animals throughout the site is greater in the Tlamimilolpa than in subsequent phases. We identified 99 individual fish but did not attempt to quantify the types of fish consumed because the family and species could not always be clearly identified. Ichthyofaunal species identified at Teopancazco are shark, herring, sardine, catfish, bobo mullet, charal (a small riverine fish), dace, sea bass, angelfish, grouper, perch, horse mackerel, red snapper, bream, sweetlips, and barracuda (Figure 3.4), along with some species of crab and marsh crocodile (Crocodylus moreletii). Although several of these species can be found on both coasts of Mexico, the presence of species that are characteristic of the Carolinian province of the Atlantic, such as the bobo mullet, horse mackerel, sweetlips, and catfish, as well as marsh crocodile “indicate that the fish are more likely to come from the Gulf of Mexico” (Rodríguez Galicia 2010:189). The only freshwater fish identified was the charal; however, it is not clear these fish were eaten because the remains “show no evidence of having been subjected to any heat source” (Rodríguez Galicia 2010:208). Perhaps they were carried into the compound during periodic river flooding. The evidence of abundant marine resources at this neighborhood center supports the hypothesis of extensive trade relations between Teopancazco and the Gulf Coast of Mexico (see Manzanilla 2011b). A variety of factors—including political, economic, social, or ritual affiliations, not to mention taboos—may influence the decisions of a group of

78 · Gabriela I. Mejía Appel

people to rely entirely on resources from the local environment or to seek foreign products. There are also numerous reasons why individuals choose to eat or not eat certain options within the spectrum of available foodstuffs. These influences prevent societies from becoming static, which is precisely what “spices up” cultural dynamics. Nourishment is a physiological function of everyday life, a biological need to which humans have assigned social and cultural meanings that bind human communities. On many occasions, people make food choices dependent not on nutritional value or ease of procurement, but instead on the symbolic value a particular food has for them and their group. Hence eating habits “are the choices made by individuals or groups of individuals in response to social and cultural pressures to select, consume and use a fraction of the available resources” (Guthe and Mead 1945:3). The reasons underlying selection reside in certain sensory characteristics of given foods, such as color or texture, and in people’s responses after the first ingestion. These encourage the social group to avoid or learn more about the food and appropriate it, affecting subsequent decisions to adopt or dispense with it (Messer 2002). To understand the cultural aspects behind diet it is also necessary to consider the three components of food processing (De Garine and Vargas 1997): 1. Obtaining food. This includes the resources that the environment offers and the way in which food is acquired, by either direct appropriation from systematic production, or trade or exchange. Advances in technology will influence the level of success achieved, as well as the division of labor by sex, age, and specialization in complex societies. 2. Preparing food. Preparation encompasses both food technology that permits food preservation, transportation, or storage, and the kitchen, where ingredients are integrated to produce various dishes. This is also where the symbolism attributed to each group of nutrients is transmitted to members of the group as well as to new generations. Cooking of food was a significant technological breakthrough that improved the characteristics of food by promoting its digestion and increasing its nutritional properties, and as a consequence its benefits to the consumer. 3. Food consumption. This stage is related more to how, when, and

Dietary and Food Patterns of the Teopancazco Population · 79

where a group consumes certain types of food, rather than to the act of eating. Habits play a role: hours of mealtimes, circumstances influencing the type of food prepared, portions, the place each individual occupies at the table, the presentation of food, types of dishes, and so on. In Mesoamerica the basic staple (maize) and primary foods (beans, tomatoes, peppers, and squash) are continuously present across time and monopolize most of the productive activities of the community. However, secondary foods (such as fish) and peripheral foods (those occasionally consumed without becoming part of the daily diet and still poorly recognized by many members of the community) are dynamic and are markers of different nutritional and sensory values (Garine and Vargas 1997). Food processes for Teopancazco’s multiethnic population in particular, and that of Teotihuacan more generally, might have been coordinated by the intermediate elites who served as neighborhood administrators. Their presence and ideological values have been unambiguously identified in several areas of the city through practices including distinctive funerary rituals and offerings. Ethnic identity could have played an equally important role in the way that each group prepared food, the ingredients they used, the clothes they wore, and perhaps even the composition of their households (Manzanilla 2009a; Manzanilla, ed., 2012). Within the city’s political and social organization the neighborhood was an administrative level where ritual exchanges of goods were performed. Wiesheu Forster (1996) also mentions that at the neighborhood level residents share a common relationship with respect to the larger institution— whether based on social status, kinship, occupation, or ethnic affiliations— which the government exploits to enhance centralized organization. Hence the neighborhood is not merely a living space for people who share an activity or origin; it also functions to manage the production units that are contained within it and that must be symbolically incorporated to facilitate production (Baez Pérez 2005), while the benefits of belonging to the neighborhood would extend to all the member groups. The inhabitants of Teopancazco, like their counterparts in other compounds in the city such as the Oaxaca Barrio, had a degree of freedom to establish and maintain new traditions or to preserve their cultural or ethnic heritage, as reflected in their burial customs, construction methods, culinary habits, and other practices.

80 · Gabriela I. Mejía Appel

Rodríguez Galicia (2006, 2010) suggests marine and coastal lagoon resources were used for three purposes: 1. food 2. ceremonies and offerings 3. raw materials for products crafted in the neighborhood center In Teopancazco it appears coastal products were primarily used as raw materials for making costumes, headdresses, and adornments such as buttons or plaques (Manzanilla 2006b, 2006c). Nonetheless, it is important to note that whether they were consumed as food or used only as symbolic entities or in craftwork, the presence of marine animals is indicative of the advances in food transportation and storage technology that Teotihuacan accomplished.

Conclusions The main conclusions of this chapter focus on burials 78, 105, and 108, which belong to the group that showed evidence of a partially marine diet. More data on these burials is available from other studies, such as carbon and nitrogen isotopes for diet (see chapter 4) and strontium isotopic indicators for migration (see chapter 6; Schaaf et al. 2012). With regard to the hypotheses that guided this research, it should be mentioned that the trace element technique revealed little change between food resources consumed at Teopancazco during the Xolalpan versus Metepec phases. During these periods the diet was predominantly based on agricultural elements and the population partook of an omnivorous diet, although the supply of meat increased during the time the garment-making workshop was operating and for a short time thereafter. This pattern of consumption is mainly explained by the need to hunt animals such as deer and domesticate animals such as turkey and canids for meat and the bones used in manufacturing sewing tools. However, as will be discussed in chapter 4, stable isotope analysis has revealed certain differences that cannot be detected through trace element analysis. Still the potential of trace elements as dietary indicators has been clearly demonstrated (see Gilbert et al. 1994). Conversely, in the Tlamimilolpa phase the results show consumption and use of marine and coastal species. From information gathered in other studies, it can be inferred that an individual’s social position in the group and place of origin are not determinative factors for the consumption of

Dietary and Food Patterns of the Teopancazco Population · 81

Figure 3.5. Burial 78, a 30–35-yearold carrier (photo by Linda R. Manzanilla).

seafood. Instead, this access is perhaps related to the individual’s role in the food processing chain. Indeed, burial 78 is a 30–35-year-old male, born in Teotihuacan during the Tlamimilolpa phase (AD 200–350). He was found in the 0.80 m pit AA164 in room 351A, which was located below the garment-making workshop. This was a primary burial in a flexed position (Manzanilla 2012b), lying on his left side, with the skull to the northeast (Figure 3.5). His skeleton displayed tabular erect cephalic modification, hernias in the vertebral bodies, caries in the tooth enamel and dentine, and strongly marked tooth attrition on the right side of the jaw, possibly related to occupational activity (see chapter 2). He was associated with burials 64 and 87, along with archaeological remains such as pottery, lithics, polishers (Manzanilla 2012c), and duck, turkey, rabbit, gopher, and dog bones. He appears to have been a carrier, or tameme (Alvarado Viñas 2013), and for this reason, his body showed activity markers of the enormous effort involved in walking long distances at a steady pace while carrying considerable weight on his back. In contrast, burial 108 represents an adolescent female born during the Tlamimilolpa phase in a region in the Central Highlands of Mexico but not in Teotihuacan (Figure 3.6); she is directly associated with burial 105 as a companion. This burial was found in pit AA227 in Room 181B-261. It was a primary burial in a seated position (Manzanilla 2012b), and she had no evident pathologies, only caries in 13 of her teeth; the related archaeological materials were the same as those in burial 105.

82 · Gabriela I. Mejía Appel

Figure 3.6. Burials 105 and 108, adolescent male and female interred together (photo by Linda R. Manzanilla).

Without a doubt, burial 105 was an important individual, based on the quantity and quality of offerings deposited with the corpse at the time of death. Furthermore, isotopic paleodiet reconstruction yielded unusual values that may place this individual at a higher trophic level than the rest of the burials studied (see chapter 4). He was a young male, possibly a migrant from the Tula region during the Tlamimilolpa phase (see Manzanilla 2012a). It was also a primary burial in a seated position wrapped in a mortuary bundle then exposed to fire (Manzanilla 2012b). He presented advanced caries, dental calculus, an invaginated tooth (dens in dente) in the upper lateral incisor, impaction of the deciduous canines, and charcoal remains associated with the teeth. The offerings found with this young man included lacquered pottery, miniature vessels, pigments, figurines, seals, earspools, and mica roundels (Manzanilla 2012b; Rosales de la Rosa and Manzanilla 2011). Each of the aforementioned individuals occupied a different place in the food processing chain. The man in burial 78 could have been part of the group that carried products from the Gulf Coast to Teotihuacan, an activity related to components 1 and 2 of the chain and that afforded him unrestricted access to certain foods—in fact, he may have been encouraged

Dietary and Food Patterns of the Teopancazco Population · 83

to eat large quantities to maintain his strength during his journeys. On the other hand, burials 105 and 108 could have represented the group who were primary consumers (component 3) of the burdens he carried to Teotihuacan. Moreover, they could have been part of the group that managed trade relations with the Gulf Coast region. They may also have been part of the group that imposed the symbolism related to aquatic resources at this site. In post-Tlamimilolpa periods, there may have been a shift regarding the use of resources brought for the enjoyment of the elite. Coastal resources were perhaps more devoted to what Rodríguez Galicia (2006, 2010) called “ceremonial and offering use.” Making inferences about the ideological aspects of a society that is so distant from the present can be highly risky given the chronological and cultural gaps between the members of that ancient society and modern researchers. This difficulty is compounded when the object of study is difficult to assess solely through the archaeological record due to the formation processes that affect it. However, a rigorous examination of the data, the locations, the contexts, and the results provided by recent nuclear technologies, such as stable isotope analyses, in addition to paleobotanical and paleozoological studies and physical anthropology can provide valuable clues that enable more accurate identification of behavioral patterns in the past.

4 Paleodiet Reconstruction Based on Carbon and Nitrogen Isotopes of Teeth from Burials in Teopancazco Isabel Casar, Pedro Morales, Edith Cienfuegos, Linda R. Manzanilla, and Francisco Otero

One of the classic subjects in anthropology has been the reconstruction of the subsistence patterns of ancient populations. Initially, this reconstruction was carried out using traces found on the surface of occupational floors, such as faunal and botanical macro-remains, pollen and phytoliths, and coprolites. Now, however, quantitative reconstructions of diet and migration patterns are possible using the characteristic isotopic signatures inscribed in animal tissues. In the last three decades important work has been done to model and understand the correlations between the isotopic signatures (from C3 or C4/CAM plants) of the nutrients ingested by humans and animals and the isotopic composition of their tissues after various metabolic biochemical pathways. The precision of ancient diet reconstruction has increased, as has the present research capability to answer questions about the past. As has often been noted, Teotihuacan seems to have been an anomaly in Classic period Mesoamerica (Manzanilla 2007b, 2009a, 2011a), as a huge urban settlement with a corporate organization that at its peak (AD 450) covered more than 20 km² and housed a population of around 114,000 to 150,000 people (Barba Pingarrón and Córdova Frunz 2011; Cowgill 1979, 1997; Millon 1970, 1973, 1992). Multiethnicity is a major attribute associated with Teotihuacan, where a considerable amount of labor was needed for building activities, craft manufacturing, and transportation of sumptuary

Paleodiet Reconstruction Based on Carbon and Nitrogen Isotopes of Teeth · 85

goods (Manzanilla 2015; Manzanilla, ed., 2012). The building of this great metropolis required not only the cooperation of a vast number of people, but also a powerful society with a complex centralized authority and a stable and sufficient food supply. In general, the Classic period population of Teotihuacan may have relied on staples of domesticated corn, beans, squash, tomatoes, and cactus fruits (González et al. 1993; Manzanilla 1996; Manzanilla, ed., 1993; McClung de Tapia 1979). Seeds with a high protein contents (as amaranth), sugar, and beverages fermented from agave were probably also consumed. Archaeozoological studies have been carried out at Teotihuacan (Valadez Azúa 1993; Valadez Azúa and Manzanilla 1988), and recently Linda Manzanilla’s team found bone remains from a variety of animal taxa in different levels and rooms at Teopancazco (Manzanilla et al. 2011; Rodríguez Galicia 2006, 2010). Some of these taxa include domestic dogs and turkeys, rabbits and hares, ducks, aquatic birds, turtles, frogs, and marine and freshwater fish. The ancient Maya in southern Mexico and Belize have been intensively studied using the isotopic signatures of bones and teeth to reconstruct their dietary practices as a function of social and economic organization and stratification (Somerville et al. 2013), as well as to infer health issues linked to their diet. At almost all the excavated sites in Teotihuacan, oxygen isotopic signatures have been used to study migration and mobility patterns (Spence, White, Longstaffe, and Law 2004; White et al. 2007; White, Spence, et al. 2004; White et al. 2002; White, Storey, et al. 2004). In addition, the carbon and nitrogen isotopic signatures of collagen from individuals in the low-status apartment compound of Tlajinga and the ethnic enclave of Tlailotlacan have been analyzed (White, Spence, et al. 2004; White, Storey, et al. 2004). In this chapter we identify the major dietary constituents and trophic levels that could have supported the growing population of the neighborhood center of Teopancazco, located in the southeastern quarter of Teotihuacan, south of the Ciudadela, based on isotopic signatures of the mineralized tissues of the inhabitants (see Manzanilla 2009a, 2012c; Manzanilla et al. 2012; Manzanilla, ed., 2012). An understanding of the diets consumed by individuals from different social classes, age groups, and time periods can provide information about the foodways (procurement, production, distribution, and consumption of food resources) of this neighborhood center. This in turn might contribute to an understanding of the more complex economic, political, and social organization of Teotihuacan. Because bone samples were badly preserved, this analysis focuses on

86 · I. Casar, P. Morales, E. Cienfuegos, L. Manzanilla, and F. Otero

dental remains from 44 burials excavated in different rooms and levels of Teopancazco by Linda R. Manzanilla (see also Morales Puente et al. 2012). Isotopic analysis of the ratio of stable carbon isotopes 13C to 12C (δ13C) and of nitrogen isotopes 15N to 14N (δ15N) were performed on collagen from tooth dentine; and analyses of δ13C and δ18O (the ratio of 18O to 16O isotopes) were performed on enamel bioapatite (Table 4.1). Bone and tooth collagen and enamel bioapatite from a small amount of the archaeological fauna found in Teopancazco were also sampled and analyzed (see Table 4.1). Some δ13C of modern fauna and flora from C3 and C4/CAM plants growing in the region of Teotihuacan are listed in Morales Puente et al. (2012).

Theoretical Background Stable Isotopes The atomic mass difference between the isotopes of a given element affects their behavior, leading to a natural isotope separation. This isotope separation, or change, in the isotopic composition of a sample is very specific to the process that takes place; therefore, it is called an isotopic signature. The changes in isotopic compositions between samples are minute but can be determined with great precision as a relative per mil (‰) difference (δ) between the ratio of heavy to light isotopes in a sample compared to the ratio of the same isotopes in an international standard. Comparing the isotopic composition, or δ, value of two compounds or phases can reveal whether enrichment or depletion of the isotopes occurred, expressed as a fractionation factor of the process or its offset value. Collagen and carbonate in bone and teeth have particular isotopic signatures that give information about three important features: (a) the diet the person ingested (δ13C) (Bender 1971; Boutton et al. 1991; Hedges 2003; Hedges et al. 2006; O’Leary 1988; Smith and Epstein 1971); (b) the trophic level of the diet (δ15N) (DeNiro and Epstein 1981; DeNiro and Schoeninger 1983; Hedges and Reynard 2007; Schoeninger and DeNiro 1984); and (c) the type of water the person drank (δ18O), which can be correlated to geographic origin (Dansgaard 1964; Epstein and Mayeda 1953). In simple terms the paleodiet reconstruction model consists of identifying and evaluating the processes through which a consumer converts ingested isotopic signatures from the food web to isotopic signatures of mineralized tissues, and finding the relationships between the parameters

-7.7

-6.5

-6.3

-5.6

-5.9

-6.0

100

100

105

106

108

116

-8.9

-8.8

-8.5

-9.2

-10.6

-9.5

-8.5

-3. 7

-5.9

-7.0

-5.7

-5.6

-0.8

-4.6

-6.5

-2.9

-3.5

-4.6

39

40

46

50

55

65

67

70

71

72

74A

-7.5

-6.3

-5.7

-9.5

-7.5

-3.6

-8.6

-8.7

-9.9

-8.8

-6.5

-3.4

-2.9

-1.9

-0.3

-3.2

-5.3

-0.7

-1.8

-1.6

-0.7

-1.1

-1.9

-1.6

-2.4

-1.7

-1.3

-1.8

-1.51

-10.2

-9.3

-7.6

-9.3

-11.6

-8.5

-10.0

-8.8

-9.4

-10.4

9.6

9.5

7.0

12.2

9.4

10.9

9.3

9.7

7.0

15.8

δ13CVPDB (‰) δ13CVPDB (‰) Denδ15NAIR (‰) Enamel Bioapatite tine Collagen Dentine Collagen

Tlamimilolpa–Xolalpan Transition (AD 320–370)

-5.6

78

δ18OVPDB (‰) Burial Enamel Bioapatite δ18O*VSMOW c-water scalea Tlamimilolpa (AD 200–350)

3.00

2.90

2.9

3.00

3.30

3.20

3.00

3.00

2.90

3.30

C/N F1

0.86

1.65

2.66

2.64

0.43

3.19

1.45

2.53

1.21

2.66

b

F2

(continued)

-1.80

-1.92

-3.66

-0.64

-2.79

-1.64

-2.55

-2.23

-3.69

1.38

b

Table 4.1. Isotopic Composition of Enamel Bioapatite and Dentine Collagen from the Burials and Archaeological Fauna of Teopancazco

-4.1

-6.7

-1.6

-7.3

-5.6

-4.2

82

86

91

92

106

112

-4.8

-4.4

-5.1

-6.6

-7.3

-7.0

24A

60

73

77

98

102

-6.4

-6.8

-6.0

3

4

5

Late Xolalpan (AD 420–550)

-6.05

15

Early Xolalpan (AD 350–420)

-6.1

75

Burial

-8.9

-9.7

-9.4

-10.0

-10.3

-9.6

-8.0

-7.3

-7.6

-8.98

-7.0

-8.5

-10.3

-4.4

-9.6

-6.9

-9.1

δ18OVPDB (‰) Enamel Bioapatite δ18O*VSMOW c-water scalea

Table 4.1—Continued

-0.4

-0.8

-1.5

-1.9

-1.8

-1.4

-4.9

-2.4

-0.7

-0.6

-3.9

-2.4

-1.2

-4.0

-0.6

-1.8

-0.4

δ13CVPDB (‰) Enamel Bioapatite

-9.1

-7.9

-7.9

-8.3

-8.9

-8.9

-18.0

-7.4

-10.9

-9.4

-7.0

δ13CVPDB (‰) Dentine Collagen

9.6

11.1

9.8

9.5

8.6

10.1

12.0

10.3

19.4

7.0

7.3

δ15NAIR (‰) Dentine Collagen

3.20

2.90

3.00

3.1

2.90

3.30

2.9

3.10

2.90

C/N F1

2.62

3.74

3.20

2.75

2.12

2.58

-3.39

3.97

2.39

1.21

3.71

b

F2

-2.82

-1.55

-2.09

-2.16

-2.86

-2.06

-2.37

-2.06

4.42

-3.69

-4.00

b

-6.0

-7.2

-4.8

-5.3

-6.7

-6.7

-2.6

8

9

10A

14

17

28

28F

-7.8 -5.6

-10.1

-4.9

-2.8

-6.7

-7.3

Puma concolor

Sylvilagus floridanus Lepus sp.

Meleagris gallo pavo

Meleagris gallo pavo

-11.3

-11.6

-9.4

-8.2

-7.6

-8.9

-3.5

-2.2

-7.6

-8.5

-9.4

-0.8

-13.0

-9.0

-19.0

-19.9

-18.8

-7.5

δ¹³CVPDB (‰) δ¹³CVPDB (‰) Enamel Bioapatite Dentine Collagen

-2.6

-6.4

-5.0

-1.1

-1.7

-2.7

-0.7

-0.5

-1.4

2.9

2.90

3.00

3

2.90

2.90

5.4

6.5

2.5

4.4

7.1

10.8

δ15NAIR (‰) Dentine Collagen

11.3

8.9

12.8

10.2

7.9

10.4

2.80

2.90

2.90

2.90

3.10

2.90

C/N

F1

-1.81

1.96

-8.46

-8.84

-7.32

4.41

b

-0.48

-0.82

2.92

3.04

3.27

2.65

F2

-5.95

-4.61

-7.86

-6.09

-2.66

-2.29

b

0.35

-1.79

-0.58

-1.83

-3.57

-1.91

Notes: The upper part of the table contains isotopic data of human remains by time periods and the lower part lists archaeological fauna. a. The ratio of δ18O* water scale data were calculated from the carbonate of the bioapatite (Iacumin et al. 1996), with an 0.8‰ correction for inter-tissue difference. b. Discriminant function values were calculated with δ15NAIR of collagen, δ13CVPDB dentine collagen, and the δ13CVPDB enamel bioapatite; no adjustments were done for modern CO2 (see Froehle et al. 2012).

-10.2

-9.6

-13.1

-10.7

-7.7

Canis familiaris

c-water scale

δ18O*

-7.0

δ18OVPDB (‰) Enamel Bioapatite

-4.2

-5.4

-9.6

-9.6

-8.2

-7.7

-10.1

-9.0

-8.9

Archaeological Fauna: Scientific Name

13A

Metepec (AD 550–650)

-6.0

7

90 · I. Casar, P. Morales, E. Cienfuegos, L. Manzanilla, and F. Otero

of the two signatures. Early models relied on fundamental assumptions concerning the food web, the consumer, and the metabolic processes: 1. a food web with global average values for the isotopic signatures of the endpoints which belong to the (δ13CC3plants and δ13CC4plants); 2. a steady consumer that would yield the same response given the same dietary inputs; and 3. simple metabolic processes that could be modeled by a constant offset value between the consumed diet and the mineralized tissue. After three decades of research and improved analytical techniques, however, small but statistically significant differences (±1‰) have been revealed in every part of the model that was formerly considered constant or nonexistent. These discrepancies are now apparent across and within species due to changes in the underlying food base as a result of environmental factors. In addition, consumers differ in their digestive physiologies and responses to states of disequilibrium (such as illness, slow rate of growth, malnutrition). Finally, there are different fractionation factors across and within disparate mineralized tissues (enamel, dentine or bone). These differences are difficult to detect and evaluate because they are of the same magnitude as the variation between individuals. Nevertheless, in order to accurately model ancient diets from mineralized tissues on a fine scale, it is important to reevaluate past assumptions, calculate potentially small differences, and reappraise the interpretative framework that was used. In this study, we are analyzing the isotopic composition of teeth from individuals with a high consumption of C4 resources. Therefore, it is important to review the assumption that enamel and bone bioapatite are isotopic equivalent tissues for humans, and the variation in the isotopic composition of archaeological maize. Carbon Isotopic Signatures With respect to diet, a major breakthrough was the discovery by DeNiro and Epstein (1978) that animal tissues carried isotopic fingerprints of the diet ingested; that is, “you are what you eat.” Variation in δ13C in the human diet arises mainly from consumption of three types of 13C-rich foods. These variations result from the three photosynthetic pathways that plants use to fix atmospheric CO2, which has a δ13C value of approximately -7 per mil (Bender 1971). Most flowering plants, trees, shrubs, and temperatezone grasses (the group of C3 plants) use the Calvin Benson photosynthetic pathway, which discriminates heavily against the carbon isotope of

Paleodiet Reconstruction Based on Carbon and Nitrogen Isotopes of Teeth · 91

atmospheric CO2, and hence the organic matter that is formed ranges in isotopic composition (δ13C) from -23.5 per mil to -35 per mil. In contrast, savannah grasses, sugarcane, sorghum, millet, amaranth, and maize (C4 plants) use the Hatch Slack photosynthetic pathway, which produces more 13C in the synthetized organic matter, in a δ13C range from -14 per mil to -8.5 per mil. Such plants evolved in hot, dry environments and constitute only 5 percent of known plant species. Finally, epiphytes and xerophytes (Cactaceae and Agavaceae, among others) are referred to as CAM plants because they use Crassulacean Acid Metabolism. This yields δ 13C values within the complete range of C3 and C4 plants. The average isotopic composition of C3, C4, and CAM plants varies across regions owing to environmental factors and even farming techniques. Warinner (2010) measured the average of economically important plants from modern Middle America, finding that for semiarid ecosystems edible cultivated C4 plants had an average δ13C of -10.8 per mil ±1.0; C3 plants had an average δ13C of -27.4 per mil ±2.0; and the δ13C for CAM plants averaged -13.2 per mil ±1.5. We use these values for calculating the relative percentage (%) of nutrients with a C4 isotopic signature, based on interpolation between the isotopic composition of C3 and C4 endpoints (Kellner and Schoeninger 2007; Schwarcz 2000). Because isotopic signatures cannot distinguish maize from other C4 taxa or CAM plants when the three types are intermixed, we will refer to a C4/CAM signature. Moreover, marine protein consumption is difficult to distinguish from C4-derived protein (except when δ15 N or other analytical techniques are also used). Nevertheless, the ingestion of either a (monoisotopic) C4 or C3 diet leaves a distinctively clear isotopic signal in collagen or bioapatite that is easily detected because this produces the highest δ values reported in the literature. These points can be used to calculate the fractionation factors between diet and the mineralized tissues with greater precision. In Table 4.2 we show isotopic values for some individuals who probably ingested a monoisotopic C4 diet. Nitrogen Isotopic Signatures The different pathways through which plants fix atmospheric nitrogen in their organic matter can be classified for leguminous and non-leguminous plants. Leguminous plants have specialized organisms in their roots called bacterium nodules that transfer inorganic atmospheric nitrogen into the amino acids of the plant without any fractionation, whereas non-leguminous plants fix the nitrogen directly from the soil, which has been enriched by the decomposition of organic matter or fertilizers. When herbivores

1.3

-7.3

-7.2

-

UCT 4361g equid tooth

UCT 3678g equid tooth

Notes: a. Ambrose 1986 b. Schoeninger and DeNiro 1982 c. González et al. 2003 d. White, Storey, Spence, and Longstaffe 2004

-0.5

-7

Sample 75f tooth, male 25 years UCT 3670g equid tooth NA

4.9

7

10

NA

13.6

9.1±0.8

10.4±0.2

12.6

12.6±0.8

δ15NAIR Collagen Date

Kalenjin, Kenya, Africa

Kenya, Africa

Kenya, Africa

Geographic Origin

10200 BC

1200 BC

1890 BC

ca. AD 350

AD 1600–1675

AD 350–550

10,755 BP

Maize agriculture and bison meat High maize consumers

Freshwater fish or C4 grassbased protein High maize consumers

High maize- and C4 grassbased meat

Cattle, caprine pastoralism; C4 grain agriculture

Caprine pastoralism, C4 grain agriculture. Highland and montane forest and C4 grasslands

Cattle and caprine pastoralism, C4 grain agriculture? (sorghum and rye). Highland C4 grassland

Dietary Context

Wonderwerk Cave, South Africa

Wonderwerk Cave, South Africa C4 grazers

Teopancazco, Teotihuacan, Mexico Wonderwerk Cave, South Africa C4 grazers.

Pecos Pueblo, N.M.

Tlajinga, Teotihuacan, Mexico

Lake Texcoco, Mexico

2800 BC–AD 1000 Tehuacán Valley, México Homo sapiens

Historic

1300–3100 BC

1300–3300 BP

e. Spielmann et al. 1990 f. This chapter g. Thackeray and Lee-Thorp 1992

-0.7

NA

NA

NA

-7

NA

From V and IIIe

-6.3±0.5, n = 11

Homo sapiensb

NA

-6.7

-6.5±0.3, n = 2

Kalenjina

NA

Sample 49d

-5.8±0.7, n = 10

Elmenteitana

NA

-11.6

-5.7±0.8, n = 10

Savanna pastorala

δ13CVPDB Enamel Bioapatite

Peñón de los Baños IIIc

δ13CVPDB Bone Collagen

Sample ID or Population

Table 4.2. δ13CVPDB Collagen in Samples from Individuals with a Probable Monoisotopic C4 Diet

Paleodiet Reconstruction Based on Carbon and Nitrogen Isotopes of Teeth · 93

consume plants, part of the nitrogen from the amino acids of the plants is used to form the collagen of their tissues and another part is excreted through urea and feces. Since 14N is excreted preferentially, the nitrogen isotopic compositions of the consumer’s tissues are enriched relative to the δ15N of the consumed plant (3‰ to 5‰). This enrichment, or nitrogen isotopic signature, has been interpreted as correlating to trophic levels and has been used to distinguish between herbivores and carnivores, as well as between marine and terrestrial vertebrates. However, the δ15N of plant and animal tissues can undergo a considerable change not only as a result of environmental factors in plants, but also depending on the quality of food ingested, the salinity of the water, and the digestion and physiological status of the consumer (nutritional stress). Diets poor in protein have less 15N isotopic enrichment than those rich in protein (Sponheimer et al. 2003); tissues of consumers with a slow growth rate are richer in 15N than those of consumers with a normal growth rate (Warinner 2010). Therefore, given that isotopic differences due to trophic level are more variable than is often assumed (Van der Zanden and Rasmussen 2001), it is necessary to carry out local verification of the nitrogen isotopic signatures of the plants and animals consumed when interpreting patterns of trophic enrichment.

Mineralized Tissues Mineralized tissues of human remains (bones and teeth) are composed of an inorganic mineral phase (bioapatite in bones, and enamel and bioapatite in teeth) and an organic phase (collagen in bones and dentine of teeth). Bone and Tooth Characteristics In teeth, enamel and dentine are laid down in incremental layers through deposition of an organic matrix followed by mineralization of the tissue. Once odontoblasts lay down the initial organic matrix of dentine, mineralization follows quickly thereafter in a wavelike pattern of development. Therefore, tooth enamel and tooth dentine (collagen and bioapatite) form only once, growing over a finite interval of time without subsequent modification following maturation and retaining the stable isotope values of their time of formation: first molar (M1), 0–3 years; second molar (M2), 3–8 years; third molar (M3), 8–17 years (Hillson 1986; Rawlings and Driver 2010; Van der Linden 1983; Zaslansky 2008). Al Qahtani and colleagues (2010) report longer formation time if root development (apex closure)

94 · I. Casar, P. Morales, E. Cienfuegos, L. Manzanilla, and F. Otero

is also considered; for example, for M3 the period ranges from 7.5 to 22.5 years. In contrast, the bioapatite of the bone is intertwined in a microfiber structure with collagen (Hedges 2003). The collagen’s function is to provide mechanical resistance to the compression resulting from gravity, mobility, and stress, and to give the necessary rigidity to support the tissues. Both bioapatite and collagen are renewed throughout an animal’s life by a slow and constant incorporation of new bone and reabsorption of the old. Therefore, the isotopic compositions of bone bioapatite and collagen samples represent a lifetime average of the ingested diet (Ambrose and Norr 1993; Krueger and Sullivan 1984), with an average turnover rate of 3 percent per year. The turnover rate of collagen varies for different bone types, increases up to 10 to 30 percent per year with high metabolism during adolescence, and declines with age (Hedges et al. 2007). Enamel bioapatite is less affected by diagenetic alteration than is bone bioapatite, but care must be taken to use M2 and M3 molars when possible, because the interpretation of isotopic patterns on earlier developing dentition is complex. Many processes occurring in childhood and registered in tooth enamel are difficult to disentangle; for example, changes in childhood diet as a result of migration; ontogenetic dietary changes, such as weaning; and even diseases associated with weaning stress during childhood (Wright and Schwarcz 1998). Isotopic Signatures in Mineralized Tissues Stable isotope signatures in human tissues are known to be fundamentally governed not by random synthesis, but by metabolic biochemistry. This metabolic biochemistry is highly complex, as are the multiple isotopic fractionations through which the dietary isotopic signatures are incorporated into the consumer’s tissues. Nevertheless some signatures are partially understood. Diet (whole diet) is a combination of carbohydrates, fats, and proteins, each of which can have a different carbon isotopic signature (C4 or C3) and is ingested in different amounts by a consumer. The total carbon isotopic composition of the diet can be derived by a linear mixing equation (Schwarcz 2000). The carbon isotopic signals imprinted in collagen and bioapatite contain different information about specific aspects of the diet, since they are formed through different metabolic pathways, are associated with different fractionation factors or diet offset values, and can be synthetized from different constituents of the diet.

Paleodiet Reconstruction Based on Carbon and Nitrogen Isotopes of Teeth · 95

In a mature consumer in equilibrium, the amount of carbon atoms entering the body as nutrients, after digestion and combustion in the mitochondria of cells, is equal to the number of carbon atoms being excreted as CO2 (Passey et al. 2005). Therefore, it can be assumed that the carbon isotopic composition of the CO2 is approximately the same as the carbon isotopic composition of the whole ingested diet δ13Cwhole diet. This CO2 dissolves in the blood as bicarbonate (HCO3-) and precipitates and mineralizes as structural carbonate in a biological hydroxyapatite (Ca5 (PO4)3OH) that we call the bioapatite (Pasteris et al. 2008). Assuming the processes occurred in isotopic equilibrium and at a constant temperature, the δ13Cbone bioapatite would represent the weighted average of all the nutrients ingested in the whole diet δ13Cwhole diet with the fractionation factor or offset value associated with the processes involved. From experimental data with small mammals, Ambrose and Norr (1993) and Tieszen and Fagre (1993a) found a good correlation between δ13Cbioapatite and δ13Cwhole diet (r2 = 0.97, P < 0.001, d.f. = 19) through the following equation: δ13Cwhole diet = 1.04* δ13Cbioapatite—9.2 percent

(equation 1)

where * indicates subtraction of 2 per mil from the δ13Cenamel bioapatite in order to match it with the δ13Cbone bioapatite data, as described later. There is still disagreement as to whether this equation and the offset value of -9 per mil between diet and bioapatite is applicable for humans or might be 1 or 2 per mil higher. For collagen, 22.3 percent is composed of essential amino acids, which cannot be synthesized in the body, so their isotopic composition is directly derived from the proteins ingested. The other 77.7 percent of collagen consists of nonessential amino acids (neAA) that can be synthesized through two possible biosynthetic pathways. One is through direct routing from ingested proteins, provided that protein intake is sufficient (20%), and the other is through the metabolic pathway of neAA synthesis in the cells from the general carbon pool (Schwarcz 2000). This means that the isotopic composition of collagen can represent the composition of either the protein ingested (routing) or the general carbon pool (linear mixing model). In experiments where animals were fed a controlled diet containing adequate protein, 60 percent of the collagen atoms were derived from the proteins ingested; and for C3 or C4 monoisotopic diets, the offset value between diet and collagen was calculated as 4.4 per mil (Froehle et al. 2010). In mixed diets where the protein and nonprotein components carry opposite isotopic signatures, however, this offset value can vary considerably, from -2

96 · I. Casar, P. Morales, E. Cienfuegos, L. Manzanilla, and F. Otero

per mil to 12 per mil (Froehle et al. 2010). If we assume that the individual represented by sample 75 from Teopancazco ingested a monoisotopic C4 diet, the δ13C of this collagen (-7‰) can be interpreted as having been metabolized from a diet with δ13C of -11.4 percent.

Paleodiet Reconstruction Models As the preceding illustrates, the available reconstruction models are based on incompletely tested assumptions, such as that data from animals with different metabolic rates can be extrapolated to humans. The models do however allow comparisons within data sets, producing a better understanding of the processes along with data that help to improve the models and open up new lines of inquiry into the study of past human diets. Bivariate Carbon Model Kellner and Schoeninger (2007) have developed a bivariate carbon model to predict the complex imprinting of the isotopic composition of the diet on human tissues. Drawing on the results of experiments on bones of animals fed a controlled diet (Ambrose and Norr 1993; Howland et al. 2003; Jim et al. 2004; Tieszen and Fagre 1993a), they found that the correlation between the carbon isotopic composition of δ13Cbioapatite and δ13Ccollagen may be represented by three regression lines. Each of the corresponding equations represents the characteristic isotopic composition of the protein ingested (C3, C4, or marine); therefore, the protein source and not physiology explains the apparent taxonomic differences between small and large mammals. Dietary protein is the major determinant of δ13Cbone collagen and locations on each regression line indicate the amount of C4 or C3 in the whole diet. Possible diagenesis in bone apatite from archaeological populations may produce deviations from this model. Because the bivariate carbon model was established experimentally using modern carbon isotopic composition, for archaeological samples a simple 1.5 per mil offset has commonly been used to adjust for the depletion of 14C in atmospheric carbon dioxide due to large-scale combustion of C3 trees and fossil fuels (Suess effect). Recent findings however reveal that ancient C3 plants were 4 per mil richer than modern specimens, whereas ancient C4 plants were only 1 per mil richer (p < 0.01, ANOVA) (Warinner 2010). The fact that C3 plants are much more sensitive to environmental changes than are C4 plants lends support to these findings. For consistency with existing reconstruction models, we will use a 1.5 percent offset

Paleodiet Reconstruction Based on Carbon and Nitrogen Isotopes of Teeth · 97

for both types of plants to convert archaeological carbon data to modern carbon data (Marino and McElroy 1991). Multivariate Isotope Model Froehle et al. (2012) developed a multivariate isotope model using three isotopic signatures—δ13Ccollagen, δ13Cbioapatite, and δ15Ncollagen—from archaeological populations with known diets. Through cluster and discriminant analysis they found two linear functions that accounted for 98 percent of the variance and described five dietary clusters with specific dietary characteristics (see F1 and F2 below). F1 = 0.322* δ13Cbone bioapatite + 0.727δ13Cbone collagen + 0.219δ15Nbone collagen + 9.354 (equation 2) F2 = -0.393* δ13Cbone bioapatite + 0.133δ13Cbone collagen + 0.622δ15Nbone collagen—8.703 (equation 3) Function 1 is highly related to the preindustrial carbon isotopic composition of bone, and Function 2, to the nitrogen isotopic composition of bone collagen. Again, * indicates subtraction of 2 per mil from the δ13Cenamel 13 bioapatite in order to match it with the δ Cbone bioapatite data, as described later.

Review of Assumptions In most archaeological studies the isotopic signatures from bone or tooth represent diets ingested during different time periods, but it has been implicitly accepted that they are isotopically equivalent tissues. That is, the offset value between diet and collagen in the bone should be the same as the offset value between diet and collagen in the dentine, and the offset value between diet and bioapatite in the bone should be the same as the offset value between diet and bioapatite in the enamel. Under these assumptions the isotopic data from bone or tooth could be used interchangeably in reconstruction models. Carbon Isotopic Differences between Tooth and Bone Bioapatite Bone and dentine are indeed structurally similar: both have a similar percentage weight for collagen (20%), bioapatite (70%), and structural carbonate (6%) and have the same crystal sizes (20 × 40 nm). Enamel is quite different, however. It lacks collagen (1%), has only 3.5 percent structural

98 · I. Casar, P. Morales, E. Cienfuegos, L. Manzanilla, and F. Otero

carbonate, has larger crystals (130 × 30 nm), and has a 96 percentage weight mineral phase that makes it ceramic-like and brittle (LeGeros 1981; Pasteris et al. 2008; Smith et al. 2005). Bone and tooth enamel are also different isotopically. This has been confirmed in high-maize-consuming populations but results are inconclusive. In Cuello, Belize (Tykot et al. 1996) and Chaux Hiix, Belize (Metcalfe et al. 2009) δ13Cenamel bioapatite has higher average values (2.2‰) than δ13Cbone bioapatite; however in Marco González and San Pedro, Belize, Webb et al. (2014) found that the enamel bioapatite from juveniles was an average of 4.3 per mil richer than δ13Cbone bioapatite and 1.4 per mil richer than δ18Obone bioapatite. In controlled monoisotopic diet experiments with pigs and rats, however, the offset value between diet and enamel bioapatite is always 1 per mil greater than that between diet and bone bioapatite (Howland et al. 2003; Jim et al. 2004; Passey et al. 2007). In modern controlled feeding experiments with pigs Warinner and Tuross (2009) found that, for a given diet, δ13Cenamel bioapatite from encrypted canines was on average 2.3 per mil richer than δ13Cbone bioapatite. In a similar experiment we fed pigs a monoisotopic C4 diet, then analyzed the carbon isotopic composition of third molars. Results showed a constant 2 mil difference between enamel and the structural carbonate of dentine, indicating that the carbonate mineral in dentine and in enamel bioapatite have different fractionation factors (unpublished data). In certain of our analyses we calibrate the carbon isotopic values in Table 4.1 to modern atmospheric CO2 by adding -1.5 per mil to the δ13Cdentine 13 collagen and -1.5 per mil to the δ Cenamel bioapatite; we denote this adjustment with the symbol m. We also subtract 2 per mil from the δ13Cenamel bioapatite in order to compare it with the δ13Cbone bioapatite data, denoting this adjustment by an asterisk (*). Carbon Isotopic Composition of Archaeological Maize In general, the relative proportion of C4 plants in a diet has been used as an indicator for maize consumption, because maize is the C4 staple in Mesoamerica. Therefore it is important to review the intrataxa variations for maize. Table 4.3 shows the range in carbon and nitrogen isotopic composition for maize samples that date from 3500 BC to the present, as reported in the literature. For modern maize the range is from -9.7 per mil to -13 per mil, whereas for archaeological maize from Tehuacán, Puebla, the range is from -8.6 per mil to -11.7 per mil (Long et al. 1989). This variation probably results from genetic variations through natural processes or selective

Table 4.3. Carbon and Nitrogen Isotopic Composition of Archaeological and Modern Maize Location

Maize sample

Archaeological Maize Cueva San Marcos, Cob fragment Tehuacán Cueva Coxcatlán, Cob fragment Tehuacán Cueva Coxcatlán, Cob fragment Tehuacán North America Cob fragment Aztalan culture, Charred corn Mississippi Arica, Chile Bulk corn Toronto, Canada Azapa Valley, Chile Chile Porteous, Canada Xochipala, Guerrero, Mexico Modern Maize Beltsville, MD Pecos Pueblo, NM CIMMYT Mexico, 109 accessions Pioneer Hi Bred, 59 accessions Goodman, 50 accessions Japanese corn Huancalco, Peru Huancalco, Peru Miracle Food Mart, USA Miracle Food Mart, USA Xochimilco, Mexico Mexico

Seed

Dates

δ¹³CVPDB (‰)

δ15NAIR (‰)

3500–3380 BC 2580–2500 BC AD 1400–1460

-8.5 to -10.8

Long et al. 1989

-8.8

Long et al. 1989

-11.7

Long et al. 1989

2600–2000 BC AD 1600

-9 to -10.2

-8.7 to -11.2 -11.3

-9.1 10.5 9.6

AD 700

-9.5 -8.8 -8.8

Carbonized maize

834 BC

-8.9

3.04

Yellow corn Yellow corn

Modern Modern

-11.3 -11.2

6 7

Bulk corn

Modern

-9.8 to -12

Bulk corn

Modern

-10.7 to -11.6

Bulk corn

Modern

-9.7 to -11.2

Average corn Unfertilized maize Maize grain

Modern Diente de mula Diente de mula Modern

-10.4 -13

-1.1 5

-12.1

4.4

Modern

-10.8

2011

-13.25

AZ141T31 Porteous

Maize grain Corn kernel charred at 400°C Maize grain, teozinte (Zea L) Maize grain (Zea mays)

Reference

-10.5

3.03

Wagner 1988 Bender et al. 1981 Tieszen and Fagre 1993b Schwarcz et al. 1985 Macko et al. 1999 Macko et al. 1999 Schwarcz et al. 1985 This volume

Hare et al. 1991 Spielmann et al. 1990 Tieszen and Fagre 1993b Tieszen and Fagre 1993b Tieszen and Fagre 1993b Minagawa 1992 Balasse et al. 2001 Balasse et al. 2001 Schwarcz et al. 1985 Schwarcz et al. 1985 This volume

2010–2012 -11.45 to -11.92 -0.12 to 1.38 This volume

Note: Carbon isotopic composition values for archaeological maize are not adjusted to modern atmospheric CO2.

100 · I. Casar, P. Morales, E. Cienfuegos, L. Manzanilla, and F. Otero

breeding (hand-selecting which seeds to plant). A variation of 3 per mil in the isotopic composition of maize can shift by 21 percent the estimated consumption of C4/CAM plants for an individual. For example, the individual in burial 75 consumed a diet with a δ13C of -11.7 per mil; that finding would be consistent with a diet of 100 percent maize if δ13Cmaize had a value of -11.7 per mil. If the maize had a value of -9 per mil, however, then the protein dietary component could have resulted from a mixture of 80 percent maize, and 20 percent beans or other C3 resources with δ13C of -25 per mil. Therefore, unless maize seeds or carbonized remains are found in the archaeological site, there is no way of knowing the constitution of the maize consumed by an ancient population, or even how mixed the dietary staples were. To complicate matters, not only do CAM plants and marine resources fall within the range of the isotopic values of maize but so do C4 grasses. In a transect survey near the Guila Naquitz rock shelter in the Oaxaca Valley (Central Highlands), Warinner (2010) calculated an average carbon isotopic value of -11.6 per mil (preindustrial) for the C4 grasses growing there; very similar to the composition of preindustrial grasses in central Africa, reported at δ13C of -10.3 per mil (NAD) and -11.3 per mil (NAD + PCK) (Cerling and Harris 1999). Furthermore, C4 grasses and maize found in a black soil horizon with vertic characteristics at Teotihuacan had a δ13C of -18 per mil (8000 BP) and -15.5 per mil (3190 BP); maize pollen and phytoliths were found in the most recent of these samples (Lounejeva Baturina et al. 2006; Sánchez Pérez et al. 2013).

Analytical Methods The preparation and analysis of samples were performed in the Stable Isotopes Mass Spectrometry Laboratory at the Geology Institute at UNAM. The tooth enamel was separated from the dentine using a dental drill, and the mass spectrometry measurements were performed using a Finnigan MAT253 spectrometer. Details of the techniques for purification of bioapatite and collagen are described in the appendix. Preservation of Isotopic Signatures To ensure the preservation of the original isotopic signature, it is important to ensure that no diagenetic alterations occurred in the archaeological remains after burial. These alterations can occur from interchange with exogenous inorganic compounds (water and humic or fulvic acids from soils)

Paleodiet Reconstruction Based on Carbon and Nitrogen Isotopes of Teeth · 101

or with fungus and bacteria. DeNiro (1985) and DeNiro and Weiner (1988) found that the atomic relationship of C to N, as measured by mass spectrometry, was a good measure of the preservation of the original isotopic signature in collagen (C/N ratios ranging from 2.9 to 3.6). (The C/N ratios in our samples are shown in Table 4.1). In addition, if recrystallization has occurred, scholars debate whether measuring the crystallinity index of the inorganic compounds can help evaluate whether the isotopic signatures of bioapatite were altered by the presence of exogenous ions (Lee-Thorp and Sponheimer 2003).

Results In Figure 4.1 we plot the δ13Ccollagen and δ15Ncollagen of the dentine in teeth from Teopancazco against the δ13Ccollagen and δ15Ncollagen of bone from individuals that lived in (a) two other sites of Teotihuacan: the Oaxacan enclave of Tlailotlacan and Tlajinga, a residential complex of low-status local craftsmen (no 15N data available); (b) precolonial Teposcolula, Oaxaca; and (c) reference points from Tehuacán and Peñón de los Baños. The last set of data is included to provide an archaeological framework; it represents ancient individuals in a pre-maize society (Tehuacán, 8500–7000 BP); ancients in a lacustrine ecosystem of the Central Highlands (Peñón de los Baños 10,750 ±75 BP); and an average of δ13Cdentine collagen measures from 11 individuals of Tehuacán, Puebla, living in four periods between 6000 and 500 BP after maize had been domesticated (Farnsworth et al. 1985). The δ13Cdentine collagen of an individual living in ancient Tehuacán approximates the baseline for pre-maize hunter-gatherers who obtained about 50 percent of their dietary protein from animals and insects, in addition to feeding on C4 resources such as grasses, sedges, and grass rhizomes; CAM plants; and probably freshwater fish and invertebrates. The sample from Peñón de los Baños is a woman found on an island in Lake Texcoco (González et al. 2003). Her higher ingestion of lacustrine resources gives her collagen a more positive carbon isotopic composition and a higher δ15N. The isotopic signatures of the collagen from Peñón de los Baños and ancient Tehuacán suggest that the native flora and fauna in the Basin of Mexico and adjacent basins had a high C4/CAM ratio. The isotopic signatures of the post-maize Tehuacanos and Tepozcolulanos show the immense effect that the domestication of maize had on the foodways of Mesoamerica. As maize evolved and adapted to different ecosystems in the Central Highlands, populations from different time periods and cultures adopted it as their dietary staple.

Figure 4.1. δ13Ccollagen versus δ15Ncollagen in dentine of individuals with high C4 isotopic signatures from Teotihuacan, Puebla, and Oaxaca (Peñón de los Baños: González et al., 2003; Tehuacán: Farnsworth et al., 1985; Tlailotlacan: White, Spence, et al. 2004; Tlajinga 33: White, Storey, et al. 2004; Teposcolula: Warinner 2010).

Paleodiet Reconstruction Based on Carbon and Nitrogen Isotopes of Teeth · 103

The isotopic signature of the collagen from all the Tehuacanos suggests that they were not consuming maize directly but were consuming protein from animals that consumed maize (which has a 100 percent C4 signal). Comparing the δ13Cdentine collagen from Tlailotlacan and Tlajinga to the 13 δ Cdentine collagen from Teopancazco, it can be seen that the populations of all three sites in Teotihuacan have similar δ13Ccollagen values (ranging from -9 to -7 per mil). Of the three sites, Tlajinga exhibits the highest average δ13Ccollagen value and the smallest standard deviation (-7.9‰ ± 0.7), followed by Tlailotlacan (-8.3‰ ± 0.9), then Teopancazco (-8.9‰ ± 1.1). However, the wider range of carbon isotopic values in dentine from Teopancazco (burials 17, 28, 28F, 50, 74, 105, 112, and 116) probably represents these individuals’ greater access to marine and nonlocal food resources (which have higher C3 signals) accessible along the trade routes to the Nautla region. Notice that the isotopic composition ranges of dentine collagen from Teposcolula, of bone collagen from Tehuacán, and of bone collagen from Tlailotlacan and Tlajinga all overlap. In addition, the average δ13Cbone collagen of individuals from Tehuacán is very similar to the δ13Cdentine collagen value of burial 75 from Teopancazco. Even though statistically meaningful tests cannot be performed on these data (that is, within ±1 per mil), they do suggest that the offset values between diet and bone collagen versus dentine collagen are similar; therefore, bone and dentine can be directly compared. Deducing Geographic Origins from Overall Diet White and colleagues established the range of δ18O from phosphates in the bioapatite of individuals living in Teotihuacan (from 16‰ to 14‰), given that phosphates are fingerprinted by the rainwater of Teotihuacan with a deviation of 1 per mil (White, Spence, et al. 2004; White, Storey, et al. 2004). In order to compare the δ18O in the carbonates in the enamel bioapatite of our samples with White and colleagues’ results, our enamel carbonate and bone phosphate data were transformed to the oxygen isotopic value of the rainwater in which both precipitated (Iacumin et al. 1996). Further discussion on the validity of the oxygen isotopic data obtained from the bioapatite of Teotihuacanos and on isotopic signatures indicating their geographic origin appears in chapter 5. In Figure 4.2 we show the adjusted values (0.8‰) for the inter-tissue apatite difference of the δ18O*enamel bioapatite and the 2 per mil adjustment for the δ13C*enamel bioapatite of the Teopancazco burials. Along the top of the figure we plot the range of oxygen isotopes in rainwater at

Figure 4.2. Values for δ13C*enamel bioapatite versus δ18O*enamel bioapatite for the Teopancazco burials. Adjustments for inter-tissue bioapatite difference are 0.8 per mil to δ18O*enamel apatite and 2.0 per mil to δ16C*enamel apatite. The limits of local geographic isotopic signature are from δ18OVSMOW bone phosphates from Tlajinga, Teotihuacan (White, Storey, et al. 2004). δ18O values are referred to VSMOV (Iacumin et al. 1996).

Paleodiet Reconstruction Based on Carbon and Nitrogen Isotopes of Teeth · 105

Figure 4.3. δ13Cenamel bioapatite by age for the Teopancazco burials. Enamel bioapatite is adjusted to bone apatite using a 2 per mil conversion factor.

different altitudes, assuming that for every 300 m change in altitude there is roughly a 1 per mil change in the isotopic composition of the rainwater (Morales Puente et al. 2012). The y-axis of the figure shows the carbon isotope values in enamel bioapatite corresponding to a C4 diet. This figure shows that more than 70 percent of the δ13Cenamel bioapatite from the individuals sampled falls within a very small range, from -3 to -5 per mil, implying that their overall diet had a high (~90%) C4/CAM and a very consistent signature; we refer to this range of values for overall diet as representing a “local diet.” The local diet was widespread in the region, since it was consumed by immigrants coming from both higher altitudes (burials 4, 9, 46, 92, 98, 101, and 102) and lower altitudes than Teopancazco (burials 2, 24a, 39, 71, 82). The remaining 10 burials demonstrate a strong correlation between δ13C*enamel bioapatite and δ18O*enamel bioapatite. That is, lower values of δ13C*enamel bioapatite (higher amounts of food resources with a C3 signature) correspond to lower altitudes than Teotihuacan; of the 12 outliers for δ13C*enamel bioapatite 10 can be identified as immigrants coming from geographic locations with altitudes lower than Teotihuacan. In Figure 4.3 we plot the δ13C* in enamel bioapatite, which represents the overall diet consumed by the sampled individuals with adjustments for

106 · I. Casar, P. Morales, E. Cienfuegos, L. Manzanilla, and F. Otero

Figure 4.4. δ18O*enamel bioapatite by age for the Teopancazco burials. Enamel bioapatite is adjusted to bone bioapatite using an 0.8 per mil conversion factor (see chapter 5). The limits of local geographic isotopic signatures for δ18OVSMOW bone phosphates are from Tlajinga, Teotihuacan (White, Storey, et al. 2004) and are converted to VSMOW (Iacumin et al. 1996).

their age. The isotopic uniformity of the local diet is very clear across all age groups, whereas a group of young adult migrants (ages 18–25) show different dietary isotopic values for both carbon and oxygen (the latter detailed in Figure 4.4). Bivariate Carbon Model In this section we detail the local diet of Teopancazco residents using Kellner and colleagues’ (2007) and Froehle and colleagues’ (2012) bivariate and multivariate models. Figure 4.5 plots the modern carbon isotopic composition of dentine collagen and enamel bioapatite (with the enamel bioapatite adjusted by 2 per mil for comparison with bone bioapatite), and draw the C3, C4 and marine protein lines. The individuals who consumed a local diet (see Figure 4.2) cluster in the upper sector above the C4 protein line, giving information about the origin of the protein they ingested. Some individuals (burials 4, 9, 15, 75)

Figure 4.5. Bivariate carbon analysis for the Teopancazco population. C3 and C4 protein lines are reproduced from Kellner and Schoeninger (2007); δ13Cdentine collagen and δ13C*enamel bioapatite values are from Teopancazco burials. The dotted line signifies a 1 per mil variation from C4 protein line; an adjustment of 1.5 per mil was made to dentine collagen and enamel bioapatite to account for fossil fuel burning; a 2 per mil adjustment was made to enamel bioapatite to account for the inter-tissue bioapatite difference. The dashed arrows toward the upper right of the figure show the effect of the proposed 2 per mil adjustment when comparing enamel bioapatite values to bone bioapatite for burial 75 is seen.

Figure 4.6. Bivariate carbon analysis for Teopancazco and modern Maya populations. C3 and C4 protein lines are from Kellner and Schoeninger (2007); δ13Cbone collagen and δ13Cbone apatite are from the following: Lamanai and Pactibun (Coyston et al. 1999); Altun Ha (White et al. 2001); Cuello (Van der Merwe et al. 2000); Chau Hiix (Metcalfe et al. 2009); San Pedro and Marco González (Williams et al. 2009); Petén (Gerry and Krueger 1997); Tehuacán (Farnsworth et al. 1985); Teposcolula (Warinner 2010). Values for δ13C*dentine 13C collagen and δ *enamel apatite from Teopancazco are from the present study. A 2 per mil adjustment to was made to enamel bioapatite to account for the inter-tissue bioapatite difference. All data are adjusted by 1.5 per mil for fossil fuel burning.

Paleodiet Reconstruction Based on Carbon and Nitrogen Isotopes of Teeth · 109

fall very close to the C4 line, indicating they likely consumed virtually 100 percent C4 protein. Another group (burials 3, 14, 71, 102, 108) fall within the 1 percent variation of the C4 protein line; the remaining individuals (burials 5, 7, 17, 50, 77, 98, 105, 106, 108, 116) have mixed protein signatures that are difficult to quantify with precision. Particle-Induced X-ray Emission Spectrometry (PIXE) trace analyses were performed on bone from burials 98, 105, 106, 108, and 116; the resulting values suggested ingestion of marine resources (see chapter 3). The offset in the upper part of Figure 4.5 illustrates the 2‰ adjustment needed to compare enamel bioapatite to bone bioapatite values. Figure 4.6 illustrates the average carbon isotopic composition of bone bioapatite and bone collagen for some modern Maya populations and postmaize individuals from Tehuacán (Farnsworth et al. 1985), compared with the adjusted average carbon isotopic composition of dentine collagen and enamel bioapatite from the populations of Teopancazco (this research) and Teposcolula (Warinner 2010). Note the average carbon isotopic composition of the overall diet for Teopancazco residents (staple maize?) is higher than that of any Maya population graphed; the isotopic signals from the Maya are closer to the C4/marine protein line. This might indicate some consumption of reef fish from the coast, which is clearly the case for San Pedro and Marco González (Williams et al. 2009). Multivariate Carbon and Nitrogen Model Figure 4.7 shows the five dietary clusters with their boundaries and centroids as well as the discriminant functions F1 and F2 (Froehle et al. 2012) from the multivariate model, calculated using δ15Ndentine collagen, δ13Cdentine 13 collagen and adjusted values from δ C*enamel bioapatite from the burials and animal bones listed in Table 4.1. With the exception of burials 24A, 105, and 112, all Teopancazco’s immigrants showed one of the three isotopic signatures corresponding to very heavy maize consumers (cluster 2). Their overall diet had a 70 percent C4 signal and their protein ingestion had a C4 signal higher than 50 percent (30:70; ≥ 50 percent C4) (Froehle et al. 2012). However, 70 percent of the individuals who consumed the local diet fall outside the F1 limit of cluster 2, having carbon values greater than 4. A wide range of nitrogen isotopic composition values correlate to this diet. Assuming δ15Ncollagen can be directly related to trophic levels, the figure shows five trophic levels with δ15Ncollagen averages of 7.4 per mil; 10.2 per mil; 12.8 per mil; 15.8 per mil, and 19.4 per mil. As discussed earlier, however, plants have been reported

Figure 4.7. F1 and F2 discriminant functions for burials and fauna from Teopancazco using discriminant functions F1 and F2 from δ13Cdentine 13 collagen, δ C*enamel bioapatite, 15 and δ Ndentine collagen from Teopancazco. Dietary clusters and functions are from Froehle et al. (2012). Average δ15Ndentine collagen values for the different groups are 4 per mil, 7.37 per mil, 10.21 per mil, 12.75 per mil, 15.81 per mil, and 19.4 per mil.

Paleodiet Reconstruction Based on Carbon and Nitrogen Isotopes of Teeth · 111

to have wide variations due to climate or nutrients, and the same is true of consumers due to their physiology and pathological conditions (Heaton 1986; Katzenberg and Lovell 1999). The unusually high F2 values for samples 105 and 112 need further analysis before any interpretations can be offered, although trace analysis of sample 105 did yield a marine consumption signal. Interestingly, also note that burials 4, 9, 15, and 75—which earlier analysis suggested were consumers of a monoisotopic C4 diet— are clearly distinct in the bivariate model owing to their nitrogen isotopic signatures. Of the outliers, sample 24A can be associated with cluster 5 and a dietary description of 30:70, ≥ 65 percent C3 protein; and samples 112 and 105, which have unusually high nitrogen values, seem to belong to cluster 3. Among the fauna, dogs are omnivores and scavengers that, when associated with humans, eat a human diet and garbage. In Figure 4.7 dogs have a notably high C4 signal, as high as that of humans. Turkeys usually eat seeds, fruits, and insects (Rawlings and Driver 2010; Zaslansky 2008). Note that one of the two bones has a strong C4 signature, implying that this animal was probably domesticated and fed maize, whereas the other had a higher C3 signal, suggesting it lived more in the wild. Rabbits and hares eat a diet of mainly C3 plants, and the hare has a slightly higher trophic level. In contrast, the puma, which is a primary carnivore feeding on herbivores, also has a C3 signature but, as expected, differs in its trophic level (rabbit δ15Ndentine collagen = 2.47‰ whereas puma δ15Ndentine collagen = 7.13‰). Figure 4.8 shows the calculated discriminant functions (F1 and F2) of the multivariate carbon and nitrogen stable isotope model for the Teopancazco burials compared to other high maize-consuming populations of North America along with the population from Marco González, Belize. The carbon isotopic composition values from Teopancazco residents fall within the clusters of F1 values from both San Nicolas Island and Marco González, whose residents ingested a diet with δ13C values higher than -11 per mil due to the unusual δ13C of reef resources: -4 per mil for snapper and -5 per mil for jackfish (Williams et al. 2009). The San Nicolas Island population has the highest F2 values (cluster 3) due to ingestion of grasses (C4) and marine resources. The American Bottom and southern Ontario populations have F1 and F2 values similar to those of Teopancazco’s immigrants, whereas the diet at Cahokia is quite different (cluster 5). It is noteworthy that the individuals who consumed a local Teopancazco diet have very high and uniform C4 signals in both dietary components (indicating a large food web with a C4 signal) but a very wide range of nitrogen isotopic composition. Some have extremely high δ15N, as high

Figure 4.8. F1 and F2 discriminant functions from highmaize-consuming populations in North America and the Central Highlands of Mexico. Discriminant functions F1 and F2 are calculated using δ13Cbone 15 collagen, δ Nbone collagen, and 13 δ Cbone bioapatite from San Nicolas Island and sites in southern Ontario (Harrison and Katzenberg 2003); sites ESLSQ, Florence St., and Range from American Bottom (Hedman et al., 2002); Cahokia (Ambrose et al. 2003); Marco Gonzalez, Belize (Williams et al. 2006). F1 and F2 are calculated using δ13Cdentine collagen, δ15Nbone colla13 gen, and δ C*enamel bioapatite from Teopancazco; dietary clusters and functions are from Froehle et al. (2012).

Paleodiet Reconstruction Based on Carbon and Nitrogen Isotopes of Teeth · 113

as San Nicolas; others have very low nitrogen values, as low as Cahokia; and still others have intermediate values similar to those of the American Bottom and southern Ontario populations, who consumed waterfowl and freshwater fish as the major source of their protein. Time Periods The excavated burials of Teopancazco were dated by archaeomagnetism and 14C radiocarbon (Beramendi Orosco, González, and Soler Arechalde 2012; Beramendi Orosco, González Hernández, et al. 2009; Manzanilla 2009b; Manzanilla, ed., 2012; Soler Arechalde et al. 2006). Five major periods were identified: Miccaotli (AD 100–200); Tlamimilolpa (AD 200–350); Tlamimilolpa-Xolalpan transition (ca. AD 350); Xolalpan (AD 350–550), and Metepec (AD 550–650). Figure 4.9 plots the adjusted averages for δ13C*menamel bioapatite and 13 δ Cmcollagen dentine. It shows that individuals living during the earliest (Tlamimilolpa) period had a δ13C*menamel bioapatite with a high C3 signature due to hunting and to planting or gathering many vegetables high in C3. During the Tlamimilolpa–Xolalpan transition, associated with termination rituals (see Manzanilla 2009a, 2012c) and the incorporation of numerous immigrants, the δ13C*menamel bioapatite increased, implying a greater consumption of C4/CAM resources in the overall diet. During the city’s peak in the Xolalpan period, there is a significant increase in the C4 dietary protein signature, possibly because larger numbers of domesticated animals (dogs, turkey, and rabbits) were being raised or garden hunted in maize fields and were easily available for consumption and trade. There are ethnohistoric references to maize-fed dogs elsewhere in the New World, which have carbon and nitrogen isotopic values in collagen similar to ours (Katzenberg 1989; White and Schwarcz 1989; White et al. 1993). During the Late Xolalpan, the C4 signature for protein and overall diet diminishes (that is, moves in a negative direction) probably as a result of lowered consumption of maize and maize-fed animals; perhaps this is indicative of the onset of societal collapse. The last period, Metepec, is represented by only one burial; the oxygen isotopic signature indicates this individual was not born locally and had a diet with a strong C3 signature, clearly divergent from the C4 maize signal. The average for δ15Ndentine collagen (9.8 per mil) appears virtually constant across all time periods, which implies that the protein intake (proportion of plant to animal foods) did not change; nevertheless, we should bear in mind that sometimes average values mask the richness of individual data.

Figure 4.9. Average isotopic composition of δ13C*enamel bioapatite and δ13Cdentine collagen for the burials of Teopancazco for different time periods. Kellner and Schoeninger (2007) model the average of δ13C*enamel bioapatite and δ13Cdentine collagen for different time periods for the local individuals and for all individuals. All data are adjusted by 1.5 per mil for fossil fuel burning; a 2 per mil adjustment is made to enamel bioapatite for the inter-tissue bioapatite difference.

Paleodiet Reconstruction Based on Carbon and Nitrogen Isotopes of Teeth · 115

Discussion The characteristic features of the Teopancazco diet were obtained using carbon and nitrogen isotopic analysis of the dentine and enamel of residents’ teeth. When analyzed in conjunction with the geographic, economic, and social characteristics of the population, the high C4/CAM isotopic signal for both plant and animal foods seems to come mainly from maize. If the residents’ diet was composed of maize as a staple, along with protein from animals consuming C4 grasses, CAM plants, and maize, this could account for the good nutritional status of these individuals—in contrast to other populations where a diet of pure maize lacking some essential amino acids caused malnutrition (White et al. 2006). The population growth observed in the neighborhood center of Teopancazco—and perhaps the entire metropolis as well, situated at 2,280 m above sea level and 400 km from coastal resources—seems possible given the characteristics of maize agriculture. Maize could be farmed intensively in the Basin of Mexico, producing a surplus that could then be kept in storehouses and distributed to support the city’s growing population. It has been suggested that maize was stored in the tunnels that were originally made to extract the volcanic scoria used for building the 20 k2 of the great city (following Pedro Armillas’s observation of numerous amphorae outside La Gruta Restaurant; see Manzanilla 2012a). Given the corporate organization of the neighborhoods, in which most of the inhabitants had specialized occupations unrelated to agriculture (Manzanilla 2009a, 2012d), maize-fed animals could have been domesticated for later trade through market exchanges, as suggested by Valadez Azúa and Manzanilla (1988). In Teopancazco Manzanilla (2011b) hypothesizes that the multiethnic labor force was provided with tokens or pottery roundels (tejos, 530 of which have been found to date). These tejos may have been exchanged for rations of tortillas and possibly meat in the row of kitchens ringing in the northern part of the neighborhood center (Manzanilla 2011b). In contrast, in Teotihuacan apartment compounds such as Oztoyahualco 15B:N6W3 (Valadez Azúa 1993), as well as in small Maya towns (White and Schwarcz 1989), there is evidence that domesticated animals like dogs and turkeys were raised at the household level. This strategy could not however have supplied the demand in a city like Teotihuacan with an average of 120,000 inhabitants; in Oztoyahualco 15B:N6W3, the breeding of rabbits was also observed (Manzanilla 1996; Somerville et al. 2016). The production of maize and animals fed with maize had to be commensurate to the size of the population and its highly

116 · I. Casar, P. Morales, E. Cienfuegos, L. Manzanilla, and F. Otero

specialized work. The likelihood that animals were domesticated and fed maize is reinforced by the fact that the proportion of protein with a C4 signal increased between the Transitional and Xolalpan periods, implying that the availability of domesticated animals or animals hunted in maize fields grew in tandem with the demands of the population. It is also notable that the isotopic composition of the overall diet of the population was surprisingly uniform (σ ± 0.6‰) considering the enormous trade network that Teotihuacan must as the foremost exchange agent in Mesoamerica have had at that time. This isotopic uniformity of the local diet in both protein and overall diet can be explained by various hypotheses, some of which are (a) as the staple crop of Teotihuacan, maize was available to the entire population; (b) eating maize and maize consumers (dog and turkey meat, turkey eggs) was a good choice economically and in terms of energy efficiency; and/or (c) the secondary food resources (animals and plants) available to the population of Teopancazco, and probably to the whole population of Teotihuacan, were isotopically undistinguishable from maize because they were either consumed in small amounts or had a similar isotopic signature to maize. Using carbon isotopic analysis alone, it is impossible to differentiate between edible C4 grasses, maize crops, cactus, and agaves growing in the Basin of Mexico. Moreover, protein derived from eating birds, reptiles, small mammals, and insects feeding on C4/CAM plants produces very similar isotopic signatures. Still, some CAM plants (cactus, agave) and other C4 foods such as amaranth must have been part of the diet, because they have been recovered from archaeological excavations at Teotihuacan (see Manzanilla 1996; McClung de Tapia 1979). The carbon isotopic composition of modern worms and insects feeding on agaves is also very similar to the protein component of the local diet (Morales Puente et al. 2012). Likewise, the isotopic composition of dietary protein is surprisingly similar among Teopancazco, Tlajinga and Tlailotlacan in Teotihuacan, Teposcolula in Oaxaca, and Tehuacán in Puebla. On the other hand, the diet of Teopancazco is unique in the context of Teotihuacan because Teopancazco’s trade connections with the Nautla region gave its residents access to resources of foreign C3 and marine origin that are preserved in iconography, faunal fossils, and human remains. Unfortunately, no faunal fossils from lacustrine or river ecosystems have been identified, but they must also have been part of the diet. It is difficult to directly compare the results of the paleodietary reconstruction based on trace elements in bones from Teopancazco burials (see

Paleodiet Reconstruction Based on Carbon and Nitrogen Isotopes of Teeth · 117

chapter 3) with the results obtained via stable isotopic analysis, since the two analyses were done on different mineralized tissues: trace elements on the mineral phase of bone and stable isotopes on the organic phase of teeth. There are however correspondences between the seven samples that were analyzed using both techniques: sample 105 had an unusually high 15N signature in stable isotope analysis and also had a log (Ba/Sr) of -1.692, indicating possible consumption of marine resources. Samples 98, 102, 108, and 116, having trace analysis values with log (Ba/Sr) ≤ -1, also fall close to the marine protein line of the bivariate model of Figure 4.5. Surprisingly, all the individuals from these burials have oxygen isotopic signatures indicating they were from Teotihuacan or locations with even higher altitudes. The adjusted tooth analysis in the bivariate and multivariate models support the fact that some Maya and North American populations highly dependent on maize had a diet similar to that of Teopancazco’s immigrants, even though the former were calculated from bone bioapatite and the latter from enamel bioapatite. When the enamel bioapatite values of Teopancazco’s population are adjusted to modern bone bioapatite, the high δ13C enamel apatite values diminish and so does the systematic overestimation of the relative consumption of C4 plants in the diet referred to by Warinner (2010). However, further data sets are required for this adjustment to be statistically meaningful. Moreover, to accurately model ancient diets from mineralized tissues at a fine scale will require (a) precise understanding of multiple isotopic fractionations that accompany the conversion of dietary inputs into bodily tissues; (b) additional and improved analytical techniques to distinguish between similar isotopic signals; and (c) the revision and inclusion of other issues such as the following: 1. The nixtamalization of maize may have produced an 0.9 per mil enrichment in δ13Ccollagen because of increased maize protein bioavailability and digestibility of essential amino acids (Warinner and Tuross 2009). 2. Isotope signatures vary within species of consumers and within mineralized tissues. 3. Some of the individuals studied here might have consumed carbohydrate-rich diets based almost entirely on maize, the isotopic or metabolic consequences of which are incompletely understood.

118 · I. Casar, P. Morales, E. Cienfuegos, L. Manzanilla, and F. Otero

Conclusions One of the most important features of the diet consumed by the sampled population of Teopancazco is that it was highly uniform (σ ±0.6‰), containing extremely high C4/CAM signatures in the overall diet (~90%) and the protein portion (~80%). Such a diet seems to have been consumed by immigrants from geographical locations with higher and lower altitudes than Teopancazco, as well as by very ancient and colonial inhabitants of the Central Highlands. The overall diet was probably dependent on maize as a staple, supplemented with other C4 and CAM resources (agave, cactus, and amaranth). The protein component of the diet came from animals and insects that were fed maize, grasses, or CAM plants (cactus, agave), as well as from some marine and freshwater resources. Immigrants demonstrate lower consumption of dietary protein with a C4/CAM signal, but there was a remarkable, ongoing increase in consumption of C4/CAM dietary proteins from the Tlamimilolpa period through the Transition period and into the early Xolalpan. The 2 per mil adjustment to δ13Cenamel bioapatite values for correlation with δ13Cbone bioapatite enabled us to compare data from the teeth of the inhabitants of Teopancazco with bones of other maize-consuming populations in bivariate and multivariate models. Reevaluating the assumption that bone and tooth bioapatite are not isotopically equivalent for human populations not only increases the precision of modeling ancient diets from mineralized tissues, but also allows for the use of teeth instead of bones for analysis. This has two advantages for ancient populations: teeth have fewer diagenetic alterations than bones and they offer evidence of variations in diet over the life span of an individual (Eerkens et al. 2011). Some of these issues can be resolved by analyzing the isotopic composition of individual amino acids and concentrations of bromine in burials with high and low δ15Ncollagen values.

5 Geographic Origins and Migration Histories of the Teopancazco Population Evidence from Stable Oxygen Isotopes Pedro Morales, Isabel Casar, Edith Cienfuegos, Linda R. Manzanilla, and Francisco Otero

Analyses and discussions of Teotihuacan tend to emphasize its impressive dimensions, not only in the city’s physical footprint, but also in the organization and cooperation of the vast numbers of people required to plan, construct, and maintain it. In fact, it has been suggested that this centrally planned and ordered city came about through a corporative strategy to organize an enormous multiethnic workforce, which was an anomaly in its time (Manzanilla 2006b, 2009a). The city arose around 150 BC and had a population of some 120,000 individuals (Cowgill 1979, 1997; Millon 1970, 1992). For the 600 years of its existence, its economic growth depended on a constant influx and outflow of an immigrant population. Initial archaeological work suggested a high rate of immigration toward Teotihuacan, especially prisoners or victims who were sacrificed and ritually buried in the Pyramids of the Moon and the Feathered Serpent. This view has been confirmed and amplified by further archaeological work and intensive investigation of stable oxygen and strontium isotopes in the human remains of residents in different parts of the city. The most extensively studied sites are two sacrificial locations—the Pyramid of the Feathered Serpent (White et al. 2002) and the Pyramid of the Moon (White et al. 2007)—as well as three living quarters: Tlajinga 33 (White, Storey, et al. 2004); Tlailotlacan (Price et al. 2000; White, Spence, et al. 2004), and the Merchants’ Barrio (Price et al. 2000; Spence, White, Longstaffe, and Law 2004). Strontium isotope ratios in bone and teeth have also been analyzed on individuals buried under the Pyramid of the Moon, in other neighborhoods of the city, and in apartment compounds such as Oztoyahualco

120 · P. Morales, I. Casar, E. Cienfuegos, L. Manzanilla, and F. Otero

15B:N6W3 (see Price et al. 2000) and Teopancazco (Manzanilla et al. 2012; Schaaf et al. 2012). All of these previous studies have revealed evidence of not only local residents but immigrants from diverse regions who arrived in Teotihuacan for a number of possible reasons. Some immigrants might have come to the city as marriage partners to maintain population growth or preserve a distinct ethnic group and its specialized production role within the community; others as labor needed to continue different trades, build the city, or move goods (Manzanilla 2011b). Still others were prisoners of war destined to be sacrificed (see chapter 10). In the present study we analyzed the oxygen isotopic composition of enamel from molars of 44 individuals buried in Teopancazco, most of whom were involved in garment production during the Xolalpan period. The objective was to concentrate the isotopic data from all the sites studied at Teotihuacan in order to compare the oxygen isotopic signatures of the inhabitants of Teopancazco. We also attempted to correlate major concentrations of oxygen isotopes in the bones and teeth of Teotihuacan’s inhabitants throughout the city’s 600-year existence with the isotopic composition of rainwater and well water from several locations in the Central Highlands of Mexico. We also address the difference in oxygen isotopic values for inter-tissue bioapatite.

Theoretical Background Physical, chemical, geological, or biological processes can cause a change or redistribution of the number of atoms of heavy and light isotopes in human tissue. This change, or fractionation factor, is highly specific to the process that produced it, so we can say that the process imprints an isotopic fingerprint, or signature, on the material. Consequently, measuring the isotopic signature in a sample reveals much about the process that produced it. Specifically, the oxygen isotopic signature in an individual’s bones and teeth reflects the isotopic signature of the water that the person drank, which in turn reflects the physical and climatic environments of the geographic location where the water was precipitated as rain. We first briefly review how the oxygen isotopic signatures of meteoric water consumed by an individual are converted, through metabolic processes, to the oxygen isotopic signature in mineralized tissues; specifically, teeth and bones. Secondly, we discuss how the oxygen isotopic signature of

Geographic Origins and Migration Histories of the Teopancazco Population · 121

meteoric water correlates with geographic locations. Finally, we make a few comments on the integrity of the isotopic signature. Mineralized Tissues There are three apatite mineralized tissues—bone, dentine, and enamel— which contain a mixture of organic compounds (collagen), inorganic compounds (bioapatite), and water. The inorganic compounds provide the mechanical rigidity and load-bearing strength of the bone, while the organic matrix provides elasticity and flexibility. The mineral component of bones and teeth is a biologically produced analog of hydroxyapatite Ca5(PO4)3OH, commonly known as bioapatite. Bioapatite has a large range of possible compositions and interdependent substitutions. Skinner (2005) has represented the range of bioapatite chemistry, writing the hydroxyapatite formula as (Ca, Na, Mg, K, Sr, Pb, . . . )10 (PO4, CO3, SO4, . . . )6 (OH, F, Cl, CO3)2. For our purposes the oxygen isotopic signal of the bioapatite belongs to either of its two crystalline structures: the carbonate (trigonal planar CO32), which fits into two structural sites of the hydroxyapatite (Pasteris et al. 2008), or to the phosphates PO4. The enamel in tooth mineralizes only during tooth formation from five months in utero to approximately 20 years of age (Al Qahtani et al. 2010; Van der Linden 1983; Zaslansky 2008), and each tooth mineralizes in a specific period of that sequence. Therefore, environmental water consumed during tooth formation produces permanent isotopic signatures. Children who move to new localities carry in their teeth permanent isotopic signatures of the environments where they grew up. Several paleo-environmental studies in a variety of mammals have demonstrated the potential for enamel to preserve environmentally based shifts or climatic changes in the δ18Oenamel apatite owing to seasonality in precipitation, temperature, and humidity (Bocherens et al. 1999; Longinelli 1984; Sullivan and Kruger 1981). This effect is obscured when whole enamel samples are homogenized in the preparation process, and attempts at laser analysis of micro samples of children’s teeth have not been successful (Wright 2012b). However, new techniques that involve cutting the teeth in several layers have successfully isolated the isotopic signatures from different moments during an individual’s life span, allowing migration to be registered (Eerkens et al. 2011). Unlike enamel, bone undergoes constant remodeling during the life span to help it adapt to changing biomechanical forces. To help preserve bone strength old, micro-damaged bone is removed and replaced with new,

122 · P. Morales, I. Casar, E. Cienfuegos, L. Manzanilla, and F. Otero

mechanically stronger bone. Therefore, δ18O in bone resets to reflect new environmental conditions and can be found in various stages of re-equilibration to the currently ingested meteoric water. The degree of equilibration in the bone will depend on the individual’s age of migration and age of death, the type of bone, and of course, the turnover rate of bone tissue, which varies by metabolic rate (Hedges et al. 2007). Metabolic Processes The metabolic processes through which phosphates and carbonates are biomineralized in bones and teeth are not fully understood. It seems that under certain conditions bone and tooth minerals are deposited in gaps, or “hole” zones, between the ends of collagen fibrils and become sufficiently concentrated that bioapatite precipitates as crystals. During the mineralization process, the phosphates and structural carbonate in the hydroxyapatite of enamel, dentine, and bone incorporate the δ18O isotopic signature of water in the body (Luz et al. 1984). In mammals the precipitation of both phosphates and carbonates occurs in equilibrium with body fluids at a constant temperature (37°C); thus, the carbonates and phosphates are cogenetic, even though each has a different offset value related to its fractionation factor. In order to compare the phosphate bioapatite data White and colleagues report in various publications with the carbonate bioapatite data we generated, we correlate the oxygen isotopic compositions of bioapatite and rainwater, which were in equilibrium prior to mineralization, using the equations derived by Iacumin and others (1996): δ18Ow = 1.002*δ18Ocarbonate 33.69

r2 = 0.977

(equation 1)

δ18Ow = 0.9355*δ18Ophosphate 23.44

r2 = 0.998

(equation 2)

The δ18Ow values of the phosphate samples from Teotihuacan residents appear in Manzanilla (ed. 2012; see also Morales Puente et al. 2012). Differences in individual metabolic processes resulting from different metabolic rates, species size, and transport of oxygen-containing fluid in the forms of perspiration, breath vapor, urine, and feces have a small effect on the δ18O oxygen isotopic signature of the water ingested. This effect is however small: intra-population variability in δ18O of human populations has been reported as ±1 per mil (Longinelli 1984). On the other hand, evaporative enrichment during breastfeeding has been shown to alter the oxygen isotopic signature.

Geographic Origins and Migration Histories of the Teopancazco Population · 123

Weaning Effect While children are breastfed, their main source of water is their mother’s milk, which is enriched not only in 15N by a trophic level effect but also in 18O; breastfeeding children therefore have higher δ18O values than do adults or children who are fully weaned (Wright and Schwarz 1998) but drink the same meteoric water. Thus, in order to ensure that enamel created pre-weaning does not bias the δ18O data, White, Spence, et al. (2004) corrected the oxygen phosphate values of teeth from the Teotihuacan sites they analyzed as follows. They lowered the values in canines and first molars by 0.7 per mil, since these teeth are formed prior to weaning, before three or four years of age. Premolars, which contain both pre- and post-weaning enamel, were adjusted downward by 0.35 per mil; and second and third molars, which form mainly after completion of weaning, were not adjusted. Oxygen Isotopic Fractionation of Bone and Enamel Because the oxygen isotopic signals of bone and teeth represent meteoric water imbibed during different periods of an individual’s life, they have been used extensively to determine individual migration and even migration patterns. Most migration studies reported in the literature have assumed that tooth and bone are equivalent tissues; in other words, given a certain oxygen isotopic signature in the water an organism consumes, bone bioapatite and tooth enamel would have the same oxygen isotopic signature. Therefore, differences between bone and enamel would provide evidence of migration. However, Warinner and Tuross (2009) demonstrated empirically that for a given diet (food and water), the oxygen isotopic composition of the carbonate from enamel bioapatite δ18Oenamel bioapatite of encrypted canines was an average of 1.7 per mil more enriched than δ18Obone bioapatite. These enrichments are not dependent on the water ingested, so they probably result from differences in the formation and maturation of carbonate mineral in bone versus enamel bioapatite (LeGeros 1981, 2002; Smith et al. 2005), yielding different fractionation factors. These different fractionation factors may be the result of structural differences. Structurally, bone and dentine have similar weight percentages for collagen (20%) and bioapatite (70%), percentage of structural carbonate, and crystal sizes (20 × 40 nm). Enamel is quite different however in that it lacks collagen (1%), has larger crystals of 130 × 30 nm, has a 96 weight percentage mineral phase that makes it ceramic-like and brittle (Pasteris et al. 2008); and contains only 3.5 percent structural carbonate.

124 · P. Morales, I. Casar, E. Cienfuegos, L. Manzanilla, and F. Otero

France and Owsley (2013) recently obtained an extensive data set of tooth and bone isotopic analyses from eighteenth- and nineteenth-century remains of people who consumed a terrestrial omnivorous diet in South Africa. Their results provided linear regression relationships between δ18Ostructural carbonate and δ18Ophosphate from bone, dentine, and enamel, as follows: δ18Ostructural carbonate = .51*δ18Ophosphate + 15.9 r2 = 0.35 for bone (equation 3) δ18O structural carbonate = .63*δ18Ophosphate + 14.9 r2 = 0.65 for enamel (equation 4) In equations 3 and 4 if δ18Ophosphate has a value of 14 per mil, δ18Ostructural carbonate values of 23.04 per mil will be obtained for bone and 23.72 per mil for enamel: a 0.7 per mil difference. Similarly Webb and others (2014) reported a small difference of 1.4 per mil between δ18O in carbonate bioapatite from bone versus enamel. Composition of Meteoric Water by Geographic Location On global and simplified scales, the evaporation and condensation processes in the hydrologic cycle imprint isotopic signals on the hydrogen and oxygen in the water. Ocean water is the starting point of the water cycle; all oceans have a constant isotopic value of δ2H and δ18O, which by convention establish reference points of 0. As water evaporates from the ocean, condenses, and moves inland, its isotopic composition changes. This change can be correlated with temperature, distance from the ocean, altitude, and latitude at which the processes occur. As water vapor moves from the equator toward the poles (latitude effect), the oxygen isotopic signature decreases to a minimum of 55 per mil in the Antarctic (Dansgaard 1964). With regard to the isotopic composition of water that falls as rain in the Central Highlands of Mexico, Fernández Eguiarte and colleagues (2014) have analyzed the movement of winds and clouds during June, July, and August, the rainy season in Mexico and Central America. These weather patterns bring water mainly from the equatorial and middle latitudes of the Atlantic Ocean and, to a lesser extent, from the equatorial Pacific (see Figure 5.1). It is worth noting that the principal air and water flows from both oceans reach Mexico at the same latitude, and their trajectories have similar lengths. This produces a highly uniform isotopic signal of δ2H = -9.5 per

Figure 5.1. Map of the surface wind climatology on the Pacific and Atlantic Oceans, as well as the Gulf of Mexico, for August, the height of the rainy season in Mexico. The arrows mark the prevailing wind direction, and their length indicates the wind intensity. Wind direction and strength were calculated from the integrated intensity values of the winds and rainfall amounts shown in this chart and were developed using historical data for 1999–2006. The bar at the bottom of the figure shows rainfall in millimeters per year (Fernández Eguiarte et al. 2014).

126 · P. Morales, I. Casar, E. Cienfuegos, L. Manzanilla, and F. Otero

mil and δ18O = -3 per mil in the water vapor entering Mexico from both shores. From December to March the prevailing winds carry water vapor mainly to South America, and Mexico experiences a dry season (Figure 5.2). In addition, water vapor moves to the Sierra Madre Oriental from the Gulf of Mexico or the Sierra Madre Occidental from the Pacific side; from either direction there is a very steep altitude gradient to the Central Highlands of Mexico—from sea level to 5,700 m in less than 100 km. Consequently, the meteoric water that falls on the Central Highlands has an extremely uniform oxygen isotopic signature. As the water vapor moves inland, the effect of altitude modifies its isotopic composition. This results mainly from a combination of two factors: first, the water vapor is progressively depleted isotopically as heavy isotopes precipitate out in successive rainfalls; and second, as the altitude increases the temperature lowers and thus the fractionation factor between water and vapor increases, and meteoric water is also progressively depleted (Rozanski et al. 1996). The Central Highlands of Mexico, where Teotihuacan is located, is a vast naturally enclosed high plain between two lofty mountain ranges, and the isotopic signatures of meteoric water correlate well with altitudinal and climatic differences across locations. Meteoric water was analyzed at several locations along a corridor from Teotihuacan to the Gulf of Mexico, revealing that roughly a 1 per mil difference in δ18O occurs for every 300 m change in altitude (Morales Puente et al. 2012). There are however microclimates, such as the Oaxaca Valley, where the altitude effect is not observed. Nevertheless, each site still displays a particular isotopic signature, especially if well water is analyzed, since it represents an average of the isotopic compositions of meteoric water over several years. This particular oxygen isotopic signal is the one transferred to the mineralized tissues of the individual who consumes it. Diagenetic Processes Before any interpretation of isotopes is performed, it is necessary to ensure that the original isotopic signatures of the mineralized tissues have not been altered by diagenetic processes occurring as a result of bacteria, microorganisms, precipitation of other secondary exogenous minerals, or isotopic interchange with water or other ions. There is considerable controversy regarding whether, when the crystalline index of the bioapatite determined by Fourier Transform Infrared (FTIR) indicates possible recrystallization,

Figure 5.2. Map of surface wind climatology for February, the peak of the dry season in Mexico. In this month the prevailing winds on the ocean surface generate low-intensity rainfall of about 50 mm in parts of Mexico, especially the Gulf of Mexico, and parts of the states of Veracruz and Tamaulipas.

128 · P. Morales, I. Casar, E. Cienfuegos, L. Manzanilla, and F. Otero

this also indicates an alteration of the isotopic signal (Lee-Thorp and Sponheimer 2003).

Oxygen Isotopic Composition of Teotihuacan Residents We analyzed the δ18O isotopic composition of the phosphate contained in 133 bone and 149 enamel samples taken from individuals buried in the Pyramid of the Feathered Serpent, the Pyramid of the Moon, Tlajinga, Tlailotlacan, and the Merchants’ Barrio. Our goals were to establish the context of events during the 600 years of Teotihuacan’s preeminence, and to compare and interpret the oxygen isotopic data from the enamel of individuals buried in Teopancazco within a wider context. Our purpose is only to summarize the salient features of each location based on the original works and to explore factors that might have encouraged immigration. Note that the data from these earlier sources treat δ18Obone bioapatite as isotopically equivalent to δ18Oenamel bioapatite and consider differences between bone and enamel in a single individual as evidence of migration. Furthermore, in the following discussion all δ18O isotopic data will be expressed as the isotopic composition of the water δ18Ow that was in equilibrium with phosphate (bone or enamel) or carbonate (bone or enamel) when these minerals precipitated. Crystalline indexes were measured on all data to give an idea of the preservation of the original isotopic signal. For clarity, the range of isotopic values was arbitrarily grouped into five zones using the intra-population variability of 1 per mil in δ18Ow. Zone 5 is -3 to -6.5 per mil; Zone 4 is -6.5 to -8.5 per mil; Zone 3 is -8.5 to -10.5 per mil; Zone 2 is -10.5 to -12.5 per mil, and Zone 1 is more than -12.5 per mil. Note that because many sites at the Central Highlands of Mexico are at the same altitude, they cannot be distinguished isotopically. Tlajinga Tlajinga 33, studied by White, Storey, and colleagues (2004), is an apartment compound with a modest conglomeration of local residents in the southern sector of Teotihuacan. It displays no evidence of farming and little in the way of artifacts associated with foreign regions. Discoveries of semiprecious greenstone, seashells, onyx, and slates would suggest the residents were initially lapidary artisans; in later periods they seem to have shifted their production to ceramics. The average δ18Ow of the bones of Tlajinga inhabitants is -9.55 per mil ±0.3, which corresponds to 15.1 per mil for phosphates and to the analyzed meteoric water (-9.8‰) of Mexico

Geographic Origins and Migration Histories of the Teopancazco Population · 129

City 50 km south of Teotihuacan and in the same watershed (Cortés et al. 1997). The small standard deviation in the oxygen isotopic signature from Tlajinga is interpreted as a sign of a stable population of long-term residents; therefore, it is used as an isotopic baseline for the city. The suggested range of δ18OVSMOW for the phosphates is between 14 per mil and 16 per mil (White, Storey et al. 2004); according to equation 2 this corresponds to a range of values for δ18Ow VSMOW of -8.5 per mil to -10.4 per mil. The main reason for migration into this compound seems to have been the need to sustain the population in the face of high infant mortality. There is little evidence of immigrants: two bones yielded δ18Ow bone bioapatite measures of -6.89 per mil and -7.71 per mil; and three teeth measured -7.42 per mil, -7.5 per mil, and -13.43 per mil, respectively. These individuals probably came from either Michoacán or west Mexico since they were buried in unusual shaft tombs characteristic of those regions and had associated Apatzingan ceramics. Merchants’ Barrio The Merchants’ Barrio is a neighborhood located in the eastern outskirts of the great city studied by Spence, White, Longstaffe, and Law (2004). It is unusual in that it appears to have been occupied by individuals from more than one group. In general different structures were found to have different isotopic signatures unrelated to the burial contents, and some of its inhabitants were long-distance traders identified with the modern state of Veracruz. In this neighborhood, burials contain associated offerings of ceramics from the Gulf Coast, Maya regions, and San Juan Ixcaquixtla, Puebla. Most of the bones have signatures showing very long periods of local residence; exceptions are three individuals with δ18Ow of -8.3 per mil and -8.0 per mil, probably from Puebla; and five individuals with δ18Ow enamel values of -6.3 per mil, -6.8 per mil, -8.2 per mil, -8.5 per mil, and -13.0 per mil. Tlailotlacan Tlailotlacan, or the Oaxaca Barrio, is an enclave near the western edge of Teotihuacan. During the fourth and fifth centuries AD, its inhabitants were members of the powerful Zapotec state, with its capital at Monte Albán, Oaxaca. Study of this enclave by White, Spence, and colleagues (2004) yielded Zapotec-style artifacts, buildings, decorative structural facades, and mortuary facilities and practices, including extended burials. Kilns and pottery from Tlailotlacan were also distinctively Zapotec. Burials in the enclave showed high infant mortality and disease rates that would have

130 · P. Morales, I. Casar, E. Cienfuegos, L. Manzanilla, and F. Otero

placed the physical and ethnic continuity of the community at risk. The initial occupants of the enclave probably came from the Oaxaca Valley. Two individuals have the δ18Ow signature (-11.3‰ and -11.4‰) characteristic of Oaxaca, while more than 80 percent relocated from other regions, probably as a result of ongoing interactions among the participants in the far-flung Zapotec network. Some known related Zapotec sites are Chingú and El Tesoro in Hidalgo and Los Teteles in Puebla (Cholula -8.4‰, -9.1‰, -9.3‰). These sites are difficult to distinguish isotopically because they are at similar altitudes so their isotopic ranges overlap with the upper part of Teotihuacan’s range. The individuals must have been long-term residents since their bones have mostly local signatures, with only three foreign values: -11.3 per mil, -8.3 per mil and -8.2 per mil; in contrast, their teeth show mostly foreign origins, with values clustering around -8.4 per mil. Ceramics and shaft tombs similar to those from Tzintzuntzan, Michoacán (δ18Ow signature range = -8.4‰ to -7.7‰) or from west Mexico were also found. The Feathered Serpent Pyramid The Feathered Serpent Pyramid, studied by White and colleagues (2002) was built during the Tlamimilolpa period between AD 150 and 250 and incorporated a massive sacrificial offering of 200–250 individuals. Most of the burials sampled were identified as soldiers, since they were young males with weapons and warrior accoutrements; they were not interred with ceramics; and they were positioned around the pyramid in a manner suggesting they were guardians. The δ18O isotopic signatures show a high degree of geographic diversity and mobility among the sacrificial victims, implying that the military structure of the state was multiethnic: 70 percent were foreign-born recruits. Most of the victims had lived in Teotihuacan long enough to have a local bone isotopic signature, perhaps serving in a locally based military unit, but showed signs of moving back and forth between different altitudes. The large spread of δ18Ow values among the soldiers indicates interaction with an extremely wide range of environments, which likely reflects the sphere of Teotihuacan interests: the Oaxaca Valley, Tula in Hidalgo, Matacapan in Veracruz, El Mirador in Chiapas, Maya areas such as Río Azul and Tikal in the Petén, Kaminaljuyú in the Guatemala highlands, and Altún Ha in Belize. Burial 13E was a foreigner with a high-status Maya-style carved wooden baton; he probably came from the Guatemala highlands based on the δ18Ow values in his teeth (-8.1‰) and bones (-8.2‰). However, the movement patterns among soldiers do not offer strong evidence of military force; instead, they may have been intended

Geographic Origins and Migration Histories of the Teopancazco Population · 131

to convey a metaphoric statement of the city’s power and prestige to the rest of Mesoamerican world. The Pyramid of the Moon Thirty-seven exclusively male sacrificial victims were found in the Pyramid of the Moon in deposits White and colleagues (2007) dated to between AD 200 and 400. The authors’ combined use of oxygen and strontium isotopic ratios in bones and enamel provided a finer resolution of the residential histories of the buried individuals. Two geographic locations that are at the same altitude or have the same δ18Ow signal can be differentiated by the strontium isotopic ratio 87Sr/86Sr of the geological formation where they are situated, and vice versa—geographic sites that lie on the same geological formation can be distinguished using oxygen isotopic signals. Most of the sacrificed individuals were foreigners; and with the aid of strontium isotopic analysis, White and colleagues (2007) identified four groups with possible geographic origins in the Central Highlands of Mexico, the Gulf Coast, the Sierra Madre del Sur, and possibly, the southern Maya Highlands, Motagua Valley, and the Maya Lowlands. A number of individuals from this site have distinctly high oxygen isotopic signals, which probably correspond with a low-lying, hot, humid, wet environment such as the Gulf Coast. This isotopic signal is not found at any of the other four Teotihuacan sites analyzed. Moreover, no individuals with isotopic signals from locations higher than Teotihuacan are present in the Pyramid of the Moon. Comparisons between the bone and enamel isotopic signals in these victims strongly suggests that they were taken from foreign locations that were not necessarily their homelands. Teopancazco Teopancazco is a neighborhood center in the southeastern quarter of Teotihuacan (Manzanilla 2006b, 2009a, 2012c; Manzanilla, ed., 2012). It is not a foreign neighborhood, although several objects and raw materials from sites in the corridor leading to the Gulf Coast have been found at the site. At Teopancazco bones are scarce and in a poor state of conservation. Therefore, we sampled molars from 44 burials and performed oxygen isotopic analysis on their enamel bioapatite (see Table 4.1). These data refer to the water in equilibrium with the carbonate of the enamel bioapatite in VSMOW units. The analytical methods applied to these samples are detailed in the appendix.

132 · P. Morales, I. Casar, E. Cienfuegos, L. Manzanilla, and F. Otero

Results Based on the oxygen isotopic data from these combined studies at Teotihuacan, individuals at all the sites have simultaneous local isotopic signatures in bone and teeth. The distribution of the δ18Ow isotopic signatures in the residential areas or neighborhood compounds of Tlajinga, Tlailotlacan, the Merchants’ Barrio, and Teopancazco, have high concentrations (three or more) of individuals from relatively few geographic sites; in contrast, the sites that have human offerings (Pyramid of the Feathered Serpent and Pyramid of the Moon) have a wider range of isotopic signatures with fewer individuals from each zone. All the sites display many bone isotopic signatures that appear to be local, implying that immigrants were integrated into the social and economic framework of the neighborhoods, probably intermarrying with and becoming part of the groups already there. Bone–Enamel Bioapatite Equivalence Figure 5.3 shows bar histograms plotting the isotopic data from the five sites studied by White and various colleagues. Analysis performed on bones is separated from that on enamel. The size of the interval is 2σ of the experimental error (0.1‰) The data plotted here is simply the conversion of the reported δ18O of the phosphates from bone and teeth to the δ18Ow water that was in equilibrium with the phosphates. We can see that the range of the δ18Ow bone bioapatite is narrower than that of δ18Ow enamel bioapatite, which encompasses two new zones (Zones 1 and 5). There are three main peaks (those with more than six individuals) within a 3 per mil interval. The δ18Ow bone bioapatite peaks average -10.3 per mil, -9.3 per mil, and -8.1 per mil. For δ18Ow enamel bioapatite the averages are -9.2 per mil, -8.4 per mil, and -7.3 per mil; this apparent displacement between the isotopic composition of teeth and bone might be explained by the difference found by Warinner (2010) and Webb and others (2014), and is reinforced by the findings of France and Owsley (2013). Even though δ18Ow 18 enamel bioapatite and δ Ow bone bioapatite appear to differ by approximately 1 per mil, this in itself is not conclusive; it does however add evidence to support the bone-enamel bioapatite difference we argue for in this work. During Teotihuacan’s florescence, many other settlements began to emerge in the Central Highlands of Mexico, along trade routes and in locations established for the extraction of raw materials or the production of goods. A number of these sites are in the modern-day states of Hidalgo, Tlaxcala, Mexico, Morelos, Puebla, and Veracruz, which lie in the same

Geographic Origins and Migration Histories of the Teopancazco Population · 133

Figure 5.3. δ18Ow(‰) water in equilibrium with phosphates of bone bioapatite from individuals of Tlajinga, Tlailotlacan, the Merchants’ Barrio, the Pyramid of the Feathered Serpent Pyramid, and the Pyramid of the Moon.

geological formation—the Trans-Mexican Volcanic Belt—within altitudes from 1,800 to 2,700 m above sea level (masl). This 900 m range in altitude may correspond to a variation of roughly 3 per mil in the isotopic composition of the meteoric water. As discussed earlier, bone bioapatite produces average isotopic signals of the imbedded meteoric water and is more prone to diagenesis than enamel is. Therefore, in the following results we will compare only the isotopic signatures of enamel between Teopancazco and the other sites of Teotihuacan studied by White, Spence, and their colleagues. We apply an adjustment of 1 per mil to the δ18Ow of the enamel bioapatite to account for the bone enamel bioapatite difference and allow comparison between enamel and

134 · P. Morales, I. Casar, E. Cienfuegos, L. Manzanilla, and F. Otero

bone bioapatite isotopic signals. We consider the δ18Ow interval between -10.4 per mil and -8.5 per mil as defining the local isotopic signature. Teopancazco Figure 5.4 is a histogram plotting the δ18Ow of phosphate in the enamel bioapatite from the burials in the five sites of Teotihuacan (darker color), compared to the δ18Ow from the carbonate in the enamel bioapatite of Teopancazco burials (lighter color). Of the 44 individuals analyzed from Teopancazco, 18 (41%) had a local oxygen isotopic signal (i.e., burials 1, 3, 5, 7, 8, 10A, 14, 15, 24a, 40, 50, 55, 73, 75, 78, 106, 108, 116). Another 19 (43%) were identified as immigrants: * Burials 28F, 65, 71, and 91 came from Zone 5 (altitudes from sea level to 600 masl); * burials 2, 13, 39, 60, 67, 72, 74a, 82, and 112 came from Zone 4 (altitudes between 600 and 1,800 masl); and * burials 9, 46, 92, 98, 100, and 102 came from Zone 2 (altitudes higher than 2,400 masl). The remaining seven individuals (16%) (burials 3, 4, 17, 28, 70, 77, 86, and 105) could be either locals or immigrants, since their oxygen isotopic signal is at the lower limit of Teotihuacan and within the 1 per mil interindividual variation. Strontium isotopic analysis were also performed on bone and teeth from the Teopancazco residents to determine more precisely their geographic origins within the Trans-Mexican Volcanic Belt (see chapter 6); since altitudes in this area vary by less than 300 m, they cannot be resolved using oxygen isotopes. Using the 87Sr/86Sr values of their enamel, 12 individuals were definitely identified as locals, five of whom also exhibited local oxygen isotopic signatures (burials 3, 7, 55, 78, and 108); 10 individuals were classified as immigrants (burials 5, 9, 13, 71, 74a, 75, 77, 98, 102, and 105). Individuals from burials 13, 71, and 74a have clearly non-local 87Sr/86Sr values agreeing with their non-local δ18O isotopic signatures, whereas individuals from burials 9, 77, 98, 102, and 105 show slightly but significantly higher enamel δ18Ow and 87Sr/86Sr values. These 87Sr/86Sr signals are still typical for the Trans-Mexican Volcanic Belt, while the δ18Ow corresponds to altitudes higher than 2,400 masl. Finally, individuals from burials 5 and 75 show high, non-local 87Sr/86Sr values but a very clear local oxygen signal. Individuals identified as immigrants by their 87Sr/86Sr values are shown with the gray histograms in Figure 5.4.

Geographic Origins and Migration Histories of the Teopancazco Population · 135

Figure 5.4. δ18Ow(‰) water in equilibrium with enamel phosphates from individuals in Figure 5.3 compared with and δ18Ow water in equilibrium with enamel carbonates from individuals of Teopancazco.

Periods of Occupation Figure 5.5 shows the δ18Ow enamel bioapatite results from the six sites broken out by time. The data from Teopancazco were dated by archaeomagnetism (Soler Arechalde et al. 2006) and 14C radiocarbon (Beramendi Orosco, González, and Soler Arechalde 2012; Beramendi Orosco, González Hernández, et al. 2009; Manzanilla 2009b). It is noteworthy that all the individuals who lived at Teopancazco or were sacrificed and buried in the Pyramid of the Moon during the Tlamimilolpa period were local. During the Transition Period marked by evidence of termination rituals, a large number of immigrants from diverse regions came to live in Teopancazco, as shown in Figures 4.3 and 4.4. The sacrifices at the Pyramid of the Moon during the

136 · P. Morales, I. Casar, E. Cienfuegos, L. Manzanilla, and F. Otero

Figure 5.5. δ18Ow enamel bioapatite values for the individuals in Figures 5.3 and 5.4 divided by time period.

Xolalpan period appear to be immigrants from the same general regions. However, the apparent influx of immigrants during different times in these two sites may just be an artifact of different dating procedures. During the Xolalpan period most Teopancazco immigrants were from locations whose altitudes were about 300 m lower than Teotihuacan (Zone 4). Finally, the only burial found in Teopancazco dating from the Metepec period shows a foreign isotopic signal.

Geographic Origins of Migrants to Teotihuacan Manzanilla (2001b, 2011b) proposes that the corporate strategy of Teotihuacan gave rise to a state that functioned like an octopus. Its head was the city of Teotihuacan together with surrounding regions that provided sustenance (Tula Valley, Toluca Valley, eastern Morelos Valley). Like tentacles,

Geographic Origins and Migration Histories of the Teopancazco Population · 137

several corridors of sites connected the great city with outlying enclaves (Matacapan, Kaminaljuyú, Loma Santa María, and Tres Cerritos). These tentacles extended toward regions (Guerrero, Oaxaca, Michoacán, and Veracruz) whence natural products (mica, obsidian, cinnabar, limestone, and onyx) and sumptuary goods (cacao, cotton cloths, and clay ware) were brought to Teotihuacan. Table 5.1 lists some of these sites, their altitudes, the δ18O values of the meteoric water as measured in our laboratory or reported in the literature, their 87Sr/86Sr ratios, and the goods produced or the strategic importance of the site.

Trade Routes Teopancazco’s commercial interaction with the Nautla region (Veracruz) has been confirmed by archaeological evidence from a group of Teotihuacan allied sites on a trade route to the Nautla region (García Cook 1981; Manzanilla 2011b, 2012c). In Figure 5.6 we show the known sites and trade routes of Teopancazco, as well as four of the six zones described herein. Each zone is a 300 m altitude range that roughly corresponds to the isotopic zones with 1 per mil increments. Xalasco and Calpulalpan in Tlaxcala, which are two sites on the trade route to Nautla, are at altitudes above 2,500 m; the six individuals from Teopancazco that fall in Zone 2 might have come from these locations. Significantly, if the 1 per mil difference between δ18Ow bone bioapatite and δ18Ow enamel bioapatite is considered, the six individuals appear to have originated in Zone 2, but if it is not, they would correspond to Zone 3, the altitude of Teotihuacan, meaning that no individuals in Teopancazco came from higher altitudes, despite the archaeological importance of these sites. In fact it seems that the lower oxygen isotopic signature obtained by adjusting for the enamel–bone bioapatite difference is more likely. As previously noted, all six burials have slightly different strontium signatures between 0.7050 and 0.7055. In our laboratory we measured the oxygen isotopic composition of water from a well in Xalasco, Tlaxcala, at -10.8 per mil; 1 per mil lower than the average for meteoric water measured in Mexico City (-9.8 per mil). The difference in altitude between Mexico City and Xalasco is 340 m. Finally, Figure 5.7 underscores the importance of Teotihuacan and its relations with all of Mesoamerica throughout almost six centuries. Significantly, even though this is a multivariate plot that involves many parameters,

Hidalgo Puebla Hidalgo Puebla Onyx, limestone

Limestone, green obsidian

Zone 3. Altitudes between 2,100 and 2,400 masl La Herradura Tlaxcala Oaxaca enclave Teotihuacan Edo. de México Xico Edo. de México Zone 2. Altitudes between 2,400 and 2,700 masl Xalasco (Altzayanca) Tlaxcala Site on the corridor to Nautla Cantona Puebla Tepeapulco Hidalgo Obsidian mines

Chingú Cholula Chapantongo Tepexi el Viejo

2,580 2,561 2,520

2,276 2,300 2,300

2,080 2,150 2,120 2,125

Raw Material or Strategic Location Current Mexican State Importance Elevation (masl) Zone 6. Altitudes lower than 1200 masl Martínez de la Torre Veracruz 61 -3.9a El Pital Veracruz 13 -5.0a El Cuajilote Veracruz 18 Matacapan Veracruz Fine clays, Teotihuacan enclave 301 Zone 5. Altitudes between 1,200 and 1,800 masl Chalcatzingo Morelos 1,437 Zone 4. Altitudes between 1,800 and 2,100 masl Las Pilas Morelos Water source on the route to Tierra Caliente (tropical lands) Ixcaquixtla Puebla Salt, onyx, Thin Orange ware 1,884 Atlixco Valley Puebla Teotihuacan enclave 1,843

Table 5.1. Isotopic Data and Characteristics of Key Sites Allied to Teotihuacan

-10.83a

-9.5a, b

-8.5f

-8.6b

0.7047d 0.7046d 0.7045c

0.705d 0.7048c 0.7052c 0.7047– 0.7067d

0.7044d

García Cook 1981

Baez Pérez 2005; Rattray 1998

Baez Pérez, 2005 Plunket and Uruñuela 1998 Díaz 1980

0.7041d

-6.2a

-7.7f -7.6f

Ortiz et al. 1988

0.7067d 0.7058d 0.7035d

-5.0a

0.7044d

Citation

87Sr/86Sr

δ18O

Cacao and jadeite

Maya obsidian, quetzal feathers

10

2,000

-4.6b

20 y

30273 Di

30273 HM

20–24 y

Male

18–25 y

29925 F

31370 Di Lix1

31370 Di Lix2

31370 Di Res3

7

Male

29925 Di

8

8

8

7

6

30273 CL

6

5

Male

20271 A

5

20271 Di Res3

5

5

4

3

3

7532 F II

6–12 y

7532 Di Lix2

3

3

Juvenile

7532 Di Lix1

2

2

3

25–35 y

4586 F

7532 F

Female

4586 Di

Enamel

Enamel

Enamel

Femur

Enamel

Collar bone

Maxilla

Enamel

Astragalus

Enamel

Enamel

Enamel

Femur

Enamel

Femur

Femur

Enamel

Enamel

Enamel

Femur

Enamel

Burial No. Material

7532 Di Res3

Indiv., age

Sample

0.704748

0.704733

0.704732

0.704777

0.704907

0.704700

0.704861

0.705162

0.704769

0.706682

0.705902

0.705302

0.704736

0.704875

0.704695

0.704672

0.704772

0.704776

0.704747

0.704723

0.704625

87Sr/86Sr

40

28

29

39

36

36

33

29

34

41

38

36

36

29

36

34

38

34

35

34

37

Residue 3

Leachate 2

Leachate 1

No

No

Residue 3

Leachate 2

Leachate 1

2 leachates

Residue 3

Leachate 2

Leachate 1

3 leachates

1 sd* Leachate

Table 6.1. 87Sr/86Sr in Teeth (Enamel) and Bones of Individuals from Teopancazco

No

No

Intermediate

Yes

No

No

Inverse

Migration?

a

Dental damage

888

a

264

242

383

667

170

766

344

330

500

56

75

163

769

205

832

141

108

126

713

297

(continued)

2,100

2,400

2,400

2,400

Sr (ppm) Altitude (m)

a

Comment

8

8

9

Male

18–25 y

Male

25–30 y

31370Di II Res3

31370 F

31700 Di

31700 V

33766 Di

33766 C

13A

15

Male

35–45 y

33766 F

36093 Di

36093 F

15

15

15

17

Male

Young adult

35658

35658

35658

35185 Di Lix1

35185 Di Lix2

36

Male

35–40 y

59212 Di Lix1

59212 Di Lix2

59212 Di II

17

35185 F

36

36

17

35185 Di Res3

17

15

35658

15

13A

33766 V

13A

13A

9

8

31370Di II Lix2

Enamel

Enamel

Enamel

Femur

Enamel

Enamel

Enamel

Femur

Vertebra

Cranium

Enamel

Femur

Enamel

Femur

Vertebra

Cranium

Enamel

Vertebra

Enamel

Femur

Enamel

Enamel

Enamel

Burial No. Material

8

Indiv., age

31370Di II Lix1

Sample

Table 6.1—Continued

0.704967

0.704999

0.705074

0.704856

0.705078

0.704989

0.704677

0.704785

0.704692

0.704714

0.705189

0.704804

0.705262

0.704897

0.704675

0.704686

0.707336

0.704874

0.705560

0.704742

0.704750

0.704777

0.704752

87Sr/86Sr

36

36

39

36

34

35

37

39

35

37

40

40

36

38

35

34

45

37

34

31

36

34

37

No

Leachate 2

Leachate 1

Residue 3

Leachate 2

Leachate 1

3 leachates

3 leachates

3 leachates

3 leachates

Residue 3

Leachate 2

Leachate 1

1 sd* Leachate

Intermediate

Intermediate

Intermediate

Yes

Yes

No

Migration?

Comment

1,077 634 268 517 663 678 787 491

b b b b b b b b

142 208

a a

190

448

149

148

202

290 1,000

b

424

85

552

315

252

354

2,400

1,650

2,800

Sr (ppm) Altitude (m)

b

a

55

Female

30–35 y

???

3y

Male

20–30 y

Female

16–20 y

67145 Di

67145 F

68701 Di

68701 FN

68892 Di

68892 F

69944 Di Lix1

69944 Di Lix2

71

74

Male

30–35 y

Male

25–30 y

Male?

24–30 y

69944 H

70020 Di

70020 H

70022 Di

70022 H

69785 Di Lix1

69785 Di Lix2

77

78

Male

30–35 y

69785 H

70081

70081

78

78

70081

70081

78

77

69785 Di Res3

77

77

75

75

74

71

69944 Di Res3

71

71

70

70

63

63

55

36

59212 F

0.704577

0.705134

0.704692

0.704560

0.706131

0.704975

0.705454

0.704944

0.707851

0.707891

0.707790

0.705188

0.704598

0.705455

0.705220

0.705236

Femur

Vertebra

Cranium

Enamel

0.704610

0.704605

0.704624

0.704665

Jaw fragment 0.704785

Enamel

Enamel

Enamel

Jaw fragment 0.704800

Enamel

Cranium

Enamel

Cranium

Enamel

Enamel

Enamel

Femur

Enamel

Child femur 0.704707

Milk tooth

Femur

Enamel

Femur

32

34

38

27

35

34

39

40

36

35

37

33

38

34

37

35

38

39

39

34

38

38

38

3 leachates

Residue 3

Leachate 2

Leachate 1

3 leachates

3 leachates

Residue 3

Leachate 2

Leachate 1

No

No

3 leachates

No

Yes

Yes

Yes

Yes

Inverse

Inverse

Inverse

469 429 970 354

b b b

448

215

218

262

614

495

387

327

437

104

93

108

255

311

456

18

242

214

247

b

leaching)

a (Without

(continued)

2,400

2,700

2,400

1,650

880

2,500

2,500

???

Middle adult Female

>40 y

70391 Di

70391 H

72494

???

1.5–2 y

Female?

35–40 y

71976

71976 H

72442

72442

105

16–20 y

76114 Di Lix1

76114 Di Lix2

108

10–15 y

76692 Di

76692 H

Femur

Enamel

Femur

Enamel

Enamel

Enamel

Femur

Vertebra

Cranium

Enamel

Bone

Tooth

Cranium

0.704700

0.705147

0.704715

0.705459

0.705052

0.705189

0.704783

0.704775

0.704830

0.705385

0.704714

0.704808

0.704658

0.704989

0.704776

0.704688

0.704800

0.705397

0.704700

0.704953

87Sr/86Sr

Notes: a. Duplicate analysis b. Analysis of the same individual but with different bone material.

108

105

Female

76499 H

105

76114 Di Res3

105

102

Male

72442

102

72442

102

102

101

101

100

2–4 y

71952 H

Enamel

Femur

98

100

???

72494

Vertebra

Cranium

Enamel

Femur

Enamel

98

98

98

86

86

Burial No. Material

71952 Di

72494

72494

Indiv., age

Sample

Table 6.1—Continued

37

32

38

35

36

34

39

35

39

42

33

37

33

35

39

40

34

35

38

32

3 leachates

Residue 3

Leachate 2

Leachate 1

3 leachates

No

3 leachates

3 leachates

No

1 sd* Leachate

Intermediate

Yes

Yes

No

No

Yes

No

Migration?

564 1,697 623

b b

566 950 606

b b b

545

355

444

323

399

417

465

b

540

399

739

153

278

b

433

164

2,400

2,700

2,800

2,850

Sr (ppm) Altitude (m)

b

Comment

Figure 6.4. Histogram plotting bone and enamel 87Sr/86Sr for all 27 individuals from Teopancazco. Data are compiled in Table 6.1. Gray bars signify non-locals. Based on the available d18O data (Table 6.1 and Morales Puente et al. 2012), possible regions of origin for these migrants are given.

154 · G. Solís Pichardo, P. Schaaf, T. Hernández Treviño, B. Lailson, L. Manzanilla, and P. Horn

55, 70, and the three-year-old child from burial 63 marked as “inverse” in Table 6.1). This change possibly occurred during rainwater interaction or diagenetic bone contamination in the burial site. The other five individuals (burials 6, 15, 17, 36, and 108) show enamel 87Sr/86Sr from 0.704999 to 0.705262, which exceeds the corresponding bone ratios by between 222 and 447 ppm. However, these people can be characterized as either locals or migrants within the volcanic Central Mexican Plateau. Both enamel and bone 87Sr/86Sr match values reported from the Trans-Mexican Volcanic Belt, which is confirmed by two available δ18O parameters (chapter 5; Morales Puente et al. 2012:397), corresponding to ca. 2,400 m in altitude (burials 15 and 108; Table 6.1). Enamel Leaching Results In order to emphasize the importance of enamel leaching for Sr isotope analyses in human migration studies, we present results from seven different individuals buried in Teopancazco. All three leaching steps described in Figure 6.3 are shown shaded in Table 6.1, and are graphically displayed in Figure 6.5, where the inverse Sr concentration (1,000/Sr ppm) is shown against 87Sr/86Sr. Sr isotope data of burials 3, 71, 77, and 105 are plotted in Figure 6.5a; Figure 6.5b shows the same for burials 5, 8, and 17. The results are presented in detail as follows: Burial 3: The three leaching steps and the bone 87Sr/86Sr of this individual, a 6- to 12-year-old juvenile, produce identical results within 1 standard deviation, characteristic of a local individual without a migration context. Burials 77 and 105: The first is a 24- to 30-year-old adult and the second, a 16- to 20-year-old adolescent, possibly males. Both show similar bone ratios typical for Teotihuacan, slightly elevated 87Sr/86Sr for the first two leaching steps, and significantly higher values for the third leaching step (residue 3; Table 6.1), emphasizing the importance of this analytical treatment. Only the 87Sr/86Sr of residue 3 can be used to evaluate whether migration occurred. This step has successfully removed the majority of secondarily induced enamel Sr and characterizes both individuals as migrants. Burial 8: The femur and all three leaching steps of this 18- to 25-yearold male are consistent within 1 standard deviation (87Sr/86Sr between 0.70473 and 0.70475). To test the analytical reproducibility, a second set of three leaching steps was performed on another

Migrants in Teopancazco: Evidence from Strontium Isotopic Studies · 155

enamel fragment, yielding very similar results between 0.70474 and 0.70477. In this case, obviously no migration occurred. Burial 17: This individual, a young adult male, shows similar 87Sr/86Sr for the femur and the first leaching step (0.70468 and 0.70486, respectively), followed by moderately increased ratios for the second and third steps (0.70499 and 0.70508), which rules out a boyhood in Teotihuacan. Burials 5 and 71: Both burials contain skeletons of 16- to 20-year-old people, a male and a female, with pounded skulls and, in the case of burial 5, with evidence as well of tooth abrasion. Their 87Sr/86Sr ratios after the third leaching step (residue 3) are much higher than their bone signatures, classifying them as migrants. With regard to the leaching procedure, however, different outcomes were observed: all three leachates of burial 71 enamels are quite similar, with 87Sr/86Sr ratios of 0.70779, 0.70789, and 0.70785, respectively. On the other hand, burial 5 leachates differ substantially, with 0.70530 for leachate 1, 0.70590 for leachate 2, and 0.70668 for residue 3. In this case, it would have been helpful to perform a fourth leachate step to control the significance of the residue 3 value and to determine the geographic origin of this individual. Summarizing the information presented above and in Figure 6.5, four of seven enamel samples show significant differences in 87Sr/86Sr during the leaching processes, justifying a recommendation that this technique be used for migration studies. Bone Homogeneity Femurs are the part of the skeleton generally considered to be most suitable for Sr isotopic analyses. Because of their larger volume and their hardness, they are less susceptible to diagenetic alterations than other bones. In some cases, however, the skeleton investigated is incomplete, and other fragments, such as skull or vertebrae, must be analyzed. To test the Sr isotope homogeneity of different bones, we selected femur, skull, and vertebra parts from burials 13A, 15, 78, 98, and 102. The results are shown in Table 6.1 and are graphically presented in Figure 6.6. Burials 13A and 15 show that the femur has a slightly but significantly higher 87Sr/86Sr ratio than the skull or vertebra. For burials 78 and 102, Sr isotope ratios for all three bone samples coincide within 1σ standard deviation. In the case of burial 98, its vertebra sample shows lower 87Sr/86Sr compared to nearly

(a)

(b)

Figure 6.5. Inverse Sr concentration (× 1,000) versus 87Sr/86Sr. (a) Bone and enamel isotopic ratios for burials 3, 71, 77, and 105; (b): bone and enamel isotopic ratios for burials 5, 8, and 17. All three leaching steps (see Figure 6.3) are shown. Analytical data are from Table 6.1. In the case of burial 8 enamel, duplicate analyses were performed on aliquots of the same tooth. Individuals 5, 71, 77, and 105 show evidence of migration. The advantage of the enamel leaching procedure is clearly discernible.

Migrants in Teopancazco: Evidence from Strontium Isotopic Studies · 157

Figure 6.6. 87Sr/86Sr ratios for different bone types (femur, cranium, and vertebra) from five individuals (burials 13A, 15, 78, 98, and 102) in comparison to the corresponding values for the leached molars.

identical values for the femur and skull. The observed 87Sr/86Sr differences for femur, skull, and vertebra samples from the same individual confirm the vulnerability of bone material to diagenetic alterations. On the other hand, the differences are relatively small, allowing for analyses of skull or vertebrae in the absence of femurs. Contributions to the Soil 87Sr/86Sr Database We investigated a total of 28 soil and 2 rock samples from 16 archaeological sites located between the Central Plateau and the Gulf Coast of Mexico. In addition, we analyzed 10 plant specimens from some of the same sites and one rainwater sample from Mexico City. Soil samples were powdered in an agate mortar to a grain size of approximately 60 mm, leached with H2O (Milli-Q quality) and further handled like the rock samples, which includes dissolution in hydrofluoric and hydrochloric acids and ion chromatography (see details in Schaaf et al. 2005:1260). Plant samples (ca. 100 mg) were ashed for two hours at 850°C in Pyrex glass vials, digested in nitric acid, and further processed exactly like the soil and rock samples. Sr isotopic data for soil, rock, and plant specimens are compiled in Table 6.2 and displayed in Figure 6.7; their locations are found in Figure 6.8.

Location

Soils, Plants, and Rocks La Joya s La Joya La Joya s La Joya 3475 Morgadal 3476 Morgadal 3907 Morgadal 3477 El Pital 3478 Cuajilote 3479 Cuajilote 3480 Cuajilote 3935 Cuajilote 3909 Cuajilote 3481 Matacapan 3482 Matacapan 3483 Matacapan 3548 Matacapan 3484 Maltrata 3485 Maltrata 3486 Maltrata 3910 Maltrata 3487 La Herradura

Sample

Ver. Ver. Ver. Ver. Ver. Ver. Ver. Ver. Ver. Ver. Ver. Ver. Ver. Ver. Ver. Pue.–Ver. Pue.–Ver. Pue.–Ver. Pue.–Ver. Tlax.

State Soil Soil Soil Soil Plant Soil Soil Soil Soil Plant Plant Soil Soil Soil Plant Soil Soil Soil Plant Soil

Material 0.704730 0.704584 0.708395 0.708286 0.707708 0.706688 0.706323 0.706614 0.705860 0.705844 0.705652 0.703492 0.703424 0.703451 0.703470 0.704463 0.704536 0.704532 0.705173 0.704444

87Sr/86Sr

38 34 39 36 39 45 41 37 37 29 38 37 36 40 39 41 38 36 36 36

1 sd

451 586 490 358 350 343 690

235

1,750

2,610

16 240

140

452 511 206 228 33.9 235 73.8 64.7 230 58.2

Cempazuchitl

Tepejilote Malastre

Guava

Sr (ppm) Comments

2,160

Altitude (m)

Table 6.2. 87Sr/86Sr Ratios in Soils, Plants, and Rocks between the Central Plateau and Gulf Coast

3488 3911 OCE s TEC s 3535 3536 3913 3537 3912 3540 3538 3549 3914 3539 67145 s 25166 s TU-1 TU-1 S TU-2 S TU-3 S Water 2734

Tlax. Tlax. Tlax. Tlax. Pue. Pue. Pue. Pue. Pue. Mor. Mor. Mor. Mor. Mor. Edo. de Mex. Edo. de Mex. Hgo. Hgo. Hgo. Hgo.

D.F.

La Herradura La Herradura Ocotelulco Tecoaque Tepexi Tepexi Tepexi Atlixco Atlixco Chalcatzingo Chalcatzingo Chalcatzingo Chalcatzingo Las Pilas Teopancazco Xalla Tula Tula Tula Tula

Mexico City

0.704447 0.704676 0.704524 0.704404 0.714567 0.706026 0.706731 0.704363 0.705067 0.703396 0.704151 0.704433 0.704491 0.704374 0.704322 0.704409 0.705033 0.704999 0.705005 0.704688

Rain water 0.706520

Soil Plant Soil Soil Soil Soil Plant Soil Plant rock Soil Plant Plant Soil Soil Soil Rock Soil Soil Soil 34

39 35 36 32 42 36 33 35 33 35 39 37 35 38 31 39 34 38 35 35 2,600

1,720 2,300 2,300 2,050

1,380

1,720

1590

0.003

405 367 251 392 447 355 423

424 70.7 467 256

464 512 118 82.8

234

From burial 55 From burial 1 Basalt

Escobilla Granite

Above Acatlán schist Above limestone

Figure 6.7. Histogram with 87Sr/86Sr values for soils, plants, and two rock samples from 16 archaeological sites located between the Mexican Central Highlands and the Gulf Coast areas of Veracruz (see Figure 6.8).

Figure 6.8. Map of south central Mexico with different fields and isolines for 87Sr/86Sr. A large number of isotopic ratios are from our laboratory (LUGIS) database (theses and unpublished manuscripts). Additional data from the literature are in Yáñez et al. (1991; Acatlán Complex), Weber (1998; Mixtequita), Gómez Tuena (2002; eastern TMVB and Palma Sola), Schaaf et al. (2002; Chiapas massif), Buikstra et al. (2003; Monte Albán and Tikal), Martínez Serrano et al. (2004), Siebe et al. (2004), Schaaf et al. (2005), Schaaf and Carrasco Núñez (2010; all for the central eastern TMVB), Hodell et al. (2004; Yucatán), Robles Camacho (2006; La Merced), Landa Arreguín (2010; eastern Yucatán), and Espíndola Castro et al. (2010; Tuxtlas). Locations of the archaeological sites where soil and plant samples shown in Table 6.2 were collected are also numbered.

162 · G. Solís Pichardo, P. Schaaf, T. Hernández Treviño, B. Lailson, L. Manzanilla, and P. Horn

In general, soil and plant isotopic ratios are similar. Rainwater was collected on the outskirts of Mexico City and yielded a 87Sr/86Sr ratio of 0.70652 (Table 6.2), which should be representative for Central Mexico. Its interaction with plants occurs as follows: when soil values are beyond this value, plant isotopic ratios shift in the direction of the rainwater value, and vice versa. Fertilizer-induced alterations may change the plant Sr isotope composition by less than 10 percent (Horn 2005:144). A noteworthy case is found at the Tepexi archaeological site in Puebla, situated on top of Cretaceous carbonate rocks (Petlalcingo Formation; Pantoja 1988:157), which is intercalated with conglomerates and schist from the Paleozoic Acatlán Complex, resulting in heterogeneous 87Sr/86Sr for the soil samples collected from this site (see Table 6.2, Figure 6.7). From Teotihuacan we analyzed a soil sample from Teopancazco burial 55 and another from Xalla burial 1 (Manzanilla 2008a; Manzanilla and López Luján 2001), obtaining 87Sr/86Sr values of 0.70432 and 0.70441, respectively (Table 6.2). The mean value for the Teopancazco bone samples is somewhat higher (0.70477; n = 40), which is interpreted as the result of rainwater interaction and possibly minor diagenetic alterations in bone materials.

Conclusions This chapter has presented results of migration studies with Sr isotopes carried out on 27 bone–enamel pairs from burials excavated from Teopancazco, Teotihuacan. Ten individuals show significant differences between bone and enamel 87Sr/86Sr values and were unequivocally identified as non-locals. Consulting the available database for soil 87Sr/86Sr and δ18O parameters, possible origins of these migrants include central Oaxaca, Perote (Veracruz), Toluca Valley, Tepexi (Puebla), Xalasco (Tlaxcala), and the lowlands (Palenque?) and highlands of Chiapas. Interestingly, none of these individuals originated from the Gulf Coast of Mexico (Veracruz, Campeche, Tabasco) or from the Yucatán calcareous platform. Five other individuals show slightly but significantly higher enamel 87Sr/86Sr values between 0.70508 and 0.70526, which are still typical for the Trans-Mexican Volcanic Belt (e.g., Martínez Serrano et al. 2004:96; Siebe et al. 2004:215; Schaaf et al. 2005:1271). A local migration within this region is confirmed for these individuals by oxygen isotope data (Morales Puente et al. 2012:397; see chapter 5), which confirms their origins at altitudes of around 2,400 m. Twelve individuals were definitely identified as locals, including almost all

Migrants in Teopancazco: Evidence from Strontium Isotopic Studies · 163

1- to 15-year-old juveniles. The combined application of Sr and O isotopes can contribute information that sometimes could not be gathered by one of these methods alone. For instance, oxygen can point toward 2,400 m altitudes, typical for the TMVB region, whereas Sr can give higher or lower 87Sr/86Sr, indicative of regions with similar altitudes off the TMVB. On the other hand, 87Sr/86Sr ratios could be around 0.7045–0.7050 (representative TMVB values), but the oxygen value is higher than typical TMVB values, giving evidence of a region with identical 87Sr/86Sr but lower altitudes. An example would be the area around the Los Tuxtlas volcanoes, close to the Gulf Coast (Espíndola Castro et al. 2010:188). An important improvement for obtaining reliable enamel 87Sr/86Sr is achieved by applying at least a three-step leaching procedure with different concentrations of acetic acid to eliminate secondary Sr contributions that can distort migration decisions. The results of this work clearly demonstrate that enamel 87Sr/86Sr without leaching can show correct biogenic values, but there is also a considerable probability that these values represent a mixture of original and secondary Sr without significance for migration reconstructions.

7 Genetic Analysis of Teopancazco Burials Inferences on Multiethnicity Brenda A. Álvarez Sandoval, Linda R. Manzanilla, and Rafael Montiel

Multiethnicity in Teopancazco is represented by foreign artifacts associated with the Gulf Coast of Mexico, Puebla, Tlaxcala, and Hidalgo, as well as by variability observed in funerary rituals. To date no systematic genetic analysis has been conducted to address the ethnic origins of residents in the Teopancazco neighborhood center at Teotihuacan. In this chapter we present results of genetic analyses of individuals from different time periods. We determined the mitochondrial haplogroup from 29 samples from Teopancazco. Estimates of both genetic and haplotype diversity indicated high levels of genetic variability in Teopancazco, which is consistent with the multiethnic character of the neighborhood center. The samples analyzed dated from the Tlamimilolpa (n = 10) and Xolalpan (n = 8) phases, as well as the Tlamimilolpa–Xolalpan transition phase (n = 11) of the Classic period (AD 200–550). A high diversity of values was found in all three periods, suggesting that the population of Teopancazco was heterogeneous from the start. No significant differences in gene diversity or haplogroup frequencies were observed between the Tlamimilolpa, Xolalpan, and Transitional phases. Therefore, our preliminary results indicate the presence of one genetically diverse population in Teopancazco throughout the Classic period. In order to understand the genetic structure of the Teopancazco neighborhood, we conducted the first comprehensive ancient DNA (aDNA) analysis of the site employing the most widely used genetic marker, mitochondrial DNA (mtDNA). The use of mtDNA typing is possible even with highly degraded samples where nuclear DNA typing is unsuccessful, since

Genetic Analysis of Teopancazco Burials: Inferences on Multiethnicity · 165

the high copy number of mtDNA increases the chances of preservation relative to nuclear genes (Shuster et al. 1988; Wallace 1994; Wallace et al. 1999). Averaging 16,569 base pairs (bp) in length, mtDNA is maternally inherited and does not undergo recombination (Anderson et al. 1981; Andrews et al. 1999; Eshleman et al. 2003). It contains a coding region where the information for 37 genes is encoded, and also a noncoding region, known as the control region or D loop, which experiences a higher mutation rate compared to both the coding region and the nuclear genome (Anderson et al. 1981; Andrews et al. 1999). The variation found in the control region is concentrated in two segments called hypervariable segments I (HVS I; positions 16024–16365) and II (HVS II; positions 73–340). Most of the mtDNA variability studies are based on the amplification and subsequent sequencing of either the HVS I or the entire control region followed by a comparison with the revised Cambridge Reference Sequence (rCRS; Andrews et al. 1999). The haplotype of each individual is established by the specific combination of the differences observed along the compared sequence sites. All mtDNA haplotypes that share specific fixed differences can be clustered into larger monophyletic groups, the haplogroups that in general have a continent-specific origin. In the Americas, haplogroups A, B, C, D, and X have been identified, mainly in extant populations (Achilli et al. 2008; Bandelt et al. 2003; Brown et al. 1998; Kemp et al. 2007; Malhi et al. 2010; Perego et al. 2010; Tamm et al. 2007; Torroni, Chen, et al. 1994; Torroni, Schurr, Cabell, et al. 1993; Torroni, Schurr, Yang, et al. 1992; Wallace 1994). Ancient DNA studies of prehispanic populations in Mexico are scarce, but there are reports on human remains from Monte Albán (Muñoz et al. 2010), Maya culture areas (González Olivier et al. 2001; Merriwether et al. 1997), and Nahua populations (Kemp et al. 2005; Mata Míguez et al. 2012). .

Materials and Methods In different field seasons (1997–2005) of the “Teotihuacan: Elite and Rulership” project directed by Linda R. Manzanilla (Manzanilla, ed. 2012), bone and teeth samples from 116 human burials were collected at Teopancazco, Teotihuacan (see chapters 1 and 2). Samples from 46 different individuals were sent to the aDNA laboratory in Langebio, CINVESTAV (Center for Investigation and Advanced Studies of the National Polytechnic Institute) for analysis.

166 · B. Álvarez Sandoval, L. Manzanilla, and R. Montiel

Contamination Control All work was carried out under rigorously controlled conditions for the analysis of aDNA, in an ultraclean laboratory, positively pressurized with ultra-filtered and UV-irradiated air, with pre- and post-polymerase chain reaction (PCR) areas separated, and with disposable protective clothing and plastic materials in use. HVS I fragments (700 bp) from the personnel performing sample handling (anthropologists, archaeologists, and molecular biologists) were amplified in order to control for the possibility of contamination. DNA Extraction DNA was extracted from 0.1 g of powdered bone or tooth material (Figure 7.1) by a phenol/chloroform method (Montiel et al. 2001). DNA extracts were analyzed with a Bioanalyzer High Sensitivity DNA Assay (Agilent 2100) to quantify and assess the quality of extracted DNA. Amplification and Cloning of HVS I Segment (Positions 16190–16339) A 149 bp fragment located between positions 16190 and 16339 (numbered according to Anderson et al. 1981) of the HVS I was PCR amplified (primers MT R16339 5' GTGCTATGTACGGTAAATGG 3' [Solórzano Navarro 2006] and MT F16190 5' CCCCATGCTTACAAGCAAGT 3' [Montiel et al. 2001]) and cloned using the PCR 2.1 TOPO TA® system (InvitrogenTM). A minimum of five clones per sample were amplified and sequenced in both directions. Figure 7.1. Photo of the DNA extraction process. Teeth were cut transversally and the sample was obtained from the pulpar chamber using a dental drill. Bone or tooth powder was collected directly into test tubes for DNA extraction. (Photo by Brenda A. Álvarez Sandoval)

Genetic Analysis of Teopancazco Burials: Inferences on Multiethnicity · 167

Haplogroup Determination We analyzed a set of diagnostic mutations characterizing haplogroups A, B, C, and D, located in the HVS I amplified fragment (Torroni et al. 2006). The haplogroups were confirmed using HaploGrep, which is supported by the most up-to-date knowledge of the mtDNA phylogeny (Kloss Brandstätter et al. 2011). The haplogroup was also determined by amplifying specific fragments of the coding region followed by high resolution melting (HRM) analysis. Data Analysis Nei’s genetic diversity index is defined as the probability that two randomly chosen haplogroups are different in the sample (Nei 1987); and the haplotype diversity index (h) measures the probability that two randomly chosen haplotypes in the sample are different (Nei 1987; Tajima 1983). These indices were calculated for haplogroup and haplotype data, respectively. Exact tests of population differentiation were carried out to test the hypothesis of the random distribution of haplogroups in the analyzed samples (Raymond and Rousset 1995) using Arlequin software v. 3.5.1.2 (Excoffier and Lischer 2010). One-way ANOVA was performed in order to compare Nei’s genetic diversity indices, at the haplogroup level, in the three chronological groups analyzed. Then a two-tailed t-test was performed in order to compare Nei’s genetic diversity indices, at the haplotype level, in the temporal groups analyzed. These analyses were carried out using GraphPad Prism software v 6.00 (www.graphpad.com). Sex Determination Sex determination was based on real-time PCR amplification of small fragments of the amelogenine gene, followed by HRM analysis, according to Álvarez Sandoval and colleagues (2014) (see also chapter 8).

Results Bioanalyzer results showed low DNA quantity and a high DNA fragmentation pattern, with most of the fragments between 20 and 70 bp in all samples analyzed, indicating generally poor DNA preservation in these samples (Figure 7.2). Probably for this reason, amplification of a short DNA fragment (a complete sequence of mitochondrial DNA) was accomplished only for 16 of the 46 samples available (34.78%). Nevertheless, the amplified

168 · B. Álvarez Sandoval, L. Manzanilla, and R. Montiel

Figure 7.2. Bioanalyzer High Sensitivity DNA Assay, showing the fragment size distribution of aDNA molecules. Numbers above the distribution line are DNA base pairs (bp). Sharp peaks correspond to molecular weight markers. Ancient DNA fragments are mainly distributed in the 20–70 bp range. Higher molecular weight fragments are attributable to bacterial or fungal DNA from soil contaminating the sample.

fragment allowed us to determine the haplogroup of each of these samples, as well as to estimate diversity indices. Haplogroup Frequencies The haplogroup determined for the amplified individuals (n = 29) is reported in Table 7.1. All samples correspond to previously reported Native American haplogroups (Figure 7.3) (Achilli et al. 2008; Brown et al. 1998; Torroni, Chen et al. 1994; Torroni, Schurr, Cabell, et al. 1993; Torroni, Schurr, Yang et al. 1992; Wallace 1994). With a frequency of 55 percent, haplogroup A was the most common; haplogroups B and D were less often represented, at 21 and 17 percent, respectively; while haplogroup C had the lowest frequency (7%) (see Table 7.2). These haplogroup frequencies are similar to those found in other studies from ancient prehispanic populations (González Olivier et al. 2001; Kemp, González Olivier et al. 2010; Kemp, Reséndez, et al. 2005; Mata Míguez et al. 2012; Merriwether et al. 1997; Vergara Pérez 2006). In the 10 samples from the Tlamimilolpa phase (AD 200–350), a higher level of haplogroup A (60%) was detected, followed by haplogroup C (20%), and a similar proportion of haplogroups B and D (10%). This pattern resembles that reported for other prehispanic

Genetic Analysis of Teopancazco Burials: Inferences on Multiethnicity · 169

Table 7.1. Mitochondrial Haplogroups Found in Teopancazco Burials Burial

Chronology

105 103 60 108 107 RT14239 99 110 101 116 46 45 96 61 89 49 56 RT12805 92 59 55 102 38 2 3 10A 4 1B 5

Tlamimilolpa Tlamimilolpa Tlamimilolpa Tlamimilolpa Tlamimilolpa Tlamimilolpa Tlamimilolpa Tlamimilolpa Tlamimilolpa Tlamimilolpa Transition Transition Transition Transition Transition Transition Transition Transition Transition Transition Transition Xolalpan–Metepec Xolalpan–Metepec Xolalpan–Metepec Xolalpan–Metepec Xolalpan–Metepec Xolalpan–Metepec Xolalpan–Metepec Xolalpan–Metepec

Mitochondrial Haplogroup C D A A B A A C A A A A B A A B A C C B B D A A C A A A B

populations, where haplogroup A is always present at the highest frequency (González Olivier et al. 2001; Kemp et al. 2005; Mata Míguez et al. 2012; Merriwether et al. 1997; Muñoz et al. 2003). A similar pattern continues for the eight samples in the Xolalpan phase (AD 350–550), with haplogroup A showing a higher frequency than the others (A: 61%, B: 13%, C: 13%, and D: 13%). The 11 samples from the transitional phase (AD 320–370) were characterized by a relatively lower but still dominant frequency of haplogroup A (50%), followed by haplogroups B and C (30% and 20%) and, notably, an absence of haplogroup D (Table 7.3). No statistically significant differences in haplogroup frequencies were detected across the three phases of Teopancazco (global exact test of population differentiation, p >0.05).

170 · B. Álvarez Sandoval, L. Manzanilla, and R. Montiel

Figure 7.3. Native American mtDNA haplogroups (map by Brenda A. Álvarez Sandoval).

Genetic Diversity The genetic diversity index calculated for Teopancazco as a whole (0.6404 ± 0.0738) is similar to that for other Mesoamerican reference populations (0.5037–0.680), with the exceptions of Xcaret and Copán (0.2967 and 0.2222, respectively) (see Table 7.2). Regarding the phases of Teopancazco represented in the sample, the Transition phase has the highest genetic diversity (0.6909 ± 0.0861), followed by the Tlamimilolpa phase (0.6444 ± 0.1518) and the Xolalpan phase (0.6429 ± 0.1841) (see Table 7.3). No significant differences in genetic diversity were detected across the three phases of Teopancazco (one-way ANOVA, F(2, 26) = 0.381, p >0.05). Haplotype Diversity A similarly high haplotype diversity (h) was observed in the Tlamimilolpa (1.00 ± 0.1265) and Transition phases (0.9643 ± 0.0772), and no significant differences in haplotype diversity were detected (two-tailed t-test, p >0.05). Haplotype diversity was not detected during the Xolalpan phase (see Table 7.3).

Table 7.2. Frequency of mtDNA Haplogroups in Teopancazco and Reference Populations N

A

B

C

D

Ĥ

Teopancazco*

29

0.55

0.21

0.17

0.07

0.6404

Xcaret (Maya)*

24

0.88

0.04

0.08

0.00

0.2355

Tlatelolco (Aztec)*

23

0.65

0.13

0.04

0.17

González Olivier et al. 2001 0.54941 Kemp et al. 2005

Copán (Maya)*

9

0.00

0.00

0.89

0.11

0.2222

State of Mexico(Mazahua) State of Hidalgo (Huastec) Isolated village in Yucatán (Maya) State of Oaxaca (Mixtec-Zapotec)

73

0.60

0.35

0.041

0.0

0.5152

97

0.67

0.216

0.041

0.061

0.5037

Merriwether et al. 1997 Moreno Centeno 2006 Vergara Pérez 2006

27

0.519

0.222

0.148

0.074

0.6781

Torroni et al. 1992

4

0.659

0.182

0.159

0.0

0.5190

Torroni et al. 1994

Xaltocan (Nahua)*

26

0.48

0.24

0.04

0.24

0.680

Mata Míguez et al. 2012

Monte Albán (Zapotec)*

2

1.00

0.0

0.0

0.0

n.d.

Muñoz et al. 2003

Reference This chapter

Notes: Ĥ = Nei’s gene diversity index; N = sample size for each population; * = aDNA studies; n.d. = not determined

Table 7.3. Haplogroup Frequencies from Teopancazco Burials across All Periods N

A

B

C

D

Ĥ

H

Teopancazco, All Periods Tlamimilolpa

29

0.55

0.21

0.17

0.07

0.6404 ± 0.0738

0.9167 ± 0.0643

10

0.60

0.10

0.20

0.10

0.6444 ± 0.1518

1.0000 ± 0.1265

Transition

11

0.50

0.30

0.20

0.0

0.6909 ± 0.0861

0.9643 ± 0.0772

Xolalpan

8

0.61

0.13

0.13

0.13

0.6429 ± 0.1841

0.0000 ± 0.0000

Notes: Ĥ = Nei’s gene diversity index; h = haplotype diversity index; N = sample size

172 · B. Álvarez Sandoval, L. Manzanilla, and R. Montiel

Population Differentiation The exact test of population differentiation revealed no statistically significant differences in haplogroup frequencies between the Tlamimilolpa, Transition, and Xolalpan phases (p >0.05). Diversity Distribution by Sex In female individuals, haplogroups A, B, and D were observed, whereas haplogroup D was absent in males. Genetic diversity was higher in males than females (0.7091 ± 0.0827 and 0.5256 ± 0.1527, respectively), and the exact test of population differentiation revealed a significant difference in haplogroup frequencies between females and males (p < 0.05).

Discussion The mitochondrial haplogroups were determined for 29 burials from Teopancazco. Across the entire sample haplogroup A (55%) was most frequent, a common feature in prehispanic populations (González Olivier et al. 2001; Kemp et al. 2005; Mata Míguez et al. 2012). In general, the haplogroup frequencies at Teopancazco were similar to those found in other Native American populations. The genetic diversity index calculated for Teopancazco as a whole was relatively high (0.6404 ± 0.0738) but was similar to previously reported estimated values for other Mesoamerican populations. A relatively high diversity index is expected in multiethnic populations with high demographic fluxes. This could explain the levels of diversity found in Teopancazco and in other populations, such as the Nahua populations (Mata Míguez et al. 2012). In order to assess changes in the genetic composition of Teopancazco over time, samples from the Tlamimilolpa (n = 10) and Xolalpan (n = 8) phases, as well as the Tlamimilolpa–Xolalpan transition (n = 11), were analyzed and compared. Previous evidence has suggested that the Tlamimilolpa population at Teopancazco was composed primarily of local people and foreigners from nearby sites (Manzanilla et al. 2012). Thus, lower genetic diversity would be expected as a result of limited contact with distant populations. Contrary to expectations, however, haplogroup frequencies revealed high genetic diversity (0.6444 ± 0.1518), beginning in the initial phase of Teopancazco. The data suggest that the population from Teopancazco was heterogeneous from the neighborhood’s founding (Figure 7.4).

Genetic Analysis of Teopancazco Burials: Inferences on Multiethnicity · 173

Figure 7.4. Preliminary overview of genetic diversity in Teopancazco.

At the end of the Tlamimilolpa phase, evidence of very unusual ritual activity was found that suggests a time of drastic changes (Manzanilla 2012c). During this time, 29 decapitated individuals were buried, 17 of them in the same pit (see chapter 1). They have been identified as foreigners, some of them from the coast and others from nearby areas (Manzanilla et al. 2012). This evidence might suggest a genetic differentiation between this group of foreigners and samples from the other phases. Haplogroup frequencies in the transitional phase were notable for the absence of haplogroup D, although the exact test of population differentiation indicated no significant difference between transitional and Tlamimilolpa populations or between transitional and Xolalpan samples (p >0.05 for both). Previously published studies have reported the presence in Teopancazco of migrants from corridor areas, migrants from the coastal plains, reverse migrants, and local people during Xolalpan times (Manzanilla et al. 2012; Manzanilla, ed. 2012; Morales Puente et al. 2012; Schaaf et al. 2012). The expansion of exchange routes in this phase might have increased genetic variability. However, the proportion of haplogroup A was similar in the Xolalpan (61%) and Tlamimilolpa (60%) phases, and genetic diversity values (0.6429) were similar to the levels found in the Tlamimilolpa population. Moreover, an exact test of population differentiation revealed no significant difference between Tlamimilolpa and Xolalpan populations (p >0.05).

174 · B. Álvarez Sandoval, L. Manzanilla, and R. Montiel

These results indicate genetic continuity between the Tlamimilolpa and Xolalpan phases. Sex determination of the samples by Álvarez Sandoval and colleagues (2014) allowed an assessment of genetic diversity by sex (see chapter 8). This analysis revealed higher diversity in males (0.7091 ± 0.0827) versus females (0.5256 ± 0.1527) and a significant difference in haplogroup frequencies between females and males (p < 0.05). These differences might be related to the social dynamics operating in this neighborhood center. However, further work is needed to clarify this point. In conclusion, the results indicate the continuous presence of a genetically diverse population at Teopancazco from the Tlamimilolpa to Xolalpan phases. This implies that the Teopancazco population was heterogeneous at the mtDNA level from the beginning of the site’s occupation.

8 The Children of Teopancazco Genetic Analysis and Archaeological Interpretations Brenda A. Álvarez Sandoval, José Ramón Gallego, Linda R. Manzanilla, and Rafael Montiel

Data from 116 formal burials found in the Teopancazco neighborhood center have shown that infants and children are overrepresented (see chapter 2). Previous studies have established different burial rituals for babies versus children and adolescents (see Manzanilla 2012b; Manzanilla et al. 2012). This distinction in burial treatment might suggest that not all children played the same role within the population of Teopancazco. Infant and child burials have been associated with diverse sectors in the neighborhood center, including a possible medical sector as well as military and ritual sectors. An important question is whether some of these differences might be related to sex. However, sex identification has been especially difficult to determine in sub-adult skeletons. In this research, we determined sex by analyzing aDNA extracts from infant and child skeletal remains. The analysis is based on real-time PCR amplification of minute fragments of the AMEL gene followed by an HRM analysis, based on the comparison of melting curves of the amplified fragments. This information is useful in assessing differential patterns of distribution and in exploring the roles that girls versus boys might have played in this neighborhood. The study of an ancient civilization entails an understanding of the nature of population dynamics at that time by inferring the roles that women and men might have played within every sector of the population. Human remains are a key source of information, but in traditional archaeological studies adults are more extensively studied, whereas children’s remains receive less attention due to methodological issues. Infant studies have been rare due to factors such as the low incidence of samples, fragility of remains (taphonomy), or skeletal immaturity, which may cause them to be

176 · B. Álvarez Sandoval, J. R. Gallego, L. Manzanilla, and R. Montiel

overlooked in the archaeological recovery process (Malgosa 2010). Studies of children have however increased in recent years (Molero 2013). One of the most important requirements in ancient human population studies is sex determination of human remains because this is the basis for any demographic profile, such as differential mortality rates between sexes. Other useful information can be gleaned from a consideration of the sociocultural context, such as social status, mortuary treatment, and distinctive burial rituals, and from an assessment of differential patterns of disease, diet, status, mortality rates, and material possessions by sex (Molero 2013). Some studies of children also have potential social significance, because children are generally overlooked as important actors in ancient societies (Malgosa 2010). Children are important to study in the Teopancazco neighborhood center because of their numbers—approximately 27 percent of the 116 formal burials found in Teopancazco are children (Alvarado Viñas 2013; Gallego 2013)—and because they had not been sexed prior to the present study. Thus, investigating the role played by children in this neighborhood center was an unexplored potential source of valuable information. In this study we first determined the children’s sex, then analyzed the archaeological context for each burial in an attempt to elucidate any significant sex-based differences in burial patterns at Teopancazco. Currently, sex determination studies are based on the dimorphism between sexes that is present in the majority of humans. Archaeological studies generally use morphological methods based on osteological measurements (Albanese 2003; Aye 2010; Dabbs and Moore-Jansen 2010; Ramadan et al. 2010; Rissech et al. 2008; Spradley and Jantz 2011). Other methods to determine sex are anthropometric measurements of the limbs, hands, index and ring fingers, and the internal auditory meatus (Graw et al. 2005; Kanchan and Krishan 2011; Kanchan and Kumar 2010; Moudgil et al. 2008). It has however been reported that sex determination by osteological measurements is only 100 percent accurate when the sample is from an adult, the skeleton is complete and well preserved, and the morphometric variability in the population to which it belongs is known (Mayall 2011; Rodríguez 1994). However, other methods can be used to determine a child’s sex with 70–90 percent accuracy. Of primary importance are differences in the fetal pelvis, mainly in the sciatic notch dimensions, the sub-pubic angle, and the non-elevation of the auricular surface; mandibular traits are also significant (Boucher 1957; Schutowski 1993; Villadóniga 2005; Weaver 1980).

The Children of Teopancazco: Genetic Analysis and Archaeological Interpretations · 177

More sensitive methods to determine sex involve molecular biology tools based on DNA analysis (Akane, Matsubara, et al. 1991; Akane, Seki, et al. 1992; Faerman et al. 1995; Lassen et al. 1996; Mannucci et al. 1994; Nakahori et al. 1991; Sullivan et al. 1993; Velarde Félix et al. 2008). Current methods employ analysis of the human amelogenin gene (AMEL) present only in the sex chromosomes (X and Y) (Bailey et al. 1992; Salido et al. 1992; Sasaki and Shimokawa 1995; Slavking 1997). Although these methodologies are widely used in forensic science, they are not sensitive enough to determine sex in extremely small or poorly preserved samples, a condition common in Mesoamerican remains, due to warm environmental conditions. Recently, analyses by real-time PCR based on melting-curve analysis using SYBR® Green as a DNA-binding dye have been reported (Andréasson and Allen 2003), although the efficacy of the dye has been questioned (Giglio et al. 2003; Karsai et al. 2002; Varga and James 2006). In response we developed a new method based on real-time PCR amplification of small fragments of DNA (61 and 64 bp), followed by HRM analysis using a saturating DNA-binding dye. This method has proven useful even for samples where previous methods were ineffective (Álvarez Sandoval et al. 2014). Genetic Analysis Over 13 field seasons of the “Teotihuacan: Elite and Rulership” project, bone and tooth samples from 14 infant or children were collected at Teopancazco (Figures 8.1–8.3). Samples were sent to the aDNA laboratory in Langebio, CINVESTAV to be analyzed. All analyses were carried out under strict contamination controls and DNA was extracted from 0.1 g of powdered bone or tooth, as described in chapter 7. Negative extraction controls and negative PCR controls were always employed. Sex Determination by HRM HRM analysis was carried out using the LightCycler® 480 High Resolution Melting Master (Roche) developed for double-stranded DNA samples differing in sequence. It contains ResoLight as a saturating double-stranded DNA-binding dye, which enables the detection of sequence variations by different melting curve shapes. Sex determination by HRM analysis started with the amplification (80 cycles) of small fragments (61 bp for the X-encoded and 64 bp for the Y-encoded versions) of the human AMEL using the LightCycler® 480 Real-Time PCR Instrument (Roche). After the PCR step, the samples were heated from 60 up to 95°C; gradually melting the DNA fragments and releasing the dye to produce a drop of fluorescence.

Figure 8.1. Pit burial of a young child of 4–6 years (burial 4) (photo by Linda R. Manzanilla).

Figure 8.2. Perinatal infant buried on top of decapitated individuals (burial 51) (photo by Linda R. Manzanilla).

The Children of Teopancazco: Genetic Analysis and Archaeological Interpretations · 179

Figure 8.3. Two toddlers (2–4 years) buried under an early altar (burials 99 and 100) (photo by Linda R. Manzanilla).

The LightCycler® PCR Instrument is capable of precisely capturing a large number of fluorescent data points per change in temperature, in order to generate a melting curve chart of sample fluorescence according to temperature. The analysis also displays the first negative derivative of these sample curves, resulting in a new graph where the melting temperature of each sample appears as a peak. A plot that distinguishes the different melting temperature curve profiles produced by male and female samples appears in Figure 8.4. Anthropological Data Infants and children account for approximately 27 percent of the total number of individuals exhumed at Teopancazco. In 13 seasons of excavation (Manzanilla 2012c), remains of 36 individual children were obtained, which can be classified into the following age groups: 22 neonates and infants, 5 children younger than five years, 5 older than five years, and 4 of unknown age (Alvarado Viñas 2013). The children’s ages were estimated using tooth eruption (Ubelaker 1989), the union of the epiphyseal cartilage and ossification centers (Schaefer et al. 2009), and cranial and postcranial

180 · B. Álvarez Sandoval, J. R. Gallego, L. Manzanilla, and R. Montiel

Figure 8.4. A dissociation curve HRM analysis displays the different melting temperature of DNA from the X and Y chromosomes, distinguishing male from female samples.

measures according to the protocols of Fazekas and Kósa (1978). Of the 36 children exhumed, five of them demonstrated porotic hyperostosis, two also had cribra orbitalia, and two had scurvy (chapter 2; also Alvarado Viñas 2013). All of these burials have been described in Manzanilla (2012b, 2012c) and the data for the samples analyzed in this chapter are summarized in Table 8.1. Comparison of Molecular and Archaeological Data The sex determination by HRM was validated by comparison with PCR results from selected adult remain samples of known sex, determined with conventional osteological methods, and by comparison with other analytical methods (Álvarez Sandoval et al. 2014). Once validated, the method was used for sex determination of unsexed samples, and the results were integrated with anthropological data previously reported in Table 8.1.

Results The bioanalyzer results showed low DNA quantity and a high DNA fragmentation pattern in all samples analyzed, indicating generalized poor DNA preservation in these samples (Figure 8.6). Nevertheless, sex determination

36–40 weeks

110

In pit

Main pit

Main pit

Main pit

Main pit

Oval pit

Tlamimilolpa

Tlamimilolpa

Tlamimilolpa

Tlamimilolpa

Transition

Transition

Oval pit

Circular closed

Altar

Altar

In pit

Main pit

End of Circular Tlamimilolpa?

Transition

Transition

Transition

Transition

Position

Sector

Northeast

Single

Primary

Multiple Primary

Indirect Multiple Primary

Direct

Direct

Type of Burial

Northeast

Indirect Single

Primary

Termination ritual Indirect Multiple Primary

Termination ritual Indirect Multiple Primary

n.d.

Flexed decubitus-dorsal

Flexed decubitus-dorsal

Flexed decubitus-dorsal

Flexed decubitus-dorsal

Northeast

Northeast

Early ritual

Early ritual

Residential

Secondary

Indirect Single

Indirect Single

Primary

Secondary

Indirect Multiple Primary

Indirect Multiple Primary

Indirect Single

Flexed left lateral decubitus Termination ritual Indirect Multiple Primary

Flexed right lateral decubitus

Flexed decubitus-dorsal

Flexed decubitus-dorsal

Flexed left lateral decubitus Termination ritual Indirect Multiple Primary

Flexed left lateral decubitus Termination ritual Indirect Multiple Primary

Sitting

Flexed left lateral decubitus Military

On top of pit Flexed left lateral decubitus Military

Pit

Notes: g.a. = gestational age Source: Based on Gallego (2013) and Manzanilla (2012b).

3–4 years old

2–4 years old

99

6 ± 2 months

38–40 weeks g.a.

96

100

38–40 weeks g.a.

61

101

38–40 weeks g.a.

38–40 weeks g.a.

38–40 weeks g.a.

51

56

36–40 weeksg.a.

49

59

38–40 weeks g.a.

45

Xolalpan

Xolalpan

6–8 years

36–40 weeks g.a.

4

Xolalpan

± 8 years

3

38

Period

Burial Age

Table 8.1. Profiles of the Children Analyzed

182 · B. Álvarez Sandoval, J. R. Gallego, L. Manzanilla, and R. Montiel

Figure 8.5. Proportion of males and females in the child and global populations of Teopancazco.

by HRM was effective in 92.85 percent (n = 14) of the samples analyzed, in spite of their poor DNA quantity and quality (Figures 8.7 and 8.8). It was impossible to obtain a third replica for only one of the samples (burial 99). The results obtained show that 50 percent of the children were male and 50 percent female (Figure 8.5; Table 8.2), which contrasts with the sex

Figure 8.6. Ancient DNA degradation pattern in the Teopancazco samples (between 40 and 150 bp).

Figure 8.7. Sex determination by HRM analysis of two male infants recovered from Teopancazco, Teotihuacan.

Figure 8.8. Sex determination by HRM analysis of a female infant recovered from Teopancazco, Teotihuacan.

184 · B. Álvarez Sandoval, J. R. Gallego, L. Manzanilla, and R. Montiel

Table 8.2. Sex Determination of the Children by HRM Analysis Burial

Sex by HRM Analysis

Period

3 4 38 45 49 51 56 59 61 96 99 100 101 110

Female Male Female Female Female Male Female Male Female Male Male Male Female Male

Xolalpan Xolalpan Xolalpan Transition Transition Transition Transition n.d. Transition Transition Tlamimilolpa Tlamimilolpa Tlamimilolpa Tlamimilolpa

ratio calculated for adults using osteological measurements, which showed males were very overrepresented (see chapter 2). Comparison of Molecular and Archaeological Data The HRM analysis results (see Table 8.2) were compared with the archaeological data available to date for the children buried in Teopancazco (see Table 8.1). The comparison suggests a possible correlation between sex and type of burial, but not between sex and occupation period, orientation of the body, or age. Only a single female infant was found, a secondary burial of a roughly six-month-old baby, buried in the Tlamimilolpa phase (burial 101), compared to three males (burials 99, 100, and 110) found as primary burials. Of these, burials 99 and 100 were male children around three years of age, placed together in an important ritual burial inside an altar (Manzanilla 2012c). This observation might indicate a distinctive burial pattern associated with rituals differentiating sexes during Tlamimilolpa. The other two babies (a female and a male) were placed inside vessels and covered with another vessel as a lid. They are located in a row of aligned pits in the medical sector of the neighborhood center, a location that suggests they died either in birth or within a few months after it. This is particularly true for the female baby (burial 101), who had porotic hyperostosis and cribra orbitalia (chapter 2; also Alvarado Viñas 2013). Mainly female neonates were found in termination rituals, such as the mass burial occurring in the transition between the Tlamimilolpa and

The Children of Teopancazco: Genetic Analysis and Archaeological Interpretations · 185

Xolalpan phases, where 6 infants were buried in one large pit with 17 decapitated adults (surrounded by other small pits) (see chapter 1 and Manzanilla 2009a, 2012c). Recall that the main pit (AA142–144) held a pyramid of vessels, each containing the head of an adult, with six perinatal infants placed in a flexed position on top of these vessels. Four of these burials were females (burials 45, 49, 56, and 61), who were deposited at the west corners of the pit, whereas the male and unsexed babies were on the east. Two children (burials 3 and 4), female and male respectively, from the Xolalpan phase were analyzed. These cases suggest that for children older than six years of age there may have been a sex-based differentiation in objects accompanying the burial, implying they were for all practical purposes considered adults. Each body was surrounded by objects that hinted at the child’s role in society, and stable isotope analyses indicate both ingested the same diet as adults. Burial 3, a female of about eight years of age, was accompanied by marine shells, slate, mica, and a needle fragment. Burial 4 was a male approximately six years of age, interred with slate, a miniature theater-type censer often associated with soldiers at Teotihuacan, and two complete male figurines, one representing a warrior and the other an elite person (Manzanilla 2012b, 2012c). Each was buried in a flexed position in a pit (the common pattern for local adult Teotihuacan burials) (see Manzanilla and Serrano, eds. 1999) in the southwestern sector of the neighborhood center, which was perhaps where the neighborhood’s military guards lived.

Discussion The genetic data obtained in this study indicated that equal proportions of boys and girls were buried in Teopancazco, in distinction to the adult population, where only 10–15 percent of burials have been identified as female (chapter 2; Alvarado Viñas 2013; Manzanilla et al. 2012). This finding suggests that there may have been no significant difference in childhood mortality rates between females and males in this site. The high proportion of children reported at Teopancazco—approximately 27 percent of the formal burials—indicates a high childhood mortality rate (mainly perinatal mortality). This finding is reinforced by data from different Teotihuacan neighborhoods: Conjunto Arquitectónico A (La Ventilla 1992–1994) where 67 percent of burials (n = 158) were perinatal babies (Gómez Chávez and Núñez Hernández 1999); Tlajinga 33, where 43 percent (n = 28) of burials were under two years old at death (Storey 1992); La Ventilla B had a

186 · B. Álvarez Sandoval, J. R. Gallego, L. Manzanilla, and R. Montiel

20 percent (n = 34) infant mortality and a 13 percent (n = 24) childhood mortality rate (Serrano and Lagunas 1974); in the west of Teotihuacan, infants represent 40 percent (n = 10) of burials (Cid and Torres 1999); and in Oztoyahualco 15B: N6W3, the rate of death before age three was 27.5 percent (n = 11) (Civera 1993). Several hypotheses have been proposed to explain the high frequency of infant burials in Teotihuacan: the differential treatment of infants, who are mostly found in indirect burials (Terrazas 2007b); high infant mortality rates due to hot weather and limited access to water; epidemic diseases of various types (Paddock 1987; Rattray and Civera 1999); the young age of mothers (Cid and Torres 1999); and intrauterine growth retardation due to malnutrition and poor health (Cid and Torres 1999; Storey 1986, 1987). There is a row of pits in the medical sector of Teopancazco containing male and female infants from the Tlamimilolpa phase. It is possible that women came to the neighborhood center to give birth and these burials represent babies who died during or shortly after birth. Current literature reports a frequent association of perinatal remains with walls, and especially altars. This raises possibilities of a religious practice of induced abortion in a ritual context (Serrano and Lagunas 1974), or of dedicatory sacrifice and offering of infants at the time of construction (Gómez Chávez and Núñez Hernández 1999; Jarquín and Martínez 1991; Spence and Gamboa 1999; Storey 1987). However, until now there had been no genetic studies carried out to correlate the infant’s sex with its burial pattern. The present research suggests a possible relation between sex and type of burial, but not between sex and phase of occupation, orientation, or age. It is interesting to note that the two children associated with a Tlamimilolpa altar were approximately three-year-old males. It is also interesting that in the main pit of decapitated individuals the male infants were placed to the east and the females to the west. The significance of this symbolic disposition eludes us at present. Future genetic analysis could be helpful in assessing if the ancestry of the children has any bearing on their burial patterns.

9 Faces of Ethnicity at Teotihuacan Facial Approximation of Five Classic Period Skulls from Teopancazco Lilia Escorcia, Linda R. Manzanilla, and Fabio Barba

The great metropolis of Teotihuacan is noteworthy in the context of ancient America for its abundant evidence of immigration from different regions of Mesoamerica. This diversity is reflected not only in the characteristic morphoscopic traits of skulls, and therefore in physical appearance, but also in culturally modified biological traits, such as cephalic skull deformation, which must also have been evident in facial appearance.

Cultural Features in the Re-creation of Biological Appearance Ethnicity refers to the study of the dynamic nature of ethnic minorities and migrant groups, the cultural relations, the multiple forms of communication implied, and the sense of belonging an ethnic identity entails (Terrén 2002). Such manifestations of identity are reflected in objects produced by cultures, enabling us to analyze interethnic relations through trade routes, exchange of goods, housing types, and other materials, among other cultural and symbolic aspects shared in a given social context. Although ethnicity can be viewed as cultural differences that arise from social interaction and contribute to processes of cultural identity, people who identify themselves as members of a culture group usually also share biological features, which are constantly reshaped as a byproduct of migration and cultural contact. Thus ethnicity is a relationship that encompasses “traits of particular cultures, traditions, languages and systems of beliefs, texts and stories that have shaped them, and is the product of several stories and interwoven cultures belonging to several ‘homes’ at the same time” (Terrén 2002:49). Ethnicity also redefines biological traits via

188 · Lilia Escorcia, Linda R. Manzanilla, and Fabio Barba

interbreeding, although physiognomic features are preserved and shared with others as a trait of shared identity through inheritance. Such is the case for cephalic and dental modifications in Mesoamerica, in terms of their forms, techniques, and instruments used. In this chapter we re-create the facial features of five prehispanic skulls belonging to people who worked or lived and were buried in the neighborhood center of Teopancazco, Teotihuacan, during the Classic period. These reconstructions are based on the composite of physiognomic features, taking the skull as a point of reference, along with the main features, to form a portrait using the computer database La cara del mexicano (Caramex; The Mexican Face; project directed by Carlos Serrano and María Villanueva; see Serrano et al. 2000). We reconstruct a frontal view and create an artistic rendering of the profile, following the guidelines of the sculptural procedure and studies of the somatoscopic traits of the reference population. This procedure uncovers phenotypes and allows us to compare and contrast biological facial forms.

Art and Science: Representing Teotihuacan Faces The methods used in this undertaking were derived from physical anthropology and art: the morphoscopic view, craniometry, a composite portrait generated with the assistance of Caramex, facial sculptural approximation techniques (Gaytán Ramírez 2004), and artistic drawings. To begin we compiled front and profile photographs to form a database of each skull superimposed against a metric scale to obtain the individual’s “biographical” features (Table 9.1). Age, sex, and chronology data came from Manzanilla (2012b) and Alvarado (2013); also see chapter 2. Then biological traits were observed; some direct measurements were made of the adult skulls, while other measurements were carried out by means of the photographs. This information was used to calculate and rank indices of facial forms for the reconstruction of facial features: eyes, nose, mouth, and ears (Table 9.2). The principal dimensions used were maximum transverse breadth, maximum anteroposterior breadth, minimum frontal breadth, bi-zygomatic breadth, nasal height, nasal breadth, orbital height, orbital breadth, upper facial height, total facial height, bregma-basion height, nasion-basion breadth, prosthion-basion length, total length of the jaw, bicondylar width, bigonial breadth, glabella-subnasale length, coronal height of the upper and lower incisors, interorbital breadth, intercanine breadth, and the breadth

Table 9.1. Age, Sex, Lesions, and Bone Markings of Each Skull Burial No. Sex and Age Provenance 4

39

48

91

92

Special Features

Observations

Late Xolalpan Inflammatory process in the Local upper part of the right parietal lobe with traces of injuries using sharp instrument. Apparent square-shaped (36 × 18 mm) surgical process on the temporal bone. Light inflammatory process in the left parietal lobe virtually regenerated, with light brands made by sharp instruments. Male 20–25 Transition (ca. Right parietal perimortem Origin possibly years AD 350) injury: fissure at the coronal from Puebla, region, depredation and in- 1,200 masl. Added flammatory process with cellturban. regeneration. Jaw: postmortem loss of a bone fragment in the left condyle. Cephalic modification of the oblique tabular type. Male 15–20 Transition None No lines of expresyears (ca. AD 350) sion and without dewlap Facial paralysis: Male 20–25 Transition Sagittal band, modified facial deviation years cephalic tabular oblique mimetic type; periodontal to the damaged disease in lower left third side, disappearmolars. Sinking of the right ance of nasolabial parietal lobe at the height of folds; drooping of the coronal suture. Orbital cheeks and nasal asymmetry: smaller on left wings, wrinkles erased, exagside. geratedly open, unblinking eye.

Male 5–7 years

Male 20–25 Transition years

Cephalic modification of the From a high altiintermediate oblique tabular tude (2,800 masl), type. Orbital asymmetry: perhaps Toluca or Pico de Orizaba smaller on left side.

190 · Lilia Escorcia, Linda R. Manzanilla, and Fabio Barba

Table 9.2. Indices and Classification of Certain Facial Features of the Adult Skulls Burial Number Craniofacial indices

39

48 0.00——

91

92

Horizontal cranial (upper view) Fronto-parietal transverse (front)

88.17, short skull 73.83, broad forehead

81.50, short 84.70, short skull skull 66.67, medium 61.29, narrow front front

68.75, medium front

Vertical-longitudinal (side view) Vertical- transversal (back view) Medium tall

0.00——

0.00——

0.00,——

0.00,——

0.00,——

0.00,——

Total face

90.98 high and narrow face

76.92, wide and short face

82.27 wide and 95.89 high and short face narrow face

Upper face

54.14, medium 41.42, wide and face short face

48.23, wide and 58.22, high and short face narrow face

Orbital features

87.50, medium 92.00, high orbits 75.61, medium 83.33, medium orbits orbits orbits

Nasal features

46.67, narrow nose

Mandibular features

85.59, medium 75.00, wide jaw jaw

77.17, wide jaw 70.07, wide jaw

Flower’s gnathic index

0.00,——

98.06, maxillary bite protrusion

76.30, high 68.31, low skull skull 93.62, medium 80.65, low skull skull 84.08, medium 73.96, low skull skull

61.54, wide nose 50.00, medium 43.24, narrow nose nose

0.00,——

100.00, maxillary bite protrusion

between the first and second upper premolars on both sides. In addition the angle of orientation of the mastoid bone was obtained. Once the appropriate front and profile images were selected, they were refined and scaled using the Photoshop program. Subsequent graphic reconstruction of some parts of the skulls in poor condition was carried out by mirror symmetry, in order to provide the basic elements on which to build the facial features (Figure 9.1).

Basic References The main craniometric points—glabella, nasion, supraorbital ridge, infraorbital ridge, dacryon, ectoconchion, subspinale, alar, infradentale, supra-

Faces of Ethnicity at Teotihuacan: Facial Approximation of Five Classic Period Skulls · 191

Figure 9.1. Graphic reconstruction of missing bone tissue by mirror symmetry.

dentale, and pogonion—were positioned to locate the facial features. We also drew the facial X, which consists of a line that begins at the ectoconchion, passes through the subnasale and extends to the dental occlusion on both left and right sides. This serves to place the chelion point on each side to determine the corners of the mouth (George 1993). Then the average thickness of the soft tissue of the face for the adult Mexican population was superimposed on the frontal photograph of the skull (Villanueva Sagrado et al. 2006). The same was done in profile, and the facial contour was classified using the Pöch classification system. For all four adults, however, particularly those with cranial deformation, the Pöch forms were adapted, since most contours did not fit the standards, given the biological origin reference of the classification system (Figure 9.2).

Facial Features The reconstruction of facial features is based on two fundamental aspects: the structure of the skull and soft tissue. Various published medical and anthropological studies, especially those pertaining to living populations, made it possible to understand the structural relationship between the bone and soft tissue of the face, such as the location of the general trait forms. However, lack of knowledge of phenotypic expression and

192 · Lilia Escorcia, Linda R. Manzanilla, and Fabio Barba

Figure 9.2. Basic facial approximation illustrating craniometrics, thickness of the soft tissues of the face, facial X, and contours and lines for the eyes, nose, lips, ears, and face.

population variability poses a challenge in this task; for instance, the shape of the eyelid crease, the color of the iris, the hairiness of eyebrows, the color and texture of skin, the color and shape of hair, the form and size of ears, the shape of the lips, and the appearance of fine lines are all unknown. For these details it was necessary to rely on somatoscopic and anthropometric studies in populations biologically close to those being analyzed, although such studies are rare. Moreover, the presence of moles and superficial scars is difficult to assess from skulls or somatoscopic studies; still, deep scars or bone injuries can be represented in a facial approximation on the basis of extant evidence, such as a nasal fracture or any pathological lesion. The shape of the face was determined according to the facial contour adapted for each skull (Figures 9.3 and 9.4). The location and shape of the eyes was estimated according to the shape of the orbits (Stephan et al. 2009), taking into account the population of Central Mexico (López Alonso 1982). The outline of the nose was traced following the contour of

Faces of Ethnicity at Teotihuacan: Facial Approximation of Five Classic Period Skulls · 193

Figure 9.3. Frontal views of the four adult skulls from Teopancazco.

Figure 9.4. Reconstructed faces of the four adult males.

the bone structure; the construction of the nasal wing was based on a third of the nasal width (Hoffman et al. 1991). The construction of the nose in profile follows Prokopec and Ubelaker’s (2002) guidelines (Figure 9.5 and Figure 9.6). The height of the lips was based on each individual’s age, his biological origin, and the relationship of the height of the dental crowns in occlusion with the length of the mouth. For the ears, the subject’s age was essential, since length increases in old age. For the size of the ear, the relationship of the glabella to the subnasale point was taken into account (Villanueva Sagrado 2010). Once the location and shape of each feature was defined, a composite portrait was assembled with the assistance of Caramex. Finally, the skin was pigmented on the basis of photographs of individuals currently living in the Teotihuacan area. Due to the scarcity of studies, the child’s face was reconstructed based solely on cranial traits, facial appearance for the corresponding chronological age, and elements of graphic illustration (see Figure 9.7).

Figure 9.5. Profile view of the four adult skulls.

Figure 9.6. Reconstructed facial profiles of the four adult males.

Figure 9.7. Sketch of the skull, image superposition, and illustration of facial appearance, in front and profile views, of the male child.

Faces of Ethnicity at Teotihuacan: Facial Approximation of Five Classic Period Skulls · 195

Hairstyle and Accessories Hairstyles and accessories must be derived from chronology and context. Teotihuacan was a place of craftspeople and traders bringing sumptuary goods from other regions; in this prehispanic context the artisan occupied the third rung of the social hierarchy, after rulers and priests (Durán 1880). Individuals of this rank could have worn status emblems, such as earrings and turbans or other headdresses, as depicted in archaeological figurines found at the site (Manzanilla 2012b). Their hair was most likely cut straight and semi-long, at neck length with bangs in front. This was the style worn by urban-dwelling, working-age adult males. The style was a hallmark of the individual’s social status, which was also associated with gender and age (Piho 1973:13).

Graphic Illustration Knowledge of graphic illustration has been crucial for the visual interpretation of faces. The technology has constantly been modified and adapted with photo manipulation and contrasts in facial tone achieved by superimposing texture, using the technique of cloning, and finally adding color. Use of light and shadow has made it possible to emphasize the volume or folds and layers of contours; initially the surface is masked, so that shape and volume can be defined, then texture is added later. This procedure is more robust and can correct specific features using different brushes and Photoshop tools, coupled with tablets. To reconstruct the child’s face starting from basic anthropological guidelines, we applied a coat of black and white colors to shape the face, after which facial features were illustrated manually and by computer. In all cases, hairstyles were copied from photographs not included in the Caramex program, which we adapted and illustrated manually.

Results This section describes the salient facial features and is intended to point out individual differences for each man (Table 9.3). Individual 39 This man had a broad forehead; a narrow, elongated face; medium orbits; a straight or narrow nose (leptorrhine), and medium jaw. The overall face

Table 9.3. Facial Features of the Adult Males Facial Feature

Burial 39

Burial 48

Burial 91

Burial 92

Facial contour (Pöch) Facial hair

Similar to an inverted trapezoid and G1 from Caramex Absent

Similar to a quadrangle and E2 from Caramex Absent

Similar to an inverted oval and B2 from Caramex Absent

Similar to an inverted trapezoid and B2 from Caramex Absent

Epicanthal fold

Form Ic

Form IIb

Form IIa

Form IIa

Palpebral opening axis

Horizontal, left outer corner slants slightly downward Fusiform, A4 from Caramex

Horizontal, left outer corner slants slightly downward Fusiform, E1 from Caramex

Horizontal, left outer corner slants slightly downward Fusiform, E1 from Caramex

Horizontal, left outer corner slants slightly downward

Hairiness of eyebrows

Scarce, C4 from Caramex

Scarce, C4 from Caramex

Scarce, C4 from Caramex

Scarce, C4 from Caramex

Iris color

Dark brown

Dark brown

Dark brown

Dark Brown

Nose shape

Leptorrhine, A1 from Caramex

Leptorrhine, A4 from Caramex

Nasal root

Sunken 2–1

Nasal dorsum

Convex 3–3

Platyrrhine (or Mesorrhine, B1 camerrhine), C4 from Caramex from Caramex Sunken 3–1 Slightly sunken 2–2 Straight 2–3 Concave 3–2

Nasal tip

Horizontal 2–4

Half raised 2–3

Depressed 3–3

Lip thickness

Fine or thin, A5 from Caramex

Slightly raised 2–3 Thick, C5 from Caramex

Medium, A5 from Caramex

Fine or thin, B5 from Caramex

Labial commissures

Horizontal

Horizontal

Horizontal

Horizontal

Shape of the ears

B2 from Caramex B2 from Caramex Loose Adherent

A2 from Caramex Loose

A2 from Caramex

Eye shape

Attachment of earlobe Hair texture

Fusiform, D2 from Caramex

Slightly sunken 2–3 Convex 3–3

Loose

Straight, fine

Straight, fine

Straight, fine

Straight, fine

Abundance of hair

Moderate

Abundant

Moderate

Moderate

Hair inserts

——

——

——

——

Hair pigmentation

Black

Black

Black

Black

Expression lines

——

——

——

——

Frontal transverse

C1 from Caramex C1 from Caramex C1 from Caramex C1 from Caramex

C1 from Caramex C1 from Caramex

C1 from Caramex

Nasal transverse

C1 from Caramex

Faces of Ethnicity at Teotihuacan: Facial Approximation of Five Classic Period Skulls · 197

Facial Feature Vertical glabellar lines Lateral orbitofrontal wrinkles (crow’s feet) Grooves in the upper orbitalis Grooves in the lower orbitalis Buccal-mandibular groove Mentolabial groove Labial commissures Dewlap

Burial 39 ——

Burial 48 No

Burial 91

Burial 92

——

——

C3 from Caramex No

C3 from Caramex

C3 from Caramex

——

——

——

C3 from Caramex Cheeks C1 from Caramex

C3 from Caramex

Mentolabial groove B from Caramex C2 from Caramex

Mentolabial groove E from Caramex

B3 from Caramex

No

No

C3 from Caramex No Expression lines No in cheeks C2 from Caramex Without mentola- Mentolabial bial groove groove D from Caramex C3 from Caramex C3 from Caramex No

No

Cheeks C1 from Caramex

C2 from Caramex

Note: Classification data from the somatoscopic frequencies of López Alonso (1982) and the Caramex database.

shape was similar to Pöch’s inverted trapezoid. Form G1 from Caramex was adapted to delineate the base of the face. The axis of the palpebral opening of the eyes was horizontal, with slight asymmetry on the left side, where the outside corner was lower. The upper fold slightly covered the eyelid. The eye shape was elongated, with low eyebrows. The profile of the nose had a sunken root, a convex back, and a horizontal tip. Lip commissure forms are horizontal at rest, and fine or thin lips match A5 from Caramex. Due to the chronological age of this young adult, facial lines are light, with graduation from 1 to 3 and virtually without a dewlap. In the profile view, the cephalic modification has caused a slightly elongated skull (see Figure 9.5). Individual 48 This man had a medium forehead, a wide and short face, high orbits, a wide nose (camerrhine or platirrhine) and wide jaw. The shape of his face is similar to Pöch’s quadrangle. The base of his face was adapted from Caramex E2.

198 · Lilia Escorcia, Linda R. Manzanilla, and Fabio Barba

The axis of the palpebral opening of the eyes is horizontal, with slight asymmetry on the left side, where the outside corner is lower. The upper fold of the eyelid is upward in its inner part. The shape of the eyes is fusiform or elongated, with low eyebrows. In profile the nose has a sunken root, straight shape and slightly raised tip. The lip commissures are horizontal at rest, and the lips are thick, corresponding to Caramex C5. Due to this adolescent’s age, he has very faint facial lines and no dewlap; his mentolabial groove matches form D from Caramex. Individual 91 This man had medium brows, a short broad face, medium orbits, a medium nose (mesorrhine), and a wide jaw. His face shape is similar to Pöch’s inverted oval. For the base of his face we adapted form B2 from Caramex. The axis of the palpebral opening of the eyes is horizontal, with slight asymmetry on the left side, where the outside corner is lower. The upper fold of the eyelid is slightly domed. The shape of the eyes is fusiform or elongated, with low eyebrows. In profile the nose has a slightly sunken root and the dorsum is convex and has a moderately raised tip. Lip commissures are horizontal at rest, and the lips are medium thick, corresponding to form A5 from Caramex. Due to the age of this young adult, his facial lines are light, graduated from 1 to 3, and his dewlap matches form B3, or regular. He had a mentolabial groove matching Caramex form B. This individual presents a periodontal lesion on the right side of the mandible, possibly caused by facial paralysis, so the interpretation of the lesion on the face, as well as the asymmetry, is questionable (Funes Canizález 2008). The longitudinal vertex index classifies this skull as high in profile. In this case, it is possible to observe the mark of the sagittal band, as a modeler tool for intentional cephalic modification perhaps of the mimetic oblique tabular type, which slightly flattens the upper part of the skull (see Figure 9.5). Individual 92 This man had a narrow forehead, a high and narrow face, medium-sized orbits, a narrow nose (leptorrhine), and a wide jaw. His face approximates Pöch’s inverted trapezoid. For the base of the face we adapted Caramex form B2.

Faces of Ethnicity at Teotihuacan: Facial Approximation of Five Classic Period Skulls · 199

The axis of the palpebral opening of the eyes is horizontal, with slight asymmetry on the left side, where the outside corner is lower. The top eyelid crease is slightly vaulted. The shape of the eyes is fusiform and elongated, and he had low eyebrows. In profile the nose has a slightly sunken root, the dorsum is convex, and the tip depressed or downturned. The lip commissures are horizontal at rest, and the lips fine or thin (Caramex B5). Due to the chronological age of this young adult, his facial lines are light, graduated from 1 to 3, and he lacks a dewlap. There is a very pronounced mentolabial groove (Caramex form E). According to the longitudinal vertex index, the skull is low in profile. The medial oblique tabular cephalic modification makes it appear elongated upwards and backwards, with a slight flattening in the occipital lobe (see Figure 9.5).

Discussion Ethnicity does not depend wholly on biological or racial characteristics, but rests on a set of shared cultural traits and arises from a process of identity and self-recognition of otherness. As ethnicity is individually determined, it also derives from a person’s set of traits or biological phenotype, not only in the face, but in height and body size in general. All our facial reconstructions share certain features of the population, such as spindle-shaped or elongated eyes, sparse eyebrows, dark irises, regularly vaulted epicanthal (upper) eyelids, horizontal corners of the mouth at rest, and absence of facial hair. This reinforces the assumption that multiethnic neighborhood centers such as Teopancazco were populated by groups from Mesoamerica (see Figures 9.4 and 9.6). Facial asymmetries are observed in all individuals, with predominance of the left eye, possibly due to the structural deformation of the skull. Although the asymmetry is virtually undetectable face-on in individuals 39, 48, and 91 (particularly if any head or hair accessories were worn), in profile one can see the differences and the degree of modification of the head. Note particularly skull 92, which is the most emblematic case. Recent morphoscopic population studies (such as those aimed at identifying an individual for forensic purposes) are based mainly on the relationship of the face and skull, which has allowed us to apply these findings to ancient skeletons with a fair degree of success. This two-dimensional procedure makes it possible to approximate a face from the skull, without

200 · Lilia Escorcia, Linda R. Manzanilla, and Fabio Barba

manipulating the skull and even if it is in fragile condition or is missing bone fragments. The initial facial approximations of the Teotihuacanos in the Caramex program used features of a predominantly mestizo population. In an effort to offset this bias, we pigmented the faces graphically and used some photographs of contemporary rural inhabitants of Teotihuacan.

10 The Multiethnic Population of Teopancazco Final Comments Linda R. Manzanilla

As described in chapter 1, few preindustrial urban settlements were as highly planned and multiethnic as prehispanic Teotihuacan. The coexistence of people of diverse origins must have required an efficient organization on the neighborhood level to integrate everyone into the city’s life, while identity markers (garments, headdresses, facial paint) may also have played a role in distinguishing each group within a setting where different languages would have been spoken. The city was born as a multiethnic settlement where groups of different origins settled primarily on the fringes of the metropolis: in Tlailotlacan (the Oaxaca Barrio) in the southwest and along the West Avenue, in the Merchants’ Barrio on the east side, populated by people from the Gulf Coast, and in the west a small group from Michoacán (Rattray 1987, 1988, 1989, 1993). In these peripheral sectors, archaeologists have found evidence of funerary rituals mirroring the migrants’ foreign practices; import wares from these foreign regions along with local imitations; and symbolic items such as stone slabs with glyphs, urns, and figurines (Gómez Chávez 1998; Ortega Cabrera 2014; Spence 1990, 1996). Skeletons buried in these areas belonged to individuals determined to be from other regions (Price et al. 2000; White and Schwarcz 1998; White, Spence, et al. 2004; White, Storey, et al. 2004). Foreigners have also been detected through isotopic analyses of the remains of sacrificed individuals, found in dedicatory offerings at two of the preeminent temples in the metropolis: inside the Pyramid of the Moon and below the Pyramid of the Feathered Serpent (Spence, White, et al. 2004; White, Price, et al. 2007; White, Spence, et al. 2002). At the same time, two apartment compounds of commoners have provided isotopic information

202 · Linda R. Manzanilla

identifying local Teotihuacanos: Tlajinga 33 along the southern periphery (White, Storey, et al. 2004), and Oztoyahualco 15B:N6W3 on the northwestern periphery of the city (Price et al. 2000). Near Teotihuacan’s core intermediate elites managed neighborhood centers that fostered the movement of sumptuary goods and people (Manzanilla 2012c, 2015). The latter included specialized craftsmen from different regions (Manzanilla 2006b, 2009a, 2011b, 2015). Over the course of 13 field seasons of extensive excavations (1997–2005) my project, Teotihuacan: Elite and Rulership, has addressed one of these neighborhood centers, Teopancazco, located in the modern town of San Sebastián Xolalpan (Manzanilla 2009a, 2012c, 2015; Manzanilla, ed. 2012). My colleagues and I devised an interdisciplinary approach to study the people buried in this particular multiethnic neighborhood center (see chapter 1). Through paleopathology, activity markers, nutritional status, trace elements, stable and strontium isotopes, and ancient DNA, we uncovered a very complex set of roles, origins, and socioeconomic relations (Manzanilla 2015). It appears that many foreign workers who had experienced nutritional stress in their infancy may have been attracted to such neighborhood centers by a food rationing system, the existence of which I proposed in 2011 (Manzanilla 2011b). Teopancazco yielded 116 formal burials, of which 32 percent were decapitated individuals. Many of the burials were determined to be migrants from different regions (Manzanilla 2011b, 2012c, 2015; Morales Puente et al. 2012; Schaaf et al. 2012). It appears that local and immigrant occupants of the center were closely linked, perhaps constituting a “house society,” or large corporate group; this group displays strong links to the Gulf Coast of Mexico (Manzanilla 2007a, 2009a, 2012c) through shared work as well as ritual and symbolic relationships. One possibility is that the local intermediate elite had clients from different regions along the corridor to the Gulf Coast (Carballo and Pluckhahn 2007; García Cook 1981; Manzanilla 2011b) who were “embedded” in the neighborhood center as full-time specialists. In this final chapter, I summarize the status of this population; the importance of multiethnic relations in establishing a highly complex house society in a Teotihuacan neighborhood, and the competitive relations among neighborhoods that may have been Teotihuacan’s most dynamic process, as well as an independent source of social and economic power for the city. This competitive and aggressive situation may have posed a threat to the corporate organization of the Teotihuacan state and caused

The Multiethnic Population of Teopancazco: Final Comments · 203

tension between the corporate and exclusionary organizations embedded in Teotihuacan society.

The Multiethnic Population of Teopancazco Studying the neighborhood center of Teopancazco led to the exposition of two issues: first, many newborn babies were buried in the northeastern sector (Alvarado Viñas 2013; Manzanilla 2012b, 2012c), perhaps suggesting that the women of the neighborhood came to this center for care during childbirth; second, some of these newborns were sexed by DNA (Álvarez Sandoval et al. 2014), revealing matching proportions of male and female babies, in contrast to the predominantly male ratio observed in the adult population, many of whom were skilled multi-craft specialists (Alvarado Viñas 2013; Manzanilla 2015). Significantly, with respect to the sexed adult population, Teopancazco burials were predominantly male, with only 15 percent being women (see chapter 2; Alvarado Viñas 2013; Álvarez Sandoval et al. 2015). This stands in sharp contrast to the roughly equal ratios in domestic apartment compounds such as Oztoyahualco 15B (8 females/11 males; Civera 1993), La Ventilla B (54 females/45 males; Serrano and Lagunas 1999), or Tlajinga 33 (13 females/19 males; Storey and Widmer 1999). It would seem that most domestic compounds had similar numbers of female and male burials, whereas neighborhood centers such as Teopancazco may have been used primarily for the burial of males (see Table 10.1). Different activity markers, such as roughness and asymmetry in certain articulations and joints, have been recognized at Teopancazco (Alvarado Viñas 2013; Manzanilla 2015; see chapter 2), as follows: • Of the burials 21.55 percent bore signs of having worked fibers with their front teeth (4 females; 21 males). We suspect that they were involved in making nets, which are depicted in mural art at Teopancazco (De la Fuente 1996) and may have been used to procure the 14 varieties of marine fish recovered at the site (Rodríguez Galicia 2010; Rodríguez Galicia and Valadez Azúa 2013b); net-making is also indicated by the presence of the bone shuttles (Pérez Roldán 2013) used for net manufacture. • Of the burials 7.75 percent (including three women) displayed signs of having thrown nets or spears. • Of the burials 6.89 percent (including one woman) showed signs of having sewed or painted for long periods. Significantly, two of

Sex

F M F M? F M? F? F? M ? M F

F ? M M

M M

M

Burial No.

60 39 65 91 71 72 28F 67 74 82 112 2

10A 24A 13A 78

116 105

106

30–35 y

20–25 y 16–30 y

25–30 y Adult 25–30 y 30–35 y

25–35 y 20–25 y 20–25 y 20–25 y 16–20 y 18–20 y 17–22 y 24–30 y 30–35 y 25–35 y 20–24 y 25–35 y

Age

Tl–Xol

Tlam Tl–Xol

Xol Xol? Xol Tlam

Tlam Tl–Xol Tl–Xol Tl–Xol Tl–Xol Tl–Xol L Xol Tl–Xol Tl–Xol Tl–Xol Tl–Xol Xol

Basin Basin, Tlax–Hg Basin

LTTeo LTTeo LTTeo Basin

Low Low Low Low Low Low Low LTTeo LTTeo LTTeo LTTeo LTTeo

Altitude Occupa- of Origin tion Phase (18O/16O)

Immigr

Im Local

Inv Mi

Im

Im

87Sr/86Sr

A C

A

A

A

Haplogroup

Diet

Marine Marine

Terr D Marine

Terr D

Terr ND

X X

X X X X X

Decapitated

Table 10.1. Burial Samples from Teopancazco Compiling Data from All Chapters

X

X

X

X

X X X

X X

X

X

CW/TL/ SQ/WLG/ FBS SQ CW/TL/ SQ

WLG/ FBS/ THR/SQ CW/FBS

Exostosis

HF, SQ

Mut A4 + B5

Scor- Porotic Dental MutilaHypo- butic Hyperos- Cribra Activity tion/Cranial plasia Disease tosis Orbitalis Marker Deformation

F

? M M M M M? M M? F M M? M M M M

M M F?

F M ? ? M

108

40 46 50 55 70 73 75 77 3 4 5 7 14 15 17

100 92 98

102 9 86 63 8

35–40 y 18–25 y Adult 3y 18–25 y

2–4 y 20–24 y >40 y

20–25 y 45–50 y 25–30 y 30–35 y 20–30 y 35–40 y 25–30 y 24–30 y 7–10 y 5–7 y 18–20 y 20–24 y 40–45 y 35–45 y Adult

10–15 y

Xol Xol–Met Tl? Tl Xol?

Tl Tl–Xol Xol?

Tl–Xol Tl–Xol Tl–Xol Tl–Xol Tl–Xol Tl–Xol Tl–Xol Tl/Xol Xol Xol Xol Xol–Met Xol Xol Xol

Tl–Xol

HTTeo HTTeo

HTTeo HTTeo HTTeo

Basin, Tla–Hg Basin Basin Basin Basin Basin Basin Basin Basin Basin Basin Basin Basin Basin Basin Basin

Im Im Local Inv Mi Local

Im

Local

D

C

Terr D

Marine

Terr ND

Imm N Imm N

Terr ND Terr D

Terr ND

Marine

Terr ND

C A B

B

A

A

Im Im Local Local Im Local

Inv Mi Inv Mi

Imm N

X

X

X X

X X X X X

X

X

X X

X

X

X X

X

Tab obl def Tab erect def

SQ/WLG/ THR

SQ, CW SQ/CW/ WLG

FBS SQ

(continued)

Tab obl def

SQ Exos/FBS Tab erect def

SQ

Sex

M

F F M M ? F F M F F F M F F?

? ? M M F?

Burial No.

6

101 103 99 110 107 61 45 96 89 56 49 59 38 47

43 44 48 66 68