Materials in Environmental Engineering: Proceedings of the 4th Annual International Conference on Materials Science and Environmental Engineering 9783110516623

This contains selected and peer-reviewed papers from the 4th Annual International Conference on Material Science and Env

243 30 44MB

English Pages 1609 [1406] Year 2017

Report DMCA / Copyright

DOWNLOAD PDF FILE

Table of contents :
Keynote Speech I. Strategies for Improving Hydropower Development
Keynote Speech II. Biotemplated Mesoporous Materials for Wastewater Treatments
Keynote Speech III. Design of Hard and Superhard Nanocomposites for Harsh Environment
Keynote Speech IV. Numerical Simulation of Slag Corrosion Behavior of Lightweight Refractories for Refining Ladles
Keynote Speech V. Precision Plastic Forming of Large Complex Component of Ti-Alloy
Study about the Landslide Deformation Forecast Model Based on Kalman Filter Method and Taylor Seris and Material Properties
Effects of Machining Process and Heat Treatment on the Mechanical Properties and Microstructure of TB2 Titanium Alloy Strip
Study on Compound Characteristics of Oleic Acid, Glycerol and Organic Ester in Grinding Fluid
Novel Room-Temperature Molten Salt Based on Chlorine Chloride with Hydrogen Bond Donors
Study on Organic Modification of Aluminum Powder Coating
Study on Material of Exothermic Insulation Riser Sleeve
The Efficiency Calculation of Cobalt Oxide for Artificial Photosynthesis with Exponential- Doping
Microscale Hierarchical Three-Dimensional Flowerlike CuO: Synthesis, Characterization, and its Supernormal Photocatalytic Activity under Visible Light Irradiation
The Distribution Behavior of Phosphorus at Non-Equilibrium Condition Simulating the Casting Ladle
Effects of Zr Addition on the Microstructure and Mechanical Properties of AlCoCrFeNiZrx High-Entropy Alloys
Research and Preparation of Super Hydrophobic and Self-Cleaning PVDF Membrane
Preparation and Characterization of TiB2 Coatings with Ultra-Low Residual Stress
Crystal Structure and Microwave Dielectric Properties of Ca [(Li1/3Nb2/3)0.9Zr0.1]O3-δ−xTiO2 ceramics
Mechanism of Mechanochemical Reactions in Magnesium-Aluminium Layered Double Hydroxides Systems
Deposition of Diamond Films on Complex Cutting Tools by Hot-Filament Chemical Vapor Deposition
The Crystal Unit Model of CsI(Tl) Film with Hexagon Microcolumns and Its Conversion Factor to X-Ray
Effect of Ion Etching on the Surface Morphology, Structure and Adhesive Strength of the TiN Coating
Influences of Photocatalytic Activity by TiO2 Doping with Graphene Oxide and Lanthanum on the Carrier of Cenosphere
Synthesis and Luminescence Properties of Eu3+-Doped NaTb(MoO4)2 Hierarchical Microcrystals
PtxNi/meso-Al2O3 (x = 0.60–2.07): High- Performance Catalysts for the Hydrogenation of N-Butanal at Low Temperatures
Hysteretic Behavior of CFT Columns with Semi- Rigid Base Connection under Different Loading Modes
Behavior of Liquid Phase Generation of High Phosphorus Oolitic Hematite during Sinter
Influence of the UUV Body on the Performance of the Propeller
Piezoresistivity of Polyethylene Terephthalate Nickel Powder Composite
Preparation of Ti-Cu Alloying Surface Layer on Ti6Al4V Substrate via Friction Stir Processing for Flame-Retardant Performance
Failure Analysis of Escalator Step Induced by the Bolt Surface Defects
Surface Wear Mechanism of Escalator Step Chain: A Failure Analysis
Toxicity Reduction Mechanism of ZnO NPs during Sludge Vermicomposting Process
A Nanocomposite Film of Polyoxometalate and TiO2: Preparation, Characterization and Photochromic Property
Application of Inductively Couled Plasma- Mass Spectrometry to the Speciation Analysis of Rare Earth Elements in Ion-Adsorption Rare Earth Ore
Electronic Structure of Cu2ZnSn1-xGexS4 New Energy Materials Probed by Soft X-Ray Absorption Spectroscopy
Preparation and Performance of a Chitosan/TiO2 Composite Film by Lyer-by- Layer Method
Facile Route to Synthetize Lanthanum Doped Titanium Dioxide Films for Improved Photocatalytic Performance
Contact Property of Au on p-InP
Effect of Polyethylene Oxide Concentration on Separation Performance of PVDF Hollow Fiber Plasma Separation Membrane
Influence of Phosphate Concentration and PH Crystallization of Magnesium Ammonium Phosphate (MAP)
Microstructure and Corrosion Resistance of CrMoVNbFex High-entropy Alloys
Finite Element Analysis of Composite Shear Walls with Double Steel Plates and Filled Concrete for a Nuclear Island Structure under In-Plane Loading
Exothermal Combustion Synthesis of the Composites TiB2/Ni from Ni–Ti–B System
Research on Wetting Characteristics of Normal Acid, Alcohol and Alkane on Surface of Monocrystal Silicon
Effect of Modified Argon Oxygen Decarburization (AOD) Stainless Steel Slag on Cementitious Properties
Optimization of structure Design of Physical Vapour Transport Furnace for Silicon Carbide (SiC) Crystal Growth via Numerical Simulation
Thermodynamical Analysis of the Spontaneous Combustion of FeS
Cause and Prediction Model of Low Infrared Emissivity for Resin/Flaky Metal Composite Coatings
Synthesis and Characterization of Modified Carbon Aerogels
A Review on the Application of Photocatalytic Materials
The Preparation of Nano ZnO/PVC and the Photocatalytic Degration of Waste Water from Seafood Processing
Efficient Adsorptive Removal of Arsenic from Water by Titanium-Based Metal-Organic Frameworks (MIL-125)
The Research of SVG in Three-Phase Four-Wire Power System
The Application of CDMA Technology in the Measurement of Antenna Array
Synthesis and Bactericidal Properties of MgO/TiO2 Nano-Composites
Effects of Assisting Agents Concentrations on Energy Consumption during the Electrokinetic Treatment of Contaminated Kaolin
Development of a Solid State pH Sensor Based on Electrodeposited Iridium Oxide Films for Water Quality Detection
Simple Fabrication of ZnO Hierarchical Structures with Enhanced Photocatalytic Activity
Enhanced Cycling Stability of Multi-Cations Doped Spinel Lithium Manganese Oxide for Rechargeable Lithium Batteries
Review on the Applications of Phase Change Materials (PCMs) for Building Envelopes
Damage Analysis of Cast Iron Specimen with Different Crack Forms
Study on the Performance of a High-Pressure Water Jet Dust Collector in a Powder Feeding Port of Explosive Sites
Self-Assembled Grapheme / Carbon Nanotube Fibers as Electrodes for Super Capacitors
Fatigue Life Prediction of a Kind of Frequentlyused Bolt under Random Excitations
Research on Development of Armor Protection Materials and Technology
Cold forming Cracking Reason and Solution Method of SS400 Hot Rolled Steel
Effect of Flow Rate of Cooling Water on the Interfacial Heat Transfer Coefficient between Modular Water-Cooled Mold and Casting
Study on High-Absorption Chrome Tanning Technology Assisted by CO2 Low Temperature Plasma Treatment
Simulation of Q345 Steel Billet Solidification Microstructure in Continuous Casting Based on Matlab
Preparation and Properties of Neopentyl Glycol/Epoxy Resin Composite Phase Change Material for Thermal Energy Storage
Hysteric Property Analysis for Semi-Rigid Base Connection of Concrete-Filled Square Steel Tubular Columns
An Adaptive Harmonic Current Detection for Improving the Power Quality in Power Grid
Paper Fiber Paper-Based ZnO Piezoelectric Nanogenerator for Self-Powered Energy Scavenging
Fabrication of Super-Hydrophobic Surface with Micro- Nano-Structure on Brass Substrate by Chemical Etching and Surface Modification
Preparation Technology and Experimental of Hydro-Thermal Method on Surface Modification of Biomedical Titanium
The Co-Pilot Position of Vehicle Noise Quality Prediction Based on SVM
Application of Aramid Fiber in Printed Circuit Board
Online Intelligent Sorting Method of Gold Ore based on LIBS Technology
Rapid Decolorization and Mineralization of Congo Red Using Fe78Si9B13Amorphous Alloy by Photo Fenton-Like Process
Preparation of Ce, N-Codoped Mesoporous Titania Photocatalyst with High Photocatalytic Activity under Visible Light
Preparation of TiO2/AC Composite and Characterization of Its Photocatalytic Activities
Electrocatalytic Oxidation Degradation of Reactive Red 2
Nanoscale Fe0 Supported on Three- Dimensional Graphene for the Removal of Methyl Orange from Water
Study on the Optimal Extraction of Coal Resources under the Constraint of Ecological Environment
Research on the Stability Calculation and Treatments of the Liyu Landslide in Zhuzhou City, Center Hunan Province
Procurement Cost Control of New Energy Vehicles Manufacturing Enterprise under Supply Chain Management
Domino Effect Index for Chemical Plants Based on Fishbone Analysis
Xinjiang Wind Power under “the Belt and Road Initiatives” Facing the Opportunities and Challenges
Analysis of the Fuel Efficiency of Airport End- Around Taxiway
Spatiotemporal Analysis on Pesticide Using in different Agriculture Lands over China
Policy Analysis and Capability Evaluation of China’s Cities in Response to Climate Change
Analysis of the Influence of Environmental Conditions on Individual SEFAE Rocket
Residual Characteristics of Organochlorine Pesticides in Four Kinds of Plants in Qingshitan Reservoir Region
Application and Research Progress of Toxicity Test of Daphnia Magna
Literature Mining-oriented Risk Management of Climate Change
Economic Evaluation of Renewable Energy Saving Technology Based on Analytic Hierarchy Process and Data Envelopment Analysis Method
Study on Modified Zeolite for Absorption of Fluoride in Water
Removal of Heavy Metal Ions from Aqeous Solution Using Bottom Ash as an Adsorbent
Research Progress of N2O Production in Different Wastewater Treatment Processes
Application of Alternative Environmental Protection Leather in Clothing
The Application of Green Environmental Protection Material in Clothing Design
Full-Flow Balance Analysis of Copper in Municipal Wastewater Treatment Plant of Hardware Electron-Mechanical Industrial Area
Study on Biological Treatment -Fenton - Oxidation Treatment -Biological Treated Landfill Leachate
Normal Section Bearing Capacity Test on Columns Composed by Fine Slag Aggregate Concrete
A Nonlinear Rheological Model for Rocks Considering the Tertiary Creep Stage
Construction of Multilayer Geo-Metadata Management System
Automobile Body Shop Optimization Design of Displacement Ventilation
The Research Progress of Polycyclic Aromatic Hydrocarbons Processing Technology in Coking Wastewater
Experimental Investigation on Flexural Properties of Sisal Fiber Reinforced Foam Concrete
Reservoir Modeling Constrained by Geological Conceptual Patterns of DC Oilfield in Llanos Basin
Numerical Simulation of Mold Surface Built-up Welding Temperature Field Based on ANSYS
Adsorption of β - HCH on Constructed Wetland Substrates
Structure and Spatial Distribution of Greenhouse Gas Emissions from Livestock and Poultry Manure Management
Study on Assimilable Organic Carbon (AOC) and Influencing Factors in Northern Living District Water Distribution System
A New Magnetic Pb (II)-Imprinted Polymer as a Highly Selective Sorbent for Preconcentration and Determination of Lead Ions in Wastewater Samples
Analysis on the Characteristics of Smog Pollution in the Urban Centre of Chongqing Municipal
Remote Sensing Monitoring Analysis of Typical Islands in Paracel Islands
The Structural Character and Optimal Design of Canal Aqueduct
Different Aqueduct Structure Make and Design
Liquefaction Technology of Rice Husk in Polyhydric Alcohols
Study on Engineering Example of Risk Based Inspection and Verification of Acoustic Emission Inspection for Storage Tank Group
Experimental Setup for Boron Meter Accuracy Analysis in Nuclear Reactor Environment
Effects of Material Dispersion on Heat Transfer Analysis of Integrated Thermal Protection Systems
Dust Pollution Emission Characteristics and Dust Suppression Effect of Porous Windbreak and Large Strip Warehouse Based on Wind Tunnel Experiments
Removal of Cadmium, Iron and Sulfate from Synthetic Acid Rock Drainage Using Metal- Tolerant Sulfate Reducing Bacterial Sludge
Measures to Prevent Subsea Wellhead Instability for Deepwater Drilling
Simultaneous Analysis of Methanol, Ethyl Acetate and Fusel Oil in Wine
Influence on Wetting Performance by Polarity Difference between Organic Acid and Organic Alcohol
Evaluation and Application of Poverty Index Water Based on Principal Component Analysis
Research Progress on Degradation of Polycyclic Aromatic Hydrocarbons in Cooking Flue Gas
Measurements of Contact Angles for CO2- Brine-Berea Sandstones System at Reservoir Conditions
The Numerical Simulation of the Surface Settlement and the Pile Horizontal Displacement Caused by the Foundation Pit Dewatering
A Study on the Influence of Integrative Structure Combined with Subway Station and Underground Passage under Dynamic Load of Subway Train
Research on Three-Dimensional Topographic Characteristics of Tensile Cement Stone Crack Surface
Diurnal Fluctuations in Oxygen Release from Roots of Phragmites Australis in Constructed Wetland Systems
Different Detection Methods for HPLC Analysis of Fatty Acid Methyl Esters in Biodiesel
Measurement and Analysis of Sound Absorption Coefficient by the Method of Reverberation Chamber and Impedance Tube
The Influence of Boundary Conditions on Sound Field in Long Space
Two Methods of Measuring Reverberation Time and Sound Absorption Coefficient in Reverberation Room
Investigation of Heat Transfer of a Square Impinging Air Jet on a Flat Surface using Thermochromic Liquid Crystal Sheet
Drying Behavior of Fluidized Bed Dried Peppercorns
Recommend Papers

Materials in Environmental Engineering: Proceedings of the 4th Annual International Conference on Materials Science and Environmental Engineering
 9783110516623

  • 0 0 0
  • Like this paper and download? You can publish your own PDF file online for free in a few minutes! Sign Up
File loading please wait...
Citation preview

De Gruyter Proceedings Materials in Environmental Engineering

Materials in Environmental Engineering Proceedings of the 4th Annual International Conference on Materials Science and Environmental Engineering

e-ISBN (PDF) 978-3-11-051662-3 e-ISBN (EPUB) 978-3-11-051573-2 Library of Congress Cataloging-in-Publication Data A CIP catalog record for this book has been applied for at the Library of Congress. Bibliographic information published by the Deutsche Nationalbibliothek The Deutsche Nationalbibliothek lists this publication in the Deutsche Nationalbibliografie; detailed bibliographic data are available on the Internet at http://dnb.dnb.de. © 2018 Walter de Gruyter GmbH, Berlin/Boston www.degruyter.com

Prof. Wen-Zhe Tang

Keynote Speech I Strategies for Improving Hydropower Development Abstract: Sustainable hydropower development plays a critical role to reduce the environmental impacts arising from using fossil fuel. We presented solutions to sustainable hydropower development for China on three governance levels. At international level, China should establish partnering relationships with the neighboring countries to cooperatively manage the Transboundary Rivers associated with hydropower production, water sharing, environmental sustainability and climate change. China has a wealth of experience and technologies to contribute from its many previous hydropower projects. At the national level, there is a need to measure and understand the cascade effects of dams at river basin scale for optimizing the reservoir operation and environmental protection. Laws and regulations on hydroelectricity pricing and migrants’ compensation standards should be reformed and updated. Inter-regional transfer payments to the local authorities for balancing social and environmental losses of affected areas need to be developed for equitably allocating benefits/rewards among stakeholders. At the project level, more attention should be paid to migrant resettlement, land planning, natural resource preservation, and enhancing input in infrastructure development. Government should help migrants with education, employment, and forming new social networks, without devaluing their livelihoods and social capital. The scheme has both research and policy implications. The approaches can not only help to choose appropriate lowcarbon development strategies for China, but also be applicable to global river basin management and hydropower developments, especially in developing countries. Biography: Dr. Tang is the Director of Institute of Project management and Construction Technology at Tsinghua University. Dr. Tang have obtained grants from National Natural Science Foundation of China, Education Ministry of China, State Key Laboratory of Hydroscience and Engineering, and large companies for conducting research to improve the efficiency of the construction industry, hydropower development, and stakeholder management in both domestic and international markets.

Prof. Jia-Qiang Wang

Keynote Speech II Biotemplated Mesoporous Materials for Wastewater Treatments Abstract: Mesoporous materials with tunable pore structure and tailored property have great potential as photocatalysts and adsorbents for wastewater treatment. Herein, biotemplate such as plant tissues, algae, natural rubber latex and botanic extracted pigments were employed for preparation of mesoporous materials. These materials could be used for effective photocatalytic degradation of organic pollutants and reduction of Cr6+, oxidation of As3+. They were also used as adsorbents for removal of PO43-, F-, Pb2+, Hg2+ in wastewater. Proposed advantages and prospects of the pilot-scale photocatalytic reactors based on biotemplated mesoporous photocatalysts are also discussed. Biography: Director, Yunnan Province Engineering Research Center of Photocatalytic Treatment of Industrial Wastewater. Yunnan Provincial Collaborative Innovation Center of Green Chemistry for Lignite Energy.The Universities’ Center for Photocatalytic Treatment of Special Pollutants in Yunnan Province. Key Laboratory of Advanced Materials for Wastewater Treatment of Kunming. Committee Member of Photochemistry, Chinese Renewable Energy Society. Vice president, Yunnan Energy Research Association. Main research fields: photocatalysis; wastewater treatment; biotemplated materials; Catalytic selective oxidation, Environmentally-friendly treatment of precursor chemicals.

Prof. Rui-Feng Zhang

Keynote Speech III Design of Hard and Superhard Nanocomposites for Harsh Environment Abstract: By means of the combined density functional theory and thermodynamic modeling, we underlined the formation mechanism of superhard nanocomposites through spinodal decomposition, and the physical origin of superhardness via the calculations of interface decohesion and shear strength during deformation. Taken superhard nc-TiN/a-SiNx nanocomposite as a prototype which consists of thin SiN layer sandwiched between nanosized TiN crystals or layers, we revealed the spinodal decomposition is responsible for the formation of the thin SiN layer coherently between TiN nanocrystals. The bulk fcc-SiN is found to be thermodynamically unstable, whereas the coherent SiN layer in TiN/1ML-SiN/TiN multilayers can be thermodynamically and dynamically stable. The bonds between Ti and N atoms within the interlayer next to the SiNx interface dominate the interface failure under loadings owing to the ubiquitous Friedel oscillations. The effect of interface thickness on the mechanical strength is further clarified. These results provide ways to design new, stronger and harder materials. Biography: He obtained his Ph.D. degree in 2005 from School of Materials Science and Engineering, Tsinghua University. His main interest areas are Materials theory, modeling and simulations. He is an editor of Journal of Beijing University of Aeronautics and Astronautics, a reviewer for 25journals. His over 80 papers (50 as the 1st authors, H-index=24) are published in international journals and book chapter with >1500 citations and >30 international presentations & talks. More than 40 papers are published in high impact journals Phys. Rev. Lett., Nano Lett., Acta Mater., Phys. Rev. B, Appl. Phys. Lett., Sci. Rep., Inter. J. Plasticity, Scripta Mater., Chem. Mater. and J. Phys. Chem. B.

Prof. Ao Huang

Keynote Speech IV Numerical Simulation of Slag Corrosion Behavior of Lightweight Refractories for Refining Ladles Abstract: Lightweight refractory is one of important development directions, and development of applicable porous aggregate instead of dense materials is an important approach. The lightweight refractory with micro-porous aggregates is of importance for energy-saving and consumption reducing in high temperature vessels such as refining ladle, and the slag corrosion resistance is significantly concerning its service life. It is not only related to the movement of the molten slag, also under the influence of microstructure of materials, and hard to clarify with only experiments. Al2O3-MgO refractory for refining ladle was selected, and the microporous aggregates were fabricated. For lightweight porous castable, a method, in which aggregates and matrix were described with different microstructures based on porous medium theory, was adopted. And a micro-CFD (Computational Fluid Dynamics), temperature and reaction coupled model was established to describe the slag corrosion process. The effect of pore characteristics of micro-porous aggregates and matrix on the slag corrosion were initially investigated by mathematical simulation, and the suitable microstructure of lightweight Al2O3-MgO castable using for ladle lining were discussed. The simulation results agree well with that of the experiments, which mean the above model is promising for slag corrosion modeling. The key parameters of micro-porous aggregates and mechanism of slag corrosion resistance of lightweight refractory were ascertained. And the lightweight lining for refining ladle is feasible. It can promote energy saving and consumption reducing of high temperature kilns. Biography: His major research interests in the simulation and control of refractory materials. He participated in the national projects more than 10 items; He won Hans Theisbacher-prize for outstanding research at Montanuniversität Leoben in Austria, Young Teacher Nomination for metallurgy president award of national colleges and universities, he got excellent paper award in the youth academic annual meeting of the Chinese society for metals, and the first prize of Provincial Science and Technology Award for 2 times.

Prof.-Zhi-Chao Sun

Keynote Speech V Precision Plastic Forming of Large Complex Component of Ti-Alloy Abstract: Ti-alloy components are widely used in aero-space fields as key loadbearing structures. In order to realize the light weight, high reliability, and efficient function of equipment, integrated manufacturing of high performance lightweight components is needed, which is the urgent need for high-end manufacturing for aerospace. Precise plastic forming, by which under thermo-mechanical coupling conditions the materials undergo plastic deformation, volume transferring, and microstructure evolution and obtain shape change and performance improvement, is an important way to manufacture high performance lightweight components. However the forming process is very complex process. On one hand the Ti-alloy has the large deformation resistance and is hard to deform. On the other hand the component is large, complex, and integral, as well as high service performance. It faces two difficulties: forming capability, integrated control of deformation and performance. Isothermal forming by local loading provides a novel method to form largescale integral component. In this report key technologies and advances in optimization of billet, die and thermo-dynamical parameters and coordinated regulation of inhomogeneous deformation and microstructure formation were introduced. In details, developing through-process simulation model for deformation and microstructure predict; proposing method for microstructure and mechanical property predict, inventing the method to obtain tri-modal microstructure, proposing the method for billet and die optimization, solving the problems of uneven deformation coordination, rib filling and forming defects; developing thermo-dynamical parameter optimization technique and realizing the integrated manufacturing of shaping and performance for Ti-alloy component.

Biography: and Prof.ininSchool SchoolofofMaterials Materialsand and Engineering, Engineering, Northwestern PolyAbstract: Dr.Dr. and Prof. technical University. A winner of Education Ministry's New Century Excellent Talents Supporting Plan. The main research interests are precision plastic forming theory and technology, process simulation and optimization. Under the supports of the National Natural Science Fund of China, the National Natural Science Foundation of China for Key Program, and the National Basic Research Program of China (973 Program), etc. More than 140 papers were published in Acta Materialia, MSEA, JMPT, etc., and 80 were indexed by SCI/EI. 18 authorized invention patents, one time of Second Prize of National Natural Science Award, and two times of First Prize of Shaanxi Provincial Science and Technology Awards were obtained.

Fu-Min Lu1 and Ting-Yao Jiang2

Study about the Landslide Deformation Forecast Model Based on Kalman Filter Method and Taylor Seris and Material Properties Abstract: Lianziya landslide consists of limestone and shale; it is 26.5 kilometer apart to Three Gorges dam, the stability of Lianziya landslide is very important to the safety of Three Gorges dam. The deformation of Lianziya landslide is influenced by the temp landslide, the deformation of Lianziya landslide is regarded as the function of the time and the temperature in the paper, and erature mainly, temperature raise, the deformation of the landslide raise. Considering the material property of Lianziya Taylor series is used to erect the functional relationship of the deformation to the time and the temperature, the remainder term of Taylor series and the variation of coefficients of second power of the variation of the time and second power of the variation of the temperature are regarded as dynamic noises whose mathematical expectation are 0 to erect Kalman filter model and predict the deformation of Lianziya landslide. An example of calculation shows that the fitted effect and the forecast effect of the model are better. Keywords: temperature, deformation, material property, dynamic noise, Kalman filter, forecast

1 Introduction Lianziya landslide in Yangtze River Three Gorges is located in Zigui county Hubei province, it is located in the south side of Yangtze River, its north bank is Xintan landslide, it is 26.5 kilometer apart to Three Gorges dam, and it consists of limestones and thin shales. Lianziya landslide is 700 meters long and 30 meters to 180 meters wide, the area is 0.54 square kilometres, there are 58 cracks in the area, and there are 12 main cracks in the area, most cracks enter the coal layer(crack 2 is 100 meters long and 5.2 meters wide and 110 meters deep), the rock body is divided into 3 hazardous rock

|| 1 Key Laboratory of Geological Hazards on Three Gorges Reservoir Area of Ministry of Education, Three Gorges University, Yichang City, China, [email protected] 2 Computer and Information College, Three Gorges University, Yichang City, China, [email protected] 10.1515/9783110516623-001 DOI 10.1515/97831105 16623-001

12 | Fu-Min Lu and Ting-Yao Jiang areas, the volume of the hazardous rock area of crack 0 to crack 6 in the south is 865000 cubic meters, the volume of the hazardous rock area of crack 7 in the middle is 20000 cubic meters, the volume of the hazardous rock area of crack 8 to crack 12 in the north is 2260000 cubic meters. The south and west of the hazardous rock mountain are divided by cracks, the north and east of the hazardous rock mountain are empty, and the bottom is the goof of the coal layer. The formation mechanism of the hazardous rock mountain is complex, it is caused by the geological and the human action, it is caused mainly by out loading and digging coal in the bottom. It was recorded by historical materials that the two banks of Xintan occurred 15 great rock fall landslides in 100, 377, 1030, 1542, 1985, and the huge landslide blocked Yangtze River 21 years and 82 years in 1030 and 1542. The geological survey and scientific test and deformation monitoring and control study from 1964 to 1989 showed that Lianziya landslide exist dangerous signs to occur the huge fall and slide, if it is not controled, and the huge fall body and slide body enter Yangtze River, that will cause to block “golden water way”, and that will affect the downriver Three Gorges Project construction and the development of the national economy and social stabilization along Yangtze River area. Control measures of Lianziya landslide include the prestressing force anchor wires reinforcement project of the hazardous rock mountain in crack T8 to crack T12, the bearing and preventing slide key project in the bottom goaf of the coal layer, the waterproof project of the cover board to great cracks, the surgical drainage project to Leipishi landslide, the erosion protection dam project to Houziling collapse accumulation slope. The monitoring and forecast are important parts of the hazardous rock mountain control, and the monitoring and forecast play very important roles in deciding whether to control to the hazardous rock mountain, adjusting the construction progress and strength, feed backing the design of the control, directing the construction. It is very important to study the landslide deformation forecast model to understand the deformation tendency of the landslide and to forecast the destabilization of the landslide. The landslide deformation forecast models are divided into two classes, the first class is single factor models, these models include single factor regression analysis models, time series models, tendency models, the other class are multiple factor models. The deformation of Lianziya landslide is regarded as the function of the time and the temperature in the paper, and Taylor series is used to erect the functional relationship of the deformation to the time and the temperature, the remainder term of Taylor series and the variation of coefficients of second power of the variation of the time and second power of the variation of the temperature are regarded as dynamic noises whose mathematical expectation are 0 to erect Kalman filter model and predict the deformation of Lianziya landslide. An example of calculation shows that the model is better.

Study about the Landslide Seris and Material Properties |13

2 The Deformation Feature of the Hazardous Rock Mountain More than 10 monitoring methods were used in 16 years, monitoring data showed the deformation feature of Lianziya landslide. To the hazardous rock body of crack T8 to crack T9, during the construction of the blocking slide key, the hazardous rock body was disturbed, the deformation raised, the cuniform body moved along the soft layer, the subsidence was obvious, and moved along NNE direction or NE direction, after the control, deformation curves of the hazardous rock body became steady through the stress adjustment, new deformation signs did not appear, it show that the hazardous rock body was stable. To the hazardous rock body of crack T9 to crack T11, during the construction of the blocking slide key, the hazardous rock body was disturbed, the subsidence was great, and moved along N46o to E63o direction, after the control, deformation curves of the hazardous rock body became steady through the stress adjustment, new deformation signs did not appear, it showed that the hazardous rock body was stable. To Qiqianfang landslie body, during the construction of the prestress anchor wires, the deformation of the landslie body was small, the control effectiveness monitoring showed that the change of the landslie body is smooth, and it is stable. To Wuwanfang landslie body (the volume is 2650000 cubic meters), during the constructon of the prestress anchor wires, the deformation of the landslie body was small, the control effectiveness monitoring showed that the deformation of the hazardous rock body was not active, and deformation curves were smooth, and new deformation signs did not appear, it showed that the stress adjustment was stable after the control construction, and the hazardous rock body was stable. The control project of Lianziya landslide began in May, 1995, and ended in August, 1999, to December, 2004, the deformation of the hazardous rock mountain was stable. June, 2003 to December, 2004, the water level of Three Gorges reservoir raised to 135 meters to 139 meters from 70 meters, the advancing edge and foot of slopes of Lianziya landslide and 70 percent of the block slide key were drowned by water, it produced definite influences, but influences were not obvious, the hazardous rock mountain was stable, it showed that the control project played important roles to stability of the hazardous rock mountain.

3 Kalman Filter Model The state equation and observation equation of the discrete linear system are

14 | Fu-Min Lu and Ting-Yao Jiang

X k 1

Lk 1

) k 1, k X k  : k

(1)

Bk 1 X k 1  ' k 1 t

(2)

L

where X k is the state vector at the time k , k is the observation vector at the time t k , ) k 1, k is the state transfer matrix at the time t k to t k 1 , Bk 1 is the observation matrix at the time t k 1 , : k is the dynamic noise at the time t k , ' k is the observation noise at the time t k . The random model of Kalman filter method is

E (: k )

0 , E (' k )

cov(' k , ' j )

E( X 0 )

P X (0)

0 , cov(: k , : j )

D' ( k )G kj cov(: k , ' j ) ,

X (0 / 0) , var( X 0 )

k , G kj

j

1

, if

j z k , G kj

0

,

,

D X (0) , cov( X 0 , : k )

cov( X 0 , ' k ) If

D: ( k )G kj

0

0, (3)

0

where E (: k ) is the mathematical expectation of : k , E (' k ) is the mathematical expectation of ' k , cov(: k , : j ) is the covariance of : k and : j , D: (k ) is the variance of : k , D' (k ) is the variance of ' k . On the basis of the state equation and observation equation and random model, Kalman filter equations are obtained

X (k / k )

X ( k / k  1)  J k [ Lk  Bk X ( k / k  1)]

D X (k / k ) [ I  J k Bk ]D X (k / k  1) Where

I

(4)

is a unit matrix, and

X ( k / k  1) D X (k / k  1) Jk

) k , k 1 X (k  1 / k  1)

) k ,k 1 D X (k  1 / k  1)) Tk ,k 1  D: (k  1)

D X ( k / k  1) BkT [ Bk D X ( k / k  1) BkT  D' ( k )] 1

(5)

Study about the Landslide Seris and Material Properties |15

4 Establishment of the State Equation and Observation Equation Because Lianziya landslide consists of limestone and shale, the deformation of Lianziya landslide is effected by the temperature mainly. Considering the material property of Lianziya landslide the deformation of Lianziya landslide can be looked upon as the function of the time and the temperature, e.g.

x

x(t , w)

(6)

Where t is the time, w is the temperature at the time t , x is the deformation value of the landslide at the time t . Because the time interval of the deformation observation to the landslide is very short, and the variation of the deformation value is very small, the deformation value of the landslide

x(tk 1 )

at the time

tk 1 can be spread at the time t k

by means

of Taylor series:

x (t k 1 , wk 1 )

x (t k , wk )  (

1 w2x wx wx ) tk (t k 1  t k ) + ( 2 )t k (tk 1  tk ) 2  ( ) wk ( wk 1  wk ) 2 wt ww wt 

In

(7),

let

vk

x(tk , wk )

xk

wx ( ) tk wt

,

ak

1 w2x ( ) w ( wk 1  wk ) 2  g k 2 ww 2 k

w2x ( 2 ) tk wt

,

sk

wx ( ) wk ww

(7)

yk

1 w2x ( )w 2 ww2 k

(7) Become

xk 1

1 xk  vk (tk 1  tk )  ak (tk 1  tk ) 2 2 sk ( wk 1  wk )  yk ( wk 1  wk ) 2  g k

where

vk

is the deformation velocity at the time

t k , ak

+ (8)

is the deformation acceler-

ation at the time

t k , s k is the influence that the variation of the temperature to the

yk

is the influence that the second power of the variation of the tem-

deformation,

16 | Fu-Min Lu and Ting-Yao Jiang

perature to the deformation,

gk

is the remainder term of Taylor series. Because

gk

is very small, it can be looked upon as dynamic noises whose mathematical expectation are 0, Let

v k 1

v k  a k (t k 1  t k )  c k

a k 1

a k  rk

(10)

sk  yk ( wk 1  wk )  pk

sk 1

yk 1 Where

(9)

(11)

yk  z k

(12)

c k , rk , p k , z k are the small perturbation, they can be looked upon as the

dynamic noise whose mathematical expectation are 0 yet. (8) to (12) can be written as the matrix form:

>xk 1 ª «1 t k 1  t k «0 1 « 0 «0 «0 0 « «¬0 0 +

yk 1 @

T

vk 1 ak 1 sk 1

1 (t k 1  t k ) 2 2 t k 1  t k 1 0 0

>gk

ck

º ( wk 1  wk ) 2 » ª xk º « » » « vk » 0 » «a » 0 »« k » wk 1  wk » « sk » »« » »¼ ¬ y k ¼ 1

wk 1  wk 0 0 1 0

rk

zk @

T

pk

(13)

In (13), let

X k 1

>xk 1

) k 1,k

vk 1 ak 1 sk 1 ª «1 t k 1  t k «0 1 « 0 «0 «0 0 « «¬0 0

yk 1 @

T

1 (t k 1  t k ) 2 2 t k 1  t k 1 0 0

,

>g k

:k

wk 1  wk 0 0 1 0

ck

rk

pk

º ( wk 1  wk ) 2 » » 0 » 0 » wk 1  wk »» 1 ¼»

zk @

T

,

Study about the Landslide Seris and Material Properties |17

(13) Can be written as

X k 1

) k 1, k X k  : k

(14)

(14) Is the state equation of Kalman filter method? To the deformation observation, the following is obtained

l k 1

x k 1  ' k 1

l

Where k 1 is the deformation observation value at the time vation noises Let

Lk 1

l k 1 , Bk 1

>1

(15)

tk 1 , ' k 1

is the obser-

0 0 0 0@

(15) Can be be written as

Lk 1

Bk 1 X k 1  ' k 1

(16)

(16) is the observation equation of Kalman filter method. On the basis of the state equation (14) and the observation equation (16), and the random model of Kalman filter method (3) is considered, by means of Kalman filter equations, Kalman filter can be done.

5 The Example of the Calculation The horizontal deformation monitoring data of monitoring point T8 in Lianziya landslide is used here, and some calculations are done. Calculation results are listed in Table 1. By means of analyzing observation data, the standard deviation of deformation observation values is obtained ' ' N r mm, X (0 / 0) is obtained from the data on December, 2012, e.g.

X ( 0 / 0)

>108.00

0 0 0 0@

T

D x (0) I and D: (k ) I ( I is a unit matrix) Table 1 shows that residual errors obtained by Kalman filter method are less, they are less than 0.3 mm, fitted errors of Kalman filter model are very small, some

Let

18 | Fu-Min Lu and Ting-Yao Jiang of signs of residual errors are negative, and others are positive, it show that residual errors are random. The deformation forecast value of monitoring point T8 on December, 2013 is 105.72mm, and the deformation monitoring value of monitoring point T8 on December, 2013 is 106.5mm, the forecast error is -0.78 mm, the forecast error is very small. Table 1: Calculation result of the monitoring point t8 Observation time (year- month)

Observation values (mm)

Temperature (oC)

Residual errors (mm)

2013-01 2013-02 2013-03 2013-04 2013-05 2013-06 2013-07 2013-08 2013-09 2013-10 2013-11

108.8 104.5 103.6 105.9 107.2 108.5 107.8 108.0 106.6 107.4 104.9

7.9 9.3 12.2 17.5 21.5 25.7 27.3 28.6 24.6 18.6 13.6

-0.26667 0.24051 -0.06492 0.00409 0.00890 0.00076 -0.00433 -0.06758 -0.00235 0.00119 0.00705

6 Conclusion Because the deformation of Lianziya landslide is effected by the temperature mainly, temperature raise, the deformation of the landslide raise, the deformation of the landslide is looked upon as the function of the time and the temperature, Taylor series are used to erect the functional relationship of the deformation to the time and the temperature, the remainder term of Taylor series and the variation of coefficients of the second power of the variation of the time and the second power of the variation of the temperature are looked upon as dynamic noises whose mathematical expectation are 0 to erect Kalman filter model and predict the deformation of the landslide. An example of calculation shows that the fitted effect and the forecast effect of the model are better. Acknowledgement: The paper was subsidized by state natural sciences foundation (No. 41172298), the paper was subsidized by the scientific research foundation for NASG key laboratory of land environment and disaster monitoring (No. LEDM2013B03).

Study about the Landslide Seris and Material Properties |19

References [1] [2] [3] [4] [5] [6] [7] [8]

[9] [10]

Jia-Zhu ZHENG, Hui GUANG, Application of Kalman filter model with the excavation depth to pit deformation analysis, J. Bulletin of Surveying and Mapping 5 (2009) 49-51.“in Chinese” Qi-Rui ZHANG, Practical Regression Analysis, Geology Press, Beijing, 1998.“in Chinese” Zheng-Ming WANG, Dong-Yun YI, Erecting Models to Surveying Data and Parameter Estimation, National Defense Science and Technology University Press, Changsha, 1977.“in Chinese” Xi-Zhang CUI, Zong-Chou YU, Ben-Zao TAO, General Surveying Adjustment, Surveying and Mapping Press, Beijing, 1992.“in Chinese” Fu-Min LU, Application of Kalman filter method in dam deformation analysis, Site Investigation Science and Technology 1(2002) Fu-Min LU, Kalman filter model based on AR(n) model, Mathematics in Practice and Theory 19(2007) 6-11.“in Chinese” Denli H., Crustal deformation analysis in the Marmara sea region, Surveying Engineering 4(2007) 151-155. Yalc, ınkaya, M., Bayrak, T., Comparison of static, kinematic and dynamic geodetic deformation models for Kutlugun landslide in northeastern Turkey, Natural Hazards 34 (2006) 91110. Lee K M, Rowe R K, Finite element modeling of the three-dimensional ground deformation due to tunneling in soft cohesive, Computer and Geotechnics 10 (1991) 87-109. Lo K Y, Ramsay J A, The effect of construction on existing subway tunnels-A case study from Toronto. Tunnelling and Underground Space Technology, 6(1991) 287-297.

Pei-Tong Ni1, Jun-Shuai Ren2, Bao-Liang Bai3and Li-Peng Zhou4

Effects of Machining Process and Heat Treatment on the Mechanical Properties and Microstructure of TB2 Titanium Alloy Strip Abstract: TB2 is a kind of metastable beta titanium alloy that has high-strength, ductility and Young modulus, used for parts working at the temperature less than 350°C, such as sheet metal component, pressure vessel, corrugated shell, cold heading rivet and so on. In this paper, the effects of machining deformation rate and subsequent heat treatment process on the mechanical properties and microstructures of TB2 alloy strip were investigated. The results reveal that excellent comprehensive mechanical properties could be acquired for the alloy with reasonable machining process and with solution treatment at 800°C (gas quenching in vacuum atmosphere). The alloy possesses favorite plasticity and high ultimate tensile strength of 1250MPa or even higher after solution and aging treatment at 480°C. Keywords: TB2 strip; machining process; heat treatment; microstructure and mechanical property

1 Introduction TB2 is a kind of metastable beta titanium alloy that has high-strength, ductility and Young modulus with a nominal composition of Ti-5Mo-5V-8Cr-3Al (mass fraction, %). It has outstanding properties of machining, heat treatable strengthening and welding[1, 2], and can be used for parts working at the temperature less than 350°C, such as wires[3, 4], sheet metal component, pressure vessel, corrugated shell, cold heading rivet[5] and so on. Although a series of research has been worked out in order to enlarge its application [6, 7], the mechanical properties and the production quality of TB2 alloy are affected greatly by the machining process and heat treatment, especially for the alloy strips. Because of the complex composition, TB2 alloy’s microstructure and mechanical properties are sensitive to processing factors. Machining process and heat treatment have been investigated on TB2 alloy strip of 0.8mm in thickness to get an excellent comprehensive mechanical property, and || 1 Northwest Institute for Nonferrous Metal Research, Xi’an 710016, [email protected], Fax: +86-02986278716 2 Northwest Institute for Nonferrous Metal Research Xi’an, China 3 Northwest Institute for Nonferrous Metal Research Xi’an, China 4 Northwest Institute for Nonferrous Metal Research Xi’an, China 10.1515/9783110516623-002 DOI 10.1515/9783110303568-002

22 | Pei-Tong Ni, Jun-Shuai Ren, Bao-Liang Bai and Li-Peng Zhou supply advantageous technical support for industry production.

2 Experimental Materials and Procedures An ingot of TB2 alloy was produced by electrode consumption vacuum arc furnace in this study. Then it was forged and rolled into strips of 0.8mm in thickness. Solution treatment was carried out at 780°C, 790°C, 800°C, 810°C for 12min and gas quenched in vacuum atmosphere. The specimens after solution treatment at 800°C were then precipitated by aging treatment at 460°C, 480°C, 500°C, and 520°C for 8h and cooled in furnace. Tensile tests were carried on the Instron 1185 Universal Testing Machine at room temperature (25°C). The OLMPUS PMG Optical Microscopy and the JSM 6460 Scanning Electron Microscopy were used to observe the microstructures.

3 Results and Discussion 3.1 Effect of Machining Deformation Rate on Mechanical Property and Microstructure in Processing Condition TB2 alloy strips were rolled at deformation rates of 10%, 20%, 30%, 40%, 50% and 70% respectively from plates. The effect of machining deformation rate on mechanical properties is shown in Figure 1. It is found that the ultimate tensile strength (Rm) and the yield strength (Rp0.2) increase and the elongation (A) decrease with the increase of the machining deformation rate (ε). Rm is 1080MPa and 1380MPa, respectively, and A is 18% and 6.5%, respectively for the strip with the ε of 20% and 70%. It is obvious that TB2 alloy strips have a favorite comprehensive mechanical property, the tensile strength is 1200MPa and the elongation is 12%, when machining deformation rate is 40%. The microstructures of TB2 alloy strips manufactured at deformation rates of 20% and 50% are both shown in Figure 2. Equiaxed grains with a small amount of deformation can be observed for the strip processed at deformation rate less than 30%, and un-trans granular slip lines can be found in grains. Obvious elongated grains and fibrous microstructures can be observed when the deformation rate is greater than 30%, which probably have a relation to the cross slipping and grain boundary gliding. [8, 9]

1400

Rm

1200

A

60

Rp0.2

50 40

1000

30

800

A(%)

Rm( MPa)

Effects of Machining Process and Heat Treatment on the Mechanical Properties | 23

20

600

10

400 10

20

30

40 50 H (%)

60

70

0

Fig. 1: Effect of machining deformation rate on mechanical property in as-processed condition

Fig. 2: Effect of machining deformation rate on microstructure in as-processed condition, (a) ε=20%, (b) ε=50%

3.2 Effect of Solution Treatment Temperature on Mechanical Property and Microstructure Figure 3 illustrates the mechanical properties of TB2 alloy strips samples after various solution treatments carried out at 780°C, 790°C, 800°C, 810°C for 12 min respectively, and gas quenched in vacuum atmosphere. As can be seen, the strength varies from 930MPa to 980MPa, and the elongation changes from 22% to 27%. Figure 4 shows the microstructure (a, b) and tensile fracture-graphs (c, d) of TB2 alloy strips samples after solution treatments at 780°C and 810°C. Only equiaxial β phase grains

24 | Pei-Tong Ni, Jun-Shuai Ren, Bao-Liang Bai and Li-Peng Zhou can be observed in the microstructure, and all of the tensile fracture morphology show ductile fracture with dimples. The equiaxial β phase grains after solution treatments at 810°C are bigger than that at 780°C. The tensile strength is 980MPa and the elongation is 27% for the strip with solution treatments at 800°C/12min, which means the strip possesses an excellent comprehensive mechanical properties.

3.3 Effect of Aging Temperature on Mechanical Properties TB2 alloy strips of 0.8mm thick were aged at 460°C, 480°C, 500°C, 520°C for 8 hours after solution treatment at 800°C/12min. The mechanical properties in aging condition are shown in Figure 5. The tensile strength is greater than 1250MPa and the elongation is higher than 18% for the strip with the aging heat treatment at 480°C/8h, which means the strip possesses excellent comprehensive mechanical properties [10].

1200

Rm A

60 50 40

800

30

600

20 10

400 780

790 800 Temperature /qC

810

0

Fig. 3: Mechanical properties at different temperature of ST

A(%)

Rm(MPa)

1000

70

Effects of Machining Process and Heat Treatment on the Mechanical Properties | 25

Fig. 4: Microstructure ( a 780°C, b 810°C ) and Tensile fracture-graphs ( c 780°C, d 810°C ) at different temperature of ST

1400

Rm A

60 50 40

1000

30

800

20 10

600 460

480 500 Temperature /qC

520

0

Fig. 5: Mechanical properties at different temperature of STA

A(%)

Rm(MPa)

1200

70

26 | Pei-Tong Ni, Jun-Shuai Ren, Bao-Liang Bai and Li-Peng Zhou Figure 6 shows the microstructure of TB2 alloy strip sample with the aging heat treatment at 480°C/8h. From the figure, it can be seen that the α phases are uniformly distributed in β phase grains which provide the high strength and good plasticity.

Fig.6: Microstructure of STA heat treatment at 480°C/8h

4 Conclusions 1) TB2 alloy strips possess good machinability. In processing condition, the strength increases and the elongation decreases with the increasing machining deformation rate. 2) The temperature of solution treatment affects the mechanical property of TB2 alloy strips. Deformed TB2 alloy strips have a remarkable comprehensive mechanical property after solution treatments at 800°C/12min. 3) The aging temperature affects the mechanical property of TB2 alloy strips. The tensile strength is greater than 1250MPa and the elongation is higher than 18% for the strip with the aging heat treatment at 480°C/8h, which means the strip possesses an excellent comprehensive mechanical properties.

References [1]

Team of handbook of rare metal materials and engineering, Handbook of rare metal materials and engineering. Beijing, CN: Metallurgical Industry Press, 1985.

[2]

Lu Yi, Wang Jian, Wang Hongwu, “Effect of heat-treatment process on structure and property of TB2 titanium alloy (in Chinese),” Rare Metals Letters, vol. 27, 2008, pp. 29-32.

Effects of Machining Process and Heat Treatment on the Mechanical Properties | 27

[3]

Cui Xuefei, Yu Ming, Chen Haishan, Tao Haiming, Wei Yanguang, Luo Zheng, “β Titanium

[4]

Wang Zhenwu, “Study on Manufacturing Procedures of TB2 Titanium Alloy Wires,” Tianjin

[5]

Zhang Zhu, Chen Haishan, Hao Ruixin, “Research on high-strength TB2 titanium alloy foil

Master Alloy High Strength TB2 Wires,” Chinese Journal of Rare Metals, 2008. Metallurgy, 2003. and its application (in Chinese),” The proceedings of The 9th National Conference on Titanium and Its Alloy, 1990. [6]

Yang Yang, Cheng Xinlin, An Yulong, “Numerical simulation on adiabatic shearing behavior

[7]

Wu Wei, Zhang Kaifeng, Gong Taibin, “Influencing Factors of Strength of Diffusion Bonding

of TB2,” Chinese Journal of Nonferrous Metals, 2004. TB2 Alloy Joint,” Aerospace Materials & Technology, vol. 2, 2002, pp. 55-59. [8]

Ni Peitong, Han Mingchen, Zhu meisheng, Zhang yingming, “Effect of heat treatment on microstructures and mechanical properties of TB2 alloy strip (in Chinese),” Titanium Industry Progress, vol. 29, 2012, pp. 19-21.

[9]

Research Institute for Non-ferrous Metals, “Recrystallization of TB2 alloy (in Chinese),” The

[10]

Yao Jinsheng, Wang Shihong, “Research on the isothermal transformation of TB2 titanium

proceedings of The 1st National Conference on Titanium and Its Alloy, 1973. alloy (in Chinese),” The proceedings of The 4th National Conference on Titanium and Its Alloy, 1983.

Zhi-Yuan Wu1, Shu-Hui Wang2, Xin-Li Tian3 and Xiu-Jian Tan4

Study on Compound Characteristics of Oleic Acid, Glycerol and Organic Ester in Grinding Fluid Abstract: In this paper, mixing experiment is adopted as a main measure, organic matters with different molecular structures and short-chain esters with different properties are experimented, and the interaction of different organic matters during compounding is inspected. Experiment result show that glycerol has good compound effect and can achieve good combination effect when being compounded with most organic matters; organic esters with different properties can achieve intensive interaction during compounding, and greatly improves or reduces the grinding wheel passivation rate during grinding. During practical. Keywords: Mixing Experiment; Organic Ester; Synergistic Effect; Glycerol; Oleic Acid

1 Introduction Various additives with different properties have decisive effect on the performance of grinding fluid, particularly during grinding in certain severe occasions, relevant effect is vital [1-3]. For example, grinding machining is a main measure for ceramic material machining, application of unreasonable grinding fluid can directly lead low grinding efficiency and rapid grinding wheel abrasion, thereby causing great increasing of grinding cost [4-5]. For metal grinding fluid, adding extreme pressure additives is an effective measure for improving the grinding performance in grinding extreme environment condition. Extreme pressure additives mainly indicate compounds of resoluble chlorine, sulfur and phosphorus, with high polarity, in grinding fluid, and the chemical elements and metal surfaces form chemical reaction, to produce chemical reaction films, compared with common adsorption films,

|| 1 National Key Laboratory for Equipment Remanufacturing, Academy of Armored Force Engineering, Beijing, 100072, China, [email protected] 2 Department of Scientific Research, Academy of Armored Force Engineering, Beijing, 100072, China, [email protected] 3 National Key Laboratories for Equipment Remanufacturing, Academy of Armored Force Engineering, Beijing, 100072, China 4 National Key Laboratories for Equipment Remanufacturing, Academy of Armored Force Engineering, Beijing, 100072, China 10.1515/9783110516623-003 DOI 10.1515/9783110303568-003

30 | Zhi-Yuan Wu, Shu-Hui Wang, Xin-Li Tian and Xiu-Jian Tan the chemical reaction film has the advantages of high melting point, low friction coefficient and high lubricating property. A good extreme pressure additive is an important aspect for improving the grinding fluid performance, but as the difference between physical chemical properties of ceramic material and metal material is great, additives for metal material cannot be copied. In this paper, oleic acid, glycerol and organic ester containing silicon, phosphorus and boron elements are selected to perform mixing experiment, and single effect and compound effect of the additives are inspected.

1.1 Adding Experiment of Organic Matters with Different Molecular Structures In this section, the main purpose is inspecting the synergistic effect of organic matters with different molecular structures through a mixing experiment computation method when the organic matters are mixed. The upper limit of additive content is 30%. Base fluid is liquid paraffin. Second order simplex lattice design and experiment result of three variables are as shown in the following Table 1. Table 1: Oleic acid additive mixing experiment scheme and result test number

code

Actual constituents (%)

passivation rates

x1

x2

x3

Z1

Z2

Z3

1

1

0

0

30

0

0

2

0

1

0

0

30

0

y2=1.025

3

0

0

1

0

0

30

y3=1.047

y1=1.035

4

1/2

1/2

0

15

15

0

y12=1.041

5

1/2

0

1/2

15

0

15

y13=1.036

6

0

1/2

1/2

0

15

15

Y23=1.034

Wherein Z1 is oleic acid; Z2 is organic silicon; Z3 is glycerol. By substituting passivation rate values in the Table into a mixing experiment formula, all coefficients of a polynomial can be obtained. ­ b1 °b ° 2 ° b3 ® ° b12 ° b13 ° ¯b23

y1 1.035 y 2 1.025 y 3 1.047 4 y12  2 y1  y 2 0.044 4 y13  2 y1  y 3 ˉ0.02 4 y 23  2 y 2  y 3 ˉ0.008

Characteristics of Oleic Acid, Glycerol and Organic Ester in Grinding Fluid | 31

By substituting coefficients into the mixing experiment formula, we can obtain the regression equation of the reagents compounded in paraffin base emulsion as follows: yˆ 1.035 x1  1.025 x2  1.047 x3  0.044 x1 x2ˉ0.02 x1x3ˉ0.008 x2 x3 Data computation in experiment is as shown in Table 2 Table 2: Data computation table of oleic acid additive mixing experiment test number

observations

( yu )

predictions

( yˆ u )

residue

( y u  yˆ u )

regression deviation

( yˆ u  y )

1

1.031

1.035

0.004

0.0016

1

1.038

1.035

0.003

0.0016

1

1.036

1.035

0.001

0.0016

2

1.022

1.025

0.004

0.0156

2

1.028

1.025

0.004

0.0156

3

1.045

1.047

0.002

0.01

3

1.05

1.047

0.003

0.01

4

1.045

1.041

0.004

0.0044

4

1.036

1.041

0.005

0.0044

4

1.041

1.041

0

0.0044

5

1.033

1.036

0.003

0.0006

5

1.039

1.036

0.003

0.0006

6

1.031

1.034

0.003

0.0026

6

1.037

1.034

0.003

0.0026

¦

12

¦y u 1

u

12

¦( y

14.512

u 1

y 1.0366

u

12

¦ ( yˆ

 yˆ u ) 2

u 1

0.000134

u

 yu ) 2

0.000766

Then we can obtain that SST

SSR  SSE ˙0 .0009

By substituting values into the mixing experiment formula, an adjusted determination coefficient fitted by a second order model can be obtained as follows: R A2

1

N  1 u SSE N  p ǂ u SST

It indicates that fitting is good.

14  1 u 0.000134 14  6 u 0.0009

0.76

32 | Zhi-Yuan Wu, Shu-Hui Wang, Xin-Li Tian and Xiu-Jian Tan In the equation, quadratic coefficient b12 is greater than b13 and b23 is smaller than zero and the plus or minus change rule indicates two questions. Firstly component 3 glycerol continuously keeps good pairing capacity with other materials and still presents certain beneficial synergistic effect when being used with oleic acid. Secondly, we can see that the interaction term coefficient between oleic acid and organic silicon is greater than zero, and it indicates that the matching between oleic acid and organic silicon produces certain effect of mutual hindering. The grinding wheel passivation rate obtained by matching oleic acid and organic silicon is greater than the simple mean value of oleic acid and organic silicon.

2 Ease of Use Adding Experiment of Short Chain Organic Ester Containing Silicon, Boron and Phosphorus The main purpose of this section is inspecting the synergistic effect of all extreme pressure components when the components are mixed through a computation method of mixing experiment. Extreme pressure components adopted for experiment contains short chain esters with various extreme pressure elements, and the content upper limit is 30%. Base fluid is liquid paraffin. Experiment result is as follows: Table 3: Short chain ester mixing experiment scheme and result test number

code

Actual Constituents (%)

passivation rates

x1

x2

x3

Z1

Z2

Z3

1

1

0

0

30

0

0

2

0

1

0

0

30

0

y2=1.05

3

0

0

1

0

0

30

y3=1.05

y1=1.048

4

1/2

1/2

0

15

15

0

y12=1.064

5

1/2

0

1/2

15

0

15

y13=1.044

6

0

1/2

1/2

0

15

15

Y23=1.038

Wherein Z1 is tetraethylorthosilicate; Z2 is tributyl phosphate; Z3 is trim ethyl borate. By substituting passivation rate values in the tables into formula, all coefficients of polynomial can be obtained as follows:

Characteristics of Oleic Acid, Glycerol and Organic Ester in Grinding Fluid | 33

­ b1 y1 1.048 ° b y 1.05 2 ° 2 ° b3 y3 1.05 ® ° b12 4 y12  2 y1  y2 0.06 ° b13 4 y13  2 y1  y3 0.02 ° ¯b23 4 y 23  2 y2  y3 0.048 By substituting the coefficients into the equation, we can obtain the regression equation of the reagents compounded in the paraffin base emulsion as follows: yˆ

1.048 x1  1.05 x 2  1.05 x 3  0.06 x1 x 2ˉ0.02 x1 x 3ˉ0.048 x 2 x3

Computation of data in experiment is as shown in Table 4 Table 4: Data computation table of extreme pressure agent mixing test number

observations

( yu )

predictions

( yˆ u )

residue

( y u  yˆ u )

regression deviation

( yˆ u  y )

1

1.045

1.048

0.003

0.001

1

1.049

1.048

0.003

0.001

2

1.047

1.05

0.003

0.001

2

1.053

1.05

0.003

0.001

3

1.053

1.05

0.003

0.001

3

1.047

1.05

0.003

0.001

4

1.062

1.064

0.002

0.015

4

1.066

1.064

0.002

0.015

5

1.042

1.044

0.002

0.005

5

1.046

1.044

0.002

0.005

6

1.034

1.038

0.004

0.011

6

1.042

1.038

0.004

0.011

¦

12

¦y u 1

u

12

¦(y

12.586

u 1

y 1.049

u

 yˆ u ) 2

0.000102

It can be obtained that

SST

SSR  SSE ˙0.00085

12

¦ ( yˆ u 1

u

 yu ) 2

0.000748

34 | Zhi-Yuan Wu, Shu-Hui Wang, Xin-Li Tian and Xiu-Jian Tan By substituting values into the mixing experiment formula, an adjusted determination coefficient fitted by a second order model can be obtained as follows:

RA2 1 

N  1 u SSE 12  1 u 0.000102 N  p ǂ u SST 12  6 u 0.00085

0.78

It indicates that fitting is good. According to the amplitudes of quadratic coefficients obtained from the experiment, esters containing various extreme pressure components show extremely high orientation. The combination of silicate ester and phosphate ester shows intensive mutual hindering effect, and the grinding wheel passivation rate obtained from the compound formula is far greater than that of each of silicate ester and phosphate ester. Compounding of boric acid ester, phosphate ester and silicate ester obtains good effect, and the grinding wheel passivation rate is obviously reduced during application of combined formula. Obtaining more excellent extreme pressure capacity through compounding use of different extreme pressure agents is an important measure for formula design, from the experiments we can see that the mutual synergistic effect among various extreme pressure agents shall be inspected during compounding use of the extreme pressure agents in ceramic grinding fluid, so as to avoid producing high mutual hindering effect.

3 Summary (1)Although the application effect is not good, glycerol with multi-functional groups has good compounding effect and can improve the beneficial effect of other reagents. (2)The combination of silicate ester and phosphate ester shows intensive mutual hindering effect, and the grinding wheel passivation rate obtained from the compound formula is far greater than that of each of silicate ester and phosphate ester. (3)The compounding of boric acid ester, phosphate ester and silicate ester obtains good effect, and the grinding wheel passivation rate is obviously reduced during application of combined formula. (4)The mutual synergistic effect among various extreme pressure agents shall be inspected during compounding use of the extreme pressure agents in ceramic grinding fluid, so as to avoid producing high mutual hindering effect. Acknowledgement: The research supported by National Natural Science Foundation of China (Project number: 51275527).

Characteristics of Oleic Acid, Glycerol and Organic Ester in Grinding Fluid | 35

References [1]

[2]

[3]

[4]

[5]

R. Balarini, N.F. Strey, A. Sinatora, C. Scandian. “The influence of initial roughness and circular axial run-out on friction and wear behavior of Si3N4–Al2O3 sliding in water,” Tribology International, Volume 101, pp.226-233, September 2016, Maksim Antonov, Jüri Pirso, Ahto Vallikivi, et.al. “The effect of fine erodent retained on the surface during erosion of metals, ceramics, plastic, rubber and hardmetal” Wear, Volumes 354–355, pp. 53-68, 15 May 2016 Chunting Wang, Yuwei Ye, Xiaoyan Guan, et.al. “An analysis of tribological performance on Cr/GLC film coupling with Si3N4, SiC, WC, Al2O3 and ZrO2 in seawater,” Tribology International, Volume 96, pp.77-86, April 2016, G.K.R. Pereira, T. Silvestri, M. Amaral, M.P. Rippe, et.al. “Fatigue limit of polycrystalline zirconium oxide ceramics: Effect of grinding and low-temperature aging,” Journal of the Mechanical Behavior of Biomedical Materials, Volume 61, Pages 45-54,August 2016 Jean-Jacques Canneto, Maria Cattani-Lorente, Stéphane Durual, et.al. “Grinding damage assessment on four high-strength ceramics” Dental Materials, Volume 32, Issue 2, Pages 171182, February 2016

Xian-Zhong Qin1, Fei-Peng Cai2, Gai Yang3 and Su-Qin Hu4

Novel Room-Temperature Molten Salt Based on Chlorine Chloride with Hydrogen Bond Donors Abstract: the thermal and electrochemical properties of novel room temperature molten salt based on chlorine chloride (ChCl) with hydrogen bond donors (HBD): urea, ethylene glycol (EG), Acetimidic Acid (AcNH2) was studied by differential scanning calorimeter and ionic conductivity. These molten salts appeared as liquid at room temperature though they were composed of two solids. The DSC analysis showed that the molten salts had excellent thermal stabilities with a melting point lower than that of each individual component. Electrochemical test showed that the conductivity of ChCl-EG molten salt at molar ratio 1:1.5was 5.24×10-3S/cm at 25°C and 2.04×10-2S/cm at 60°C.) Keywords: room-temperature molten salt; choline chloride; thermochemical stability; ionic conductivity

1 Introduction Recent years, room-temperature molten salts (which are composed of ions and present liquid at room temperature, also which was known as room temperature ionic liquids (RTLs)) have been widely studied and applied particularly in the battery, capacitors, electrode position, etc. for its unique physical and chemical properties such as thermal stability, high solubility, high conductivity, wide electrochemical window, etc., especially its non-volatile and non-flammability, which provides a new choice for improving and enhancing the safety aspects of the performance of

|| 1 Energy Research Institute of Shandong Academy of Sciences, Key Laboratory for Biomass Gasification Technology of Shandong Province Jina, China, [email protected] 2 Energy Research Institute of Shandong Academy of Sciences, Key Laboratory for Biomass Gasification Technology of Shandong Province Jina, China, [email protected] 3 Energy Research Institute of Shandong Academy of Sciences, Key Laboratory for Biomass Gasification Technology of Shandong Province Jina, China, [email protected] 4 Energy Research Institute of Shandong Academy of Sciences, Key Laboratory for Biomass Gasification Technology of Shandong Province , Jina, China, [email protected] 10.1515/9783110516623-004 DOI 10.1515/9783110303568-004

38 |Xian-Zhong Qin, Fei-Peng Cai, Gai Yang and Su-Qin Hu lithium-ion batteries[1-3]. However, the latest toxicological study showed that ionic liquids were toxic, because most of the ionic liquids was an anion of a halogen anion synthetic (e.g. [Cl-1], [PF6-1], [BF4-1]), but such ionic liquids environmental and biological systems were harmful [4]. Moreover its high cost and large-scale industrial application development was limited by the presence of ionic liquids and the synthesis of complex, difficult purification drawbacks [5].To overcome the high price and toxicity of RTILs, a new room-temperature molten salts can be obtained by simply mixing a quaternary ammonium salt with metal salts or a hydrogen bond donors (HBD) that has the ability to form a complex with the halide anion of the quaternary ammonium salt. One of the most wide-spread components used for the formation of these room-temperature molten salts was chlorine chloride (ChCl). ChCl was a very cheap, biodegradable and non-toxic quaternary ammonium salt which could be either extracted from biomass or readily synthesized from fossil reserves (million metric tons) through a very high atom economy process [6]. Currently, low-temperature molten salts have attracted widely attention and showed good application prospects in other areas of electrochemistry [7, 8]. In order to apply to lithium in molten salt systems, the LiCl anion was selected as the electrolyte. In conventional organic solvent electrolyte system was mainly used LiPF6 as electrolyte. Because LiCl anions were insoluble in organic electrolyte and the electrostatic interaction between the ions had stronger degree of association, which had lower migrate rate and lower conductivity in the conventional organic electrolyte. Also the rapidly reverse mobile ions leaded to higher concentration over potential in the electric field, making it difficult to use a lithium-ion battery electrolyte [9]. Compared to LiPF6, the LiCl as electrolyte was synthesized simply and good thermal stability. Furthermore LiCl was much cheaper than and higher stability and it had relatively small molecular weight, so that it required less quality under the same molar concentration [10]. They were few reports about the electrochemical Performance of choline chloride molten salt system, especially as the lithium ion electrolyte aspects. In this paper, we tested and analyzed for its chemical stability and thermal conductivity.

2 Experimental 2.1 Materials Choline chloride (AR, Sinopharm Chemical Reagent Co., Ltd.), Lithium chloride (AR, Tianjin Chemical Reagent mao), Acetimidic Acid (Purity≥ 98.5%, Tianjin Bodi Chemical Ltd.), Ethylene Glycol (CP, Beijing Yili Fine chemicals Co., Ltd.), Urea (Tianjin Hongyan chemical Reagent) were dried in vacuum at 55°C for 10h.

Chlorine Chloride with Hydrogen Bond Donors | 39

The ChCl were mixed with a molar ratio of different samples and heated to a homogeneous phase. ChCl and EG could slowly form a liquid; ChCl contacting surfaces wetted with Urea mixture, heated to a temperature to form a uniform liquid was allowed to cool to room temperature. RTLs were all prepared for the process in an argon atmosphere glove box (Lab master 130, German M. Braun Inc.).

2.2 Methods The thermal behavior of the molten salts were studied using a differential scanning calorimeter (DSC2010, TA Company USA). Melting points were determined in a glove box, the first seal about 10 mg sample measurement of liquid samples in a dedicated aluminum crucible, and then removed when measuring the first liquid nitrogen cooled to about room temperature, then 5°C /min rate of heating to150°C , measured under a nitrogen stream. The ionic conductivity of samples were measured by the AC impedance spectroscopy fitting, electrochemical impedance spectroscopy in workstation (CHI660A, Shanghai Chen Hua Instrument Company), the electricity was extremely bright platinum electrode, conductivity cell constant correction by the standard KCl solution standards, the sample in the glass tube installed in the glove box, bright platinum electrode was inserted and sealed after the removal, placed in incubators at 0 ~ 60 °C.

3 Results and Discussion 3.1 The Conductivity for ChCl- HBD at Various Molar Ratios From Fig.1 the relationship between the ChCl with HBD system, conductivity and temperature, the conductivity of the samples were increased with increasing temperature, but did not radiate linear relationship. Reported in the literature [11, 12], the electrical conductivity and the viscosity were relevant to the molecular size and weight, concentration, density of the ion. Generally, conductivity and viscosity was related inversely, so the ionic liquid with low viscosity had high conductivity and conductivity increased with the concentration. The fig. 1 showed molten salt was not very good at low temperature properties, 0 ~ 30°C conductivity less than 2.5×103S/cm, 30~60°C conductivity increases with increasing temperature slightly forward.

40 |Xian-Zhong Qin, Fei-Peng Cai, Gai Yang and Su-Qin Hu 25

ChCl:Urea(1:1) ChCl:Urea(1:2) ChCl:EG(1:1.5) ChCl:AcNH2(1:2)

15

.

-1 d/( mS cm )

20

10 5 0 0

10

20

30

40

50

60

t/ qC

Fig. 1: The conductivity for ChCl- HBD at various molar ratios

N (ChCl): n (EG) = 1:1.5 conductivity significantly higher than other samples, which was due to the low viscosity. The conductivity was 5.24×10-3S/cm at 25°C and 2.04×10-2S/cm at 60°C. The conductivity of the molten salts increased wih increasing the ChCl content. In the measuring range, n (ChCl): n (Urea) = 1:2 conductivity was slightly lower than the n (ChCl): n (Urea) = 1:1 sample. However, compared with the molar ratio of acetimidic acid molecules, the electric conductivity decreased this was closely related to their molecular structure. Although they had the same two NH bonds, but stronger than the intermolecular force acetamide acid molecular ion mobility was decreased so that n (ChCl): n (AcNH2) = 1:2 sample conductivity n (ChCl): n (Urea) = 1:2 was slightly higher compared to the samples. Ionic conductivity was an important parameter to measure the ionic liquid, which can be applied to the battery electrolyte. In addition, the conductivity variation with temperature of all samples were determined by fitting the temperature– dependent conductivity date to the Vogel- Tamman- Fulcher (VTF) equation for the best linearity relationship as shown in the inserted graph of fig.2. The VTF equation was as follows [13]: lnG= lnG0 - Ea / RT

Chlorine Chloride with Hydrogen Bond Donors | 41 1.2 ChCl:Urea (1:1)

1.0 o

-1

lg(s /(mScm ))

0.8

24 C

0.6

o

12 C

0.4 0.2 0.0 -0.2 -0.4 3.0

3.1

3.2

3.3 3.4 3 -1 -1 10 T /(K )

3.5

3.6

3.7

ChCl:AcNH2 (1:2)

1.0

0.0

-1

lg(s /(mScm ))

0.5

o

52 C

-0.5

o

24 C

-1.0 -1.5 -2.0

3.0

3.1

3.2

3.3 3.4 3 -1 -1 10 T /(K )

3.5

1.4

3.6

3.7

ChCl:EG (1:1.5)

1.2

-1

lg(s /(mScm ))

1.0 0.8 o

36 C

0.6 0.4 0.2 0.0 3.0

3.1

3.2

3.3 3 -1

3.4

3.5

3.6

3.7

-1

10 T /(K )

Fig. 2: The Arrhenius plots of conductivity for ChCl-HBD at various molar ratios

42 |Xian-Zhong Qin, Fei-Peng Cai, Gai Yang and Su-Qin Hu In the VTF equation, Gis the conductivity, G0 is the pre-exponential factor, Ea is the energy of the activation, T is the absolute temperature, and R is the gas constant. Further segmentation analysis showed: the conductivity of the sample n (ChCl): n (Urea) = 1:1. The first 10 points fall within 0 ~ 12°C and the last four points fall within 24 ~ 60°C, respectively fitting conductivity and temperature had a strong linear correlation. The inflection point was at 12 ~ 24°C, presumably the glass transition temperature fall into this temperature range. The DSC test results showed that the eutectic temperature of the sample was 24°C. The conductivity of the sample n (ChCl): n (Urea) = 1:2, The first 3 points fall within 0 ~ 8°C and the last 11 points fall within 16 ~ 60°C , respectively fitting conductivity and temperature had a strong linear correlation. The inflection point was at 8 ~ 12°C , presumably at this temperature range it presented glassy state and the sample occurred eutectic, which consistent with the DSC test results and the melting point of the sample was 12°C . The conductivity of the sample n (ChCl): n (AcNH2) = 1:2 before the 7 points fall in 0 ~ 24°C and the last 3 points was in 52 ~ 60°C respectively fitting. The conductivity and temperature had a strong linear correlation 24 ~ 52°C in a platform, in this sample was estimated eutectic occurs, the melting point of the test sample of a melting point of 51°C happened to fall within this temperature range. The conductivity of the sample n (ChCl): n (EG) = 1:1.5 temperature curve linear fit was found, the first 9 points was 0 ~ 32°C that after 7 points with 36 ~ 60°C respectively. The linear fit, two straight lines intersect at a point that the temperature at 36°C. And it was different from the first three samples, the sample n (ChCl): n (EG) = 1:1.5 without the eutectic temperature range, which may be ethylene glycol (EG) was itself below 36°C , a solution dissolving process , was higher than 36°C between choline chloride and ethylene glycol molecule hydrogen bond interactions occur. Several of the above-described test samples were found to fit the data, the eutectic melting point fall within the temperature interval of two cross curve fitting, which undoubtedly provided a new test method to test the melting point of the eutectic composition.

3.2 ChCl-HBD-LiCl System and Temperature It was reported that the pure ionic liquid had a high conductivity at room temperature, it cannot be used solely as electrolyte in the li-ion batteries and addition of LiCl could have an adverse effect on the ionic mobility and thus the ionic conductivity of the electrolytes. Hence, here we investigate the effect of concentration of lithium salt on the ionic conductivity and lithium ion mobility. Fig. 3 showed the ionic conductivity of electrolyte with different concentrations of the lithium salt. It can be easily found that, with increasing the concentration of the lithium salt, the ionic conductivity gradually decreases, which was mainly because a significant increase

Chlorine Chloride with Hydrogen Bond Donors | 43

of viscosity after introducing lithium salt depress the motion and transfer of free ions in the electrolyte systems. 6

ChCl:Urea(1:2) ChCl:Urea(1:1) ChCl:EG(1:1.5) ChCl:AcNH2(1:2)

5

-1

s(mscm )

4 3 2 1 0

0.0

0.5

1.0

1.5 2.0 X (licl %)

2.5

3.0

Fig. 3: The Arrhenius plots of conductivity for ChCl-HBD-LiCl at various weight ratios

4 Conclusion We synthesized colorless, transparent and uniform choline chloride ionic liquids. A comparative study on the conductivity, the conclusions as follows: (1)The relations system and the temperature can be seen from choline chloride (ChCl) and hydrogen-bond donor (HBD), the conductivity of each samples increased with temperature, but not they were not linear. (2) The results from fitting the data, the melting point of the eutectic temperatures fall within the range of the two cross curve fitting, which undoubtedly provided a new method to test the melting point of the molten salts. (3) The system was a low viscosity, high conductivity (up 2.04×10-2S/cm at 60°C) of ionic liquids. The conductivity increased with temperature and was related to the molecular size and weight, concentration, density of the ion. Acknowledgement: This work was sponsored by international S&T Cooperation Program of China (2014DFR50210), Shandong Provincial independent innovation and achievement transformation special funds (2014ZZCX05501) and Shandong Provincial Natural Science Foundation (ZR2016BQ44) and Jinan University Institute of Independent Innovation (201402023) and Research on Key Technologies of Pure Electric Vehicles and Industrial Application

44 |Xian-Zhong Qin, Fei-Peng Cai, Gai Yang and Su-Qin Hu

References [1] Qinghua Zhang, Karine De Oliveira Vigier, Sébastien Royer and François Jérôme, “Deep eutectic solvents: syntheses, properties and applications,”Chem.Soc.Rev.London,Vol.41,pp.71087146, May 2012. [2] Lu Wei, Youjun Fan. Progress of deep eutectic solvents and their applications. Chem.Beijing,Vol. 74,pp.333-338,April 2011. [3] Xiaofen Chen,Peng Yanqing. Application of deep eutectic solvents in green synthesis and combinatorial chemistry. Shanghai Chemical Industry. Shanghai, Vol.33, pp.10-13, August 2008. [4] Andrew P. Abbott,Glen Capper, David L.Davies, Raymond K. Rasheed and Vasuki Tambyraja. Novel solvent properties of choline chloride/urea mixtures. Chem.Common. London, Vol.1, pp.70-71, January 2003. [5] Andrew P. Abbott, Glen Capper, David L.Davies and Pragna Shikotra. Selective Extraction of Metals from Mixed Oxide Matrixes Using Choline-Based Ionic Liquids.Inorg.Chem.Washington, Vol.44pp. 6497−6499, October, 2005. [6] Andrew P. Abbott, David Boothby, Glen Capper, David L. Davies, and Raymond K. Rasheed.Deep Eutectic Solvents Formed between Choline Chloride and Carboxylic Acids: Versatile Alternatives to Ionic Liquids. J. AM. CHEM. SOC. Washington, Vol.126, pp.9143-9147, May 2004. [7] H.F. Xiang, B. Yin, H. Wang,H.W.Lin,X.W.Ge and C.H.Chen.. Improving electrochemical properties of room temperature ionic liquid (RTIL) based electrolyt for Li-ion batteries, Electrochimica Acta. New York, Vol.55, pp. 5204-5209, April 2010. [8] R.J. Chen, F. Wu, H.Y. Liang, C.Z. Zhang. New Room-temperature Molten Salt Based on LiTFSI with Acetamide and Ethyleneurea. Chemical journal of chinese universities. Beijing, Vol.11, pp.2108-2111, August 2011. [9] Ohno H.,Electrochemical Aspects of Ionic Liquids,2nd ed., New Jersey:John Wile &Sons Inc, 2011, pp.43-64. [10] Huaiyou Wang, Yan Jing, Xuehai Lv, Gang Yin, Xiaohua Wang, Ying Yao, Yong zhong Jia. Structure and physico-chemical properies of ionic liquid containg manesium chloride. Journal of Chemical Industry and Engineering (China). Beijing, Vol.62, pp.21-25, 2011. [11] Y.T. Dai, Jaap van Spronsenb, Geert-Jan Witkamp, etal. Natural deep eutectic solvents as new potential media for green Technology. Analytica Chimica Acta. Amsterdam,Vol. 766,pp.6168,January 2013. [12] Adam Latała, Marcin N edzi and Piotr Stepnowski. Toxicity of imidazolium ionic liquids towards algae.Influence of salinity variations. Green Chem. London, Vol.12, pp.60-64, April 2010. [13] Jose Restolhoa, b, Jose L. Mataa,c, Benilde Saramagoa. Choline based ionic liquids: interfacial properties of RTILs with strong hydrogen bonding. Fluid Phase Equilibria. Amsterdam, Vol.322323, pp.142–147, April 2012.

Yi-Ming Sun1, Teng-Fei Ma2, De-Peng Gong3 and Miao Yu4

Study on Organic Modification of Aluminum Powder Coating Abstract: In order to prepare coated aluminium pigments, the aluminium powders were coated with polyacrylic acid through in-situ polymerization. The effects of dosage of acrylic acid and DAAM-ADH dosage ratio on corrosion inhibiting efficiency of self-crosslinking coated pigment were experimentally investigated. The results show that, with acrylic acid of 0.5g, mass ratio of DAAM and ADH of 1:2, reaction temperature of 85°C the rate of corrosion inhibitor of self-crosslinking polyacrylic acid coated aluminium powder reach to more than 90%. Furthermore, the aluminium pigments are analysed by scanning electron microscopy, which reveal that the aluminium powders are successfully coated with polyacrylic acid. The aluminium pigments are analysed by Fourier transform infrared spectrum and the experiment of corrosion inhibitor, which reveal that the polyacrylic acid of coated aluminium powders generate cross-linking. Keywords: coated aluminium powder; self-crosslinking; inhibition efficiency; in-situ polymerization

1 Introduction Recent years, the government attaches great importance to the environmental issues so that more and more aluminium flake pigments have been used in waterborne coatings [1]. However, under the condition of water and oxygen, the lustre of aluminium powder was affected because of corrosion. Aluminium flake pigments will be more serious corrosion in alkaline environments [2].

|| 1 School of Materials Science and Engineering, Hubei University of Technology, Key Laboratory of Green Materials for Light Industry, Hubei University of Technology, Hubei Wuhan, China, E-mail: [email protected] 2 School of Materials Science and Engineering, Hubei University of Technology, Key Laboratory of Green Materials for Light Industry, Hubei University of Technology, Hubei Wuhan, China, E-mail: [email protected] 3 School of Materials Science and Engineering, Hubei University of Technology, Key Laboratory of Green, Materials for Light Industry, Hubei University of Technology, Hubei Wuhan, China, E-mail: [email protected] 4 School of Material Science and Engineering, Hubei University of Technology, Key Laboratory of Green Materials for Light Industry, Hubei University of Technology, Hubei Wuhan, China, Email:[email protected] 10.1515/9783110516623-005 DOI 10.1515/9783110303568-005

46 |Yi-Ming Sun, Teng-Fei Ma, De-Peng Gong and Miao Yu The primary means of aluminium powder protection is coating. In order to protect the aluminium powder from corrosion Qing-peng li etc [3] use tetraethylorthosilicate as raw material to coeat aluminium powder with silica, which disadvantage is the poor compatibility of coated aluminium powder and waterborne coatings. Hongwei Zhu etc [4] prepar polyacrylic acid / aluminum composite particles using the method of in-suit polymerization. Aluminium powder was coated with hydrophilic cacrylic acid, which could inhibit corrosion in some way, however acrylic could dissolve under aqueous environment for a long time. Liu etc [5] use methods of double cladding of organic shell- inorganic core and organic core- inorganic shell, the corrosion rate of coated aluminium powder up to 96.4%, 97.9%, which disadvantages are complex process and high cost. With the technology of self - crosslinking growing up, many self - crosslinking systems was used in coatings and adhesives to increase solvent resistance and hardness [6]. The aluminium pigments become hydrophobic by using self - crosslinking technology in coated aluminium powder. Xie etc [7] add aziridine cosslinker in the acrylic resinemulsion to improve the mechanical properties of rubber membrane and water, alkaline resistance, solvent resistance, however, the disadvantage of aziridine cosslinker are corrosive, high price and toxicity.Chen etc [8] used diacetone acrylamide (DAAM) and adipic dihydrazide (ADH) as crosslinker to prepare room temperature self - crosslinking acrylic resin with core - shell structure by the method. Of seeded emulsion polymerization. This article firstly proposed that combination of self - crosslinking technology and coating keep the hydrophilic and improve its water resistance at the same time. Acrylic was used to coating raw materials while self - crosslinking system of carbohydrazide was used to crosslink. Self - crosslinking system of carbohydrazide is characteristic of less pollution, safe and convenient in the process. The preparation of coating is characteristic of flexibility, mechanical strength, resistance to water [9, 10].

2 Experimental 2.1 Materials Aluminum: CP, Suzhou Alloy Material Co.Ltd; Ethanol: AR, Sinopharm Group chemical reagent Co; Isopropyl alcohol: AR, Sinopharm Group chemical reagent Co; Acrylic acid ( AA ): AR, Sinopharm Group chemical reagent Co; Ammonium persulfate: AR, Sinopharm Group chemical reagent Co; Calcium hydroxide: AR, wind ship of Tianjin Chemical Reagents Technology Co.Ltd; Ammonia:AR, loading Plant of Shanghai Chemical Company; Diacetone acrylamide ( DAAM ): AR, Sinopharm

Study on Organic Modification of Aluminum Powder Coating | 47

Group chemical reagent Co; Adipic dihydrazide ( ADH ): Analysis of pure, sinopharm Chemical Reagent Co. Ltd.

2.2 Apparatus Infrared Spectrometer: Fourier type FT-IR200, the NICOLET company; Scanning Electron Microscope: JSM-6390LV, JEOL Japanese Hitachi Company.

2.3 Specimen Preparation Weighing a certain amount of aluminum powder with anhydrous ethanol washing three times and then suction filtration. Taking a certain amount of washed aluminum powder, sodium bicarbonate, isopropyl alcohol, acid, DAAM and distilled water, then adding the three flasks fitted with condensing tubes and blenders, and then warming up to the right temperature, constant pressure drop funnel into ammonium persulfate initiator to made acrylic and DAAM functional monomer polymerization on the surface of aluminum powder, adjustment of pH to 7-8 using ammonia after cooling, adding ADH solution and stirring, self - crosslinking coated with aluminium powder was getting after suction filter. Repeating the experiment in different reaction conditions.

2.4 Sample Characterization 2.4.1 Corrosion Tests Weighing 0.5g coated aluminium powder place in the conical flask, Pour 40ml pH=12 calcium hydroxide solution, and put a catheter inserted in the tank filled with water in a graduated cylinder, 24h after reading. J corrosion inhibition efficiency is used to judge the effect of Corrosion Protection of Aluminum pigments:

-

9  9 u  9

(1)

Equation (1) is the equation for calculating rates of corrosion inhibitor J,where V0 refers to the volume of release of hydrogen that is not coated with aluminium powder in conditions of solution of calcium hydroxide with pH equals to 12; V refers to the volume of release of hydrogen of flake aluminium powder Coated in conditions of solution of calcium hydroxide with pH equals to 12.

48 |Yi-Ming Sun, Teng-Fei Ma, De-Peng Gong and Miao Yu 2.4.2 Infrared Spectroscopic Analysis Infrared analysis of aluminium powder coated: Taking a small amount of drying test powder pattern and KBR powder, mixing, and mulling, sample scanning ranges from 4000 to 400cm-1.

2.4.3 Analysis by Scanning Electron Microscope ( SEM ) On self-crosslinking of aluminium powder-coated surface spraying, using Japanese Neo-Confucianism H-800 test scanning electron microscope, then observing surface.

3 Results and Discussions 3.1 Corrosion Tests Results in Different Reaction Conditions Studing on the effects of the amount of acrylic acid on the aluminum powder coating corrosion efficiency when aluminum powder of 2g, ammonium persulfate of 0.2g, mass ratio of DAAM and ADH of 2:1, reaction time of 2 hour and reaction temperature of 85°C. In Figure 1it can be seen that with the increase of amount of acrylic acid, inhibition efficiency increased gradually. With the increase the amount of acrylic acid on the one hand increases the chance of contact with aluminium powder, more polies - acrylic acid coating on aluminum flake powder. Besides, the more amount of acrylic acid the more chance of reaction with functional monomer of DAAM, polyacrylic acid on the surface of the aluminum powder crosslinking more fully.

Study on Organic Modification of Aluminum Powder Coating | 49

100

Self cross-linking polyacrylic acid - coated aluminum powder

90 80

J/%

70 60 50 40 30 20

0.1

0.2

0.3

0.4

0.5

AA/g

Fig.1: A plot of (J) corrosion inhibition efficiency versus the mass of AA

Studying on the effects of the mass ratio of DAAM and ADH on the aluminum powder coating effects of corrosion efficiency when aluminum powder of 2g, acrylic acid of 0.3, ammonium persulfate of 0.2, reaction time of 2 hour and reaction temperature of 85°C. In Figure 2 it can be seen that increase the quality of ADH, inhibition corrosion efficiency of coated aluminium powder is also on the rise when the mass ratio of ADH and DAAM small than 0.5, because the increased quality of ADH increase the chances of reacting to the DAAM, which increases the degree of crosslinking systems, and makes polypropylene acid on the surface of coated aluminium powder more resistant to water and corrosion; Inhibition corrosion efficiency of coated aluminium powder is little change when the mass ratio of ADH and DAAM more than 0.5, because the quality of ADH increases, but the quality of DAAM not increase, there is no functional groups of cross-linking react with ADH, so the degree of crosslinking will not increase, the water resistance and corrosion resistance of aluminum powder will not improve, so the inhibition efficiency was also little changed.

50 |Yi-Ming Sun, Teng-Fei Ma, De-Peng Gong and Miao Yu 86 84

Self cross-linking polyacrylic acid - coated aluminum powder

82 80

J/%

78 76 74 72 70 68 66 0.0

0.5

1.0

1.5

2.0

2.5

3.0

ADH/DAAM

Fig. 2: A plot of corrosion inhibition efficiency versus mass ratio of DAAM and ADH

3.2 Infrared Spectroscopy Comparing with figure3 (a) and 3(b), the wave number in the field of 1500-1675 only one peak which is the characteristics absorption of carbon - carbon double bond stretching vibration can be found in fig.a, while in figure b in the field of 1500-1675 has two peaks, which is carbon - carbon double bond extension vibration and carbon - nitrogen double bond extension vibration. The Carbon - Nitrogen double bond is formed by hydrazide crosslinking reaction.

Study on Organic Modification of Aluminum Powder Coating | 51 a

polyacrylic acid coated aluminum particles

3411.42

2925.87

1092.55

1587.91

1458.94

3500 3000 2500 2000 1500 1000 500

0



Wave numberFP

b

Self cross-linking polyacrylic acid - coated aluminum powder

3415.72

2933.99

1367.13 1713.18 1457.68 1632.12 1170.23

1537

3500 3000 2500 2000 1500 1000

500

0

-1

Wave number/cm

Fig. 3: The FTIR spectrum: a is polyacrylic acid coated aluminium powder; b is self - crosslinking polyacrylic acid coated aluminium powder

3.3 Scanning Electron Microscopy ( SEM ) Analysis Aluminum powder particle surface can be seen angular from figure4 (a), according to which, the grooves can be show clearly, figure4 (c) can't shows a clear edge and

52 |Yi-Ming Sun, Teng-Fei Ma, De-Peng Gong and Miao Yu notch, however, a fuzzy layer of material on it, because aluminum powder coating cross linked polyacrylic acid. a

c

b

d

Fig. 4: SEM of aluminum powder and coated aluminium powder (a) the local morphology of aluminum powder; (b) the overall morphology of aluminum powder; (c) the local topography of coated aluminum particles; (d) the overall top ography of coated aluminum particles.

4 Conclusions (1)Through analyzing the study on preparing self - crosslinking coated aluminum particles by using in - situ polymerization of acrylic acid and then introducing hydrazine crosslinking system,it’s found that the more amount of acrylic acid corrosion rate the better of self - crosslinking coated aluminum particles, mass ratio of ADH and DAAM affect the degree of crosslinking of coated aluminum particles.

Study on Organic Modification of Aluminum Powder Coating | 53

(2)The corrosion rate of preparatied self - crosslinking polyacrylic acid coated aluminum is higher than 90% under the conditions acrylic acid of 0.3g, mass ratio of DAAM and ADH of 2:1, reaction time of 2 hour and reaction temperature of 95 °C. (3)A layer of film on aluminum powder can be observed by scanning electron microscopy, which proved polyacrylate coat on aluminium powder successly. It’s found the characteristics absorption peak of the Carbon - Nitrogen double bond by IR spectra, which is due to the formation of cross – linking.

References [1]

[2]

[3]

[4]

[5] [6] [7] [8]

[9]

[10]

Gao Aihuan, Pi Pihui, Wen Xiufang, Cheng Jiang, “Research Progress of modification of aluminum pigments for corrosion protection,” Chemical Industry and Engineering Progress, Vol. 28, pp. 485-490 2009 Liang Wei,Ye Hongqi, Chen Yuqiong, Liu Xiuyun, “Corrosion Resistance of the Flaky Aluminum Powder Coated by Emulsion Polymerization,” Journal of Chinese Society for Corrosion and Protection, vol. 31, pp. 68-71 2011 Li Qingpeng,Ding Guoqiang,Liu Jianguo, He Xiujuan,Yan Chuanwei, “Inhibition of Hydrogen Evolution for Powder Mixture of Zn and Al by SiO2 Coated Al,” Paint Industry, vol. 42, pp. 7579 2012 Hongwei Zhu, Zhenxing Chen, Yong Sheng, Thu Thuy Luong Thi, “ Flaky polyacrylic acid/aluminium composite particles prepared using in-suit polymerization,” Dyes and Pigments, vol. 86, pp. 155-160 2010 Liu hui,Ye Hongquan, “Influence of Double-Layer Coating on the Anticorrosion Behavior of Aluninium Powders,” Materials Protection, vol. 41, pp. 38-40 2008 Peng Jun,Ren Biye,Ou Yang, “Propress in Ambient Self-Crosslinking Technology of One Component Waterborne Coatings,” Paint and Coatings Industry, vol. 42, pp. 73-79 2012 Xie Fei,Liu Zonghui,Wei Deqing, “ Properties and Curing Kinetic of Acrylic Resin Cured with Aziridine Crosslinker,” synthetic chemistry, vol. 10, pp. 120-125 2002 Chen Jia,Qiang Xihuai, “Synthesis and Characterization Research of Keto-hydrazine Crosslinking Core-shell Structure Acrylate Emulsion,” Fine Chemical Industry, vol. 29, pp. 1212-1216 2012 Yan Xu,Tang Yifeng,Tang Liming, “Synthesis,structure and properties of water-based ambient self-crosslinkable polyacrylate emulsion,” Electroplating and Finishing, vol. 32, pp. 57-61 2013 Fu Xiaokun,Qu Linchuan, “Consideration on the Fire Protection Technology of Construction Steel Structure,” Shang hai coating, vol. 52, p.44-46 2014

Neng-Wei Wang1*, You Li2, Ren-Fu Li3 and Xiao Tang4

Study on Material of Exothermic Insulation Riser Sleeve Abstract: The exothermic insulation riser sleeve has dual efficacy of heating and heat preservation and further improves the efficiency of feeding. In this paper, a new formula is proposed which bases on the same kind of heat insulation riser analyzed and by the single factor analysis researched. The formula has many merits including the wide raw material, low cost, high intensity, feeding on time, feeding the characteristics of high efficiency. Keywords: Exothermic insulation, Riser, Formula, Feeding.

1 Introduction Insulation risers is mainly made by ecospheres, vermiculites and expanded perlite which belong to thermal insulation materials or refractories. Insulation risers get the property of insulation through thermal insulation material’s reduce of the liquid steel’s heat dissipation, besides, liquid steel’s solidification time will be much longer, feeding efficiency will be also increased[1-5]. Exothermic-insulated risers are invented basted on the insulation risers which have the properties of heat and insulation and increase the feeding efficiency deeply. It’s mixed by thermite, flux, oxidant and thermal etc. From the liquid steel implant to the dies to temperature, it covers three prospects including contraction, solidification shrinkage and solid shrinkage. If the metal liquid’s feeding can’t be obtained in the course of liquid contraction and solidification shrinkage, shrinkage cavity and shrinkage porosity will appear at the place of concreting, then the casting’s mechanical properties and operating requirements will be influenced, and the casting will scrap[6-8]. In order to reduce the defects of the casting, get the perfect casting and increase the yield rate, the insulation riser sleeves always are used to feed the casting in the factories.

|| 1 School of Material Science and Engineering, Panzhihua University, 617000 Panzhihua, Sichuan Province, People’s Republic of China, [email protected] 2 School of Material Science and Engineering, Panzhihua, University, 617000 Panzhihua, Sichuan Province, People’s Republic of China, [email protected] 3 School of Material Science and Engineering, Panzhihua, University, 617000 Panzhihua, Sichuan Province, People’s Republic of China, [email protected] 4 School of Material Science and Engineering, Panzhihua, University, 617000 Panzhihua, Sichuan Province, People’s Republic of China, [email protected] 10.1515/9783110516623-006 DOI 10.1515/9783110303568-006

56 |Neng-Wei Wang, You Li, Ren-Fu Li and Xiao Tang In the 1920s, the casting workers used the same founding materials of the casting to produce risers to carry out feeding. But the heat of liquid metal lost too fast, the feeding efficiency of liquid was from 6 percent to 10 percent [9]. In order to make the risers have enough metal liquid to the only feeding of casting in the solidification process and get qualified castings, larger and higher risers must be designed; more metal was recycled to smelt. Then more manpower, material resources and energy were needed, the casting cost improved greatly. Exothermic insulation risers were produced in order to overcome the above shortcomings. The risers were formed by different kinds of materials including thermal insulation material, heating materials, refractory aggregate, regulator and binder. The material must have the following requirements: good heat preservation performance, strong chemical stability under high temperature, good fireproof performance, enough dry strength and wet strength, no environmental pollution in the course of using, what’s more, source of raw materials is widely obtained, the price is low and it is easy to be purchased, etc[10-14]

2 Experimental Process The single factor level is used in the experiment. That is to say, a factor is changed and other factors are fixed. In the test, raw materials were needed including cenosphere, silica powder, aluminium powder, iron oxide powder, magnesite, graphite powder, potassium permanganate, potassium chloride, potassium nitrate, borax etc. According to the needs these materials were mixed with a certain formula of water and water glass together, from which each 10 grams was taken and pressed into small cylindrical samples. The diameter of the specimen was 20mm. The samples were placed to dry under the natural conditions for 24h, and then put into a drying oven at 150 degrees for 3h. The tests of ignition time (the time that the sample is put into the heating furnace to turn red) were carried out after drying at 720 degrees in the constant temperature electric furnace respectively. The burning phenomenon was observed.

3 Analysis And Discussion 3.1 Study of Optimization Formula 3.1.1 Optimized Formula of Exothermic Agent Aluminum powder was used as an exothermic compound in the experiment, the content of aluminum powder was added to 8 percent, 12 percent, 16 percent, 20

Study on Material of Exothermic Insulation Riser Sleeve | 57

percent, and 24 percent respectively, and other components were adjusted properly. Figure 3.1 displays the relationship of different content of aluminum powder and ignition time. The ignition time becomes less and less when the content of aluminum powder increases gradually. As the content of aluminum powder is added up to 16 percent from 8 percent, the ignition time is slowly dropped from 34 seconds to 30 seconds. However, when the content is added up to 24 percent, the ignition time declines sharply, dropping from 30s to 18s. It is indicated that the content of added aluminum powder makes the ignition time of the exothermic riser materials shortened. The effect of aluminum powder on ignition time and cost is totally considered. The content range of aluminum powder is from 16% to 20%, which can not only make the ignition time of the exothermic riser shortened, but also make a lot of heat extraction released to supply the metal liquid in the riser.

34 32

Ignition time/s

30 28 26 24 22 20 18

8

10

12

14

16

18

20

22

24

Content of aluminium powder/% Fig.3.1: The relationship of the content of aluminum powder and ignition time

3.1.2 Optimized Formula of Slow Heating Material The aluminum thermal reaction can release a lot of heat, but the reaction rate is fast. In insulation and exothermic riser more mild fever materials are needed to add to increase the attached heating time, relieving the effect of heating. Common slow heating materials are charcoal powder, sawdust, coke and graphite powder, etc. The main material of the slow heating agents is carbon. Many small holes appear after materials are burned in the riser sleeve, making the object of heat dissipation performance enhanced. Graphite powder has the advantages of stable structure, high purity, commonly used in the laboratory and low price. As a result graphite powder has strong representation in slow heating materials. So graphite powder is chosen to

58 |Neng-Wei Wang, You Li, Ren-Fu Li and Xiao Tang study the ignition time for the heat insulation risers in the experiment. The content of graphite powder was 11 percent, 13 percent, 15 percent, 17 percent, 19 percent, respectively. Figure 3.2 displays the influence of graphite powder on ignition time.

80

Ignition time/s

70 60 50 40 30

10

12

14

16

18

20

Content of graphite powder Fig. 3.2: The relationship of the content of graphite powder and ignition time

It can be seen from Fig.3.2 that the ignition time becomes longer with the increase of the content of graphite powder. The ignition time is the shortest, only 34s when the content of graphite powder is 11 percent, while the time is 82s when the content of graphite powder is 19 percent. With the increase of the content of graphite powder, the ignition time changes greatly. The rate of change is different which can be divided into two stages. When the content of graphite powder is changed from 9 percent to 11percent, the ignition time increases slowly, only from 34s to 36 s. While the content of graphite powder is changed from 11 percent to 19 percent, the increasing rate of the ignition timing is bigger, from 36s to 83s directly. So when the content of graphite powder is less than 11 percent, the ignition time is less affected, while when the content of graphite powder is more than 11 percent, the ignition time was more affected. Through the above analysis, it is appropriate that the content of graphite powder should be chosen from 11 percent to 13 percent.

3.1.3 Optimized Formula of Oxidant Agent The role of oxidants is to adjust appropriate exothermic reaction which can make the thermite burned and burned out easily. Common antioxidants are used such as

Study on Material of Exothermic Insulation Riser Sleeve | 59

potassium nitrate, sodium nitrate, potassium permanganate and so on, which can make oxygen released under high temperature conditions by decomposition. At the same time the decomposition products have a certain catalytic effect, and can further accelerate the thermite reaction. Manganese dioxide is the decomposition product of potassium permanganate. It has more obvious catalytic action and can reduce the activation energy of thermite reaction, reduce the temperature of thermite reaction, make the thermite lit time become shorter. Under the condition of high temperature not only strong oxidizer has the effect and catalytic oxidation, but sodium chloride, potassium chloride and magnesium chloride also has a certain action of oxidation. The study and use about sodium chloride, potassium chloride and magnesium chloride in exothermic insulation riser are less. In the experiment potassium chloride as the representative of chloride is focused on the ignition time for exothermic insulation riser. Potassium nitrate, potassium chloride and potassium permanganate are used as oxidizing agent of exothermic insulation riser. The content of potassium nitrate and potassium permanganate is fixed to 4% and 2% respectively, and the content of potassium chloride is zero, 1 percent, 2 percent, 3 percent, 4 percent respectively, and the effect of potassium chloride on ignition time is shown in Fig 3.3.

38

Ignition time/s

36 34 32 30

0

1

2

3

4

Content of potassium chloride Fig. 3.3: The relationship of the content of potassium chloride and ignition time

It can be seen from Fig 3.3 that the content of potassium chloride has an especial relationship with ignition time, which is similar to the English letter "V". When there is no potassium chloride, the ignition time is the longest, which is 38.2s. When the content of potassium chloride is 2 percent, the ignition time is the shortest,

60 |Neng-Wei Wang, You Li, Ren-Fu Li and Xiao Tang which is 31.6s. When the content of potassium chloride is changed from zero to 2 percent, the ignition time becomes shorter with the increase of the content of potassium chloride. The ignition time decreased from 38.1s to 36.4s, and the change was smaller and the change rate was slower when potassium chloride is changed from zero to 1 percent. While the ignition time is reduced from 36.4 to 31.3, the change is larger, and the change is faster when the content is changed from 1 percent to 2 percent. When the potassium chloride content is changed from 2 percent to 4 percent, the ignition time increases from 31.3s to 35.6s. Changed speed is the same basically. In conclusion, potassium chloride plays a crucial role in the ignition time which has a good effect on improving the performance of exothermic insulation riser, so choose the content of potassium chloride is chosen from 1 percent to 2 percent.

3.1.4 Optimized Formula of Flux The study shows that the reaction temperature, heating speed and reaction time can be changed by the flux; what’s more, low melting slag also can be generated by some of them. At present cryolite, borax and fluoride (potassium fluoride and calcium fluoride) have been used as the flux widely, which can effectively reduce the heating material melting temperature. But it is different for them to reduce the melting temperature, in which borax has the best effect. In order to achieve excellent performance of heat insulation riser, borax was used in the test, while cryolite was abandoned. The content of borax was zero, 1 percent, 2 percent, 3 percent, 4 percent. Fig 3.4 shows the relationship of borax and the ignition time. It can be seen from Fig 3.4 that the ignition time decreases gradually with the increase of borax content. But the rate of reduction is different which can be roughly divided into three processes. First, the content of borax is changed from zero to 1 percent, the ignition time decreases sharply, from 290s to 81s. It shows that thermite reaction is very difficult without borax. Here the borax has the role to reduce the activation energy of the reaction and decrease the reaction temperature. Second, the content of borax increases from 1 percent to 2 percent, the ignition time decreases directly from 81s to 50s. Third, the content of borax increases from 2 percent to 4 percent, the decline range of the ignition time is uniform, reducing from 50s to 34s. This fully shows that it has a certain impact on the effect of ignition time when the content of borax is over 2 percent, but the effect is limited. In summary, it is ideal that the content of borax is controlled from 2 percent to 4 percent.

Study on Material of Exothermic Insulation Riser Sleeve | 61

300

Ignition time/s

250 200 150 100 50 0

0

2

Content of borax/%

4

Fig. 3.4: The relationship of the content of borax and ignition time

3.1.5 The Effect of Binder on the Strength of the Heat Insulation Riser The influence of the content of sodium silicate on the strength of the heat insulation riser is shown in Fig 3.5. The amount of the added sodium silicate is proportional to the compressive strength of the sample, the more amount of sodium silicate is, and the stronger the compressive strength is. When the content of sodium silicate is 9 ml, compressive strength is minimum, only about 0.6kg/cm2. When the quantity of the added sodium silicate is 17 ml, compressive strength is the highest, about 2kg/cm2. Therefore, when the quantity of sodium silicate is 12 ml or so, the strength is enough safety for heat insulation riser.

62 |Neng-Wei Wang, You Li, Ren-Fu Li and Xiao Tang

Compressive strength/ Kg/cm2

2.0 1.8 1.6 1.4 1.2 1.0 0.8 0.6 8

10

12 14 16 Content of sodium silicate

18

Fig. 3.5: The relationship between the content of sodium silicate and compressive strength

The content of sodium silicate is chosen from 9ml to 13 ml by various factors integrated.

3.2 The Test Results of the Heat Insulation riser Sleeve According to the study on the optimal formulation of the scheme mentioned above, the formula of exothermic insulation riser sleeve is as follows: cenosphere 35%~41%, silicon powder 4%~6% magnesia 4%~6%, aluminum powder 18~20%, iron oxide powder 10%~12%, graphite powder 11%~13%, potassium nitrate 4%, potassium permanganate 2%~3%, potassium chloride 1 ~ 2%, borax 2%~5%, sodium silicate and water are 12ml and 20ml in 100 grams of dry mixed materials. According to the above formula, the specific formula of the two groups is listed out, respectively. One of the optimized formulations is as follows: cenosphere 35%, silicon powder 5%, magnesia 4%, aluminum powder 20%, iron oxide powder 12%, graphite powder 13%, potassium nitrate 4%, potassium permanganate 3%, potassium chloride 2%, and borax 2%. The other of the optimized formulations is as follows: cenosphere 41%, silicon powder 4%, magnesia 5%, aluminum powder 18%, iron oxide powder 10%, graphite powder 11%, potassium nitrate 4%, potassium permanganate 3%, potassium chloride 1%, and borax 3%.

Study on Material of Exothermic Insulation Riser Sleeve | 63

According to the above two kinds of formulations tested, good results in feeding are achieved for the heat insulation riser sleeves, so the desired purpose of the formula is obtained.

4 Conclusion This topic studies the heat insulation riser material for riser ignition time and the influence of the secondary combustion time, finally the optimum formula is obtained by testing, it is concluded that the conclusion is as follows: (1) The single factor analysis is used in the experiment; a new formulation is developed by the study of ignition time for the exothermic insulation risers. (2) Potassium chloride which has double effect of oxidizer and flux plays a very important role on ignition time for exothermic insulation risers, but the content of potassium chloride should not be high. (3) The influence on the ignition time is studied by experimental study on a variety of materials, the composition and proportion of various excellent exothermic insulation riser is obtained, the formula of exothermic insulation riser sleeve is as follows: cenosphere 35%~41%, silicon powder 4%~6% magnesia 4%~6%, aluminum powder 18~20%, iron oxide powder 10%~12%, graphite powder 11%~13%, potassium nitrate 4%, potassium permanganate 2%~3%, potassium chloride 1~2%, borax 2%~5%, sodium silicate and water are 12ml and 20ml in 100 grams of dry mixed materials. Acknowledgement: This work was financially supported by National Innovation Training Program for College Students (201411360005).

References [1] [2] [3]

[4] [5] [6] [7]

WANG Zuo-li. The Application of Heat Preserving Casting Head in Foundry Production. Research Studies on Foundry Equipment. Vol.4 (2004): p.39-p.40. WANG Min. Application of Heat Insulating Feeder in Foundry Production. Production Method & Process. Vol.4 (2005): p.51-p52. SONG Zhong-xun, YAN You-wei, etc. Influence of Sylvite Oxidizer on Properties of Exothermic/ Insulation Riser Sleeve. Equipments, Measurements and miscellanea. Vol.2 (2007):p.76p.80. He Yuan, MA Min-tuan. Development of a New Heat Insulation Riser. Hot Working. Vol.12 (2000):p.9-p.10. QUAN Bei-ping, XU Hong, GU Hong-chen, etc. Progress in Research and Application for Hollow Micro Beads of Fly Ash. Industrial Minerals and Processing.Vol.11 (2003):p.30-p.33. YU Jin, MAO Lin, LI Cheng-ye, etc. New Formulation of Exothermic Compound Used in the Heat-preservation Riser-head. Foundry Technology. Vol.30 (2009):p.1102-p.1104. LIANG Yu-xing. The Application of Thermo-aluminium Reacting Technology to the Riser of Big Steel Casting. Foundry Technology. Vol.5 (1999):p.22.

64 |Neng-Wei Wang, You Li, Ren-Fu Li and Xiao Tang [8] [9] [10] [11] [12] [13] [14]

WANG Ai-qin, WANG Wen-yan, XIE Jing-pei, etc. GL- I Risers Covering Flux and Its Application. Hot Working Technology. Vol.3 (2003):p.58-p.59. LI Jun-ru, ZHANG Ming. Experimental Study on the Heat Riser Sleeve. Shanxi Machinery. Vol.1 (1994):p.25-p.28. LI Chuan-shi. Application Status and Development Trend of Domestic and Foreign Foundry Binder. Hot Working. Vol.3 (2004): p.1-p.4. ZHAO Yu-hua, HAI Jie. A Study on Insulation Riser and Its Application in Cast Steel Items. Journal of Shenyang Institute of Aeronautical Engineering.Vol.17 (2000):p.34-p.37. KOU Feng-he, LIU Fu-lai,etc. Research and Application of Insulation Riser Cenospheres. Journal of University of Science and Technology Beijing. Vol.12 (1990):p.227-p.232. ZHANG Shu-lan. A New Type of Cover Flux for Risers. Hot Working Process. Vol.2 (1994):p.41p.42. WEI Bing, TANG Yi-lin, ZHU Jian-xun. Application of Exothermic and Insulating Riser on the Casting Feeding Technology. Foundry Technology. Vol.29 (2008):p.971-p.974.

Lei Chen1 and Rui Shi2

The Efficiency Calculation of Cobalt Oxide for Artificial Photosynthesis with ExponentialDoping Abstract: The semiconductor material Cobalt oxide (Co3O4) was selected for the experiment of artificial photosynthesis, but from sunlight capture to water splitting, the conversion efficiency of the whole process was below 10%. Doping is one of the methods to improve the conversion efficiency. In this paper we will calculate the conversion efficiency of exponential-doped Co3O4 film with different thickness. By solving continuity equation and compare the efficiency curves to find the best thickness, which can achieve highest conversion efficiency. Due to the regular pattern of exponential-doping is along the trend of the exponential function from one surface of the semiconductor layer to another. So, we can compare and find which surface under the illumination will show higher conversion efficiency and find the best film thickness. According to the result, the surface with lower doping concentration under the sunlight irradiate can get higher efficiency and the 4.4μm thickness layer show highest efficiency. Keywords: artificial photosynthesis; conversion efficiency; Co3O4; exponentialdoping; incident surface; optimum film thickness

1 Introduction At present, the main energy resource is fossil fuel, but after the fossil fuel was burned, carbon dioxide (CO2) and sulfur dioxide (SO2) will be released, which will lead to global warming and acid rains. To solve the problems about the climate, we should find another kind of energy resource with cleanly, renewable and some other advantages. For an example, nuclear electric power generation will not generate CO2 and SO2 and we just need 30 tons nuclear fuel every year, which is much more less than the coal consuming(2700 tons every year)[1][2]. Wind energy is a new kind of new energy, too. The conversion efficiency has gotten 59% [3]. Photosynthesis is a biological reaction, which is happened inside the chloro-

|| 1 Department of Mathematics and Physics, North China electronic power university, NCEPU, Beijing, China, [email protected] 2 Department of Mathematics and Physics, North China electronic power university, NCEPU, Beijing, China, [email protected] 10.1515/9783110516623-007 DOI 10.1515/9783110303568-007

66 | Lei Chen and Rui Shi plast to provide energy and organic materials for plants growing. The process is that the electronics in chlorophyll are excited by sunlight to split water and emit oxygen, hydrogen ions and CO2 will join the carbon cycle together to generate organic materials. The artificial photosynthesis is use the semiconductor material to substitute chlorophyll to split water, the hydrogen from the reaction can be used for hydrogen electric power. The reaction of photosynthesis in chloroplast:

chloroghyll  hQ

o chlorophyll  e  chlorophyll   H 2 O o 1 O2  H  2   2e  2 H o H 2 

Artificial photosynthesis:

semiconductor  hQ semiconductor 

o semiconductor  e  1  H 2 O o O2  H  2 

2e   2 H  o H 2 From the reaction equations, we can understand that artificial photosynthesis is the combination of solar cell and hydrogen electric power, they are low cost and will not pollute environment [4]. 1hour of sunlight falling to the earth is equivalent to all the energy consumed by humans in an entire year [5], from that we can understand how abundant the solar energy is. The research about artificial photosynthesis is originated from 1972; Japanese researcher Akira Fujishima and his tutor Kenichi Honda used n-type TiO2 to split water [6]. Due to the band gap of TiO2 is 3ev, the sunlight, which can be absorbed into TiO2 and motivate electronics to across the band gap to split water is limited in ultraviolet light area. It means that only 3%-5% of sunlight can be utilized [5]. After that, more and more researcher tried to use other kinds of semiconductor materials to improve artificial photosynthesis, such as in 2007, Arunava Gupta used CdS to split water. He changed the physics factories of the material, such as molar ratio of Cd and S in different annealing temperature [7]. In 2010, Heinz Frei and Feng Jiao did the research about the amount of hydrogen production from water splitting by nano-structured Co3O4 [8]. Steven Y.Reece and his colleagues used triple junction Co3O4 cell (Co3O4|amorphous silicon| NiMoZn) to split water, they call the device artificial leaf [9]. In 2012, Fengqiang Xion et al did the experiment about the photocatalytic activity of CdS, which was plated TiO2 on the surface [10].

The Efficiency Calculation Photosynthesis with Exponential-Doping | 67

In this paper, we select semiconductor material Co3O4. Cobalt is an earth-abundant element; the band gap of Co3O4 is 2.58-2.07ev [11], which means that it can absorb visible light. Co3O4 can be operated in near-neutral PH solution. In addition, Co3O4 will show excellent stability in reaction, it is not easy to be influenced by external environment shift [12] [13]. Due to the advantages above, Co3O4 has been widely used to electron device and lithium battery manufacturing [14]. All of the research is to make some kinds of invention becoming maturely. Co is an earth-abundant element and the cost of Co3O4 is lower than some kinds of materials’, so we can follow Steven’s work, to improve Co3O4 to make the conversion efficiency become higher.

2 Exponential Doping and Conversion Efficiency 2.1 The Conversion Efficiency The conversion efficiency of artificial photosynthesis [15]: J is current density on the surface of material, Pin is the total incident solar irradiance and 1.23ev is the stored energy of water splitting reaction.

2.2 Exponential Doping and Build-in Constant Electric Field From the equation of conversion efficiency ,we can find that, the conversion efficiency of artificial photosynthesis is similar to photoelectric conversion efficiency of solar cell, so we can reference the approach for solar conversion efficiency improving to promote artificial photosynthesis efficiency, such as multifunction[16][17], Dye-Sensitize[18]-[22] or doping[23]-[26]. Exponential-doping will create a build-in constant electric field, in this instance, non-equilibrium carriers can be moved not only by diffusion but also by the help of electric field force [27], which is good for non-equilibrium carriers to get to the surface of material instead of recombination. So-called exponential-doping means that the doping concentration (N(x)) along the trend of exponential function:

N x

N 0 ˜ exp  Ax

Where A is the coefficient of exponential doping, N0 is the initial doping concentration. Doping will change the energy level:

68 | Lei Chen and Rui Shi

EV  K 0 ˜ T ˜ ln

EF

Na NV

Where EF is the Fermi level, K0 is Boltzmann's constant, T is the absolute temperature, Na is doping concentration, Nv is the valence band effective density of states. If the doping concentration is Na1 and Na2 respectively:

E F1

EV 1  K 0 ˜ T ˜ ln

N a1 NV

EF 2

EV 2  K 0 ˜ T ˜ ln

N a2 NV

The semiconductor material should have the same Fermi level, from that we can get the difference of valence band energy level:

EF1

EF 2

Ÿ EV 1  ln

N a1 NV

N a2 NV

EV 2  ln

Ÿ EV 1  EV 2

K 0T ln

Ÿ EV 0  EVn

V x

N a1 N a2

K 0T N0 ln q N 0 exp  Ax

K 0TAx q

The build-in constant electric field:

E x

 dV x dx

 K 0TA q

Where q is the unit charge of the electronic .The band structure of exponentialdoping is shown in Fig.1.

The Efficiency Calculation Photosynthesis with Exponential-Doping | 69

Fig. 1: Energy band structure of exponential-doping.

In this paper, we assume that the coordinate of the surface with doping concentration N0 is x=0 and we call it surface1. The surface with the lowest doping concentration is called surface2, the coordinate is x=Te. From the express of build-in electric field we can understand that, the higher of the A we assume, the more carriers will get to surface2 under the electric field force. But we know that the current will not be increased infinitely and form Fig.3 we can find that ,the trend of the doping concentration curves become gently, especially in the area of x>4μm, even the difference of the concentration in this area can get to 10^(-22), which is impossible to be achieved in actual operation. In fact, the material is divided into multiple sections, each section has their doping concentration [28, 29], the trend of the concentration along the trend of exponential function approximately (Fig.2). According to Fig.3, coefficient A is more appropriate to be selected between 0.5 to 1, because their difference of doping concentration curves are not smaller than 1% magnitude, which can be achieved in actual operation[30]. So we select the number 1 as the coefficient A.

Fig. 2: Variation of doping concentration in actual operation, the lighter of the color corresponding to the lower doping concentration.

70 | Lei Chen and Rui Shi 1

A=0.5 A=1 A=2 A=3 A=4 A=5 A=6

0.9 0.8

D oping concentration

0.7 0.6 0.5 0.4 0.3 0.2 0.1 0

0

0.5

1

1.5

2

2.5

x(ȝm)

3

3.5

4

4.5

5

Fig. 3: Different doping concentration curves depend on different coefficient A

We can get the concentration distribution of non-equilibrium carriers by solve continuity equation: The continuity equation for the condition of sunlight irradiates the surface1:

d 2 n x dn x n x Dn  P E x  2  x W dx  DI 0 1  R exp  Dx 0, x  >0, Te @ The continuity equation for the condition of sunlight irradiates the surface2:

d 2 n x dn x n x  P E x  2 x W dx  DI 0 exp  D Te  x 0, x  >0, Te @ Dn

The boundary condition:

Dn

dn x dn x  P E x dx dx x

n Te 0 Current density (J) [31]:

0

s v n x ,

The Efficiency Calculation Photosynthesis with Exponential-Doping | 71

J

Dn

dn x dx x

Te

where Dn is the diffusion coefficient, μ is the electronic mobility, τ is the lifetime of the electron, α is the absorption coefficient, I0 is the intensity of incident light, Sv is the back-interface recombination velocity, Te is the layer thickness, R is reflection coefficient. Due to the roughness of Co3O4 end product are different [13] [14] [32], the reflection coefficient are different, too. So we assume R=0.

3 Results and Analysis The semiconductor layer with different thickness will show different conversion efficiency. If the thickness is too thin, some of the photons will trans illuminate the layer which means that the solar light cannot be utilized sufficiently. If the layer is too thick, the non-equilibrium carriers must cross longer distance to get to the surface, the longer distance will improve the probability of recombination. So we should find an optimal thickness.

3.1 Sunlight Irradiate Surface 1 Fig.4 shows the conversion efficiency of Co3O4 for artificial photosynthesis, the xcoordinate show the different energy of sunlight; y-coordinates are conversion efficiencies. The thickness is 1.0μm, 1.3μm, 1.4μm, 1.5μm, 1.6μm, 2.0μm respectively and the thickness of the undoped film is 1.4μm. From Fig.4 we can find that the layer with 1.4μm, 1.5μm thick have the highest conversion efficiency, but from the inserts in Fig.4, we can find that the thin film with 1.5μm thicknesses shows higher efficiency in low energy area but in high energy area, lower than 1.4μm layer’s, so we compare the area enclosed by the curve and find that S1.4>S1.5, which means that thin film with 1.4μm thick has the highest utilization for sunlight. So, if the sunlight irradiates surface1, the optimum thickness of the layer is nearby 1.4μm.

72 | Lei Chen and Rui Shi 18

16 17.53 17.52

E fficie ncy(% )

14

17.51 17.5 17.49 4.514 4.516 4.518

12

4.52 4.522 4.524

9 8.95 10

8.9

nondoping A=1,Te=1.0ȝm A=1,Te=1.3ȝm A=1,Te=1.4ȝm A=1,Te=1.5ȝm A=1,Te=1.6ȝm A=1,Te=2.0ȝm

8.85 8.8 8.75

8

8.7

6

2

2.5

2.14

2.15

2.16

2.17

3

2.18

2.19

2.2

2.21

3.5

E(ev)

4

4.5

5

Fig. 4: The curves of conversion efficiency about different thickness when A=1 and the solar light irradiate surface

3.2 Sunlight Irradiate Surface 2 Which surface is being irradiated by the sunlight, most of the non-equilibrium carriers will be formed near the irradiated surface? If the sunlight irradiates surface 1, most of the non-equilibrium carriers are near surface 1, and then they will be moved to surface 2 by the electric field force (Fig.5). If the sunlight irradiate surface 2, the non-equilibrium carriers will need not be moved to cross the whole thick of the material to get to surface 2(Fig.6), then the probability of recombination can be decreased obviously, so, maybe the later condition will improve conversion efficiency. Is it true?

 Fig. 5: The schematic diagram for the band structure and carriers movement when the solar light irradiates surface 1.

The Efficiency Calculation Photosynthesis with Exponential-Doping | 73

Fig. 6: The schematic diagram for the band structure and carriers movement when the solar light irradiates surface 2

The answer is yes. We assume that the sunlight irradiates surface1 and surface 2 under same film thickness. From Fig.7, we can find that the curve of conversion efficiency with surface 2 being irradiated is higher. 22

20

18

Efficiency(% )

16

14

12

10

A=1,Te=1.4ȝm,Surface2 A=1,Te=1.4ȝm,Surface1

8

6

2

2.5

3

3.5

E(ev)

4

4.5

5

Fig. 7: The curves of conversion efficiency about the sunlight irradiate surface 1 and surface 2 respectively, both of them has 1.4μm thick.

Then we will explore the optimum thickness for the condition of surface2 being irradiated. According to Fig.8 , with the increasing of thickness ,the differences between curves becoming smaller, even the curves for 4.4μm ,4.5μm and 4.6μm are overlap-

74 | Lei Chen and Rui Shi ping, it means that the more distantly from surface 2,the donation about no equilibrium carriers is smaller. So, when the sunlight irradiates surface 2, the optimum thickness is near 4.4μm. 24

22

20

E fficiency(% )

18

16

14

12

Undoped A=1,Te=1.4ȝm A=1,Te=2.0ȝm A=1,Te=3.0ȝm A=1,Te=4.0ȝm A=1,Te=4.4ȝm A=1,Te=4.6ȝm A=1,Te=4.5ȝm

10

8

6

2

2.5

3

3.5

E(ev)

4

4.5

5

Fig. 8: The curves of conversion efficiency about different thickness when A=1 and the solar light irradiate surface 2.

4 Conclusion Artificial photosynthesis is one of the via to obtain the renewable and clean energy, which combines the solar energy and hydrogen energy together. The semiconductor material Co3O4 has several advantages such as high stability; the requirement of PH for the reaction solution is 7. Exponential doping will create a build-in constant electric field; build-in constant electric field will help no equilibrium carriers get to the surface of material to improve conversion efficiency. In this paper, we select the 1 as the coefficient A for exponential doping and we assume that the reflectivity is 0 (ideal condition). After the comparation, it is easy to find that if the sunlight irradiates surface2 we can get higher conversion efficiency, in this condition, we find the optimum thickness of the Co3O4 layer is around 4.4μm.

References [1] [2]

G.Qiao, “Re-known of Nuclear Power Generation Safety and Environmental Risks,”Future and Development Transl.G.Qiao.China, pp. 25-29, October 2011. M.Xie, “Nuclear energy is a clean and safety energy source,” Taiyuan Science and Technology Transl. X.Manting.China, pp.15-16, 2009.

The Efficiency Calculation Photosynthesis with Exponential-Doping | 75 [3]

[4] [5] [6] [7]

[8] [9]

[10]

[11]

[12] [13]

[14] [15]

[16] [17]

[18] [19]

[20] [21]

S.Eriksson, H. Bernhoff,and M.Leijon,“Evaluation of different turbine concepts for wind power,”Renewable and Sustainable Energy Reviews. Uppsala, vol.12, pp.1419–1434, May2006. J.Barber, P.D.Tran,“From natural to artificial photosynthesis,”Interface.London,pp.116,January 2013. X.Chen, W.Shangguan,“Hydrogen production from water splitting on CdS-based photocatalysts using solar light,” Front Energy.Berlin Heidelberg,pp.111-118,July 2013. Fujishima, K. Honda, “Electrochemical photolysis of water at a semiconductor electrode,” Nature.Tokyo, vol.238, pp.37-38, July 1972. N.Z.Bao, L.M.Shen,T.Takata,K.Domen,A.Gupta,K.Yanagisawa,et al.“Facile Cd-Thiourea Complex Thermolysis Synthesis of Phase-Controlled CdS Nanocrystals for Photocatalytic Hydrogen Production under Visible Light,”Phys.Chem.Tokyo, pp.17527-17534, September 2007. H.Frei, F.Jiao,“Nanostructured cobalt and manganese oxide clusters as efficient water oxidation catalysts,” Energy & Environmental Science. California, pp.1018-1027, March 2010. S.Y.Reece, J.A.Hamel,K.Sung,T.D.Jarvi,A.J.Esswein,J.J.H.Pijpers,et al.“Wireless Solar Water Splitting Using Silicon-Based Semiconductors and Earth-Abundant Catalysts,”Science. Massachusetts, Vol.334,pp.645-648,December 2011. M.Zhong, J.Y.Shi,F.Q.Xiong,W.H.Zhang,C.Li,“Enhancement of photoelectrochemical activity of nanocrystalline CdS photoanode by surface modification with TiO2 for hydrogen production and electricity generation,”Solar Energy.Dalian,vol.86,pp.756-763,February 2012. M.A.Chougule,S.G.Pawar,P.R.Godse,R.D.Sakhare,S.Shashwati,V.B.Patil,“Sol–gel derived Co3O4 thin films: effect of annealing on structural,morphological and optoelectronic properties,”Materials Science: Materials in Electronics.Solapur,vol.23,pp.772-778,March 2012. Masanori, K.Tetsuhiko, H.Masatake, “Humidity-sensitive optical absorption of Co304 film,” Sensors and Actuators B: Chemical.Osaka, vol.32, pp.157-160, March 1996. P.N.Shelke,Y.B.Khollam,R.R.Hawaldar,S.D.Gunjal,R.R.Udawant,M.T. Sarode,et al. “Synthesis, characterization and optical properties of selective Co3O4 films 1-D interlinked nanowires prepared by spray pyrolysis technique,” Fuel.Pune,vol.112,pp.542-549,October 2012. M.Salavati-Niasari, A.Khansari,“Synthesis and characterization of Co3O4 nanoparticles by a simple method,”Comptes Rendus Chimie.Kashan,vol.17,pp.352-358,April 2014. E.L. Miller, R.E. Rocheleau, X.M. Deng,“Design considerations for a hybrid amorphous silicon /photoelectrochemical multijunction cell for hydrogen production,”International Journal of Hydrogen Energy.Honolulu,vol.28,pp.615-623,June 2003. Q.W.Deng, X.L.Wang,H.L.Xiao,C.M.Wang,H.B.Yin,H.Chen,et.al.“An investigation on InxGa1−xN/GaN multiple quantum well solar cells,”Science.Beijing, June 2011. R.R.King, D.C.Law,K.M.Edmondson,C.M.Fetzer,G.S.Kinsey,H.yoon,et.al. “40% efficient metamorphic GaInP/GaInAs/Ge multijunction solar cells,”Appled Physics Letters.California, vol.90, pp.183516, May 2007. Y.Chiba, A.Islam,Y.Watanabe,R.Komiya,N.Koide and L.Han,“Dye-Sensitized Solar Cells with Conversion Efficiency of 11.1%,”Applied Physics.Japanese,vol.45,pp.24-28,June 2006. S.Ito, S.M.Zakeeruddin,R.HumphryBaker,P.Liska,R.Charvet,P.Comte,et al.“High-Efficiency Organic-Dye- Sensitized Solar Cells Controlled by Nanocrystalline-TiO2 Electrode Thickness,”Advanced Materials.Lausanne, vol.18, pp1202-1205, May 2006. T.Horiuchi, H.Mura, K.Sumioka and S.Uchida,“High Efficiency of Dye-Sensitized Solar Cells Based on Metal-Free Indoline Dyes,”Am. Chem. Soc.Japan, pp.12218–12219,September 2004. Y.Q.Wang, Y.Z.Hao,.H.M.Chen,J.M.Ma,B.Xu,W.H.Li,et al.“The photoelectrochemistry of transition metal-ion-doped TiO2 nanocrystalline electrodes and higher solar cell conversion efficiency based on Zn2+-doped TiO2 electrode,”Materials Science.Beijing,pp.2773-2779,1999.

76 | Lei Chen and Rui Shi [22]

[23]

[24]

[25]

[26]

[27]

[28]

[29]

[30]

[31]

[32]

H.Cheng, J.H.Yao,Y.Cao,“Photoelectric Conversion Efficiency of N719/TiO2-Inx%/FTO Film Electrodes Incorporating In Doped at the TiO2 Surface,”, Acta Phys. – Chim,Transl.C.Hui.Tianjin,pp.2632-2640,July 2012. P.Wang,S.M.Zakeeruddin,I.Exnar,M.Gätzel,“High efficiency dye-sensitized nanocrystalline solar cells based on ionic liquidpolymer gel electrolyte,”Chemical Communications.pp.29722973,November 2002. U.Bach, D.Lupo,P.Comte,J.E.Moser,F.Weissörtel,J.Salbeck,et al. “Solid-state dye-sensitized mesoporous TiO2 solar cells with high photon-to-electron conversion efficiencies,”Letters to Nature.Lausanne.pp.583-585,October 1998. C. Liu, X .B. Li, J.Z .Su ,L.J. Guo,“ Enhanced charge separation in copper incorporated BiVO4 with gradient doping concentration profile for photoelectrochemical water splitting,” Hydrogen energy.Xi’an,vol.41,pp.12842-12851,August 2016. H.J.Du, W.C.Wang,B.Ma,T.Long,J.Z.Zhu ,“Band structure adjustment of solar cells by gradient doping,”Materials Science in Semiconductor Processing.Qinhuangdao.vol.40,pp.570577,December 2015. J.J. Zou, B. K. Chang, Z. Yang, “Theoretical calculation of quantum yield for exponentialdoping GaAs photocathodes,”ACTA PHYSICA SINICA.Trans.Nanjing.vol.56,pp.2292-2297,May 2007. L.Chen, Y.S.Qian,Y.J.Zhang,B.K. Chang,“Comparative research for transmission-mode GaAs photocathodes of different doping structures on surface photovoltage,”Optics Communications.Nanjing.vol.284,pp.4520-4524,September 2011. J. Zhao, B .K. Chang, Y.J. Xiong, J .J.Zhang, Y.J. Zhang,“Influence of the antireflection, window, and active layers on optical properties of exponential-doping transmission-mode GaAs photocathode modules,”Optics Communications.Nanjing.vol.285,pp.589-593,March 2012. Z.Yang, J.J. Zou, B.K.Chang, “Research on the optimal thickness of transmission-mode exponential-doping GaAs photocathode,”J. ACTA PHYSICA SINICA.Nanjing.vol.59, pp.4290-4295, June 2010. Z.P. Cai, W.Z. Yang, W .D. Tang, X .Hou, “Numerical analysis of temporal response of a large exponential-doping transmission-mode GaAs photocathode,” Materials Science in Semiconductor Processing.Xi’an.vol.16, pp.238-244, April 2014. D.E. Zhang, L.Z. Ren, X.Y.Hao, B.B.Pan,M.Y.Wang,J.J.Ma,et al. “Synthesis and photocatalytic property of multilayered Co3O4,” Applied Surface Science.Lianyungang.vol.355,pp.547552,November 2015.

Na Guo1 and Hong-Wen Yu2*

Microscale Hierarchical Three-Dimensional Flowerlike CuO: Synthesis, Characterization, and its Supernormal Photocatalytic Activity under Visible Light Irradiation Abstract: Hierarchical three-dimensional (3D) flowerlike CuO (F-CuO) photocatalyst with high specific surface area (83.53 m2/g) was prepared successfully. The F-CuO exhibits excellent photocatalytic activity on the degradation of CR under visible light irradiation, the degradation efficiency come up to 99.75% in 30 min, which is higher than that of P25 and B-CuO in the same experimental condition. The CR can be also removed by the adsorption of F-CuO even in the dark environmental conditions. Keywords: flowerlike; CuO; Congo; red; visible light; sureface area.

1 Introduction Effluent contains toxic azo dyes, which are caused by the improper handling, is urgently call for more quickly and effectively method to deal with these harmful pollutant. The past few decades have witnessed a surge of interest in the development of technique to settle this intractable issue, including chemical precipitation, advanced oxidation process, electrochemical technique, and ion-exchange, etc. [1], however, there are still some limitations for the widespread applications of these methods because of the technical difficulties or high cost. Up to now, photocatalysis, which uses semiconductor photocatalyst to oxidize organic/inorganic pollutants, has been regarded as one of the green sustainable avenues and effective ways to address the environmental crisis. [2] A myriad of studies have been emphasis on TiO2 because of its high efficiency, stability, non-toxicity and low cost [3]. Nevertheless, the degradation efficiency of TiO2 is badly impeded by its large band gap (3.2 eV for anatase) and small specific surface area. [4, 5] Thus, there is an urgent need for excellent photocatalysts based on narrower band gap and higher photocatalytic

|| 1 Key Laboratory of Wetland Ecology and Environment, Northeast Institute of Geography and Agroecology, Chinese Academy of Sciences, Changchun, China, University of the Chinese Academy of Sciences, Beijing, China, E-mail: [email protected] 2 Key Laboratory of Wetland Ecology and Environment, Northeast Institute of Geography and Agroecology, Chinese Academy of Sciences, Changchun, China, E-mail: [email protected] 10.1515/9783110516623-008 DOI 10.1515/9783110303568-008

78 |Na Guo and Hong-Wen Yu activity semiconductors to replace aforementioned counterpart. Recently, transition-metal oxides (MxOy, M = Fe, Co, Ni, Mn, Cu, etc.) receive extensive attention due to their inexpensiveness, good safety, and high performance, and they are widely applied in lithium-ion batteries anodes [6], photocatalysis [7], gas sensors [8], energy storage device [9], etc. Among these transition-metal oxides, CuO has become a promising candidate for visible light driven photocatalyst applications, due to its narrow band gap (1.2 eV) [8], unique electrochemical characteristics [10], and excellent adsorption properties [11]. By referring to large numbers of the previous reports, there are almost no report on the rational design and construction of threedimentional flowerlike CuO photocatalysts yet. In this contribution, we design a visible light driven photocatalyst with a unique hierarchical 3D flowerlike structure CuO (F-CuO) photocatalyst for the first time, which possesses high BET surface area. And the high surface area indeed exerts a significant influence on the degradation process. What’s more, the CR can be removed by the as-prepared F-CuO in the dark conditions.

2 Experimental Procedures 2.1 Preparation of F-CuO 3D F-CuO was prepared by facile water bath. In a typical method, 5 mmol Cu (CH3COO) 2 H2O were dissolved in 40 mL of deionized water under stirring and then for another 10 min. Then, the pH value of obtained transparent blue solution were adjusted to 11.4 by dropping NaOH (2 mol/L) aqueous solution, after that, the flocculent blue solution were keep in 60 oC for 6 h. Finally, the black precipitation were collected by centrifugation and washed for several times with deionized water and ethanol, and then dried at 50 oC for 12 h. The sample was termed as F-CuO. Bulk CuO photocatalyst were also prepared by simply pouring the same volume NaOH solution into the Cu (CH3COO) 2 H2O solutions under stirring, other conditions are the same as the above experimental condition. The sample was termed as BCuO.

2.2 Photocatalytic Performance Tests Congo red (CR) (30 mg/L) was chosen as representative target organic contaminants to evaluation the photocatalytic activity of the CuO photocatalyst under visible-light (λ>420 nm). A 500 W Xe lamp (Zolix, LSH-X500) equipped with a 420 nm (visible light) cut-off filters served as light resource. In a typical procedure, a certain amount of as-prepared photocatalyst dispersed into abovementioned organic dyes aqueous solution. Keep the concentration of photocatalyst to be 1 mg/mL. To obtain a better

Microscale Hierarchical Activity under Visible Light Irradiation | 79

dispersion and establish an adsorption–desorption equilibrium, the suspensions were shaken for 30 min continuously in the dark prior to irradiation. During the photo-degradation reaction process, the samples were taken out termly at a select times interval and remove the photocatalyst by centrifugation. The concentration of the organic dye before and after degradation was measured via a PE-Lambda 25 UVvisible light UV-vis spectrometer. The adsorption capability (qe) and degradation efficiency (D) was calculated using the following equations [12, 13]:

qe

D

(C0  Ce )V W

C0  Ce u 100% C0

(1)

(2)

Where C0 is the initial concentration of target solution (mg/L), Ce is the equilibrium concentration after degradation/adsorption (mg/L), V is the volume of target solution (mL), and W is the weight of the synthesized catalyst (mg).

3 Results and Discussion The TEM pictures of the synthesized F-CuO and B-CuO were shown in figure 1. Figure 1 a shows the low-magnification SEM images of F-CuO, it can be seen that the size of the F-CuO microflower is approximately 2-3µm, figure 1 b clearly show us the monodispersed microflower CuO, and the microflower were assembled by the CuO nanoflakes.

80 |Na Guo and Hong-Wen Yu

Fig. 1: (a) TEM images of F-CuO under low-magnification, (b, c) high-magnification, (d) TEM images of B-CuO

Fig. 2: XRD pattern of F-CuO.

The hierarchical structure can be seen more clearly from figure1 c, and there exist ample pores on the CuO nanoflakes, it can be testify further by the N2 adsorptiondesorption isotherm analysis. The TEM image of B-CuO was given in figure 1 d, apparently, the CuO naoflakes stack with each other closely. Therefore B-CuO shows

Microscale Hierarchical Activity under Visible Light Irradiation | 81

serious aggregation. Compared to the B-CuO, the 3D F-CuO inevitably takes upper hands in photo-degradation process. The X-ray diffraction (XRD) pattern of the as-prepared F-CuO is shown in figure 2. It can be seen that, all the peaks matches well with the JCPDS powder diffraction pattern: 65-2309. The two sharp peaks at 2θ = 35.66° and 38.85° corresponding to the (-111) and (111) planes, respectively [14]. The sharper peaks imply the formation of high CuO crystallization, which would be very useful for the F-CuO photocatalysts to exhibit high photocatalytic activities. The XRD analysis and TEM images manifests that the hierarchical 3D F-CuO has been prepared successfully.

Fig. 3: (a) N2 adsorption-desorption isotherm of F-CuO, (b) pore size distribution of F-CuO.

The N2 adsorption-desorption isotherm and corresponding pore size distribution of F-CuO were shown in figure 3. The N2 adsorption-desorption isotherms obtained for the samples is of type IV according to IUPAC, which is the characteristic of the mesoporous materials [15]. That means, F-CuO belong to mesoporous materials, and there exists mesopores on the CuO nanoflakes, this result is in accordance with the TEM observation. The BET surface area of F-CuO is 83.53 m2/g, which is about 4-time higher than that of B-CuO (20.15 m2/g). The higher specific surface area may resulting from the highly order self-assembling CuO nanoflakes, these CuO nanoflakes intermesh together to form a high hierarchical surface, which will be adsorb more organic dye molecules during the photoreaction. Curve c depicts that the corresponding pore size distribution of the CuO sample is unimodal with the peak pore diameters at 11.3 nm. High BET surface area and mesoporous characters endowed FCuO a higher adsorption capability, which exert a vital influence on photo-

82 |Na Guo and Hong-Wen Yu degradation activity by increasing the local concentration of organic molecules in the vicinity of the photocatalyst. Prominent differences in degradation of CR were observed with different experimental conditions (figure 4). It can be seen from figure 4 a, the self-degradation of CR and RhB is ignorable under visible light irradiation. And it is clearly demonstrate that, the F-CuO displays the highest photocatalytic efficiency towards CR, which comes up to 99.75% in 30 min irradiation.

Fig. 4: (a) photo-degradation efficiency towards CR in the presence of different photocatalyst, (b) the corresponding removal efficiency of the above systems.

Microscale Hierarchical Activity under Visible Light Irradiation | 83

Fig. 5: Absorption changes spectra of CR aqueous solution in the presence of F-CuO under different Visible-light irradiation times.

However, P25 almost show no photocatalytic activity under visible light irradiation, the small portion of CR were removed by its adsorption (D=36.80%). B-CuO displays relatively low degradation efficiency compared to that of F-CuO, the degradation efficiency of B-CuO is 41.54%. It is worth noting that, the F-CuO possesses high adsorption capability, even in the dark conditions, the F-CuO can remove the contaminant by adsorption. The removal efficiency of F-CuO via adsorption is up to 46.76%, and the qe is 186.1 mg/g. As for the B-CuO, the qe is 84.15 mg/g. By comparing the degradation efficiency difference between the F-CuO and B-CuO, the higher degradation efficiency is surely contribute to the unique 3D flowerlike structure. The corresponding removal efficiency of each system was shown in figure 4b. The removal efficiency of the samples varies in the following order: F-CuO > dark > BCuO > P25 > no catalyst. Figure 5 shows changes in the degradation spectra of the CR aqueous solution exposed to visible light at different times in the presence of F-CuO photocatalyst. The characteristic peak is 497 nm, which is used to determine the concentration of CR. The lower absorbance intension means higher catalysis efficiency.]

84 |Na Guo and Hong-Wen Yu

Fig. 6: Cycling runs performance of F-CuO on degradation towards CR.

A rapid decrease in absorbance intension was observed in figure 5. And after 30 min under visible-light irradiation, there almost no absorption, this indicates that there almost no CR existing in the system. F-CuO exhibited excellent photocatalytic activity in the degradation of CR. Durability is a critical issue for photocatalyst in practical applications. In the cycling test, the F-CuO maintains high activity after three times photoreaction cycles. As shown in figure 6, the photo-degradation efficiency of F-CuO towards CR still exceeds 99% in 30 min after three times cycles. The remarkable degradation efficiency of F-CuO may attribute to the following factors: (1) The unique 3D flowerlike CuO structure endows it a higher specific surface are, (2) higher surface area can result in large numbers oxygen vacancies [16], also increases the active sites, which will consequently enhance the photocatalytic activity. The aforementioned experimental results exactly demonstrated the priority of 3D flowerlike CuO.

4 Summary Hierarchical 3D flowerlike CuO photocatalyst were successfully synthesized, the FCuO exhibits high specific surface area (83.53 m2/g), and also show excellent degradation efficiency towards CR, the outstanding degradation efficiency of F-CuO may attribute to its unique 3D structure and higher surface are.

Microscale Hierarchical Activity under Visible Light Irradiation | 85

Acknowledgement: This work was supported by the National Natural Science Foundation of China (no. 21277142 and no. 21403230), “Cross-disciplinary Collaborative Teams Program for Science, Technology and Innovation” of Chinese Academy of Sciences, the “Hundred Talents Project” of the Chinese Academy of Science, CAS Interdisciplinary Innovation Team, the Excellent Young Scientists Foundation of the Northeast Institute of Geography and Agroecology (DLSYQ14001) and the Project of Science and Technology Development Plan of Jilin Province (no. 20140520092JH).

References [1]

[2]

[3]

[4]

[5] [6]

[7] [8] [9]

[10] [11]

[12]

[13]

[14]

W. Bao, H. Zou, S. Gan, X. Xu, G. Ji, K. Zheng, “Adsorption of heavy metal ions from aqueous solutions by zeolite based on oil shale ash: kinetic and equilibrium studies,” Chem. Res. Chin. Univ., 29 (2013) 126-131. H. S. Kibombo, R. Peng, S. Rasalingam, R. T. Koodali, “Versatility of heterogeneous photocatalysis: synthetic methodologies epitomizing the role of silica support in TiO2 based mixed oxides,” Catal. Sci. Technol., 2 (2012) 1737-1766. G. Z. Liao, S. Chen, X. Quan, Y. B. Zhang, H. M. Zhao, “Remarkable improvement of visible light photocatalysis with pANI modified core−shell mesoporous TiO2 microspheres,” Appl. Catal. B, 102 (2011) 126-131. J. Yu, S. Wang, J. Low, W. Xiao, “Enhanced photocatalytic performance of direct Z-scheme gC3N4-TiO2 photocatalysts for the decomposition of formaldehydein air,” Phys. Chem. Chem. Phys., 15 (2013) 16883-16890. X. B. Chen, C. Burda, “N- and S-doped TiO2 nanomaterials,” J. Am. Chem. Soc., 130 (2008) 5018-5019. Li, H. Song, X. Chen, J. Zhou, Z. Ma, “Lithiation confined in one dimensional nanospace of TiO2 (Anatase) nanotube to enhance the lithium storage property of CuO nanowires,” ACS Appl. Mater. Interfaces, 7 (2015) 22372-22379. R. Liu, J. Yin, W. Du, F. Gao, Y. Fan, Q. Lu, “Monodisperse CuO hard and hollow nanospheres as visible-light photocatalysts,” Eur. J. Inorg. Chem., 2013, 1358-1362. Y. Zhang, J. Yin, L. Li, L. Zhang, L. Bie, “Enhanced ethanol gas-sensing properties of flowerlike p-CuO/n-ZnO heterojunction nanorods,” Sensors and Actuators B, 202 (2014) 500-507. H. Chen, S. Zhou, M. Chen, L. Wu, “Reduced graphene Oxide–MnO2 hollow sphere hybrid nanostructures as high-performance electrochemical capacitors,” J. Mater. Chem., 22 (2012) 25207-25216. Z. Wang, F. Su, S. Madhavi, X. W. Lou, “CuO nanostructures supported on cusubstrate as integrated electrodes for highly reversible lithium storage,” Nanoscale, 3 (2011) 1618-1623. X. Yu, R. Xu, C. Gao, T. Luo, Y. Jia, J. Liu, X. Huang, “Novel 3D hierarchical cotton-candy-like CuO: Surfactant-free solvothermal synthesis and application in As(III) Removal,” ACS Appl. Mater. Interfaces, 4 (2012)1954-1962. T.K. Sen, M.V. Sarzali, “Removal of cadmium metal ion (Cd2+) from its aqueous solution by aluminium oxide (Al2O3): a kinetic and equilibrium study,” Chemical Engineering Journal, 142 (2008) 256-262. Q. Geng, W, Cui, “Adsorption and photocatalytic degradation of reactive brilliant red K-2BP by TiO2/AC in bubbling fluidized bed photocatalytic reactor,” Ind. Eng. Chem. Res., 49 (2010) 11321-11330. Z. Yin, Y. Ding, Q. Zheng, L. Guan, “CuO/polypyrrole core–shell nanocomposites as anode materials for lithium-ion batteries,” Electrochemistry Communications, 20 (2012) 40-43.

86 |Na Guo and Hong-Wen Yu [15]

[16]

G. Liao, S. Chen, X. Quan, Y. Zhang, H. Zhao, “Remarkable improvement of visible light photocatalysis with PANI modified core–shell mesoporous TiO2 microspheres,” Appl. Catal. B: Environ. 102 (2011) 126-131. P. Cheng, M. Zheng, Y. Jin, Q. Huang, M. Gu, Preparation and characterization of silica-doped titania photocatalyst through sol–gel method,” Materials Letters, 57 (2003) 2989-2994.

Jin-Fang Ma1, Jian-Liang Zhang2, Zhen-Yang Wang3 and Lei Zhang4

The Distribution Behavior of Phosphorus at Non-Equilibrium Condition Simulating the Casting Ladle

Abstract: In order to investigate the phosphorus distribution behavior between slag and hot metal in the casting ladle, this study used AR reagent to make up dephosphorization slag and to change the initial condition of basicity and FeO. Due to the increase of viscosity, dephosphorization slag with high basicity inhibits the full contact of slag and iron, which lead to the low reaction rate in early stage. However, since the high basicity increase CaO activity coefficient, dephosphorization rate and P capacity in late reaction stage goes up. FeO promotes the increase of reaction rate in early dephosphorization stage. But the polarization force of Fe 2+ is stronger than Ca2+, which hinders the reaction between phosphate ion and CaO and reduces the stability of PO43-. Thus, high content of FeO will adversely impact on dephosphorization reaction. In addition, MgO has a promoting effect to the dephosphorization, whereas Al2O3 has a negative influence. Keywords: nonequilibrium; dephosphorization; phosphorus capacity

1 Introduction Phosphorus can affect the steel plasticity, toughness and weldability. The phosphorus atoms are easily enriched on the ferrite grain boundaries and formed phosphides. It can lead to not only solution strength but also toughness drop. Especially in room temperature (for example 20 °C to minus 20 °C) the toughness value reduces a lot. It may promote cold brittleness phenomenon generation and invalidation in the steel loading process. Therefore, the quality control standard is [P] ≤ 0.035 wt% for general steels and [P] ≤ 0.025 wt% for premium steel. As the requirements for special steel are improving gradually, the hot metal with low hazardous elements

|| 1 University of Science and Technology Beijing, School of Metallurgical and Ecological Engineering, Beijing, China, Email: [email protected] 2 University of Science and Technology Beijing, School of Metallurgical and Ecological Engineering, Beijing, China, Corresponding Email: [email protected] 3 University of Science and Technology Beijing, School of Metallurgical and Ecological Engineering, Beijing, China, Email: [email protected] 4 University of Science and Technology Beijing, School of Metallurgical and Ecological Engineering, Beijing, China, Email: [email protected] 10.1515/9783110516623-009 DOI 10.1515/9783110303568-009

88 | Jin-Fang Ma, Jian-Liang Zhang, Zhen-Yang Wang and Lei Zhang contents receives more and more attention [1-4]. However, exhausted resources of high quality iron ore and coal make the clean steel production more difficult. Fortunately, hot metal pretreatment process can eliminate the harmful element and purify the hot metal effectively [5-7]. At present, the studies about dephosphorization pretreatment are mostly focused on the influence factors such as temperature; slag system etc. at balanced reaction conditions [8-11]. But further studies regarding the non-equilibrium conditions process have not been carried out. Using a high temperature electromagnetic induction furnace to melt iron and a box-type resistance furnace to maintain the temperature, the non-equilibrium dephosphorization was investigated using the reflux contact reaction between slag and hot metal. The initial slag composition, such as the basicity, FeO, MgO and Al2O3 contents were changed in the experiment schemes in order to explore their influence on the dephosphorization behavior and the phosphorus capacity [12, 13].

2 Experimental 2.1 Experimental Material The iron used in the experiment was from an iron making plant in north China. Table I shows the composition of this pig iron. The analytical reagents were used to prepare the dephosphorization slag system. The oxide weight used for preparation slags is given in Table II. Table 1: The components of iron in the experiments / wt% C

Si

Mn

P

S

Fe

4.100

0.340

0.260

0.098

0.011

95.191

The Distribution Condition Simulating the Casting Ladle | 89 Table 2: The dephosphorization slag proporrtion plan in the experiments Number

CaO/wt%

SiO2/wt%

FeO/wt%

CaO/SiO2

a-1

43.6

36.4

20

1.2

a-2

53.3

26.7

20

2

a-3

60

20

20

3

a-4

64

16

20

4

b-3

52.5

17.5

30

3

c-3

45

15

40

3

d-3

37.5

12.5

50

3

b-3(5%Al2O3)

48.75

16.25

30

3

b-3(5%MgO)

48.75

16.25

30

3

The basicity, CaO, Al2O3 and MgO influence the slag dephosphorization property. a, b, c, d in Table II correspond to 20 wt%, 30 wt%, 40 wt% and 50 wt% FeO respectively. 1, 2, 3, and 4 mean the varying the binary basicity of 1.2, 2, 3, 4. The effect of MgO and Al2O3 on phosphorus distribution behaviors have been studied through adding 5wt% Al2O3 and 5wt% MgO to the last part of the experiments.

2.2 Experimental Methods For preparing the pure FeO, the powders of analytical reagent Fe2O3 and Fe were matching at 51 mol% oxygen atom and mixing for 40 min in agate mortar. Then the mixture was put into the iron crucible. The sample was heated at 1050 °C through muffle furnace and kept the temperature for 24 h. The heating process was under argon protective atmosphere. When the scheduled time was reached, the sample was cooled to room temperature in the furnace to get final FeO. The experimental reagents of CaO, SiO2, Al2O3 and MgO were roasted at 1000 °C in argon atmosphere for 2 h. The carbonate and hydroxide existed in the reagents were decomposed during the heating, which refined the raw materials and reduced experimental error through removing of CO2 and H2O. After roasting was finished, the reagents were cooled down to room temperature and put into the sealed bottles for the next experiments. The dephosphorization slags were prepared by mixing uniformly in the agate mortar. 200 g slag for each test was put into a 55 mm - diameter - 70 mm - deep graphite crucible. 60 kW electromagnetic induction furnace was used to melt the pig iron at 1500 °C. Simulating industrial ladle method, the hot metal was poured into the graphite crucible. And then the crucible was immediately taken into the muffle furnace at 1350 °C and kept at the temperature for predetermined time. After that,

90 | Jin-Fang Ma, Jian-Liang Zhang, Zhen-Yang Wang and Lei Zhang the samples were rapidly quenching to ice water. The iron and slag were separated after drying and detected the phosphorus contents.

3 Results and Discussion 3.1 Dephosphorization Rate under Non-Equilibrium Through Equation (1), the relationship between dephosphorization rate and reaction time was given in Fig. 1. The ternary slag phase diagram CaO-SiO2-FeO at 1350 °C was calculated using Factsage 6.4 software provided by Thermfact and GTTTechnologies, which was labeled with the primary slag composition as shown in Fig. 2.

R[P]

[ PBefore reaction ]%-[PAfter reaction ]% [ PBefore reaction ]%

u100% ǂǂ ǂǂǂǂ (1)

Fig. 1 shows that, the dephosphorization rate increases significantly in all instances at the beginning of the reaction and it can reach more than 64% in 10 min. It takes 20 min for the dephosphorization rate to exceed 77%. However, after 30 min, the dephosphorization rate remains stable, which can hold at around 80%.

a-binary basicity;b-FeO;c-Al2O3, MgO addition Fig.1: Dephosphorization rate and P content in hot metal under different initial conditions

The Distribution Condition Simulating the Casting Ladle | 91

Based on Fig. 1-a, with the primary slag basicity increases from R=1.2 to R=4, the dephosphorization rate becomes lower in the early stage of the reaction. That is, the high basicity slag reduces the dephosphorization reaction speed. From Fig.2, high basicity slag has more solid solution phase and less liquid phase, which increases the slag viscosity and inhibits the full contact between slag and hot metal. Thus the high basicity slag does not correspond to a high dephosphorization rate in the initial reaction. However, since the increase of basicity is advantageous for the enhancement of CaO activity, the high basicity slag enhances dephosphorization rate at the end of reaction, according to Equation (2).

Fig. 2: The CaO-SiO2-FeO ternary phase diagram at 1350°C and the initial slag composition

3(CaO) + 5(FeO) + 2[P] = (3CaO·P2O5) + 5[Fe]

(2)

The dephosphorization rate under different FeO contents is shown in Fig. 1-b. With the FeO content in primary slag increasing, the dephosphorization rate becomes higher in the early stage of the reaction. That is, high FeO primary slag corresponds to a quick dephosphorization rate at beginning. The increasing amount of FeO in primary slag promotes the liquid phase expanding, which is advantageous to the completely contact between slag and hot metal, as shown in Fig. 2. Moreover, FeO can increase the oxygen potential in the slag system. Thus, high FeO slags keep the high dephosphorization rate within 30 min. However, as the polarization force of Fe2+ is stronger than Ca2+, the reaction between phosphate ion and CaO is hindered and the stability of PO43- is reduced. Thus, high content of FeO exceeding a certain limit can adversely impact on dephosphorization reaction. That is why the dephosphorization rate of 50 wt% FeO slag is less than that of 40 wt% FeO slag after 30 min.

92 | Jin-Fang Ma, Jian-Liang Zhang, Zhen-Yang Wang and Lei Zhang 3(FeO) + (3CaO·P2O5) = (3FeO·P2O5) + 3(CaO)

(3)

Based on Fig. 1-c, after adding 5 wt% Al2O3 or 5 wt% MgO into primary slag, the dephosphorization rates are both slightly increased? The dropping of slag liquidus temperature shortens the transition time from solid-liquid interface reaction to liquid-liquid interface reaction. Therefore, the dephosphorization reaction rate in the early stage is improved. When the reactions are close to the end, the dephosphorization rate is enhanced of the 5 wt% MgO slag but is declined of the 5 wt% Al2O3.

3.2 Slag Phosphorus Capacity The slag phosphorus capacity is defined by the gaseous phosphorus dissolution in the alkaline oxidation slag, as shown in Equation (4) and Equation (5) [14, 15]:

1 5 3 3P2(g )  O 2˄g˅  ˄O 2-˅˄PO 4 ˅ 2 4 2 ǂǂ

ǂǂǂǂ

ǂ CPO 34

PO 4 3- wt% PP 12 PO 2 54 ˄ T2 ˅˄ ˜ T˅ P P

(4)

(5)

Where PO 43 wt% means the phosphate mass fraction. The reaction interface partial pressure of the phosphorus and oxygen are represented by PP2 and PO2. The PP2 and PO2 can be obtained by Equation (6) to Equation (11):

1 P˄ 2 g˅ [P] 2

(6)

ǂǂǂǂǂǂǂǂǂǂǂǂǂǂǂǂǂǂǂǂǂǂǂǂǂǂǂǂǂǂǂǂǂǂǂǂ a[P] [%P] ˜ f[P] ș (7) ǂ ǂ K[P] PP2 12 PP2 12 ˄ ș˅ ˄ ș˅ P P ș lg K[P]

6381  1.01 T

1 O2˄g˅ [O] 2

(8)

(9)

The Distribution Condition Simulating the Casting Ladle | 93

ș K[O]

ș lg K[O]

a[O] PO 1 ˄ ș2 ˅2 P

6118  0.151 T

(10)

(11)

Where [%P] and f [P] express the mass fraction and activity coefficient of phosphorus in hot metal. K [P]θ and K [O]θ are the chemical reaction equilibrium constants of Equation (6) and (8). Oxygen activity in hot metal is represented by a [O]. Since the phosphorus content in hot metal conforms the Henry’s law conditions, f [P] is approximate to 1 for calculation. The oxygen activity in hot metal is measured by zirconia base oxygen-content probe. Based on Fig. 1, the phosphorus contents in hot metal have been no longer changed around 60 min. For calculating the phosphorus capacity under different conditions, the phosphorus mass fractions in final slags are chemically analyzed and converted into PO43 wt%. Combined with the phosphorus mass fraction in hot metal reflected by Fig. 1, the slag phosphorus capacities of each group are depicted in Fig.3.

Fig. 3: Relationship between dephosphorization slag capacity and basicity, FeO, Al2O3, MgO

From Fig. 3, with the slag basicity increasing, the phosphorus capacities are rising. When the basicity increases from 1.2 to 4.0, the phosphorus capacities enhances from 1019.82 to 1020.68. After FeO content increases from 20wt% to 40wt%, the phosphorus capacity raises 100.55 times. However, as the FeO content increases to 50wt%, there is a turning point presenting the downward trend. At this moment, Fe2+ tends

94 | Jin-Fang Ma, Jian-Liang Zhang, Zhen-Yang Wang and Lei Zhang to the round of PO43 and hinders the phosphorus fixation effect of Ca2+. Finally, the phosphorus capacities show up falling back phenomenon. In addition, the addition of MgO improves the slag phosphorus capacity while that of Al2O3 lowers the slag phosphorus capacity in the same conditions of basicity and FeO content.

4 Conclusions 1) At beginning of the dephosphorization, the reaction rate increases significantly and reaches to 64% at 10 min. It achieves more than 77% before 20 min. And in 30 min, the dephosphorization rates of all slag systems in the experiment are more than 80%. After that, the variations in dephosphorization rate become small. The method of casting ladle reflux reaction is beneficial to improve the dephosphorization dynamics condition. 2) The higher basicity slag has a higher content of solid solution and a lower content of liquid phase, the increasing slag viscosity inhibits the full contact between hot metal and slag and leads to a low dephosphorization rate in the early reaction stage. As the reaction progressing, the dephosphorization rate of high basicity slag increases gradually. The high basicity was advantageous to the increase of CaO activity coefficient. Therefore, high basicity slag enhances the dephosphorization rate and phosphorus capacity when the reaction is nearing completion. 3) FeO has promoted the liquid phase increasing and the fully contacted between slag and hot metal. That is, high FeO primary slag is corresponding to a quick dephosphorization rate at the reaction beginning. But the polarization force of Fe2+ is stronger than Ca2+, which tends to be round of PO43 and hinders the reaction between phosphate ion and CaO and reduces the stability of PO43 . Thus, 50wt% FeO in slag adversely impacts on dephosphorization after reaction proceeding to 30 min. In addition, MgO has a promoting effect to the dephosphorization, whereas Al2O3 has a negative influence.

References [1] [2] [3] [4] [5] [6] [7] [8]

H. Zhou, Y. Bao and L. Lin, Steel Res Int, 84, 9, 863-869, 2013. P.I. Chernousov, O.V. Golubev and A.L. Petelin, Metallurgist+, 55, 3-4, 242-250, 2011. N. Sen, Steel Res Int, 77, 4, 242-249, 2006. P.I. Yugov, A.V. Sarychev and L.A. Baeva, Metallurgist+, 45, 9-10, 379-381, 2001. F. Pahlevani, S. Kitamura, H. Shibata, and N. Maruoka, Isij Int, 50, 6, 822-829, 2010. I.A. Krasnyanskaya, G.S. Podgorodetskii and S.N. Paderin, Metallurgist+, 59, 9-10, 887-894, 2016. L.H. Zhao, Y.J. Zhang, H.M. Zhou, P. Xu, and Y.P. Bao, High Temp Mat Pr-Isr, 34, 7, 627-633, 2015. K. Shimauchi, S. Kitamura and H. Shibata, Isij Int, 49, 4, 505-511, 2009.

The Distribution Condition Simulating the Casting Ladle | 95 [9] [10] [11] [12] [13] [14] [15]

D.Y. Shin, C.H. Wee, M.S. Kim, B.D. You, J.W. Han, S.O. Choi, and D.J. Yun, Met Mater Int, 13, 2, 171-176, 2007. J.D. Zhou, X.G. Bi and F. Yang, Ironmak Steelmak, 41, 4, 298-303, 2014. A.N. Telyakov, A.A. Petukhov, A.A.D. In, and N.M. Telyakov, Metallurgist+, 59, 5-6, 466-469, 2015. F. Akbari and C.A. Pickles, High Temp Mat Pr-Isr, 34, 1, 71-79, 2015. M.K. Cho, J.H. Park and D.J. Min, Isij Int, 50, 2, 324-326, 2010. M. Ek, J.C. Huber, G. Brosse, and D. Sichen, Ironmak Steelmak, 40, 4, 305-311, 2013. M.D. Johnston and M. Barati, J Non-Cryst Solids, 357, 3, 970-975, 2011.

Yu-Feng Ban1, Gui-Zhong Liu2*, Cong-Min Hao3, Xin-Tao Dong4 and Jing-Jie Guo5

Effects of Zr Addition on the Microstructure and Mechanical Properties of AlCoCrFeNiZrx High-Entropy Alloys

Abstract: The microstructure and mechanical proprieties of AlCoCrFeNiZr x highentropy alloy at different Zrcontent was studied through XRD, SEM, DSC and room temperature compression experiment test etc. Results show that: with the increase of Zr content, BCC phase relative increase, Laves phase relative decrease. Thermal analysis show that alloys spinodal decomposition phase transition point at about 1152°C.In a certain range ,with Zr content increasing their yield strength is increased. However, with Zr content increasing their fracture strength is decreased. Alloys are typical quasi cleavage fracture. Keywords: high-entropy alloy; mechanical properties; thermal analysis; Fracture strength

1 Introduction The so-callled high entropy alloys (HEAs)-alloys composed of≥5 principal elements with concentration from 5 at% to 35 at%. HEA tend to form simple solid solution phases with FCC or\and BCC structure rather than large amount of complex intermetallic phase, which is attributed to high entropy effect. HEAs have received significant attention due to their encouraging properties [1].For example; some of the HEAs demonstrate exceptional strength at elevated temperatures which makes them attractive for high temperature applications [2]. In addition, High alloying properties such as high hardness [3], high strength, high temperature resistance [4], wear re-

|| 1 Guangxi Key Laboratory of Information Materials, Guilin University of Electronic Technology, Guilin 541004, China 2 Guangxi Key Laboratory of Information Materials, Guilin University of Electronic Technology, Guilin 541004, China; lgzlgz@ guet.edu.cn 3 Guangxi Key Laboratories of Information Materials, Guilin University of Electronic Technology, Guilin 541004, China 4 Guangxi Key Laboratories of Information Materials, Guilin University of Electronic Technology, Guilin 541004, China 5 School of Materials Corresponding author: Science and Engineering, Harbin Industrial University, Heilongjiang Harbin 150001, China 10.1515/9783110516623-010 DOI 10.1515/9783110303568-010

98 | Yu-Feng Ban, Gui-Zhong Liu, Cong-Min Hao, Xin-Tao Dong and Jing-Jie Guo sistance [5] and high temperature oxidation resistance [6] can be obtained by designing suitable alloy compositions. Now some of the high-performance highentropy alloy used in navigation, machinery and equipment manufacturing and other industries. Now many of reported HEA intended for high-temperature application simultaneously have sufficient ductility at room temperatures [7-16]. In this letter we report a novel AlCoCrFeNiZrx high entropy alloy combining high specific strength and good ductility.

2 Experimental Procedutes The alloy with nominal composition of AlCoCrFeNiZrx was produced by arc melting of the high-purity (≥99.9 at %) elements in an argon atmosphere inside a watercooled copper cavity. The produced ingot with dimensions of≈6×15×60mm3was remelted 5 times. After casting the alloy was homogenized at 1200°C for 24 h in vacuum and cooled down on air. Phase composition and microstructure of the alloy were studied using X-ray diffraction (XRD) and scanning electron microscopy (SEM). The XRD analysis was performed using RIGAKU dif- fractometer and Samples for SEM observations were prepared by mechanical polishing. SEM investigations were performed utilizing Quanta 200 3D microscope equipped with EDS detector used for chemical composition measurements. The thermal analysis of the alloys was carried out using differential scanning calorimetry (DSC) The milled powder sample is placed in the analyzer, and the heating rate is 20°C to heat the samples from room temperature to 1200°C, and then to 40 °C / min rate of cooling down to room temperature, analysis of the sample - the exothermic process Hardness Test The hardness of the alloy was measured using an HV-1000 Micro Hardness Tester. The average of 10 test results for each test specimen was 25 g.

3 Results and Discussion Fig.1 XRD pattern of the AlCoCrFeNiZrx alloys, Fig.2 XRD pattern of the AlCoCrFeNi alloys from the graph, we can see that the AlCoCrFeNi alloy has only one set of diffraction peaks, corresponding to the BCC solid solution structure. From figure 1, we can see the position of the diffraction peak shift to the left, suggesting that Zr elements in a certain extent can be dissolved into the AlCoCrFeNihigh entropy alloy, Although the Zr element has a large negative enthalpy of mixing with the other principal elements in the alloy, the atomic radius is much larger than that of other elements.

Effects of Zr Addition on the Microstructure High-Entropy Alloys | 99

Fig. 1: XRD pattern of the AlCoCrFeNiZrx alloys

Fig. 2: XRD pattern of the AlCoCrFeNi alloys

Zr element in the AlCoCrFeNi alloy, in addition to causing the shift to the left of the peak position, we can also from the AlCoCrFeNiZrx diffraction patterns found that when the Zr element, the 2θ = 30.7 ° near the emergence of new diffraction peaks, Jade6.0 software analysis, which is a small amount of ordered BCC structure.When the molar ratio of Zr was 0.2, the diffraction peak of Laves phase appeared in another group, and the diffraction peak of ZrX2 (X=Co or Ni) was determined by the phase retrieval,

100 | Yu-Feng Ban, Gui-Zhong Liu, Cong-Min Hao, Xin-Tao Dong and Jing-Jie Guo Before Zr0.2, Laves diffraction peak phase relative to the intensity of body centered cubic solid solution phase diffraction peak intensity is slightly lower, which indicates that the alloy phase is still the main body centered cubic solid solution structure, and this is because of high entropy alloy made in the solidification process, structure than orderly intermetallic compounds are easier to form a solid solution. With the further increase of Zr content, the relative weakening of the diffraction peak intensity of BCC phase, Laves phase and diffraction peak intensity increased, which indicates that with the increase of Zr content, the volume fraction of Laves phase increased. Fig 3 is the microstructure of AlCoCrFeNiZrx high entropy alloy. The microstructure of AlCoCrFeNiZrx alloy can be seen as a typical dendritic structure. Laves can be seen in the phase in the body centered cubic structure of the grain boundary (arrow in figure). However, with the increase of the content of Zr, the volume fraction of Laves phase increased significantly, as shown in figure 3-2 (b-e). When the content of Zr increased to 0.3, the main structure of the alloy changed into Laves phase, and the body centered cubic phase became the dendrite structure. Figure (f) - (k) is a high magnification of the microstructure of thealloy; we clearly see that the microstructure of AlCoCrFeNiZrx high entropy alloy is divided into two regions: one region containing Laves phase and the other without Laves phase. In the picture does not contain Laves phase region, its structure is composed of dark and light colored periodic distribution of the eutectic structure. With the increase of Zr content from 0.1 to 0.3, the light phase portion of the thick, especially in connection with Laves and without Laves phase two regions (figure g-h, arrow part).at the same time, with the increase of Zr content, light grey phase structure was significantly increased. AlCoCrFeNiZr0.3 analysis of the high entropy alloy EDS, respectively, in the Laves phase region of white and black phase on each beat 5 points, while the Laves phase of the dark and light colored phase on each of the 5 points.

Effects of Zr Addition on the Microstructure High-Entropy Alloys | 101

Fig. 3: Microstructure images of AlCoCrFeNiZrx alloys:(a)(f)AlCoCrFeNiZr0.1;(b)(g)AlCoCrFeNiZr0.2;(c)(h)AlCoCrFeNiZr0.3;(d)AlCoCrFeNiZr0.4;(e)(k)AlC oCrFeNiZr0.5

Then calculate the average of each element of each phase, and make the table 1. As can be seen from table 1, the Zr element is not detected in the region that does not contain Laves. And the area of the dark phase is rich in Ni, Al, and light color phase rich in Cr, Fe, element Co in the two regions of the content distribution is more uniform. This shows that the addition of Zr element makes the alloy structure have a metastable state. From the graph (f) - (k), it can be seen that the crystal structure of the region containing the Laves phase is the modulation structure of the body centered cubic structure and the Laves phase. The chemical composition of the area can be seen in Figure 1. The element distribution of the dark phase is similar to that of the ordered body centred cubic structure of the Al rich or Ni rich phase formed by the metastable decomposition. In this experiment, the coexistence of metastable decomposition and ordered structure is found, which is attributed to the serious lattice distortion caused by the large atomic radius difference in the alloy system, which causes the increase of the lattice strain energy. The significant difference between the atomic size and the elastic interaction is the driving force for the occurrence of the coexistence of the sub steady state decomposition and ordering.

102 | Yu-Feng Ban, Gui-Zhong Liu, Cong-Min Hao, Xin-Tao Dong and Jing-Jie Guo Table 1: Chemical Composition of Alcocrfenizrx Alloys in Atomic Percentage. Al

Co

Cr

Fe

Ni

Zr

Hue

16.22

17.49

30.16

23.57

12.56

0.00

Hue

26.95

20.14

14.76

15.24

22.91

0.00

Hue

8.67

23.57

8.77

13.59

23.64

21.76

Hue

24.94

20.03

13.57

14.86

20.95

5.65

Laves phase is not included

Contai-ning Laves phase

Fig 4 is the alloy from room temperature to 30°C heating rate is heated to 1200°C, and then to 40 degrees /min cooling rate down to room temperature DSC curve. From the curve, it can be known that there is a very small exothermic peak near 1152°C, which can be inferred from the phase transition point of the high entropy alloy. But at 1000°C, the high entropy alloy had no obvious exothermic peak, that is, there was no phase transition point and melting point.

Fig. 4: DSC curves of AlCoCrFeNiZrx (x=0.1, 0.2, 0.3, 0.4, 0.5) alloys

Fig.5 compressive stress-strain curves of AlCoCrFeNiZrx alloy at room temperature, table 2. From table 2 we can see that the combination of the former 4 gold has anti better compression performance, even better than that of some of the high entropy alloy performance, optimal compressive properties of AlCoCrFeNiZr0.1 alloy, its yield strength is about 1385 MPa; the fracture strength reaches 1906MPa, the strain at break of 16.7%. When a small amount of Zr element (Zr0.1) is added to the AlCoCrFeNi alloy, the yield strength, fracture strength and plastic deformation of

Effects of Zr Addition on the Microstructure High-Entropy Alloys | 103

the alloy can be improved. When the content of Zr is more than 0.1, the plastic deformation and fracture strength of the alloy decreases, but the yield strength of the alloy increases. There is a close relationship between reason and Zr elements of this phenomenon.first, with larger atomic radius of Zr elements, the lattice distortion of alloy will increase, solid solution strengthening effect increases; secondly, the addition of Zr will lead to precipitation strengthening effect. When the Zr content increased to 0.5, the alloy has no obvious yield process, but directly induces irreversible fracture, which may be due to the structural transformation of alloy into Laves intermetallic compound as the base of the reason. 2500

Stress(MPa)

2000

1500

1000

500

Zr0.1 0

0

Zr0.2 10

20

Zr0.4

Zr0.3 30

Zr0.5 40

Strain(100%)

50

Fig. 5: Compressive true stress-strain curves of AlCoCrFeNiZrx alloys. Table2: Room-Temperature Compressive Stress-Strain Parameters of Alcocrfenizrx Alloys. alloys

Zr0.1

Zr0.2

Zr0.3

Zr0.4

Zr0.5

Vy

1385

1517

1819

1887



Vb

1906

1743

2069

2026

544

Hp

16.7

14.1

11.4

9.5

7

Fig. 6 the morphology of the compression section of AlCoCrFeNiZrx alloy. We can see from the figure of the alloy is quasi cleavage fracture. Fracture of Zr0.1 alloy on the surface of a lot of slip bands, a river shape, there are some people shaped crack; many small tear ridges and small dimple fracture of Zr0.2 alloy, on the surface of Zr0.4 alloy; fracture surface distribution of a tear edge, into the river pattern;

104 | Yu-Feng Ban, Gui-Zhong Liu, Cong-Min Hao, Xin-Tao Dong and Jing-Jie Guo fracture of Zr0.5 alloy surface is smooth, have a small amount of tear ridge. These are typical section characteristics of quasi cleavage fracture, so the fracture mechanism of the alloy microstructure belongs to quasi cleavage fracture and macro fracture is brittle. This is because the volume fraction of Laves phase in the alloy is more and more large, and the occurrence of metastable decomposition of the organization is also more and more, these will increase the strength of the alloy, so that the alloy is more easily broken.

Fig. 6: Fracture surfaces of AlFeCrCoTiZrX alloy

4 Conclusions (1) After the addition of AlCoCrFeNiZrx element in Zr alloy, there is a small amount of ordered BCC structure. When the molar ratio of Zr is 0.2, the Laves phase appears. With the further increase of Zr, the intensity of the diffraction peak of BCC phase was decreased, and the diffraction peak intensity of Laves phase was increased. (2) There was no phase transition point and melting point of alloy at 1000°C, and the phase transition point of metastable decomposition of the alloy were near 1152°C. (3) The alloy has good compression performance, the yield strength and fracture strength of the former 4 groups increased with the increase of Zr content. Compression fracture belongs to quasi cleavage fracture at the micro level, the macro fracture is brittle.

Effects of Zr Addition on the Microstructure High-Entropy Alloys | 105

References [1] [2]

[3] [4] [5] [6]

[7]

[8]

[9]

[10]

[11] [12] [13]

[14] [15]

[16]

Y.Zhang,T.T.Zuo,Tang,M.C.Gao,K.A.Dahmen,P.K.Liaw,etal.,Micro-structures and properties of high-entropy alloys,Prog.Mater.Sci.61(2014) 1–93. O.N. Senkov G. B. Wilks. J.M. Scott, D. B. Miracle, Mechanical properties of Nb25Mo25Ta25W25and V20Nb20Mo20Ta20W20 refractory high entropy alloys, Intermetallics 19(2011)698–704. Ren M X, Li B S, Fu H Z. Formation condition of solid solution type high-entropy alloy [J]. Transactions of Nonferrous Metals Society of China, 2013 23: 991-995 Wu J M, Lin S J, Yeh J W. Adhesive wear behavior of AlCoCrCuFeNi high-entropy alloys as a function of aluminum content [J]. Wear, 2006, 261: 513-519. Li B Y, Peng K, Hu A P, et al. Structure and properties of FeCoNiCrCu0.5AlX high-entropy alloy [J]. Transactions of Nonferrous Metals Society of China, 2013, 22: 735-741. Huang Y S, Chen L, Liu H W. Microstructure, hardness, resistivity and thermal stability of sputtered oxide films of AlCoCrCu0.5NiFe high-entropy alloy [J]. Materials Science and Engineering: A, 2007, 457(1-2): 77-83 O. N. Senkov, J. M. Scott, S. V. Senkova, D. B. Miracle, C.F. Woodward, Microstructure and room temperature properties high-entropyTaNbHfZrTial-loy,J.Alloy.Compd.509 (20) (2011) 6043–6048. O.N. Senkov, J.M. Scott, S.V. Senkova, F. Meisenko then, D.B. Miracle, C.F. Wood wart, Microstructure and elevated temperature properties of a refractor TaNbHfZrTi alloy, J. Mater. Sci. 47 (2012) 1062–1074. O.N. Senkov, S.V. Senkova, C. Woodwart, D.B. Miracle, Low-density, refractory multipricipal element alloys of the Cr-Nb-Ti-V-Zr system: microstructure and phase analysis Acta Mater.61 (2013)1545–1557. O.N. Senkov, S.V. Senkova, C.Woodwart, D.B. Miracle, Mechanical properties of low-density refractory multi-principal element alloys of the Cr-Nb-Ti-V-Zr system, Mater. Sci. Eng.A 565(2013)51–62. O.N. Senkov, C. Woodwart, D.B. Miracle, Microstructure and properties of aluminumcontaining refractory high-entropy alloys, JOM 66 (2014) 2030–2042. O.N. Senkov, S.V. Senkova, C. Wood wart, Effect of aluminum on the microstructure and properties of two refractory high-entropy alloys, Acta Mater.68 (2014)214–228. Y.D. Wu, Y.H. Cai, T. Wang, J.J. Si, J. Zhu, Y.D. Wang, et al., A refractory Hf25Nb25Ti25Zr25high-entropy alloy with excellent structural stability and tensile properties, Mater. Lett.130 (2014)277–280. Y.D. Wu, Y.H. Cai, X.H. Chen, T. Wang, J.J. Si, L. Wang, et al., Phase composition and solid solution strengthening effect in TiZrNbMoV high-entropy alloys, Mater.Des.83(2015)651–660. C.C. Juan, M.H. Tsai, C.W. Tsai, C.M. Lin, W.R. Wang, C.C. Yang, et al., Enhanced mechanical properties of HfMoTaTiZr and HfMoNbTaTiZr refractory high-entropy alloys, Intermetallics 62(2015)76–83. C.M. Lin, C.C. Juan, C.H. Chang, C.W. Tsai, J.W. Yeh, Effect of Al addition on mechanical properties and microstructure of refractory AlxHfNbTaTiZr alloys, J. Alloy. Compd. 624(2015)100–107.

Wen-Fang Yang1, Zhong-Da Zhang2, Jian-Fei Zhang3 and Xiao-Ming Zhao4

Research and Preparation of Super Hydrophobic and Self-Cleaning PVDF Membrane

Abstract: PVDF used as the surface material of architectural membrane don´t meet the demand of anti-fouling and self-cleaning function. The paper prepared PVDF membrane of rough surface by template method based on the lotus effect principle, and then the rough PVDF membrane was modified with fluoride hydrophobic agent in SCCO2 (Supercritical carbon dioxide). The results showed that the roughness of the membrane surface had important effect on its hydrophobicity. The PVDF membrane modified by fluoride hydrophobic agent had super hydrophobicity, its static contact angle was 163.8°and rolling angle was 2.1°. Observation with SEM illustrated that the PVDF membrane had morphology like lotus leaf. Gathering ash test showed that the PVDF membrane had well self-cleaning property. Keywords: PVDF; lotus leaf effect; super hydrophobic; template method; SCCO2

1 Introduction Membrane structure buildings, once contaminated, need to be cleaned by a lot of professionals and facilities, it´s dangerous also. Therefore, anti-fouling and selfcleaning membrane had attracted much attention [1]. PVDF was usually used as the surface material of PVC because of its chemical stability, which can delay aging rate of PVC. Although PVDF had lower surface energy, but it cannot offer anti-fouling and self-cleaning function, it is necessary to modify PVDF membrane. Lotus leaf had come out of the dirty mud and had “unsoiled” reputation, which

|| 1 Tianjin Polytechnic University Textile College, Advanced composite materials key laboratory of the ministry of education, Tianjin, China, E-mail:[email protected] 2 Tianjin Polytechnic University Textile College, Advanced composite materials key laboratory of the ministry of education, Tianjin, China, E-mail:[email protected] 3 Tianjin Polytechnic University Textile College, Advanced composite materials key laboratory of the ministry of education, Tianjin, China, E-mail: [email protected] 4 Tianjin Polytechnic University Textile College, Advanced composite materials key laboratory of the ministry of education, Tianjin, China E-mail:[email protected] 10.1515/9783110516623-011 DOI 10.1515/9783110303568-011

108 | Wen-Fang Yang, Zhong-Da Zhang, Jian-Fei Zhang and Xiao-Ming Zhao comes from its anti-fouling and self-cleaning performance. Berthlott W and Neinhuis C [2] found that there was a layer of micro sized projects of 5-9μm. Further, Jiang [3] found that there was an upper layer of waxy hydrophobic crystalloids of 5070nm on the lotus leaf. Micro- and nano- structure and low surface energy was necessary for “lotus effect” [4]. SCCO2 is nonpolar fluid between gas and liquid, according to the similar compatibility theory, SCCO2 can play a role to dissolve the fluoride hydrophobic agent [5] and plasticize and swell PVDF membrane [6], Therefore, it can used as medium to modify PVDF membrane. The paper prepared antifouling and self-cleaning PVDF membrane on the basis of “lotus effect” theory, rough surface structure was built by template methods and low surface energy was gotten by modified with fluoride hydrophobic agent in SCCO2 medium.

2 Experiments 2.1 Main Chemicals Polyvinylidenefluorid (PVDF, 3F, Shanghai, China. Industrial product); Dimethlformamide (DMF, Kermel, Tianjin, China. Chemical reagent); Fluoride hydrophobic agent TUCGUARD EX-900E (Da-ichi, Tianjin, China, industrial product); Fourier transform infrared spectrometer (TENSOR37,BRUKER); Scanning Electron Microscope (Quanta 2000, FEI, Check); Atom Force Microscope (Nanoscope3a, Veeco DI multimode, America); contact angle tester (JY-82, Chengde, Heibei, China); Video optical contact angle measurement instrument (OCA15 Pro, Detaphysics, Germany). Templates were made to put different diameter of SiC on the matrix, which can be classified into 1#~6# according to particle sizes, the average particle diameter was 18~2.7μm. The particle diameter of SiC corresponding to the template number were showed in table1. Table 1: Specification of Templates The template number

1#

2#

3#

4#

5#

6#

Average diameter of SiC/μm

18

13

10

5.5

5

2.7

Research and Preparation of Super Hydrophobic PVDF Membrane | 109

Fig. 1: The SEM figure of template: (a) 1#template; (b) 5# template.

Figure 1 showed that the shape of particles was random, there were different shape and size of pores between particles when template was coated with filmforming gum, the film-forming gum filled into the pores between particles, then dried and peeled to achieve the rough structure film, the morphology of film is opposite to the template.

2.2 Preparation of PVDF Flat Membrane The film-forming gum was prepared to resolve1.5g PVDF powders into the 10mL DMF at 40°C, stirred for 2h, and then standing for 3h. The PVDF plat membrane was prepared to coat the film-forming gum on the glass matrix, dried at 100°C for 10min, cured at 180°C for 5min, and then peeled from glass matrix.

2.3 Preparation of the Rough Surface PVDF Membrane The rough surface PVDF membranes were prepared to coat PVDF film-forming gum on 1#~6# templates respectively, dry at 80°C for 10min, cure at 180°C for 5min, and then peel from templates.

2.4 Optimization the Process of Super-Hydrophobic Modification in SCCO2 Medium PVDF plat membrane was put into SCCO2 machine, treated according to designed processes, after releasing pressure of machine, PVDF membrane was taken out, rinsed and washed with acetone at room temperature, and then ultrasonic washed to get the samples. The basic process was determined as pressure of 20 MPa, temperature at 120°C, time for 4h. One of three variables was changed in turn to obtain the optimal pro-

110 | Wen-Fang Yang, Zhong-Da Zhang, Jian-Fei Zhang and Xiao-Ming Zhao cess. The experiment changes pressure of 7.5MPa, 10MPa, 20MPa and 30MPa, temperature at 35°C, 75°C, 110°C, 120°Cand 150°C, time for 1h,2h,3h, 4hand 5h. The rough PVDF membrane was modified according to the optimal process, so superhydrophobic and self-cleaning PVDF membrane was prepared.

2.5 Test and Characterization PVDF membrane was put on the contact angle tester, dropping 0.05mL distilled water on it, reading data when water drop became steady. Testing five different points and taking average value. Dropping 0.1mL distilled water on the membrane surface, rotating the sample platform, recording the inclined angle of sample platform when water drop rolls off, testing five different points and taking average value. The morphology of membrane was observed by SEM. The micro- and nano- structures and three dimensional structures were observed by AFM. The characteristic functional groups were analyzed by KBr pellet method using IR spectrum.

3 Results and Discussion 3.1 Effect of the PVDF Membrane Roughness on Its Hydrophobicity Wenzel and Cassie theory [7] indicated that the roughness of solid surface severely affected its hydrophobicity. The relationship between roughness and hydrophobicity was shown in figure 2.

145

Contact angle/°

140 135 130 125 120 115 110 20

18

16

14

12

10

8

6

SiC particle size/ȝm

4

Fig. 2: Effect of surface roughness on contact angle

2

Research and Preparation of Super Hydrophobic PVDF Membrane | 111

The horizontal axis in figure 2 represented average diameter of SiC used to prepared template. As shown in figure 1, the bigger the particle size was, the bigger the spires of template was, conversely, the smaller it was, the finer the membrane structure was, therefore, different morphological membrane was prepared. The contact angle of the PVDF plat membrane was more than 94.3°as shown in figure 2. So, the rough morphology of membrane was attributed to improving contact angle. In addition, the contact angle increased rapidly as the diameter of SiC decreased. The maximum of contact angle reached 140.9° when membrane was prepared with template 5#(the diameter of SiC 5μm),which was analyzed combining to SEM.

Fig. 3: SEM of PVDF membrane: (a) Plat, membrane (5000×); (b) 18μm (400×); (c) 5μm (400×).

The morphology of plat membrane was showed as Figure 3(a), although there were crystal cells of 5μm diameter on the surface of membrane, but it was relatively smooth. As shown in figure 3(b), the surface of PVDF membrane became rough as increasing of the template-making particles diameter, the spires diameter reached 100μm or so, which was much larger than that in lotus [5], so its contact angle had a smaller increase. As shown in figure 3(c), the spires diameter of PVDF membrane ranged from 3μm to 15μm, it approached the micro spires structure of lotus (5~9μm), the contact angle reached the maximum of 140.9°. The membrane made by 6# template had superficial micro spires structure, which dramatically decreased the contact angle of PVDF membrane. The PVDF membrane made by template method had an obviously higher contact angle, but it cannot reach the super-hydrophobicity. It was necessary to modify the rough PVDF membrane.

3.2 Optimization the Process of Super-Hydrophobic Modification in SCCO2 Medium The experiments mainly focus on the plate membrane, research the effects of SCCO2 process on modification, and choose the optimal process.

112 | Wen-Fang Yang, Zhong-Da Zhang, Jian-Fei Zhang and Xiao-Ming Zhao 3.2.1 Effect of Pressure on Modification of PVDF Membrane The changes of pressure in SCCO2 system could affect the dissolution of hydrophobic agent and swelling of the membrane. The hydrophobicity of membrane modified at different pressures was showed in figure 4.

130

Contact angle/°

125 120 115 110 105 100

5

10

15

20

25

30

Pressure/Mpa Fig. 4: The relationship between pressure and contact angle

As shown in figure 4, the contact angle of PVDF modified was greater than that unmodified (94.3°). The contact angle was almost a straight line up as the pressure increasing when pressure kept near 10MPa. But the contact angle decreased when the pressure exceeded 15MPa. The reason was that hydrophobic agent existed distribution equilibrium between membrane and medium in “fluorine hydrophobic agent - fluid medium - membrane” system. At the initial stage, the hydrophobic agent concentration was higher in SCCO2 but lower in PVDF membrane, the hydrophobic agent mainly transferred toward membrane and absorbed by membrane, and reached adsorption balance finally. Therefore, the solubility of hydrophobic agent in SCCO2 increased with pressure increasing and liquid density increasing [8], the amount of hydrophobic agent absorbed on membrane increased also, which led to hydrophobicity of membrane increasing. However, when system pressure was excessive, the dissolution of hydrophobic agent in SSCO2 was high; there were more hydrophobic agents to transfer from membrane to medium, which led to hydrophobicity of membrane decreasing. As a consequence, the optimal pressure should be within 15-20MPa.

Research and Preparation of Super Hydrophobic PVDF Membrane | 113

3.2.2 Effect of Temperature on Super-Hydrophobicity of PVDF Membrane Temperature can influenced the diffusion coefficient of liquid, movement of micromolecular segment of membrane, and the dissolution of solid fluorine hydrophobic agent. It further influenced modification of hydrophobic agent for PVDF membrane. The experiment results were showed in figure 5. Figure 5 showed that the contact angle of PVDF membrane increased with the increasing of system temperature, but it decreased when temperature was excessive. The reason was that the system kept isobaric heating process, the intensity of SCCO2 was low in comparatively low temperature[8], the dissolution of fluorine hydrophobic agent, plastification and swelling were also low, which brought adverse modification effect. The dissolution of fluorine hydrophobic agent increased at comparatively high temperature, meanwhile, the intensity of liquid continued to decrease, PVDF molecular segment became more active to form more and more large pores, which were beneficial for hydrophobic agent to embed and diffused in PVDF membrane. Therefore, the temperature played duple roles on the modification of PVDF membrane. The optimal temperature was within 120°C~130°C on the basis of above experiments.

130 128

Contact angle/°

126 124 122 120 118 116 114

20

40

60

80

100

120

140

160

Temperture/ć Fig. 5: Effect of SCCO2 temperature on hydrophobicity of membrane

114 | Wen-Fang Yang, Zhong-Da Zhang, Jian-Fei Zhang and Xiao-Ming Zhao

130

Contact angle/°

125 120 115 110 105 100 95

1

2

3

4

5

Time/h Fig. 6: Effect of time on hydrophobicity of membrane

3.2.3 Effect of the Time on PVDF Membrane Modification The modification of PVDF membrane with fluorine hydrophobic agent in SSCO2 underwent the following processes: the dissolution of fluorine hydrophobic agent in medium, plastification and swelling of membrane in medium, fluorine hydrophobic agent movement close to the membrane, adsorption and diffusion in membrane. So, hydrophobic agent could not transfer into the membrane sufficiently if the time was not enough. The effect of the time on modification was showed in figure 6. As shown in figure 6, the contact angle of PVDF membrane increased with the extension of time, which reached a maximum of 129.6°, but it decreased when time prolonged to 5h, therefore, the optimal time was 3-4h. Based on above research, the hydrophobic modification process of PVDF membrane in SCCO2 were as follows: pressure was 15MPa, temperature was 130°C, time for 4h. The PVDF membrane was modified according to the above process; its contact angle was 135.7° and rolling angle 12.5°. So the hydrophobicity of modified PVDF membrane had been improved obviously. The morphology of PVDF membrane before and after modified was shown in figure 7-8 respectively.

Research and Preparation of Super Hydrophobic PVDF Membrane | 115

Fig. 7: SEM of PVDF membrane before and after modified: (a) PVDF before modified; (b) PVDF after modified.

Fig. 8: AFM of PVDF after modified

As shown in figure 7a, before modified the surface of membrane appeared spherical crystal structure, the surface of spherical crystal was smooth. Figure 7b showed that the surface of spherical crystal became rough after PVDF membrane was modified, it may be relevant to embed fluorine hydrophobic agent in the spherical crystal. Figure 8 illustrated AFM of modified PVDF membrane, there existed wax-crystal nano-structure similar to lotus leaf in micro bumps of PVDF membrane. It contributed to the hydrophobicity of PVDF membrane, but it is far from super hydrophobicity because micro-and nano- diameter was too small.

116 | Wen-Fang Yang, Zhong-Da Zhang, Jian-Fei Zhang and Xiao-Ming Zhao

3.3 The Super Hydrophobic Modification of the Rough PVDF Membrane in SCCO2 3.3.1 The Super Hydrophobic Modification of Rough PVDF Membrane The PVDF membrane prepared by template method had morphology similar to lotus leaf, but it cannot meet the demand of super hydrophobicity because of higher surface energy. In this section, PVDF membranes were prepared to use 1#~5# templates, and modified according to the process mentioned in 3.2. Table 1: The Contact Angle and Rolling Angle of Modified Membrane The template number

1#

2#

3#

4#

5#

Contact angle/°

145.8

151.5

153.2

156.1

163.8

Rolling angle/°

8.2

5.5

5.2

4.3

2.1

The data in table 2 showed that the contact angle of PVDF membrane prepared by template method in SCCO2 had been improved obviously, because it had rough structure similar to lotus leaf. After modified by hydrophobic agent in SCCO2, the membrane was covered with fluorine alkane, which decreased the surface energy of membrane, so the PVDF membrane achieved super hydrophobicity. Figure 9 illustrated the SEM of membrane modified in SCCO2, the morphological structure of membrane became fine as the diameter of SiC decreasing, it was more like a lotus leaf.

Fig. 9: The SEM of PVDF modified in SCCO2: (a) Plate membrane; (b) Plate membrane (template 1#); (c) Plate membrane (template5#).

Research and Preparation of Super Hydrophobic PVDF Membrane | 117

3.3.2 The IR analysis of Modified PVDF Membrane The chemical compositions of the PVDF membrane before and after modification were analyzed by IR in figure 10. After the PVDF membrane was modified, strong absorption peaks appeared at 1724cm-1 and 1188cm-1, they belonged to stretching vibration of C=O bond and C-O respectively, which was the characteristic absorption peak of -CO-O group of fluorine hydrophobic agents. The absorption peak in 1172cm1 was considered to be the stretching vibration of C-F bond, it became stronger after modification, which was contributed to fluorine hydrophobic agents [9]. On the basis of experimental result above-mentioned, we could draw a conclusion that the fluorine hydrophobic agent was embedded onto the PVDF membrane [9].

%HIRUH

$IWHU

3500

3000

2500

2000

1500

wave numbe/cm-1 Fig. 10: IR spectrum of PVDF membrane

1000

500

118 | Wen-Fang Yang, Zhong-Da Zhang, Jian-Fei Zhang and Xiao-Ming Zhao 3.3.3 The Self-Cleaning Experiment of Modified PVDF Membrane.

Fig. 11: Gathering ash experiment: (a) Before modification; (b) After modification.

Rapid cleaning effect test method of flowing water built by university of Bonn Germany was referred in self-cleaning experiment. The anti-fouling and selfcleaning effect was evaluated qualitatively according to removing ash when water drop ran off. Figure 11 illustrated the self-cleaning effect of PVDF membrane prepared by 5# template. There were still a lot of dirt at the route of water droplet in figure 11(a), but it was clean in figure 11(b), which showed that the PVDF membrane prepared by template and then modified with hydrophobic agent in SCCO2 had well self-cleaning effect.

4 Conclusions (1)The rough PVDF membrane could obtain low surface energy and high contact angle after modified with fluorine hydrophobic agent in SCCO2, IR analysis showed that the fluorine hydrophobic agent was applied to PVDF membrane successfully. (2)There was an important influence of the state parameter of SCCO2 liquid and treating time on the modification process of PVDF membrane, the optimal processing conditions included pressure of 15MPa, temperature at 130°C, and time for 4h. (3) In SCCO2, the PVDF membrane prepared by 1#-5# templates was modified according to the optimized processing conditions, which given the PVDF membrane super hydrophobicity. The contact angle of PVDF membrane prepared by template 5# was 163.8°, rolling angle 2.1°. Gathering ash experiment showed that modified PVDF membrane had well self-cleaning property; water droplet can take away “dirt” in its path.

Research and Preparation of Super Hydrophobic PVDF Membrane | 119

References [1] [2] [3] [4] [5] [6] [7] [8]

[9]

Zheng Z R,Gu Z Y, Huo R T,et al. the preparation of anti-fouling and self-cleaning PVDF membrane[J]. Building materials science, 2010, 13(1):37-41. Barthlott W, Neinhuis C. Purity of the secret lotus or escape from contamination in biological surface [J]. Planta, 1997, 202(3): 1-8. Jiang L. The super hydrophobic nanoscale interfacial material from nature to bionics [J] .Science & Technology Review, 2005, 23(2):2-8. Feng L, Li S H, and Li Y S, et al. Super-hydrophobic surface: From nature to artificial [J]. Advanced Materials, 2002, 14(24): 1857-60. Li S, Wang J X.the research progress of surfactant used in supercritical carbon dioxide [J].Chemistry World,2007,(8):496-499. Wang S,Zhang C J,Zhu C J.The applied research of Super critical CO2 Fluids in the field of polymer [J].Journal of Anhui University(Natural Science),2008,32(2):83-86. R.D.Narhe,D.A.Beysens.Growth Dynamics of Water Drops on a Square-Pattern Rough Hydrophobic Surface [J].Langmuir,2007,23(12): 6486-6489. Zhang J C,Zhang J J,Cao W L. the research of the relation between temperature, pressure and the density of supercritical carbon dioxide [C]. The fourth session of the national conference on supercritical fluid technology and application, 66-69. E. Pretsch, M. Badertscher,Song G Translator. Structure Analysis of Organic Chemicals [M]. Peking, Science Press, 2013.5.

Chun-Lei Jiang1, Hai-Li Zhu2, Kyunsoo Shin3, Tao Wang4, Guang-Hai Chen5 and Yong-Bing Tang6*

Preparation and Characterization of TiB2 Coatings with Ultra-Low Residual Stress

Abstract: Industrial application of TiB2 coatings has been strongly limited by the high compressive residual stress. In this work, TiB2 coatings with extremely low residual stress about 72 MPa were deposited using the DC magnetron sputtering technique on (100) silicon substrate. The significant reduction of the residual stress was achieved by balancing the tensile thermal stress and compressive intrinsic stress by adjusting the deposition temperature and substrate bias voltage. The deposition temperature was set as 500°C, and the bias voltage varied from -30 V to -200 V. TiB2 coating with the lowest residual stress was obtained at -150 V, with extremely dense microstructure and high hardness. Keywords: TiB2 coatings; residual stress; thermal stress; intrinsic stress; magnetron sputtering

1 Introduction TiB2 coating have attracted extensive attentions as wear-resistant protective coatings due to its excellent properties, such as high hardness, wear resistance, chemical inertness, and thermal conductivity[13]. However, the industrial applications of TiB2 coatings are restricted by coating cracking or spalling due to high residual stress [1;4]. Great efforts have been taken to control the residual stress level, such as post annealing [5], increasing target-to-substrate distance [6], applying positive bias voltage [7] and so on. Note that, residual stress of coatings consists of intrinsic stress

|| 1 Functional Thin Films Research Centre, Shenzhen Institutes of Advanced Technology, Chinese Academy of Sciences , Shenzhen, China , E-mail: [email protected] 2 Nano Science and Technology Institute, University of Science and Technology of China, Suzhou, China, E-mail: [email protected] 3 Functional Thin Films Research Centre, Shenzhen Institutes of Advanced Technology, Chinese Academy of Sciences ,Shenzhen, China, E-mail: [email protected] 4 Functional Thin Films Research Centre, Shenzhen Institutes of Advanced Technology, Chinese Academy of Sciences, Shenzhen, China, E-mail: [email protected] 5 School of Materials Science & Engineering, Chongqing University of Technology, Chongqing, China, E-mail: [email protected] 6 Functional Thin Films Research Centre, Shenzhen Institutes of Advanced Technology, Chinese Academy of Sciences, Shenzhen, China, Corresponding author e-mail: [email protected] 10.1515/9783110516623-012 DOI 10.1515/9783110303568-012

122 | Chun-Lei Jiang, Hai-Li Zhu, Guang-Hai Chen5 and Yong-Bing Tang and thermal stress. Intrinsic stress is typically in compressive stress state, due to the formation of defects under the highly non-equilibrium deposition process conditions and the energetic particles bombardment [8]. And bias voltage could be used to control the intrinsic stress by adjusting the energy of the incident ions. Thermal stress results from the mismatch of the coefficient of thermal expansion (CTE) between the coating and substrate at elevated deposition temperature [9]. The stress state of thermal stress could be either compressive or tensile stress depending on the CTE values of the coating and substrate. If the CTE value of the coating is larger than that of the substrate, tensile thermal stress will be generated when cooling down from elevated deposition temperature, otherwise compressive thermal stress will be formed. For TiB2 coating, the CTE value (α = 8.1×10-6/K[10]) is larger than that of cemented carbide substrates (α = 4.5×10-6/K[11] for YG6) and silicon substrates (α = 2.6×10-6/K for (100) silicon[12]), and tensile thermal stress will be formed in the TiB2 coating on YG6 or (100) silicon substrate. In this case, the tensile thermal stress will counteract the compressive intrinsic stress to achieve low even zero stressed TiB2 coatings by regulating the bias voltage and the deposition temperature. In this paper, TiB2 coatings were deposited on (100) silicon and YG6 substrates using DC magnetron sputtering method. And extremely low stressed TiB2 coating was prepared by adjusting bias voltage under high deposition temperature.

2 Experiment V-Tech MF610/610 ion plating system was used to deposit TiB2 coatings. In this system, two magnetron sputtering sources, and one ion source are mounted on the walls of the octagonal vacuum chamber. In this work, one rectangle TiB 2 target (300 mm×100 mm×10 mm in size and 99.5% in purity) was used. Mirror polished (100) silicon (50 mm×10 mm×0.8 mm in size) and YG6 (18 mm×18 mm×3mm in size) were used as the substrates. (100) silicon was used for SEM morphology characterization and residual stress test, while YG6 was used for XRD characterization and hardness measurement. In the deposition process, the working pressure was kept constant at 0.5 Pa with Ar as working gas. High deposition temperature was needed to generate large enough tensile thermal stress to counteract the compressive intrinsic stress. In this work, the deposition temperature was set as 500 °C, and the thermal stress could be calculated by the following equation: σth = Ef/(1-νf)(αf-αs)(Td-Tc)

(1)

where E, ν and α is the Young’s modulus, Poisson’s ratio and coefficient of thermal expansion, respectively. The subscript f, s refers to the coating and substrate, respectively. Td is the deposition temperature, while Tc is the temperature to calculate

Preparation and Characterization with Ultra-Low Residual Stress | 123

the thermal stress and room temperature is usually used. The calculated σth value for TiB2 coating on (100) silicon substrate with deposition temperature at 500 °C was 1.78 GPa, which is comparable on the order of magnitude with the typical intrinsic stress values. The DC power of the target employed in this work was set as 2.4 kW, with power density about 8 W/cm2. The bias voltage (Ub) varied from -30 V to -200 V to adjust the intrinsic stress, and the values were set as -30 V, -50 V, -100 V, -150 V and -200 V, respectively. For simplicity, notations S1, S2, S3, S4, and S5 were used to denote TiB2 coating samples deposited at bias voltage -30 V, -50 V, -100 V, -150 V and -200 V, respectively. Crystal structure was determined by X-ray diffraction (XRD; D/Max 2500PC, Rigaku, Japan) with Cu Kα radiation (λ=1.54056 Å). Field-emission scanning electron microscopy (FESEM; FEI Nova NanoSEM 450, FEI, Netherlands) was used to characterize the plan and cross-sectional morphologies of coatings. The thicknesses of coatings were derived from the cross-sectional morphology. Vickers hardness was tested using the microhardness tester (HMAS-D1000SZ, Shanghai Yanrun, and China) with the applied load of 0.98 N. FST-1000Film Stress Tester (Supro Instruments, China) was used to measure residual stress of coatings based on substrate curvature method. The residual stress was calculated by Stoney equation as follows [13]: σr = {(Eshs2)/[6(1-νs[(1/R0)-(1/R)]

(2)

where E, h, and ν presents the Young’s modulus, thickness and Poisson’s ratio, respectively. The subscript s and f denotes the substrate and coating, respectively. R0 and R is the curvature radius of the substrate before and after deposition, respectively.

3 Results and Discussion XRD patterns of TiB2 coating samples deposited at various bias voltages on the YG6 substrate are displayed in Fig. 1. As shown in Fig. 1, (0001), (10ī1) and (0002) diffraction peaks were observed for TiB2 coatings deposited at different bias voltage (Ub) from -30 V to -200 V. All coating samples exhibited strong (0001) preferred orientation which is consistent with most reported works [1;7]. For hexagonal TiB2 phase, energetic adatoms are required for the preferred growth along the [0001] direction, since the (001) plane has the highest packing factor[14]. Therefore, factors such as high sputtering power, deposition temperature and bias voltage contributing to enhance the energy of adatoms favor the evolution of the (0001) orientation. In this study, bias voltage has little influence on the preferred orientation, and the possible reason was that the sputtering power density (8 W/cm2) and deposition temperature

124 | Chun-Lei Jiang, Hai-Li Zhu, Guang-Hai Chen5 and Yong-Bing Tang (500 °C) were high enough for the (0001) plane growth. Moreover, diffraction peaks of WC phase referring to the YG6 substrate were also observed for all coating samples.

Fig. 1: XRD patterns of TiB2 coating samples deposited at different bias voltage (from -30 V to -200 V)

Fractured cross-section morphology for coatings deposited at different bias voltage (from -30 V to -200 V) was shown in Fig. 2(a)-2(e). As seen in Fig. 2(a), the fracture cross-section morphology of sample S1 (Ub = -30 V) exhibited dense columnar structure without any pores or voids. Tilted direction of the columns regarding to the substrate surface was observed for sample S1, which might due to the substrate surface normal was not perpendicular to the target surface during the deposition. At Ub = -50 V, fine fibrous structure was observed for sample S2 as shown in Fig. 2(b). At Ub = -100 V, the fibrous structure became finer, and fracture-amorphous glassy structure appeared in the coating-substrate interface region for sample S3 (see Fig. 2(c)). When Ub was increased to -150 V (sample S4), the cross-section morphology was dominated by fracture-amorphous glassy structure, but still with some fine fibrous feature (see Fig. 2(d)). At Ub = -200 V (sample S5), the fibrous structure was totally disappeared and was replaced by the smooth fracture-amorphous glassy structure. Note that, the surface morphology of all sample coatings exhibited featureless smooth structure like sample S5 shown in Fig. 2(f). By increasing the negative bias voltage, the compactness of TiB2 coating was enhanced with the evolution of the cross-section morphology from columnar to fine fibrous and then glassy structure. High compactness would improve the load-bearing capacity, which is necessary for high hardness.

Preparation and Characterization with Ultra-Low Residual Stress | 125

Fig. 2: Fractured cross-section morphology SEM images for TiB2 coatings deposited at -30 V (a), -50 V (b), -100 V (c), -150 V (d) and -200 V (e), while (f) refers to the plan view of the TiB2 coating deposited at -200 V

Residual stress of TiB2 coatings deposited at different bias voltage was measured by the method of curvature. As shown in Fig. 3(a), residual stress of TiB2 coatings decreased almost linearly with the increase of negative bias voltage. According to the linear fitting, the residual stress was in the tensile state in the bias voltage range from -30 to -160 V, and turned to be compressive at higher bias voltage. The linear fitting formula could be written as follows: σr = 0.82+0.005Ub

(3)

where, σr is the residual stress, and Ub is the negative bias voltage. As discussed above, residual stress is composed of intrinsic stress and thermal stress, and the relationship could be expressed by (3). σr =σin + σth

(4)

where, σin is the intrinsic stress, σth is the thermal stress. The thermal stress of TiB2 coatings on the (100) silicon substrate has been calculated with the value of 1.78 GPa. And the intrinsic stress σin could be calculated by (4), and the results were plotted using red solid circle with the negative bias voltage in Fig. 3(a). The results were also linearly fitted giving the same slope with that of the residual stress, indicating the change of the residual stress with the bias voltage depended on the intrinsic stress, since the thermal stress was a constant. At Ub =-150 V, extremely low residual stress about 72 MPa was obtained. The critical negative bias voltage for zero residual

126 | Chun-Lei Jiang, Hai-Li Zhu, Guang-Hai Chen5 and Yong-Bing Tang stress could be calculated as Ub = -160 V through (3). In this way, stress free TiB2 coating could be synthesized by optimizing the negative bias voltage at high deposition temperature. The reasons for the deposition of stress free TiB2 coating lie in the following aspects: The CTE of TiB2 is higher than that of the (100) silicon, which makes it possible to form tensile thermal stress counteract the compressive intrinsic stress. The biaxial modulus E/ (1-ν) of TiB2 coating is high about 682 GPa [10], which is necessary to generate high enough tensile thermal stress to counteract the compressive intrinsic stress. High deposition temperature is also necessary to from high tensile thermal stress.

Fig. 3: Residual stress and intrinsic stress of TiB2 coatings on (100) silicon substrate (a) and calculated residual stress of TiB2 coatings on YG6 substrate (b) plotted with negative bias voltage

For most transition metal boride (TMB) or nitride (TMN) coatings, their CTE are larger than that of cemented carbides[15]. Take TiB2 coating on YG6 substrate for

Preparation and Characterization with Ultra-Low Residual Stress | 127

example, the intrinsic stress was assumed to be the same as that of TiB2 coating on (100) substrate, since same deposition parameters were applied to (100) silicon and YG6 substrates. And the thermal stress of TiB2 coating on YG6 substrate could be calculated through (1) with the value of 1.17 GPa. And the residual stress could be calculated through (4) with results plotted in Fig. 3(b). According to the linear fitting, the critical bias voltage for zero residual stress could be calculated as Ub = -58 V. Therefore, it is possible to deposit stress free TMB or TMN coatings on cemented carbide cutting tools with relatively large coating thickness, which is beneficial to improve the wear resistance and service life. The Vickers hardness was plotted with the bias voltage in Fig. 4. Note that, the obtained hardness was the composite hardness of the coating-substrate system, since the substrate effect was predominant under large applied load (0.98 N). As illustrated in Fig.4, the composite hardness rises almost linearly from 20.2 to 22.7 GPa with the increase of the negative bias voltage. The hardness enhancement with the increase of negative bias voltage could be explained by the coating microstructure and residual stress. As discussed above, the TiB2 coating compactness and the compressive residual stress increased with the increase of the negative bias voltage. On the one hand, dense coating microstructure is vital for the high load-bearing capacity[16]. On the other hand, the compressive residual stress is also beneficial for the hardness enhancement. Although linear increase of the composite hardness with the increase of negative bias voltage was observed, the hardness enhancement was relatively small about 2.5 GPa. TiB2 coatings deposited at different bias voltage exhibited similar hardness in the range of 20-23 GPa.

Fig. 4: Composite hardness of TiB2 coatings plotted with different negative bias voltage

128 | Chun-Lei Jiang, Hai-Li Zhu, Guang-Hai Chen5 and Yong-Bing Tang

4 Summary TiB2 coatings with extremely low residual stress were synthesized by DC magnetron sputtering, and conclusions could be drawn as follows: (1)The thermal stress of TiB2 coating on (100) silicon substrate is in tensile state. At 500°C the thermal stress is 1.78 GPa, which is high enough to counteract the compressive intrinsic stress to achieve almost stress free (72 MPa) coatings. This work has proved that it is an effective way to deposit stress free TiB2 coating by balancing the thermal stress and intrinsic stress. This method could be also applied to other hard or superhard coatings with the precondition that the CTE of the coating must be higher than that of the substrate. This method shows great possibility to grow hard protective coatings with large thickness. It would be beneficial to improve coatings’ wear resistance and service life. (2)TiB2 coatings exhibited (0001) preferred orientation, which is due to the high deposition temperature (500°C) and sputtering power density (8 W/cm2), and the bias voltage showed little influence on the preferred growth direction. (3)With the bias voltage increasing, the microstructure evolution from dense columnar structure to fine fibrous structure, and eventually to smooth fractureamorphous glassy structure was observed in this work. (4)The hardness of TiB2 coatings showed similar values and increased almost linearly from 20.2 to 22.7 GPa with increase of the negative bias voltage. Acknowledgement: This work was supported by Shenzhen Municipality Project (JCYJ20150630114942259), Shenzhen Municipality Science and Technology Planning Project (JSGG20160229202951528), Scientific Equipment Project of Chinese Academy of Sciences (yz201440; GJHS20160329112009617), Shenzhen Municipality Technology R&D Project (JSGG20160229202951528; JSGG20160301155933051), Science and Technology Planning Project of Guangdong Province (Nos. 2014A010105032, 2014A010106016), and Guangdong Innovative and Entrepreneurial Research Team Program (No. 2013C090).

References [1] [2] [3] [4] [5]

M. Berger, M. Larsson and S. Hogmark, "Evaluation of magnetron-sputtered TiB2 intended for tribological applications," Surface and Coatings Technology,vol. 124, pp. 253-261 ,2000. F. Huang, J. A. Barnard and M. L. Weaver, "Ultrathin TiB2 protective films," Journal of Materials Research, vol. 16, pp. 945-954, 2001. R. G. Munro, "Material properties of titanium diboride," Journal of Research of The National Institute of Standards and Technology, vol. 105, pp. 709-720, 2000. C. Mitterer, M. Rauter and P. Rödhammer, "Sputter deposition of ultrahard coatings within the system Ti-B-C-N," Surface and Coatings Technology, vol. 41, pp. 351-363, 1990. J. Chen and J. A. Barnard. Growth, "structure and stress of sputtered TiB, thin films," Materials Science and Engineering A vol. 191, pp. 233-238, 1995.

Preparation and Characterization with Ultra-Low Residual Stress | 129 [6]

[7] [8] [9]

[10]

[11]

[12] [13] [14]

[15] [16]

M. Zhoua, M. Nose, Y. Makino and K. Nogi, "Annealing effects on the structure and mechanical properties of r.f.-sputtered Cr-B hard thin flms," Thin Solid Films,vol. 359, pp. 165-170, 2000. M. Berger, L. Karlsson, M. Larsson and S. Hogmark, "Low stress TiB2 coatings with improved tribological properties," Thin Solid Films, vol. 401, pp. 179-186, 2001. R. Daniel, K. J. Martinschitz, J. Keckes and C. Mitterer, "The origin of stresses in magnetronsputtered thin films with zone T structures," Acta Materialia, vol. 58, pp. 2621-2633, 2010. Chawla, R. Jayaganthan and R. Chandra, "Analysis of thermal stress in magnetron sputtered TiN coating by finite element method," Materials Chemistry and Physics, vol. 114, pp. 290-294, 2009. M. Xia and H. Ding, "Numerical Simulation of Thermal Stress in Sputtered TiB2Films by Finite Element Method," Proceedings of 2012 International Conference on Mechanical Engineering and Material Science (MEMS 2012), Atlantis Press, pp. 428-431 J. Liu, W. Zhao, Y. Lv and Q. Zhang, "Optimization of Substrate Materials and Preparation of ZrN Coated Tools,"2011 Third International Conference on Measuring Technology and Mechatronics Automation, IEEE Computer Socity, 2011 815-818. K. G. Lyon, G. L. Salinger, C. A. Swenson and G. K. White. Linear thermal expansion measurements on silicon from 6 to 340 K Journal of Applied Physics, 1977 (48): 865 G. G. Stoney, "The tension of metallic films deposited by electrolysis," Proceedings of the Royal Society of London A, vol. 82, pp. 172-175, 1909. P. Sricharoenchai, N. Panich, P. Visuttipitukul and P. Wangyao, "Effect of Substrate Temperature, Biasing and Sputter Cleaning on the Structure and Properties of Nanostructured TiB2 Coatings on High Speed Steel," Materials Transactions, vol. 51, pp. 246-252, 2010. D.-I. C. Friedrich, G. Berg, E. Broszeit and C. Berger, "Datensammlung zu Hartstoffeigenschaften," Materialwissenschaft und Werkstofftechnik, vol. 28, pp. 59-76, 1997. S. J. Bull and D. S. Rickerby, "Paper XV (i) The inter-relationship between coating microstructure and the tribological performance of PVD coatings,"vol. 17, pp. 337-349, 1990

Ying-Jie Gan1 and Gang Xiong2

Crystal Structure and Microwave Dielectric Properties of Ca [(Li1/3Nb2/3) 0.9Zr0.1]O3-δ−xTiO2 ceramics Abstract: Crystal structure and microwave dielectric properties of Ca [(Li1/3Nb2/3) 0.9Zr0.1]O3−δ−xTiO2(0≤x≤0.1) ceramics were investigated. A single phase with orthorhombic perovskite structure was obtained at x=0.0~0.1. With an increasing of Ti4+ content, the Qf value decreased due to a decrease of the degree of B-site 1:2 ordering. However, the τf value increased from-12.8ppm /ºC to -6.8ppm/ºC. When x=0.05, the optimum microwave dielectric properties: εr=33.1, Qf =18230GHz and τf =−6.8 ppm/ºC. Keywords: Microwave dielectric ceramics; Microwave dielectric properties

1 Introduction Recently, Ca(Li1/3Nb2/3)O3−δ ceramics have been newly developed and widely investigated because of its excellent microwave dielectric properties and low sintering temperature of about 1150ºC [1,2]. Ca [(Li1/3Nb2/3) 0.9Zr0.1] O3−δ show εr of 29.5 and Qf of 21030 GHz, while τf is a large negative value (−12.8ppm/ºC). It is important to adjust τf to near zero for application of the microwave device. In order to adjust τf to near zero, two or more compounds having positive and negative τf value are employed to form a solid solutions or mixed phases [3]. TiO2 was reported to possess good microwave dielectric properties: εr =100, τf = 400ppm/ºC and Qf ≈ 40000 GHz. Therefore, it is expected that the microwave materials with Near-Zero temperature coefficient, good sinterability and dielectric properties were obtained by combining Ca [(Li1/3Nb2/3)0.9Zr0.1]O3−δ with TiO2. In the present study, the influence of TiO2 addition on microwave dielectric properties and crystal structures of Ca [(Li1/3Nb2/3) 0.9Zr0.1] O3−δ ceramics has been investigated.

|| 1 Department of Electronic and Information Engineering, Hubei University of Science and Technology, Xianning, China, [email protected] 2 Department of Electronic and Information Engineering, Hubei University of Science and Technology, Xianning, China, xgang68@ aliyun.com 10.1515/9783110516623-013 DOI 10.1515/9783110303568-013

132 | Ying-Jie Gan and Gang Xiong

2 Results and Discussion Fig. 1 shows part of powder XRD patterns of the Ca [(Li1/3Nb2/3) 0.9Zr0.1]O3−δ−xTiO2 (0.0≤x≤0.1)ceramics varied with TiO2 content sintered at 1170ºC for 4h.. With x increases, the peaks of superlattice diffractions of specimen 1:2 decreases until disappear, the degree of B-site 1:2 ordering will decrease, second phase appearence, which means Ti2+ entered the B-site of the ABO3 perovskite structure, and then formed complete solid solution with single perovskite phase. TiO2 addition accelerated the composition of main phase in ceramic systems, but inhibited the degree of 1:2 ordering in Ca [(Li1/3Nb2/3) 0.9Zr0.1]O3−δ-xTiO2 ceramics.

Fig.1: XRD spectra of Ca [(Li1/3Nb2/3) 0.9Zr0.1] O3−δ−xTiO2 specimens with the various values of x

Fig. 2 shows the relationship between the dielectric constant ε r and the composition (x). With the increasing content of TiO2 ranged from 0.05 to 1.0, the dielectric constant εr increased almost linearly from 29.5 to 35.7 by the compensation effect, which was due to the formation of complete solid solution with single perovskite phase, CaTiO3 has a high εr of 170[4].Although the samples are not the mixtures of pure Ca[(Li1/3Nb2/3) 0.9Zr0.1]O3−δ and TiO2, the measured values could still be compared with the theoretical values calculated using the logarithmic mixing rule lnεr=V1lnεr1+V2lnεr2 where Vi and εri are the volume fraction and dielectric constant of each component [5].

Crystal Structure and Microwave Dielectric ceramics | 133

Fig. 2: εr values of Ca [(Li1/3Nb2/3) 0.9Zr0.1] O3−δ−xTiO2 specimens with the various values of x

Fig. 3 shows the effect of TiO2 addition on the quality factor. The quality factor decreases with TiO2 addition. This is expected since TiO2 addition inhibited the degree of 1:2 ordering in Ca[(Li1/3Nb2/3) 0.9Zr0.1]O3−δ-xTiO2 ceramics and thus cause the decreases of the quality factor[6,7].

Fig. 3: Qf values of Ca [(Li1/3Nb2/3) 0.9Zr0.1] O3íįíxTiO2specimens with the various values of x

The relationship between the temperature coefficient of the resonant frequencies and the TiO2 content in Ca [(Li1/3Nb2/3)0.9Zr0.1]O3−δ-xTiO2 ceramics was plotted in Fig.4. As indicated τf values varied almost linearly with TiO2 content which was quite similar to that of dielectric constant. It ranged from negative value of 12.8ppm/ºC to negative value of –6.8ppm/ºC when TiO2 content increased from 0 to 10 mol%.The results indicated that by proper choose of two compounds with opposite temperature coefficients, it is possible to achieve temperature stable material.

134 | Ying-Jie Gan and Gang Xiong

Fig. 4: τf values of Ca [(Li1/3Nb2/3) 0.9Zr0.1]O3−δ−xTiO2 specimens with the various values of x

3 Summary TiO2 addition accelerated the composition of main phase in ceramic systems, but inhibited the degree of 1:2 ordering in Ca [(Li1/3Nb2/3)0.9Zr0.1]O3−δ-xTiO2 ceramics. When 5mol%≤x≤10mol%, the systems changed into single perovskite phase. The εr increased from 29.5 to35.7 with an increase of Ti content. Which was due to the εr value of CaTiO3 is 170, higher than that of Ca[(Li1/3Nb2/3)0.92Zr0.08]O3−δ ceramics.The Qf value decreased due to a decrease of the degree of B-site 1:2 ordering and an change of the matrix. With an increasing of Ti4+ content, the τf value increased from-12.8 ppm/ ºC to -6.8 ppm/ºC, When x=0.05, the optimum microwave dielectric properties: εr=33.1, Qf =18230GHz and τf =−8.7 ppm/ºC. Acknowledgement: This work was supported by the Foundation of Bureau of human resources and social service of Xianning (No.xnrsg-3) and the Natural Science Foundation of Scientific office of Xianning (No.XNKJ-1302)

References [1] [2] [3]

[4] [5]

J.W. Choi, C.Y. Kang, S.J. Yoon, H.J. Kim and H.J.Jung, Microwave dielectric properties of Ca [(Li1/3Nb2/3)1-XMX] O3−δ (M=Sn, Ti) ceramics. J. Mater. Res.14 (1999): 3567-3570. J.W. Choi, J.Y. Ha , S.J. Yoon, H.J. Kim and K.H. Yoon, Microwave dielectric properties of Ca[(Li1/3Nb2/3)1-XZrX]O3−δ ceramics. Jpn.J. APPL. Phys.43 (2004):223-225. C.L. Huang, H.L. Chen, C.C. Wu,Improved high Q value of CaTiO3-Ca (Mg1/3Nb2/3)O3 solid solution with near zero temperature coefficient of resonant frequency. Mater. Res. Bull., 36(2001):1645-165236 O.Hirotaka, P. Liu, E.S.Kim, et al., Low-temperature sintering and microwave dielectric properties of Ca (Li1/3Ta2/3) O3−δ−CaTiO3 ceramics. J. Eur. Cer. Soc., 23 (2003): 2417-2421 K. Lichtenecker,Dielectric constants of cubic ionic compounds. Physik Zeits., 27(1926): 833835

Crystal Structure and Microwave Dielectric ceramics | 135 [6] [7]

I.T. Kim, Y.H. Kim, S.J. Chung, Order-disorder transition and microwave dielectric properties of Ba (Zn1/3Ta2/3) O3 ceramics. Jpn. J. Appl. Phys.,34 (1995), : 4096-4101 P.K. Davies, J. Tong, T. Negas, Effect of ordering-induced domain boundaries on low-loss Ba (Zn 1/3Ta2/3) O3-BaZrO3 perovskite microwave dielectrics. J. Am. Ceram. Soc., 80(1997): 17271740

Hong-Bo Yu1, Hui-Ru Liu2, Gui-Lin Liu3 and Hong Gao4

Mechanism of Mechanochemical Reactions in Magnesium-Aluminium Layered Double Hydroxides Systems Abstract: The mechanochemical synthesis and formation mechanisms of magnesium-aluminium-layered double hydroxides (MgAl LDHs) by ball-mill were investigated. In order to verify the structure of LDHs, X-ray diffraction (XRD) patterns, scanning electron microscope (SEM) and energy dispersive spectroscopy (EDS) were characterized. The results show that flower-like particles with high crystallinity are obtained. The R values (Mg/Al molar ratio) of samples are higher than feed ratios. This approach includes two processes, activation and diffusion. The magnesium hydroxide must be activated. The diffusion leaded to isomorphously substituted between Mg2+ ions and Al3+ ions in hot water and synthesized the MgAl LDHs. Keywords: LDHs; mechanochemical reaction; diffusion; LDHs

1 Introduction Layer double hydroxides (LDHs) are class of compounds derives from the structure of mineral brucite, which have a general formula: [M (II) 1-xM (III) x (OH) 2] (An-) 2+ x/n·mH2O. Brucite comprises a hexagonal packing of hydroxyl ions, in which Mg ions occupy alternate layers of octahedral sites, leading to a stacking of chargeneutral layers having the composition [Mg (OH) 2]. When a fraction, x, of the Mg2+ ions is isomorphously substituted by trivalent ions, M (III) (Al, Cr, Fe), the hydroxide layers acquire a positive charge with the composition. Anions, An-, are incorporated in the interlayer region for charge neutrality, resulting in the formation of LDHs [1-4]. It is interesting that the mixed oxides derived from LDHs have a large surface area, high metal dispersion, and acid-base and redox properties. LDHs are widely used as catalyst precursors, drugs, ion exchangers, adsorbents, etc [5-7].

|| 1 Liaoning Key Laboratory for Fabrication and Application of Super-fine Inorganic Powders, Dalian Jiaotong University, Dalian, China, E-mail: [email protected] 2 Liaoning Key Laboratory for Fabrication and Application of Super-fine Inorganic Powders, Dalian Jiaotong University, Dalian, China, E-mail: [email protected] 3 Liaoning Key Laboratory for Fabrication and Application of Super-fine Inorganic Powders, Dalian Jiaotong University, Dalian, China, E-mail: [email protected] 4 Liaoning Key Laboratory for Fabrication and Application of Super-fine Inorganic Powders, Dalian Jiaotong University, Dalian, China, E-mail: [email protected] 10.1515/9783110516623-014 DOI 10.1515/9783110303568-014

138 | Hong-Bo Yu, Hui-Ru Liu, Gui-Lin Liu and Hong Gao At present, there are several approaches to synthesize LDHs, such as coprecipitation [8], hydrothermal [9], ion exchange [10], rehydration [11], and sol-gel processing [12]. The most widely used process for LDHs synthesis is co-precipitation of M2+ and M3+ cations from salts solutions by an alkaline reagent at controlled pH value of the solution. A major drawback to this process is that its product has the form of a difficult to filter fine-particle, poorly crystallized, gel-like material. To remove the mother solution from such materials by washing, a large amount of water is needed. This process can increase the particle size and improve the crystallinity. In other words, LDHs prepared through co-precipitation are subjected to an extra processing step: long-term aging in aqueous solutions at elevated temperatures, often under hydrothermal conditions [13]. So it is reasonable to search an efficient, selective and simple method for preparation of LDHs. Isupov [14, 15] proposed a new method to synthesize MgAl LDHs via mechanical activation of a mixture of magnesium hydroxide and hydrous aluminum salts (chloride, nitrate, and sulfate). Mechanical activation enables the preparation of well-crystallized MgAl LDHs and does not require large volumes of water and solution. Moreover, the resulting compounds are easy to filter off. Such environmentally friendly method belongs to a new applied chemistry field of “green chemistry” [16]. According to the comparison of co-precipitation and mechanochmistry, the mechanochemical method was used to synthesis the MgAl LDHs with magnesium hydroxide, aluminum hydroxide and sodium bicarbonate in this paper. The sodium bicarbonate can help to control the pH value. It is discussed that the mechanism of mechanochemical reactions in MgAl LDHs systems.

2 Experimental 2.1 Synthesis Analytically grade Mg (OH) 2, Al (OH) 3 and NaHCO3 were used for the synthesis of LDHs. The mixtures were mechanically activated in an AGO-II planetary mill with water-cooled drums at an acceleration of 20g. The grinding media was 8mm stainless steel ball, and the ball to powder weight ratio was 30:1. After grinding, the powder was saturated in deionized water at 90°C for 12h, then separated in centrifugal separator and dried in air at ambient temperature for 24h.

2.2 Characterization The phase compositions of the samples were determined by an X-ray diffraction (XRD) meter(D/max-3B, Rigaku, Japan) equipped with a graphite monochromator under Cu Kα radiation (λ=0.15406nm), operating at 40kV and 40mA over 2θ range

Mechanism of Mechanochemical Reactions Hydroxides Systems | 139

from 5 to 75 at a scanning rate of 3.6°/min. The microstructures of the samples were observed using a scanning electron microscope (SEM, JEOL JSM-6360LV, and Japan). The metal element analysis was determined by an energy dispersive spectroscopy (EDS, Oxford NCA).

3 Results and Discussion After grinding, the mixtures were investigated by XRD (showed in Fig.1). It can be found that LDHs was not prepared in the process of activation. With the increasing of grinding time, the intensity of the diffraction peaks is lower and broader. This indicated that the particle size of the mixture became smaller and smaller, and the lattice defect was increased. The diffraction peaks of Al (OH) 3 and NaHCO3 had disappeared/ however, the Mg (OH) 2 remains its structure.

*

Intensity(a.u.)

* o

++

*:Mg(OH)2 o:Al(OH)3

*

*

+:NaHCO3

0min

+

5min 10min 15min 20min 10

20

30

40

50

60

70

T e

Fig. 1: XRD patterns of MgAL LDHs sample with different grinding time.

After saturating in water at 90°C for 12h, a series of MgAl LDHs were synthesized. The Mg/Al molar ratio(R) was 2:1. The XRD patterns of these samples with different grinding time are shown in Fig.2. The diffraction peaks confirm the presence of hydrotalcite (JCPDS file 35-0964) with 3R packing of layers. The peaks close to 2θ=11°, 23° and 35° are sharp and intense, these can be ascribed to diffraction by basal planes (003), (006) and (012), respectively. The peaks close to 2θ=39°,47°,61°and 62° are broad and less intense, these can be ascribed to diffraction by basal planes(015),(018),(110) and (113), respectively. No other impurity reflections emerge in the XRD patterns of samples. It is well known that for the same

140 | Hong-Bo Yu, Hui-Ru Liu, Gui-Lin Liu and Hong Gao

(110) (113)

(015) (015)

(018)

(012)

(006)

(003)

crystal phase, the sharpness and intensity of XRD peaks are proportional to their crystallinity. As we can see from the Fig.2, there are not many differences while increasing grinding time. In other words, the grinding time is not the most important factor.

0min 5min 10min 15min 20min

10

20

30

40

50

60

70

©˄e˅

Fig. 2: XRD patterns of MgAL LDHs sample with different grinding time.

When the mixture was activated 15min, and then put into hot water (90°C). The XRD patterns of these samples with different saturating time are shown in Fig.3. Phase analysis shows that the crystallization of LDHs was improved with the increasing of saturating time, especially crystal face of (110). Crystal face of (110) indicates the distance of metal ions in the layer. On the other hand, the saturating temperature is not emphasis on the reaction. According to Fig.4, there was little difference in different saturating temperature.





Intensity(a.u.)





Mechanism of Mechanochemical Reactions Hydroxides Systems | 141

K 4h 8h 12h

10

20

30

40

50

60

70

© e





Intensity(a.u.)





Fig. 3: XRD patterns of MgAL LDHs sample with different saturating time.

ć ć ć ć

10

20

30

40

50

60

70

© e

Fig. 4: XRD patterns of MgAL LDHs sample with different saturating temperature.

In order to discuss the influence of Mg/Al molar ratio(R), MgAl LDHs were synthesized with different R values and the grinding time was 15 minutes. The XRD patterns are shown in Fig.5. Some XRD structural parameters and EDS results of the solid products are shown in Tab.1. All basal diffraction peaks of LDHs appeared, but they become broad and less intense. It reveals that the crystallinity of LDHs decreased. Meanwhile, all diffraction peaks shifted to lower angles. For example, the peak of basal (003) moved from 11.46° to 10.88° when R changed from 2 to 5. It indicated that the electrostatic attraction between the layers became weaker and the interlayer spacing became bigger and bigger. Because ionic radius of Mg2+ is bigger than Al3+, when Mg2+ was replaced by Al3+ at lattice, charge density of the layers

142 | Hong-Bo Yu, Hui-Ru Liu, Gui-Lin Liu and Hong Gao

(110)

(009)

Intensity(a.u.)

(006)

(003)

increased. With the increasing of R values, less Al3+ can come into layer and make the interaction force between layers decreased. The EDS results indicated that R values in samples are higher than feed ratios. This means that a few of Al3+ are not involved in the solid reaction. It depended on the mechanism of LDHs formation. According to the SEM photographs in Fig.6, the synthesized samples consist of platelets and the platelets overlap each other such as a flower. With the increase of R values, the particle size became bigger and the particle agglomeration became serious.

5:1 4:1 3:1 2:1

10

20

30

40

50

60

70

©˄e˅

Fig. 5: XRD patterns of LDHs with Variable Mg/Al molar ratios. Table 1: XRD Structural Parameters and EDS Results of LDHs with Variable Mg/Al Molar Ratios 2:1

3:1

4:1

5:1

d003/nm

0.772

0.787

0.809

0.812

d110/nm

0.153

0.153

0.154

0.154

Lattice parameter c/nm

2.313

2.359

2.429

2.437

Lattice parameter a/nm

0.306

0.306

0.308

0.308

R(Mg/Al molar ratio)

2.19

3.15

4.30

5.57

Mechanism of Mechanochemical Reactions Hydroxides Systems | 143

Fig. 6: SEM images of the samples with different R values

The formation of crystal LDHs was investigated by mechanochemical method, using magnesium hydroxide, aluminum hydroxide and sodium bicarbonate. The synthetic process of the LDHs by mechanochemical method includes two processes. The first stage is the activation and the second stage is the diffusion. In the first stage, mechanochemical activation involves the increase of internal and surface energy, surface area and decrease of the coherence energy of solids [17, 18]. These may lead to spontaneous aggregation, adsorption, or recrystallization in the activated system. In the second stage, the diffusion leads to isomorphously substitute between Mg2+ ions and Al3+ ions in hot water. Four routes of activation were investigated for the mechanism of mechanochemical method the mole ratio of Mg/Al/HCO3 was 2:1:0.5. Different mixtures were activated in different routes: (1) activated Mg (OH) 2, Al (OH) 3 and NaHCO3; (2) activated Mg (OH) 2 and Al (OH) 3; (3) activated Mg (OH) 2 and NaHCO3; (4) activated Al (OH) 3 and NaHCO3. The mixtures were milled 5 minutes then added the third component in accordance with mole ratio. After that the powders were put into hot water for 12h with stirring. The samples were dried in air at ambient temperature for 24h. The XRD spectrums of different samples with different routes were shown in

144 | Hong-Bo Yu, Hui-Ru Liu, Gui-Lin Liu and Hong Gao Fig.7. It can be seen from Fig.4 that LDHs could be observed in the compositions of the synthesized samples. In route (1), there was only crystal LDHs and no other impurity phase. In route (2), there were LDHs and Al (OH) 3. In route (3), there were more phases including LDHs, Mg (OH) 2 and Al (OH) 3. In route (4), there were LDHs and Mg (OH) 2, and Mg (OH) 2 became the principal crystalline phase. Although they can synthesize LDHs by route (2) (3) (4), but crystallinity and orderliness of LDHs became worse. Comparing with the four patterns of XRD, it can be found that the activation of Mg (OH) 2 probably played a critical role in the formation of LDH.

1000

path 1

ƽ

ƽ

2500

˖LDHs

path 2

ƽ

: LDHs Al(OH)3

ƽ

ƹ:

2000 Intensity(a.u.)

Intensity(a.u.)

800 600 400

ƽ ƽ

1500 ƽ

ƽ

1000 ƽ

200

ƽƽ ƽ

ƽ

500

ƽ

0

ƹ

ƽƽ

ƹ

0 20

30

40

50

60

70

10

20

30

© e

40



10

50

60

70

T °

3500

path 3

ƽ

1200

Ʒ:

Mg(OH)2

ƹ:

Al(OH)3

Ʒ

ƽ

800

ƽ

Ʒ ƹ

400

ƹ

2500

ƽ:

LDHs

Ʒ:

Mg(OH)2

ƽ Ʒ

2000 1500

ƽ

ƽ Ʒ

1000

ƽ ƹ

ƹ

Path 4 Ʒ

3000

: LDHs

ƽ

Intensity(a.u.)

Intensity(a.u.)

1600

Ʒ

ƽƽ

500 0

0 10

20

30

40

50

60

70

2T °

Fig. 7: XRD patterns of different activated routes.

10

20

30

40 2T °

50

60

70

Mechanism of Mechanochemical Reactions Hydroxides Systems | 145

Fig. 8: The diagram showing the process of formation of MgAl LDHs.

After grinding, the magnesium hydroxide became amorphous and many structural defects appeared such as vacancy [19]. When the powders were put into hot water, the diffusion began between solid phases in the water. The solubility product of Mg (OH) 2 is smaller than Al (OH) 3, So Mg (OH) 2 is the diffusion media and Al (OH) 3 is the diffusion matter. During this period, the ions of Al3+ came into diffusion media and produced MgAl LDHs. The ions of Al3+ substituted Mg2+ and went into octahedral sites and made the layers carry positive charges. The Anions of CO32went into the layer spaces and balanced charges. This diffusion process follows the principle of thermal diffusion and vacancy mechanism. The diffusion layers have characteristics of randomness, irregularity and self-similarity. In addition, the activation can produced elastic stress. Stress relaxation may improve the speed of diffusion. Sodium bicarbonate is a mild base, and the dissociation degree of Al3+ decrease in this solution. So the R was higher than feed ratio. Based on the above reasons, the diagram illustrating the process of formation of MgAl LDHs is shown in Fig.8. During the period of diffusion, some small flake particles inserted each other and formed flower-like particles.

4 Conclusions Uniform MgAl LDHs can be synthesized through the mechanochemical method, using magnesium hydroxide and aluminum hydroxide. The R values (Mg/Al mole ratio) of samples are higher than feed ratios. This approach includes two processes, activation and diffusion. The activation involves the increase of internal and surface energy, increase of surface area, and decrease of the coherence energy of solids. The activation of magnesium hydroxide is the most important. After activation, the powder was saturated in deionized water at 90°C for 12h. The solid reaction is needed under such conditions. The diffusion leaded to isomorphously substituted between Mg2+ ions and Al3+ ions in hot water and synthesized the MgAl LDHs. Mg(OH)2

146 | Hong-Bo Yu, Hui-Ru Liu, Gui-Lin Liu and Hong Gao is the diffusion media and Al(OH)3 is the diffusion matter. This diffusion process follows the principle of thermal diffusion and vacancy mechanism. Acknowledgement: This study was supported by the Liaoning department of education scientific research project (No.L2015102).

References [1]

[2] [3]

[4] [5]

[6]

[7]

[8]

[9] [10]

[11]

[12]

[13]

[14]

H.-W.Olfs, L.O.Torres-Dorante, R.Eckelt, and et al., Comparison of different synthesis routes for Mg–Al layered double hydroxides (LDH): Characterization of the structural phases and anion exchange properties, Applied Clay Science, 2009, 43(3-4): 459-464. NobuoIyi, Takayoshi Sasaki, Deintercalation of carbonate ions and anion exchange of an Alrich Mg-Al-LDH (layered double hydroxide), Applied Clay Science, 2008, 42(1-2): 246-251. F.Delorme, A.Seron, M.Bizi, et al., Effect of time on the reconstruction of the Mg4Al2 (OH) 12CO3•3H2O layered double hydroxide in a Na2CO3 solution, Journal Material Science, 2006, 41:4876-4882. Feng Li, Xue Duan, Applications of Layered Double Hydroxides, Structure Bond, 2006, 119: 193-223. Yan-Jun Lin, Dian-Qing Li, David G. Evans, et al., Modulating effect of Mg-Al-CO3 layered double hydroxides on the thermal stability of PVC resin, Polymer Degradation and Stability, 2005, 88(2): 286-293. Matilte Halma, Kelly Aparecida Dias de Freitas Castro, Vanessa Prévot, et al., Immobilization of anionic iron(III) porphyrins into ordered macroporous layered double hydroxides and investigation of catalytic activity in oxidation reactions, Journal of Molecular Catalysis A: Chemical, 30 May 2009. Linyan Zhang, Yanjun Lin, Zhenjun Tuo, et al., Synthesis and UV absorption properties of 5sulfosalicylate-intercalated Zn–Al layered double hydroxides, Journal of Solid State Chemistry, 2007, 180(4): 1230-1235. Toshiyuki Hibino, Hitoshi Ohya, Synthesis of crystalline layered double hydroxidesPrecipitation by using urea hydrolysis and subsequent hydrothermal reactions in aqueous solutions. Applied Clay Science, 2009, (4):578-583. Pausch I., Lohse H.H., Schurmann K., Allmann R., Synthesis of discordered and Al-rich hydrotalcite-like compounds, Clay Miner, 1986,34(5):507-510. Lianying Wang, Cang Li, Miao Liu, et al., Large continuous, transparent and oriented selfsupporting films of layered double hydroxides with tunable chemical composition, Chemical. Communication. 2007, 123-125. B. M. Choudary, B. Bharathi, Ch. Venkat Reddy, et al., Tungstate-exchanged Mg-Al-LDH catalyst: an eco-compatible route for the oxidation of sulfides in aqueous medium, Journal of Chemical. Society. 2002, (1):2069-2074. M. Nayak, T. R. N. Kutty, V. Jayaraman, et al., Preparation of the layered double hydroxide (LDH) LiAl2 (OH) 7·2H2O, by gel to crystallite conversion and a hydrothermal method, and its conversion to lithium aluminates, Journal of Material. Chemistry, 1997, 7(10):2131-2137. A V Radha, P Vishnu Kamath. Aging of trivalent metal hydroxide/oxide gels in divalent metal salt solutions: Mechanism of formation of layered double hydroxides (LDHs). Bulletin Material. Science. 2003,26,661-666. V.P. Isupov, L. E. Chupakhina, and R. P. Mitrofanova, Mechanochemical synthesis of double hydroxides, Journal of Materials Synthesis and Processing. 2000, 8,251-253.

Mechanism of Mechanochemical Reactions Hydroxides Systems | 147 [15] [16]

[17] [18] [19]

V.P. Khusnutdinov and V.P. Isupov. Mechanochemical synthesis of a hydroxycarbonate form of layered magnesium aluminum hydroxides. Inorganic Materials.2008. 44(3), 263-267. Xiaoqing Zhang, Fenglin Qi and Shuping Li et.al. A mechanochemical approach to get stunningly.uniform particles of magnesium-aluminum-layered double hydroxides. Applied Surface Science.2012, 259,245-251. E.V.Bogatyreva, A.G.Ermilov. Energy stored in mineral raw materials during mechanical activation. Inorganic Materials. 2008, 44(2):197-202. R.K. Allada, A. Navrotsky, H.T. Berbeco, et,al. Thermochemistry and Aqueous Solubilities of Hydrotalcite-Like Solids. Science. 2002,296:721-723. Samayamutthirian Palaniandy, Khairun Azizi Mohd Azizli. Mechanochemical effects on talc during fine grinding process in jet mill. Int.J.Miner.Process. 2009,92,22

Tao Wang1, Song-Quan Zhang2, Chun-Lei Jiang3 and Yong-Bing Tang4*

Deposition of Diamond Films on Complex Cutting Tools by Hot-Filament Chemical Vapor Deposition Abstract: Diamond films were deposited on cemented carbide cutting inserts and end mills by hot-filament chemical vapor deposition. The morphology of the diamond film surface was controlled by adjusting the substrate temperature and the gas concentration. The film adhesion strength was enhanced by applying lower substrate temperatures. With increase of methane gas concentration from 2% to 5%, the diamond grain size decreased from 1 μm to 200 nm, and the diamond film adhesion was improved. Furthermore, diamond films were homogenously and densely deposited on end mills by carefully manipulating the position of filaments and substrates. These results suggest that this technique is helpful for coating tools with complex shape in the industrial applications. Keywords: diamond film; cutting tool; hot filament chemical vapor deposition; adhesion; cemented carbide

1 Introduction Diamond, a famous gemstone, is the hardest material ever known. Its hardness in combination with other outstanding properties such as high stiffness, high wear resistance, high thermal conductivity, semi-conductivity, and chemical inertness, makes diamond an excellent material for a variety of applications, such as protective coatings, heat spreader, optical windows and biological platforms, and so forth. [1-4] The synthesis of diamond in general and approaches via chemical vapor deposition (CVD) based techniques in specific have been a research focus for many decades. [5, 6] Nonetheless, diamond proved challenging in many aspects and up to

|| 1 Functional Thin Films Research Center, Shenzhen Institutes of Advanced Technology, Chinese Academy of Sciences, Shenzhen 518055, China, e-mail: [email protected] 2 Functional Thin Films Research Center, Shenzhen Institutes of Advanced Technology, Chinese Academy of Sciences, Shenzhen 518055, China, e-mail: [email protected] 3 Functional Thin Films Research Center, Shenzhen Institutes of Advanced Technology, Chinese Academy of Sciences, Shenzhen 518055, China, e-mail: [email protected] 4 Functional Thin Films Research Center, Shenzhen Institutes of Advanced Technology, Chinese Academy of Sciences, Shenzhen 518055, China, e-mail: [email protected] 10.1515/9783110516623-015 DOI 10.1515/9783110303568-015

150 | Tao Wang, Song-Quan Zhang, Chun-Lei Jiang and Yong-Bing Tang date several issues in CVD diamond synthesis remain rather unsatisfactorily answered or even unsolved. For the application in high performance Micro and Nano Electro-Mechanical System, carbide tools in micro size with sharp cutting edge are highly needed. Diamond can be coated on cemented carbide tools to improve the machining performance. However, it has been proven difficult to deposit continuous and adherent diamond films on a WC-Co substrate due to strong catalytic effect cobalt, which promote the formation of graphite at the substrate interface. [2] Moreover, it is also difficult deposit continuous diamond films on cutting tools with complex shape.[7-9] In this paper, diamond films were deposited on cutting inserts and end mills by controlling the substrate temperature and the gas concentration.

2 Experiment The diamond films were synthesized by hot-filament chemical vapor deposition (HFCVD). Cemented carbide (WC-6 wt. % Co) inserts (SPCW120416-GA0115) and end mills (UA100-S2-03009) were provided by Xiamen Golden Egert Special Alloy Corporation. Before deposition, the cutting tools were pre-treated. The binder phase Co in the cemented carbide catalyzes the formation of graphite at the reaction surface at the CVD diamond deposition conditions. To prevent this disadvantage during the deposition process, the polished substrates were chemically treated prior to the seeding procedure. The most practiced method is to etch the sample in Murakami solution (10 g K3(Fe(CN)6), potassium ferricyanide + 10 g KOH, potassium hydroxide + 100 mL H2O) followed by a Caro’s acid solution (10 ml 98% H2SO4, sulphuric acid, + 100ml 33% H2O2, hydrogen peroxide). The substrates were dipped into the Murakami solution for 10 min followed by ultrasonically cleaning in distilled water. Afterwards, the substrates were immersed in the Caro’s acid solution for 30 s followed by ultrasonically cleaning in distilled water, acetone and ethanol. Subsequently, the surface underwent the diamond seeding procedure. The samples were immersed into the diamond colloid dispersion (0.05 wt. %) ultrasonically for 30 minutes. Finally, the samples were removed from the dispersion, rinsed in distilled water, and then dried with flowing N2. The detailed deposition parameters are summarized in Table 1. The substrate temperature was controlled by adjusting the water flow rate in cooling system and the distance between filaments and substrate. The reactive gases are H2 and CH4. The flow rate of H2 was maintained at 800 sccm. Tantalum wires are chosen as hot filaments in a diameter of 0.5 mm. nine filaments were parallelly installed above the sample, and were kept straight in deposition process. The distance between filaments was 8 mm for inserts (sample A1-C1), but 16 mm for end mills (sample C2) which was perpendicular to the filaments. For sample C2, the distance between filaments and the tip of mills is around 10 mm. For inserts A1, A2 and A3, only the substrate temperature and the distance between filaments and sub-

Deposition of Diamond Films Hot-Filament Chemical Vapor Deposition | 151

strate were different. For inserts B1, B2 and B3, only the concentration of CH4 was different. The thickness of all films ranges from 2 μm to 3 μm. The film adhesion was evaluated by Rockwell C indentation by a load of 150 kgf. Raman scattering (LAabRam HR Visibie Raman Microscope) was carried out to identify diamond and non-diamond phases by utilizing a laser wavelength of 532 nm. Table 1: Diamond Films Deposited On Cemented Carbied with Different Parameters. Sample No.

Deposition Parameters Substrate Temper- Filaments – ature Substrate Distance

Filament Temperature

CH4%

Pressure

A1

900°C±20°C

7 mm

2800°C±50°C

2%

4 kPa

A2

850°C±20°C

7 mm

2800°C±50°C

2%

4 kPa

A3

800°C±20°C

9 mm

2800°C±50°C

2%

4 kPa

B1

820°C±20°C

9 mm

2800°C±50°C

2%

4 kPa

B2

820°C±20°C

9 mm

2800°C±50°C

3%

4 kPa

B3

820°C±20°C

9 mm

2800°C±50°C

4%

4 kPa

C1

820°C±20°C

9 mm

2800°C±50°C

5%

4kPa

C2

-

10 mm

2800°C±50°C

2%

4kPa

3 Results and Discussion Diamond films were at first deposited on indexable cutting inserts. The effects of substrates temperature and gas concentration on the morphology and adhesion of diamond films were investigated. Further, the diamond films were coated on end mills with carefully manipulating the position of filaments and the tool. Figure 1 (a-c) shows the surface morphology of diamond coated cutting inserts with different substrate temperature. The substrate temperature was adjusted by changing the flow rate of cooling water in the substrate holder, and the distance between filaments and substrate. Comparing sample A1 and A2, the diamond grain size becomes larger with higher substrate temperature (from 850 °C to 900 °C). Figure 2 shows the high diamond quality of sample A1 with a sharp peak at around 1335 cm-1, which corresponds to the first-order Raman mode of natural diamond [10]. The peak position is shifted from the peak position at 1332 cm-1 to that at 1335 cm-1 due to the internal stress in the film. Figure 1(d-f) shows the SEM images of indentation craters on the diamond films after the Rockwell C indentation tests. It is clearly observable that the diamond film deposited with high temperature (900 °C) exhibits a

152 | Tao Wang, Song-Quan Zhang, Chun-Lei Jiang and Yong-Bing Tang large area of coating delamination after indentation. The peeled area is much smaller in the case of the film deposited with lower temperature (850 °C). Furthermore, with decreasing the distance between filaments and substrate, the substrate temperature decreased from 850 °C to 800 °C. Figure 1f shows also small peeled area, indicating similar adhesion strength between diamond films deposited with 850 °C and 800 °C.

Fig. 1: SEM surface morphology images of diamond films deposited on cemented carbide inserts (ac) with different substrate temperatures (900°C, 850°C and 800°C) and the corresponding Rockwell C indentation tests (d-f).

Fig. 2: Raman spectrum of diamond film coated on cutting inserts (sample A1).

Deposition of Diamond Films Hot-Filament Chemical Vapor Deposition | 153

Figure 3 (a-c) shows the surface morphology of diamond coated cutting inserts with different methane gas concentration (CH4%). The diamond grain size of coated films is 1 μm, 0.6 μm and 0.2 μm, corresponding to the CH4% of 2%, 3% and 4%, respectively. With increasing CH4%, the diamond grain size decreased. Figure 3 (d-f) shows SEM images of indentation craters on the diamond films after the Rockwell C indentation tests. It is obviously that the diamond film deposited with 2% CH4 exhibits a large area of coating delamination, while the diamond films deposited with 3% and 4% CH4 show nearly no delamination around the crater. Accordingly, the diamond film adhesion became better with increasing CH4% in the gas phase. The improved adhesion of sub-micro sized diamond crystalline can be attributed to smaller holes between crystals than that of micro-sized diamond crystals on the film-substrate interface. Moreover, Figure 4 shows the morphology of the diamond film deposited with 5% CH4 in the gas phase. As shown in Figure 4a, the surface of the insert is homogenously covered by diamond films. Figure 4b shows the SEM image of the coated cutting edge. All the cutting edges are coated by dense submicrocrystalline diamond film.

Fig. 3: SEM surface morphology images of diamond films deposited on cemented carbide inserts (ac) with different CH4 concentrations (2%, 3% and 4%) and the corresponding Rockwell C indentation tests (d-f)

154 | Tao Wang, Song-Quan Zhang, Chun-Lei Jiang and Yong-Bing Tang

Fig. 4: (a) Photograph of diamond coated insert (Sample C1). (b) SEM surface morphology images of coated cutting edge. Insert shows high magnification SEM image of the coated cutting edge.

Furthermore, diamond films were coated on end mills with 2% CH4 concentration in the gas phase. However, the substrate temperature was too high for the end mill, which results in graphite deposition on the tip of the tool. In the case of end mills, the position of filaments and substrates should be different like that of flat insert. The distance between filaments was changed from 8 mm to 16 mm. As shown in Figure 5, all the cutting edge surfaces were coated by diamond films. No film delamination was found on the coated tool. Figure 5 (a-d) shows SEM surface morphology of diamond coating at different positions. The surface of the cutting edge on the top of the tip is shown in Figure 5a. Diamond film was densely coated on the cutting edge. Figure 5b and 5c shows also homogenously coated diamond film on the other side. For the position far from the tip, the morphology is different than that before (see Figure 5d). Diamond clusters appears due to lower substrate surface temperature.

Deposition of Diamond Films Hot-Filament Chemical Vapor Deposition | 155

Fig. 5: (a) Photograph of diamond coated end mill (Sample C2, middle). (b) to (d) show SEM morphology images of coated surfaces. Insert shows high magnification SEM image of the diamond coated surface.

4 Conclusions Diamond films were successfully deposited on cutting inserts and end mills by hot filament chemical vapor deposition. Decreasing substrate temperature from 900 °C to 800 °C, the diamond grain size decreased and the film adhesion was enhanced. With increase of CH4% from 2% to 4%, the diamond grain size decreased from 1 μm to 200 nm. The diamond film adhesion was improved by applying crystalline with smaller size. By carefully manipulating the position of filaments and substrates, diamond films were homogenously and densely deposited on end mills. These results suggest that this technique can be utilized for coating tools with complex shape. Acknowledgement: This work was supported by Shenzhen Municipality Project (JCYJ20150630114942259), Shenzhen Municipality Science and Technology Planning Project (JSGG20160229202951528, KQJSCX20160301145319,JCYJ20160122143847150), Scientific Equipment Project of Chinese Academy of Sciences (yz201440), Science

156 | Tao Wang, Song-Quan Zhang, Chun-Lei Jiang and Yong-Bing Tang and Technology Planning Project of Guangdong Province (Nos. 2014A010105032, 2014A010106016), and Guangdong Innovative and Entrepreneurial Research Team Program (No. 2013C090).

References [1]

[2]

[3]

[4]

[5] [6]

[7]

[8] [9]

[10]

Strakowska P, Beutner R, Gnyba M, Zielinski A, Scharnweber D. Electrochemically assisted deposition of hydroxyapatite on Ti6Al4V substrates covered by CVD diamond films-Coating characterization and first cell biological results. Materials Science and Engineering C 2016; 59:624-35. Hei H, Ma J, Li X, Yu S, Tang B, Shen Y, et al. Preparation and performance of chemical vapor deposition diamond coatings synthesized onto the cemented carbide micro-end mills with a SiC interlayer. Surf & Coat Tech 2015; 261:272-7. Anaya J, Rossi S, Alomari M, Kohn E, Toth L, Pecz B, et al. Control of the in-plane thermal conductivity of ultra-thin nanocrystalline diamond films through the grain and grain boundary properties. Acta Materialia 2016; 103:141-52. Liu S, Liu J, Li C, Guo J, Chen L, Wei J, et al. The mechanical enhancement of chemical vapor deposited diamond film by plasma low-pressure/high-temperature treatment. Carbon 2013; 65:365-70. Buijnsters JG, Celis J, Hendrikx RWA, Vazques L. Metallic seed nanolayers for enhanced nucleation of nanocrystalline diamond thin films. 2013. Baudrillart B, Benedic F, Brinza O, Bieber T, Chauveau T, Achard J, et al. Microstructure and growth kinetics of nanocrystalline diamond films deposited in large area/low temperature distributed antenna array microwave-plasma reactor. physica status solidi a 2015;212:2611-5. Lei X, Shen B, Cheng L, Sun F, Chen M. Influence of pretreatment and deposition parameters on the properties and cutting performance of NCD coated PCB micro drills. Int J Refract Met Hard Mater 2014; 43:30-41. Optimization of diamond coated microdrills in aluminum alloy 7075 maching: A case study. Diamond Relat Mater X. LeiB. Shen, F. Sun; 5:479-502. Bouzakisa K-D, Skordarisa G, Bouzakisc E, Charalampousa P, Kotsanisa T, Tasoulasa D, et al. Effect of the interface fatigue strength of NCD coated hardmetal inserts on their cutting performance in milling. Diamond Relat Mater 2015; 59:80-9. R. E. Shroder, R. J. Nemanich, Glass JT. Analysis of the composite structures in diamond thin films by Raman spectroscopy. Phys Rev B 1990; 41:3738-45.

Li-Na Guo1, Shuang Liu2, Tian-Yu Wang3 and Xiao-Chuan Tan4

The Crystal Unit Model of CsI(Tl) Film with Hexagon Microcolumns and Its Conversion Factor to X-Ray Abstract: In this paper, we modeled the crystal unit of CsI(Tl) film with hexagon columnar crystallites which corresponds to the CCD photosensitive cell. Image point structure of excited point for the fluorescence transmittance was proposed. The conversion factor of CsI(Tl) crystal unit to x-ray was studied. Calculated results show that with different thickness, the maximum conversion factor can be obtained by choosing an appropriate incident energy for the CsI(Tl) film. For the film with a given thickness, the smaller grain diameter is beneficial to achieve a higher conversion factor. Keywords: X-ray detection; Integrated directly; CsI (Tl) film; fluorescence transmission efficient

1 Introduction CsI (Tl) scintillation films are widely applied as the x-ray convertors because of high scintillation efficiency for X-ray radiation, good match with spectral sensitivity of Sibased readout arrays and its particular ability to grow with hexagon columnar crystallites by vacuum thermal evaporation [1-7]. It is been a long time since the CsI (Tl) scintillation crystal is used in non-destructive evaluation, high-speed X-ray imaging, macromolecular crystallography and digital mammography [8-10]. There are a few of literature about the fluorescence transmittance and conversion factor of CsI (Tl) layers [11, 12]. Particularly, study on the fluorescence transmittance of the CsI (Tl) || 1 School of Optoelectronic Information, State Key Laboratory of Electronic Thin Films and Integrated Devices, University of Electronic Science and Technology of China, Chengdu, China, [email protected] 2 School of Optoelectronic Information, State Key Laboratory of Electronic Thin Films and Integrated Devices, University of Electronic Science and Technology of China, Chengdu, China, [email protected] 3 School of Optoelectronic Information, State Key Laboratory of Electronic Thin Films and Integrated Devices, University of Electronic Science and Technology of China, Chengdu, China, [email protected] 4 School of Optoelectronic Information, State Key Laboratory of Electronic Thin Films and Integrated Devices, University of Electronic Science and Technology of China, Chengdu, China, [email protected] 10.1515/9783110516623-016 DOI 10.1515/9783110303568-016

158 | Li-Na Guo, Shuang Liu, Tian-Yu Wang and Xiao-Chuan Tan films with hexagon columnar crystallites is very limited. In this paper, the crystal unit of CsI (Tl) film with hexagon columnar crystallites is modeled. The image point structure of excitation point is proposed to study the fluorescence transmittance based on the crystal unit model. The conversion factor of CsI (Tl) crystal unit to x-ray is calculated. The impacts of the parameters of crystal unit and the x-ray incident energy on the conversion factor also are studied.

2 Crystal Unit Structure Modeling 2.1 CsI(Tl) Crystalline Unit with Hexagon Columnar Crystallites As the fluorescence tends to emit in an isotropic fashion in CsI (Tl) scintillation crystal [13], the transverse diffusion of fluorescence in bulk scintillation crystal is very severe resulting in the signal crosstalk between adjacent photosensitive cells. This directly impacts the imaging resolution of the radio imaging system. While dividing the CsI (Tl) layer into numerous small units in accordance with the photosensitive cell size can effectively reduce the crosstalk. Taking into account the highly reflectivity of aluminum (ideal value is about 0.9), we use Al film as the reflecting layer to wrap the CsI (Tl) crystal unit [14, 15]. It’s only that it will cause reflection loss when fluorescence reflects on the Al reflecting layer. In addition, CsI (Tl) film has the ability to grow in a micro-columnar structure by vacuum thermal evaporation, especially the hexagon columnar crystallites under certain deposition conditions [16-18]. Therefore the divided CsI (Tl) crystal units with hexagon columnar crystallites would be more effective to prevent the transverse diffusion of the fluorescence. In Figure 1, we model the crystal unit of CsI (Tl) film with hexagon columnar crystallites and wrapped with the Al reflecting layer. As shown, the length, width and height of CsI (Tl) crystal unit are A, A and L respectively and the diameter of hexagon columnar crystallite is D. The role of the anti-reflective coating on the surface of photosensitive cell is to reduce the reflection loss of fluorescence from the emergent surface and improve the transmittance of CsI (Tl) film.

The Crystal Unit Model and Its Conversion Factor to X-Ray | 159

Fig. 1: The cross-section view and side-section view crystal unit model of CsI (Tl) film with hexagon columnar crystallites corresponding to the photosensitive cell of CCD.

2.2 CsI(Tl) Crystalline Unit with no Column

Fig. 2: The side-section view of CsI (Tl) crystal unit model with non-columns and the transmission types of fluorescence.

160 | Li-Na Guo, Shuang Liu, Tian-Yu Wang and Xiao-Chuan Tan

Fig. 3: The Cartesian coordinate based on the CsI (Tl) crystal unit model with non-columns

In order to study the fluorescence propagation in the Csi (Tl) crystal unit shown in Figure 1, we start with the assumption of the CsI (Tl) crystal unit model with no columnar crystallites as shown in Figure 2. This unit is wrapped with the Al reflective layer and the length, width and height are A, A and L respectively. In Figure 3, the Cartesian coordinate is established, in which the origin O is the center of photosensitive cell, x and y axis are parallel to the vertical edges of crystal unit and z axis is perpendicular to the surface of crystalline unit. To simplify the calculation, the monochromatic x-ray is taken as the incident ray and vertically incident along with z axis. The emission point of fluorescence P(x0 , y0 , z0 ) is random. As the thickness of CsI(Tl) layer is z L , the incident depth of X-ray is z X L -z0 . Then the X-ray energy EZ at the point P(x0 , y0 , z0 ) can be given by

Ez

E0 e - P X ( L - z ) .

(1)

where E0 is the energy of incident X-ray, PX is the linear attenuation coefficient of xray in CsI (Tl) layer. In the thickness element dz , the probability of the absorbed x-ray energy

f z ( z )dz

P pe dEz / E0 PX

P pe e- P

X

( L- z )

dz .

(2)

where P pe is the linear photoelectric conversion coefficient of x-ray in CsI(Tl) layer. In the angle element T ~ T +dT , the probability of fluorescence is

The Crystal Unit Model and Its Conversion Factor to X-Ray | 161

fT (T )dT

1 sin T dT ˄ , 0 d T d S ˅. 2

(3)

where T is the included angle between the fluorescence and the incident direction of x-ray. According to the fluorescence transmission path in the crystal unit, it is classified into three categories: light a transfer to the receiving surface directly, light b is only reflected by the side surface before emitting to the receiving surface and light c is reflected once by the incident surface before emitting to the receiving surface. The density of Al reflective layer is 2.7 g/cm3 less than the density of CsI (4.51 g/cm3), so some fluorescence will be total reflected by the Al layer. The fluorescence loss is relatively large as the included angle between the fluorescence and the incident direction of x-ray is less than the total reflection angle is arcsin2.7/4.51, so we can ignore this part of fluorescence to simplify calculation. For light a, the transmission function f(z,T ) can be given by

f ( z ,T ) e- riV

-

z

V

e cosT ,(0 d T d arctan

A . 2z

(4)

where ri is the transmission distance of light a, V is the linear absorption coefficient of CsI(Tl) material. To study the transmission distance of light b, the image point structure of excitation point P(x0 , y0 , z0 ) is established in Figure 4. The image points Pi of the excited point P(x0 , y0 , z0 ) of light b are at the plane z = z0 and the subscript i represents the reflective numbers on the Al layer. This can be explained by the fact that the transmission distance of light b is the distance between the image point Pi and the exit point. Then the transmission function of light b is

f ( z,T , M ) RAl Nb e riV ˄arctan

RAl

2 z cosM z V 1  cosT A cosT

e

 ,

A S 2.7  T d  arcsin ˅. 2z 2 4.51

where RAl is the reflection coefficient, N b is the reflection number of light b and is the included angle between the excited plane and x axis.

(5)

M

162 | Li-Na Guo, Shuang Liu, Tian-Yu Wang and Xiao-Chuan Tan

Fig. 4: The image point structure of excited point P of light b in CsI (Tl) crystal unit model with noncolumns.

For light c shown in Figure 5, a portion is reflected by the incident surface first like light 1 and light 2, another portion is reflected by the side surface and then reflected by the incident surface before emitting to the receiving surface like light 3. The distance of those lights whose images point is at the plane z 2 L - z0 is similar as the light b. Moreover, light 3 has two image points at the plane z L . The transmission distance of light 3 is the sum of the distance between excited point P(x0 , y0 , z0 ) and one image and the distance between the other image point and emergent point. However, we found that the sequence of the reflection on the incident surface has no influence on the transmission distance of the fluorescence. So the transfer function of light c can be given by

Fig. 5: The image point structure of excited point P of light c in CsI (Tl) crystal unit model with noncolumns.

The Crystal Unit Model and Its Conversion Factor to X-Ray | 163

Nc - riV

f ( z,T , M ) RAl e

˄S - arcsin

RAl

-2(2 L- z ) cosM 2 L- z -2 V cosT , AcosT

e

2.7 d T d S˅. 4.51

(6)

where N c is the reflection number of light c. Then the transmittance T(L, A,V ,R Al ) and conversion factor K ( L, A, V , RAl ) of the fluorescence are

T ( L, A, V , RAl ) L

³ 0

2S

f z ( z )dz ³ 0

S

1 dM fT (T ) f ( z,T , M )dT . 2S ³0

K ( L, A, V , RAl )

E0 T ( L, A, V , RAl ). W

(7)

(8)

where W is the energy of x-ray exciting every fluorescence photon (about 20 eV).

2.3 CsI(Tl) Crystalline Unit with Hexagon Columns

Fig. 6: The CsI (Tl) crystal unit model with one hexagon column. (a) the cross-section view, (b) the side-section view.

Then, we assume that there is only one ideal hexagon columnar crystallite in the CsI (Tl) crystalline unit which is modeled in Figure 6. The grain diameter is D and the relation between D and side length value of photosensitive cell A is D 3 / 2 A . The ĉ region of the crystal model in Figure 6 is the cross section area of the columnar crystallite which is the effective emergent area of fluorescence. The proportion of effective emergent area relative to the photosensitive cell area can be given by

164 | Li-Na Guo, Shuang Liu, Tian-Yu Wang and Xiao-Chuan Tan

KS

3D2 / 2 A2 . The Cartesian coordinate based on the hexagon columnar crystal-

lite model is established in Figure 7, in which the origin O is the center of photosensitive cell, x axis is along the direction of grain diameter and z axis is perpendicular to the surface of crystal unit. This model is similar as the crystal unit model with non-columns except for the side surfaces are crystal boundaries. So the transfer function of light b and light c should be modified. Then the fluorescence transfer function of the model with one hexagon column can be given by z V ­ -riV A e cosT ˄0 d T d arctan ˅ °e 2z ° °° 3z cosM - 3 - z V A 1 S f ( z,T ,M ) ® Rb D cosT 2 e cosT ˄arctan  T d - arcsin ˅. 2z 2 4.51 ° 3(2 ) cos M L z 5 2 L z ° - V 2.7 2 e cosT ° RAl Rb D cosT ˄S - arcsin d T d S˅ 4.51 °¯

(9)

The transmittance T ( L, A, V , R Al , Rb ) and conversion factor K ( L, A, V , RAl , Rb ) of the fluorescence in the crystalline unit with hexagon columnar crystallite can be given by

T ( L, A, D, V , RAl , Rb ) 2S S L º 3 D2 ª 1 f ( z )dz ³ dM ³ fT (T ) f ( z ,T , M )dT » . 2 «³ z 2 A ¬0 2 S 0 0 ¼

K ( L, A, D, V , RAl , Rb )

E0 T ( L, A, D, V , RAl , Rb ). W

(10)

(11)

In the end, we assume the crystalline unit has multiple hexagon columnar crystallites. In ideal conditions, the number of the columns is 4 j ( j t 0) , in which j the segmenting numbers of small crystalline units is corresponding to every hexagon columnar crystallite. Then the proportion of the effective emergent area can be given by

KS

3 u 2 j 1

D2 ,( j t 0). A2

(12)

So the transmittance T ( L, A, V , R Al , Rb ) and conversion factor K ( L, A, V , RAl , Rb ) of the fluorescence in the crystalline unit with hexagon columnar crystallite can be modified as

The Crystal Unit Model and Its Conversion Factor to X-Ray | 165

Fig. 7: The Cartesian coordinate based on the CsI(Tl) hexagon column.

T ( L, A, D, V , RAl , Rb ) 3 u 2 j-1

L S 2S º 1 D2 ª ( ) M f z dz d fT (T ) f ( z,T ,M )dT » . « z 2 ³ ³ ³ 2S 0 A ¬0 0 ¼

K ( L, A, D, V , RAl , Rb )

E0 T ( L, A, D, V , RAl , Rb ). W

(13)

(14)

3 Simulation Results According to integral equation (11) from the CsI (Tl) unit model with one hexagon column, the conversion factor to different x-ray incident energies is shown in Figure 8. The contrast factor curve of CsI (Tl) unit model with non-columns and one column when the incident energy is 100 keV also is obtained on the top right corner of Figure 8. Apparently the variation trend of conversion factor as the film thickness increasing to different x-ray incident energies is very different. For incident energies 20 keV and 50 keV, the factor values both increase rapidly as the film thickness increasing and reduce sharply after reaching the maximum at 13 μm and 17 μm respectively. The increase and decrease trend of conversion factor become less sharp when the incident energy is 100 keV and the maximum is obtained at the thickness 25μm. For the incident energy is 140 keV, the trend of factor began to flatten after the film thickness is larger than 60 μm. This result indicates that the best x-ray incident energy to the CsI (Tl) film with different thickness is different. Meanwhile the CsI (Tl) crystal unit with columnar crystallite has a higher conversion factor clearly.

166 | Li-Na Guo, Shuang Liu, Tian-Yu Wang and Xiao-Chuan Tan

Fig. 8: The conversion factor of CsI (Tl) film unit with one hexagon column to different x-ray incident energies and the contrast factor curve of CsI (Tl) film with non-columns and one column when the incident energy is 100 keV. (A=9 μm, σ=2.22×10-4 μm-1, RAl=0.8)

Figure 9 shows the impact of grain diameter to the conversion factor of the CsI (Tl) crystal unit with the thickness 12 μm under the incident energy 50 keV. The conversion factor is decreases exponentially with increasing grain diameter. Namely, the larger the number of hexagon columns in CsI (Tl) crystal unit has, the higher the conversion factor would be got.

Fig. 9: The conversion factor of CsI (Tl) film unit with different grain diameter. (A=9 μm, L=17 μm, E0=50 keV, σ=2.22×10-4 μm-1, RAl=0.8)

The Crystal Unit Model and Its Conversion Factor to X-Ray | 167

4 Conclusions In this paper, we model the CsI (Tl) crystal unit with hexagon columnar crystallites to study the fluorescence transmittance and conversion factor to incident x-ray. A novel model of image points of excited points is proposed to calculate the fluorescence transmission distance in crystal unit. The influence of film thickness on conversion factor for different incident x-ray energies is obtained through the integral formula of conversion factor. The impact of grain size to conversion factor also is gained. The CsI(Tl) films with different thickness have the different incident energy to get the highest value of conversion factor. The large number of hexagon columns is beneficial to gain the higher conversion factor to incident x-ray. Acknowledgement: This work was supported by National Natural Science Foundation of China (No. 61435010, 61421002, 61177035, 61307070), Chinese 973 Program under Grant No. 2012CB315701, Sichuan Provincial International Cooperation Project (2013HH0002) and Sichuan Provincial Science and Technology Support Project (12ZC0245). The authors would also like to thank CCD Research Center of China Electronics.

References [1] [2] [3] [4]

[5] [6]

[7]

[8] [9]

Y. Wu, G. Ren, F. Meng, X. Chen, D. Ding, H. Li, S. Pan, C.L. Melcher, Scintillation Characteristics of Indium Doped Cesium Iodide Single Crystal, IEEE Trans. Nucl. Sci. 62 (2015) 571-576. P. Leblans, L. Struye, S. Elen, I. Mans, H. Vrielinck, F. Callens, X-ray enhancement of CsI:Eu2+ radioluminescence, J Lumin. 165 (2015) 68-76. Y. Wu, G. Ren, M. Nikl, X. Chen, D. Ding, H. Li, S. Pana, F. Yang, CsI:Tl+,Yb2+: ultra-high light yield scintillator with reduced afterglow, Cryst. Eng. Comm. 16 (2014) 3312-3317. Y. Wu, G. Ren, F. Meng, X. Chen, D. Ding, H. Li, S. Pan, Ultralow-concentration Sm codoping in CsI:Tl scintillator: A case of little things can make a big difference, Opt Mater. 38 (2014) 297300. D. Yao, M. Gu, X. Liu, S. Huang, B. Liu, C. Ni, Performance of columnar CsI(Tl) scintillation films prepared on special pre-deposited layers, Appl Surf Sci. 276 (2013) 776-781. D. Yao, M. Gu, X. Liu, S. Huang, B. Liu, C. Ni, Fabrication and Performance of Columnar CsI(Tl) Scintillation Films With Single Preferred Orientation, IEEE Trans. Nucl. Sci. 60 (2013) 16321636. Y. Wu, G. Ren, F. Meng, X. Chen, D. Ding, H. Li, S. Pan and C.L. Melcher, “Scintillation Characteristics of Indium Doped Cesium Iodide Single Crystal,” IEEE Trans. Nucl. Sci., vol. 62, no. 2, pp. 571-576, 2015. Y. Tian and G. Pang, “Experimental study of a single-pixel prototype anti-scatter detector for megavoltage x-ray imaging,” Radiat. Phys. Chem., vol. 119, pp. 9-13, 2016. Teymurazyan,, G. Pang, , “Megavoltage X-Ray imaging based on Čerenkov effect: a new application of optical fibres to radiation therapy,” Med. Phys., vol. 39, no. 7 , pp. 4644-4649 , 2012.

168 | Li-Na Guo, Shuang Liu, Tian-Yu Wang and Xiao-Chuan Tan [10]

[11]

[12] [13] [14] [15] [16]

[17]

[18]

C.W. Seo, B.K. Cha, S. Jeon, R.K. Kim and Y. Huh, “Characterization of indirect X-ray imaging detector based on nanocrystalline gadolinium oxide scintillators for high-resolution imaging application,” Nucl. Instrum. Meth. A., vol. 699, pp. 129-133, 2013. X. Xu, H. Niu, “The Fluorescence Escape Efficiency of CsI:Na (CsI:Tl) Phosphor and its Concerting Factor to X-rays,” Chinese Journal of Computational Physics, vol. 19(3), pp. 195-202, 2002. B. Wei, M. Zhou, D. Jin, P.Feng, D. Mi, “Study of the Luminescent for Narrow CsI(Tl) Scintiallor,” Acta Photonica Sinica, vol. 35(1), pp. 41-46, 2006. B. Wei, M. Zhou, et al, X-ray High-resolution Detection Research Using CsI (Tl) Crystal Monte Carlo Simulation, Optics, 2006,26(11): 1429-1434 W. J. Veinele, Photon Cross Sections from 0. 1keV to 1MeV Foi Elements Z= 1 to Z= 94, Atomic Data Tables, 1973, 5:51-111 B. K. Cha, B. J. Kim, et al. A Pixelated CsI (Tl) Scintillator for CMOS-based X-ray Image Sensor. Nuclear Science Symposium Conference Record. N30-132(2006):1139-1143 T. Jing, G. Cho, J. Drewery, I. Fujieda, S.N. Kaplan, A. Mireshghi, V. Perez-Mendez, D. Wildermuth, “Enhanced Columnar Structure in CsI Layer by Substrate Pattering,” IEEE Trans. Nucl. Sci., vol. 39, no. 5, pp. 1195-1198, 1992. S. Kobayashi, T. Shinomiya, T. Yoshida, H. Kitamura, Y. Shirakawa, K. Kurita, Y. Uchihori, Characteristic X-ray detector: In-situ imaging of radioactive contaminant distributions, Radiat Meas. 82 (2015) 26-30. C.W. Seo, B.K. Cha, S. Jeon, R.K. Kim, Y. Huh, Characterization of indirect X-ray imaging detector based on nanocrystalline gadolinium oxide scintillators for high-resolution imaging application, Nucl Instrum Meth A. 699 (2013) 129-133.

Hai-Li Zhu1, Chun-Lei Jiang2, Kyunsoo Shin3, Tao Wang4, Guang-Hai Chen5, Yong-Bing Tang6*

Effect of Ion Etching on the Surface Morphology, Structure and Adhesive Strength of the TiN Coating

Abstract: In this paper, the ion etching by ion source is conducted to clean the 304 stainless steel substrate with different etching time and bias voltage. TiN coating were deposited on the etched substrates by the method of Arc Ion Plating (AIP). The surface morphology of the substrates before and after etching, as well as the surface morphology of the coating was characterized. Besides, the microstructure and adhesive strength of coatings were also investigated. The results showed that with the increase of the etching time and the bias voltage, wrinkles were observed on the substrate surface and got more significantly. After coating, with the increase of the etching time and the bias voltage, coating morphology change from smooth surface to the wrinkles consistent with the substrate. Etching time and the voltage bias have larger influence on adhesive strength, long etching time and high etching bias voltage was helpful to improve the adhesive strength, but too long etching time was detrimental to the adhesive strength. Keywords: TiN coating; etching cleaning; surface morphology; mechanical properties

1 Introduction Hard coating are widely used in cutting tools, moulds, components and parts, and || 1 Functional Thin Films Research Centre, Shenzhen Institutes of Advanced Technology, Chinese, Academy of Sciences, Shenzhen, China, Nano Science and Technology Institute, University of Science and Technology of China, Suzhou, China, E-mail: [email protected] 2 Functional Thin Films Research Centre, Shenzhen Institutes of Advanced Technology, Chinese,Academy of Sciences, Shenzhen, China, E-mail: [email protected] 3 Functional Thin Films Research Centre,Shenzhen Institutes of Advanced Technology, Chinese,Academy of Sciences, Shenzhen, China, E-mail: [email protected] 4 Functional Thin Films Research Centre, Shenzhen Institutes of Advanced Technology, Chinese, Academy of Sciences, Shenzhen, China, E-mail: [email protected] 5 School of Materials Science & Engineering, Chongqing University of Technology, Chongqing, China, E-mail: [email protected] 6 Functional Thin Films Research Centre, Shenzhen Institutes of Advanced Technology, Chinese, Academy of Sciences, Shenzhen, China, Corresponding author e-mail: [email protected] 10.1515/9783110516623-017 DOI 10.1515/9783110303568-017

170 | Hai-Li Zhu, Chun-Lei Jiang, Guang-Hai Chen, Yong-Bing Tang many other fields, due to their high hardness, wear resistance and chemical inertness[1,2,3,4]. Mechanical properties such as hardness, wear resistance, and adhesive strength are the key factors affecting the service life of coated tools. Especially, adhesive strength is the prerequisite for the industrial application. Adhesive strength is mainly depends on the mechanical properties of the substrate and film, such as hardness, modulus of elasticity, and residual stress of the coating. Besides, surface quality and the microstructure of the substrate surface also have influence on the adhesive strength significantly [5]. Researchers have tried a variety of methods to improve the adhesive strength. Ali et al. reported a 20% adhesive strength improvement by Ti-TiN multilayer structure designing compared with the Ti-TiN double-layer structure [6]. Wei et al. proved that the adhesive strength of DLC coating on silicon substrate could be improved by depositing Ti or Cr transition layers [7]. In addition to optimizing the coating structure, substrate cleaning before the deposition is crucial for the adhesive strength enhancement. Generally, manual scrubbing, ultrasonic cleaning, blow-drying with high purity nitrogen as well as drying in the oven are needed before coating [8]. However, simple mechanical and chemical cleaning is inefficient to remove contaminants on the substrate surface completely. Even after cleaning, the absorption of moisture, dust, organic and inorganic pollutants in the air is unavoidable in the process of sending the substrate to the vacuum chamber. Moreover, especially fresh substrate surface will be oxidized when contacting with the air [9, 10]. Therefore, strong bonding between the coating and substrate would be hindered by loose pollutants layers, if no further cleaning is conducted [9]. Ion etching cleaning is powerful to remove the surface adsorption of contaminants and oxide layers, which is helpful to improve the coating adhesion. For example, Wei et al.’s work showed that the adhesive strength of Ta coating was increased by 93% after ion etching cleaning [11]. In addition to the etching cleaning, surface morphology of the substrate could also be modified by ion etching method, which is also helpful to increase the adhesive strength by roughing the surface. In this work, effects of ion etching cleaning on the surface morphology evolution of the 304 stainless steel substrate were investigated by changing the etching time (T) and etching bias (Ub). The surface morphology, microstructure and adhesive strength of TiN coatings deposited on the etched substrates by the arc ion plating technique was also characterized.

2 Experiment V-Tech MF610/610 ion plating system was used to deposit TiN coatings. In this system, two arc ion plating sources, and one ion source are mounted on the walls of the octagonal vacuum chamber. In this work, two circular Ti targets (99.99% in purity) was used. Double-sided polishing 304 stainless steel (18 mm x 18 mm x 0.8 mm in

Effect of Ion Etching on the Surface Morphology, Strength of the TiN Coating | 171

size) were used as the substrates for characterization of morphology and structure. Ultrasonic cleaning with deionized water, acetone and ethanol in sequence and then dried with nitrogen and drying in the oven for 120 °C before deposition. Etching cleaning process was divided into two groups, firstly, fixed the bias voltage (Ub) as 260 V, and the time were set as 0 min, 2 min, 5 min, 10 min, 15 min and 20 min, respectively, the second group was conducted with the etching time fixed as 10 min, and the bias voltage was set as -100 V, -200 V, -300 V and -400 V, respectively. In all the etching cleaning experiments, the working pressure was kept constant at 0.6 Pa with Ar as working gas, ion source current was set as 25 A with voltage varied from 55 to 75 V. In the deposition process, the working pressure was kept constant at 0.8 Pa with N2 as working gas, the deposition time is 1 h. Crystal structure was determined by X-ray diffraction (XRD, D/Max 2500PC, Rigaku, Japan) with Cu Kα radiation (λ=1.54056 Å). The surface morphologies of substrates and coatings were observed by WHX-2000 super depth of field microscope (KEYENCE, China). The adhesive strength was tested using the HT-3002 type scratch tester.

Fig. 1: Optical images of the substrates and coatings cleaned for different etching time: (a) 0 min, (b) 2 min, (c) 5 min, (d) 10 min, (e) 15 min and (f) 20 min, with the etched bias voltage fixed as -260 V

172 | Hai-Li Zhu, Chun-Lei Jiang, Guang-Hai Chen, Yong-Bing Tang

Fig. 2: Optical images of the substrates and coatings etched at different bias voltage: (a)-100 V, (b)200 V, (c)-260 V, (d)-300 V and (e)-400 V, with etching time fixed as 10 min

3 Results and Discussion The optical morphologies of the etched 304 stainless steel substrate and the TiN coating deposited on the etched substrate with different etching time and etching bias voltage are shown in Fig. 1 and Fig. 2, respectively. The etching bias voltage was set as -260 V for different etching time, while etching time was set as 10 minutes for different etching bias voltages. Note that, the left part of the image refers to the substrate, while the right part presents the corresponding TiN coating. The substrate surface without being etched was smooth as displayed in Fig. 1(a). With the increase of etching time and etching bias voltage, "roughen phenomenon" [12] featured with wrinkles were observed. As illustrated in Fig. 1(a) and 1(b), only slight wrinkles were observed if the etching time is less than 5 minutes, and the morphology of the TiN coating deposited on the etched substrate showed little difference with coatings without ion etching cleaning as shown in Fig. 1(a). If the etching time exceeding 5 minutes, obvious wrinkles could be observed and became more significant with the increase of etching time. As shown in Fig. 2(b), obvious wrinkles could be detected at -200 V with etching time 10 minutes. Wrinkles became more clearly with the increase of the etching bias voltage. The formation of the wrinkles was due to the inhomogeneous emission of surface material caused by ion bombardment. The non-uniform etching might be owing to the inhomogeneous distribution of composition and microstructure of the substrate surface. Note that, the TiN coatings deposited on the etched substrates exhibited similar morphology to that of the etched substrate surface

Effect of Ion Etching on the Surface Morphology, Strength of the TiN Coating | 173

when obvious wrinkles were obtained, as displayed in Fig. 1(d)-1(f), and Fig. 2(c)2(e). Droplets were observed for all the coating samples, which is typical for arc ion plating technique [13, 14, 15]. Interestingly, the droplets seemed to get disappeared with the increase of the etching time and bias voltage. This might be explained by the fact that when the roughness gets higher, the etching depth would be larger enough to get the particles embedded in the valleys, which overshadowed the droplet features. X-ray diffraction patterns of TiN coating samples at different etching time and etching bias are illustrated in Fig. 3(a) and 3(b), respectively. The etching time and etching bias voltage has little effect on the microstructure, since almost all the coating samples showed strong (111) preferred orientation except for coating samples deposited at Ub = -260 V, T = 15 min, and Ub = -400 V, T = 10 min. The (111) preferred orientation was due to the deposition condition, since in the case of large coating thickness and residual stress, the coating growth is dominated by strain energy, which promotes the growth of low strain energy (111) surface inhibiting the growth of other lattice planes [16]. The (200) preferred orientation of the coating samples deposited at Ub = -260 V, T = 15 min and Ub = -400 V, T = 10 min might attributed to the special surface morphology of the substrate which favored the growth of (200) plane, and this needs to be confirmed further.

Fig. 3: XRD patterns of TiN coating samples at different substrate etching time (a) and bias voltage (b)

174 | Hai-Li Zhu, Chun-Lei Jiang, Guang-Hai Chen, Yong-Bing Tang

Fig. 4: (a) Experimental data of scratch test of TiN coating samples etched with Ub =-260 V and T =15 min (b) Optical image of scratch of TiN coating sample etched with Ub = -260 V and T = 15 min

Adhesive strength of TiN coating samples were measured by scratch test. A typical friction force and acoustic emission singal curves of the coating sample deposited at Ub = -260 V, T = 15 min are plotted with the applied load of 10 N to 40 N in Fig. 4(a), and the corresponding optical scratch image was shown in Fig. 4(b). When loading force came to 13.5 N, the first inflection point was observed, referring to the lower critical load Lc1, indicating the damage within the coating, like cracking or peeling. When loading force reached 18.3 N, the second inflection point appeared in the friction curve, corresponding to the higher critical load Lc2, which indicated the coating spalling failure. Besides, the maximum acoustic emission signal also appeared at the critical load Lc2. Meanwhile, the Lc1 and Lc2 could also be derived from the optical scratch image as shown in Fig. 4(b). Cracking was observed at the applied load of 13.7 N, referring to the lower critical load Lc1, and coating spalling was detected at the applied load of 18.3 N, referring to the higher critical load Lc2. The obtained results from the optical scratch image were in good agreement with that from the fiction and acoustic emission singal curves, showing the reliability of the test data.

Effect of Ion Etching on the Surface Morphology, Strength of the TiN Coating | 175

Fig. 5: Adhesive strength plotted with the (a) ion etching time and (b) etching bias voltage

Using the above methods obtained the adhesive strength of TiN coating samples deposited at different etching time and bias voltage is shown in Fig. 5(a) and 5(b), respectively. As shown in Fig. 5(a), the adhesive increased with the increase of the etching time before T = 15 min, and then decreased with the further increase of the etching time. The maximum adhesive strength was obtained at T = 15 min. When the etching time is short, the adsorption of contaminants and the oxide layer on substrate surface could not be completely removed, leading to a low adhesive strength. As the extension of etching time, pollutants and oxide layer on the surface of the substrate were etched away gradually, exposing the fresh metal surface, which could improve the surface energy of the substrate resulting in the adhesive strength improvement. In addition, with the extension of etching time, the surface roughness growed more intense (see Fig. 1), which increased the contact area between substrate and coating. In this case, mechanical locking could be formed, which was beneficial to the adhesive strength enhancement. However, when the etching time is

176 | Hai-Li Zhu, Chun-Lei Jiang, Guang-Hai Chen, Yong-Bing Tang too long, the large surface roughness was detrimental to the adhesive strength, a possible reason was that deposition atoms could not fully populated holes or valleys formed by etching on the substrate surface, which made the formation of pinholes or gaps occur at the coating-substrate interface, resulting in the reduction of the adhesive strength. As shown in Fig. 5(b), the adhesive strength showed little difference before Ub = -260 V, and then increased after that. This indicated that low etching bias voltage had little influence on adhesive strength, since the ion energy was not high enough to get rid of the absorbed contaminants and oxide layers, and generate sufficient roughness. When the bias voltage exceeding -260V, the etching effect was strong enough to improve the adhesive strength significantly by the exposing of fresh metal surface of the substrate and the mechanical locking effect.

4 Summary Ion etching was conducted to clean the 304 stainless steel substrate using ion source, and TiN coatings were deposited at the etched substrates by the arc ion plating method in this work. The effect of etching time and etching bias voltage on the morphology of the etched substrate surface was investigated, and the influence of the etching time and etching bias voltage on the TiN coatings deposited on the etched substrates, as well as the microstructure and adhesive strength of the coating samples were also studied. According to the experiment results and discussions, some conclusions could be drawn as follows: (1) The etching time and etching bias voltage had important effect on the morphology of the 304 stainless steel substrate and the TiN coatings deposited on the etched substrates. Wrinkles were observed on the substrate surface and got more significantly with the increase of etching time and bias voltage. At short etching time and small bias voltage, the morphology of the TiN coating showed little difference with coatings without being etched, and exhibited almost similar features to the etched substrate surface when the wrinkles on the substrates became obvious. (2) X-ray diffraction analysis showed that the etching time or the etching bias voltage had little effect on the preferred orientation. (3) The adhesive strength of TiN coatings was affected greatly by the etching time and etching bias voltage. Long etching time and high etching bias voltage was helpful to improve the adhesive strength, but too long etching time was detrimental to the adhesive strength. Therefore, the etching time and etching bias voltage should be optimized to achieve the best adhesive strength.

Effect of Ion Etching on the Surface Morphology, Strength of the TiN Coating | 177

Acknowledgement: This work was supported by Shenzhen Municipality Project (JCYJ20150630114942259), Shenzhen Municipality Science and Technology Planning Project (JSGG20160229202951528), Scientific Equipment Project of Chinese Academy of Sciences (yz201440; GJHS20160329112009617), Shenzhen Municipality Technology R&D Project (JSGG20160229202951528; JSGG20160301155933051), Science and Technology Planning Project of Guangdong Province (Nos. 2014A010105032, 2014A010106016), Natural Science Foundation of Guangdong Province, China (2014A030310482) and Guangdong Innovative and Entrepreneurial Research Team Program (No. 2013C090).

References [1] [2] [3] [4] [5] [6] [7]

[8] [9]

[10] [11]

[12]

[13]

[14]

H. Mohrbacher, B. Blanpain, J. P. Celis and J. R. Roos, "Oxidational wear of TiN coatings on tool steel and nitrided tool steel in unlubricated fretting," Wear, Vol. 188, pp. 130-137, 1995. I. J. Smith, D. Gillibrand, J. S. Brooks and W.-D. Munz, "Dry cutting performance of HSS twist drills coated with improved TiAlN," Surf. Coat. Technol, Vol. 90, pp. 164-171, 1997. W. D. Sproul, "High rate reactively sputtered TiN coatings on high speed steel drills,"Thin Solid Films, Vol. 126, pp. 257-263, 1985. H. K. TonshoV and A. Mohlfeld, "PVD-Coatings for wear protection in dry cutting operations," Surface and Coatings Technology, Vol. 93, pp. 88-92, 1997. P. A. Steinmann, "Adhesion of TiC and Ti(C, N) coatings on steel," Journal of Vacuum Science & Technology A, Vol. 3, pp. 2394, 1985. R. Ali, M. Sebastiani and E. Bemporad, "Influence of Ti-TiN multilayer PVD-coatings design on residual stresses and adhesion," Materials & Design, Vol. 75, pp. 47-56, 2015. C. Wei and J.-Y. Yen, "Effect of film thickness and interlayer on the adhesion strength of diamond like carbon films on different substrates," Diamond and Related Materials, Vol. 16, pp. 1325-1330, 2007. Y. Sun and W. Hong, "Surface Modification of Glass Substrate by Linear Ion Source," Journal of the Chinese Ceramic Society, Vol. 43, pp. 1561-1566, 2015. D. Chen, B. Jiang, H. Shi and Y. Long, "Effect of ion cleaning pretreatment on interface microstructure, adhesive strength and tribological properties of GLC coatings on Al substrates," Vacuum, Vol. 86, pp. 1576-1582, 2012. H. C. Barshilia, A. Ananth, J. Khan and G. Srinivas, "Ar + H-2 plasma etching for improved adhesion of PVD coatings on steel substrates," Vacuum, Vol. 86, pp. 1165-1173, 2012. J. J. Wei, X. Y. Zhu, L. X. Chen and J. L. Liu, "Influence of ion source pretreatment on WC substrate surface and Ta buffer coating," Transactions of Materials and Heat Treatment, Vol. 36, pp. 164-168, 2015. D. C. Zhao, H. S. Wu, Z. J. Ma and G. J. Xiao, "Influence of Ar Ion Cleaning on Interfacial Adhesion of Al Film and Resin-Based Composite," Chinese Journal of Vacuum Science and Technology, Vol. 33, pp. 867-870, 2013. Y. H. Zhao, G. Q. Lin, C. Dong and L. S. Wen, "Experimental verification of the physical model for droplet-particles cleaning in pulsed bias arc ion plating," Journal of Materials Science & Technology, Vol. 21, pp. 423-426, 2005. Q. Zhang, X. Zhong, C. Li, Y. Guo, "Synthesis and Mechanical Properties of Ti/TiN/TiAIN Composite Coatings by Arc Ion Plating and Magnetron Sputtering," Chinese Journal of Vacuum Science and Technology, Vol. 35, pp. 195-200, 2015.

178 | Hai-Li Zhu, Chun-Lei Jiang, Guang-Hai Chen, Yong-Bing Tang [15] [16]

M. H. Shiao and F. S. Shieu, "A formation mechanism for the macroparticles in are ion-plated TiN films," Thin Solid Films, Vol. 386, pp. 27-31, 2001. J. Pelleg, L. Z. Zevin., S. Lungo, “Reactive-sputter-deposited TiN films on glass substrates," Thin Solid Films, Vol. 197, pp. 117-128, 1991.

Wei Wang1, Zhen Cheng2, Song-Tao Huang3, Li-Mei Yang4, Zheng Xu5 and Lu Jia6

Influences of Photocatalytic Activity by TiO2 Doping with Graphene Oxide and Lanthanum on the Carrier of Cenosphere Abstract: Photocatalytic activity by supported TiO2 doping with Graphene oxide and Lanthanum were investigated. The carrier of cenosphere was prepared by using washing, acid-processing and alkali-processing, SEM result shows that the surface of cenosphere is glossy and smooth. Through photocatalytic degradation of methylene blue solution, photocatalytic activities of powder materials after treatment and the influencing factors were compared. The degradation rate of methylene blue by using 0.5% Lanthanum doped TiO2 is better than the other doping amounts. 0.5% GO doped TiO2 has the same rule. 0.5% La and 0.5% GO doping TiO2 were chosen as the optimum condition. SEM and XRD result shows the sol become antase-TiO2 and were coated uniformly in the surface of the carrier. The decoloration rate of the supporter material is about 90% in 60 minutes and it can maintain a very good photocatalytic performance after recycle 20 times. It indicates that the material has a wide application prospect. Keywords: photocatalyst; supported TiO2; graphene oxide; lanthanum; cenosphere

1 Introduction Titanium oxide(TiO2) has become one of main photocatalysts in the field of environmental photocatalytic which has a low toxicity and long term stability in recent years.[1-3] many efforts have been devoted to improve the photocatalytic performance of it in the past decade. A lot of methods were used to improve the photocatalytic performance. [4-7] Rare earth elements such as lanthanum dopant can improve the intensity with an appropriate content, which is attributed to the increase in the content of surface oxygen va-cancies and defects. [8-9] some non-metals materials such as graphene oxide (GO) dopant can also improve the photocatalytic perfor|| 1 General Research Institute for Nonferrous Metals, Beijing, China, [email protected] 2 General Research Institute for Nonferrous Metals, Beijing, China, [email protected] 3 General Research Institute for Nonferrous Metals, Beijing, China, [email protected] 4 General Research Institute for Nonferrous Metals, Beijing, China, [email protected] 5 General Research Institute for Nonferrous Metals, Beijing, China, [email protected] 6 General Research Institute for Nonferrous Metals, Beijing, China, [email protected] 10.1515/9783110516623-018 DOI 10.1515/9783110303568-018

180 | Wei Wang, Zhen Cheng, Song-Tao Huang, Li-Mei Yang, Zheng Xu and Lu Jia mance. When take TiO2 as a photocatalyst to deal with the polluted water, the biggest problem is how to recycle the materials. Fly-ash hollow cenosphere (cenosphere) is a very good carrier and easy to recycle. [10] In this study, Photocatalytic activity of TiO2 doping with Graphene oxide and lanthanum on the carrier of cenosphere were investigated. Through photocatalytic degradation of methylene blue solution, after recycle twenty times the material also has a good activity.

2 Materials and Method 2.1 Reagents and Reactor Used The carrier is fly-ash hollow cenospherewere (80-120μm). The reagents used in this study are deionized water, Tetrabutyl Titanate (98%,Tianjin Guangfu Fine Chemical Research Institute), absolute ethanol(99.7%,Beijing Chemical Works), Nitric acid(65%-68%,Beijing Chemical Works),Acetic acid(99.5%,Tianjin Guangfu Fine Chemical Research Institute) Ferric nitrate(98%,Tianjin Guangfu Fine Chemical Research Institute), lanthanum nitrate(98%,Tianjin Guangfu Fine Chemical Research Institute), GO(0.2-1μm, Ashine) The photocatalytic reactor used in this study is a common reactor (PL-300D) with a lamp .The lamp used is of the range 200-500nm of 300W.The irradiation powder was measured as 100mW/cm2. The solution along with the catalyst in beaker with the volume capacity of 500mL was 30cm under the photocatalytic reactor. The sample is centrifuged before analysis of concentration.

2.2 Methods Titanium dioxide sol was prepared using tetrabutyl titanate as precursor. 30 mL of tetrabutyl titanate was mixed with 100 mL of ethanol and stirred well. After stirring 30 minutes, sol A was obtained. To prepare sol B, adding lanthanum nitrate and GO to 30 mL of deionized water and 10 mL of acetic acid, then dissolved in 100 mL by using the ultrasonic dispersion method. Adjusted the pH value equals to 1.6 by Nitric acid. At last added lanthanum nitrate to the materials and stirred well. The sol A was added to the sol B at the speed of 5ml/min to become the coating sol, then coating to cenosphere by using fluidized bed with spraying, dried under normal pressure, calcinated at 773K for 3h. The photocatalyst was obtained. The powder material which without cenosphere is made by the same step.

Influences of Photocatalytic Activity on the Carrier of Cenosphere | 181

The photocatalyst was added to methylene blue solution to investigate the photocatalytic activity by using photocatalytic reactor.

3 Results and Discussion 3.1 Surface Preparation of the Cenosphere The cenosphere is wildly used in material field. Its microbeads can be classified as sinking beads and floating beads according to the difference in density. The floating beads one is chosen as the sample. The main elements were shown in Table 1. The XRD and SEM were shown in Figure 1 and Figure 2 separately. Table 1: Main composition of cenosphere unprepared ELEMENT

Al

Si

Ca

Mg

Fe

W/%

16.20

28.23

0.64

0.34

1.68

M-Mullite S-SiO2

Intensty(a.u.)

M

M S

M M M

M

S MM M

10

20

30

40

M

S M SM M M M M

50 60 2-Theta 2T /q

Fig. 1: XRD diagram of cenosphere unprepared

MM

70

80

90

182 | Wei Wang, Zhen Cheng, Song-Tao Huang, Li-Mei Yang, Zheng Xu and Lu Jia

Fig. 2: SEM pattern of cenosphere unprepared

As shown in Table 1, the main elements are Al and Si. The XRD result which was shown in Figure 1 also shows that the main material is mollite and SiO2. As shown in Figure 2, there is some ash in its surface. It cannot be used to be a good carrier without any treatment. The carrier was prepared by using washing, acid-processing and alkali-processing. The carrier SEM was shown in Figure 3. As shown, the surface is glossy and smooth after treatment.

Fig. 3: Example of cenosphere prepared

3.2 Photocatalytic Activity of Powder Material The contents of La and GO are both very important actors. The powder materials were prepared to choose the optimum conditions. The result of photocatalytic activity was shown in Figure 4 and Figure 5.

Influences of Photocatalytic Activity on the Carrier of Cenosphere | 183

100

0.00% La 0.20% La 2.00% La

90

Decoloration DE / %

80

0.10% La 1.00% La 0.50% La

70 60 50 40 30 20 10 0

10

20

30

40

50

60

70

80

90

Time t / min

Fig. 4: Photocatalytic performance of powder materials with different La addition amounts

100 0.00% GO 0.10% GO

Decoloration DE / %

80

0.25% GO 0.50% GO 1.0% GO

60

2.0% GO

40

20

0

10

20

30

40

50

60

70

80

90

Time t / min

Fig. 5: Photocatalytic performance of powder materials with different GO addition amounts

184 | Wei Wang, Zhen Cheng, Song-Tao Huang, Li-Mei Yang, Zheng Xu and Lu Jia

100

Decoloration K/%

80 60 40

TiO2

0.50% La-TiO2

20

TiO2/GO(0.50%)

0.50% La-TiO2/GO(0.50%)

0

0

10

20

30

40

50

60

70

80

90

7LPH/min Fig. 6: Photocatalytic performance of several powder materials

As shown in Figure 4 Figure 5andFigure 6, as time growing, the deconloration rate is growing. When the reaction time longer than 60 minutes, many power materials can be a good photocatalytic performance. 0.50% amount La and 0.50% amount GO are the optimum condition separately. When compared the photocatalytic performance of TiO2, 0.50%La dopant TiO2, 0.50% GO dopant TiO2 and 0.50%La-0.50% GO dopant TiO2, the last one has the best photocatalytic performance.

3.3 Preparation and Photocatalytic Activity of Carrier Material After cenosphere was prepared, it was coated with sol at 313K and alcinated at 773K for 3h. The SEM and XRD were shown in Figure 7 and Figure 8 separately.

Influences of Photocatalytic Activity on the Carrier of Cenosphere | 185

Fig. 7: SEM pattern of supported material

As shown in Figure 7, sol was coated uniformly in the surface of cenosphere. In Figure 8, anatase-TiO2 was shown in the diagram; it indicates the sol was coated in the carrier.

M

M---Mullite S---SiO2

M M M

Intensty(a.u.)

S

A---Anatase

M M S MM M

M Cenosphere S S MM M M M M M M

A Carrier material

10

20

30

40

50 60 2 Theta 2T q

70

80

90

Fig. 8: XRD diagram of cenosphere and supported material

The photocatalytic performance of powder material and supported material were compared in Figure 9.

186 | Wei Wang, Zhen Cheng, Song-Tao Huang, Li-Mei Yang, Zheng Xu and Lu Jia

100

Decoloration/%

80

60 supported material 0.50% La-TiO2/GO(0.50%)

40

powder material 0.50% La-TiO2/GO(0.50%)

20 10

20

30

40

50

60

70

80

7LPH/min

Fig. 9: Photocatalytic performance of powder material and supported material

100

Decoloration / %

80

60

40

20

0

0

5

10

15

20

Recycle time Fig. 9: Photocatalytic performance of supported material recycles 20 times (60minutes)

As shown in Figure 9, in the first 60minutes, powder material has a better photocatalytic performance than supported material. When the reaction time is longer than 60minutes, supported material has the same photocatalytic performance as the powder one. Even more, the powder material’s photocatalytic performance is easy to drop to a very low level after three times recycles when the supported material can maintain a very good photocatalytic performance after recycle 20 times. The result was shown in Figure 10.As shown in Figure 10, the photocatalytic performance of supported material is sustainable. The decoloration rate keeps 80%percent in 60minutes.

Influences of Photocatalytic Activity on the Carrier of Cenosphere | 187

4 Conclusions After prepared by using washing, acid-processing and alkali-processing, the carrier was prepared. SEM result shows that the surface of cenosphere is glossy and smooth which is easy to be coated. Through photocatalytic degradation of methylene blue solution, photocatalytic activities of powder materials after treatment and the influencing factors were compared. The degradation rate of methylene blue by using 0.5% Lanthanum doped TiO2 is better than the other doping amounts. 0.5% GO doped TiO2 has the same rule. 0.5% La and 0.5% GO doping TiO2 were chosen as the optimum condition. SEM and XRD result shows the sol become antase-TiO 2 and were coated uniformly in the surface of the carrier. The decoloration rate of the supporter material is about 90% in 60 minutes and it can maintain a very good photocatalytic performance after recycle 20 times. Acknowledgement: This work was financially supported by Science and Technology Project of Beijing (Z151100003315016).

References [1] [2] [3]

[4] [5] [6]

[7]

[8]

[9]

[10]

M.V.Dozzi, E. Selli, “Doping TiO2 with p-block elements: Effects on photocatalytic activity: Journal of Photochemistry,” Photochemistry Reviews. Vol.14, 2013. pp. 13-28. R. DaI. Sopyan, M. Watanabe and S. Murasawa, “Efficient TiO2 powder and film photocatalysts with rutile crystal structure,” Chem Lett, 289, Vol.1, 1996.pp.69-70. Y. Shavisi, S.Sharifnia, M. Zendehzaban , ML. Mirghavami and S. Kakehazar . “Application of solar light for degradation of ammonia in petrochemical wastewater by a floating TiO2 LECA photocatalyst.,” Journal of Industrial and Engineering Chemistry. 20. vol. 5, 2014.pp. 28062813. V. Stengl, S. Bakardjieva and N. Murafa, “Preparation and photocatalytic activity of rare earth doped TiO2 nanoparticles,” Matedals Chemistry and Physics. vol.14, 2009.pp. 217. UG. Akpan, BH. Hameed, “The advancements in sol–gel method of doped-TiO2 photocatalysts,” Applied Catalysis A: General, 375. Vol.1, 2010, pp.1-11. P. Muthirulan, CN. Devi and MM. Sundaram. “TiO2 wrapped graphene as a high performance photocatalyst for acid orange 7 dye degradation under solar/UV light irradiations,” Ceramics International. 40. Vol.4, 2014. pp. 5945-5957. S. Wang, JS. Lian, WT. Zheng and Q. Jiang, “Photocatalytic property of Fe doped anatase and rutile TiO2 nanocrystal particles prepared by sol–gel technique,” Applied Surface Science. vol.263, 2012.pp. 260-265. LQ. Jing, X. Zhang, YC. Qu, ZH. Sun, SD Li, BJ. Jiang, HG. Fu and JZ. Sun, “Photolumine scence of Lanthanum-Doped TiO2 Nanoparticles and Their Photocatalytic Activity,” Journal of the chinese rare earth society.vol.06, 2004, pp.746-750. X. Lan, Wang L, B. Zhang, B. Tian and J. Zhang, “Preparation of lanthanum and boron codoped TiO2 by modified sol–gel method and study their photocatalytic activity,” Catalysis Today. vol.224, 2014. pp. 163-170. Z. Lu , P. Huo, Y. Luo , X. Liu , D. Wu and X.Gao, “Performance of molecularly imprinted photocatalysts based on fly-ash cenospheres for selective photodegradation of single and ternary antibiotics solution,” Journal of Molecular Catalysis A: Chemical. vol.378, 2013. Pp.91-8.

Jia-Yue Tian1, Jing Zhao2, Wan Wei3, Run-Run Yao4, Long Chen5, CuiMiao Zhang6, Guang Jia7* and Shuang Liu8

Synthesis and Luminescence Properties of Eu3+-Doped NaTb(MoO4)2 Hierarchical Microcrystals

Abstract: The novel NaTb (MoO4)2:Eu3+ hierarchical phosphors have been fabricated via a hydrothermal method. The morphology and particle size of the samples can be tuned in a controlled manner by altering the component of solvent. The Eu3+-doped NaTb(MoO4)2 sample mainly shows the characteristic emission of Eu3+ corresponding to 5D0–7FJ (J = 1, 2, 3, 4) transitions due to an efficient energy transfer from MoO42– and Tb3+ to Eu3+. The as-synthesized NaTb (MoO4)2:Eu3+ may be applied as a novel red phosphor in optoelectronic devices or advanced flat panel displays. Keywords: NaTb (MoO4)2; Hydrothermal synthesis; Energy transfer; Luminescence properties

1 Introduction In the past few decades, the tetragonal double alkaline rare earth molybdates (MLn (MoO4)2, where M = Li, Na, K; Ln = Lanthanide ions) have attracted great attention due to their eminent physical and thermal stability [1]. The studies on the MLn (MoO4)2 compounds mainly focused on the single crystals to be used as laser crystal materials [2−4]. In recent years, the lanthanide activator ions (Ln3+) doped NaLn (MoO4)2 have been proven to be a class of excellent luminescent materials, which may show better luminescence properties than the AMoO4 (A = Ca, Sr, Ba) phosphors [5]. However, to our knowledge, the previous report on the luminescent matrix for Ln3+ ions mainly concentrated on NaLn (MoO4)2 (Ln = Y, La, and Gd) [2, 6−9].

|| 1 College of Chemistry and Environmental Science, Hebei University, Baoding 071002, China 2 College of Chemistry and Environmental Science, Hebei University, Baoding 071002, China 3 College of Chemistry and Environmental Science, Hebei University, Baoding 071002, China 4 College of Chemistry and Environmental Science, Hebei University, Baoding 071002, China 5 College of Chemistry and Environmental Science, Hebei University, Baoding 071002, China 6 College of Chemistry and Environmental Science, Hebei University, Baoding 071002, China 7 College of Chemistry and Environmental Science, Hebei University, Baoding 071002, China, E-mail: [email protected] 8 Department of Chemistry, Tang Shan Normal University, Tangshan 063000, China, E-mail: [email protected] 10.1515/9783110516623-019 DOI 10.1515/9783110303568-019

190 | Jia-Yue Tian, Jing Zhao, Cui-Miao Zhang, Guang Jia and Shuang Liu Little attention has been paid for the synthesis and applications of other NaLn (MoO4)2 type phosphors. As we know, the energy transfer between lanthanide donor and acceptor is a general physical phenomenon. The luminescence properties may be improved or quenched by the energy transfer from other the co-doped lanthanide ions in host matrix. The energy transfer between Tb3+ to Eu3+ can be utilized to realize the tunable luminescence when they co-doped into in the third-party hosts [10−12]. Moreover, the luminescence properties of several Eu3+-doped terbium based hosts have been investigated, such as NaTbF4 [13], Tb (OH) 3 [14], TbBO3 [15], Tb2 (CO3)3 [16], Tb2 (WO4)3 [17], and TbPO4 [18]. However, there has been no report for the luminescence as well as the energy transfer between Tb3+ to Eu3+ for the Eu3+-doped NaTb (MoO4)2 phosphors. In this paper, the Eu3+-doped NaTb (MoO4)2 hierarchical architectures have been fabricated via a facile hydrothermal route. The energy transfer from MoO42− and Tb3+ to Eu3+ in NaTb (MoO4)2 host matrix was also investigated.

1.1 Experimental Section In a typical process, 1.9 mmol of Tb(NO3)3 and 0.1 mmol Eu(NO3)3 aqueous solution was added to 20 mL or 10 mL of ethylene glycol (EG). Subsequently, 2 mmol of Na2MoO4 solution was added to the mixing solution. The solution was transferred into a 50 mL Teflon bottle held in a stainless steel autoclave, sealed, and maintained at 180 °C for 12 h. Finally, the product was separated by centrifugation, washed with deionized water and ethanol, and dried in air. The samples were characterized by powder X-ray diffraction (XRD) performed on a D8 Advance diffractometer (Bruker). Fourier transform infrared spectroscopy (FT-IR) spectra were measured with a Perkin-Elmer 580B infrared spectrophotometer. The morphology and composition of the samples were inspected using JSM7500F cold field scanning electron microscope JEOL equipped with an energydispersive X-ray (EDX) spectrum. The photoluminescence excitation and emission spectra were recorded with a Hitachi F-7000 spectrophotometer equipped with a 150 W xenon lamp as the excitation source. All measurements were performed at room temperature.

2 Results and Discussion Fig. 1 shows the XRD patterns of the as-obtained samples prepared with 10 mL and 20 mL EG at the initial stage. It can be seen that the diffraction peaks of all samples are well indexed to the scheelite-type sodium terbium molybdate with tetragonal

Synthesis and Luminescence Properties Hierarchical Microcrystals | 191

phase [NaTb (MoO4)2, JCPDS Card No. 27-1422, Space group: I41/a (88)]. No other impurity peaks can be detected, indicating the Eu3+ ions have been effectively doped into the NaTb (MoO4)2 hosts. The strong and sharp diffraction peaks reveal a good crystallinity of the samples. This is important for luminescent matrix, because high crystallinity generally means less traps and stronger luminescence.

Fig. 1: XRD patterns of the samples prepared with (a) 10 mL and (b) 20 mL EG at the initial stage.

The NaTb (MoO4)2 samples prepared with 20 mL EG was selected as a representative example to further illustrate the composition and structure of the samples by EDX and FT-IR spectra. The EDX spectrum confirms the presence of sodium (Na), terbium (Tb), molybdenum (Mo), oxygen (O), and europium (Eu) elements (Fig. 2), which can effectively support the XRD result. Fig. 3 shows the FT-IR spectrum of the NaTb (MoO4)2 sample. The absorption bands centered at 3490 (1633) and 2365 cm−1 are due to the O–H stretching and bending vibration of the adsorbed water and CO2 on the surface of sample. The intense absorption bands at 928, 868, and 766 cm-1 are assigned to the stretching vibrations of Mo–O groups, confirming the presence of MoO42– in the product [19, 20]. The FT-IR spectrum provides further evidence for the formation of the NaTb (MoO4)2, agreeing well with the XRD and EDX results.

192 | Jia-Yue Tian, Jing Zhao, Cui-Miao Zhang, Guang Jia and Shuang Liu

Fig. 2: EDX spectrum of the NaTb (MoO4)2:Eu3+ sample.

Fig. 3: FT-IR spectrum of the NaTb (MoO4)2:Eu3+ sample.

Fig. 4 show the SEM images of the as-obtained NaTb (MoO4)2 samples. The sample prepared with 10 mL EG exhibits an irregular plate-like morphology (Fig. 4a). When the EG solvent increases to 20 mL, the as-obtained sample is composed of the mixture of quasi octahedral nanocrystals and plate-like microstructures (Fig. 4b).

Synthesis and Luminescence Properties Hierarchical Microcrystals | 193

Fig. 4: SEM images of the NaTb (MoO4)2:Eu3+ samples prepared with (a) 10 mL and (b) 20 mL EG.

The photoluminescence (PL) properties of the NaTb (MoO4)2:Eu3+ sample prepared with 20 mL of EG was characterized by the PL excitation and emission spectra, respectively. The excitation spectrum of NaTb (MoO4)2:Eu3+ monitored at the 617 nm (5D0–7F2 of Eu3+) consist of a broad band centered at about 260 nm and some sharp peaks from 350 to 550 nm, which are ascribed to the charge transfer transition within MoO42– and 4f-4f transitions of Eu3+ and Tb3+ ions [i.e., 7F0–5L6 (395 nm) and 7 F0–5D2 (464 nm) transitions of Eu3+, 7F6 –5D4 (486 nm) transition of Tb3+] (Fig. 5a). The presence of the excitation bands and lines of MoO42– and Tb3+ monitored with Eu3+ emission indicates that an energy transfer process occurs from MoO42– and Tb3+ to Eu3+ in NaTb (MoO4)2:Eu3+ sample. Upon excitation at 395 and 486 nm, the emission spectrum of NaTb (MoO4)2:Eu3+ sample consists of a group of lines in the range of 550 to 750 nm, which can be assigned to 5D0–7FJ (J = 1, 2, 3, 4) transitions of Eu3+, respectively (Fig. 5b). The emission spectrum is dominated by the 5D0–7F2 (615 nm) transition of Eu3+ ions. Moreover, it can be found that the emission intensity excited

194 | Jia-Yue Tian, Jing Zhao, Cui-Miao Zhang, Guang Jia and Shuang Liu by the f-f transition of Tb3+ (486 nm, 7F6 –5D4) is much higher than that of intensity excited by f-f transition of Eu3+ (395 nm, 7F0–5L6). Moreover, the characteristic emission peaks of Tb3+ ions cannot be detected from the emission spectrum. The results provide further evidence for the efficient energy transfer from Tb3+ to Eu3+ in NaTb (MoO4)2 host, which agrees well with the previous reports [13,15,17].

Fig. 5: Photoluminescence (a) excitation and (b) emission spectra of NaTb (MoO4)2:Eu3+ sample.

3 Conclusions In summary, a facile hydrothermal route has been developed to synthesize NaTb (MoO4)2:Eu3+ phosphors. The phase, morphology, particle size, and luminescence properties of the as-obtained samples were characterized by XRD, SEM, FT-IR, EDX and PL spectra, respectively. The component of solvent has great effect on the morphology and particle size of the products. The as-synthesized NaTb(MoO4)2:Eu3+ sample exhibit pure characteristic red emission of Eu3+ induced by an efficient ener-

Synthesis and Luminescence Properties Hierarchical Microcrystals | 195

gy transfer from MoO42– and Tb3+ to Eu3+. Such a simple synthesis strategy may be useful for the synthesis of other lanthanide molybdates. Acknowledgement: This research was supported by the Second Batch of Top Youth Talent Support Program of Hebei Province, Distinguished Young Scholars Fund of Hebei University (2015JQ04), Post-graduate’s Innovation Fund Project of Hebei University (X2016087), and Undergraduate Training Programs for Innovation and Entrepreneurship of Hebei Province (201610075051, 2016003).

References [1] [2]

[3] [4] [5] [6]

[7] [8]

[9]

[10]

[11]

[12]

[13]

[14]

A. M. Kaczmarek and R. Van Deun, “Rare earth tungstate and molybdate compounds – from 0D to 3D architectures,” Chem. Soc. Rev., vol. 42, 2013, pp. 8835-8848. S. B. Cui, Y. S. Zhu, W. Xu, P. W. Zhou, L. Xia, X. Chen, H. Song, and W. Han, “Self-assembly and Modified Luminescence Properties of NaY(MoO4)2:Tb3+,Eu3+ Inverse Opals,” Dalton Trans., vol. 43, 2014, pp. 13293-13298. J. Huang, J. Huang, Y. Lin, X. Gong, Y. Chen, Z. Luo, and Y. Huang, “Spectroscopic Properties of Dy3+-doped NaGd(MoO4)2 Crystal,” J. Alloys Comp., vol. 664, 2016, pp. 266-271. F. Guo, J. Ru, H. Li, N. Zhuang, B. Zhao, and J. Chen, “Growth and Magneto-Optical Properties of NaTb(MoO4)2 Crystals,” J. Crystal Growth, vol. 310, 2008, pp.4390-4393. S. Neeraj, N. Kijima, and A. K. Cheetham, “Novel Red Phosphors for Solid-State Lighting: the System NaM (WO4)2−x (MoO4) x: Eu3+ (M = Gd, Y, Bi),” Chem. Phys. Lett., vol. 387, 2004, 2-6. Z. Xu, C. Li, G. Li, R. Chai, C. Peng, D. Yang, and J. Lin. “Self-Assembled 3D Urchin-like NaY(MoO4)2:Eu3+/Tb3+ Microarchitectures: Hydrothermal Synthesis and Tunable Emission Colors,” J. Phys. Chem. C, vol. 114, 2010, pp. 2573-2582. W. Bi, Q. Meng, and W. Sun, “Luminescent Properties and Energy Transfer Mechanism of NaGd(MoO4)2:Sm3+,Eu3+ Phosphors,” Ceram. Int., vol. 42, 2016, pp. 14086-14093. D. He, C. Guo, S. Zhou, L. Zhang, Z. Yang, C. Duan, and M. Yin, “Synthesis and Thermometric Properties of Shuttlelike Er3+/Yb3+ Co-doped NaLa(MoO4)2 Microstructures,” CrystEngComm, vol. 17, 2015, pp. 7745-7753. F. Mo, L. Zhou, Q. Pang, F. Gong, and Z. Liang, “Potential Red-Emitting NaGd(MO4)2:R (M=W, Mo, R=Eu3+, Sm3+, Bi3+) Phosphors for White Light Emitting Diodes, Ceram. Inter., vol. 38, 2012, 6289-6294. X. Zhang, J. Zhang, Y. Chen, and M. Gong, “Energy Transfer and Multicolor Tunable Emission in Single-Phase Tb3+, Eu3+ Co-doped Sr3La (PO4)3 Phosphors,” Ceram. Int., vol. 42, 2016, pp. 13919-13924. A. I. Ramos-Guerra, J. Guzmán-Mendoza, M. García-Hipólito, O. Alvarez-Fregoso, and C. Falcony, “Multicolored Photoluminescence and Structural Properties of Zirconium Oxide Films Co-doped with Tb3+ and Eu3+ Ions,” Ceram. Int., vol. 41, 2015, pp. 11279-11286. S. Yuan, L. Wang, Y. Yang, F. Cheviré, F. Tessier, and G. Chen, “Novel Color-Tunable Gd2O2CN2:Tb3+, Eu3+ Phosphors: Characterization and Photoluminescence Properties,” Ceram. Int., vol. 42, 2016, pp. 12508-12511. Y. Luo, R. Yang, X. Zhang, B. Hu, S. Hu, L. Zhou, and J. Yang, “Shape-Controllable Hydrothermal Synthesis of NaTbF4:Eu3+ Microcrystals with Energy Transfer from Tb to Eu and Multicolor Luminescence Properties,” CrystEngComm, vol. 17, 2015, pp. 7762-7771. J. Yang, G. Li, C. Peng, C. Li, C. Zhang, Y. Fan, Z. Xu, Z. Cheng, and J. Lin, “Homogeneous OneDimensional Structured Tb(OH)3:Eu3+ Nanorods: Hydrothermal Synthesis, Energy Transfer, and Tunable Luminescence Properties,” J. Solid State Chem., vol. 183, 2010, pp. 451-457.

196 | Jia-Yue Tian, Jing Zhao, Cui-Miao Zhang, Guang Jia and Shuang Liu [15]

[16]

[17]

[18]

[19]

[20]

J. Yang, C. Zhang, C. Li, Y. Yu, and J. Lin, “Energy Transfer and Tunable Luminescence Properties of Eu3+ in TbBO3 Microspheres via a Facile Hydrothermal Process,” Inorg. Chem., vol. 47, 2008, pp. 7262-7270. L. Zhou, J. Yang, S. Hu, Y. Luo, and J. Yang, “Synthesis of 3D Hierarchical Architectures of Tb 2 (CO3)3: Eu3+ Phosphor and its Efficient Energy Transfer from Tb3+ to Eu3+,” J. Mater. Sci., vol. 50, 2015, pp. 4503-4515. Z. Hou, Z. Cheng, G. Li, W. Wang, C. Peng, C. Li, P. Ma, D. Yang, X. Kang, and J. Lin, “Electrospinning-Derived Tb2(WO4)3:Eu3+ Nanowires: Energy Transfer and Tunable Luminescence Properties,” Nanoscale, vol. 3, 2011, pp. 1568-1574. W. Di, J. Li, N. Shirahata, Y. Sakka, M. G. Willingere, and N. Pinna, “Photoluminescence, Cytotoxicity and in vitro Imaging of Hexagonal Terbium Phosphate Nanoparticles Doped with Europium,” Nanoscale, vol. 3, 2011, pp. 1263−1269. G. Jia, C. Huang, L. Li, C. Wang, X. Song, L. Song, Z. Li, and S. Ding, “Hydrothermal Synthesis and Luminescence Properties of Uniform BaMoO4:Ln3+ (Ln = Eu, Tb, Dy, and Sm) Microspheres,” Opt. Mater., vol. 35, 2012, pp. 285-291. C. Zhang, L. Zhang, C. Song, G. Jia, S. Huo, and S. Shen, “Well-Defined Barium Molybdate Hierarchical Architectures with Different Morphologies: Controllable Synthesis, Formation Process, and Luminescence Properties,” J. Alloys Comp., vol. 589, 2014, pp. 185-191.

Jun Yang1, Yu-Xi Liu1, Ji-Guang Deng1 and Hong-Xing Dai2*

PtxNi/meso-Al2O3 (x = 0.602.07): HighPerformance Catalysts for the Hydrogenation of N-Butanal at Low Temperatures Abstract: The P123-assisted sol-gel and polyvinyl alcohol-protected sodium borohydride reduction methods were used to prepare the meso-Al2O3 and 1.601.66 wt% PtxNi/meso-Al2O3 (x = 0.602.07) catalysts, respectively. Physicochemical properties of the samples were characterized by means of inductively coupled plasma-atomic emission spectroscopy (ICP–AES), X-ray diffraction (XRD), transmission electron microscopy (TEM), nitrogen adsorptiondesorption (BET), and X-ray photoelectron spectroscopy (XPS). Catalytic activities of the samples were evaluated for the hydrogenation of n-butanal. It is found that the particle size (2.7 nm) of Pt0.60Ni was smaller than those (3.3 and 3.6 nm) of Pt1.10Ni and Pt2.07Ni, respectively. Among all of the samples, 1.60Pt0.60Ni/meso-Al2O3 possessed the highest surface Ni2+/Ni0 molar ratio. The bimetallic catalysts outperformed the single metal counterparts; with the 1.60Pt0.60Ni/meso-Al2O3 catalyst showing the highest activity (n-butanal conversion and n-butanol selectivity were both 100% within 3 h of hydrogenation at 60 oC and 2.00 MPa). The excellent catalytic performance of 1.60Pt0.60Ni/meso-Al2O3 was related to the well-dispersed bimetallic nanoparticles, unique ordered mesoporous structure, and high surface Ni2+ species concentration. Keywords: Pt-Ni bimetallic nanopartical; mesoporous alumina; supported noble metal catalyst; n-butanl hydrogenation; n-butanol synthesis

1 Introduction Butanol is an important chemical intermediate widely used in the production of

|| 1 Beijing Key Laboratory for Green Catalysis and Separation, Key Laboratory of Beijing on Regional Air Pollution Control, Key Laboratory of Advanced Functional Materials, Education Ministry of China, and Laboratory of Catalysis Chemistry and Nanoscience, Department of Chemistry and Chemical Engineering, College of Environmental and Energy Engineering, Beijing University of Technology, Beijing 100124, China. 2 Beijing Key Laboratory for Green Catalysis and Separation, Key Laboratory of Beijing on Regional Air Pollution Control, Key Laboratory of Advanced Functional Materials, Education Ministry of China, and Laboratory of Catalysis Chemistry and Nanoscience, Department of Chemistry and Chemical Engineering, College of Environmental and Energy Engineering, Beijing University of Technology, Beijing 100124, China.,* Corresponding author's email: [email protected] 10.1515/9783110516623-020 DOI 10.1515/9783110303568-020

198 | Jun Yang, Yu-Xi Liu, Ji-Guang Deng and Hong-Xing Dai plasticizer, lacquers, and varnishes and as a potential gasoline additive [1, 2]. Butanol is usually synthesized from the catalytic hydrogenation of butanal, in which the key issue is the availability of effective catalysts. It is of great significance to develop a high-performance heterogeneous catalyst to synthesize butanol via the hydrogenation of butanal with a high atom economy. It is known that support plays an important role in catalytic hydrogenation reactions. For example, carbon, ceria, alumina, silica, zirconia, and titania as support were used to prepare the supported Pt catalysts for the hydrogenation of aldehydes [27], and they exhibited different catalytic activities due to the different nature of the support. γ-Al2O3 was one of the most commonly used supports since it has a higher surface area, good thermal stability, and chemical inertness. If γ-Al2O3 was fabricated to be an ordered mesoporous material, its higher surface area and unique pore structure are beneficial for the dispersion of metal nanoparticles, thus improving the catalytic activity. It has been reported that supported Pt catalysts showed high activities for the hydrogenation of C=O bonds under mild reaction conditions [811]. Alloying platinum with a transition metal could reduce the use of Pt and enhance the catalytic activity [1214]. For example, the Pt–Ni–Pt(111) or Pt–Co– Pt(111) catalysts showed much higher activity for the hydrogenation of cyclohexene than the corresponding monometallic surfaces [1517], which was related to the modification of the electronic properties due to formation of the subsurface bimetallic structures [17]. Chen and coworkers reported that the PtCo/Al2O3 bimetallic catalysts exhibited significantly higher activity than PtNi/Al2O3 and monometallic Co/Al2O3, Ni/Al2O3, and Pt/Al2O3 catalysts for benzene hydrogenation, while the PtNi/Al2O3 catalysts showed higher activity for cyclohexene hydrogenation [12]. The same group also investigated the hydrogenation of 1, 3-butadiene over supported PtNi bimetallic catalysts at low temperatures, and observed an effect of support on activity of the sample [18]. Although the PtNi/γ-Al2O3 catalysts were used in the hydrogenation of unsaturated hydrocarbons [12, 18], the reports on catalytic hydrogenation of butanal over mesoporous Al2O3-supported PtNi alloys have been rarely seen in the literature. The only relevant work is from Yu's group who studied the hydrogenation of nbutanal over the Ru/C, Pt/C, and Pd/C catalysts at 150 oC and 4.0 MPa, and the authors observed a n-butanal conversion of 100% but a n-butanol selectivity of 6068% [19]. In this work, we report the preparation, characterization, and catalytic activities of ordered mesoporous alumina-supported (PtxNi/meso-Al2O3) PtNi nanoparticles (NPs) for the hydrogenation of n-butanal to n-butanol.

Catalysts for the Hydrogenation of N-Butanal at Low Temperatures | 199

2 Experimental 2.1 Synthesis of Meso-Al2O3 Meso-Al2O3 was synthesized via a simple sol-gel route with triblock copolymer (P123) as soft template [20]. In a typical synthesis, 1.00 g of P123 was first dissolved in 20.00 mL of ethanol at room temperature (RT). Then, 1.50 mL of nitric acid aqueous solution (67 wt %) and 2.04 g (10 mmol) of aluminum isopropoxide were added to the above alcoholic solution under vigorous stirring. The mixture was stirred at RT for 5 h, dried at 60 oC for 2 days, and calcined at a ramp of 1 °C/min from RT to 400 o C, maintained at 400 oC for 2 h, and at a ramp of 10 °C/min from 400 to 800 oC and kept this temperature for 1 h, thus obtaining the meso-Al2O3 support.

2.2 Preparation of Meso-Al2O3-Supported Ni, Pt, and PtxNi NPs The meso-Al2O3-supported Ni, Pt, and PtxNi NPs were prepared using the polyvinyl alcohol (PVA)-protected sodium borohydride reduction method [21]. The typical preparation procedure is as follows: 6.00 mL of PVA (MW = 10,000 g/mol) was added to 1.70 mL of NiCl2 aqueous solution (0.0238 g/mL), 27.0 mL of H2PtCl4 aqueous solution (1.90 mmol/L) or a mixture of 16.80, 20.80 or 23.40 mL of H2PtCl4 aqueous solution (1.90 mmol/L) and 0.64, 0.40 or 0.23 mL of NiCl2 aqueous solution (0.0238 g/mL) with the theoretical Pt/Ni molar ratio = 0.50, 1.00, and 2.00 and the metal/PVA mass ratio = 1.00 : 1.50 at RT under vigorous stirring for 10 min, respectively. After rapidly injecting the 0.1 mol/L NaBH4 aqueous solution (metal/NaBH4 molar ratio = 1.00: 5.00), a dark-brown sol was generated. 0.50 g of the meso-Al2O3 support (the theoretical loading of all catalysts was 2.00 wt %) was added to the above darkbrown sol under stirring until complete adsorption (the solution was totally decolorized) was achieved. The obtained mixture was filtered, washed with deionized water, dried at 80 oC for 12 h, and calcined from RT to 300 oC and maintained this temperature for 2 h. The results of inductively coupled plasma-atomic emission spectroscopic (ICP–AES) investigations reveal that the real Ni, Pt, and PtxNi loadings were 1.54, 1.71, 1.60, 1.56, and 1.66 wt% in Ni/meso-Al2O3, Pt/meso-Al2O3, and PtxNi/meso-Al2O3 (real Pt/Ni molar ratio (x) = 0.60, 1.10, and 2.07), respectively.

2.3 Catalyst Characterization The real metal loadings in the samples were measured by the ICP–AES technique on a Thermo Electron IRIS Intrepid ER/S spectrometer. The X-ray diffraction (XRD) patterns of the samples were obtained on a Philips PW-1800 diffractometer using the Cu Kα radiation (λ = 0.1.5406 nm) at 40 kV and 30 mA. Transmission electron

200 | Jun Yang, Yu-Xi Liu, Ji-Guang Deng and Hong-Xing Dai microscopic (TEM) images of the typical samples were recorded on a JEOL JEM-2010 apparatus (operating at 200 kV). The X-ray photoelectron spectroscopic (XPS, ESCALAB Xi250) technique was used to determine the Pt 4d, Ni 2p, and C 1s binding energies (BEs) of surface species with Mg Kα (hν = 1253.6 eV) as the excitation source. The BE values of Pt 4d, Ni 2p, and C 1s were calibrated against the C 1s signal at BE = 284.6 eV of contaminant carbon. Via N2 adsorption at −196 oC on a Micromeritics ASAP 2020 analyzer, surface areas and pore-size distributions of the samples were determined. Prior to measurement, the samples were degassed at 250 oC for 2.5 h under vacuum.

2.4 Catalytic Activity Evaluation The hydrogenation of n-butanal was carried out in a stainless steel autoclave reactor with a 25-mL Teflon sleeve. 0.05 g of catalyst was first dispersed in 15 mL of methanol, and then 1.00 mmol of n-butanal was added to the above solution. The reactor was sealed, purged with a H2 flow of 15 mL/min for 5 min, and then pressurized to 2.00 MPa. The reaction was conducted at desired temperatures and a stirring rate of 1000 rpm. The effluent from the reactor was analyzed on a gas chromatography (Shimadzu GC2010) using a FID detector and a Stabilwax column (30 m in length).

3 Results and Discussion 3.1 Crystal Phase, Pore Structure, and Surface Area Figure 1A shows the small-angle XRD pattern of the meso-Al2O3 support. There were a strong diffraction peak at 2T = 1.0o and a weak peak at 2T = 1.7o, indicating generation of a good-quality mesoporous structure in the alumina support. By comparing the wide-angle XRD pattern of the standard γ-Al2O3 sample (JCPDS PDF# 10-0425), one can deduce that the alumina in the samples was of the γ-Al2O3 phase, and no XRD signals assignable to the Pt, Ni or PtxNi phases were recorded (Figure 1B). The results indicate that the Pt, Ni or PtxNi particles were highly dispersed on the surface of meso-Al2O3.

(440)

(511)

(400)

(B)

(A)

(200) (311)

Catalysts for the Hydrogenation of N-Butanal at Low Temperatures | 201

(f)

Intensity (a.u.)

Intensity (a.u.)

(e) (d) (c)

(b) (a) 0.5

1.5

2.5

3.5 o

2ș ( )

4.5

5.5

20

40

2ș (o)

60

80

Fig. 1: Small-angle XRD pattern of meso-Al2O3 (inset) and wide-angle XRD patterns of (a) meso-Al2O3, (b) 1.54Ni/meso-Al2O3, (c) 1.71Pt/meso-Al2O3, (d) 1.60Pt0.60Ni/meso-Al2O3, (e) 1.56Pt1.10Ni/mesoAl2O3, and (f) 1.66Pt2.07Ni/meso-Al2O3.

Figure 2 shows the TEM images of the samples. A good mesoporous structure of γ-Al2O3 with an average pore size of ca. 6 nm was observed. Loading the Pt, Ni or PtxNi nanoparticles did not alter the mesoporous architecture, and the metal NPs were highly dispersed on the surface of γ-Al2O3. After analyzing the particle sizes of 150 metal NPs, one can realize that the average diameters of Pt 0.60Ni, Pt1.10Ni, and Pt2.07Ni NPs in 1.60Pt0.60Ni/meso-Al2O3, 1.56Pt1.10Ni/meso-Al2O3, and 1.66Pt2.07Ni/mesoAl2O3 were 2.7, 3.3, and 3.6 nm (Figure 3), respectively.

202 | Jun Yang, Yu-Xi Liu, Ji-Guang Deng and Hong-Xing Dai

(a)

(b)

(c)

80 nm

30 nm

5 nm

(e)

(d)

(f)

30 nm

5 nm

5 nm

Fig. 2: TEM images of (a, b) 1.60Pt0.60Ni/meso-Al2O3, (c, d) 1.56Pt1.10Ni/meso-Al2O3, and (e, f) 1.66Pt2.07Ni/meso-Al2O3.

Average d = 2.7 nm

100

(B) Average d = 3.3 nm

80

Frequency (%)

80

Frequency (%)

100

(A)

60

40

20

60

40

2.0-3.0

3.0-4.0

4.0-5.0

Pt0.60Ni particle size (nm)

60 40

0

0 1.0-2.0

Average d = 3.6 nm

20

20

0

(C)

80

Frequency (%)

100

1.5-2.5

2.5-3.5

3.5-4.5

4.5-5.5

Pt1.10Ni particle size (nm)

2.0-3.0

3.0-4.0

4.0-5.0

5.0-6.0

Pt2.07Ni particle size (nm)

Fig. 3: Metal particle size distributions of (A) 1.60Pt0.60Ni/meso-Al2O3, (B) 1.56Pt1.10Ni/meso-Al2O3, and (C) 1.66Pt2.07Ni/meso-Al2O3.

Figure 4 shows the N2 adsorptiondesorption isotherms and pore-size distributions of the samples. Each of the isotherms was type IV with a hysteresis loop similar to an intermediate between H1 and H2 in the relative pressure range of 0.51.0 (Figure 4A). As shown in Figure 4B, there was a peak in the range of 415 nm, confirming generation of mesopores in the samples. The BET surface area of meso-Al2O3 was 364 m2/g. With the loading of metal nanoparticles, surface area of the sample decreased, possibly due to the blocking of the mesopores. The supported bimetallic

Catalysts for the Hydrogenation of N-Butanal at Low Temperatures | 203

samples possessed a surface area of 237270 m2/g, an average pore size of 5.7 nm, and a pore volume of 0.410.47 cm3/g (Table 1). 7

(A)

(B)

6

(f)

5

(e)

800

(f) 600

(e)

dV /d(logD )

Volume adsorbed (cm3/g, STP)

1000

(d) 400

(c)

4

(d)

3

(c)

2

(b) 200

0 0.0

(b)

1

(a) 0.2

0.4

0.6

Relative pressure (p /p 0 )

0.8

1.0

(a)

0 0

5

10

15

20

25

30

Pore diameter (nm)

Fig. 4: (A) Nitrogen adsorption–desorption isotherms and (B) pore size distributions of (a) mesoAl2O3, (b) 1.54Ni/meso-Al2O3, (c) 1.60Pt0.60Ni/meso-Al2O3, (d) 1.56Pt1.10Ni/meso-Al2O3, (e) 1.66Pt2.07Ni/meso-Al2O3, and (f) 1.71Pt/meso-Al2O3

3.2 Surface Element Composition and Metal Oxidation State XPS is an effective technique to investigate the surface element compositions and metal oxidation states of a catalyst. Figure 5 illustrates the Ni 2p and Pt 4d XPS spectra of the samples and their surface element compositions are summarized in Table 1. It is observed from Figure 5A that there were three components at BE = 852.3, 855.7, and 860.7 eV, attributable to the surface Ni0 and Ni2+ species and the satellite of Ni2+ species [22], respectively. The surface Ni2+/Ni0 molar ratio (4.02) on 1.60Pt0.60Ni/meso-Al2O3 was the highest among all of the samples. It was reported that nickel oxide was the surface active site in the hydrogenation of 2-ethylhexanol [23]. A more amount of NiO species could give rise to a higher catalytic activity, which was confirmed by the activity data presented below.

204 | Jun Yang, Yu-Xi Liu, Ji-Guang Deng and Hong-Xing Dai Table 1: Bet surface areas, pore volumes, pore diameter, average particle sizes, real metal loadings, real pt/ni molar ratios, and surface element compositions of the as-prepared samples. Surface area (m2/g)

Pore Pore Average Real metal Pt/Ni volume size particle size loadinga molar (cm3/g) (nm) (nm) (wt %) ratioa

Ni2+/Ni0 molar ratiob

Pt0 contentb (%)

meso-Al2O3

364

0.58

5.7











1.54Ni/mesoAl2O3

275

0.55

7.8



1.54



2.43



1.60Pt0.60Ni/me 270 so-Al2O3

0.47

5.7

2.7

1.60

0.60

4.02

100

1.56Pt1.10Ni/me 237 so-Al2O3

0.41

5.7

3.3

1.56

1.10

2.24

100

1.66Pt2.07Ni/me 265 so-Al2O3

0.47

5.7

3.6

1.66

2.07

1.29

100

210

0.34

8.5



1.71





100

Sample

1.71Pt/mesoAl2O3

Data were obtained by the ICP-AES technique; b

Data were obtained by quantitatively analyzing the XPS spectra of the samples.

Since the Al 2p and Pt 4f XPS signals overlap, the Pt 4d XPS spectra of the supported Pt or PtxNi samples were used in this study. In the Pt 4d XPS spectra (Figure 5B), there were two symmetrical peaks at BE = 315.0 and 322.0 eV, assignable to the surface Pt0 species [21, 24]. No Ptδ+ species were detected in all of the samples. Therefore, the Pt in the surface of each sample was all Pt0 species.

Catalysts for the Hydrogenation of N-Butanal at Low Temperatures | 205

Fig. 5: (A) Ni 2p and (B) Pt 4d XPS spectra of (a) 1.54Ni/meso-Al2O3, (b) 1.60Pt0.60Ni/meso-Al2O3, (c) 1.56Pt1.10Ni/meso-Al2O3, (d) 1.66Pt2.07Ni/meso-Al2O3, and (e) 1.71Pt/meso-Al2O3

3.3 Catalytic Performance Figure 6A shows the catalytic activities of the samples for the hydrogenation of nbutanal within 3 h of reaction at different temperatures and a H2 pressure of 2.00 MPa. Over the PtxNi/meso-Al2O3 samples, n-butanal conversion increased with a rise in temperature and reached 100% at 60 oC, whereas 87 and 20% n-butanal conversions were achieved over the supported Pt and Ni samples at 60 oC, respectively. Obviously, the PtxNi/meso-Al2O3 samples outperformed the supported Pt or Ni samples at lower temperatures. Figure 6B shows the catalytic activity versus reaction time over the samples for n-butanal hydrogenation at a temperature of 40 oC and a H2 pressure of 2.00 MPa. n-butanal conversions increased with time, the PtxNi/mesoAl2O3 samples exhibited higher activities than the 1.71Pt/meso-Al2O3 sample, and much higher activities than the 1.54Ni/meso-Al2O3 sample. Furthermore, catalytic performance of the supported PtxNi samples increased in the sequence of 1.66Pt2.07Ni/meso-Al2O3 < 1.56Pt1.10Ni/meso-Al2O3 < 1.60Pt0.60Ni/meso-Al2O3, coinciding with the orders in surface Ni2+/Ni0 molar ratio and metal particle size. Chen et al. investigated the hydrogenation of n-butanal over the Ru/C, Pd/C, and Pt/C catalysts at 150 oC and 4.0 MPa of initial hydrogen pressure, and observed that the n-butanal conversion was 100% after 3 h of reaction, but the selectivity to n-butanol was only 6068% [19]. They detected some side products (e.g., n-butane, methane, and propane) that were formed via dehydration-hydrogenation of n-butanol and hydrogenolysis of C4 compounds, respectively. Over our catalysts, however, only n-butanol product was detected in our catalytic system. In addition, the reaction temperature (60 oC) over our catalysts was much lower than that (150 oC) over the carbon-

206 | Jun Yang, Yu-Xi Liu, Ji-Guang Deng and Hong-Xing Dai supported noble metal catalysts [19]. Therefore, the excellent catalytic performance of PtxNi/meso-Al2O3 for n-butanal hydrogenation was associated with the small-sized and well-dispersed metal particles, unique ordered mesoporous structure, and high surface Ni2+ species concentration. 100

100

80

n -butanal onversion (%)

n -butanal conversion (%)

(A)

60 Ƹ Ʒ Ƶ ƶ ƽ

40

1.60Pt0.60 Ni/meso -Al2 O3 1.56Pt1.10 Ni/meso- Al2 O3 1.66Pt2.07 Ni/meso -Al2 O3 1.71Pt/meso -Al2 O3 1.54Ni/meso- Al2O3

20

0

(B)

80

60 Ƹ Ʒ Ƶ ƶ ƽ

40

20

1.60Pt0.60 Ni/meso -Al2O3 1.56Pt1.10 Ni/meso- Al2O3 1.66Pt2.07 Ni/meso -Al2O3 1.71Pt/meso -Al2 O3 1.54Ni/meso- Al2 O3

0

20

30

40

50

Reaction temperature (oC)

60

0

100

200

300

400

Reaction time (min)

Fig. 6: (A) n-butanal conversion after 3 h of reaction as a function of reaction temperature under the conditions of 1.00 mmol n-butanal, 15 mL methanol, and 2.00 MPa H2; and (B) n-butanal conversion as a function of reaction time over the as-prepared catalysts under the conditions of 1.00 mmol nbutanal, 15 mL methanol, 2.00 MPa H2, and 40 oC.

4 Conclusions The meso-Al2O3 and its supported metal nanoparticles (PtxNi/meso-Al2O3) were prepared using the P123-assisted sol-gel and PVA-protected NaBH4 reduction methods, respectively. The as-fabricated gamma-alumina possessed an ordered mesoporous structure with an average pore size of about 6 nm. Pt, Ni or PtxNi nanoparticles were highly dispersed on the surface of meso-Al2O3, and the average particle sizes of PtxNi were in the range of 2.73.6 nm. The 1.60Pt0.60Ni/meso-Al2O3 sample exhibited the highest surface Ni2+/Ni0 molar ratio (4.02). The supported bimetallic catalysts outperformed the supported single metal catalysts for n-butanal hydrogenation, and the 1.60Pt0.60Ni/meso-Al2O3 catalyst showed the best activity (100% n-butanal conversion and 100% n-butanol selectivity within 3 h of hydrogenation at 60 oC and 2.00 MPa). The well-dispersed bimetallic nanoparticles, unique ordered mesoporous structure, and high surface Ni2+ species concentration were responsible for the excellent catalytic performance of PtxNi/meso-Al2O3 for n-butanal hydrogenation.

Catalysts for the Hydrogenation of N-Butanal at Low Temperatures | 207

Acknowledgement: This work was supported by the National Natural Science Foundation of China (21377008 and 21677004), National High Technology Research and Development Program (863 Program, 2015AA034603), Foundation on the Creative Research Team Construction Promotion Project of Beijing Municipal Institutions, and Scientific Research Base Construction-Science and Technology Creation Platform-National Materials Research Base Construction.

References [1] [2] [3]

[4]

[5] [6]

[7]

[8]

[9]

[10]

[11]

[12]

[13]

P. Durre, “Fermentative butanol production: bulk chemical and biofuel,” Ann. N. Y. Acad. Sci., vol. 1125, 2008, pp. 353-362. E. Christensen, J. Yanowitz, M. Ratcliff and R.L. McCormick,. “Renewable oxygenate blending effects on gasoline properties,” Energy Fuels, vol. 25, 2011, pp. 4723-4733. C.M. Piqueras, V. Puccia, D.A. Vega and M.A. Volpe, “Selective hydrogenation of cinnamaldehyde in supercritical CO2 over Me–CeO2 (Me = Cu, Pt, Au): Insight of the role of Me–Ce interaction,” Appl. Catal. B, vol. 185, 2016, pp. 265-271. M. Arai, H. Takahashi, M. Shirai, Y. Nishiyama and T. Ebina, “Effects of preparation variables on the activity of alumina-supported platinum catalysts for liquid phase cinnamaldehyde hydrogenation,” Appl. Catal. A, vol. 176, 1999, pp. 229-237. R. Patricio and R. Hugo, “Hydrogenation of citral over Pt and Pt-Fe/SiO2 catalysts,” React. Kinet. Catal. Lett. vol. 88, 2006, pp. 363-369, doi:. L. Zhu, J.Q. Lu, P. Chen, X. Hong, G.Q. Xie, G.S. Hu and M.F. Luo, “A comparative study on Pt/CeO2 and Pt/ZrO2 catalysts for crotonaldehyde hydrogenation,” J. Mol. Catal. A, vol. 361– 362, 2012, pp. 52-57. Huidobro, A. Sepulveda-Escribano and F. Rodriguez-Reinoso, “Vapor-phase hydrogenation of crotonaldehyde on titania-supported Pt and PtSn SMSI catalysts,” J. Catal., vol. 212, 2002, pp. 94-103. Z.B. Tian, C. Liu, Q.Y. Li, J.Y. Hou, Y. Li and S.Y. Ai, “Nitrogen- and oxygen-functionalized carbon nanotubes supported Pt-based catalyst for the selective hydrogenation of cinnamaldehyde,” Appl. Catal. A, vol. 506, 2015, pp. 134-142. Z.B. Tian, C. Liu, Q.Y. Li, J.Y. Hou, L. Pei, Y. Li and S.Y. Ai, “Platinum nanocrystals supported on CoAl mixed metal oxide nanosheets derived from layered double hydroxides as catalysts for selective hydrogenation of cinnamaldehyde,” J. Catal., vol. 331, 2015, pp. 193-202. M.J. Taylor, L.J. Durndell, M.A. Isaacs, C.M.A. Parlett, K. Wilson, A.F. Lee and G. Kyriakou, “Highly selective hydrogenation of furfural over supported Pt nanoparticles under mild conditions,” Appl. Catal. B, vol. 180, 2016, pp. 580-585. G. Kennedy, L.R. Baker and G.A. Somorjai, “Selective amplification of C=O bond hydrogenation on Pt/TiO2: Catalytic reaction and sum-frequency generation vibrational spectroscopy studies of crotonaldehyde hydrogenation,” Angew. Chem. Int. Ed., vol. 53, 2014, pp. 34053408. S.L. Lu, W.W. Lonergan, J.P. Bosco, S.R. Wang, Y.X. Zhu, Y.C. Xie and J.G. Chen, “Low temperature hydrogenation of benzene and cyclohexene: A comparative study between γ-Al2O3 supported PtCo and PtNi bimetallic catalysts,” J. Catal., vol. 259, 2008, pp. 260-268. T.S. Moraes, R.C.R. Neto, M.C. Ribeiro, L.V. Mattos, M. Kourtelesis, S. Ladas, X. Verykios and F.B. Noronha, “The study of the performance of PtNi/CeO2-nanocube catalysts for low temperature steam reforming of ethanol,” Catal. Today, vol. 242, 2015, pp. 35-49.

208 | Jun Yang, Yu-Xi Liu, Ji-Guang Deng and Hong-Xing Dai [14]

[15] [16] [17]

[18]

[19]

[20]

[21] [22]

[23]

[24]

Z. Jiang, Y.H. Zhao, L.Z. Kong, Z.Y. Liu, Y. Zhu and Y.H. Sun, “Structure-dependent selective hydrogenation of α, β-unsaturated aldehydes over platinum nanocrystals decorated with nickel,” ChemPlusChem, vol. 79, 2014, pp. 1258-1262. B. Jongsomjit, J. Panpranot and J.G. Goodwin, “Effect of zirconia-modified alumina on the properties of Co/γ-Al2O3 catalysts,” J. Catal., vol. 215, 2003, pp. 66-77. N.A. Khan, L.E. Murillo and J.G. Chen, “Observation of novel low-temperature hydrogenation activity on Co/Pt (111) surfaces,” J. Phys. Chem. B, vol. 108, 2004, pp. 15748-15754. M.P. Humbert, L.E. Murillo and J.G. Chen, “Rational design of platinum-based bimetallic catalysts with enhanced hydrogenation activity,” Chem. Phys. Chem., vol. 9, 2008, pp. 12621264. W.W. Lonergan, T.F. Wang, D.G. Vlachos and J.G. Chen, “Effect of oxide support surface area on hydrogenation activity: Pt/Ni bimetallic catalysts supported on low and high surface area Al2O3 and ZrO2,” Appl. Catal. A, vol. 408, 2011, pp. 87-95. W. Chen, Z.Y. Luo, C.J. Yu, G.X. Li, Y. Yang, J.X. Zhang and K.Y. Lu, “Catalytic transformations of acids, aldehydes, and phenols in bio-oil to alcohols and esters,” Fuel, 135, 2014, pp. 20145562. Q. Yuan, A.X. Yin, C. Luo, L.D. Sun, Y.W. Zhang, W.T. Duan, H.C. Liu and C.H. Yan, “Facile synthesis for ordered mesoporous γ-aluminas with high thermal stability,” J. Am. Chem. Soc., vol. 130, 2008, pp. 3465-3472. H.G. Yang, J.G. Deng, Y.X. Liu, S.H. Xie, P. Xu and H.X. Dai, “Pt/Co3O4/3DOM Al2O3: Highly effective catalysts for toluene combustion,” Chin. J. Catal., vol. 37, 2016, pp. 934-946. E.T. Saw, U. Oemar, X.R. Tan, Y. Du, A. Borgna, K. Hidajat and S. Kawi, “Bimetallic Ni–Cu catalyst supported on CeO2 for high-temperature water-gas shift reaction: Methane suppression via enhanced CO adsorption,” J. Catal., vol. 314, 2014, pp. 32-46. R.C. Yang, J.S. Wu, X.G. Li, X. Zhang, Z.H. Zhang and J.T. Guo, “Hydrotreating of crude 2ethylhexanol over Ni/Al2O3 catalysts: Influence of the Ni oxide dispersion on the active sites,” Appl. Catal. A, vol. 383, 2010, pp. 112-118. M. García-Dieguez, I.S. Pieta, M.C. Herrera, M.A. Larrubia, I. Malpartida and L.J. Alemany, “Transient study of the dry reforming of methane over Pt supported on different γ-Al2O3,” Catal. Today, vol. 149, 2010, pp. 380-387.

Fan-Qin Meng1, Zhi-Chao Zhang2, Dong-Xue Zhao3 and Bao-Jie He4

Hysteretic Behavior of CFT Columns with SemiRigid Base Connection under Different Loading Modes Abstract: In order to study the influence of loading modes on the hysteretic behavior of concrete filled steel tubular (CFT) columns with semi-rigid base connections, three loading modes were adopted to simulate the seismic force. With the help of finite element software ABAQUS, the effects of the following parameters were also conducted, including slender ratio and steel ratio. Cumulative plastic deformation rate was employed to evaluate the ductility capacity of CFT columns with semi-rigid base connection type. In conclusion, CFT columns with semi-rigid base connections under loading mode III showed a higher cumulative plastic deformation rate. Keywords: Semi-rigid base connection, CFT columns, loading modes, cumulative plastic deformation rate

1 Introduction In a semi-rigid frame, columns and bases are connected by partially restrained (PR) connections [1], which typically have a moment resisting capacity less than that of the connected base and possess a flexural rigidity between those of a simple connection and a fully rigid connection. Namely, concrete is casted into the steel tube and base with a shallow embedded depth, meanwhile, steel tube is welded together with base. Numerous experimental and numerical studies have clearly showed that the hysteretic behavior of semi-rigid structure is ideal. Many researchers focused their study on the semi-rigid connections to understand their seismic behavior, Mirza and Uy [2] conducted tests in attempt to determine the feasibility of using blind bolts and presents the result of both experimental and finite element analysis on composite columns. Seventeen monotonic and cyclic

|| 1 School of Environment and Architecture, University of Shanghai for Science and Technology, Shanghai 200093, China, [email protected] 2 College of Civil engineering, Tongji University, Shanghai, 200092, China, [email protected] 3 School of Environment and Architecture, University of Shanghai for Science and Technology, Shanghai 200093, China Corresponding: [email protected] 4 Faculty of Built Environment, The University of New South Wales, Sydney 2052, Australia, [email protected] 10.1515/9783110516623-021 DOI 10.1515/9783110303568-021

210 | Fan-Qin Meng, Zhi-Chao Zhang, Dong-Xue Zhao and Bao-Jie He connection tests were conducted by Elghazouli [3], who presented a detailed account of the results from main aspects and outlined a simplified mechanical model for predicting the initial stiffness and moment capacity of blind-bolted angle connections in his paper. To investigate seismic behavior and failure modes of blind bolted concrete-filled steel tubular frames with semi-rigid connections, Wang’s [4] research results demonstrated that concrete-filled steel tubular frames with semirigid connections possessed large hysteretic loops, good ductility, and excellent energy dissipation capacity. With the increasing application of stainless steel, Tao [5] tested seven blind bolted connections to concrete-filled stainless steel columns and the influence of steel type on the joint performance is limited. There is little attention has been paid to do investigating the seismic behavior of CFT columns with semi-rigid connections in spite that the study on seismic behavior of CFT columns with rigid or hinged connections is abundant, not to mention semirigid connections under different loading modes. Zhu [6] carried out an experimental study on the seismic behavior of square steel tubes filled with steelreinforced high-strength concrete columns; Han [7] took a series tests on hysteretic behavior of CFT columns. The main objective of this paper is to investigate seismic behavior of CFT columns with semi-rigid connections under three different kinds of loading modes. The influence of slender ratio and steel ratio were taken into consideration in this paper.

2 Finite Element Model 2.1 Mechanical Properties and Loading Modes A total of 45 finite element models were built in this paper. The mechanical properties of steel and concrete were illustrated in Table1. The length of square section is 346mm. The constitutive relations of constituent materials of CFT columns were employed from ABAQUS. To study the effect of various types of cyclic loading modes, three types of cyclic loading modes were employed according to Takemura’s [8] research. In which, ߂‫ݑ‬ represented the maximum displacement of the specimen. Loading mode I is an equal increasing displacement loading mode, which starts from 0 to߂‫ݑ‬, and the displacement of each step is 0.1߂‫ݑ‬.

Columns with Semi-Rigid Base Connection under Different Loading Modes | 211 Table 1: The mechanical properties of steel and concrete Materials

Strength Grade

Poisson's ratio

267.2

Ultimate Strength/ (ࡺΤ࢓࢓૛ )

Modulus of Elasticity/ E(ࡹࡼࢇ)

Q235

Yield Strength/ (ࡺΤ࢓࢓૛ )

Steel

350.6

2.1×105

Concrete

0.3

C30

23.28

34.87

3.15×104

0.167

Loading mode II is an unequal increasing displacement loading mode, which starts from 0 to߂‫ݑ‬, and displacement of each step is 0 or 0.2߂‫ݑ‬, which interval occurs. Loading mode III is an equal decreasing displacement loading mode, which starts from ߂‫ ݑ‬to 0, and the displacement of each step is ͨǤͩ߂‫ݑ‬Ǥ Three kinds of loading modes were showed in Fig.1. (a)

(b)

(c)

Fig. 1: Three kinds of loading modes, (a) loading mode I, (b) loading mode II, and (c) loading mode III

212 | Fan-Qin Meng, Zhi-Chao Zhang, Dong-Xue Zhao and Bao-Jie He

2.2 Quantitative Analysis of Hysteretic Behavior Cumulative plastic deformation rate was proposed by Akiyama [9] to help designers predict the plastic deformation capacity of CFT columns, which take the damage resulting from accumulated hysteresis dissipated energy. In this paper, cumulative plastic deformation rate serves as a reference to evaluate the plastic deformation capacity. The calculation equation of cumulative plastic deformation rate is as follows. ா೛

Kൌெ

೤ ήఏ೤

Eq-1

(1)

In which, ‫ܧ‬௣ is the cumulative plastic energy dissipation at the end of the component; ‫ܯ‬௬ is the yield moment of component; ߠ௬ represents the angle of the end part of the component reaches the yield moment. In which, ‫ܧ‬௣ could be obtained by the integral calculation of hysteresis curve of CFT columns.

3 Simulation Results and Analysis The finite element model was built under an axial compression and the axial compression ratio is 0.6. (a)

(b)

Columns with Semi-Rigid Base Connection under Different Loading Modes | 213 (c)

(d)

(e)

Fig. 2: The influence of loading modes on cumulative plastic deformation rate. (a) α =0.08, (b) α =0.12, (c) α =0.16, (d) α =0.20, and (e) α = 0.24.

It can be seen in the Fig.2. That the cumulative plastic deformation rate increased with the increase of load mode number, and the cumulative plastic deformation rate of loading mode II and loading mode I was almost the same. Hence, the theoretical research and proposed calculating equations based on loading mode II and I for predicting cumulative energy dissipation capacity was lower than that of from loading mode III. As shown in Fig.2 and Fig.3 (a), with various steel ratios, the cumulative plastic deformation rate ratio of CFT columns which were subjected to loading mode I or loading mode II reached a plateau. But when it comes to loading mode III, the cumulative plastic deformation rate ratio fluctuated from 2.6 to 4.3, and the change law was not obvious. Hence, more attention should be focused on the study of CFT columns with a wider range of steel ratio.

214 | Fan-Qin Meng, Zhi-Chao Zhang, Dong-Xue Zhao and Bao-Jie He Slender ratio was another parameter that had been investigated in this paper. It was evident that the cumulative plastic deformation rate decreased slightly with the increase of slender ratio as shown in Fig.2. Fig.4 provided the cumulative plastic deformation rate of CFT columns with their steel ratio varied from 0.08 to 0.16, in which effect that three different loading modes had exerted on CFT columns with various slender ratio was similar, except when ߙ=0.08. This is because columns with a relatively higher steel ratio performed better on ductility comparing with pure concrete columns. (a)

(b)

5

3

a a a a a

Ratio

a a a a a

4 3 Ratio

2

=0.08 =0.12 =0.16 =0.20 =0.24

1

=0.08 =0.12 =0.16 =0.20 =0.24

2 1

0

0

0

0

Fig. 3: The K ratio when λ=20. (a) K Ratio (loading mode II/ I) and (b) K ratio (loading mode III/ I) (a)

(b)

1.5

0.9 0.6

Loading mode I Loading mode II Loading mode III

0.9 0.6 0.3

0.3 0.0

1.2

Ratio

Ratio

1.2

1.5

Loading mode I Loading mode II Loading mode III

0

0.0

0

Columns with Semi-Rigid Base Connection under Different Loading Modes | 215 (c)

1.5

Ratio

1.2

Loading mode I Loading mode II Loading mode III

0.9 0.6 0.3 0.0

0

Fig. 4: The K ratioሺއ†‡”ͬͨȀͪͨሻ with variousȽ. (a)K ratio when Ƚ=0.08, (b)K ratio when Ƚ=0.12, (c)K ratio when Ƚ=0.16.

4 Conclusions The behavior of CFT columns with a semi-rigid base connection under three different kinds of loading modes was investigated by using finite element model software. Several conclusions can be drawn from the limited test studies. (1) CFT columns with semi-rigid base connections under loading mode III showed a higher cumulative plastic deformation rate. (2) Cumulative plastic deformation rate of CFT columns with semi-rigid base connections under loading mode II and loading mode I were similar, which means that equal and unequal increasing displacement loading mode have similar effect. Acknowledgement: Many thanks go to Prof. Pei-Zhen Xu at Qingdao University of Technology, for providing support when doing ABAQUS numerical simulation. Meanwhile, we would like to thank A/Prof. Mei-Chun Zhu at Shanghai Normal University for giving us valuable suggestions. We appreciate the valuable work from reviewers.

References [1] [2]

AISC, Specification for Structural Steel Buildings (ANSI/AISC 360-10), American Institute of Steel Construction, Chicago, IL, 2010. Mirza O, Uy B. Behaviour of composite beam–column flush end-plate connections subjected to low-probability, high-consequence loading. Engineering Structures, 2011, 33(2): 647-662.

216 | Fan-Qin Meng, Zhi-Chao Zhang, Dong-Xue Zhao and Bao-Jie He [3] [4] [5]

[6]

[7] [8]

[9]

Elghazouli A Y, Málaga-Chuquitaype C, Castro J M, et al. Experimental monotonic and cyclic behaviour of blind-bolted angle connections. Engineering Structures, 2009, 31(11): 2540-2553. Wang J, Wang J, Wang H. Seismic Behavior of Blind Bolted CFST Frames with Semi-Rigid Connections//Structures. Elsevier, 2016. Tao Z, Hassan M K, Song T Y, et al. Experimental study on blind bolted connections to concrete-filled stainless steel columns. Journal of Constructional Steel Research, 2017, 128: 825838. Meichun Zhu, Liu Jianxin, and Wang Qingxiang. "Experimental study of seismic behavior of square steel tubes filled with steel-reinforced high-strength concrete." China Civil Engineering Journal 44.7 (2011): 55-63. Linhai Han. Concrete filled steel tube structure: Theory and practice. Science Press, 2007 [in Chinese]. Takemura, Hiroshi and Kawashima, Kazuhiko. Effect of loading hysteresis on ductility capacity of reinforced concrete bridge pier. Journal of Structural Engineering, Japan, 1997, 43A: 849858. H. Akiyama. Earthquake-resistant limit-state design for buildings. University of Tokyo Press, 1985.

Hong-Wei Xing1, Xiao-Yuan Wang2, Wei Zhang3, Tie-Lei Tian4 and Chao Liu5

Behavior of Liquid Phase Generation of High Phosphorus Oolitic Hematite during Sinter

Abstract: In order to better comprehend the characteristics during sintering of highphosphorus hematite and to promote the development and utilization of highphosphorus iron ore. Combined with FactSage thermodynamic software simulation, this essay provides an all-round analysis in the liquid phase formation behavior of iron ore powder was described by using the X-ray diffract meter (XRD) and Melting point and speed locator during sintering process. The main oxide content was determined by normalized treatment according to the chemical composition of iron ore powder. Using FactSage 7.0 thermodynamic software and data to simulate, the result showed the liquidus temperature of high-phosphorus iron ore was above 1350°C when the binary alkalinity was 3.0. With the ratio of the amount of high-phosphorus iron ore increasing, the liquid phase increased more quickly when the temperature was higher than 1250°C. Using the Melting point and speed locator to verify the approximate test: by changing the ratio between high phosphate iron ore powder and Australian powder, it can be seen that the experimental results are in accordance with the simulation results: with the ratio of high phosphorus iron ore powder increases, The melting temperature of mixture increased, so was the melting rate. The sintered products of high phosphorus iron ore powder were analyzed by XRD, so that the main bonding phase was calcium lron oxide and calcium aluminum lron silicate. It is of great guiding significance for optimizing the sintering ore distribution and improving the sinter production and quality. Keywords: high-phosphorus iron ore; melting point and speed; effective liquid phase; sintering characteristics

|| 1 Metallurgy and Energy College, North China University of Science and Technology, Tangshan, China, E-mail: [email protected] 2 Metallurgy and Energy College, North China University of Science and Technology, Tangshan, China, E-mail: [email protected] 3 Metallurgy and Energy College, North China University of Science and Technology, Tangshan, China, E-mail: [email protected] 4 Metallurgy and Energy College, North China University of Science and Technology, Tangshan, China, E-mail: [email protected] 5 Metallurgy and Energy College, North China University of Science and Technology, Tangshan, China, E-mail: [email protected] 10.1515/9783110516623-022 DOI 10.1515/9783110303568-022

218 | Hong-Wei Xing, Xiao-Yuan Wang, Wei Zhang, Tie-Lei Tian and Chao Liu

1 Introdoution Iron ore resources is very rich in China, the amount of resources not identified is far greater than 100 billion tons [1], widely distributed a considerable number of lowgrade, complex symbiotic high-phosphorus iron ore deposits, abundant reserves. The proven resource is 10 billion tons of reserves in its western Hubei region of 4 billion tons, mainly in Hubei Yichang, Enshi and Yunnan Wuding and other regions. "Ningxiang type" high phosphorus oolitic hematite with high phosphorus and complex structure, has not yet been developed and used, belongs to "dull" mineral resources [2-7]. If it can be developed effectively, iron and steel enterprises will be able to further improve the profit margins, reduce the dependence on imported ore, improve China's international iron ore pricing power. The steel industry is developing rapidly in the range of the world, the natural rich ore because of its production and quality constraints can no longer meet the traditional blast furnace smelting, and lean ore through the selected concentrate cannot be directly into the blast furnace smelting, can only use artificial enrichment methods to meet production needs. The main man-made methods of enrichment are sintering and pellet method [8]. The sintering method is the most widely used method of man-made ore-enrichment in the world. Its principle is to mix the powdered iron-containing raw materials into a certain amount of flux, fuel, back-ore and substitutes as required, Equipment for ignition sintering [9]. Sintering liquid produced by the liquid phase as the basis for consolidation sintering material [10]. The quantity, composition and properties of the liquid phase in the iron ore sintering process determine to a large extent the properties and strength of the sinter. It also involves extremely complex three-phase melt-solids-gas systems [11], and various physical and chemical phenomena such as momentum, heat and mass transfer coupled with combustion, melting, solidification, evaporation and condensation [12]. In order to better understand the self-sintering characteristics of highphosphorus iron ore powder, to optimize the sintering ore, the test selected Yichang oolitic iron ore powder, the sintering process of liquid phase formation of the thermodynamic simulation, and through the test Effect of Proportion of High Phosphorus Iron Oxide Powder on Melting Rate of Melting Point in Sintering Process.

2 Experimental Analysis High-phosphorus oolitic iron ore in Yichang of Hubei, Australian powder, and CaO reagent were used as raw materials. The chemical composition of iron ore powder is shown in Table 1.

Generation of High Phosphorus Oolitic Hematite during Sinter | 219 Table 1: Iron Ore Powder Chemical Composition Name of iron ore powder

chemical composition/% TFe

Fe2O3

FeO

SiO2

CaO

MgO

Al2O3

High phosphorus iron ore powder

51.73

64.96

8.10

8.88

4.20

0.47

5.42

Australian powder

58.69

83.25

0.59

4.50

0.68

0.22

1.39

The thermodynamic simulation of the Phase Diagram module and the Equilib module was carried out using the FToxid database by FactSage 7.0 software, and the effect of the proportion of the high phosphorus iron ore powder on the amount of liquid phase was studied. Because of the influence of material structure and dynamics in the normal experiment, so the experiment is carried out to verify the influence rule on the basis of the guidance of thermodynamics simulation.

3 Factsage Thermodynamic Software Simulation 3.1 Phase Diagram Module Simulation According to the chemical composition of the two iron ore powder in table 1, the main oxide is selected and normalized, and the data required for simulation are determined. Fig. 1 shows the Fe2O3-CaO-SiO2-Al2O3 quaternary phase diagram with different Al2O3 contents. The up side of the figure is quaternary phase diagram with Al2O3 content of 5.73%, another is 1.41%.

220 | Hong-Wei Xing, Xiao-Yuan Wang, Wei Zhang, Tie-Lei Tian and Chao Liu

Fig. 1: The simulated liquid phase of iron ore powder.

If the two graphs represent high-phosphorus iron ore powder and Australian powder, the difference of the chemical composition between the two ore powder is the content of Fe2O3 and Al2O3. The content of Al2O3 decreases and the liquid phase region moves towards Fe2O3 [13], and the lowest liquid phase temperature increases from 1175°C to 1200°C. The content of Fe2O3 in the iron ore powder was calculated by TFe and the position of the Fe2O3 was determined. When the basicity(R=CaO/SiO2) is 2.0, as shown in the intersection of basicity and iron content shown in the location, the high phosphorus iron ore liquidus temperature is above 1350°C, the Australian

Generation of High Phosphorus Oolitic Hematite during Sinter | 221

powder liquidus temperature is above 1400°C; When the basicity is 3.0, the Australian powder liquidus temperature is about 1375°C. If any two of temperaturealkalinity-iron content in the map was determined, the location of another parameter is definite. Taking into account the dynamic factors, the simulation of the data also need to rely on further verification test and optimization.

3.2 Equilib Module Simulation The effect of the proportion of high phosphorus iron ore powder on the liquid phase was researched by Equilib module in FactSage. According to the chemical composition of the high phosphorus iron ore and the Australian powder, the main oxide was selected for the thermodynamic Equilib module simulation calculation. Therefore, the simulated contents of the components are shown in Table 2. Table 2: Calculation of the Chemical Composition /% P content

Fe2O3

FeO

SiO2

CaO

MgO

Al2O3

ω(P)=0.4%

76.38

3.02

5.87

11.74

0.3

2.68

ω(P)=0.6%

72.54

4.23

6.53

13.05

0.34

3.32

ω(P)=0.8%

68.72

5.42

7.18

14.35

0.37

3.95

ω(P)=1.0%

64.91

6.61

7.83

15.67

0.41

4.57

The FToxid database containing various oxides was selected, and the initial conditions were input to the Equilib module. The FToxid-SLAGA was selected to calculate the liquid phase generation during the sintering. The FToxid MeO was selected to calculate the solid phase reactions which appear among the FeO, MgO, CaO, and MnO[13].The reactions happening in the four groups from 800°C to 1350°C in the step of 25°C were calculated. The results were shown as followings.

222 | Hong-Wei Xing, Xiao-Yuan Wang, Wei Zhang, Tie-Lei Tian and Chao Liu

100

mass of the liquid phase˄g˅

Z(P)=0.4 Z(P)=0.6

80

Z(P)=0.8 Z(P)=1.0

60

40

20

1150

1200

1250

1300

1350

tempeture˄ć˅

Fig.2: Material liquid with the temperature change.

It shows that the quantity of liquid phase increases with the increase of temperature, and when the temperature is higher than 1225°C, it grows relatively quickly. For these four sets of data, the proportion of high phosphorus iron ore powder is higher, liquid phase increases in the faster. When the temperature is below 1250°C, the liquid phase changes in the amount of smaller differences, but higher than this temperature, the gap increases. Figure 3 shows the simulation of liquid phaserelated substances change process.

Generation of High Phosphorus Oolitic Hematite during Sinter | 223

Fig.3: Simulates the change of the liquid-phase related substances with temperature.

Figure 3 shows that the liquid phase started at about 1125°C, the material generated at the beginning of liquid phase, due to the generation of melting CAF3, such as Ca(Al,Fe)2O4 like calcium ferrite or complex ; The increase of liquid phase in the middle stage is due to the decrease of bC2SA, such as silicate material; the increase of liquid phase in later stage is due to the formation of melting salts and oxides by various oxides, such as Ca2Fe1Si2O7 and other substances, and the liquid phase is significantly increased.

4 The Proportion Of High Phosphorus Iron Ore Powder On The Amount Of Liquid 4.1 Melting Point and Speed Locator Test Adding high-phosphorus iron ore powder to the Australian powder, the raw material phosphorus content of 0.4%, 0.6%, 0.8%, 1.0%, by adding CaO reagent and mix well, so that the material has a basicity of 3.0.

224 | Hong-Wei Xing, Xiao-Yuan Wang, Wei Zhang, Tie-Lei Tian and Chao Liu Table 3: Material composition ratio /% Number

High phosphorus iron ore powder

Australian powder

CaO

1#

29.86

56.24

13.90

2#

44.78

40.00

15.20

3#

59.70

23.84

16.46

4#

74.62

7.64

17.72

Preparation of the sample and observe the shrinkage of the heated sample at different times to record the sample liquid formation characteristic temperature. The influence of temperature on the liquid phase during the process of adding high phosphorus hematite was studied.

60

   

melting shrinkage˄%˅

50 40 30 20 10 0 1260

1270

1280

1290

1300

1310

1320

1330

1340

temperature˄ć˅

Fig.4: Effect of proportion of high phosphorus iron ore powder on liquid phase.

By changing the ratio between the high phosphate rock and the Australian powder, it can be seen that when the proportion of the high phosphorus iron ore powder is low, the melting temperature of the mixture begins to be low, the melting speed is slow; with the high phosphorus iron ore powder ratio increase, the melting temperature increases, but the melting rate increases continuously. When the iron powder has a shrinkage of 20%, the liquid phase is allowed to flow, which indicates that the liquid phase satisfying the effective bonding is generated at this time; and when the iron powder has a shrinkage of more than 50%, the liquid phase exhibits complete Flow state, this time will make the adhesive layer between the particles is too thin, cannot play an effective bonding effect. Figure 4 can be seen with the addition of high phosphorus iron ore powder, 1# or 2#, then mixed material P content of 0.4% to 0.6%, relatively low melting temperature, and melting more than 50%, the

Generation of High Phosphorus Oolitic Hematite during Sinter | 225

melting rate was significantly reduced slow, it is possible to suppress the formation of an excessively thin adhesive layer.

4.2 XRD Analysis 300

250

6)&$

㹽ሴᕪᓖ

200

150



100

50

0 10



20



30

40

50

60

70

80

2T/°

Fig. 5: XRD analysis of sintered materials.

High phosphorus iron ore and analytical grade CaO were prepared with R=3.0 and heated to 1250°C for 30 min. The calcined products were analyzed by XRD. The main binder phase is calcium lron oxide and calcium aluminum lron silicate. Because high phosphorus iron ore powder SiO2 content of more fixed binary alkalinity, the addition of CaO is relatively large, easy to produce iron oxide reaction of Fe2O3 or calcium ferrite complex, which also led to high phosphorus iron ore powder with more, the liquid phase volume increased rapidly.

5 Conclusion The main oxide content was determined by normalized treatment according to the chemical composition of iron ore powder. Using FactSage thermodynamic software and data to simulate, the result showed the liquidus temperature of highphosphorus iron ore was 1350°C~1375°C when the basicity was 3.0. With the ratio of the amount of high-phosphorus iron ore increasing, the liquid phase increased more quickly when the temperature was higher than 1250°C. Using the Melting point and speed locator to verify the approximate test: by changing the ratio between high

226 | Hong-Wei Xing, Xiao-Yuan Wang, Wei Zhang, Tie-Lei Tian and Chao Liu phosphate iron ore powder and Australian powder, it can be seen that the experimental results are in accordance with the simulation results: with the ratio of high phosphorus iron ore powder increases, the temperature of mixture beginning to melt increased, so was the melting rate. The sintered products of high phosphorus iron ore powder were analyzed by XRD, so that the main bonding phase was calcium lron oxide and calcium aluminum lron silicate. Acknowledgement: This work was financially supported by the China National Natural Science Foundation (51274081)

References [1] [2] [3] [4] [5] [6] [7] [8] [9] [10] [11] [12]

[13]

Zhangfu Yuan, Xiaoqiang Wang, Cong Xu. A new process for comprehensive utilization of complex titaniaore[J]. Minerals Engineering, 2006, 19(9):975-978. Zhao Yiming.China's iron ore resources status, assurance degree and countermeasures [J] .Geological Review, 2004, 50 (4): 396,417. Hou Zonglin. Status and potential of iron ore resources in China [J]. Contributions to Geology and Mineral Resources Research, 2005, 20 (4): 242-247. Zhang Jisheng. Status and development trend of iron ore resources development and utilization in China [J].Iron & Steel, 2007, 42 (2): 1-6. XU Ye-bing, DENG Jun.Study on the countermeasures of iron ore resources support in China [J] .Land and Resources Information, 2006, 6: 37-40. YIN Wan-zhong, DING Ya-zhuo. Utilization status of refractory iron ore resources in China [J]. Nonferrous Metals, 2006, 8: 163-168. Zhao Yiming, Bi Chengsi.Spatiotemporal distribution and evolution of Ningxiang-type sedimentary iron deposits [J]. Mineral Deposits, 2004, 19: 350-362. Wu Shengli, Chen Dongfeng, Zhao Chengxian, et al.Experimental study on improving the burning property of sintered fuel in thick layer. Iron & Steel, 2010, 45 (11): 16-21. Zhang Rende.Sinter behavior of blends with high proportion of Australian ores in Chongqing iron and steel company [D] .Chongqing: Chongqing University, 2014. Zhang Heli. Baosteel high proportion of iron ore and iron-containing composite lumping process research [D]. Changsha: Central South University, 2014. Dongmei Liu, Chin Eng Loo, Geoffrey Evans. Flow characteristics of the molten mix generated during iron ore sintering [J]. International Journal of Mineral Processing, 2016, 149:56–68. Zhilong Cheng, Jian Yang, Lang Zhou, et al.Sinter strength evaluation using process parameters under different conditions in iron ore sintering process [J]. Applied Thermal Engineering, 2016: 1-11. Xuewei Lv, Chenguang Bai, Qingyu Deng, et al. Behavior of Liquid Phase Formation during Lron Ores Sintering[J]. ISIJ International, 2011, 5(51):722–727.

Yi-Lin Li1 and Bao-Wei Song2

Influence of the UUV Body on the Performance of the Propeller Abstract: In the design and analysis of marine propellers, open water characteristics are always used. For the UUV (Unmanned Underwater Vehicle), the propeller works in the wake field of UUV body. This paper is dedicated to investigate the influence of the UUV body on the performance of the propeller. The propeller’s performances are calculated with and without the UUV body’s influence using an in-house BEM (Boundary Element Method) code. The comparison indicates that the inclusion of the UUV body leads to larger thrust, torque and efficiency. This finding can provide a reference for the UUV propeller design. Keywords: UUV; marine propeller; wake field; BEM

1 Introduction UUV (Unmanned Underwater Vehicle) is an efficient tool to investigate the marine environment. Recently, the demand for long cruising time and energy saving becomes more and more important. At the same time, the onboard energy is restricted by the UUV’s limited size. Thus, it is vital to consider more details about the propeller design and try to improve the efficiency. However, most of the time, the performance of marine propellers is represented by open water characteristics, i.e. the thrust coefficient, torque coefficient and efficiency of the propeller when it operates in the uniform flow. The series charts of marine propellers are also always based on the open water characteristic [1]. To verify the design result, the obtained propeller is analyzed by CFD (Computational Fluid Mechanics) method or experimental method for the open water characteristic. However, the propeller works in the wake field of vehicles, such as ship and UUV (Unmanned Underwater Vehicle). The wake field is rarely uniform. Thus, the first step for efficiency improvement is to find out the influence of the wake field of the UUV body on the propeller’s performance more clearly. The current work is dedicated to study the influence of the UUV body on the propeller’s performance in detail. The propeller’s performance is calculated in the uniform flow field and in the wake field of the UUV body, respectively. Then, the || 1 School of Marine Science and Technology, Northwestern Polytechnical University, Xi’an, China, [email protected] 2 School of Marine Science and Technology, Northwestern Polytechnical University, Xi’an, China 10.1515/9783110516623-023 DOI 10.1515/9783110303568-023

228 | Yi-Lin Li and Bao-Wei Song obtained performances are compared to investigate the influence. The performance is analyzed with BEM (Boundary Element Method), which is time-saving and always adopted in the primary stage of the propeller’s design. BEM is introduced to the analysis of the flow around marine propellers in [2]. Afterwards, many researchers have contributed to its improvement [3-6]. Recently, Wang [7] applied BEM to the prediction of the tip vortex cavitation inception. Different wake align methods have been compared in [8]. We chose the fastest one in the current work. The wake field of the UUV body is calculated with the commercial CFD solver ANSYS FLUENT, and then used as the inflow velocity field in BEM for the analysis of the propeller. In the current work, the three-blade propeller DTMB4119 [9] is adopted for the study. Firstly the BEM code is validated by the experimental data. Then, the performances are evaluated and the influence of the UUV body is analyzed.

2 Calculation of the Wake Field of the UUV Body Without loss of generality, the UUV body analyzed in the current work is axisymmetrical. Thus, 2D axisymmetrical FLUENT solver is adopted. The computational domain and mesh are shown in Figure 1(a). The coordinates of the MK46 torpedo, which is a typical streamline shape, are used to determine the shape of the UUV body. Totally 77K 2D quad cells are used. The grids around the UUV body are refined to capture the boundary layer flow. The y+ value around the UUV body lies in the range from 30 to 60. The final mesh around the UUV body is shown in Figure 1(b). The SST (Shear Stress Transport) k-omega model [10] is adopted as the turbulence model in the simulation. The convergent results are got with 500 iterations. The obtained axial velocity field is shown in Figure 2. The axial velocities at the propeller’s position, which is also shown in Figure 2, are extracted as the inflow velocities utilized for the analysis of the marine propeller. To make the data easier to be used, the obtained axial velocity is fitted as a polynomial function of the non-dimensional radius. The function polyfit in Matlab is adopted for the fitting. The original data got from the CFD result and the fitting result is shown in Figure 3. The obtained formula for the fitting function is vx va

3

2

r §r· §r· 0.4442 ¨ ¸  1.6981¨ ¸  2.0595  0.1769 R ©R¹ ©R¹

(1)

where va is the advance velocity of the UUV, vx is the axial velocity, R is the propeller’s radius (10mm less than the UUV body radius), and r is the radius of the data’s position. The fitting formula is a good approximation for the wake field obtained

Influence of the UUV Body on the Performance of the Propeller | 229

with FLUENT. In the BEM simulation, when the axial wake velocity is needed, equation (1) is used to calculate it. (a)

(b)

Fig.1: The mesh used in the wake flow calculation. (a) The overall domain and mesh, and (b) the mesh around the UUV body.

Fig. 2: The non-dimensional axial velocity around the UUV body.

230 | Yi-Lin Li and Bao-Wei Song

Fig. 3: The original axial velocity data obtained from the CFD result and the fitting result. Table 1: Basic dimensions of propeller DTMB4119 Parameter

Value

Boss Ratio

0.20

Pitch Ratio at 0.7R

1.084

Number of Blades

3

Angle of Skew

0

Angle of Rake

0

Designed Advance Ratio

0.833

3 Evaluating The Propeller’s Performance The propeller DTMB4119 is used in the current work. The basic dimensions of this propeller are given in Table 1. An in-house BEM code developed in Chinese NPU is adopted to evaluate the propeller’s performance. The panel numbers in the radial and chordwise directions are chosen as 25 and 60, respectively. The cosine function is used for the chordwise panel distribution to concentrate panels at leading edge and trailing edge. Orthogonal grid is used to improve the accuracy of the BEM code. The panel arrangement on the blade surface is shown in Figure 4. The non-dimensional variables utilized in this paper are defined as following:

Influence of the UUV Body on the Performance of the Propeller | 231

T

Thrust coefficient: KT

U n2 D 4

Torque coefficient: K Q

U n2 D5

Advance coefficient: J Efficiency: KT

vaT 2S nQ

Q

va nD J KT 2S K Q

where T stands for thrust, Q for torque, n for the rotation speed in revolution per second, and D for the propeller’s diameter. The BEM code is firstly verified by comparing the open water characteristics obtained from the BEM code with the experimental data. The fastest wake align algorithm referred in [8] is adopted in the current work. The convergence is considered to be achieved when the residuals of the thrust coefficient KT and torque coefficient KQ are both less than 1e-4 in two consecutive steps. The results are shown in Figure 5, where K denotes the efficiency. The performances obtained with the current BEM code correlate very well with the experimental data. Thus, the results obtained with the current BEM code can be trusted.

Fig. 4: Panel arrangement on the DTMB4119 propeller blade.

232 | Yi-Lin Li and Bao-Wei Song

Fig. 5: The comparison of the open water characteristics obtained from BEM with the experimental measurements.

Fig. 6: The comparison of the propeller’s performance predicted with and without the wake field.

The propeller’s performances obtained with the wake field described in the former section and without the wake field (i.e. in the uniform flow field) are compared in Figure 6. At different advance ratios, the thrust and torque are always larger when the influence of the UUV body is included. Furthermore, the UUV body also leads to higher efficiencies. The differences increase with the advance ratio. One may argue that the increase of the thrust and torque is caused by the axial velocity deficit in the inflow, which makes the real advance ratio smaller. Smaller advance ratio could make the thrust and torque larger. However, the increase of the efficiency can only be explained by the velocity distribution caused by the UUV body.

Influence of the UUV Body on the Performance of the Propeller | 233

4 Conclusion To investigate the influence of the UUV body on marine propellers performance, the current work analyzes the performance of the propeller DTMB4119 in the uniform inflow and in the wake field of a UUV body. The 2D axisymmetrical FLUENT solver is adopted to calculate the velocity field around the UUV body. The wake field is obtained by extracting the axial velocity at the propeller’s position. An in-house BEM code is firstly verified and then used to evaluate the propeller’s performance. The results show that the inclusion of the UUV body leads to larger thrust coefficient, torque coefficient and efficiency. Such a finding serves as a reference for the design of the UUV propeller. The inclusion of the UUV body’s influence during the design of propeller is essential. Future work will be focused on the technique to design the UUV propeller optimistically with the consideration of the wake field.

References [1] [2] [3] [4] [5] [6]

[7] [8]

[9] [10]

Carlton and John. Marine Propellers and Propulsion (Third Edition). Elsevier, 2012. Kerwin, J. "A Surface Panel Method for the Hydrodynamic Analysis of Ducted Propellers." Society of Naval Architects and Marine Engineers-Transactions 95(1987):93-122. Hoshino, T. "Hydrodynamic Analysis of Propellers in Steady Flow Using a Surface Panel Method.” Naval Architecture & Ocean Engineering, 28(1990):19-37. Kinnas, S. A. and Hsin, C. "Boundary element method for the analysis of the unsteady flow around extreme propeller geometries." AIAA Journal, 30(1992):688-696. Lee, H. "Modeling of Unsteady Wake Alignment and Developed Tip Vortex Cavitation. " The University of Texas at Austin, the University of Texas at Austin, 2002. Baltazar, J. "On the modeling of the potential flow about wings and marine propellers using a boundary element method." Instituto Superior Técnico, Lisbon, Portugal, Instituto Superior Técnico, Lisbon, Portugal, 2008. Wang, Youjiang, M. Abdel-Maksoud, K. Wang, and B. Song. "Prediction of tip vortex cavitation inception with low-order panel method." Ocean Engineering 125(2016):124-133. Wang, Youjiang, M. Abdel-Maksoud, and B. Song. "Convergence of different wake alignment methods in a panel code for steady-state flows." Journal of Marine Science & Technology (2016):1-12. Jessup, S. "An experimental investigation of viscous aspects of propeller blade flow." Catholic University, Catholic University, 1989. Menter, F. R. "Two-equation eddy-viscosity turbulence models for engineering applications." AIAA Journal 32.8(1994):1598-1605.

Xiao-Meng Zhang1, Zhan-Yong Yao2, Teng-Hai Yu3 and Shuo Zhang4

Piezoresistivity of Polyethylene Terephthalate Nickel Powder Composite

Abstract: The mechanical properties, electrical resistivity and piezoresistivity of polyethylene terephthalate (PET) nickel powder composite were studied. The composite was produced by mix melted PET with river sand and nickel powders. The properties of composite were investigated by different nickel powder’s content and load scenario. The results show that the electrical resistivity of composite is improved by nickel powder added. The electrical conductive percolation threshold of composite is 30%. The effect of loading rate on piezoresistivity of composite is negligible. The piezoresistivity of composite has the best repeatability by cyclic loading. The fractional change in resistivity to stress regression equation is obtained by statistical analysis as the nickel powder content is 30%. Keywords: Polyethylene terephthalate; Nickel powder; Mechanical property; Electrical resistivity; Piezoresistivity

1 Introduction Asphalt pavements health monitoring has the role of continuously monitoring and evaluating the mechanical state of asphalt pavements. It is able to provide real time data on the condition of pavements by using sensor measuring parameters like stress, strain, temperature, etc. This information will help engineers in the timely detection of asphalt pavement’s distress, leading to informed decisions on its maintenance [1]. However, the asphalt pavements have extremely complicated mechanical properties in different environments. In order to monitor the mechanical state of asphalt pavements accurately, the deformation of sensor must be compatible with asphalt mixture. In other words, the sensor’s materials should have similar elastic modulus to the asphalt mixtures, which is 800 MPa to 2100 MPa in different mix proportions. Using asphalt as matrix to produce sensor could easily obtain the same modulus to the asphalt mixture. However, this kind of sensor has poor repeatability as the asphalt has high viscidity and plasticity [2-8]. Recent researches show

|| 1 School of Civil Engineering, Shandong University, Jinan, China, E-mail: [email protected] 2 School of Civil Engineering, Shandong University, Jinan, China, Corresponding author e-mail: [email protected] 3 School of Civil Engineering, Shandong University, Jinan, China, E-mail: [email protected] 4 School of Civil Engineering, Shandong University, Jinan, China, E-mail: [email protected] 10.1515/9783110516623-024 DOI 10.1515/9783110303568-024

236 | Xiao-Meng Zhang, Zhan-Yong Yao, Teng-Hai Yu and Shuo Zhang that some polymers also have similar modulus with asphalt mixture, for example, Polyethylene terephthalate (PET), Polypropylene (PP) and High Density Polyethylene (HDPE). PET, a semi-crystalline polymer, is the first linear thermoplastic polymer which is industrialized. It is widely employed as a raw material to produce products such as bottles for soft-drinks and containers for the packaging of food and other consumer goods [9-10]. However, PET is material with low electrical conductivity. And it is theoretically feasible to improve the conductivity of PET by the addition of conductive additives. Therefore, it is possible to use PET as matrix to produce asphalt pavement sensor. And this sensor would function based on the principle of piezoresistivity, defined as the dependence of electrical resistivity on the applied stress. Immense research efforts focused on utilizing different conductive additives for the preparation of polymer composites that are highly electrically conductive and piezoresistivity [11-17]. One of conductive additive is nickel powder. Nickel powder is manufactured through carbonyl refining technology that uses Ni (CO) 4. The nickel powder morphology is highly specific. One type of nickel is composed of individual spherical particles with spiky surfaces. Another type is characterized by strings of spherical particles with spiky surfaces. The nickel powders is stabilized with an oxide coating and contain approximately 0.8% oxygen. Several researchs have been investigated nickel powder polymer composites. HDPE matrix is blended with a special grade of branch-structured nickel particles has highly electrical conductive in high filler content. Young’s modulus of this composite increase from 606 MPa to 1057 MPa when composites are filled with 20 vol. % nickel powders. The electrical conductivity of HDPE nickel powder composite reaches a value of 8.3×103 S m-1 as filled with 30 vol. % nickel powders [18]. Han investigated using epoxy resin and silicon rubber as matrix and nickel powder as conductive additive to produce composites. The fractional change in resistivity of epoxy resin-nickel powder composite is 69.98% as the compressive stress is from 0 to 12.5 MPa. As the nickel powder content decreases, the piezoresistivity of composite increased. The silicon rubber-nickel powder composite also had good piezoresistivity. As the nickel powder content increases, the mechanical response of composite changes obviously. The electrical resistance of composite changes 11 order of magnitudes as the stress increases from 0 to 2 MPa [19-21]. This paper investigated the mechanical properties, electrical resistivity and piezoresistivity of PET nickel powder composite by different load scenarios.

Piezoresistivity of Polyethylene Terephthalate Nickel Powder Composite | 237

2 Experimental 2.1 Specimen Preparation The PET particles are supplied by Jinan Plastic Factory. The density of the PET particles is 1.35 g/cm3, melting point is 260 °C, maximum particle size is 4 mm and minimum particle size is 2 mm. The fine aggregate is local river sand which has a fineness modulus of 2.87, density of 2.317 g/cm3, and water absorption of 1.4%. The fine aggregate grading is shown in Table I. Table 1: Aggregate Grading Size/m m

9.3~4.75

Content 1 /wt.%

4.75~2.36 2.36~1.18 1.18~0. 0.6~0.3 0.3~0.1 0.15~0.075 ˘0.075 6 5 30

20

20

10

7

5

7

The conductive additive is nickel powder which obtained from Sinopharm Chemical Reagent Company. The properties of nickel powder are shown in Table II. Table 2: Properties of Nickel Powder Shape

Black powders

Particle size

Chemical compositions Ni

˘1.5μm 99.9%

Fe

Cu

Mn

Mg

Si

C

As

˘ 0.0002

˘ 0.0002

˘ 0.0001

˘ 0.0002

˘ 0.0005

˘ 0.0076

˘0.0001

The PET to aggregate ratio is 1:3 by weight. The nickel powder content of composite are 15 wt.%, 20 wt.%, 25 wt.%, 30 wt.%, 35 wt.% and 40 wt.% of PET and aggregate. The mix proportion is shown in Table III.

238 | Xiao-Meng Zhang, Zhan-Yong Yao, Teng-Hai Yu and Shuo Zhang Table 3: Mix Proportion of Pet Nickel Powder Composite PET to Aggregate

Nickel Powder Content %

Ni15

1:3

15

Ni20

1:3

20

Ni25

1:3

25

Ni30

1:3

30

Ni35

1:3

35

Ni40

1:3

40

The specimen was prepared as follow: PET particles were thoroughly mixed with fine aggregate and nickel powder for 180 seconds. The mixture was then heated to 260 °C by special heating equipment and mixed at rate of 50 rpm for 20 min. After that, the mixture was poured into a metal mold and compacted by hammer for 1 min to make the cubic and prism specimens. Following this, the specimen was cured in an oven preheated to 160 °C oven for 2 h and then de-molded. After that the specimen was cooled down the room temperature and stored until testing. Two copper electrodes coated with graphite paste in the specimen. The size of electrode was 50×50 mm2 and distance of two electrodes was 50 mm. The electrodes were covered by non-conductive tape to insulate the specimen from the surface of the testing machine.

2.2 Test Methods The size of specimen for the compressive strength test was 50×50×50 mm3. The test was conducted with Microcomputer Controlled Electronic Universal Testing Machine. The loading rate was 0.5 kN/s. Prisms speccimens of 40×40×160 mm3 were cast for the flexural strength test. The three point bending test was carried out to measure the flexural strength with a loading rate of 0.04 kN/s. All strengths were obtained from three samples at room temperature. The variation of three samples could not exceed more than 15%. The average of these three samples was presented and discussed in the next section.

Piezoresistivity of Polyethylene Terephthalate Nickel Powder Composite | 239

Fig. 1: Piezoresistivity test

The size of specimens for the electrical resistance and pizezoresistivity test were 50×50×50 mm3. The electrical resistance was measured by a digital multi-meter (Keithley 2100 Electronic Multimeter) using two probe method. While a compressive monotonic load, static load and cyclic load were simultaneously applied, the change in electrical resistance was monitored continuously by Keithley 2100 Electronic Multimeter, the fractional change in resistivity was then calculated. Fig. 1 illustrates the experimental setup for measuring the piezoresistivity of the PET nickel powder composites. Non-conductive tape was attached to the top and bottom surfaces of testing machine, which was in contact with the composites, to insulate the specimens from the surface of the testing machine. Three load scenarios were used to test the piezoresistivity of composite. A) Monotonic loading: the load increased from 0 KN to 20 KN on the constant rate. Three different loading rates (0.05 kN/s, 0.1 kN/s and 0.5 kN/s) were investigated. B) Cyclic loading: The load increased from 0 KN to 1.75 KN and then decreased from 1.75 KN to 0 KN on 0.1 kN/s in five times. The electrical resistance of the composites was calculated by Ohm's law. And the volume electrical resistivity and fractional change in resistivity (∆R/R0) of composite was calculated by equation (1) and (2): ρ=RA/l ∆R/R0= (R0-R)/R0×100%

(1) (2)

where ρ (Ω·cm), R (Ω), R0 (Ω), A (cm2) and l (cm) denote the volume electrical resistivity, electrical resistance, material’s initial electrical resistance, electrode area and electrode interval, respectively.

240 | Xiao-Meng Zhang, Zhan-Yong Yao, Teng-Hai Yu and Shuo Zhang

3 Results and Discussions 3.1 Mechanical Properties Compressive and flexural tests were conducted on composite with nickel powder to evaluate its mechanical properties. The compressive strength and flexural strength of composite were increased by nickel powder addition. The results are given in Table IV. The specimen of Control was made without adding nickel powder. The compressive strength of Control is 32.2 MPa. The compressive strength of Ni15, Ni25 and Ni35 increases by 2.41%, 5.28% and 1.98% as the nickel powder content changes from 0 to 15 wt.%, 25 wt.% and 35 wt.%, respectively. The flexural strength of Control is 7.1 MPa.The flexural strength increases by 6.51%, 10.37% and 4.46% as the nickel powder content changes from 0 to 15 wt. %, 25 wt. % and 35 wt. %, respectively. As the nickel powder content of composite is 25 wt. %, the strength of composite is better than others. Table 4: Compressive strength of pet nickel powder composite Compressive Strength MPa

Change Rate %

Flexural Strength MPa

Change Rate %

Control

32.20

——

7.12

——

Ni15

32.97

2.41

7.59

6.51

Ni25

33.90

5.28

7.86

10.37

Ni35

32.84

1.98

7.44

4.46

3.2 Electrical Resistivity Fig. 2 presents the electrical resistance of composite dramatically decreases as nickel powder content increases. The electrical conductivity of the composite with nickel powder content lower than 15 wt. % is not measurable due to the high level of electrical resistivity for these composites. As the nickel powder content of composite increases from 15 wt. % to 35 wt. %, the volume resistivity decreases in order of 105 Ω·m. As nickel powder content increases from 35 wt. % to 40 wt. %, the electrical resistance levels off with further addition of nickel powder. The volume resistance of composite abruptly decreases near the percolation threshold of the composites, which is acquired at approximately 30 wt. % of nickel powder content. By further addition of nickel powder, the volume resistance slightly decreases after 35 wt. % of the nickel powder content and levels off at 40 wt. %. Fig. 2 indicates the percolation

Piezoresistivity of Polyethylene Terephthalate Nickel Powder Composite | 241

phenomena for the composites in which conductive networks without disconnections are formed by nickel powder. The percolation threshold of the composite is 30 wt. % of nickel powder content as a mean value of the aforementioned nickel powder content range.

3.3 Piezoresistivity 3.3.1 Monotonic Loading As composite with nickel powder near the percolation threshold have higher fractional change in resistivity, the 30 wt.% nickel powder content of composite is used to investigate the piezoresistive response under loading scenario A. The piezoresistive response of 30 wt. % nickel powder composite with regard to the applied compressive stress with different loading rates is shown in Fig. 3. Once the compressive load applies on the specimen, the fractional change in resistivity increases until the compressive stress reaches 8 MPa. 6

lg[ȡ/(ȍ·m)]

5 4 3 2 1 0 10%

15%

20%

25%

30%

35%

40%

45%

Nickel Powder Content/%

Fig. 2: Resistivity of composite with different nickel powder content

242 | Xiao-Meng Zhang, Zhan-Yong Yao, Teng-Hai Yu and Shuo Zhang

Fig. 3: Response of Ni30 in different loading rate

The maximum fractional change in resistivity is an important factor to evaluate the performance of piezoresistive sensors. The value of the maximum fractional change in resistivity of specimen is 10.3% for the load rate at 0.05 kN/s, whereas it decreases for the 0.1 kN/s and 0.5 kN/s to 9.8% and 9.6%, respectively. As the stress increases from 0 MPa to 8 MPa in different loading rates, the specimens have similar fractional change in resistivity in the same stress. And the fractional change in resistivity curves of specimens is similar to linear. This means loading rate affected the piezoresistivity of Ni30 slightly. Parabolic trend lines are fitted to the data points in Fig. 3 by minimizing the sum of squared errors. The equation for these curves is: ∆R/R0=-0.1120σ2+2.1564σ-0.303 (R2=0.9977)

(3)

Where σ is the stress (MPa). Therefore, this equation could be used in monitoring load in different loading rates. Further research is required to confirm this relationship and to find out whether it could be extrapolated for other loading rates, representing creep and impact, respectively.

3.3.2 Cyclic loading In this test, a cyclic loading with 0.7 MPa load amplitude was performed. The load of 0.7 MPa is the standard axle load on asphalt pavements. Load scenario C is used. In Fig. 5, as the nickel powder content is 25 wt. % and 30 wt. % respectively, the specimens have a domed response to the sharp response of the stress. The Ni25 and Ni30 outperform other nickel powder content of composites in terms of the cyclic loading response.

Piezoresistivity of Polyethylene Terephthalate Nickel Powder Composite | 243

The Fig. 5a, B and E showed the responses of Ni15, Ni20 and Ni35 are inconformity with compressive stress. The Ni25 and Ni30 approach the percolation threshold. Fig. 5c and Fig.6d show the ∆R/R0 curves of Ni25 and Ni30 have good correlation with stress curves. The results show that 25 wt. % and 30 wt. % nickel powder content of PET nickel powder composites have good piezoresistivity on 0 to 0.7 MPa stress. As the compressive stress to be removed, ∆R/R0 of Ni25 and Ni30 could back to the initial values. The composites show the good repeatability. As the stress is 0.7 MPa, the ∆R/R0 of Ni25 and Ni30 is 0.42% and 1.23% respectively. The ∆R/R0 of Ni30 is more sensitive to stress than Ni25. And the curve is more smoothly than Ni25. The Ni30 has better piezoresistivity than Ni25. (a)15%

(b) 20%

244 | Xiao-Meng Zhang, Zhan-Yong Yao, Teng-Hai Yu and Shuo Zhang (c) 25%

(d)30%

(e) 35%

Fig. 5: ∆R/R0 and stress of different nickel powder in cyclic loading

Piezoresistivity of Polyethylene Terephthalate Nickel Powder Composite | 245

4 Conclusions The mechanical properties of PET nickel powder composite are affected by nickel powder content. As PET to aggregate ratio is 1:3, the composite has good strength and workability. Nickel powder increases the compressive strength and flexural strength of composite. As the nickel powder content of composite is 25 wt. %, the strength of composite is better than others. The adding of nickel powder significantly increases the electrical conductivity of PET based materials. The percolation threshold of composite is 30 wt. %. This electrical conductive PET nickel powder composite is also piezoresistive and can produce excellent asphalt pavement sensor. The composite responds well to an applied compressive stress by depicting an increase in its fractional change in resistivity, which applies to cases including monotonically and cyclically applied load. The PET nickel powder composite’s fractional change in resistivity (∆R/R0) of composite are 10.3%, 9.8% and 9.6% as loading rate are 0.05 kN/s, 0.1 kN/s and 0.5 kN/s, respectively. The specimens of Ni25 and Ni30 have good piezoresistivity in 0.7 MPa amplitude cyclic loading. Acknowledgement: This study is supported by National Natural Science Foundation of China (51108247) and China Ministry of Transport Enterprise Technical Innovation Project (2015 315 Q15 070).

References [1] [2] [3] [4] [5] [6] [7] [8]

[9] [10]

F. Azhari and N. Banthia. “Cement-based sensors with carbon fibers and carbon nanotubes for piezoresistive sensing,” Cement & Concrete Composites, 2012, 34:866-873. X. M. Liu and S. P. Wu. “Study on the graphite and carbon fiber modified asphalt concrete,” Construction and Building Materials, 2011, 25:1807-1811. S. H. Wen and D. D. L. CHUNG. “Effects of carbon black on the thermal, mechanical and electrical properties of pitch-matrix composites,” Carbon, 2004, 42(12):2393-2397. A. García, E. Schlangena, M. van de Ven. “Electrical conductivity of asphalt mortar containing conductive fibers and fillers,” Construction and Building Materials, 2009, 23:3175-3181. S. P. Wu, L. T. Mo, Z. H. Shui. “Investigation of the conductivity of asphalt concrete containing conductive fillers,” Carbon, 2005, 43:1358-1363. X. M. Liu, S. P. Wu, Q. S. Ye. “Properties evaluation of asphalt-based composites with graphite and mine powders,” Construction and Building Materials, 2008, 22(3):121-126. H. Zhang, J. L. Wang, S. Y. Zhao. “Conductivity mechanism of asphalt concrete with PANI/PP compound conductive fiber,” Journal of Dalian University of Technology, 2010, 50(4):564-569. Z. Y. Yao, J. Han, Q. S. Shang. “Research on pressure sensitivity of the conductive asphalt mortar with carbon fiber and graphite powders,” Journal of Shandong University (Engineering Science), 2013, 43(1):80-85. F. Mariaenrica. “Recycling of PET bottles as fine aggregate in concrete,” Waste Manage, 2010, 30:1101-1106. Z.Y. Yao, X.M. Zhang and Z. Ge. “Mix proportion design and mechanical properties of recycled PET concrete,” Journal of Testing and Evaluation, 2015, 43(2):344-352.

246 | Xiao-Meng Zhang, Zhan-Yong Yao, Teng-Hai Yu and Shuo Zhang [11] [12] [13] [14] [15] [16]

[17] [18]

[19] [20]

[21]

B. Liao, G. Q. Zhou, T. F. Wan. “Compression sensitivity of conductive silicone rubber composites,” Journal of Functional Materials, 2012, 43(2):196-199. J. Zhang, X. Zhi and Z.M. Dang. “Preparation and properties of novel silicone-rubber-matrix piezoresistive sensitive composites,” Function Materials, 2011, 42(6):1115-1118. Q. F. Wang. “Study on conductivity and smart property of carbon fiber epoxy resin composite,” Chongqing University, China, 2006. X. Y. Ji. “Epoxy matrix composites filled with nano-carbon black and their strain and crack monitoring,” Harbin Institute of Technology, China, 2009. M. H. Wichmann, S. T. Buschhorn, J. Gehrmann, K. Schulte. “Piezoresistive response of epoxy composites with carbon nanoparticles under tensile load,” Phys. Rev. B., 80(24):245-437. A. G. Arani, A. Haghshenas, S. Amir, M. R. Mozdianfard, M. Latifi. “Electro-thermomechanical response of thick-walled piezoelectric cylinder reinforced by boron-nitride nanotubes,” Strength of Materials, 2013, 45(1):102-115. Y. Shibutani, H. Kitagawa, M. Akagi, M. Sakaguchi. “Propagation process of delamination and local deformation of metal-polymer laminated materials,” Strength of Materials, 34(2):207-213. K. Igor, C. Volkan, B. Abderrahim, P. Jan, N. Igor. “The mechanical and adhesive properties of electrically and thermally conductive polymeric composites based on high density polyethylene filled with nickel powder,” Materials and Design, 51:620-628. B. Z. Han, D. C. Zhou, B. G. Han. “Force sensitivity of silicon rubber matrix composites filled with nickel powder,” Polymer Materials Science and Engineering, 2010, 26(11):97-99. B. Z. Han, B. G. Han, K. Zhang. “Effect of shape of nickel powder on pulling-sensitivity of silicon rubber-matrix composites,” Rare Metal Materials and Engineering, 2008, 37(12):22262230. B. Z. Han, D. C. Zhou, B. G. Han. “Piezoresistivity of nickel powder filled epoxy resin composites,” Transactions of China Electrotechical Society, 2011, 26(4):1-6.

Bo Li1

Preparation of Ti-Cu Alloying Surface Layer on Ti6Al4V Substrate via Friction Stir Processing for Flame-Retardant Performance Abstract: Under a certain condition of high temperature, the common titanium alloys are prone to spontaneous combustion in service. The titanium-fire will rapid spread and damage the titanium matrix component. The problem could be effectively solved by the preparation of flame-retardant modified layer on the surface of common titanium alloy. In the present paper, the plastic metallic Cu powder was implanted into the grooving prepared in the surface layer on the Ti6Al4V alloy substrate. The friction stir processing technology was newly-utilized for producing TiCu alloying modified layer on Ti6Al4V substrate. To obtain the good surface modification layer forming and the beta-Ti phase rich zone in the Ti-Cu alloying layer, the process optimization was conducted. The inter-metallic phase of Ti2Cu and other TiCu intermediate phases were produced in Ti-Cu alloying layer. The flame-retardant performance of common Ti6Al4V alloy with the modified layer was evaluated via laser ablation. Then, the flame-retardant mechanism was elucidated. Keywords: friction stirs processing; surface modification; titanium alloy; alloying; flame-retardant

1 Introduction The conventional or common titanium (Ti) melting point temperature is much higher than that of the combustion point temperature. The common titanium and its alloys are prone to spontaneous combustion under a certain service condition of high temperature. The rapid spread of titanium-fire would damage the titanium matrix component. This greatly limits its application in the field of the aviation engines and other industries. The special flame-retardant titanium alloy will not only increase the weight of the aircraft parts, but also greatly increase the material cost and process cost. The problem can be effectively solved by the preparation of flameretardant modified layer on the surface of common titanium alloy. The researchers put forward the preparation of flame retardant coating on the common titanium surface, while maintaining the excellent properties of titanium alloy matrix materi-

|| 1 Shanghai Institute of Special Equipment Inspection and Technical Research, SSEI, Shanghai 200062, P.R. China, E-mail: [email protected] 10.1515/9783110516623-025 DOI 10.1515/9783110303568-025

248 | Bo Li als, the surface of the titanium to play the role of flame-retardant, heat insulation, and anti-oxygen, etc.. The technical route can also reduce the weight gain of aviation engines. Research shows that the single-phase beta-Ti is favorable to be against combustion. Cr, Al, V, and Cu elements in the combustion front can quickly form a flame-retardant layer or oxide film, for effective separation of oxygen into the titanium substrate. The absorption of heat will occur when that A1, Cu, and/or Mg is oxidized, to contribute reducing the higher combustion heat. The heat absorption will occur within their softening or melting layer before that the Ti-matrix combustion happens. Therefore, in this research work, the plastic metallic and beta-Ti phase stabilization element Cu, as the powder form, was pre-implanted into the grooving prepared in the surface layer on conventional Ti6Al4V alloy substrate. The friction stir processing (FSP) technology was introduced to produce Ti-Cu alloying modified layer on Ti6Al4V substrate. During FSP, the thermal reaction diffusion behaviors between the thermoplastic Ti-matrix and metallic Cu powder in the stir nugget zone benefited the formation of Ti-Cu alloying layer. Meanwhile, the beta-Ti phase stabilization element of Cu mainly contributed to the alpha-Ti/beta-Ti phase proportion modification, aiming to produce more beta-Ti phase after the alpha-Ti/beta-Ti transformation during the FSP processing. And inter-metallic Ti2Cu phase and other Ti-Cu intermediate phases were produced in Ti-Cu alloying layer, which favored for the flame-retardant performance. After the preparation, the flame-retardant property of the common Ti6Al4V alloy with the modified layer titanium alloy was evaluated via laser ablation. Moreover, the flame-retardant mechanism was elucidated in detail. The author believed that the technical routes via friction stir processing was a significant research foundation for the preparation of the surface flame-retardant alloying layer on the conventional or common Ti alloys.

2 Experimental Details The four-millimeter-thick rolled plates of Ti6Al4V alloy (6.01 wt.% Al, 3.84 wt.% V, 0.3 wt.% Fe, 0.1 wt.% C and bal. Ti), with alpha +beta duplex phases after the annealing treatment, were used as substrates in the experimental works. The FSP procedures were performed using the professional FSP machine, with an FSP tool of WC-13 wt. % Co matrix material. The control mode of the FSP machine was adopted as the position-control mode. As exhibited in Fig.1a, the FSP tool was composed of a cylindrical shoulder with 15mm in diameter and a pin in a shape of circular truncated cone. The surface of shoulder was flat in shape. The pin was shaped as circular truncated cone, tapered from 6mm in diameter at the root to 4mm in diameter at the pin tip. The pin length was 2.2mm to produce an FSP processed surface layer on the Ti alloy substrate with a thickness of slightly more than 2.2 mm.

Substrate via Friction Stir Processing for Flame-Retardant Performance | 249

Fig. 1: View of FSP tool (a), and diagrammatic sketch of the applied gas protective device with a gas chamber with infrared temperature probe (b).

During the FSP procedures, a specialized gas protection device with the gas chamber fixed on the work operating platform was utilized to continuously introduce a shielding atmosphere of argon gas (99.9% purity) into the chamber. As illustrated in Fig.1b, a sliding panel was settled with the stationary spindle above the rotation spindle holding the FSP tool. The air impermeability of the gas protection device was well ensured as possible through a good physical design. Hence, the shielding argon gas was introduced surrounding the rotating tool and upper part of the FSP-processed zones aiming to prevent the high temperature oxidation of the Ti alloy. An infrared temperature measurement system was then applied to monitor the temperature changes of the substrate surface during FSP on Ti6Al4V plates, aiming to investigate the thermal histories and cooling rates of the FSP procedures. An infrared temperature probe (IRTP) (as sketched in Fig.2b) was statically aimed to the suitable position on the center line of the FSP-processed surface layer along the tool traveling direction. The distance between the IRTP aiming point and the initial FSP tool plunged position was uniformly placed as 60mm for FSP. The obtained real-time temperature values from IRTP were automatically recorded per 1s to draw the temperature-time data curves. Furthermore, for eliminating the physical obstruction of the gas protection device chamber against the infrared point, the IRTP was embedded with the gas chamber and placed on the side of the FSP-processed pass. It should be noted that, the fluctuations of temperature-time data curves due to the interference of traveling FSP tool were inevitable and partly remained. Before FSP procedures, the plastic metallic Cu powder was implanted into the grooving prepared in the surface layer on the Ti6Al4V alloy substrate. The grooving size was the width of 4mm and the depth 0.8mm. In terms of metallic surface modification, the multi-passed FSP procedures using the consistent processing parameters could be employed to obtain the large scale FSP-processed zone. It means that the micro-structure characteristic in the FSP-processed zone of every FSP pass is equivalent. Thus, in the present study, only the single-pass FSP procedures on Ti6Al4V alloy substrates were investigated. The FSP process parameters included tool rotation speed (n, r/min), tool traveling speed (v, mm/min), tool-shoulder

250 | Bo Li plunge depth (d, mm) and tool tilt angle (a, °). After process optimization, the tailored parameters were as follows: a was 0° for well performed surface in macro scale. After a series of previous processing experimental works for ensuring a defectfree formability of FSP-processed surface layer, the d was set as 0.05mm, and the n was tailored as 350 r/min, the v was tailored as 210 mm/min. Samples for macro/micro structure examinations were cut, ground, polished, and etched for 10s period with the solution consisting of HF (6mL), HNO3 (8mL), and distilled water (86mL). The macro-structures and low magnification microstructures of FSP-processed samples were observed by optical microscope (OM). Micro-structure observations were mainly conducted by a Quanta 200 scanning electron microscope (SEM). Phase identification was performed by an X-ray diffractometer (XRD), at the scan speed of 2°/min. This experiment adopted laser ablation method to evaluate the ablation resistance using YAG laser of continuous pulse. The output power was 100W, with spot diameter of 0.15mm (pulse energy of 50J/10ms, pulse width 50ms). The burning point was aiming on Ti6Al4V base metal substrate and FSP modified layer on surface for 30s period. The burning pitting morphology was detailed for detection and analysis.

3 Results and Discussions 3.1 Analysis of Directly FSP zone of Ti6Al4V Substrate Fig.2a exhibits the final micro-structure characterization in the directly FSP produced stir nuggest zone, without the Cu powder and prepared grooving on the substrate surface layer. The final micro-structure contained numerous beta-Ti grains, or called beta-Ti regions, with grain-boundary (GB) alpha phase and acicular-alpha phase emanating from GB-alpha into the beta-regions). The average grain size of beta-grains was approximately 15~20μm. By comparison, Fig, 2b gives the microstructure of Ti6Al4V alloy substrate used in this study, without the FSP procedures. It was composed of a large number of relatively equiaxed alpha-grains with small amounts of GB beta-Ti phase. The mean grain size of parent matrix of mainly alphaTi grains with GB beta-Ti grains was determined as about 22μm. It implied that the average grain size of grains in the FSP stir nuggest zone further but slightly decreased. The final stir nuggest zone micro-structure after the directly FSP included not only the change of beta-region grain size but also that of grain morphology, phase fraction and distribution of alpha phase. Typical XRD spectra of the FSP-processed surface layer of Ti6Al4V alloy and the parent substrate matrix without any FSP treatment are depicted in Fig.2c. The diffraction peaks corresponding to hexagonal close-packed (hcp) Ti and body-centered cubic (bcc) Ti were generally detected in the parent and directly FSP zone. Due to

Substrate via Friction Stir Processing for Flame-Retardant Performance | 251

that the beta-Ti phase fraction of parent is very small, there is no obvious bcc Ti diffraction peak marked in the XRD spectrum of Ti6Al4V alloy parent substrate. However, after the FSP, the beta-Ti phase fraction became higher according to the intensity change of appeared bcc Ti diffraction peaks in Fig.2c. Considering the typical micro-structure observation of directly FSP zone, the beta-Ti phase fraction was indeed higher than that of parent. Despite that above relational expression was established on lots of experiments for FSP of aluminum alloys, some similar relations between processing parameters and thermal histories of Ti6Al4V alloy processed by FSP were found as well in this work. It was believed of that the detection and analyses of thermal cycles including the all heating-cooling procedures of the processed surface benefited investigation on the micro-structure evolution laws of the FSP-processed Ti6Al4V. Fig.1b illustrated the placement of IRTP. Fig.2d gives the real-time temperature curves under the different FSP condition groups of variable parameters. As indicated in Fig.2d, the peak temperature during FSP on the Ti6Al4V substrate was generally in direct proportion to the n value when the v value was invariable. The peak FSP processing temperatures under the three processing conditions, marked in Fig.2d, were all obviously higher than the alpha-Ti/beta-Ti phase transformation temperature (Beta Transus, as marked as the dotted line in Fig.2d) of Ti6Al4V alloy.

252 | Bo Li

Fig. 2: Micro-structure of directly FSP stir nugget zone of Ti6Al4V alloy (a), and parent substrate without FSP (b); the XRD spectra of the directly FSP-processed surface layer , noted as D-FSP SNZ, and the parent substrate matrix without any FSP treatment (c); the thermal cycles using different tool rotation speed values but an invariable travel speed (d). Note: slope of the dotted lines represents the cooling rates through Beta Transus.

The temperature measurement results and micro-structure characterizations demonstrated that alpha-Ti/beta-Ti phase transformation had been significantly accomplished in stir nugget zone during FSP, under these processing conditions. It had been found that the duration above Beta Transus became longer as the increase of n value (Fig.2d). The higher peak temperature during the FSP procedures promot-

Substrate via Friction Stir Processing for Flame-Retardant Performance | 253

ed the phase transformation behaviors. Thus, more beta phase was remained with less acicular-shaped alpha after the cooling.

3.2 Macro and Micro Structures of the FSP Ti-Cu Alloying Surface Layer Under the optimized process parameters, the FSP surface morphology and microstructure of the Ti-Cu alloying surface layer on Ti6Al4V titanium alloy was obtained by single pass FSP, which was shown in Fig.3. Through the observation of the modified layer, the top surface ring pattern distribution was uniformity, as shown in Fig.3. The structure of the cross section of the FSP produced Ti-Cu modified surface layer of the stir nugget zone was shown and marked in Fig.4, with the special structural characteristics of the partition. The stirring zone was divided into the newly formed beta-Ti phase rich region near the outer surface, and a newly formed dual phase zone of alpha-Ti+beta-Ti beneath the beta-Ti regions. It was distinguished from the original dual phase of titanium alloy structure in parent material matrix. Fig.5a gives the vertical cross-section macro-structure of the Ti-Cu modified layer via FSP. The outermost surface of the Ti-Cu modified layer was detected by XRD. The diffraction pattern and the main phase calibration are shown in Fig.5b. The SEM and EDS results of the region marked in Fig.5a as region point of A), B, and C are shown in Fig.5c, Fig.5d, and Fig.5e. By comparing the XRD results of the directly FSP zone of Ti6Al4V under the same process parameters (Fig.2c), it is shown that the proportion of beta-Ti phase is significantly increased in the outer surface layer of the newly enriched beta-Ti phase due to the presence of the stable element Cu in the Ti-Cu modified layer. The intermetallic phase of Ti2Cu and other Ti-Cu intermediate phases were produced in Ti-Cu alloying layer.

Fig. 3: The top view of the Ti-Cu modified layer via FSP

254 | Bo Li

Fig. 4: View of longitudinal cross-section macro-structure of Ti-Cu modified layer via FSP.

3.3 Formation Mechanisms of the Ti-Cu Alloying Layer The Cu is the important phase stabilization element for the beta-Ti phase. The FSP process utilized the stirring pin to roll the powder into the high temperature titanium matrix stir mixing zone, as indicated as Fig.6. The migration path of Cu powder with the stirring tool behaviors, as indicated as the white arrows in Fig.6, easily inter-diffused into the titanium, in which the grain transformation and the plastic deformation process were both conducted and realized in the stir nugget zone, retaining higher beta-Ti proportion after cooling. The large amount of Cu elements was dissolved into the titanium grain diffusion in the FSP process, effectively reducing the alpha-Ti-into-beta-Ti transition temperature in the dual phase titanium alloy system. The thermodynamic conditions of the titanium based alpha/beta phase transformation occurred was decreased. Thus, more beta-Ti phase was ensured to remain stable at room temperature to during the cooling process.

Substrate via Friction Stir Processing for Flame-Retardant Performance | 255

Fig. 5: The vertical cross-section macrostructure of Ti-Cu modified layer via FSP (a); the XRD spectra of Ti-Cu modified layer (b); the SEM and EDS results of the region marked in (a) as region point of A (c), B (d), and C (e).

256 | Bo Li

Fig. 6: Illustration of the Cu powder, as marked as the red region, migration path with the stir tool behavior, as indicated as the white arrows: the cross-section profile on the side view of stir nugget zone. Note: the region-A was the Ti-Cu alloying layer, the region-C was the beta-Ti phase rich region, and the region-D was the unprocessed parent.

According to the binary phase diagram of Ti-Cu as given as Fig.7 and the FSP processing peak temperature as marked in Fig.2d, the Ti2Cu phase was preferentially generated when that the content of Cu element in the titanium matrix was low. The formation mechanism of Ti2Cu could be that Cu powder and Ti matrix in the FSP process by direct reaction, may also be due to that the Cu element dissolved in the titanium grain in supersaturation and then during the cooling process as the second phase in precipitation. The peak temperature of the titanium alloy during FSP was above the Beta Transus or the alpha-Ti to beta-Ti phase transition point under the process parameters. Therefore, the thermodynamic conditions of the above Ti/Cu reaction and the solid solution then precipitation behavior were both satisfied. At the same time, the interface in the micro region of Cu powder and Ti around the base was tissue, due to the impact of high temperature and the stirring extrusion on the FSP tool stirring and mixing head. It was easy to establish Ti/Cu two element diffusion interfaces for the formation of Ti2Cu. In other word, the formation kinetics of the period condition required for diffusion was shortening in the reaction time.

Substrate via Friction Stir Processing for Flame-Retardant Performance | 257

Fig. 7: The Ti-Cu Binary Phase Diagram.

3.4 Evaluation of Flame-Retardant Performance Fig.8 gives the surface morphology (Fig.8a) and the SEM image (Fig.8b) with the magnified morphology (Fig.8c) of laser continuous pulse burning pitting after 30s period on the FSP produced Ti-Cu modified layer, and the laser burning pitting (Fig.8d), with the magnified morphology (Fig.8e) of the parent Ti6Al4V substrate. According to the ablation time after 30s laser ablation pitting morphology of modified layer on the surface of the central position in the Ti-Cu, compared with Ti6Al4V base material ablation results, the crater depth was more shallow for the Ti-Cu layer. And the core part of the crater was more flat than that of the parent. For the Ti-Cu layer ablation pitting, it had the melt and oxide range which was smaller, and presented the flower ring around the crater morphology. But for the parent of Ti6Al4V, the annular melt surface ablation around the pitting existed in a large number of micro melting pit. It indicated that the Ti-Cu modified layer after the same 30s laser burning condition presented a better flame-retardant performance.

258 | Bo Li

Fig. 8: Surface morphology (a) and SEM image (b) with the magnified morphology (c) of laser continuous pulse burning pitting after 30s period on the FSP produced Ti-Cu modified layer, and the laser burning pitting (d), with the magnified morphology (e) of the parent Ti6Al4V substrate.

3.5 Flame-Retardant Mechanisms The alpha+beta dual phase titanium alloy surface with flame retardant as the goal of the organization and control, mainly from the two aspects: one is to control the ratio of the two-phase alpha/beta titanium substrate surface, two is the addition of flame retardant of alloy elements (such as Al, Nb, V, Cr, Mo, Cu). But these two aspects can be passed FSP technology to achieve. The flame retardant mechanism is mainly embodied in the control of the alpha/beta phase of the dual phase titanium alloy substrate. Phase ratio is an important factor affecting the flame retardant properties of the multi-phase Ti alloy system. For the different types of titanium alloys, the thermal conductivity of pure titanium at the low temperature is the highest. But at high temperature, the thermal conductivity of beta titanium alloy is much higher than that of alpha and the alpha+beta alloy. For the single phase titanium crystal, the more complex the crystal structure, the smaller the thermal conductivity, the local heat is not easy to be conducted and dissipate. A body centered cubic structure of beta-Ti phase to six row sealing structure alpha-Ti phase has a higher thermal conductivity. Because the lattice structure is more complex, the lattice vibrational anharmonicity of a greater

Substrate via Friction Stir Processing for Flame-Retardant Performance | 259

degree of interaction between wave is stronger, the greater the received wave scattering, the phonon mean free path is small, high temperature phonon mean free path is more likely to reach the minimum limit, so the lower complex crystal structure thermal material the coefficient of temperature. Because the alpha phase linear expansion coefficient and beta is different, if the two-phase titanium alloy, alpha grain in heat induced phase transformation of the expansion will destroy any form can prevent combustion oxidation. Cracks in the oxide layer on alpha grains are the way of oxygen diffusion. While the oxide on the beta crystal maintains the initial ignition heat without loss, it can continue to provide anti burn ability. The all beta titanium alloy has a good resistance performance to burning. Therefore, increasing the proportion of beta phase in the micro-structure of the composite titanium alloy can improve and enhance the flame retardant properties. The thermal conductivity of Cu metal is almost twenty times as much as that of Ti with the addition of flame retardant alloy. Thermal conductivity of the relatively low cost of Cu has not only high, but also in burns, both has formed in the process of FSP Ti-Cu intermediate, or formed eutectic in 955~990ć at combustion front Cu elements with low melting point eutectic (such as Ti2Cu), which will be on the burning front before the titanium crystal melting or melting. The formation of the eutectic liquid phase can not only absorb the local micro zone of a large amount of heat, and partial or whole melting can be transformed into a dry friction friction liquid lubrication, low friction coefficient and reduce the friction heat. In addition, the combustion front Cu oxide generated heat is much lower than that of Ti oxide. In particular, when the CuO gas generating phase is formed, the heat can escape to take a certain quantity of heat into the environment of the external gas phase, which can play a role of heat absorption.

4 Conclusion The preparation of flame-retardant Ti-Cu modified layer on the surface of common titanium alloy was performed via FSP. The thermal reaction diffusion behavior between the thermoplastic Ti matrix and Cu powder in the stir nugget zone benefited the formation of Ti-Cu alloying surface layer. The beta-Ti phase stabilization element of Cu favored for the phase proportion modification, aiming to produce more beta-Ti phase after the transformation during the processing. The inter-metallic Ti2Cu phase was produced in Ti-Cu alloying layer. The modification of chemical composition and multi- phase structure of the Ti-Cu modified layer resulting that the surface flame-retardant performance was realized.

260 | Bo Li Acknowledgement: The research work was sponsored by China Postdoctoral Science Foundation funded project (Grant No.2015M580342; Grant No.2016T90377), and supported by Shanghai Rising-Star Program (Grant No.16QB1403200) and the National Natural Science Foundation of China (Grant No.51505293).

References [1] [2] [3] [4] [5] [6]

Li B, Ding R D, Shen Y F, et al. Mater Des, 2012; 35: 25 Mishra R S, Ma Z Y. Mate Sci Eng R, 2005; 50: 1 Li B, Shen Y F, Luo L, et al. Mater Sci Eng A, 2013; 574: 75 Luo L, Shen Y F, Li B, et al. Acta Metall Sin, 2013; 49: 996 Li B, Shen Y F, Luo L, et al. Mater Manuf Process, 2014; 29: 412 Leyens C, Peters M. Titanium and titanium alloys. Weinheim: Wiley-Vch, 2003: 296

Bo Li1* and Xiao Liang2

Failure Analysis of Escalator Step Induced by the Bolt Surface Defects Abstract: A failure analysis was performed of the connecting structure of an escalator step and its step chain, according to an escalator accident. In the present paper, the examination of the macro and micro structures of the failed escalator step was conducted. The computer finite element numerical simulation method was utilized for figuring out that the position of stress concentration was the fractured connecting structure. It was carefully observed of the fracture surface morphology and the metallurgical micro-structure of the failed bolt assembled on the link sleeve for the connecting structure. The surface defect of decarburizing was found on the bolt. The failure mechanism was then elucidated. Authors appealed for the improvement of manufacturing process quality of mechanical parts, aiming to reduce the risk of escalator accident. Keywords: failure; escalator; bolt; fracture; step; defect

1 Introduction The escalator is well-known as an indispensable means of transport in our modern society. And it is widely used in the people daily life and production activities. The escalator safety performance is directly related to the public safety and social harmonious development. Therefore, the safety of the automatic escalator performance requirements are attracted more and more attention. As indicated in Fig.1, the escalator is made up of a special form of the chain convey or and two special structure form of belt convey or with circular motion cascade. The structure form implies that the step and the step chain component are so important for the safe operation of the escalator equipment. The two-side step chains are linked with the steps with the connecting structures, which presents different mechanical structure forms according to the design requirements.

|| 1 Shanghai Institute of Special Equipment Inspection and Technical Research, SSEI, Shanghai, P.R. China, E-mail: [email protected] ,* Corresponding author 2 Shanghai Institute of Special Equipment Inspection and Technical Research, SSEI, Shanghai, P.R. China, [email protected] (Xiao Liang) 10.1515/9783110516623-026 DOI 10.1515/9783110303568-026

262 | Bo Li and Xiao Liang

Fig. 1: Schematics of the escalator structure and its step component.

In the present paper, a failure analysis was performed of a connecting structure of an escalator step and its step chain according to an escalator accident situation, in which many escalator steps were crashed and then backward slid, causing two passengers injured. The initial failed step was removed for examination and analysis.

2 Description of Failure Structure The appearance of the initial failed step component of the accident escalator was given as Fig.2. The horizontal width of the step tread plate was 1m. The total length of the failed shaft sleeve, as shown as Fig.2a, was 160mm. A cylindrical shaped nylon sleeve cap was embedded in the metallic sleeve, as shown as Fig.2b after wireelectrode cutting to observe the cross-section. The metallic sleeve was assembled with a bolt to fix and connect with the step bracket, as shown as Fig.2c and Fig.2d. The depth of the cylindrical nylon sleeve, with the inner diameter of 20mm, was 37mm. The inner diameter of the metallic sleeve was 24.5mm, and the outer diameter of that was 30mm.

Failure Analysis of Escalator Step Induced by the Bolt Surface Defects | 263

Fig. 2: Appearance of the failure connecting structure of the failed step.

In the connecting structure between the step driver wheel shaft and the step chain, as shown in Fig.1 and Fig.2, the bolt played a role of fixture to prevent rotating of the shaft sleeve. If the bolt fractured or detached, the shaft sleeve and the step bracket would stay instability, associating with the running of step chain and the rotating of step driver wheel.

3 Finite Element Numerical Simulation Of Failure Structure Finite element numerical simulation of the escalator step utilizing ANASYS finite element software was performed in computer. The displacement contour map of aluminum alloy matrix escalator step under an external static-load of 3000N was given as Fig.3. According to the calculation results, the maximal elastic deformation was 1.079mm. And the location of the maximal elastic deformation was on the center region of the step kick plate. By comparison, there was scarcely any elastic deformation at the failed connecting structure of step bracket and shaft sleeve, as

264 | Bo Li and Xiao Liang arrow-marked in Fig.3. Fig.4 was the stress contour of the aluminum alloy escalator step under 3000N external load. The maximal stress was calculated as 71.98MPa. As arrow-marked and enlarged in Fig.4, the max. Stress location was the failed connecting structure of the step bracket and shaft sleeve. The calculation result indicated that a severe stress concentration existed at the failed connecting structure in the step. In other words, the connecting structure suffered the maximum stress concentration and the minimum elastic deformation. The failure and/or fracture risk of the structure discontinuity location was the highest in the step. Although the concentrated stress is lower than the yield strength of the material, the stress concentration is very easy to cause the micro damage of the material at the location.

Fig. 3: The displacement contour map of step under 3000N external load.

Failure Analysis of Escalator Step Induced by the Bolt Surface Defects | 265

Fig. 4: The stress contour map of step under 3000N external load.

4 Failure Analysis Procedures 4.1 Macro-Structure Examination The head section of the bolt fixing to the shaft sleeve, which was assembled in the connecting structure, had been fractured, as seen in Fig.5. The cross-section and the top cap of the other bolt, unbroken in the screw hole, were given as Fig.6a and Fig.6b, for comparison. The cross-section and the fracture surface of the broken bolt were given as Fig.6c and Fig.6d. There was no plastic deformation of the sleeve within the metallic shaft whole section. The end of the nylon sleeve was inclined to deform. The fracture occurs at the edge of the metal sleeve, due to that it slipped out of the metallic sleeve and continued to be dragged by the shaft. The fractured bolt specification was M8×40mm, Grade 8.8. The screw thread section accounted for only about one-third of the whole length. The top bolt fracture distance to the screw surface was about 4.8mm. This indicated that the shear stress was independent of the fracture process due to the bolt assembling position relative to the screw hole.

266 | Bo Li and Xiao Liang

4.2 Fracture Morphology Observation The macroscopic morphology of the failed bolt fracture surface was given in Fig.6d, which evidently showed that the basic development of thread root and broken steps formed on the 12 o'clock direction on the fracture surface. The fracture surface was rough. But the topography was relatively flat at the edge of the fracture surface. It was visible of the oblique and rotating pattern on the topography. It implied that it was an exhibit torsional overload like fracture morphology.

Fig. 5: The bolt damage morphology.

Fig. 6: The morphology of fixed unbroken bolt installation (a), its top head inscription (b), and the failed bolt installation (a), its fracture surface.

Failure Analysis of Escalator Step Induced by the Bolt Surface Defects | 267

The fracture topography of the broken bolt was observed in detail by scanning electron microscope (SEM). The total fracture surface was shown in Fig.7, which showed that the fracture edge was in the thread root, with the distribution of small cleavage steps. Fig.8 was the enlargement SEM image of the Region a marked in Fig.7. The downward sliding and scratching phenomenon occurred at the edge of the fracture surface morphology, with downward patterns in Fig.8. Fig.9 shown the tear dimples at the Position of D marked in Fig.8. The downward parabolic shape of tear dimples implied the tear fracture direction along the fracture surface. Fig.10 was the fracture surface morphology enlargement of the Region B marked in Fig.7, in which the thread root zone on the bolt. It was found that the shape of oblique fracture was formed in the outward direction, and the shape of inclined cracking was also formed. Fig.11 was the enlargement of tear dimples at the Position E marked in Fig.10. It was visible of that the tear direction was from right to left. Fig.12 given the enlargement SEM of Region C marked in Fig.7. The left side of Fig.12 was the root of the thread, and the fracture edge was bruised. And the cross section pattern was presented from the bottom up to the development. Fig.13 was the enlargement SEM of tear dimples at Position F marked in Fig.12. It was visible from the lower to the upper of the oblique tear shaped ductile dimples, accompanying with tear patterns. Fig.14 showed the fracture surface morphology enlargement of many equiaxed dimples at the fracture surface center of Position G marked in Fig.7. The shape of equiaxed dimples was different from tear dimples. It implied that the tearing fracture was initially occurred along with the edge around the bolt, and then the ductile fracture occurred at the middle area of the fracture surface. According to the direction of tear dimples presented in Fig.9, Fig.11, Fig.13, the tearing fracture direction should be clockwise as in Fig.7. The fracture surface center area showed a vertical dimple pattern, indicating the vertical overload crack morphology.

268 | Bo Li and Xiao Liang

Fig. 7: The bolt fracture surface morphology.

Fig. 8: The morphology enlargement of the Region A marked in Fig.7.

Failure Analysis of Escalator Step Induced by the Bolt Surface Defects | 269

Fig. 9: The fracture surface morphology enlargement of tear dimples at the Position D marked in Fig.8.

Fig. 10: The morphology enlargement of the Region B marked in Fig.7.

270 | Bo Li and Xiao Liang

Fig. 11: The fracture surface morphology enlargement of tear dimples at the Position E marked in Fig.10.

Fig.12: The morphology enlargement of the Region C marked in Fig.7.

Failure Analysis of Escalator Step Induced by the Bolt Surface Defects | 271

Fig. 13: The fracture surface morphology enlargement of tear dimples at the Position F marked in Fig.12.

Fig.14: The fracture surface morphology of equiaxed dimples at the fracture surface center of Position G marked in Fig.7.

4.3 Metallographic Analysis The metallographic micro-structures of the fractured bolt were shown in Fig.15. On the left side of Fig.15, the fracture surface was oblique distribution and vertical against threads. The edge of the threads was white and bright. According to the enlargement, the decarburization defect was obvious on the surface layer of the tread cross-section. The deformation phenomenon also existed on the threads close to the fracture surface. Meanwhile, it was also found of a relatively small shrinkage of the fracture surface, which should be related to the plastic deformation during the fracture.

272 | Bo Li and Xiao Liang

Fig. 15: The metallographic structures of the fractured bolt thread.

The bolt microstructure was mainly Ferrite and Sorbite, with the decarburization in the surface layer of threads. The depths of the decarburizing defect were about 0.08mm. As in Fig.16, the folded cracking in oblique distribution was found in the surface layer of thread. The length of micro crack was about 0.2mm.The preferring position of crack initiation was often in the internal micro-structure of decarburizing layer. The micro-structure of the fracture surface edge was shown in Fig.17. The matrix was Sorbite and massive Ferrite. By comparison, the unbroken bolt micro-structures were also observed in detail. As shown in Fig.18 and Fig.19, there was no a plastic deformation or decarburization defects on the threads. The core micro-structure of the unbroken bolt was Sorbite with a uniform distribution.

Failure Analysis of Escalator Step Induced by the Bolt Surface Defects | 273

Fig. 16: The surface decarburizing and micro cracking on the bolt thread surface layer.

Fig. 17: The micro-structure of the fracture surface edge of the bolt.

Fig. 18: The metallographic structures of the unbroken bolt thread.

274 | Bo Li and Xiao Liang

Fig. 19: The metallographic structures of the unbroken bolt core.

4.4 Hardness Determination The hardness determination was performed on the failed and unbroken bolts. For the fractured bolt thread, the average hardness value was 293Hv (which was measured as 292Hv, 291Hv, 296Hv). The average hardness value of the fractured bolt core was 288Hv (which was measured as 292Hv, 291Hv, 296Hv). For the unbroken bolt thread, the average hardness value was 312Hv (which was measured as 305Hv, 316Hv, 316Hv). The average hardness value of the unbroken bolt core was 304Hv (which was measured as 301Hv, 308Hv, 304Hv). The hardness value of the unbroken bolt was higher than that of the fractured one.

5 Failure Analysis Results and Discussion During the failure analysis procedure, it was claimed that the decarbonization defect and micro-cracking existed on the surface layer of the fractured bold threads. The fracture mode was mainly tearing fracture. It was believed that the defects could induce the initiation of micro-cracks on the bolt thread surface layer. Meanwhile, the matrix micro-structures of the fractured bolt were different from that of the unbroken bolts, which implied that the heat-treatment processes of the failedbolt was abnormal [1]. The decarbonization phenomenon was directly related to the unreasonable heat treatment process of the bolt components. The Sorbite phase basic matrix could present better performances of ductile and strength. The multiple insoluble Ferrite with block shaped in matrix did not contribute to comprehensive performance. The hardness determination result indicated that the hardness values of the failed bolt and its threads were lower than those of unbroken

Failure Analysis of Escalator Step Induced by the Bolt Surface Defects | 275

bolt. Thus, under the overloading in-service condition, the failure then occurred. It was inferred that the surface layer decarburization could reduce the surface fatigue strength of the steel components [2-3]. It claimed that the hardness value of the bolt without decarburization was superior to that with decarburization. Authors appealed for the improvement of the manufacturing process quality of mechanical components, aiming for reducing the risk of escalator accidents. Acknowledgement: The work is supported by Shanghai Rising-Star Program (No.16QB1403200), the research project of Shanghai Bureau of Quality Supervision (No.2015-038), China Postdoctoral Science Foundation funded project (No.2015M580342).

References [1] [2] [3]

H.D. Alvarenga, T.V.D. Putte and N.V. Steenberge: Metallurgical & Materials Transactions A, 2015, vol.46A, pp. 123. R.W. Klopp: Failure Analysis of Redundant Escalator Chain Pin Retention Mechanisms, ASME International Mechanical Engineering Congress and Exposition. 2011, pp. 407. T.G. Kim, S.B. Lee, H.C. Lee: Safety & Health at Work, 2010, vol.11, pp. 43.

Xiao Liang1* and Bo Li2

Surface Wear Mechanism of Escalator Step Chain: A Failure Analysis Abstract: The escalator is a cyclic movement of the load transport machinery, wear failure of mechanical components is the main cause of equipment damage and even scrap. In this paper, by taking a variety of analytical methods, such as visual inspection, chemical composition analysis, microstructure and hardness gradient determination, analysis on the reasons of the escalator step chain wear in a subway station. According to analysis, we can conclude that the surface of the pin shaft and the sleeve of the step chain are wear and tear, which is affected by the friction stress. Authors suggest that the lubrication condition of step chain is checked regularly, to prevent the oil pump, pipe, nozzle problems caused by the chain without lubrication. Keywords: failure; escalator; step; chain; wear

1 Introduction The escalator is a cyclic movement of the load transport machinery, wear failure of mechanical components is the main cause of equipment damage and even scrap. According to an uncompleted statistic, a subway station has more than 100 escalators, in less than 5 years of service life; nearly 30% of the escalator step chain appears serious wear and tear, causing the problem of the amount of elongation. To continue to maintain the normal operation of this part of the escalator, the subway company must replace the excessive elongation of the chain; this greatly improves the cost of equipment maintenance and management. In this paper, by taking a variety of analytical methods, such as visual inspection, chemical composition analysis, microstructure and hardness gradient determination, Analysis on the reasons of the wear failure of the escalator in a subway station.

|| 1 Shanghai Institute of Special Equipment Inspection and Technical Research, SSEI, Shanghai, P.R. China, E-mail: [email protected], * Corresponding author 2 Shanghai Institute of Special Equipment Inspection and Technical Research, SSEI, Shanghai, P.R. China, E-mail: [email protected] 10.1515/9783110516623-027 DOI 10.1515/9783110303568-027

278 | Xiao Liang and Bo Li

2 Principle of Escalator Movement The escalator is powered by an electric motor arranged in the upper or middle area, by the chain (the main drive chain) to transfer power. The escalator step is connected with the left and right step chain through the step shaft. The escalator step chain is driven by the main drive chain to do circular motion .In addition, the escalator step main wheel / auxiliary wheel is moving on the ladder track, which plays the role of supporting the step load and guidance. The most widely used step chain structure is the sleeve roller chain. Including the inner chain plate, the outer chain plate, pin, sleeve, and roller. Wherein, the pin and the outer chain plate, the sleeve and the inner chain plate are respectively adopted by the interference fit. The pin shaft and the sleeve, the roller and the sleeve, then use the gap to form a hinge. When the chain and the sprocket enter or out of engagement, roller can roll on the sprocket, between the two is mainly rolling friction, reducing the wear of chain wheel and chain. When the link between flexion and extension, the inner chain plate and the chain plate relative rotation sleeve roller pin between free rotations.

3 Failure Analysis of Escalator STEP Chain Wear 3.1 Sample Introduction The wear of the escalator step chain components, with the wheel of the chain plate area combined with the shape shown in figure 1, the component is composed of a chain plate, a pin shaft, a sleeve, and the like. The step chain pitch is about 135mm, the chain plate width 44mm, length 189mm; pin length is about 50.90mm, the middle diameter of about 19.95mm diameter; the sleeve height is about 30mm. In the process of using the inner cavity of the pin shaft and the outer part of the sleeve, the abnormal wear phenomenon occurs in the inner cavity of the step chain assembly.

Surface Wear Mechanism of Escalator Step Chain: A Failure Analysis | 279

Fig.1: The morphology of the step chain plate with rolling wheel

3.2 Macro Analysis 3.2.1 Pin Shaft The appearance of the pin shaft is shown in Figure 2, visible wear occurs in the inner region of the two pin shaft. The pin shaft surface showed visible metal luster, and visible along the circumferential distribution of wear traces.

Fig. 2: The pin shaft and wear surface

280 | Xiao Liang and Bo Li 3.2.2 Sleeve The sleeve looks as shown in Figure 3, visible chain long axis direction of the end of the end of the wall thickness of the region, to be more serious wear. Dig the sleeve longitudinally, the wall thickness is thinner and the surface of the inner wall is more serious. And visible along the circumferential distribution of wear trace; there was no obvious phenomenon of extrusion and wear on the inner surface of the thick wall thickness region.

Fig. 3: The sleeve and wear surface

3.3 Scanning Electron Microscope Analysis 3.3.1 Pin Shaft Wear Area Inner Cavity Surface The surface topography of the region is shown in Figure 4, and the visible and parallel distribution of the affected area is affected by the extrusion trace. Under high magnification, the surface of the area is rough, to be related with the squeeze abrasion, as shown in Figure 5.

Surface Wear Mechanism of Escalator Step Chain: A Failure Analysis | 281

Fig. 4: The morphology of the surface of the cavity in the wear area of the pin shaft

Fig. 5: The surface topography of the inner cavity of the wear area of the pin shaft

3.3.2 Sleeve Wear Area Inner Cavity Surface The surface topography of the region is shown in Figure 6, and the visible and parallel distribution of the affected area is affected by the extrusion trace. Under high magnification, the surface of the area is rough; local was patchy distribution, to be related with the squeeze abrasion, as shown in Figure 7.

282 | Xiao Liang and Bo Li

Fig. 6: The morphology of the surface of the inner cavity of the inner cavity of the sleeve wear

Fig. 7: The surface of the inner cavity of the sleeve wear region

3.4 Metallographic Analysis 3.4.1 Pin Shaft Wear Area Normal Section The distribution of the regional structure is shown in Figure 8; the upper side of the figure is the outer surface, no obvious carburizing quenching layer, to be associated with the squeeze wear. Under high magnification, the visible surface microstructure is martensite, as shown in Figure 9. The heart of the organization is: low carbon martensite + bainite + a small amount of ferrite, as shown in figure 10.

Surface Wear Mechanism of Escalator Step Chain: A Failure Analysis | 283

Fig. 8: The microstructure and morphology of the wear area of pin shaft

Fig. 9: The microstructure and morphology of the wear area of pin shaft

284 | Xiao Liang and Bo Li

Fig. 10: The microstructure and morphology of 10 pin shaft

3.4.2 Normal Section of Sleeve Wear Area The distribution of the regional structure is shown in Figure 11; the upper side of the figure is the outer surface, visible with a layer of carburized layer. The upper side of the figure is the inner surface, no obvious carburizing quenching layer, and the surface is rough. The thickness of the wall of the sleeve is relatively thin. Under high magnification, the inner cavity surface layer is: low carbon martensite + bainite + ferrite, as shown in figure 12.

Fig. 11: The distribution of normal section in the area of sleeve wear

Surface Wear Mechanism of Escalator Step Chain: A Failure Analysis | 285

Fig. 12: The microstructure of the normal section of the wear area

3.5 Hardness Gradient Determination 3.5.1 Pin Shaft In the sample surface without pin shaft wear area cross section from the outside to the inside of Vivtorinox hardness gradient determination, the results shown in Table 1 Table 1: the Pin Shaft Surface and the Internal Surface of the Sleeve without Wear Area from the Outside to the Inside Hardness Gradient Value Distance from surface /mm

0.05 0.15 0.35 0.45 0.55 0.75 0.85

0.95

Department of heart

Vivtorinox hardness/HV1

683

538

449:448:447

775

741

711

695

610

582

Taking 550HV as the threshold value, the depth of the sample carburizing and quenching layer was measured by CHD=0.92mm.

3.5.2 Sleeve In the sample did not wear sleeve surface cross sections of the area from the outside to the inside Vivtorinox hardness gradient determination, the results shown in table 2.

286 | Xiao Liang and Bo Li Table 2: The surface of the sleeve and the sleeve surface wear area from the outside to the inside hardness gradient value Distance from surface /mm

0.05

0.15

0.35

0.45

0.55

0.75

0.85

0.95

Department of heart

Vivtorinox hardness/HV1

758

743

664

582

488

357

/

/

272:269:271

Taking 550HV as the threshold value, the depth of the sample carburizing and quenching layer was measured by CHD=0.49mm.

3.6 Chemical Analysis 3.6.1 Pin Shaft The spectral analysis of the pin shaft, its main elements and contents are shown in table 3. Table 3: The chemical composition of membrane matrix of pin shaft (wt %) Elements

C

S

Pin shaft

0.22

0.014 0.23

Si

20Cr (GB/T 30771999)

0.18~0.24 ≤0.03 5

Mn

P

Cr

Ni

0.60

0.022

0.85

0.016 0.015

0.17~0.37 0.50~0.80 ≤0.035

0.70~1.00 ≤0.30

Cu ≤0.30

3.6.2 Sleeve The spectral analysis of the sleeve, its main elements and contents are shown in table 4

Surface Wear Mechanism of Escalator Step Chain: A Failure Analysis | 287 Table 4: The chemical composition of membrane matrix of sleeve (wt %) Elements

C

S

Sleeve

0.32

0.015

30 steel (GB/T 699-1999)

0.27~0.34 ʉ0.035

Si

Mn

P

Cr

0.23

0.44

0.018 0.018 0.015 0.024

0.17~0.37 0.50~0.80 ʉ / 0.035

Ni /

Cu /

4 Failure Analysis Results and Discussion (a) By the chemical analysis results show that the sample pin shaft material equivalent to 20Cr (3077-1999 GB/T); sample sleeve material equivalent to 30 steel (GB/T699-1999). (b) By metallographic analysis and hardness determination of visible surface and the surface of the sleeve, a pin shaft were treated by carburizing and quenching treatment The microstructure of the pin shaft carburizing layer is very coarse, which will affect the overall performance of the pin shaft surface. There was no obvious abnormality in the microstructure distribution of the sleeve. (c) From the macroscopic analysis and the scanning electron microscopy analysis, it can be seen that the wear of the surface of the sample pin and sleeve surface is not squeezed abrasion. According to the above analysis, we can conclude that the surface of the pin shaft and the sleeve of the step chain are wear and tear, which is affected by the friction stress.

References [1] [2] [3] [4]

2011 Asia-Pacific Diecasting Industry Exhibition [J]. China Foundry. 2011(02) The 6th China International Diecasting Congress and Exhibition 2008—Post Show Report [J]. China Foundry. 2008(03) Exhibition Preview 2011 Asia-Pacific Diecasting Industry Exhibition [J]. China Foundry. 2011(03) The Largest Gathering of Chinese Die Casting Industry in Shanghai [J]. China Foundry. 2012(03)

Chun-Hui Zhao1*, Hui Mu2, Hong-Hong Guo3 and Tai-Kun Liu4

Toxicity Reduction Mechanism of ZnO NPs during Sludge Vermicomposting Process Abstract: To investigate the feasibility of stabilization and resourceful application of excess sludge contaminated with ZnO NPs by means of vermicomposting, experiment groups with ZnO NPs (V-ZnO NPs) and control groups without ZnO NPs (Vcontrol) were compared. The average weight and the individual number of earthworms in V-ZnO NPs are significant lower than those of earthworms in V-control. However, earthworms in V-ZnO NPs can adjust their antioxidant enzyme system (SOD) to maintain their normal physiological function and still play the important role in regulative role in vermicomposting. Furthermore, sequential extraction indicate that vermicomposting decrease the migration and availability of Zn by combining with humus, and the earthworm can reduce the mobile fraction, while increase the stable fraction of heavy metals with the effect of the releasing their mucus and urine. Those results indicate vermicomposting can effectively promote the reduction of ZnO NPs toxicity and thus is an effective means for the disposal and reutilization of residual sludge contaminated by metal oxide nanoparticles. Keywords: execss sludge; vermicompost; zinc oxide nanoparticles; sequential extraction.

1 Introduction The nano-materials also result in very serious environmental pollutions and ecological poisoning problems, as well as promoting the developments of science and technology [1]. Commentators’ articles have been issued on the authoritative journals such as Science and Nature to call for strengthening the studies on the environmental behaviors and eco-toxicity effects of metal oxide nanoparticles [2, 3]. Taking zinc Oxide nanoparticles (ZnO NPs) as an example, due to its magnetic property, thermal resistance, chemical activity, and other characteristics, it has been widely used in the electronics, medical treatment, chemical engineering, military, aerospace and environmental protection and other fields. However, during its production, transportation, utilization and disposal process, it will be inevitably

|| 1 School of Resources & Environment, University of Jinan, Jinan, PR China, [email protected] 2 Energy Research Institute of Shandong, Academy of Sciences, Jinan, PR China, [email protected] 3 School of Resources & Environment, University of Jinan, Jinan, PR China, [email protected] 4 School of Resources & Environment, University of Jinan, Jinan, PR China, [email protected] 10.1515/9783110516623-028 DOI 10.1515/9783110303568-028

290 | Chun-Hui Zhao, Hui Mu, Hong-Hong Guo and Tai-Kun Liu discharged into the environment through various ways, which leads to serious environmental pollution and ecological toxic problem [4]. As the final barrier of the sewage discharge to the environmental water the wastewater treatment plant becomes the final destination of metal oxide nanoparticles in the sewage, which is enriched in the excess sludge by adsorption, cohesion and sedimentation [5]. In recent years, with the continuous attention to the ecological toxicity of metal oxide nanoparticles, the toxic effects of metal oxide nanoparticles on earthworms have been reported. For example, Alahdadi found that ZnO NPs had a certain impact on the earthworm reproduction [6]; and Gupta found that Eisenia foetidas were not sensitive to the toxicity of ZnO NPs, in addition, it had a certain enrichment effect on ZnO NPs, and its enrichment capacity was inversely proportional to the size of ZnO NPs [7]. Based on the researches above, the author deemed that in the concentration of ZnO NPs that is toxic to anaerobic digestion of sludge, the toxic effect of ZnO NPs on vermicompost may be insignificant, that is, it is feasible to use the vermicompost to treat the excess sludge contaminated by the higher concentration of ZnO NPs. Therefore, in this research the excess sludge contaminated by ZnO NPs was treated by vermicompost, and it was investigated that the resource utilization of compost substrate and the physiological and ecological adaptability of earthworms during the sludge vermicompost under the stress of ZnO NPs; it was analyzed that the changes of overall amount and chemical speciation of Zn in the substrate before and after vermicompost; it was also analyzed that the reduction mechanism of earthworm composting on the toxicity of ZnO NPs, and providing an effective method for the treatment and disposal of excess sludge contaminated by ZnO NPs.

2 Material and Methods 2.1 Substrate and Vermicomposting The substrate was prepared by the excess sludge and cattle dung with the ration of 1:1, which was equally divided into two groups (each has three parallel reactors, and each reactor of 1000g), the experiment groups with ZnO NPs (V-ZnO NPs) with the Zn equivalent weight of 500mg/kg, while the control groups without ZnO NPs (Vcontrol) were compared. The substrates were manually turned over every 24 hours to remove the volatile toxic gases. After one week, 125 earthworms (Eisenia foetidas) with the average weight of 200±4.2mg were added into each reactor for vermicomposting of 12 weeks.

Mechanism of ZnO NPs during Sludge Vermicomposting Process | 291

2.2 Analysis of Earthworms Table 1: Physico-Chemical Properties of the Substrates before and after Vermicomposting pH

Initial substrate

7.63±0.040

EC

TOC

μs/(cm)

(g/kg)

1066±39.0

385±7.7

NH4-N

N-NO3

AP

0.6±0.08

0.7±0.17

1.3±0.17

V-control

6.60±0.065

2222±15.0

253±5.2

2.7±0.62

5.9±0.04

1.7±0.14

V-ZnO NPs

6.38±0.059

2388±50.5

273±6.0

2.9±0.14

6.3±0.16

1.4±0.08

The earthworms were sampled every 2 weeks. The total number and weight of earthworms surviving were determined by hand sorting and enumeration. Average weight of earthworms was estimated from the total weight of earthworms was divided by the total number of earthworms. The SOD enzyme activity of earthworms during the composting process was determined by the enzyme kit provided by Nanjing Jiancheng Bioengineering Institute.

2.3 Analysis of Zn The heavy metals in the sludge were digested into liquid state with mixed acid by microwave, and then the content of Zn in the substrate was determined in a constant volume by ICP-MS. By the method of Tissier sequential extraction procedure, the heavy metals in the substrate were divided into five fractions of the exchangeable fraction (F1), carbonate bindingfraction (F2), Fe-Mn oxides binding fraction (F3), organic and sulfide binding fraction (F4), and residual fraction(F5) [8]. Each fraction concentration of Zn was also determined by ICP-MS.

3 Results And Discussing 3.1 Effects of Vermicomposting Table 1 showed the physico-chemical properties of the substrates before and after vermicomposting. After vermicomposting, the pH and TOC in V-ZnO NPs and Vcontrol were all decreased, while the conductivity, the contents of ammonia nitrogen and nitrate nitrogen were all increased in comparison with the initial substrates. It indicated that the presence of earthworms promoted the degradation and transformation of organics and the mineralization of organic nitrogen and phosphorus in the substrate, forming the organic acids of small molecules, nitrate nitrogen, and nitrite nitrogen, etc. In comparison with that in the initial substrates, the content of

292 | Chun-Hui Zhao, Hui Mu, Hong-Hong Guo and Tai-Kun Liu available phosphorus in V-control was increased, while that of V-ZnO NPs was insignificantly changed. Remarkably, the conductivity in V-ZnO NPs was significantly higher than that in V-control, which might be resulted from the release of Zn2+ from ZnO NPs due to the decreasing of pH during the vermicomposting. While the degradation rate of TOC in V-ZnO NPs was lower than that in V-control, which indicated that the added ZnO NPs in V-control had a stress on earthworms, affecting the treatment of vermicompoting. Physiological adaptation of earthworms The average weight of earthworms is the direct performance of growth status of earthworms, which reflects the adaptation of earthworms to survival environment. As shown in Fig.1, both of the average weights of earthworms V-control and VZnO NPs showed a trend of increasing first and then decreasing, however, the average weight of earthworms in V-ZnO NPs was significantly lower than that in Vcontrol. It was indicated that the earthworms could use the organics to carry on the metabolism activity and achieve the individual growth during the composting of pre-period; as vermicomposting progresses, the weight of earthworms decreased resulting from the decreasing of organics in the substrate. With the time increasing of vermicomposting, the number of earthworms in both V-control and V-ZnO NPs showed a decreasing trend, and it was caused by the organic acids and ammonia which generated during the vermicomposting, was toxic to earthworms, and led to the death of earthworms in the case of extremely trace amount. At the end of vermicomposting, the survival earthworms in V-control and V-ZnO NPs were 115 and 106, respectively, which indicated that the death amount of earthworms in the test group was slightly higher than that of control group.

Mechanism of ZnO NPs during Sludge Vermicomposting Process | 293

Fig. 1: Individual numbers and average weight of earthworms in vermicomposting.

Fig. 2: Variation of SOD of earthworms in V-control and V-ZnO NPs

294 | Chun-Hui Zhao, Hui Mu, Hong-Hong Guo and Tai-Kun Liu The average weight and number of earthworms are the simple and intuitionistic manifestation to reflect the physiological adaptability of earthworms. However, the physiological stress effect which may be brought onto earthworm organism is more complicated due to the change of the external stress. In this study, we determined the changes of SOD of the earthworms in both V-control and V-ZnO NPs so as to reflect the impacts of environmental stresses on the earthworms and their response mechanism. (Fig. 2). As shown in Fig. 2, the SOD of earthworms in both V-control and V-ZnO NPs firstly rose and then declined. The above results suggested that after earthworms were inoculated into the vermicomposting, the change of living environment caused the oxidative stress responses of the enzyme system. Some living factors which were different from those in the original living environment of the earthworms, such as the foodstuff and stress effect of heavy metals, produced irritation on earthworms and enhanced all kinds of metabolism activities in earthworm antioxidant enzyme system to defend against the adverse effects of the environment, thereby leading to the increases in superoxide anion free radical (O2-) in earthworm as well as the induction and activation of SOD for effectively cleaning O2- generated in earthworm body and preventing earthworm body from being damaged [9]. Then, the activities of SOD of VF earthworms continued to decline. The changes show that, after a period of domestication, the earthworms can gradually adapt to the living environment in vermicomposting by adjusting their own antioxidant enzyme systems, thereby maintaining normal physiological metabolism activities. While the activity of SOD enzyme inside earthworm body in V-ZnO NPs was significantly higher than that of in V-control, and it was indicated that the addition of ZnO NPs caused much more of the superoxide anion free radicals would generated inside the earthworm body so as to activate a higher SOD to remove the O2- inside earthworm body and maintain its normal physiological metabolism. Seen from the above results, although the average weight and individual number of earthworms V-ZnO NPs were decreased in comparison with those in Vcontrol, most of the earthworms could survive in the stress of ZnO NPs, and maintain its normal physiological and metabolic activities through the regulation of SOD enzyme activity. It was indicated that the earthworms could adapt the stress of ZnO NPs, use the organics to achieve the metabolic activity and individual growth, and continue to carry out the regulation effect in vermicomposting. In V-ZnO NPs, the addition of ZnO NPs had a more significant stress on earthworms, which led to deterioration of vermicomposting. Therefore, it is necessary to study the content and speciation of Zn during the vermicomposting.

Mechanism of ZnO NPs during Sludge Vermicomposting Process | 295

3.2 The Content and Speciation of Zn The contents of Zn in the initial substrates were 1234 mg/kg and 1784 mg/kg in Vcontrol and V-ZnO NPs, respectively. After vermicomposting, the contents of Zn were increased by 13.4% and 5.8% in V-control and V-ZnO NPs, respectively. It was resulted from the concentrating of Zn in the substrate caused by the degradation of organics. As shown above, the degradation rate of organics in V-control was higher than that in V-ZnO NPs, which led to the concentration of Zn in the substrate of control group was higher than that in the test group. The speciation of heavy metals is the key indicator to determine its biological toxicity. By the method of Tissier sequential extraction, Zn was divided into five fractions in this research: the exchangeable fraction (F1), carbonate binding fraction (F2), Fe-Mn oxides binding fraction (F3), organic and sulfide binding fraction (F4), and residual state (F5). The heavy metals in the F1, F2 and F3 are commonly deemed as instable heavy metals, while the F4 and F5 are deemed as the stable heavy metals which are hard to be absorbed by animals and plants [10]. The contents of Zn of different fractions in the substrates of V-control and V-ZnO NPs before and after vermicomposting were determined as shown in Fig.3 The Zn contents of each fraction in V-ZnO NPs were higher than those in Vcontrol due to the addition of ZnO NPs. The F3 of Zn was the highest fraction both in V-control and V-ZnO NPs, which was prone to transform into Zn of other forms in the condition of pH decreasing. The sum of F1,F2 and F3 is use to represent the ecological availability of heavy metals, the higher the proportion value of F1+F2+F3 is, the higher the ecological availability of heavy metals, and the greater the biological toxicity. In the initial substrate, the proportion values of F1+F2+F3 were 69.4% and 76.4% in V-control and V-ZnO NPs, respectively, and the biological toxicity of Zn in V-ZnO NPs was significantly higher than that of V-control, which might be the direct reason that the effect of V-ZnO deteriorated under the stress on the physiological metabolism of earthworms. After vermicomposting, the proportion of F1+F2+F3 in V-control and V-ZnO NPs were slightly decreased, wherein the test group decreased by 11.0%. Those results above suggested although the addition of ZnO NPs made a stress effect on earthworms in the vermicomposting; however, the generated substances such as a large number of humus, the enzymes and carbonates secreted inside the digestive tract and the mucus secreted outside the body during the process of earthworm feeding resulting from the changes of physicochemical properties in the vermicomposting could chelate with the Zn ion of strong mobility so as to transform the Zn from instable fractions into stable fractions, thereby reducing the biological toxicity of ZnO NPs.

296 | Chun-Hui Zhao, Hui Mu, Hong-Hong Guo and Tai-Kun Liu

Fig. 3: Content of the chemical speciation (F1, F2, F3, F4 and F5) of Zn in the initial substrate-contral, vermicomposting-control, initial substrate-ZnO NPs and vermicomposting- ZnO NPs.

4 Conclusions The addition of ZnO NPs had a harmful effect on the physiological metabolism of earthworms in vermicomposting. However, the earthworms could adapt to the stress of ZnO NPs, and use the organics in the substrate to carry on the metabolic activity and individual production, thereby continue to play its role on the regulation of vermicomposting. The generated substances such as a large number of humus, the enzymes and carbonates secreted inside the digestive tract and the mucus secreted outside the body during the process of earthworm feeding resulting from the changes of physicochemical properties in vermicomposting chelate with the Zn ion of strong mobility so as to transform the Zn from instable fractions into stable fractions,

Mechanism of ZnO NPs during Sludge Vermicomposting Process | 297

thereby reducing the biological toxicity of ZnO NPs, thereby reducing the biological toxicity of ZnO NPs, and achieving the resource stabilization treatment of excess sludge contaminated by ZnO NPs. Acknowledgement: The research was funded by the National Natural Science Foundation of China (51608228), the National Natural Science Foundation of Shandong Province (ZR2014EEQ023 and ZR2016EEQ19).

References [1] [2] [3]

[4] [5]

[6]

[7] [8]

[9]

[10]

R. D. Handy, F. von der Kammer, J. R. Lead, M. Hassellov, R. Owen,and M. Crane, “The ecotoxicology and chemistry of manufactured nanoparticles,” Ecotoxicoloy, vol. 17, pp. 287–314. Nel, T. Xia, L. Madler, and N. Li, “Toxic potential of materials at the nanolevel,” Science, vol. 311, pp. 622–627. D. Maynard, R. J. Aitken, T. Butz, V. Colvin, K. Donaldson, G. Oberdorster, M. A. Philbert, J. Ryan, A. Seaton, and V. Stone, “Safe handling of nanotechnology,” Nature, vol. 444, pp. 267– 269. R. Brayner, “The toxicological impact of nanoparticles,” Nano Today, vol. 3, pp. 48–55. M. A. Kiser, P. Westerhoff, T. Benn, Y. Wang, J. Perez-Rivera, and K. Hristovski, “Titanium nanomaterial removal and release from wastewater treatment plants,” Environmental science & technology, vol. 42, pp. 6757–6763. Alahdadi, F. Behboudi, E. M. Goltapeh, A. M. Sanavi, J. Malakootikhah, and S. M. Ghafary, “The effects of CuO and ZnO nanoparticles on survival, reproduction, absorption, overweight and accumulation in Eisenia foetida earthworm tissues in two substrates,” International Journal of Agronomy and Plant Production, vol. 2, pp. 209–218 . S. Gupta and S. Yadav, “Bioaccumulation of ZnO-NPs in Earthworm Eisenia fetida (Savigny),” Journal of Bioremediation & Biodegradation, vol. 5, pp. 1–7 Tessier, P.G.C. Campbell, and M. Bisson, “Sequential extraction procedure for the speciation of particulate trace metals,” International Journal of Agronomy and Plant Production, vol. 51, pp. 844–851. Y. Song, L. Zhu, J. Wang, J. Wang, W. Liu, and H. Xie, “DNA damage and effects on antioxidative enzymes in earthworm (Eisenia foetida) induced by atrazine,” Soil Biology & Biochemistry, vol. 41, pp. 905–909 . J. Yang, C. H. Zhao, M. Y. Xing, and Y. N. Lin, “Enhancement stabilization of heavy metals (Zn, Pb, Cr and Cu) during vermifiltration of liquid-state sludge,” Bioresource Technology, vol. 146, pp. 649–655.

Shu-Ping Liu1

A Nanocomposite Film of Polyoxometalate and TiO2: Preparation, Characterization and Photochromic Property Abstract: The composite film consisting of poly (allylamine hydrochloride) (PAH), polyoxometalate (POM) and TiO2 was fabricated on quartz and ITO by the layer-bylayer method (LbL). The assembling process and photochromism of the composite film were characterized by UV-vis spectrum. The surface topography of composite film was scanning electron microscopy (SEM). This study can provide a new material for the application of photochromic devices. Keywords: polyoxometalate; TiO2; photochromic; layer-by-layer

1 Introduction Polyoxometalates (POMs) represent a well-known class of transition metal oxide nanoclusters with intriguing structures and electronic properties, which make them attractive in areas such as catalysis, medicine, and material science [1, 2]. Xu et al. fabricated a new type of phthalocyanine-sensitized solar cells with polyoxometalate-modified TiO2 photoanode, which improved the overall power conversion efficiency of the cell [3]. Zhang et al. synthesized crystalline porphyrinic polyoxometalate, which displayed photocatalytic activities in the reduction process of metal compositions [4]. Liu et al. fabricated a nanocomposite film containing WO3 nanoparticles, tungstophosphate clusters, which supported a greater number of sites for Li+ ion intercalation and extraction and enhanced electrochromic properties [5]. The ability to accept electrons after UV irradiation giving rise to mixed-valency species is one of the most important properties, which displays blue color. This behavior of POMs makes them attractive candidates for photochromic devices. Ball et al. synthesized new hybrid films by Fe2+ doping into polyoxometalates acid (POMs)/polyacrylamide (PAM) system, which exhibited a good photochromic property. The color change intensity of PMoA/PAM film was 2.56 times stronger than that of Fe2+/PMoA/PAM under the same condition [6]. Jiang and co-workers prepared a novel phosphomolybdic acid (PMoA)-based composite film, which turned to blue and exhibited high photochromic responsiveness as well as reversible photochromism with visible light irradiation [7]. However, in comparison with a large number of

|| 1 College of Tourism and Cuisine, Harbin University of Commerce, Harbin, China, [email protected] 10.1515/9783110516623-029 DOI 10.1515/9783110303568-029

300 | Shu-Ping Liu researches on other photochromic materials, the study of photochromism based on POMs has been rarely reported. Titanium dioxide (TiO2), another important transition metal oxide, has been widely studied for its promising applications such as photocatalysis, solar cells, photoctrochromic and sensors. Cao and co-workers Anatase TiO2 nanocrystals exposed with {001} facets were fabricated by solvothermal strategy, which exhibited much superior photocatalytic activity for photodegradation of methyl orange [8]. Li et al. propose a heterojunction strategy based on a MoO3@TiO2 (MT) core/shell nanorods system which enhanced photochromic property [9]. Furthermore, TiO2 has been combined with POMs in films to enhance their properties. Ayati et al. deposited the gold nanoparticles on the surface of tungstophosphoric acid immobilized TiO2 nanotubes, which showed high photocatalytic efficiency in nitrobenzene removal [10]. Wang, et al. fabricated a ternary nanocomposite photoelectrode consisting of TiO2 nanoparticles, polyoxometalate and copper quantum dots, which demonstrated that both the photocurrent response [11]. In recent years, the layer-by-layer (LbL) method relied on alternately electrostatic adsorption of oppositely charged species has been widely utilized to fabricate composite films [12, 13]. The LbL method can control the structure, thickness and composition of the films, which is promising for the fabrication of POM films. Gao et al. prepared a series of LbL electrostatically self-assembled films consisting of one of three Keggin-type polyoxometalates, which uniformly deposited with the visible absorption bands [14]. Nasser et al. constructed multilayer films based on POMs through employment of the LbL using pentaerythritol-based Ru(II)metallodendrimer [RuD](PF6)8 as the cationic layer [15]. In this paper, we prepare a composite film containing POMs, TiO2 and poly (allylamine hydrochloride) (PAH) by LbL method. The film demonstrates color changes from colorless to blue after UV irradiation.

2 Experimental 2.1 Materials The colloidal dispersion of TiO2 and POM were synthesized according to the literature method [16]. 3-aminopropyltrimethoxysilane (APS), poly (styrenesulfonate) (PSS) (MW 70000) and PAH (MW70000) were purchased from Aldrich. Other reagents were of AR grade.

Preparation, Characterization and Photochromic Property | 301

2.2 Fabrication of the Film ITO and quartz substrates were used for the preparation of the composite films. First, APS modified substrates were dipped into HCl (pH=2.0) for 20 min to get an amino cation surface. Then they were immersed into PSS (5×10−3 mol/L) and PAH (5×10−3 mol/L pH=4.0) for 20min, respectively. Then they were alternately dipped into the POM (1×10−2 mol/L pH=2.0), PAH and POM solution for 8 min, and then immersed into a colloidal dispersion of TiO2 for 1 min. This sequence can be repeated until the desired number of layers (referred to as [POM–TiO2]) is obtained. All the fabrication processes were performed at room temperature. After deposition of each layer, the substrates were rinsed with HCl solution (pH 2.0) and dried in nitrogen.

2.3 Characterization UV–vis absorption spectra of quartz-supported and ITO-supported films were recorded on a 756CRT UV–visible spectrophotometer. Scanning electron micrographs were obtained with a Hitachi S-4800 instrument. The light source was a 125 W highpressure mercury lamp (HPML, output mainly at 313.2 nm).

3 Result and Discussion 3.1 Preparation of Composite Film The composite film was fabricated on ITO substrate by LbL method which relies on alternate electrostatic absorption of oppositely charged species. Figure 1 illustrates the schematics of the fabrication of a POM–TiO2 film. The formation of four kinds of layers primarily relies on coulombic interactions between the negative charged POM and the positive charged of PAH and TiO2. PAH was employed to increase stability of the multilayer film based on POMs and TiO2.

302 | Shu-Ping Liu

Fig.1: Schematics of the self-assembly of a [POM-TiO2] composite film.

Fig. 2: Transmittance spectra of [POM-TiO2]n film with n=0–4 on quartz substrate.

UV–vis spectroscopy was used to monitor the LbL assembling procedure of the material. Figure 2 displays the transmittance spectra as a function of the number of [POM-TiO2]n film on quartz substrate with n=0–4. The absorption is basically due to POM and TiO2 as PAH has no absorption in this area. The composite film displays the characteristic absorption with the bands at 208 and 253 nm. The former is owing to the terminal oxygen to tungstencharge transfer transitions, and the latter is due to the presence of TiO2, which confirms the incorporation of POM and TiO2 into the composite film [17].

Preparation, Characterization and Photochromic Property | 303

3.2 Surface Morphology of the Composite Film The detail information about surface morphology and the homogeneity of the composite film was provided by scanning electron microscopy (SEM). Figure 3 shows the SEM images of POM-TiO2 film on ITO glass. Generally, the precursor APS/PSS/PAH film is fairly smooth and uniform. However, after deposition of the POM, TiO2 and PAH layer, the mean surface roughness increases. As shown in Figure 3, the composite film displays a uniform distribution of the aggregate nanoclusters, which maybe arise from the absorption the POM anions and PAH chains.

3.3 Photochromic Properties of the Composite Film The absorption spectra of the POM-TiO2 composite films before and after UV irradiation are shown in Figure 4. After UV irradiation, a broad absorption band in the region above 600 nm was observed; meanwhile, the films turn blue which manifests the films in photochromism. As show in Figure 4, the absorption of the multilayer film in the visible region increases with different irradiation time. In order to demonstrate the photochromic mechanism, we made a comparison of the POM-TiO2 composite film with the TiO2 film.

Fig. 3: (a-b) Low- and high-magnification SEM images of POM-TiO2 film.

304 | Shu-Ping Liu

Fig.4: Absorbance change at 350–800 nm upon UV irradiation of 30 min and 60 min of the POM-TiO2 composite film at room temperature.

Fig. 5: The decaying curve of the absorbance at 800 nm of the irradiated POM-TiO2 composite film at room temperature.

After irradiation the latter film displays no significant absorption in the visible region. Therefore, the color change results from the reduction of POM. The bands are characteristic of reduced Dawson molecular species (heteropoly blues) with d-d bands charge transfer intervalence transitions (WV -W VI) in the visible region. The magnitude of the difference in the optical properties (∆OD) before and after the col-

Preparation, Characterization and Photochromic Property | 305

oration is used to evaluate the coloration change. After 30-min and 60-min UV-light irradiation, the ∆OD at 800 nm for the multilayer film is 0.05 and 0.02 respectively. The absorbance change for the multilayer film increases with the increased irradiation time. The bleaching process of the multilayer film after 30 min UV irradiation in shown in Figure 5. After the UV light was turned off, the blue film began to discolor in air, suggesting an unstable reduced species in the film.

Fig.6: The reversibility of the coloration-decoloration cycles of pom-tio2 composite film.

When the composite film was exposed upon air for 60 h, it returned to the initial state. Figure 6 shows the reversibility of the coloration-decoloration cycles of the multilayer film. Upon irradiation with UV light for coloration and oxidation in air for decoloration, the color of the composite film reversibly changes from colorless to blue. The absorption changes of the film at 800 nm are displayed in Figure 6 which indicated that the film has good photochromic reversibility.

4 Conclusion The composite film consisting of POM, TiO2 and PAH has been prepared using the LbL method. The composite film is found to switch from colorless to blue due to the reduction of POM. The absorption change for the composite film increases with the increased irradiation time. In addition, the composite film shows good photochromic reversibility. Therefore, the POM-based film may become a promising candidate for application in photochromic devices.

306 | Shu-Ping Liu Acknowledgement: This work was supported by the Natural Science Foundation of China (No. 21301041), Postdoctoral Scientific Research Starting Foundation of Heilongjiang Province, China (No. LBH-Q15072), Harbin University of Commerce Doctor Start-up Fund Research (No. 12DW030), Young Innovative Talent Training Program of General Undergraduate Colleges of Heilongjiang Province (No. UNPYSCT2016053), Young Creative Talents Program of Harbin University of Commerce (No. 2016QN059), Natural Science Foundation of Heilongjiang Province of China (No. B201409) and Scientific Research Fund of Heilongjiang Provincial Education Department (No. 12541213).

References [1]

[2]

[3]

[4]

[5]

[6]

[7]

[8]

[9]

[10]

Yanjun Gong, Fengqiao Bai, Zhidan Yu, Yanhui Bi, Wenwen Xu and Li Yu, “Photoluminescent Eu-containing polyoxometalate/gemini surfactant hybrid nanoparticles for biological applications”, RSC Advances, vol. 6, Jan. 2016, pp. 8601-8604, doi: 10.1039/C5RA21544G. Peng Huang, Xi-Guang Han, Xiu-Ling Li, Chao Qin, Xin-Long Wang and Zhong-Min Su, “Selfassembly and photocatalytic properties of Ta/W mixed-addendum polyoxometalate and transition-metal cations”, CrystEngComm, vol. 18, Oct. 2016, pp. 8722-8725, doi: 10.1039/C6CE01953F. Na Lia, Zhixia Sun, Ran Liu, Lin Xu, Ke Xu and Xi Ming Song, “Enhanced power conversion efficiency in phthalocyanine-sensitized solar cells by modifying TiO2 photoanode with polyoxometalate,” Solar Energy Materials and Solar Cells, vol. 157, Dec. 2016, pp. Surface Wear Mechanism of Escalator Step Chain: A Failure Analysis 853-860, doi: 10.1016/j.solmat.2016.08.005. unyong Zhang, Chunhua Gong, Xianghua Zeng, Jiahui Shu, Pingxiu Xiao and Jingli Xie, “Fabrication of crystalline porphyrinic polyoxometalate cluster with high thermal stability and exploration of its photocatalytic activity,” Polyhedron, vol. 121, Jan. 2017, pp. 95-100, doi: 10.1016/j.poly.2016.10.004. Shuping Liu, “Layer-by-layer assembled WO3 and tungstophosphate nanocomposite with enhanced electrochromic properties”, J Mater Sci: Mater Electron, vol. 27, Sep. 2016, pp. 1111811125, doi: 10.1007/s10854-016-5229-3. Jie Chen, Su-Ling Liu, Wei Feng, Xin-Jian Bao and Feng-Lin Yang, “The influence of Fe2+ doping on the microstructure and photochromic behavior of polyoxometalates acid/polyacrylamide hybrid films”, Optical Materials, vol. 35, Mar. 2013, pp. 973-977, doi: 10.1016/j.optmat.2012.11.022. Xiaofei Jing, Qingling Meng, Donglei Zou, Wei Feng and Xiangkui Han, “Visible light photochromism of polyoxometalates-based composite film with deposition of ZnFe2O4 nanoparticles”, Materials Letters, vol. 136, Dec. 2014, pp. 229-232, doi: 10.1016/j.matlet.2014.08.040. Yuhui Cao, Lanlan Zong, Qiuye Li, Chen Li, Junli Li and Jianjun Yang, “Solvothermal synthesis of TiO2 nanocrystals with {001} facets using titanic acid nanobelts for superior photocatalytic activity”, Applied Surface Science, vol. 391, Jan. 2017, pp. 311-317, doi: 10.1016/j.apsusc.2016.06.198. Ning Li,Yamei Li, Yijie Zhou, Wenjing Li, Shidong Ji, Heliang Yao and Xun Cao, “Interfacialcharge-transfer-induced photochromism of MoO3@TiO2 crystalline-core amorphous-shell nanorods”, Solar Energy Materials and Solar Cells, vol. 160, Feb. 2017, pp. 116-125, doi: 10.1016/j.solmat.2016.10.016. Ali Ayati, Bahareh Tanhaei, Fatemeh F. Bamoharramc, Ali Ahmadpourd, Philipp Maydannik and Mika Sillanpää, “Photocatalytic degradation of nitrobenzene by gold nanoparticles deco-

Preparation, Characterization and Photochromic Property | 307

[11]

[12]

[13]

[14]

[15]

[16]

[17]

rated polyoxometalate immobilized TiO2 nanotubes”, Separation and Purification Technology, vol. 171, Oct. 2016, pp. 62-68, doi: 10.1016/j.seppur.2016.07.015. Lihao Wang, Lin Xu, Ya Wang, Zhongmin Su and Ran Liu, “Photoelectrochemical enhancement of ternary nanocomposite electrode polyoxometalate/copper quantum dots/TiO2 with electrocatalytic performance of formic acid oxidation”, Electrochimica Acta, vol. 155, Feb. 2015, pp. 1-7, doi: 10.1016/j.electacta.2014.11.114. Wei Qi, Wenjing Yuan and Jing Yan, “The fabrication of glucose-sensitive insulin carriers with layer-by-layer assembly technique”, Journal of Controlled Release, vol. 213, Sep. 2015, pp. e110, doi: 10.1016/j.jconrel.2015.05.184. Qian Nan, Pei Li, and Bing Cao, “Fabrication of positively charged nanofiltration membrane via the layer-by-layer assembly of graphene oxide and polyethylenimine for desalination”, Applied Surface Science, vol. 387, Nov. 2016, pp. 521-528, doi: 10.1016/j.apsusc.2016.06.150. Li-Hua Gao, Jin-Feng Zhang, Hui-Li Wang, Xiao-Yan Lin, Jian-Min Qi and Ke-Zhi Wang, “Effects of elemental composition variations of Keggin polyoxometalates on photocurrent generation of their layer-by-layer self-assembled films with a hemicyanine dye”, Electrochimica Acta, vol. 166, Jun. 2015, pp. 215-222, doi: 10.1016/j.electacta.2015.03.062. Rashda Naseer, Sib Sankar Mal, Masooma Ibrahim, Ulrich Kortz, Gordon Armstrong, Fathima Laffir, Calum Dickinson, Mikhail Vagind and Timothy McCormac, “Redox, surface and electrocatalytic properties of layer-by-layer films based upon Fe(III)-substituted crown polyoxometalate [P8W48O184Fe16(OH)28(H2O)4]20-”, Electrochimica Acta, vol. 134, Jul. 2014, pp. 450-458, doi: 10.1016/j.electacta.2014.03.099. Shuping Liu, Lin Xu, Guanggang Gao, Bingbing Xu and Weihua Guo, “Electrochromic multilayer films with enhanced stability based on polyoxometalate and TiO”, Materials Chemistry and Physics, vol. 116, Feb. 2009, pp.88-93, doi: 10.1016/j.electacta.2009.02.054. Shuping Liu, Lin Xu, Fengyan Li,Weihua Guo, Yan Xing and Zhixia Sun, “Carbon nanotubesassisted polyoxometalate nanocomposite film with enhanced electrochromic performance”, Electrochimica Acta, vol. 56, Jul. 2011, pp.8156-8162, doi: 10.1016/j.electacta.2011.05.131.

Yi-Hua Shi1*, Xue-Biao Li2, Zhong-Ping Yang2 and Wei Fu3

Application of Inductively Couled PlasmaMass Spectrometry to the Speciation Analysis of Rare Earth Elements in Ion-Adsorption Rare Earth Ore Abstract: A sequential extraction procedure and acid digestion by HCl-HNO3-H2SO4HF were employed to evaluate the total contents and fractions of REEs in the ionadsorption rare earth ore of Guang-xi, respectively ,then the contents of REEs in ionadsorption rare earth ore samples and fractions extracted were determined by ICPMS.Standard series matrix matching, dilution shape extraction solution 20 times and added 103Rh-185Re double internal standard methods were studied, which eliminated the effects of the extraction agents such as magnesium chloride, sodium acetate, sodium pyrophosphate, oxalic acid and ammonium oxalate for the determination of rare earth elements by ICP-MS.The results show that the contents of REEs in the samples sampling from ion-adsorption rare earth ore are in the range of 685~2290mg·kg-1. The speciation distribution law with the fourteen kinds of rare earth elements such as La, Gd, Pr, Nd, Sm,Eu,Tb,Dy,Ho,Er,Tm,Yb and Lu is the ion exchange state > the carbonate combined state > the residual state >the combination state by humic acid > the iron-manganese oxide state > the strong organic state >the water soluble state, the ion exchange state which account for 48.6%~86.9% of the total rare earth is the mainly speciation. And the mainly speciation of Ce exists in the ion exchange, iron-manganese oxide, strong organic and residue state .The recovery ratios of the sum of fractions to total content of REEs are in the range of 95%~107%. The sequential extraction procedure is suitable for the speciation analysis of rare earth elements in ion-adsorption rare earth ore. Keywords: Inductively couled plasma-mass spectrometry (ICP-MS); Ion-adsorption rare earth ore; Rare earth elements; Speciation analysis

|| China Nonferrous Metal (Guilin) Geology and amining Co., Ltd,, Guilin, 541004, China; *Email:[email protected] 2 China Nonferrous Metal (Guilin) Geology and amining Co.,Ltd, Guilin, 541004, China 3 College of Earth Sciences, Guilin University of Technology, Guilin 541004, China, Email:[email protected] 10.1515/9783110516623-030 DOI 10.1515/9783110303568-030

310 | Yi-Hua Shi, Xue-Biao Li, Zhong-Ping Yang and Wei Fu

1 Introduction Ionic type rare earth ore is a common kind of rare earth ore [1] in South China. As geologists continuously deepen the research of the ionic type rare earth ore, it is required the accurate phase state content of rare earth elements in ionic type rare earth ore to provide an important technical support for the study of the ionic type rare earth ore mineralization mechanism, the evaluation of the ore body, the comprehensive utilization experiments of rare earth resources, the influence, evaluation and research of rare earth elements geochemistry. At present, the determination of rare earth elements in the ionic type rare earth ore is mostly the determination of the total amount and the component of the rare earth element, and there is few research on the rare earth element phase state of the ionic type rare earth ore. The author [2] determines the ionic phase rare earth in the ionic type rare earth ore by ICP-MS without analysis of the other phase. The increasingly updating selective continuous chemical extraction method has been widely used in the analysis of different element speciations in soil and sediment [3-5], which uses different extracting agents to extract and separate the different speciations of the elements in soil and sediment step by step. There are some reports on which the selective continuous chemical extraction method is applied to research of different chemical speciations of rare earth elements in geochemical samples of soil [6], cobalt bearing crust [7], and sediment [8] and so on, which is stable and reliable. In the study of mineralization law of ionic type rare earth, it is not only to analyze the total amount and component of rare earth elements in ionic type rare earth ore, but also need to know the influence of chemical speciations on the mobility differences, persistence and usability of environmental geochemistry of the trace rare earth elements in the ionic type rare earth ore, and it needs a stable chemical speciation continuous extraction technique to obtain relevant accurate data. Therefore, according to the characteristics of the weathering mineralization of the ionic type rare earth ore, it is applicable to use selective continuous chemical extraction method in the rare earth elements speciation analysis of ionic type rare earth ore. At present, ICP-MS has the characteristics of less interference, low detection limit, high accuracy and simultaneous determination of multiple elements, it is widely used in the determination of microelements and trace elements in the sample of geology [9-12], biological medicine [13-15], new materials [16] and so on, which is the main analysis technique of microelements and trace elements in all kinds of materials. In this paper, referring to the element speciation continuous extraction method in soil and sediment[3,6], it analyses seven kinds of chemical speciations of rare earth elements in ionic type rare earth ore: the water soluble state, the ion exchange state, the carbonate combined state, the combination state by humic acid, the iron-manganese oxide state, organic high combination and the residual state by ICP-MS, studies matrix interference factor, in which a method for chemical specia-

Speciation Analysis of Rare Earth Elements in Ion-Adsorption Rare Earth Ore | 311

tion analysis of rare earth elements is established to provide an important basis for the related research of ionic type rare earth ore in China.

2 Experimental 2.1 Instrumentation ICAP Qc Series Inductively Coupled Plasma Mass spectrometer (America Thermo Scientific Company). Operating Parameters: Forward Power 1.55 kW, Atomized Gas Velocity 1.04 L•min-1;Auxiliary Air Flow 0.80 L•min-1; Cooling Gas Flow 14.0 L•min-1; Inject Speed 50 r•min-1; Determination Method: peak hopping; Integration Time 10 S; Sampling Depth 5.00 mm; Sampling Cone (Ni) Aperture: 1.0 mm; Skimmer Cone (Ni) Aperture: 0.7 mm. THZ-82 Water-bathing Constant Temperature Vibrator (Jintan Han Kang Electronics Co., Ltd.); TGL-16M High Speed Figuretop Refrigerated Centrifuge (Hunan Xiang Yi Company).

2.2 Material and Reagents T are earth elements, rhodium and rhenium standard stock solution are provided by the National Nonferrous Metals and Electronic Materials Analysis and Testing Center. The content of each element is 1 000 mg•L-1; the mixed rare earth standard working solution is diluted to the experimental concentration step by step from the standard stock solution. The medium and extracting agent of various speciations of solution to be tested are basically in the same matrix. The experimental acid is GR. The extraction reagents of Magnesium Chloride, Sodium Acetate, Tetrasodium Pyrophosphate, Oxalic Acid, Ammonium Oxalate are AR. 18.2 MΩ•cm ultrapure water was used throughout this work.

2.3 Experimental Prcedure 1) Sample preparation Collect rare earth ore in a certain ionic type rare earth ore district in Guangxi, remove weeds, leaves and other debris, after natural dried, grinded with agate mortar to make it all through the 74 μm nylon sieve, then mix and store in a dry grinding glass bottle for preparation. 2) Analysis method of rare earth elements in ionic type rare earth ore sample [9] Weigh 0.1000 g ionic type rare earth ore sample into a 100 mL of teflon beaker, wet with a small amount of water, then add 5 mL HNO3, 5 mL HF, 1mL H2SO4 and 1mL HClO4, heat it on the electric furnace with temperature control of 100 °C for 4 h with cover. Remove the cover, heat up to 200 °C till the stream is dried up

312 | Yi-Hua Shi, Xue-Biao Li, Zhong-Ping Yang and Wei Fu and the white smoke disappears. Take it off, slightly cool down then add 5 mL aqua regia to dry up on 150 °C. Add 5 mL aqua regia until the residue is completely dissolved. Fix volume with a 100 mL capacity bottle. Meanwhile, according to the experimental procedure, make the procedure blank. With 103Rh and 185 Re as interior standards, determine the rare earth elements in sample solution by ICP-MS Method. At the same time, the national grade one standard material GBW07158 is used as the analysis quality control sample. 3) Method for Extracting Speciation of Rare Earth Element Continuous extraction method is used in chemical speciation analysis of rare earth elements in ionic type rare earth ore, the main process is shown in Figure 1.

Speciation Analysis of Rare Earth Elements in Ion-Adsorption Rare Earth Ore | 313

Fig.1: Flow diagram of continuous extraction method

314 | Yi-Hua Shi, Xue-Biao Li, Zhong-Ping Yang and Wei Fu

3 Results and Discussion 3.1 Determination of Isotope Selection Isotope selection for the determination of elements by ICP-MS was under the principle of selecting the maximum value of measuring isotope abundance and avoiding the use of polyatomic ion or isotope of isobaric overlap. In this paper, we considered the potential interference factors during the determination process. The coexistence elements in multiple solutions[II.C.2) and 3)]were determined by ICP-MS and ICPAES, the results showed that the concentrations of sodium, potassium, magnesium, calcium, phosphorus, aluminum and iron were less than 0.5 mg•L-1, the concentrations of lithium, barium, copper, lead, zinc, strontium, cadmium, chromium, nickel and manganese were less than 0.1 mg•L-1, which showed that these elements do not interfere with the determination of rare earth elements. Although the gold, platinum, palladium, indium, rhenium, osmium, iridium, hafnium, tantalum, tungsten, bismuth and thallium of the solution interfere with the determination of rare earth elements, their concentrations are less than 0.1 μg•L-1, which produced negligible effect on the determination of rare earth elements. Considering the main interference of rare earth analysis by ICP-MS introduced in the reference [17], the isotope determined in the experiment were 89 139 140 141 146 147 153 157 159 163 165 166 169 172 175 Y, La, Ce, Pr, Nd, Sm, Eu, Gd, Tb, Dy, Ho, Er, Tm, Yb, Lu.

3.2 Matrix Interference and Elimination Although ICP-MS had little interference, it had great matrix effect in the practical application of the speciation analysis of rare earth elements in the ionic type rare earth ore, which was mainly caused by high matrix salt concentration of the extraction agent of rare earth elements. Based on Hu Shenghong[18], He Man[19] and other authors’ matrix effect studies of determination of rare earth elements by ICP-MS, the total dissolved solids (TSD) in solution[II.C .3)F1 and F7] was less than 0.05%, therefore the influence of matrix effect on the determination of rare earth elements was negligible. In this paper, a series of mixed standard solution of rare earth elements containing 10μg•L-1 was prepared (Matrix matching had been perspeciationed by adding different concentrations of the extract and 0.3 mol·L-1 HNO3). The effect of F2~F6 morphology extraction agent on elements to be tested was investigated. The internal standard 103Rh and 185Re were added into the sample solution through three links in the determination process, the recovery rate of each element was between 90% and 102%. The result showed that with the increase of the concentration of MgCl2, NaAc, Na4P2O7, NH2OH•HCl-HCl and HNO3-H2O2-NH4Ac, it had different degree of the matrix inhibitory effect on the determination of rare earth elements. When the extract was diluted more than 20 times (MgCl2 was 0.05 mol·L-1, NaAc was 0.05

Speciation Analysis of Rare Earth Elements in Ion-Adsorption Rare Earth Ore | 315

mol·L-1, Na4P2O7 was 0.005 mol·L-1, 0.0125 mol·L-1NH2OH•HCl-0.0125 mol·L-1HCl, 0.5%(V/V)H2O2-0.016 mol·L-1 NH4Ac), the recovery rate of the elements were more than 98%, which was consistent with the matrix effect of the determination of rare earth elements that could be eliminated by diluting the solution to be tested reported in the literature[18]. Therefore, the method eliminated the influence of matrix effect through diluting the extracted state solution by 20 times and added various speciations of extraction into the standard series solution to be consistent with the matrix of the solution to be measured, as well as using double internal standards 103 Rh and 185Re for correction.

3.3 Selection of Internal Standard Elements The selection principle of internal standard elements in the process of ICP-MS analysis: The solutions to be measured didn’t include the selected internal standard elements; the internal standard elements were close to the elements to be tested in mass number, ionization potential and boiling point. It commonly used double internal standard 103Rh-187Re for correction in determination of rare earth elements. Because Rh and Re are very low in the sample solution to be measured, the effect on the determination of rare earth elements was very small. Therefore, the experiment was based on 10μg•L-1 mixed rare earth standard solution (Each containing 0.05 mol·L-1 of MgCl2, 0.05 mol·L-1 of NaAc, 0.005 mol·L-1 of Na4P2O7, 0.0125 mol·L1 NH2OH•HCl-0.0125 mol·L-1HCl, 0.47 %( V/V) H2O2-0.016 mol·L-1 NH4Ac) as the tested object. The Rh and Re solutions of 10μg·L-1 were selected as internal standard for correction experiment. The result showed that the recovery rate of 15 rare earth elements were between 90% and 98% without double internal standard of 103Rh and 185 Re used for correction; while the recovery rate of rare earth elements were between 97% and 102% with double internal standard of 103Rh and 185Re used for correction, as 185Re for correcting Tb, Dy, Ho, Er, Tm, Yb, Lu and as103Rh for correcting Y, La, Ce, Pr, Nd, Sm, Eu, Gd. Therefore, 10μg/L of 103Rh and 185Re solutions was chosen as internal standard to compensate for matrix effects and instrument drift.

3.4 Calibration Curve and Detection Limit of the Method Prepare standard series solution according to Table 1, various speciations of extraction was added to the standard series solution to be consistent with the matrix of the solution to be tested in order to eliminate the matrix effect. Because the large difference in the content of each element, the calibration curves range was relatively wide. The calibration curve can be drawn by 3 ~ 4 points according to the content of the element to be measured. After determination, the linear regression equation and correlation coefficient of each element can be obtained. The linear correlation coef-

316 | Yi-Hua Shi, Xue-Biao Li, Zhong-Ping Yang and Wei Fu ficients of the elements were all over 0.99992. The blank determination was taken by leaching process of rare earth element speciations in Figure 1, the detection limit was calculated by 3 times standard deviation of 11 blank determinations, and the results were listed in Table 2. Table 1: The Series of Mixed Standard Solution with Matrix Matching (Μg·L-1) element

Standard 1

Standard 2 Standard 3 Standard 4 Standard 5

Standard 6

La,Y,Ce,Nd

2.5

5

10

50

100

500

Pr,Sm,Gd,D y

1.25

2.5

5

25

50

250

Eu,Tb,Ho

0.25

0.5

1

5

10

50

Er,Yb

0.5

1

2

10

20

100

Tm,Lu

0.1

0.2

0.4

2

4

20

Table 2: The Detection Limits of the Method Spe- Detection(mg·kg-1) ciaLa Ce Pr Nd tion Y

Sm

Eu

Gd

Tb

Dy

Ho

Er

Tm

Yb

Lu

F1

0.0 0.0 0.0 0.0 0.0 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.002 30 31 29 08 23 41 19 28 22 40 21 40 10 29 2

F2

0.2 0.2 0.3 0.0 0.2 0.05 0.01 0.01 0.01 0.01 0.02 0.02 0.01 0.02 0.012 1 3 8 75 1 1 6 3 5 9 3 5 1 6

F3

0.1 0.2 0.1 0.1 0.1 0.04 0.01 0.01 0.01 0.01 0.02 0.02 0.01 0.02 0.011 2 3 5 4 8 6 3 1 4 7 1 2 0 1

F4

0.0 0.1 0.1 0.0 0.1 0.03 0.01 0.00 0.01 0.01 0.01 0.01 0.00 0.01 0.006 82 3 2 78 6 2 1 59 1 2 5 3 59 3 1

F5

0.0 0.1 0.6 0.0 0.1 0.02 0.00 0.00 0.01 0.00 0.01 0.00 0.00 0.01 0.005 61 5 6 51 2 8 70 51 0 82 2 9 51 1 0

F6

0.0 0.1 0.7 0.0 0.1 0.02 0.00 0.00 0.01 0.00 0.01 0.01 0.00 0.01 0.006 48 2 3 42 1 3 62 61 0 89 1 0 70 0 2

F7

0.0 0.1 0.3 0.0 0.0 0.01 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.004 51 1 2 64 46 1 89 78 71 60 67 82 48 60 7

Speciation Analysis of Rare Earth Elements in Ion-Adsorption Rare Earth Ore | 317 Table 3: Total Content of Rare Earth Elements in the Ionic-Adsorption Rare Earth Ore (Mg·Kg-1) Sample

TQ1

TQ2

TQ3

TQ4

TQ5

GBW07158 Found

GBW07158 Refence

Y

485

72.2

110

242

506

141

142

La

464

113

176

306

583

260

264

Ce

153

302

344

222

177

74.7

74.9

Pr

102.8

26.5

39.8

71.5

119

41.3

40.7

Nd

379

91.8

154

264

456

144

146

Sm

80.8

16.8

26.8

50.7

86.9

28.3

28.6

Eu

14.9

2.93

4.38

8.93

16

7.15

7

Gd

97.6

19.9

30.5

60.9

101.9

28

27.5

Tb

19.8

3.66

5.36

11.2

21

4.6

4.59

Dy

84.5

14

20

43.5

88.9

23.3

23.8

Ho

16.3

2.88

4.44

8.76

16.8

5.1

4.98

Er

52.7

9.97

13.9

26.7

54.9

14.5

14

Tm

5.96

1.19

1.81

3.09

6.06

2.04

2.1

Yb

39.6

7.46

10.9

20.6

41.3

12.7

12.4

Lu

5.67

1.26

1.81

3.06

5.76

1.8

1.76

REE

2001

685

944

1343

2280

788

794

3.5 Total Content Analysis of Rare Earth Elements in Ionic Type Rare Earth Ore According to the steps of [II.C.2)] , the 15 rare earth elements (GBW07158 rare earth ore sample for quality control sample) in ionic type rare earth ore sample(TQ1-TQ5) were determined(n=5), the average value of the experimental results were listed in Table 3. The results show that the measured value of GBW07158 is consistent with the reference value. The total amount of 15 kinds of rare earth elements in the ionic type rare earth ore is between 685 and 2290 mg•kg-1, during which content of rare earth elements Y, La, Ce, Pr, Nd is relatively high. The total content of these five elements is more than 79.1% of the total content of rare earth elements.

3.6 The Precision of Speciation Analysis Parallel weigh 5 portions of TQ1 rare earth ore samples, determine different speciation contents of rare earth elements according to the steps of [II.C.3)],The specific

318 | Yi-Hua Shi, Xue-Biao Li, Zhong-Ping Yang and Wei Fu data was shown in Table 4. The result shows that the precision of each rare earth element speciation is between 1.35% and 10.1%

3.7 Determination of the Speciation of Rare Earth Elements i The rare earth elements in ion-type rare-earth ore samples (TQ1-TQ5) were analyzed in three parallel.(According to the steps of II.C.3)).The experimental results (in which TF is the total of 7 speciations) are shown in table 5.From the table 3, table 4 and table 5, it can be seen that the water soluble state (F1) is the lowest and ion exchange state (F2) is the highest (except for Ce) in the seven speciations of ionic type rare earth ore (TQ1 ~ TQ5). The sum of various speciations rare earth elements is close to that of rare earth.Total amount of 15 ion exchange state elements is more than 48.6% (TQ2) of total amount of rare earth (REE) , the highest is 86.9%(TQ1), which states that the rare earth elements of ionic rare earth ore mainly exists as ion exchange state. The speciation distribution law of rare earth elements (except Ce): ion exchange state (F2)> carbonate bound state (F3)> residual state (F7)>humic acid state (F4)> iron-manganese oxide state (F5)> organic high combination state (F6)>water soluble state (F1), mainly in the presence of ion exchange state. While the distribution of Ce is not obvious, mainly in the presence of ion-exchange state, iron-manganese oxide bound statem,strong organic and residual state, accounting for 18.1% ~ 50.1%, 7.3% ~ 17.2%, 13.2% ~ 51.0% and 11.1% ~ 50.2% of the total amount of Ce.The total amount of these four speciations is more than 94.7% of the total amount of Ce. It states that during the ionic type rare earth mineralization, influenced by the natural climate condition, mineralization mother rock condition and the tectonic landspeciation condition in the ore district[20], relying on supergene weathering, leaching, infiltration, adsorption for mineralization, during which Ce is easily oxidized to Ce4+ in the surface layer of the ore body from Ce2+ , under the condition of weak acid, the hydrolysis is easy to occur, leading to the migration and transspeciationation of Ce speciation is different from that of other rare earth elements, which remains to be further discussed. The worth recovery rate of total amount of rare earth elements relative to the total amount is between 95% and 107%, which shows that the extraction method is suitable for the rare earth speciation analysis of rare earth elements in ionic type rare earth ore.

Speciation Analysis of Rare Earth Elements in Ion-Adsorption Rare Earth Ore | 319 Table 4: Precision test results of the method Elm Results(n=5) ent F1 F2

F3

F4

F5

F6

F7

Found RSD Found RSD Found RSD Found RSD Found RSD Found RSD Found RSD / /% / /% / /% / /% / /% /% / /% / mg·kg mg·kg mg·kg mg·kg mg·kg mg·kg mg·kg -1

-1

-1

-1

-1

-1

-1

Y

0.24

4.2 8

439

2.3 6

39.3

3.5 1

2.07

4.6 7

1.21

3.5 6

0.81

3.2 6

7.62

3.62

La

0.21

5.3 1

421

1.8 7

39.2

3.3 3

1.82

4.8 9

1.07

3.3 4

0.9

3.4 2

8.85

3.89

Ce

0.089 6.8 7

75

2.6 9

7.12

4.6 1

0.78

5.1 2

17.1

2.9 6

23.4

2.2 4

26.9

2.26

Pr

0.052 6.5 1

91.8

2.8 7

9.58

4.2 2

0.48

5.2 3

0.29

4.8 7

0.24

3.5 5

2.58

3.57

Nd

0.21

4.6 7

337

1.3 5

35.1

3.1 7

1.61

4.1 3

1.07

3.9 5

0.95

3.1 7

7.01

3.23

Sm 0.043 5.2 6

72.8

2.7 6

8.15

4.1 8

0.38

5.2 6

0.26

4.7 2

0.21

4.1 3

1.81

4.6

Eu

0.009 7.2 1

12.3

3.9 7

1.45

5.1

0.091 6.1 4

0.062 5.8 6

0.04

5.7 6

1.55

4.73

Gd

0.055 5.4 3

87.3

2.6 2

8.79

3.6 6

0.46

5.5 5

0.34

0.29

5.1

2.07

4.15

Tb

0.01

6.2

17.5

3.8

1.93

4.7 9

0.14

5.8 6

0.092 5.5 7

0.062 6.1 4

0.52

5.1

Dy

0.045 5.2 4

74.4

2.9 5

8.1

4.1 1

0.43

5.9 7

0.37

3.9 9

0.23

4.8 9

1.82

4.03

Ho

0.009 7.6 3

14.5

3.6 9

1.6

5.6 8

0.12

6.0 2

0.07

5.1 4

0.034 5.6 3

0.52

5.02

Er

0.026 6.2 5

46.1

3.1 3

4.65

4.1 4

0.32

5.1 7

0.23

3.6 8

0.14

4.1 8

1.61

3.79

Tm

0.003 9.6 4

5.18

4.1 6

0.65

6.1 7

0.064 6.2 5

0.028 6.1 1

0.013 6.1 2

0.27

4.33

Yb

0.022 5.2 3

33.2

3.3 3

3.75

3.9 8

0.34

4.4 5

0.019 6.3 5

0.12

4.2 7

1.71

3.92

Lu

0.003 10. 1

4.47

4.1 3

0.55

5.8 6

0.064 5.8 8

0.032 5.7

0.018 5.7 9

0.49

4.87

4.6 9

320 | Yi-Hua Shi, Xue-Biao Li, Zhong-Ping Yang and Wei Fu Table 5: E results of speciation analysis for rare earth elements in the ionic-adsorption rare earth ore (mg·kg-1) Sample

speciation

Y

La

Ce

Pr

Nd

Sm

Eu

TQ1

F1

0.24

0.21

0.087

0.051

0.21

0.042

0.0091 0.054

F2

441

423

75.1

92.3

339

73.2

12.4

87.7

F3

38.7

38.7

6.94

9.37

34.6

7.95

1.33

8.59

F4

2.05

1.78

0.76

0.46

1.59

0.36

0.071

0.45

F5

1.23

1.09

17.7

0.3

1.09

0.27

0.066

0.35

F6

0.79

0.88

22.9

0.23

0.93

0.22

0.039

0.27

F7

7.54

8.73

26.4

2.5

6.89

1.76

1.49

2.02

TF

491

474

150

105

384

83.8

15.4

99.5

F1

0.55

0.55

0.49

0.12

0.47

0.098

0.023

0.121

F2

53.5

82.9

61.6

17.4

63.9

11.4

1.74

14.1

F3

8.4

11.9

9.61

3.12

12.1

2.51

0.39

2.72

F4

1.55

1.5

2.17

0.46

1.61

0.37

0.065

0.4

F5

2.06

2.99

50.5

0.72

2.72

0.59

0.095

0.75

F6

1.62

2.92

93.6

0.84

3.12

0.58

0.095

0.86

F7

8.07

6.51

75.3

2.02

5.77

1.48

0.38

1.73 20.6

TQ2

TQ3

TQ4

TQ5

Gd

TF

75.8

109

293

24.7

89.7

17

2.79

F1

0.068

0.085

0.091

0.02

0.081

0.014

0.0036 0.019

F2

81.2

137

63.6

29.4

116

18.9

3.18

23.9

F3

11.8

18.5

11.6

4.7

17.6

3.76

0.57

3.7

F4

2.43

2.93

3.1

0.89

3.08

0.74

0.12

0.78

F5

1.15

1.92

49.6

0.46

1.89

0.43

0.076

0.59

F6

1.27

2.14

173

0.71

2.48

0.55

0.088

1.04

F7

8.29

7.33

37.9

2.17

6.18

1.57

0.41

1.81

TF

106

169

339

38.4

147

25.9

4.45

31.9

F1

0.17

0.19

0.13

0.046

0.17

0.033

0.008

0.042

F2

202

252

55.8

55.3

215

39.4

6.65

49.4

F3

16.4

19.8

5.06

4.83

17.6

3.83

0.62

4.28

F4

1.1

1.27

1.06

0.32

0.99

0.22

0.038

0.27

F5

0.57

0.69

15.4

0.18

0.67

0.15

0.033

0.2

F6

0.39

0.59

27.8

0.15

0.66

0.12

0.031

0.21

F7

9.79

19.9

105.9

8.28

19.6

4.84

1.4

7.16

TF

230

295

211

69.1

255

48.6

8.78

61.6

F1

0.29

0.27

0.12

0.065

0.25

0.054

0.01

0.065

Speciation Analysis of Rare Earth Elements in Ion-Adsorption Rare Earth Ore | 321

Sample

speciation

Y

La

Ce

Pr

Nd

Sm

Eu

Gd

F2

452

521

76.4

103.5

408

76

12.8

93.3

F3

36.9

40.3

7.16

9.32

33.9

7.23

1.26

7.42

F4

2.14

1.9

0.9

0.5

1.64

0.39

0.075

0.47

F5

1.22

1.13

16.6

0.31

1.09

0.28

0.071

0.33

F6

0.72

0.85

32.6

0.23

0.87

0.21

0.048

0.27

F7

6.11

5.95

39.9

1.9

5.28

1.39

1.51

1.58 103

TF

499

571

174

116

451

85.6

15.8

Sample

Tb

Dy

Ho

Er

Tm

Yb

Lu

TF-REE

TQ1

0.01

0.044

0.0089

0.025

0.003

0.021

0.003

1.02

17.6

74.8

14.6

46.3

5.21

33.3

4.49

1740

1.81

7.91

1.48

4.5

0.54

3.61

0.5

167

0.12

0.42

0.1

0.3

0.059

0.32

0.058

8.9

0.094

0.38

0.071

0.23

0.029

0.2

0.033

23.1

0.061

0.23

0.033

0.137

0.013

0.132

0.016

26.9

0.48

1.78

0.49

1.54

0.24

1.64

0.44

63.9

20.2

85.6

16.8

53

6.09

39.2

5.54

2029

0.023

0.099

0.02

0.066

0.007

0.046

0.006

2.69

2.54

9.61

1.93

6.3

0.72

4.47

0.62

332.7

0.49

1.8

0.36

1.11

0.12

0.81

0.12

55.6

TQ2

TQ3

TQ4

0.1

0.34

0.077

0.25

0.046

0.27

0.056

9.26

0.16

0.49

0.102

0.34

0.034

0.22

0.031

61.8

0.15

0.39

0.073

0.3

0.027

0.2

0.025

105

0.45

1.77

0.47

1.4

0.23

1.57

0.44

108

1.18

3.91

14.5

3.02

9.76

7.58

1.3

674

0.0038

0.014

0.003

0.0071 0.001

0.005

0.001

0.42

4.12

14.8

2.99

10.1

1.13

7.03

0.97

514

0.67

2.51

0.48

1.55

0.17

1.09

0.17

78.9

0.16

0.56

0.13

0.41

0.064

0.41

0.068

15.9

0.11

0.36

0.068

0.21

0.023

0.17

0.026

57.1

0.16

0.4

0.064

0.269

0.028

0.208

0.028

182

0.45

1.76

0.49

1.55

0.22

1.69

0.44

72.3

5.67

20.4

4.22

14.1

1.64

10.6

1.7

921

0.0081

0.031

0.007

0.017

0.002

0.015

0.003

0.87

9.31

37.4

7.33

23.6

2.64

17.5

2.34

976

0.81

3.36

0.64

2.01

0.24

1.46

0.21

81.2

0.07

0.22

0.058

0.18

0.035

0.16

0.041

6.03

0.049

0.17

0.033

0.086

0.011

0.071

0.012

18.3

322 | Yi-Hua Shi, Xue-Biao Li, Zhong-Ping Yang and Wei Fu

Sample

TQ5

speciation

Y

La

Ce

Pr

Nd

Sm

Eu

0.034

0.11

0.014

0.066

0.003

0.047

0.004

30.2

1.16

3.45

0.68

2.27

0.27

1.85

0.48

187

11.4

44.8

8.76

28.2

3.2

21.1

3.08

1300

0.012

0.051

0.011

0.036

0.003

0.025

0.003

1.27

18.5

78.1

15.2

48.1

5.43

34.9

4.74

1948

1.63

7.53

1.42

4.16

0.49

3.22

0.46

162

0.11

0.42

0.1

0.31

0.061

0.32

0.058

9.39

0.09

0.38

0.072

0.217

0.029

0.21

0.027

22.1

0.057

0.26

0.038

0.137

0.016

0.123

0.016

36.4

0.38

1.56

0.42

1.27

0.19

1.46

0.41

69.3

20.8

88.3

17.3

54.2

6.22

40.3

5.71

2249

Gd

4 Conclusions The matrix interference of the determination of rare earth elements is eliminated by experiments.The seven speciations (such as water soluble, ion exchange, carbonate bound, humic acid bound, iron-manganese oxide bound, organic high combination and residual)of 15 rare earth elements in a certain rare earth ore district in Guangxi are exactly analyzed by the method of selective continuous extraction and ICP-MS method.The result shows that the ionic type rare earth ore mainly exists as the ion exchange state, the total amount of seven speciations rare earth element components is completely consistent with the total amount of rare earth, which is able to reflect the existing speciations of rare earth elements and the distribution law of various speciations and shapes in the ionic type rare earth ore district. This method provides an important reference data for the study of rare earth elements chemical fractions in the ionic type rare earth ore district. Acknowledgement: This work is supported by the National Natural Science Foundation of China (No.41462005), Natural Science Foundation of Guangxi (No.2014GXNSFBA118226) and Science Research and Technology Development Project of Guangxi (No. 14123006-12).

References [1]

LI Yongxiu,ZHANG Ling,ZHOU Xinmu.Resource and Environment Protected Exploitation Model for Ion-type Rare Earth Deposit in Southern of China[J]. Chinese Rare Earths, 2010,

Speciation Analysis of Rare Earth Elements in Ion-Adsorption Rare Earth Ore | 323

[2]

[3]

[4]

[5]

[6]

[7]

[8]

[9]

[10]

[11]

[12]

[13]

[14]

[15]

31(2):80. SHI Yihua,QIU Li,TANG Biyu,YANG Zhongping,SONG Cian,GU Xingqian.Determination of total ionic-phase rare earth and component in ion-adsorption rare earth ore by inductively coupled plasma mass spectrometry[J].Metallurgical Analysis,2014,39(9):14. doi: 10. 13228/j. issn.1000-7571.2014.09.003. GUAN Tianxia, HE Hongbo,ZHANG Xudong,BAI Zhen,XIE Hong-tu. The Methodology of Fractionation Analysis and the Factors affecting the Species of Heavy Metals in Soil [J]. Chinese Journal of Soil Science, 2011, 42(2):503. XU Yayan, BAI Yucai,WANG Yunlong,YIN Yane,JIANG Mei, YUAN Qi. Variation Characteristics and Potential Ecological Risk Assessment of Cd and Pb in the Sediments of the East China Sea [J]. Ecology and Environmental Sciences, 2015, 24(4): 650.doi: 10.16258/j.cnki.16745906.2015.04.016. HU Dexin,WU Suru,LIU Yueyong,WANG Hong,WANG Xiang-dong,LI Quanbing.Determination of Chemical Species of Cadmium,Arsenic and Lead in Mineral Yard Soil by Modified BCR and ICP-AES Method[J].Rock and Mineral Analysis,2014,33(3):369. GUO Pengran.JIA Xiao,DUAN Taicheng,ZHANG Yiming ,XU Ta,CHEN Hangting. Speciation Analysis of Rare Earth Elements in Soil [J]. Chinese Journal of Anaytical Chemisty, 2008, 36(11):1483. GAO Jingjing,LIU Jihua,LI Xianguo,ZHANG Hui,HE Lianhua.Chemical Phase Analysis of Rare Earth Elements in Cobalt-rich Crusts and Its Application[J]. Chinese Journal of Analytical Chemistry, 2015, 43(12): 1895, doi: 10.11895/j.issn.0253-3820.150418. LIU Jingjun, LAI Zijuan, LIU Ying. Study on Speciation and Fractionation of Rare Earth Elements in Surface Sediments in Gansu,Ningxia and Inner Mongolia Sections of Yellow River[J].Spectroscopy and Spectral Analysis,2013,33(3):798,doi:10.3964/j.issrh 10000593(2013}03-0798-06. ZHANG Yafeng,FENG Jun,TANG Jie,LONG Junqiao,WANG Fei,YANG Feng. Simultaneous Determination of 46 Species of Micro,Trace and Rare Earth Elements by ICP-MS Based on the System of Five-Acids Dissolution of Sample[J]. Journal of Chinese Mass SpectrometrySociety, 2016, 37(2):186-192, doi: 10.7538/zpxb...2016..37.02.0186 ZHOU Guoxing, LIU Xixiang, CUI Desong. Determination of 28 Elements Including Rare Earth Elements by ICP-MS in Alkali Melted Rock Sample [J]. Journal of Chinese Mass Spectrometry Society, 2010, 31(2): 120. [YANG Boyong, HU Bin,BAO Zhengyu,ZHANG Zhaogan. REE geochemical characteristics and depositional environment of the black shale-hosted Baiguoyuan Ag-V deposit in Xingshan,Hubei Province,China[J]. Journal of Rare Earths, 2011, 29(5):499. doi: 10.1016/S10020721(10)60488-7 LI JingXi, ZHU ZhiWei,YIN XiaoFei, HAN Bin, ZHENG Li, WANG Jiangtao. Analysis of Contents and Distribution Patterns of Rare Earth Elements in Surface Sediments of the South MidAtlantic Ridge [J]. Chinese Journal of Analytical Chemistry, 2015, 43(1): 21, doi: 10. 11895 / j. issn. 0253_3820. 140557 NING Pengbo, GONG Chunmei, ZHANG Yanming, GUO Kangkang. La, Ce, Pr, Nd and Sm concentrations in Pu’er tea of Yunnan, China [J]. Journal of Rare Earths, 2010, 28(4):636, DOI: 10.1016/S1002-0721(09)60170-8. ZHAO Yanfang SHANG Derong ZHAI Yuxiu,et al. Application of ICP-MS to Detect Rare Earth Elements in Three Economic Macroalgaes in China[J]. Spectroscopy and Spectral Analysis, 2015, 35(11):3196, doi:10.3964/j.issn.1000-0593 (2015)11-3196-04. CAO Can,WANG Zhijia,WU Dongdong,CUI Chang,WU Zhigang. Simultaneous Determination of Ten Trace Elements in Soft Capsules by Microwave Digestion-ICP-MS[J].Journal of Chinese Mass Spectrometry Society,2015,36(5): 442,doi:10.7538/zpxb.youxian.2015.0026.

324 | Yi-Hua Shi, Xue-Biao Li, Zhong-Ping Yang and Wei Fu [16]

[17] [18]

[19] [20]

NIE Xidu,FU Liang.Determination of Heavy Metal Elements in Diatomite Filter Aid by Inductively Coupled Plasma Mass Spectrometry[J]. Spectroscopy and Spectral Analysis, 2015, 35(11):3192, doi:10.3964/j.issn.1000-0593 (2015)11-3192-04. WANG Xiaoru. Applications of Inductively Coupled Plasma Mass Spectrometry [M].Beijing:Chemical Industry Press, 2005, 199-200. HU Shenghong, LIN Soulin,LIU Yongsheng,GAO Shan. Studies on the Calibration of Matrix Effects and Polyatomic Ion for Rare Earth Elements in Geochemical Samples by ICP-MS [J]. Chemical Journal of Chinese Universities, 2000, 21(3):368. HE Man,HU Bin,JIANG ZuCheng. Step wise Dilution Method for the Study of Matrix Effects in ICP-MS [J]. Chemical Journal of Chinese Universities, 2004, 25(12):2232. WU Jiwei,WANG Ying,HUANG Changshuai,ZENG Zhiping. Characteristics and metallogenic conditions of REE deposits in Botang area of Cenxi, Guangxi [J]. Mineral Resources and Geology,2014,28(6):679,doi:10.3969/j.issn.1001-5663.2014.06.005

Xiao-Jing Hao1*, Jian Chen1, Wei Li1, Fang-Yang Liu1, Chang Yan1 and Anton Tadich2

Electronic Structure of Cu2ZnSn1-xGexS4 New Energy Materials Probed by Soft X-Ray Absorption Spectroscopy

Abstract: Alloying Cu2ZnSnS4 (CZTS) with Ge provides an excellent capability of engineering the bandgap of CZTS absorbers. In this work, the electronic structure of Cu2ZnSn1-xGexS4 (CZTGS, x= (0, 0.49, 0.72 and 1)) thin films was preliminarily investigated using x-ray photoelectron spectroscopy (XPS) and near edge x-ray absorption fine structure spectroscopy (NEXAFS). XPS results show that the valence band maximum (VBM) of CZTGS does not shift with Ge alloying. NEXAFS results indicate that the conduction band minimum (CBM) of CZTS shifts upwards with Ge substitution. This agrees well with reported theoretical calculations showing that the valence band of CZTS is dominated by hybridized antibonding Cu3d-S3p states, and the conduction band by Sn5s-S3p states. The energy separation, deduced from the relative shift in the VBM and CBM between CZTS and CZGS is in accordance with the expected energy gap. Potential buffer options for CZGS are also discussed. The traditional CdS buffer provides an unfavorable cliff-like conduction band alignment with CZGS. The modulation of Zn(S, O) materials to a desired CBO level by adjusting S/O atomic ratio and/or forming a hybrid buffer between Zn(S, O) and CdS could provide a way for high performance CZGS solar cells. Keywords: component; Solar cell materials; electronic structure; soft X-ray absorption spectroscopy

1 Introduction Kesterite Cu2ZnSnS4 (CZTS) has emerged as the most promising material capable of replacing the champion chalcopyrite (CIGS) thin film solar cells due to its abundance, high absorption coefficient, as well as its direct bandgap characteristics [1-3]. With the typical device structure derived from that of CIGS where Mo, CdS and ZnO serve as back contact, buffer and window layers, respectively, the highest device

|| 1 Australian Centre for Advanced Photovoltaics, School of Photovoltaic and Renewable Energy Engineering, University of New South Wales, Sydney, NSW 2052, Australia 2 Australian Synchrotron, 300 Blackburn Road, Clayton Victoria 3168, Australia, [email protected] 10.1515/9783110516623-031 DOI 10.1515/9783110303568-031

326 | Xiao-Jing Hao, Jian Chen, Wei Li, Fang-Yang Liu efficiencies of 8.5% and 12.7% have been achieved for CZTS and Cu2ZnSnSxSe4-x (CZTSSe) solar cells, respectively [1,4]. The present CZTS solar cell performance is limited by the quality of CZTS absorber as evidenced by its 1-10 ns lifetime, more than an order of magnitude shorter than that in CIGS cells as well as more severe Voc deficit, lower Jsc and FF compared to its counterpart CIGS. Adjusting the bandgap of the absorber has been demonstrated to be important for optimizing the device performance in single-junction solar cells and acting as the top cell to form high efficiency multi-junction solar cells. In the case of single-junction copper indium gallium diselenide (CIGS) thin film systems, replacing 25-30% of Ga with in is typically employed to reduce Voc deficit [5, 6]. In addition, surface sulfurization treatment of CIGSe absorbers has also been shown to improve cell performance through lowering the valence band at the CdS/CIGS hetero-junction interface [7]. In the case of multi-junction cells, 7.4% efficiency has been demonstrated for CIGSbased dual-junction tandem solar cells [8]. Similar device design strategies can be pursued for optimizing CZTS-based systems. By replacing the cation and/or anion elements of CZTS with elements in the same column of the element periodic table, the conduction band minimum (CBM) and valence band maximum (VBM), and thereby the bandgap, can be adjusted. For example, plenty of work has been reported on tuning the bandgap of CZTS by substituting sulfur with selenium in the absorber [1, 9-10]. Recent experimental reports also demonstrated the alloying CZTS with Ge [11, 12]. The Agrawal group reported an efficiency of 9.8% using Ge-doped CZTSSe nanoparticle inks [13], whilst Kim et al reported a 6.3% efficient CZTGS solar cell without an antireflection coating by using a gradually decreasing bandgap from the back contact to the p-n hetero-junction [14]. Compared with an un-graded band structured CZTGS cell, Kim’s grading structure through Ge-doping facilitates both higher short circuit current and open circuit voltage [15]. Though demonstrating an improvement in device performance, there is no experimental result showing how the electronic structure varies with the substitution of Ge. Enabling a tunable bandgap and improved carrier lifetime [16] by alloying CZTS with Ge make CZTGS a promising material for tandem solar cells as well. To further investigate CZTGS, understanding the electronic structure is critical; however, it has not been experimentally determined thus far. To date, only the electronic structure of the CZTS and CZTSSe systems have been thoroughly investigated in theoretical studies [17-19], while experimental analyses (especially of kesterite thin films as used in solar cells) are still in their early stages [20]. In this work, the electronic structure of CZTGS films as a function of the Ge/Sn ratio is studied by XPS and NEXAFS. The relative shift of the VBM and CBM of CZTGS to that of intrinsic CZTS is the key issue for investigation in this study. Potential buffer options to form a heterojunction with CZGS for its application as the top cell of tandem cells are also discussed. This template provides authors with most of the formatting specifications needed for preparing electronic versions of their papers. All standard paper components have been specified for three reasons: (1) ease of use when formatting individual

New Energy Materials Probed by Soft X-Ray Absorption Spectroscopy | 327

papers, (2) automatic compliance to electronic requirements that facilitate the concurrent or later production of electronic products, and (3) conformity of style throughout conference proceedings. Margins, column widths, line spacing, and type styles are built-in; examples of the type styles are provided throughout this document and are identified in italic type, within parentheses, following the example. PLEASE DO NOT RE-ADJUST THESE MARGINS. Some components, such as multi-leveled equations, graphics, and tables are not prescribed, although the various table text styles are provided. The formatter will need to create these components, incorporating the applicable criteria that follow.

2 Experimental In this work, CZTGS films were prepared by sulfurizing sputtered metallic stacks. All metallic-stack precursors of Zn/Cu/Ge/Sn with Zn as the bottom layer and Sn as the top layer were then subject to sulfurization by annealing at 580°C for 2 hours and left to naturally cool down to room temperature. By varying the thickness of the Ge and Sn layers, the mole ratio of Ge/Sn is tuned as desired while the mole ratios of Cu/ (Ge+Sn) and Zn/ (Ge+Sn) remain constant. The thickness of synthesized CZTGS films is around 1 um. More experimental details can be found in our previous paper [11]. Confirmed by both ICP (Inductively Coupled Plasma) and EDS (Energydispersive X-ray spectroscopy) measurement on the CZTGS samples, the mole ratio of Ge/Sn of these CZTGS films was varied from 0, 0.49, 0.72 to 1, with Cu/(Ge+Sn) and Zn/(Ge+Sn) remaining constant at 1.84±0.03 and 1.80±0.05, respectively. The Cu and Zn content (Cu-poor and Zn-rich) are chosen to be within the range reported for the high efficiency CZTS devices. X-ray diffraction and Raman measurements confirmed the formation of the main phase of CZTGS with a slight amount of ZnS secondary phase [11]. XPS and NEXAFS measurements were carried out at the soft x-ray beamline at the Australian Synchrotron, in order to study how the valence band and conduction band of CZTS varied with Ge substitution. Synchrotron radiation was monochromatized using plane grating monochromator whose line density was 1200 lines/mm. The XPS and NEXAFS spectra were recorded in the different analyzing chambers with CZTGS samples transferred under vacuum. The XPS measurements were acquired in an ultra-high vacuum chamber operating at a base pressure of 10-10 mbar, using a SPECS Phoibos 150 hemispherical analyser working at constant 10 eV pass energy. Before the XPS measurements, the atmospheric surface contamination of the films was removed by mildly sputtering (100eV Ar+ ions) the surface of the samples in a separate preparation chamber. It has been reported that at these ions energies (and even up to at 1kV) does not induce observable surface modifications [21, 22]. Analogously, no artificial alteration of the initial CZTGS surface structure is

328 | Xiao-Jing Hao, Jian Chen, Wei Li, Fang-Yang Liu anticipated here. The NEXAFS measurements were obtained by measuring the total fluorescence yield (TFY) using a microchannel plate–based retarding grid detector. The photon energies at the beamline were calibrated using in-situ photoemission measurements of the Au4f7/2 core level at the conclusion of each NEXAFS scan, the total photon energy resolution of the beamline is estimated to be around 50 meV.

3 Results and Discussion As the probing depth in the XPS analysis is only a few nm. The C- & O-related signal in the XPS survey spectra of CZTGS samples can be used to determine the surface contamination. After the Ar+ ion treatment, the intensities of the photoemission and Auger lines ascribed to C are significantly decreased and the C contamination is removed. At the same time, an increase of the CZTS-related peaks (Cu, Zn, Sn, and S) can be observed, indicating that the C and O contamination is present primarily at the surface, most likely as physisorbed molecular species. The valence-band structure of the CZTGS films was measured on the surface-treated CZTGS samples by XPS. The valence band maximum (VBM) of the CZTGS films are estimated by using a linear extrapolation approach [23]. The variation of the valence band of the CZTGS samples is illustrated in Fig.1. All spectra are normalized to the same intensity above the Fermi Energy. Using the linear extrapolation method, the VBM position can be approximated by the intersection between the straight green lines, which correspond to the near VBM valence band dispersion and the background respectively (see Fig.1). It can be deduced from Fig.1 that the VBM of CZTS does not shift with Ge substitution. Germanium, in the same column with Sn in the periodic table, is expected to exhibit similar chemical bonding with Sn in the CZTS. As the VBM of CZTS is dominated by hybridized antibonding Cu 3d-S 3p states, determined both experimentally [20] and theoretically [17, 19], it is reasonable to expect that the substitution of Sn by Ge would not affect the VBM of CZTGS.

Normalised Intensity (a.u.)

New Energy Materials Probed by Soft X-Ray Absorption Spectroscopy | 329

G0 G0.49 G0.72 G1

1.0 0.8 0.6 0.4 0.2 0.0

0.58 eV -2

0

2

4

6

Binding energy (eV)

Fig.1 : VB measured on the CZTGS films with various Ge content. Data are normalized to the same height. The straight green lines are only guides for the eye and indicate the approximate near VBM dispersion and the background according to the linear extrapolation method..

NEXAFS is most commonly used for studying the unoccupied states of materials, probing the absorption of electromagnetic radiation by excitation of core electrons into unoccupied bound or continuum states [24]. Spectral structures in NEXAFS are related to the unoccupied density of states. Its optical process is a local process because the core level localizes. The four nearest neighbors of an S atom in a CZTGS are two Cu, one Zn, and one Sn/Ge. Because of the expected hybridization of S states with Zn, Sn/Ge, and Cu states, by focusing on the S L2,3 edge, corresponding to the transition from the S 2p core level to the unoccupied hybridized S3p state, it is possible to use S L2,3 absorption spectroscopy to estimate the conduction band structure of these CZTGS materials. The relative shift of CBM of CZTGS to that of intrinsic CZTS can be achieved by studying the on-set edge of the S L2, 3 absorption edge for CZTGS, as a function of Ge substitution, which will then elucidate the conduction band minimum information. Fig. 2 shows S L2, 3 NEXAFS spectra as a function of the Ge/Sn concentration ratio in CZTGS. At first sight, the CZTGS spectra systematically vary with the Ge substitution. A prominent peak, located at around 162.5 eV, can be attributed to hybridized antibonding Sn 5s-S 3p states which dominate the bottom of the CZTS conduction band [17]. Close inspection of the spectra reveals a systematic shift in the range between 162 and 166 eV with the substitution of Ge. Whilst the shape of the NEXAFS spectra does not vary much with the Sn/Ge ratio, the first absorption maximum at around 162.5 eV in CZTS shifts monotonously to higher energy with increasing Ge substitution. As mentioned, ZnS was identified as the only detected secondary phase in all CZTGS films [11]. To distinguish the contribution of ZnS to the absorption edge of CZTGS, normalized NEXAFS spectra at the sulfur L2, 3-edge of both CZTGS and the ZnS are showed in Fig.2. It is notable that

330 | Xiao-Jing Hao, Jian Chen, Wei Li, Fang-Yang Liu the spectra of CZTGS and ZnS differ significantly from each other. ZnS exhibits two distinct peaks between 165 and 168 eV. In contrast, each CZTGS sample exhibits the presence of the clear pre-edge feature. The NEXAFS edge onset of ZnS significantly differs from that of CZTGS by about 1.8-2.2 eV. Therefore, the contribution to the CZTGS absorption spectra due to any residual ZnS will only be appreciable at energies well away from the edge onset of the CZTGS, and therefore will not affect the estimation of the CBM of the CZTGS films using the on-set of the absorption edge. Fig.3 summarizes the relative shift of the CBM as a function of the Ge/Sn concentration ratio in CZTGS estimated from a linear extrapolation to the absorption edge as shown in Fig. 2. The estimated CBM shifts monotonously with an increasing Ge/Sn ratio. As Ge is within the same column in the element periodic table and thus should play a similar role as Sn does in CZTS in terms of chemical bonding, it is reasonable to expect that the substitution of Sn with the smaller radius Ge will lead to Sn related bonding changes. As reported in [17, 19], the conduction band minimum of CZTS is dominated by Sn5s-S3p states, therefore substitution of Sn with Ge will therefore affect the conduction band minimum of CZTGS. According to Pauli exclusion principle, when atoms approach each other, their energy levels must split, resulting in the distinction between bonding states (the valence band) and anti-bonding states (the conduction band) [25]. Binding energy originates from downshift of the bonding states relative to initial atomic states. Among atoms with similar chemical properties, such as atoms within the same column of the element periodic table, smaller one tends to form stronger ones, introducing higher downshift [26]. Germanium atoms are smaller than Sn and will thus strengthen the s-s and s-p level repulsion between Ge and S atoms resulting in the increase in the CBM. Considering the similar VBM value, as well as the CBM difference of 0.48±0.05 eV, between CZTS and CZGS found in these measurements, the bandgap of intrinsic CZGS can be deduced to be around 1.98±0.05 eV based on the CZTS bandgap value of 1.5eV. This is comparable to the theoretically calculated bandgap of kesterite CZGS of 2.27eV and of stannite CZGS at 2.06 eV as well as the experimentally reported bandgap in the range of 2.05 to 2.25 eV [15, 18]. The zero VBM shift whilst upwarding CBM shift of CZTGS relative to CZTS makes CZTGS suitable for functioning as a back surface field in CZTS solar cells that reduces electron dark-current while allowing hole photocurrent to pass through, reducing the electron recombination at the back contact area.

New Energy Materials Probed by Soft X-Ray Absorption Spectroscopy | 331

Fig. 2: VB measured on the CZTGS films with various Ge content. Data are normalized to the same height. The straight green lines are only guides for the eye and indicate the approximate near VBM dispersion and the background according to the linear extrapolation method..

It has been reported in our previous work that there is an unfavorable cliff-like conduction band alignment between CdS and CZTS. As aforementioned, the CBM of CZTS up-shifts with increasing Ge substitution, which will lead to even larger clifflike CBO between CZTGS and CZTS. It is imperative to identify alternative buffer materials which yield an optimal band alignment with CZTGS inhibiting interface recombination (small spike-like CBO of 0.1-0.2 eV). To design and identify suitable buffer options for CZTGS cells, we directly measure the CBM of synthesised CdS and Zn(S, O) buffer options by the aforementioned linear extrapolation approach from the energy of the absorption onset of the SL2, 3 edges for different materials.

Fig. 3: Shift of CBM of CZTGS relative to that of CZTS as a function of the Ge/Sn atomic ratio.

332 | Xiao-Jing Hao, Jian Chen, Wei Li, Fang-Yang Liu

Fig. 4: Estimated CBO between CZTGS series and CBD-synthesized buffer material options (CdS, In2S3 and Zn(S, O) by CBD method) and ZnS taken from the reference [20].

In addition, the CBM of In2S3 estimated by the indirect method reported in our previous paper [27] is also included in Fig. 4. CdS, In2S3 and Zn(S, O) were synthesized by a chemical bath deposition (CBD) method with the experimental details given in our previous paper [27]. The estimated CBM alignment between CZTGS and the different buffer options are illustrated in Fig.4. It is notable that CdS forms a “cliff-like” Conduction Band Offset (CBO) with CZTS. This cliff-like CBO between CdS and CZTGS grows larger with increasing substitution of Ge as a result of the upward shifting of the CBM. In the case of CZGS, cliff-like CBO values of -0.6 eV, is formed between CdS and CZGS, and -0.07 eV between In2S3 and CZGS. In contrast, a spikelike CBO of 0.39eV is formed between CZGS and Zn(S, O), which is slightly higher than the desired optical CBO in the reported range of 0.0-0.3 eV [28]. This suggests that modulated Zn(S, O) by adjusting S/O atomic ratio and/or forming a hybrid buffer between Zn(S, O) and CdS could adjust the CBO of a hetero-junction with CZGS absorber to a desired level. More sub-topics, the next level head (uppercase Roman)

4 Conclusions The electronic structure of CZTGS films is investigated by XPS and NEXAFS at the synchrotron beamline. It is found that the top of the CZTS valence band remains unchanged with the substitution of Ge, whilst the bottom of the CZTS conduction band shifts upward with increasing Ge substitution. This agrees with the theoretical predictions that the valence band is dominated by hybridized antibonding Cu3d-S3p states, whilst conduction band is dominated by Sn5s-S3p states. This suggests a promising role of applying CZTGS as an option for back surface field for the further

New Energy Materials Probed by Soft X-Ray Absorption Spectroscopy | 333

optimization of CZTS cell performance. For buffer materials options, comparison with the experimental CBM values from this study indicates a cliff-like CBO between CdS and CZTGS, which gets bigger with increasing Ge concentration up to a 0.6 eV cliff-like CBO between CdS and CZGS, and 0.07 eV cliff-like CBO between In2S3 and CZGS. In contrast, Zn(S, O) forms a spike-like CBO of 0.38 eV with CZGS. The modulation of Zn(S, O) materials to a desired CBO level by adjusting S/O atomic ratio and/or forming a hybrid buffer between Zn(S, O) and CdS could provide a way for high performance CZGS solar cells. Acknowledgement: This work has been financially supported by the Australian Government through the Australian Renewable Energy Agency (ARENA) and Australian Research Council (ARC). Responsibility for the views, information or advice expressed herein is not accepted by the Australian Government. The synchrotron related characterization in this work was undertaken on the Soft X-ray spectroscopy beamline at the Australian Synchrotron, Victoria, and Australia. The authors would like to acknowledge great assistance in XPS and NEXAFS measurements given by Bruce Cowie from Australian Synchrotron.

References [1] [2] [3] [4]

[5] [6] [7]

[8] [9] [10] [11] [12]

W. Wang, M.T. Winkler, O. Gunawan, T. Gokmen, T.K. Todorov, Y. Zhu, D.B. Mitzi, Adv. Energy Mater. , Vol. 4, 2014, 1301465. G.Y. Kim, A.R. Jeong, J.R. Kim, W. Jo, D.-H. Son, D.-H. Kim, J.-K. Kang, Sol. Energy Mater. Sol. Cells, Vol.127, 2014, pp.129-135. M.G. Sousa, A.F. da Cunha, P.A. Fernandes, J.P. Teixeira, R.A. Sousa, J.P. Leitão, Sol. Energy Mater. Sol. Cells, Vol.126, 2014, pp., 101-106. Kim J, Hiroi H, Todorov TK, Gunawan O, Kuwahara M, Gokmen T, et al. High Efficiency Cu2ZnSn(S,Se)4 Solar Cells by Applying a Double In2S3/CdS Emitter. Adv Mater., Vol. 26, 2014, pp.7427-7431. P. Jackson, D. Hariskos, E. Lotter, S. Paetel, R. Wuerz, R. Menner, W. Wischmann, M. Powalla, R. Prog. Photovolt: Res. Appl., Vol 19(7) , 2011, pp.894-897. Repins, M.A. Contreras, B. Egaas, C. DeHart, J. Scharf, C.L. Perkins, B. To, R. Noufi, Prog. Photo: Vol.16 (3), 2008, pp.235–239. Y. Nagoya, K. Kushiya, M. Tachiyuki, O. Yanase, “Role of incorporated sulfur into the surface of Cu(InGa)Se2 thin film absorber”, Solar Energy Materials and Solar Cells, Vol. 67 (1-4), 2001, pp. 247-253. S. Nishiwaki, S. Siebentritt, P. Walk and M.Ch. Lux-Steiner, R. Prog. Photovolt: Res. Appl., Vol.11, 2003, pp. 243-248. Repins, C. Beall, N. Vora, C. DeHart, D. Kuciauskas, P. Dippo, B. To, J. Mann, W.C. Hsu, A. Goodrich and R. Noufi, Sol. Energy Mater. Sol. Cells, Vol. 101, 2012, pp.154-159. W. C. Hsu, I. Repins, C. Beall, C. DeHart, B. To, W. B. Yang, Y. Yang and R. Noufi, R. Prog. Photovolt: Res. Appl., Vol 22, 2014, pp.35-43. J. Chen, W. Li, C. Yan, S. Huang, X.J. Hao, Journal of Alloys and Compounds, Vol.621, 2015, pp.154-161. Kim, K. Kim, Y. Oh, K. Woo, G. Cao, S. Jeong, J. Moon, Chem. Mater., Vol.26, 2014, pp. 39573965.

334 | Xiao-Jing Hao, Jian Chen, Wei Li, Fang-Yang Liu [13] [14] [15] [16] [17] [18] [19] [20]

[21] [22] [23] [24] [25] [26] [27] [28]

C. K. Miskin, W.-C. Yang, C. J. Hages, N. J. Carter, C. S. Joglekar, E. A. Stach, R. Agrawal, Prog. Photovolt: Res. Appl., Vol.23 (5), 2015, pp.654-659. Kim, K. Kim, Y. Oh, K. Woo, G. Cao, S. Jeong, and J. Moon, Chemistry of Materials, Vol.26, 2014, pp.3957-3965. G. M. Ford, Q. Guo, R. Agrawal, H. W. Hillhouse, Chem. Mater., Vol.23, 2011, pp.2626−2629. C. J. Hages, S. Levcenco, C. K. Miskin, J. H. Alsmeier, D. Abou-Ras, R. G. Wilks, M. Bär, T. Unold, R. Agrawal, Prog. Photovolt: Res. Appl., Vol.23, 2015, pp.376-384. S. Chen, X.G. Gong, A. Walsh, S-H. Wei, Appl. Phys. Lett., Vol. 94, 041903 (2009), doi: 10.1063/1.3074499. S. Chen, X.G. Gong, Physical Review B, and Vol. 79, 165211 (2009), DOI: 10.1103/PhysRevB.79.165211. C. Persson, Journal of Applied Physics, Vol.107, 053710 (2010), DOI: 10.1063/1.3318468. M. Bär, B.A. Schubert, B. Marsen, S. Schorr, R.G. Wilks, L. Weinhardt, S. Pookpanratana, M. Blum, S. Krause, Y. Zhang, W. Zhang, T. Unold, C. Heske, and H.W. Schock, Physical Review B, Vol. 84, 035308 (2011). M. Bär, B.A. Schubert, B. Marsen, S. Krause, S. Pookpanratana et al., Appl. Phys. Lett., Vol.99 , (2011) 112103. Santoni, F. Biccari, C. Malerba, M. Valentini, R. Chierchia and A. Mittiga, J. Phys. D: Apl. Phys. Vol. 46, (2013) 175101. E. A. Kraut, R. W. Grant, J. R. Waldrop, and S. P. Kowalczyk, Phys. Rev. Lett., Vol.44(24), (1980)1620. G. Hähner, Chem.Soc. Rev., Vol.35, 2006, pp. 1244-1255. C. L. Tang, Fundamentals of Quantum Mechanics: For Solid State Electronics and Optics, Cambridge University Press, 2005 Ananya Ganguly, Fundamentals of Inorganic Chemistry, Pearson Education India. C. Yan, F. Liu, N. Song, B. K. Ng, J. A. Stride, A. Tadich, X.J. Hao, Appl. Phys. Lett., Vol.104, 173901 (2014). D. Aaron, R. Barkhouse, R. Haight, N. Sakai, H. Hiroi, H. Sugimoto, and D. B. Mitzi, Appl. Phys. Lett., Vol.100 (19), 193904 (2012).

Wei Wang1, Jia-Rong Liu2, Cui-Ping Li, Hua-Nan Guan, Da-Wei Fu and Jin-Zhong Liang

Preparation and Performance of a Chitosan/TiO2 Composite Film by Lyer-byLayer Method

Abstract: The present paper describes the preparation of a composite film based on chitosan (CS) and titanium dioxide (TiO2) by the layer-by-layer self-assembly method (LbL). In the experiment, the various factors which had influenced on the preparation of the composite film, including concentration of CS, immersion time and the number of assembly layers were analyzed. The LbL assembling procedure was monitored by UV-Vis spectroscopy. The composite film was characterized by scanning electron micrographs (SEM). The photocatalysis-adsorption processes by the immobilized CS/TiO2 layer by layer system on a quartz substrate [CS/TiO2] n were investigated for the decolourisation of Rhodamine B. The proposed composite film exhibits higher photocatalytic activity toward Rhodamine B and the degradation rate was up to 97.8%. Keywords: composite film; chitosan (CS); titanium dioxide (TiO2); the layer-by-layer self-assembly method (LbL); composite film; Rhodamine B

1 Introduction Dyes are widely used in various industries including textile, leather, paper, coating and plastics [1], but dyes in effluents has raised global concerns over their harmful impact on the environment and organisms. The presence of dyes in water consumes oxygen and elevates biochemical oxygen demand destroying the aquatic life [2]. Furthermore, some dyes and their degradation products, such as aromatic amines, possess high carcinogenicity [3]. Additionally, due to its high water-solubility, it is estimated that 10-20% of reactive dye remains in wastewater during production and nearly 50% of reactive dyes may be lost to the effluents during dyeing process [4] [5]. Variety of dye treatment technologies have been used for the removal of dyes from the wastewater, such as chemical coagulation-flocculation, oxidation, biological process; membrane-based separation processes [6-10]. Of the various methods of

|| 1 School of Food Engineering, Harbin University of Commerce, Harbin, China, E-mail: [email protected] 2 School of Food Engineering, Harbin University of Commerce, Harbin, China 10.1515/9783110516623-032 DOI 10.1515/9783110303568-032

336 | Cui-Ping Li, Hua-Nan Guan, Da-Wei Fu and Jin-Zhong Liang dye wastewater treatment, adsorption is a classical technique which can quickly decrease the concentration of dissolved dyes in effluents. However, high cost and low adsorption capacity makes the process impossible for industrial applications. Therefore, there is a need to develop a novel biological composite film which will make the process economically feasible and high adsorption capacity. Chitosan (CS) is a linear amino polysaccharide, obtained by N-deacetylation of chitin, and chitin, which is found in the exoskeletons of crustaceans (e.g., crabs and shrimp), is the second most abundant naturally occurring polysaccharide [11-14]. It has found wide applications in a variety of areas, including biomedicine, pharmaceuticals, metal chelation, sensors, wastewater treatment and other industrial applications [15-19], due to its biocompatibility, biodegradability, low toxicity, good film-forming characteristics, and anti-infection activity. Titanium dioxide (TiO2), an important transition metal oxide, has been widely studied for its promising applications such as solar cells, photocatalysis, catalyst supports, water-splitting devices, antifogging and self-cleaning devices and sensors [20]. It has appeared to be the most efficient, stable, non-toxic and inexpensive catalyst in heterogeneous photocatalytic processes for the removal of dyes. Recently, several studies have revealed that chitosan (CS) exhibited a multi-functional performance with TiO2 in heterogeneous photocatalysis technologies by enhancing the adsorption–photocatalytic processes [21-27]. However, most of the conducted studies have physically or chemically mixed CS with the photocatalyst, either of which could limit the activity of CS or the photocatalyst. In view of the reasons for above all, we fabricated the composite film containing CS and TiO2 based on the LbL self-assembly method. The photocatalytic degradation of dye solution by the composite film was systematically investigated with Rhodamine B as a test dye.

2 Experimental 2.1 Materials All solvent and chemical were of analytical grade and used without further purification. Chitosan (92.0% degree of deacetylation) was purchased from Amresco. TiO2 was prepared according to a sol-gel method. Briefly, 30mL tetrabutyl titanate and 30mL isopropyl alcohol were dropped into 300mL distilled water slowly with vigorous stirring, then was added 2mL 70% nitric acid, and was stirred at room temperature for 2h, and was heated at 80°C while stirring for 4h, giving rise to a stable and transparent (slightly cloudy) TiO2 sol. Poly-γ-glutamic acid (γ-PGA) was prepared in our laboratory using the biosynthetic methods [28]. Briefly, γ-PGA was produced from Bacillus subtilis B-1, which was maintained on beef extract peptone medium

Preparation and Composite Film by Lyer-by-Layer Method | 337

slant to produce in appropriate cultivation conditions. γ-PGA was precipitated by the addition of absolute ethyl alcohol and filtered. The γ-PGA was redissolved in distilled water, dialyzed against distilled water, and freeze-dried for further experiments.

2.2 Preparation of the Composite Films The quartz substrate and FTO-coated glass were thoroughly cleaned with Piranha solution (H2O2:H2SO4=3:7, v/v) at 80°C for 20min, followed by rinsing with distilled water. Then the cleaned substrate was immersed into a positively charged CS solution (1g/L) for 2h. After washing and nitrogen drying, the CS-supported precursor films were dipped into a negatively charged γ-PGA solution (0.5g/L) for 20min, and then the CS/γ-PGA substrates were obtained. Next the composite film were assembled on the CS/γ-PGA substrates by first immersing it CS solution (0.2g/L, 0.4g/L, 0.6g/L, 0.8g/L, 1g/L) for a certain time (1min, 2min, 5min, 10min), and then immersing it TiO2 sol for a certain time (1min, 2min, 5min, 10min), rinsed with distilled water and dried in a nitrogen stream after each dipping. Then, repeat the above process until the desired number of [CS/TiO2]n film was obtained. The LbL assembling procedure is monitored by UV–Vis spectroscopy. It is known that the transmission measurement is affected by the film thickness. Generally, the transmittance intensity of the composite film will decrease with the increase in the film thickness.

2.3 Characterization Scanning electron micrographs (SEM) were obtained with a Hitachi SU8010 instrument.

2.4 Photocatalytic Procedure Photocatalytic reactions were carried out as follows. Rhodamine B was selected as the target to study the photocatalytic activity of the composite film. A proposed composite film was immersed into a fresh aqueous dye Rhodamine B solution (16mg/L). The reactor was maintained at room temperature by cooling water and fume cupboard during the irradiation. The UV light source was a 16W ultraviolet lamp, located away from the solution about 15cm. After the signal intensity of the ultraviolet lamp became stable, the solution was irradiated. The degradation of the Rhodamine B was monitored by measuring the maximum absorption of Rhodamine B solution at 552nm. A quantitative determination of dye concentration was achieved by using the linear regression equation, y=0.2265x + 0.0718 (R2 = 0.9992), obtained from the calibration curve prepared with a range of Rhodamine B dye con-

338 | Cui-Ping Li, Hua-Nan Guan, Da-Wei Fu and Jin-Zhong Liang centration (2-12mg/L). Each sample was measured three times, and average serial data were calculated. The degradation efficiency of the composite film was evaluated by the following equation [29]: (1)

‡‰”ƒ†ƒ–‹‘ሺΨሻ ൌ ሺ‫ܣ‬଴ െ ሻȀ଴ ή ͳͲͲΨ

where A0 is the initial absorbance of Rhodamine B solution at λmax (the wavelength with a maximum absorption) and A is the absorbance of Rhodamine B solution at λmax after UV light irradiation.

3 Results and Discussion 3.1 Identification of Concentration of CS Solution The composite film based on electrostatic interactions between negative charged TiO2 and positive charged CS is formed by the LbL self-assembly method. First, the CS/γ-PGA substrates were modified by CS solution and γ-PGA solution and then, CS and TiO2 were deposited on the modified substrates to construct the [CS/TiO2] n film. The quality of the LbL film was monitored by UV-Vis electronic spectroscopy. It is known that the transmission measurement is affected by the film thickness. Table 1 displays the change of absorbance (ΔA) of the [CS/TiO2] n film with n=0-5 deposited on a quartz substrate because the quartz has no absorption in this area under different concentration of CS solution. It can be seen from TABLE ĉthat the absorbance values of the composite film increase linearly, confirming the proper preparation of a composite film by the LbL self-assembly method. When concentration of CS solution was 0.2g/L, the change of absorbance (ΔA) of the [CS/TiO2]5 film was up to 0.349. Table 1: Effect of concentration of CS solution Absorbance

Concentration of CS solution 1g/L

0.8g/L

0.6g/L

0.4g/L

0.2g/L

CS/γ-PGA substrates

0.051

0.050

0.060

0.056

0.060

[CS/TiO2]1

0.135

0.135

0.177

0.149

0.160

[CS/TiO2]2

0.203

0.161

0.219

0.199

0.248

[CS/TiO2]3

0.235

0.213

0.261

0.233

0.285

[CS/TiO2]4

0.273

0.283

0.283

0.284

0.331

[CS/TiO2]5

0.299

0.287

0.314

0.310

0.409

ΔA

0.248

0.237

0.254

0.254

0.349

Preparation and Composite Film by Lyer-by-Layer Method | 339

3.2 Identification of Immersion Time Table 2 displays the change of absorbance (ΔA) of the [CS/TiO2] n film with n=0-5 deposited on a quartz substrate under different immersion time. The linear growth of absorbance indicates that the deposition process is reproducible, confirming the incorporation of CS and TiO2 into the composite films. When immersion time was 2min, the change of absorbance (ΔA) of the [CS/TiO2]5 film was up to 0.573.

3.3 Identification of the Number of Assembly Layers Figure 1 shows the UV-Vis spectra of the composite film [CS/TiO2] n with n = 0-20 deposited on the CS/γ-PGA substrates. In the range 190-800nm, the spectra showed two characteristic absorptions at 195nm and 250nm. They are owing to CS and TiO2. It can be seen from the Figure 1 that the absorbance values of the multilayer film at 195nm and 250nm increase linearly, indicating that the deposition process is very consistent from layer to layer. However the UV-Vis spectra of the composite film [CS/TiO2] n with n = 0-10 deposited on the CS/γ-PGA substrates increases more consequently and more stable. Table 2: Effect of Immersion time Absorbance

Immersion time 10min

5min

2min

1min

CS/γ-PGA substrates

0.060

0.052

0.052

0.058

[CS/TiO2]1

0.160

0.156

0.165

0.170

[CS/TiO2]2

0.248

0.243

0.259

0.305

[CS/TiO2]3

0.285

0.301

0.390

0.377

[CS/TiO2]4

0.331

0.362

0.515

0.417

[CS/TiO2]5

0.409

0.408

0.625

0.502

ΔA

0.349

0.356

0.573

0.444

340 | Cui-Ping Li, Hua-Nan Guan, Da-Wei Fu and Jin-Zhong Liang

Fig. 1: UV–Vis absorption spectra of [CS/TiO2] n film (with n = 0-20).

Taking above factors have made the preparation of composite films. First, the cleaned substrate was immersed into a positively charged CS solution (1g/L) for 2h. After washing and nitrogen drying, the CS-supported precursor films were dipped into a negatively charged γ-PGA solution (0.5g/L) for 20min, and then the CS/γ-PGA substrates were obtained. Next the composite film were assembled on the CS/γ-PGA substrates by first immersing it CS solution (0.2g/L) for 2min, and then immersing it TiO2 sol for 2min, rinsed with distilled water and dried in a nitrogen stream after each dipping. Then, repeat the above process until the [CS/TiO2]10 film was obtained for further experimentation.

3.4 Characterization The surface morphology of the FTO-supported composite films is investigated by SEM. Figure 2a clearly put in evidence the formation of a network on the surface after the deposition of 10 [CS/TiO2] bilayers. The composite film surface is rough and uniform. In addition, the thickness of the [CS/TiO2]10 (Figure 2b) is approximately 215.7nm. It was evident that CS and TiO2 deposited on a quartz substrate, confirming the proper preparation of composite film by the LbL self-assembly technique.

3.5 Photocatalytic Procedure The photocatalytic activity of the composite film was investigated via degradation of Rhodamine B solution under irradiation of a UV light source at room temperature. After stirring the Rhodamine B solution in the dark, the initial concentration was

Preparation and Composite Film by Lyer-by-Layer Method | 341

recorded as concentrate via UV-Vis spectra. The UV-Vis spectra of Rhodamine B remaining in the sample solution by both non-irradiated and irradiated the composite film [CS/TiO2]10 are shown in Figure 3 and Figure 4, respectively.

Fig. 2: Top-view (a) and cross-sectional (b) SEM images of CS/TiO2 films on a FTO glass.

Figure 3 shows decolourisation of Rhodamine B solution by the non-irradiated composite film [CS/TiO2]10 was slow, and only 78.7% of Rhodamine B was removed after 180min of treatment. It was evident that there was adsorption of Rhodamine B on the composite film [CS/TiO2]10, which illustrated the strong adsorption ability of the CS sub-layer. By contrast, the percentage of Rhodamine B removed by the irradiated composite film [CS/TiO2]10 after 180min of treatment was up to 97.8%. Irradiation of the composite film [CS/TiO2]10 under a UV light source enabled the photocatalysis and adsorption processes to run concurrently, while only the adsorption process would occur under non-irradiated conditions.

342 | Cui-Ping Li, Hua-Nan Guan, Da-Wei Fu and Jin-Zhong Liang

Fig. 3: UV-Vis spectra of Rhodamine B remaining in the sample solution by the non-irradiated composite film [CS/TiO2]10.

Fig. 4: UV-Vis spectra of Rhodamine B remaining in the sample solution by the irradiated composite film [CS/TiO2]10.

4 Conclusions A composite film composed of CS and TiO2 has been successfully constructed onto the quartz and FTO glass by LbL self-assembly method. The composite film was characterized by UV-Vis spectra, and Scanning electron micrographs. An increase in multilayer thickness and surface roughness with increasing layer number was ob-

Preparation and Composite Film by Lyer-by-Layer Method | 343

served via SEM. Moreover, the photocatalytic studies indicated that the composite film had excellent degradation ability for Rhodamine B. Acknowledgement: This work was financially supported by the Scientific Research Fund of Heilongjiang Provincial Education Department (No. 12541213).

References [1]

[2]

[3]

[4] [5] [6]

[7] [8]

[9] [10] [11] [12] [13] [14] [15] [16] [17]

K Ravikumar, B Deebika, K Balu, Decolourization of Aqueous Dye Solutions by a Novel Adsorbent: Application of Statistical Designs and Surface Plots for the Optimization and Regression Analysis [J]. J. Hazard. Mater. 2005, 122(1–2): 75–83. Inbaraj B.S., Chien J.T., Ho G.H., Yang J., Chen B.H., Equilibrium and kinetic studies on sorption of basic dyes by a natural biopolymer poly (γ-glutamic acid). Biochem. Eng., 2006a, 31, 204–215. Inbaraj B.S., Chiu C.P., Ho G.H., Yang J., Chen B.H., Removal of cationic dyes from aqueous solution using an anionic poly-γ-glutamic acid-based adsorbent. J. Hazard. Mater. 2006b, 137, 226–234. P V Messina, P C Schulz, Adsorption of Reactive Dyes on Titania-Silica Mesoporous [J]. J. Colloids Interf. Sci., 2006, 299(1): 305–320. S Netpradit, P Thiravetyan, S Towprayoon, Evaluation of Metal Hydroxide Sludge for Reactive Dye Adsorption in a Fixed-Bed Column System [J]. Water Res., 2004, 38(1): 71–78. S Sadri Moghaddama, M R Alavi Moghaddama, M Aramib, Coagulation/Flocculation Process for Dye Removal Using Sludge from Water Treatment Plant: Optimization through Response Surface Methodology [J]. J. Hazard. Mater. 2010, 175(1–3): 651–657. M S Lucas, J A Peres, Decolorization of the Azo Dye Reactive Black 5 by Fenton and PhotoFenton Oxidation [J]. Dyes Pigments, 2006, 71(3): 236–244. S Ledakowicz, M Solecka, R Zylla. Biodegradation, Decolourisation and Detoxification of Textile Wastewater Enhanced by Advanced Oxidation Processes [J]. J. Biotechnol., 2001, 89(2– 3): 175–184. S Chakraborty, M K Purkait, S DasGupta, Nanofiltration of Textile Plant Effluent for Color Removal and Reduction in COD [J]. Sep. Purif. Technol., 2003, 31(2): 141–151. M K Purkait, S DasGupta, S De, Micellar Enhanced Ultrafiltration of Eosin Dye Using Hexadecyl Pyridinium Chloride [J]. J. Hazard. Mater. 2006, 136(3): 972–977. V.L. Finkenstadt, R.P. Millane, Crystal structure of Valonia cellulose 1β, Macromolecules31 (1998) 7776–7783. A.V. Augustine, S.M. Hudson, J.A. Cuculo, Cellulose Sources and Exploitation, Ellis Horwood, New York, 1990. T.R. Dawsey, Cellulosic Polymers, Blends and Composites, Carl Hanser Verlag, New York, 1994. J. Kadowaka, M. Mukarami, Y. Kaneko, A facile preparation of gel materials from a solution of cellulose in ionic liquid, Carbohydr. Res. 343 (2008) 769–772. Langer R, Tirrell DA, Designing materials for biology and medicine. Nature (Lond) 2004, 428: 487–92. Rabea EI, Badawy MET, Stevens CV, Smagghe G, Steurbaut W, Chitosan as antimicrobial agent: applications and mode of action. Biomacromolecules 2003, 4: 1457–65. Guibal E, Von Offenberg Sweeney N, Zikan MC, Vincent T, Tobin JM, Competitive sorption of platinum and palladium on chitosan derivatives. Int J Biol Macromol 2001, 28: 401–8.

344 | Cui-Ping Li, Hua-Nan Guan, Da-Wei Fu and Jin-Zhong Liang [18] [19] [20] [21] [22] [23] [24] [25] [26] [27] [28] [29]

Zhang MG, Smith A, Gorski W, Carbon nanotube–chitosan system for electrochemical sensing based on dehydrogenase enzymes. Anal Chem 2004, 76: 5045–50. Majeti NV, Kumar R, A review of chitin and chitosan applications. React Funct Polym 2000, 46: 1–27. W. J. Liu, J. G. Wang, W. Li, X. J. Guo, L. H. Lu, X. H. Lu, X. Feng, C. Liu and Z. H. Yang, Phys. Chem. Chem. Phys., 2010, 12, 8721–8727. C.E. Zubieta, P.V. Messina, C. Luengo, M. Dennehy, O. Pieroni, P.C. Schulz, J.Hazard. Mater. 152 (2008) 765. Z. Zainal, L.K. Hui, M.Z. Hussein, A.H. Abdullah, I.R. Hamadneh, J. Hazard. Mater. 164 (2009) 138. M.A. Nawi, S. Sabar, A.H. Jawad, Sheilatina, W.S.W. Ngah, Biochem. Eng. J. 49(2010) 317. S.M. Miller, J.B. Zimmerman, Water Res. 44 (2010) 5722. S.M. Miller, M. Spaulding, J.B. Zimmerman, Water Res. 45 (2011) 5745. Q. Li, H. Su, J. Li, T. Tan, Process Biochem. 42 (2007) 379. M.A. Nawi, A.H. Jawad, S. Sabar, W.S.W. Ngah, Desalination 280 (2011) 288. Wang Fengqing, Researched on Bacillus subtilis Producing Poly γ-glutamic acid With Fermentation, Dissertation for the Degree of Master, Harbin University of Commerce, 2011. P. Niu, J.C. Hao, Langmuir 27 (2011) 13590e13597.

Yu Fu1, Yu-Feng Wu2*, Qi-Jun Zhang3 and Kai-Hua Zhang4

A Facile Route to Synthetize Lanthanum Doped Titanium Dioxide Films for Improved Photocatalytic Performance Abstract: Rare earth doped TiO2 catalytic material has promising applications in the effective degradation of organic pollutants. Lanthanum doped TiO2 films were prepared by a facile solvothermal method using tetrabutyl titanate as titanium source. And facets were controlled by preferably non-metallic ion modulating agent. X-ray diffraction (XRD), scanning electron microscopy (SEM), energy dispersive spectroscopy (EDS) were used to characterize the structures, morphologies etc. of the products. The photocatalytic performances of the products were measured by degradation of methylene blue as the model organics. A series of characterizations illustrate that combining modification of doping can improve the photocatalytic performance to varying degrees. Importantly, the La doped TiO2 films show great potential in detoxification of harmful pollutants in wastewaters and other catalytic applications. Keywords: TiO2; rare earth; doping; photocatalysis

1 Introduction With the accelerating process of industrialization, environmental pollution has become more and more serious. How to control and manage environmental pollution has become a major issue to be solved. The researchers at home and abroad continue seeking high efficiency and environmentally friendly new environmental management technology [1]. Since 1972, Japanese scientists Honda and Fujishima [2] found that under ultraviolet light, single crystal electrodes of rutile TiO2 can made the oxidation reduction reaction occurring in water, there have been a lot of researches on the photocatalytic reaction process. As a semiconductor photocatalyst with high photocatalytic activity, TiO2 has

|| 1 Institute of Circular Economy, Beijing University of Technology, Beijing, P. R. China, E-mail: [email protected] 2 Institute of Circular Economy, Beijing University of Technology, Beijing, P. R. China, E-mail: [email protected] 3 Institute of Circular Economy, Beijing University of Technology, Beijing, P. R. China, E-mail: [email protected] 4 Institute of Circular Economy, Beijing University of Technology, Beijing, P. R. China, E-mail: [email protected] 10.1515/9783110516623-033 DOI 10.1515/9783110303568-033

346 | Yu Fu, Yu-Feng Wu, Qi-Jun Zhang and Kai-Hua Zhang many advantages such like stable chemical properties, cheap price, no secondary pollution, and so on. However, owning to its characteristics, TiO2 has narrow light absorption range, low utilization rate of solar energy, high rate of carrier recombination, which greatly limits its application in the production process [3]. In order to solve these problems, the researchers took a series of methods to modify the TiO2 in order to improve its photocatalytic performance, in which the ion doping is an effective way to improve the photocatalytic efficiency [4-5]. Herein, we have successfully synthetized TiO2 and La-TiO2 films via a facile solvent-thermal method. Tetrabutyl titanate is chosen as titanium source. And the structure and morphology of the as-prepared samples are characterized by X-ray diffraction (XRD). The component contents are measured by Energy dispersive spectroscopy (EDS) equipped on the scanning electron microscopy (SEM). The photocatalytic performance is also investigated by degrading organic dye solution.

2 Experiment Section 2.1 Synthesis A facile solvothermal method is used to prepare TiO2 and La doped TiO2 films on FTO substrates. The FTO substrates are prepared with sizes of 2.0 × 4.0 cm2, and cleaned ultrasonically by deionized water, acetone, and ethanol for 1 h separately. In most experiments, 40 mL of acetic acid (HAc) is mixed with La (NO3)3, 10 mL of tetrabutyl titanate (Ti(OBu)4), and 2 mL of hydrogen fluoride (HF). Every chemical is added with uniform stirring. The molar ratios of La elements and Ti are 1.0%. The solution is transferred into a 100 mL Teflon-lined autoclave, and the FTO substrate is on the bottom of the autoclave with the conductive surface facing upward. The solution is kept at 200 °C for 12 h. Having finished the reaction, the FTO substrates with RE-TiO2 films are pick out and washed with ethanol several times, then dried at 60 °C for 24 h. Finally, all the RE-TiO2 films are calcined at 500 °C for 6 h with a rate of 1 °C/min.

2.2 Characterization The crystal structure is examined by X-ray diffraction (XRD) analysis with a Bruker axs D8 Advance using Cu Kα radiation (Bruker, Germany). The morphology of the samples is examined by SU-8020 field-emission scanning electron microscopy (SEM) (Hitachi, Japan). Energy dispersive spectroscopy (EDS) is performed on the SEM.

A Facile Films for Improved Photocatalytic Performance | 347

2.3 Evaluation of Photocatalytic Properties The photocatalytic properties of the samples are compared by analyzing the degradation rates of Methylene Blue (MB). TiO2 and La-TiO2 films of 2.0 cm × 4.0 cm are used. To establish the adsorption-desorption equilibrium, samples are submerged in MB solution (10 mL, 10 mg/L) in 60 mm culture dishes separately for 12 h. In the experiment, a 30 W UV lamp with a maximum emission at approximately 365 nm was used as the illumination source. And the absorption of MB solution is measured every 1 h by the ultraviolet spectrophotometer. The data are analyzed by recording the absorption peaks of MB at 664 nm.

3 Results and Discussion Crystal structure is analyzed by XRD, as shown in Fig. 1. It is illustrated that all the diffraction peaks of the as-prepared TiO2 and La-TiO2 are corresponded with anatase TiO2 (JPCDS No. 21-1272) [6]. However, there aren’t any peaks of rare earth or La2O3 show up, which may be owing to the low doping amount of La. Obviously, the intensity of (004) peak is increasing with the addition of La, which means that the thickness of TiO2 in [001] direction is reduced. And the intensity of (200) peak is decreasing with the adding of La, which indicates that the side length in orientated [200] direction [7].

Fig. 1: XRD pattern of TiO2 and La-TiO2.

348 | Yu Fu, Yu-Feng Wu, Qi-Jun Zhang and Kai-Hua Zhang The morphology is characterized by SEM, as shown in Fig.2a-d. And the chemical compositions are shown in Fig. 2e using EDS. In Fig. 2a, it is found that the exposed surface of the TiO2 film consists of well-arranged nanosheets, which are vertically growing on the FTO substrate (Fig. 2b). The top square surfaces are {001} facets and the lateral surfaces are {100} and {010} facets. And the thickness of TiO2 nanosheet is about 0.6 μm (Table 1). Similarly, the La-TiO2 nanosheets are perpendicular to the substrate. It is obvious that the thickness of La-TiO2 nanosheet is about 0.15 μm, as shown in Fig. 2c-d, which is far below TiO2. And the percentage of {001} facets [8] of TiO2 and La-TiO2 are 66% and 85%, respectively. The EDS profile confirms the presence of doped elements in TiO2 as shown in Fig. 2e. Titanium, oxygen, lanthanum peaks are detected by EDS, which means that La has doped into TiO2 successfully. Table 1: Summary of Structural Parameters of Samples Samples

Average Thickness (μm)

Average lateral length (μm)

Average height (μm)

Percentage of {001} facets (%)

TiO2

0.6

3.0

1.8

65

La-TiO2

0.15

2.6

2.3

85

A Facile Films for Improved Photocatalytic Performance | 349

Fig. 2: SEM patterns of (a, b) TiO2 and (c, d) La-TiO2. (b, d) sectional view of TiO2 and La-TiO2. (e) EDS spectrum of La-TiO2.

The growth process of La-TiO2 is investigated by control time kept in the oven at 200°C without any change in other parameters. And six points of time are chosen: 1 h, 3 h, 6 h, 9 h, 12 h, 24 h. And SEM patterns are utilized to characterize the growing process as shown in Fig. 3. In Fig. 3a, few small particles are scattered on the FTO substrate. After two hours, the particles are growing bigger and more (Fig. 3b). And the particles are growing into nanosheets gradually and becoming larger (Fig. 3c-d). Having kept for 12 h, the nanosheets are forming a layer of compact uniform films on the substrate (Fig. 3e). However, the angles of nanosheets are partly eroded, which may attribute that the nanosheets are soaked in acid solution for a long time (24 h), as shown in Fig. 3f. And the schematic diagram of films growth process is shown in Fig.4.

350 | Yu Fu, Yu-Feng Wu, Qi-Jun Zhang and Kai-Hua Zhang

Fig. 3: SEM patterns of La-TiO2 kept at 200 °C for (a) 1 h, (b) 3 h, (c) 6 h, (d) 9 h, (e) 12 h, (e) 24 h.

Fig. 4: Schematic diagram about the growth process of La-TiO2.

Dyes are widely used in the fields like food, medicine, cosmetics and other industries. It’s commonly known that dyes are difficult to degrading naturally because the majority of these dyes are stable when released to the in the process of production. And this is a great threat to the health of humans and the environment. Therefore, MB is chosen as the representative of organic dyes to be degraded. The evaluation of photocatalytic properties begins after an adsorption-desorption equilibrium. A 30 W high-pressure UV lamp is utilized to irradiate the MB solution soaked with as-prepared La-TiO2 films. The degradation rates of the samples are shown in Fig. 5. The original MB solution without soaked samples is evaluated as the blank reference. It is shown that the degrading rate of original blank MB solution is only 22%, and the degrading rates of TiO2 and La-TiO2 are 74% and 84.5%, respectively, which means that La-TiO2 has higher degradation ability than TiO2 in the certain period (Fig. 5a).

A Facile Films for Improved Photocatalytic Performance | 351

The first-order kinetics equation (ln (C0/Ct) = κt) is employed to further analyze the photocatalytic activities quantitatively. κ is introduced which represents reaction rate constant. C0 represents the original concentration of the MB solution and Ct represents the solution phase concentration when the time is t. It is shown that the reaction rate constant of MB solution and TiO2 are 1.27 × 10-3 min-1 and 4.19 × 10-3 min1 . And the reaction rate constant of La-TiO2 is 6.02 × 10-3 min-1, which is five times as much as MB solution. And the trend of reaction rate constants is according with the first-order kinetics equation (Fig. 5b). La-TiO2 has higher photocatalytic property than TiO2 attribute that the recombination rate of the photo generated electron hole pair is reduced, and the TiO2 bandwidth is reduced as well. The introduction of La element can form a live trapping center to separate the electron hole pair and reduce the recombination rate. The ions lower than the Ti4+ valence state trap holes, whereas the electrons are trapped electrons when the ions higher than the Ti4+ valence state. And the doping of La can bring in impurity levels to the TiO2 band gap, which can reduce the width of band gap and increase the visible light region, thus the photocatalytic activity is enhanced.

Fig. 5: (a) Photocatalytic activities of different samples and (b) variations in ln (C0/Ct) as a function of irradiation time with linear fits.

352 | Yu Fu, Yu-Feng Wu, Qi-Jun Zhang and Kai-Hua Zhang

4 Conclusions TiO2 and La-TiO2 films with stable anatase phase structure on transparent conductive fluorine-doped tin dioxide substrates are prepared via a traditional solvothermal method using tetrabutyl titanate. The structure of the as-prepared samples is the anatase TiO2 phase. The dopant type and the holding time are investigated. TiO2 and La-TiO2 have high photocatalytic properties. The degrading rates reach 74.0% and 84.5% separately. And La-TiO2 shows higher photocatalytic property than pure TiO2. Therefore, the La-TiO2 films could be used as photocatalysts in sewage treatment due to its outstanding photocatalytic stability. Finally, complete content and organizational editing before formatting. Please take note of the following items when proofreading spelling and grammar: Acknowledgement: This research was financially supported by National Natural Scientific Foundation of China (No. 21306004), Beijing Nova Program (Z1511000003150141), Academician Workstation in Yunnan Province, and Key Discipline for Resource, Environment & Circular Economy of Beijing.

References [1]

[2] [3]

[4]

[5]

[6]

[7]

[8]

Sawanta S. Mali, Pravin S. Shinde, C.A. Betty, Popatrao N. Bhosale, Won J. Lee, and Pramod S. Patil, “Nanocoral architecture of TiO2 by hydrothermal process: Synthesis and characterization”. Applied Surface Science, vol. 257, Sep. 2011, pp. 9737–9746. doi:10.1016/j.apsusc.2011.05.119. Fujishima A, and Honda K, “Electrochemical Photolysis of Water at a Semiconductor Electrode”. Nature, vol. 238, Jul. 1972, pp. 37-38. doi:10.1038/238037a0 W. J. Zhou, Y. H. Leng, D. M. Hou, H. D. Li, L. G. Li, G. Q. Li, et al., “Phase transformation and enhanced photocatalytic activity of S-doped Ag2O/TiO2 heterostructured nanobelts”. Nanoscale, vol. 6, Jun. 2014, pp. 4698-704. doi: 10.1039/c3nr06565k T. I. Nkambule,A. T. Kuvarega,R. W. Krause,J. Haarhoff,and B. B. Mamba., “Synthesis and characterisation of Pd-modified N-doped TiO2 for photocatalytic degradation of natural organic matter (NOM) fractions”. Environmental Science and Pollution Research, vol. 19, Nov. 2012, pp. 4120-4132. doi: 10.1007/s11356-012-0872-6. G. Fu, P. Zhou, M. Zhao, W. Zhu, S. Yan, T. Yu, and Zhigang Zou, “Carbon coating stabilized Ti(3+)-doped TiO2 for photocatalytic hydrogen generation under visible light irradiation”. Dalton Transactions, vol. 44, Jun. 2015, pp. 12812-12817. doi: 10.1039/c5dt01204j. H. Yao, J. Ma, Y. Mu, Y. Chen, S. Su, P. Lv, et al., “Hierarchical TiO2 nanoflowers/nanosheets array film: synthesis, growth mechanism and enhanced photoelectrochemical properties”. Rsc Advances, vol. 5, Sep. 2015, pp. 6429-6436(6438). F. Tian, Y. Zhang, J. Zhang, and C. Pan, “Raman Spectroscopy: A New Approach to Measure the Percentage of Anatase TiO2 Exposed (001) Facets”. Journal of Physical Chemistry C, vol. 116, Mar. 2012, pp. 7515-7519. doi: 10.1021/jp301256h D. Zhang, G. Li, X. Yang, and J. C. Yu, “A micrometer-size TiO2 single-crystal photocatalyst with remarkable 80% level of reactive facets”. ChemInform, vol. 29, Aug. 2009, pp. 4381-4383. doi: 10.1039/b907963g.

Hong-Hai Deng1, Bo Yang2, Xing-Long Guo3, Qiang Wang4, ZhiLiang Wang5, Hai-Bao Shao6, Qing-Lan Ma7, Xiu-Mei Shao8, Xue Li9 and Hai-Mei Gong10

Contact Property of Au on p-InP

Abstract: The contact characteristics of Au on p-InP were studied to solve the problem of Au flowing during rapid thermal processing. The problem had caused inoperable pixels in the 24×1 element linear InGaAs near infrared focal plane arrays. The samples were fabricated by using MOCVD-grown n-InP/i-In0.53Ga0.47As/n-InP double heterostructure epitaxial materials with sealed-ampoule method. The special contact resistivity of the contacts was determined using the transfer line model (TLM) measurements after the samples were annealed at 450°C and 480°C. The result shows that the contacts are all ohmic contacts and the room-temperature special contact resistivity is 1.04×10-3 Ω•cm-2 and 5.02×10-4 Ω•cm-2, respectively. Although the special contact resistivity of the sample annealed at 450°C was slightly higher, the problem of Au flowing in p-InP was solved. The 24×1 element InGaAs near infrared FPAs without inoperable pixels were obtained by improving the technics of rapid thermal processing. Keywords: contact property; p-InP; ohmic contact; special contact resistivity; diffusion

|| 1 Nantong University, School of Electronics and Information Nantong, P.R. China, [email protected] 2 Chinese Academy of Sciences, Shanghai Institute of Technical Physics, Shanghai, P.R. China, [email protected] 3 Nantong University, School of Electronics and Information, Nantong, P.R. China, [email protected] 4 Nantong University, School of Electronics and Information, Nantong, P.R. China, [email protected] 5 Nantong University, School of Electronics and Information, Nantong, P.R. China, [email protected] 6 Nantong University, School of Electronics and Information, Nantong, P.R. China, [email protected] 7 Nantong University, School of Electronics and Information, Nantong, P.R. China, [email protected] 8 Chinese Academy of Sciences, Shanghai Institute of Technical Physics, Shanghai, P.R. China, [email protected] 9 Chinese Academy of Sciences, Shanghai Institute of Technical Physics, Shanghai, P.R. China, [email protected] 10 Chinese Academy of Sciences, Shanghai Institute of Technical Physics, Shanghai, P.R. China, [email protected] 10.1515/9783110516623-034 DOI 10.1515/9783110303568-034

354 | Hong-Hai Deng, Xiu-Mei Shao, Xue Li and Hai-Mei Gong

1 Introduction The photodiodes using ternary In0.53Ga0.47As material lattice matched to InP substrate with cut-off wavelength of about 1.7 μm has already been widely applied in optical communication systems, remote sensing, night vision imaging and near infrared spectroscopy [1- 4]. The lattice matched epitaxial film of In1-xGaxAs absorption layer and InP cap layer on the substrate of InP could be obtained when x=0.47. For InP/InGaAs/InP near infrared detector, the contacts property of contact metal on p-InP cap layer has great influence on detector performance such as quantum efficiency and photoresponse characteristics. An ohmic contact has a linear current–voltage characteristic because the contact resistance is smaller than that of the device. Ohmic contacts on InP-based materials are required for use in InGaAs photovoltaic detectors. The conditions of metallization, electrical properties and wettability are usually improved by electronegative metals which are used as a dopant. Au which is an electronegative metal has been commonly added to III–V compound semiconductors to form ohmic contacts [5]. According to several reports, n-type ohmic contacts to InP could be easily obtained and the special contact resistivity was formed as low as a typical value of 1×10-5 Ω•cm-2. In contrast, fabrication of ptype ohmic contacts to InP is difficult because of a large barrier height of most metals to p-InP as well as the large hole effective mass which limits hole transport properties relative to n-InP [6]. The conventional p-type ohmic contact to InP is AuZn based or AuBe based [7, 8], although other p-type dopants have also been used with Au [6]. Normally, the technics of rapid thermal processing (RTP) is mainly used to achieve low contact resistivity after the Au-based contact systems are deposited on InP-based materials to form alloyed contacts. Although low special resistivity contacts were obtained for the Au-based contacts, there are several inherent problems like poor reliability, nonuniform surface, poor thermal stability and spiking interfacial morphology during subsequent annealing which are essential factors for InP/InGaAs/InP PIN photovoltaic detectors[9]. In this paper, Au flowing in p-InP cap layer occurred during the process of RTP to form ohmic contacts in the fabrication of 24×1 element linear InGaAs near infrared FPAs, as shown in figure 1. In order to solve the inoperable pixels caused by the problem, the lower RTP temperature 450°C was attempted to be adopted compared with the original temperature 480°C. The special contact resistivity of the contacts was determined using the transfer line model (TLM) measurements. Finally, the inoperable pixels were effectively reduced by the annealing improvement and ohmic contact was obtained with Au on p-InP cap layer.

Contacct Property of Au u on p-InP | 355 3 (a)

(b)

Fig. F 1: (a)The piccture of Au flowing on p-InP after RTP and (b) thee I-V characterisstics of inoperab ble pixels p on 24×1 linear InGaAs dettector

2 Experiment De etails The T samples w were fabricateed on the n-i-n n+ type InP/IIn0.53Ga0.47As/IInP double he eterodeposiition (MOCVD structures s by metal organ nic chemical vapor v D). The multilayer structure s InP//In0.53Ga0.47As//InP was grow wn on the n--InP substrate with the ca arrier 18 -33 concentration c n of 2×10 cm , and the layers sequence is a 0.5μm th hick n+-InP buffer b layer (n≥2×10 018cm−3), a 2.5μm 2 thick Si doped i--In0.53Ga0.47As absorbing layer 16 (n≈5×10 ( cm−3)), and a 1μm thick t doped n-InP n cap layeer (n≈5×1016cm m−3). Prior to metal m deposition, d th he samples weere cleaned in n sequence wiith chloroform m, aether, ace etone and a ethanol tto dissolve su urface organicc contaminan nt. The wholee hetero-structures epitaxial e mateerial was doped with seale ed-ampoule m method using Zn3P4 as the diffud sion s source, b by which the n-InP n cap laye er was changeed from n-type to p-type. A SiNx layer was dep posited using PECVD P to app proach devicee process, and d the transmisssion line method (T TLM) patternss were formed d by photolith hographic liftt-off process. Then T they were wett-etched using g HF acid and d rinsed with h de-ionized water w and imm medit ately a blown w with N2. Au contacts were deposited d by aan ion beam sputtering s sysstem. Annealing A pro ocess was peerformed in a rapid therm mal annealing g (RTA) apparratus with w rise timees of about 10 0s and negligiible overshooot. The ambien nt during the process c was nitro ogen. To approach device process, p Cr/Au u (20 nm/300 0 nm) was dep posit-

356 | Hong-Hai Deng, Xiu-Mei Shao, Xue Li and Hai-Mei Gong ed on the contact pads still by the ion beam sputtering system after the annealing process. The TLM pattern used in this work consists of a linear array of eleven rectangular contact pads, each with a nominal width of 250 μm and a nominal length of 120 μm. The pad separations vary from 10 μm to 28 μm in 2 μm increments, as shown in figure 2. Current-voltage (I-V) characteristics were measured by a keithley4200 Source-Measure Unit at room temperature after the samples package.

Fig. 2: The TLM structure picture of sample

3 Result and Discussion The I-V measurements which were shown in Figure 3 for the ion beam sputtering Au contacts to p-InP materials annealed at 450°C and 480°C in N2 were carried out at room temperature. Linear I-V behavior indicated the formation of ohmic contact in the two annealing conditions. In the case of ohmic contact, the special contact resistivity is one of the essential factors for the characteristics of the InP/InGaAs/InP p-in photo detectors. The specific contact resistance U c can be defined as the inverse of the derivative which is the current density J on the interface voltage drop, which could be expressed as:

Uc

(

wJ 1 ) wV

V 0

(1)

and the lower specific contact resistance indicts the better ohmic contact property.

Contacct Property of Au u on p-InP | 357 3 (a)

(b)

Fig. F 3: Room tem mperature I-V cha aracteristics of Au A contacts to p--InP annealed att 450°Cand 480°C in N2 N with differentt pad distances

The TLM test structuree is common nly used to m model the mettal-semicondu uctor contact c like im mportant con ntact paramete ers such as coontact resista ance Rc ( : ), spe2 cific c contact resistance U c ( :˜ cm ),, and the seemiconductorr sheet resisttance beneath b the co ontact Rsh ( : /� ). Accord ding to the TLLM, the total resistance betw ween electrodes e pad ds is linear with w the dista ance of electroode pads. Th he specific con ntact resistivity r of tthe metal eleectrode on th he semicondu uctor can be deduced, d and d the formula f can b be expressed as: a

Uc

Rc 2W 2 Rsh (: ˜ cm m 2 )

(2)

where w W is th he length of th he metal electtrode pad. Figgure 4 display ys the depend dence of o measured to otal resistance on pad paciing. Follow th he TLM, U c iss determined from the t intercept ((= 2 Rc ) and slope s (= Rsh / W ) of the pllot in Figure 4. 4 Least squarre fits t the resistan to nce versus pa ad separation data mostly yyield correlattion coefficien nts of almost a 0.99. And the special contact resistivity r of the two sam mples anneale ed at 450°Cand 4 480 0°C is 1.04×10 0-3 Ω•cm-2 and 5.02×10-4 Ω•ccm-2 respectiveely which ind dicted the t low resistaance ohmic contacts were achieved. Altthough the sa ample annealed at 450°C 4 has slig ghtly higher special contacct resistivity, tthe problem of o Au flowing in pInP cap layer during rapid thermal proccessing was su uppressed un nder the annealing temperature t o of 450°C, as shown in fig gure 5. In add dition, the neear-infrared 24h1 2 element e linearr InGaAs FPA As without ino operable pixeels were obtaiined by impro oving the t temperatu ure of RTP.

358 | Hong-Hai Deng, Xiu-Mei Shao, Xue Li and Hai-Mei Gong

Fig. 4: Resistance dependence on pad spacing for Au contacts to p-InP annealed in N2 at 450 °C and 480°C

Fig. 5: The picture of samples annealed at 450 annealed in N2 at 450 °C

4 Conclusion In order to solve the problem of inoperable pixels in the 24×1 element linear InGaAs near infrared FPAs because of the Au flowing in p-InP cap layer during RTP, the special contact property annealed at 450 °C and 480 °C was determined using the TLM measurements. The result suggests that the ohmic contacts are possible formed for Au on p-InP annealed at 450 °C, and the special contact resistivity is 1.04×103 Ω•cm-2 which is slightly higher than the sample annealed at 480 °C. But the problem of Au flowing in p-InP cap layer during rapid thermal processing was suppressed under the annealing temperature of 450°C. The near-infrared 24×1 element linear InGaAs FPAs without inoperable pixels were obtained by improving the temperature of RTP eventually.

Contact Property of Au on p-InP | 359

Acknowledgement: This research is supported by the National Natural Science Foundation of China under grant no 61505090, the Science and Technology Project of Nantong under grant no GY12015010 and GY12016024, the Natural Science Project of Nantong University under grant no 14ZY003, 14ZY002, 03080666 and 14Z003, the Six Top Talents of Jiangsu Province grant no 2016-XCL-052 and 2013-XCL-013, the Qing Lan Project of Jiangsu Province, and the Key NSF Program of Jiangsu Provincial Department of Education under grant no 15KJA510004, and University Natural Science Foundation of Jiangsu Province under grant no 15KJB150023.

References [1]

[2]

[3]

[4]

[5] [6]

[7] [8] [9]

G.Q.Cao, H.J.Tang, T.Li, X.M.Shao, X.Li, H.H.Gong,”Temperature-dependent characteristics of ohmic contact in hetero-junction InP/InGaAs detector,” J. Infrared Millim. Waves, vol. 34, Dec. 2015, pp.721-725, doi: 10.11972/j.issn.1001-9014.2015.06.016. R.W.M.Hoogeveen, A.R.J.Vander, P.H.Goede. “Extended wavelength InGaAs infrared (1.02.4μm) detector arrays on SCIAMACHY for space-based spectrometry of the Earth atmosphere,” InFrared Phys. & Tech, vol. 42, Feb. 2001, pp.1-16, doi: 10.1016/S1350-4495(00)00061-X. M.MacDougal, J.Geske, C.Wang, S. Liao, J. Getty, A. Holmes, “Low Dark Current InGaAs Detector Arrays for Night Vision and Astronomy,” Proc. SPIE, vol. 7298, May 2009, pp. 2983F-172983F-10, doi: 10.1117/12.820377. M.J.Cohen, M.J.Lange, M.H.Ettenberg, P. Dixon, G.H. Olsen, “A thin film Indium Gallium Arsenide Focal Plane Array for Visible and Near Infrared Hyperspectral Imaging,” LEOS’99. IEEE Lasers and Electro-Optics Society 1999 12th Annual Meeting, vol.2, Nov. 1999, pp. 744745, doi: 10.1109/LEOS.1999.811948. W.C. Huang, “Effect of Au overlayer on PtSi ohmic contacts with n-InP,” Applied Surface Science, vol. 245, Oct. 2004, pp.141-148, doi: :10.1016/j.apsusc.2004.10.001. A.G. Baca, F. Ren, J.C. Zolper, R.D. Briggs, S.J. Pearton, “A survey of ohmic contacts to III-V compound semiconductors,” Thin Solid Films, vol. 308-309, Oct. 1997, pp. 599-606, doi: 10.1016/S0040-6090(97)00439-2. J.B. Boos, W. Kruppa, “Low-resistance AuZn gate ohmic contacts for InP JFETs,” Solid-State Electron., vol. 31, Feb. 1988, pp. 127-133, doi: 10.1016/0038-1101(88)90119-0. H. Temkin, R.J. McCoy, V.G. Keramidas, W.A. Bonner, “Ohmic contacts to p-type InP using BeAu metallization,” Appl. Phys. Lett., vol. 36, Mar. 1980, pp. 444-446, doi: 10.1063/1.91539. P.Wei, H.H.Deng, H.J.Tang, X.Li, Y.M.Zhua, H.M.Gong, “Contact property of Ni (Ti)/Pt/Au on p-In0.52Al0.48As,” Proc. of SPIE, Vol. 8419, Apr. 2012, pp. 84191H1-5, doi: 10.1117/12.974293.

Jian-Hui Guo1, Xiao-Long Lu2, Chun-Feng Wu2, Juan-Juan Liu2, ZhenDong Li2 and Chun-Rui Wu2

Effect of Polyethylene Oxide Concentration on Separation Performance of PVDF Hollow Fiber Plasma Separation Membrane

Abstract: The pore size of commonly PES/PVP plasma separation modified membrane materials is not ideal enough. Based on that, in this paper, a newly developed plasma separator made of polyvinylidene fluoride (PVDF) hollow fiber membranes was prepared by dry/wet phase inversion method with blended hydrophilic macromolecular polyethylene oxide (PEO). The effect of PEO concentration on PVDF hollow fiber membranes was evaluated for separation performance. The results showed that the pore size distribution of PVDF/PEO modified membrane was 0.30-0.93μm. In addition, the sieving coefficients of bovine serum albumin (BSA) were over 95%. And attenuated total reflection flourier transformed infrared spectroscopy (ATRFTIR) analysis confirmed that the PEO macromolecular additives remained within the PVDF modified membrane, which could effectively improve hydrophilicity of the membrane. Keywords: Polyvinylidene fluoride; Membrane; Plasma separation; Sieving coefficients

1 Introduction Plasma separation membrane with high filtration efficiency and great biocompatibility, have been extensively required in blood separation field. Polyether sulfone (PES) membrane plasma separator is widely studied by many researchers. It is generally recognized as good biocompatibility and filtration efficiency. But its membrane pore size is not very ideal or relatively small. Polyvinylidene fluoride (PVDF) material is an emerging and wonderful performance membrane material. It is gradually used in the medical field, such as nerve regeneration and artificial blood vessel [1], surgical mesh [2] and tissue engineering [3]. Recently, there has no article

|| 1 State Key Laboratory of Separation Membranes and Membrane Process, Institute of Biological and Chemical Engineering, Tianjin, Polytechnic University, Tianjin, China, E-mail: [email protected] 2 State Key Laboratory of Separation Membranes and Membrane Process, Institute of Biological and Chemical Engineering, Tianjin Polytechnic University, Tianjin, China 10.1515/9783110516623-035 DOI 10.1515/9783110303568-035

362 | Jian-Hui Guo, Juan-Juan Liu, Zhen-Dong Li and Chun-Rui Wu about PVDF material used in membrane plasma separation. PVDF material was first suggested to be used in membrane plasma separation. However, membrane pore size can be obtained probably in 0.20μm by using the existing technology, which is difficult to get more than 0.50μm microporous structure and good mechanical properties of membrane because of the hydrophobicity and viscosity property of the PVDF material itself [4-5]. As a result, it is crucial to prepare large aperture size and improve hydrophilic of PVDF membrane, further to improve the biocompatibility. The membrane with high hydrophilicity can be obtained by adding additives such as polyethylene glycol (PEG) [6], polyvinylpyrrolidone (PVP) [7] and amphiphilic polymers [8-9] into polymer. Taking advantage of easy residue of the plasma separation membrane in the post-processed procedure and to meet the demand of plasma separation, a newly developed plasma separator made of PVDF hollow fiber membranes was prepared by dry/wet phase inversion methods with blending hydrophilic macromolecular PEO. The effects of PEO concentration on PVDF hollow fiber membranes were verified for its plasma filtration efficiency. The different additives of PEG, PVP and PEO were adopted to prepare PVDF and PES modified membrane. PEG molecular weight and different kinds of additives on membrane performances were researched. And pore size distribution of the PVDF/PEO hollow fiber membrane was examined. The sieving coefficients of bovine serum albumin (BSA) were also tested throughout the perfusions, so as to be applied in the membrane plasma separation field.

2 Materials and Methods 2.1 Materials The PVDF (SOLEF 1010) and PES resin used was purchased from Solvay Solexis Company in France. N, N-dimethylacetamide (DMAc, >99%) was purchased from Samsung Company in South Korea. PEG (Mw=400) was purchased from Tianjin Fukang Chemical plant in China. Polyethylene oxide (PEO, Mw=200,000) and polyviny lpyrrolidone (PVP, Mw=37,900) were purchased from Shanghai Gobekie Company in China. Dioxane was prepared by us. Bovine Serum Albumin (BSA, Mw=68,000) was purchased from Beijing PuBoXin biotechnology Company in China.

2.2 PVDF flat Membrane Preparation According to a certain proportion (table1), the casting polymer dopes were prepared by adding PVDF, additives, DMAc and dioxane with mechanical stirring at 70°Cuntil it was homogeneous to obtain optimal particle dispersion. The casting dopes were kept at 70°C for 6h to eliminate air bubbles. The casting solution was onto clean

Effect of Polyethylene of PVDF Hollow Fiber Plasma Separation Membrane | 363

glass. Using scraper to make a certain thickness of liquid membrane. Then immediately put it into the coagulation bath. The membrane was washed 48h with deionized water. Table 1: Different kinds of membrane material flat membrane preparation Membrane type

PVDF (g)

Additive (g)

Dioxane (mL)

DMAc (mL)

PVDF

47.4

PG(20)

9.2

213.4

PVDF/PEG400

47.4

PEG400(20)

9.2

213.4

PVDF/PEO

47.4

PEO(20)

9.2

213.4

PES/PVPK30

47.4

PG(20)

9.2

213.4

PVDF/PVPK30

47.4

PEG400(20)

9.2

213.4

PVDF/PEO

47.4

PEO(20)

9.2

213.4

2.3 Residual Characteristics Analysis of PEO Additive Attenuated total reflectance Fourier transforms infrared spectra (ATR-FTIR) analysis: the residual of macromolecular additives within the membrane was directly characterized by FTIR-ATR Analyzer, the range of which is 4000-400 cm-1.

2.4 Membrane Morphology The morphology of the prepared porous membrane was examined by scanning electron microscope (SEM). The fiber was immersed in liquid nitrogen and fractured carefully. The specimen was put on a metal support and dried under vacuum for at least 24h.Then the specimen was coated by sputtering gold under vacuum. The cross sectional images of the fiber were taken by QUANTA-200 scanning electron microscopy.

2.4.1 Pore Size Distribution and BSA Sieving Properties The pore size distribution test: pore size distribution of the membrane was tested by using MM1200A type pore size analyzer with liquid-liquid method. It can be used to characterize the pore size and pore distribution. BSA transmittance test: the BSA transmittance device was shown in figure 1. PVDF/PEO hollow fiber membrane was spun by the dry/wet spinning method. The self-assembly widget was made with 20 pieces of PVDF hollow fiber membranes by

364 | Jian-Hui Guo, Juan-Juan Liu, Zhen-Dong Li and Chun-Rui Wu epoxy resin cast. Then the widget was fixed on the device by using internal pressure test method. The test was done under inlet pressure (0.100 MPa) and outlet pressure (0.060MPa). The BSA transmittance was calculated by using the formula: R=

Cp Cf

×100%

Where R (%) is the BSA transmittance; Cp (mg·L-1) is the solute concentration of permeate liquid; Cf (mg·L-1) is the solute concentration of original liquid.

Fig.1: BSA transmittance device test

3 Result and Discussion 3.1 Macromolecule Additive Effect on the Properties of PVDF Membrane The ATR-FTIR spectra of PVDF/PEO and PVDF/PEG modified membranes are shown in Figure 2. Because the PEG and PEO molecules containing -OH and CH2-CH2-O-CH2CH2 functional groups have a characteristic peak in 3400cm-1 and 1111 cm-1 respectively. We can confirm whether macromolecular PEO remained in the membrane by detecting the special functional groups. From Figure 2 we know that PVDF/PEO modified membrane have -OH and CH2-CH2-O-CH2-CH2 functional groups, and PVDF/PEG400 modified membrane is not obvious to test out the existence of two functional groups. It illustrates that small molecules PEG400 is easily washed away but hydrophilic macro molecularity additive PEO easily remains within the membrane, so as to improve the hydrophilic of the membrane.

Transmittance( %)

Effect of Polyethylene of PVDF Hollow Fiber Plasma Separation Membrane | 365

4000

3 4 0 0 cm -1 -O H

P V D F /P E G 4 0 0 P V D F /P E O 3500

3000

1 1 1 1 cm -1

C H 2 -C H 2 -O -C H 2 -C H 2

2500

2000

1500

1000

500

W a v e n u m b e rs( cm -1 )

Fig. 2: ATR-FTIR spectra of PVDF/PEG and PVDF/PEO modified membrane

3.2 PVDF Hollow Fiber Membrane SEM a.0wt%PEO

b.1.5wt%PEO

Fig. 3: The SEM of PVDF and PVDF /PEO membrane

The SEM of PVDF and PVDF /PEO membranes are shown in Figure 3, compared to PVDF original membrane, PVDF / PEO hollow fiber membrane (1.5wt% PEO) has excellent performance. We can also conclude that adding membrane with 1.5wt% PEO in the PVDF hollow fiber membrane can promote the growth of finger-like macrovoids. This is because polymer dopes, with low PVDF concentration, has significantly lowered the dope viscosity while the PEO content increased. Therefore, low dope viscosity is beneficial to the diffusion between solvent and nonsolvent,

366 | Jian-Hui Guo, Juan-Juan Liu, Zhen-Dong Li and Chun-Rui Wu which will promote the growth of finger-like macrovoids during the coagulation process.

3.3 Pore Size Distribution of PVDF and PVDF/PEO Membrane In the present experiment, excellent performance of PVDF / PEO hollow fiber membranes (1.5wt% PEO) and PVDF original membranes without any additives (0wt% PEO) are selected. Furtherly, the pore size distribution of PVDF and PVDF/PEO membranes is listed as follows.

35

Pore distribution(%)

30 25 20 15 10 5 0 0.04

0.06

0.08

0.10

0.12

0.14

0.16

0.18

Pore Size( um)

Fig. 4: Pore size distribution of PVDF original membrane

0.20

Effect of Polyethylene of PVDF Hollow Fiber Plasma Separation Membrane | 367

Pore distribution(%)

20

15

10

5

0 0.30

0.40

0.50

0.60

0.70

0.80

0.90

Pore Size(um)

Fig. 5: Pore size distribution of PVDF/PEO membrane

From Figure 4, we can see that the pore size distribution of PVDF original film is 0.06-0.17um. By contrast, Figure 5 shows that the pore size distribution of PVDF/PEO modified membranes is 0.30-0.93um, and the largest pore size could be reached 0.93um. That is to say, adding suitable amount of PEO in the PVDF hollow fiber membrane can adjust the pore size of membrane. The PVDF/PEO modified membrane preliminary achieved the purpose of isolated from whole blood plasma. On one hand, the plasma separation is mainly concentrated on separating plasma and blood cells, and the size of the blood plasma component is significantly smaller than the blood cells, on the other hand, the size of blood cells is 2μm or more. Therefore, the blood cells are trapped in the PVDF / PEO hollow fiber membrane, and the low molecular weight protein will get through the plasma membrane, which will contribute to improving the permeability of plasma protein. At the same time, BSA transmittance was tested. Self-assembly widget was made with 20 pieces of PVDF/PEO hollow fiber membranes by epoxy resin cast. Then through the BSA transmittance test, the BSA transmittance was above 95%. In this way, it was expected to be applied to the plasma separation field.

4 Conclusion Polyethylene oxide (PEO) is a kind of water-soluble polymer and has neutral charges, by adding the hydrophilic macro molecularity PEO, high-performance modified membrane which has a better resistance to exogenous hemorrhagic than PES/PVP

368 | Jian-Hui Guo, Juan-Juan Liu, Zhen-Dong Li and Chun-Rui Wu modified membrane can be obtained. That is to say, adding suitable amount of PEO in the PVDF hollow fiber membrane can adjust the pore size of membrane. The PVDF/PEO modified membrane preliminary achieved the purpose of isolated from whole blood plasma. At the same time, adding suitable amount of PEO in the PVDF hollow fiber membrane can adjust the pore size of membrane. The pore size distribution of PVDF/PEO hollow fiber membrane was 0.30-0.93um. The sieving coefficients of BSA were above 95%. It appeared to be within acceptable ranges for clinical use. In the future, it may be expected to be applied in the plasma separation field. Acknowledgement: This work was supported by the Key Projects of Science & Technology Project of Tianjin City-Preparation of polyvinylidene fluoride hollow fiber cell filter (No: 15ZCZDGX00280).

References [1] [2]

[3] [4]

[5]

[6]

[7] [8] [9]

Li LH, Tu M, Mou SS, et al. Preparation and blood compatibility of polysiloxane/liquid-crystal composite membranes, [J].Biomaterials, 2001, 22(19):2595–2599. Wongchitphimon S, Rong W, Jiraratananon R, et al. Effect of polyethylene glycol (PEG) as an additive on the fabrication of polyvinylidene fluoride-co-hexafluropropylene (PVDF-HFP) asymmetric microporous hollow fiber membranes, [J]. Journal of Membrane Science, 2011, 369(1-2):329-338. Rodrigues MT, Gomes ME, Mano JF, et al.β-PVDF membranes induce cellular proliferation and differentiation in static and dynamic conditions, [J]. Materials Science Forum, 2008, 587:72-76. Zhao Y H, Zhu B K, Li K, et al. Improving Hydrophilicity and Protein Resistance of Poly(vinylidene fluoride) Membranes by Blending with Amphiphilic Hyperbranched-Star Polymer, [J]. Langmuir, 2007, 23(10):5779-5786. Asatekin A, Menniti A, Kang S, et al. Antifouling nanofiltration membranes for membrane bioreactors from self-assembling graft copolymers, [J]. Journal of Membrane Science, 2006, 285(1-2):81–89. Chang Y, Shih Y J, Ruaan R C, et al. Preparation of poly(vinylidene fluoride) microfiltration membrane with uniform surface-copolymerized poly(ethylene glycol) methacrylate and improvement of blood compatibility, [J]. Journal of Membrane Science, 2008, 309(s1-2):165-174. Fontananova E, Jansen J C, Cristiano A, et al. Effect of additives in the casting solution on the formation of PVDF membranes, [J]. Desalination, 2006, 192(1):190-197. Liu F, Xu Y Y, Zhu B K, et al. Preparation of hydrophilic and fouling resistant poly(vinylidene fluoride) hollow fiber membranes, [J]. Journal of Membrane Science, 2009, 345(s 1-2):331-339. Akthakul A, Salinaro R F, Mayes A M. Antifouling Polymer Membranes with Subnanometer Size Selectivity, [J]. Macromolecules, 2004, 37(20):7663-7668.

Hong-Lan Li1

Influence of Phosphate Concentration and PH Crystallization of Magnesium Ammonium Phosphate (MAP) Abstract: The influence of initial phosphate concentration and pH on reactants molar ratio in the process of magnesium ammonia phosphate (MAP) crystallization was investigated by using single factor analysis, and the crystal products with different reaction condition were also characterized through the XRD analysis to evaluate the MAP formation in the crystallization process. The experimental results showed that the optimum reactants molar ratio of n(NH4+):n(Mg2+):n(PO43-) were 90:25:1, 4:1.6:1 and 3:1.4:1 when pH value was 9.5 and initial phosphate concentrations were 8mg/L, 50mg/L and 100mg/L, respectively, resulted in the phosphate removal efficiencies were 95.5%, 97.6% and 99.0% correspondingly. It was observed that the phosphate removal increased with the improving of the initial phosphate concentration or pH value, even the reactants molar ratio of n (NH4+): n (PO43-) or n (Mg2+): n (PO43-) was lower than the optimum values. The XRD analysis revealed that the best MAP crystal could be produced with initial phosphate concentration 50mg/L and pH 9.0. Keywords: phosphorous wastewater; magnesium ammonium phosphate crystallization; reactants molar ratio; initial phosphate concentration; pH

1 Introduction Phosphorus is the leading causes of eutrophication; therefore, the phosphorus removal from wastewater before discharge has to be considered an effective measure to protect natural waters from eutrophication. On the other hand, phosphorus is a kind of nonrenewable resources and considerably limited for utilization of human society [1]. Based on these considerations, several novel technologies of phosphate removal and recovery from wastewater in the world in the past decade, there into, the magnesium ammonium phosphate (MAP) crystallization was brought to the research frontier [2-4]. These reaction conditions played important roles, such as the initial phosphate concentration, pH value and reactants molar ratio, played an important role in the

|| 1 School of Civil Engineering and Architecture, University of Jinan, Jinan, China, Email: [email protected] 10.1515/9783110516623-036 DOI 10.1515/9783110303568-036

370 | Hong-Lan Li MAP crystallization. Warm adewanthi et al [5] studied the MAP crystallization in semiconductor industry wastewater with the initial phosphate concentration 83.6mg/L, phosphate removal efficiency reached to 92.5% when the reaction time was 2h, pH was 9.0 and the reactants molar ratio of n(NH 4+):n(Mg2+):n(PO43-) (express as n(N):n(Mg):n(P)) was 15:2.5:1 and. Song et al [6] found that 97% of phosphate could be removed from the synthetic swine wastewater with the initial phosphate concentration 80mg/L, while the n(N):n(Mg):n(P) was 8:1.4:1 and pH was 9.5. The optimum reactants molar ratios are different with different water quality such as phosphate concentration, pH value and interfering ions. However, the influence of initial phosphate concentration and pH on reactants molar ratio in the process of the MAP crystallization is unclear. In a general way, the phosphate concentration of wastewater varies within the limits of 10mg/L-100mg/L. If the initial phosphate concentrations vary, the optimum reactants parameters would be different accordingly. Therefore, the objective of this study is to investigate the influence of initial phosphate concentration (8mg/L, 50mg/L and 100mg/L) and pH on reactants molar ratio in the process of MAP crystallization to supply an important reference for engineering application.

2 Material and Methods The all experiments were performed by using synthetic solution, which was prepared of reagent grade KH2PO4, MgCl2 and NH4Cl respectively. The batch experiments were initiated by a complete mixing of 400mL solution which included KH2PO4, MgCl2, and NH4Cl according to the desired reactants molar ratio. And then the pH of the mixing solution was adjusted with pH meter by adding NaOH (10mol/L) or HCl (10mol/L) solutions, followed by mechanical mixing at a speed of 80 per min and a temperature of 12~15°C. The samples for compositions measuring were filtrated by 0.45μm MF-Millipore Membrane. PO4--P concentration was measured by molybdate–ascorbic acid colorimetric method with UV-VIS 752 spectrophotometer at the wavelength of 700nm NH4+-N concentration was measured by Nessler´s reagent colorimetric method with UV-VIS 752 spectrophotometer at the wavelength of 420nm. Mg2+ was measured by the chelate standard method [7]. Produced precipitates were air-dried at a temperature of 12~15eC, and then were analyzed with Xray diffraction.

Influence of Phosphate Magnesium Ammonium Phosphate (MAP) | 371

3 Results and Discussion 3.1 Influence of Initial Phosphate Concentration on Reactants Molar Ratio When ion concentrations of MAP components reach to oversaturation, crystallization occurs as follows: PO43-+Mg2++NH4++6H2OėMgNH4PO4•6H2O

(1)

Theoretically, the MAP crystallization reactions occur generally when reactants molar ratio of n (N): n (Mg): n (P) reaches to 1:1:1. However, the reactantsion concentrations in wastewater, which provide the different phosphate concentrations, are different from that of the theoretical modes. The phosphate removal efficiency will increase with the increasing of reactants molar ratio according to common law of ion effect. For higher phosphate removal efficiency, the NH4+-N and Mg2+ concentration in the reaction solution must be in excess. However, if the precipitates have formed and a higher phosphate concentration is provided, more phosphate would be crystallized on the surface of the precipitates, results in the MAP crystal growth and the decrease in NH4+-N and Mg2+ concentration continuously. To discuss the influence of different initial phosphate concentration on reactants molar ratio, experiments were carried out with initial phosphate concentrations 8mg/L, 50mg/L and 100mg/L, respectively. And pH 9.5, stirring rate 80r/min, reaction time 30min and ageing time 30min were adopted. The results were shown in Table 1 and Table 2 respectively.

372 | Hong-Lan Li Table 1: Influence of initial phosphate concentration on N (N): N (P) Initial phosphate concentration (mg/L)

n(Mg):n(P)

n(N):n(P)

Phosphate removal efficiency (%)

8

2

20

94.8

8

2

50

95.8

8

2

70

97.2

8

2

90

98.5

8

2

110

98

50

2

1

73.8

50

2

2

90.7

50

2

4

98.2

50

2

6

98.6

50

2

8

99

50

2

10

99.2

100

2

1

87.3

100

2

2

98

100

2

3

98.8

100

2

5

99.2

100

2

8

99.2

100

2

10

99.3

Usually, saturation index (SI) is used to evaluate whether crystallization can occur under certain conditions. SI=log IAP/ Ksp= log (K • γ) / Ksp.

(2)

IAP-ion activity product; Ksp-ion solubility product; γ- ion activity coefficients product; K-effective ion concentration product. When SI=0, solution is in balance. When SI0, solution is in oversaturation, and there will be sedimentations.

Influence of Phosphate Magnesium Ammonium Phosphate (MAP) | 373 Table 2: Influence of initial phosphate concentration on N (Mg): N (P) Initial phosphate concentration (mg/L)

n(Mg):n(P)

n(N):n(P)

Phosphate removal efficiency (%)

8 8

2

90

92.8

15

90

92.7

8

25

90

95.5

8

50

90

95.8

8

100

90

96.7

50

1

4

89.9

50

1.2

4

93.5

50

1.4

4

96.4

50

1.6

4

97.6

50

2

4

97.9

100

1

3

95.0

100

1.2

3

98.6

100

1.4

3

99.0

100

1.6

3

99.4

100

2

3

99.6

As showed in table 1 and table 2, the phosphate removal efficiency increased noticeably with increasing of the initial phosphate concentration and molar ratio. High molar ratio induced phosphate precipitation, and the removal efficiency reached to 95.5%, 97.6% and 99.0% respectively with the initial phosphate concentrations 8mg/L, 50mg/L and 100mg/L when the reactants molar ratio of n(N):n(Mg):n(P) increased to 90:25:1, 4:1.6:1 and 3:1.4:1 correspondingly. When the initial phosphate concentration was high, the phosphate removal efficiency could be increased because of the high effective PO43- concentration. So that the MAP crystallization could occur even effective NH4+ concentration and effective Mg2+ concentration were lower than the optimum values. The results suggested that when the initial phosphate concentration was low, the IAP value could be improved by increasing of reactants molar ratio. And when the initial phosphate concentration was high, the MAP crystallization could occur even though the reactants molar ratio was lower than the optimum values.

3.2

Influence of pH on Reactants Molar Ratio

The solution pH value is one of the most important influence factors of the MAP crystallization. To discuss the influence of pH on reactants molar ratio, experiments were carried out with different pH value. The initial phosphate concentrations were

374 | Hong-Lan Li 8mg/L, 50mg/L and 100mg/L, and the stirring rate 80r/min, reaction time 30min and ageing time 30min were adopted. Influence of pH on n (N): n (P) and n (Mg): n (P) were studied respectively. The results were shown in Fig. 1 and Fig. 2.

P removal efficiency (%)

100

P removal efficiency (%)

100 80 60 40

n(N):n(Mg):n(P)=20:25:1 n(N):n(Mg):n(P)=45:25:1 n(N):n(Mg):n(P)=90:25:1

20 0 8

(a)

8.5

9 pH

9.5

10

(b)

80 60 40

n(N):n(Mg):n(P)=2:1.6:1 n(N):n(Mg):n(P)=4:1.6:1 n(N):n(Mg):n(P)=6:1.6:1

20 0 8

8.5

9 pH

9.5

10

P removal efficiency (%)

100

(c)

80 60 40

n(N):n(Mg):n(P)=1:1.4:1 n(N):n(Mg):n(P)=3:1.4:1 n(N):n(Mg):n(P)=5:1.4:1

20 0 8

8.5

9 pH

9.5

10

Fig. 1: Influence of pH on reactants molar ratio n(N):n(P) of initial phosphate concentration is (a) 8mg/L (b) 50mg/L and (c) 100mg/L.

Fig. 1 showed that the phosphate removal efficiency increased with pH increasing when the initial phosphate concentrations were 8mg/L, 50mg/L and 100mg/L, respectively. With a lower reactant molar ratio (n (N): n (Mg): n (P) =20:25:1, 2:1.6:1 and 1:1.4:1, respectively), the phosphate removal efficiencies were low, even pH increased to 10.0. These results illustrated that the sufficient NH4+ concentration had to be supplied to carry out high phosphate removal efficiency. When pH was increased from 8.0 to 9.5, the phosphate removal efficiency increased remarkably. But when pH increased from 9.5 to 10.0, the phosphate removal efficiency was steady. This phenomena might be explained that the solubility of MAP would drop down with increasing of pH, and the ratio of PO43- in crystal reaction solution will increased with increasing of pH, leading to the phosphate removal improving with the increase in pH. The results in Fig.2 illustrated that the phosphate removal effi-

Influence of Phosphate Magnesium Ammonium Phosphate (MAP) | 375

ciency could be high with a high pH, even the reactants molar ratio of n (N): n (P) was lower than the optimum value.

P removal efficiency (%)

80 60 40

n(N):n(Mg):n(P)=45:10:1 n(N):n(Mg):n(P)=45:25:1 n(N):n(Mg):n(P)=45:50:1

20 0 8

(a)

8.5

9 pH

9.5

P removal efficiency (%)

100

100

10

80 60 40

n(N):n(Mg):n(P)=4:1.4:1 n(N):n(Mg):n(P)=4:1.6:1 n(N):n(Mg):n(P)=4:1.8:1

20

(b)

0 8

8.5

9 pH

9.5

10

P removal efficiency (%)

100 80 60 40

n(N):n(Mg):n(P)=3:1.2:1 n(N):n(Mg):n(P)=3:1.4:1 n(N):n(Mg):n(P)=3:1.6:1

20

(c)

0 8

8.5

9 pH

9.5

10

Fig. 2: Influence of pH on reactants molar ratio n(Mg):n(P) of initial phosphate concentration is (a) 8mg/L (b) 50mg/L and (c) 100mg/L

It could be seen from Fig. 2 that the influence patterns of pH on n (Mg): n (P) and the phosphate removal efficiency were the same as that of pH on n (N): n (P) as well as the phosphate removal efficiency. Fig. 2 also indicated that the increase in the n (Mg): n (P) was an effective means to enhance the crystal formation in the process of MAP crystallization, especially at a lower pH value. When pH increased from 8.0 to 9.0, the phosphate removal efficiency increased remarkably.

3.3

XRD Analysis

There are complex ion balance systems in the MAP crystallization solution. All kinds of ion concentrations vary with the different phosphate concentration and pH value. Many side reactions will occur in the process of MAP crystallization. However, from the standpoint of good recovery of MAP, crystal formation is important and side

376 | Hong-Lan Li reactions are not accepted in the process of MAP crystallization. XRD analysis was conducted to investigate the crystal formation in the process of MAP crystallization. The XRD analysis was performed over a 2θ range of 0~60°. Compared with the standard spectra of MAP, the X-ray diffraction spectrums of the sedimentations were well fitted to the diffraction figures [8]. There were several characteristic peaks in the Fig.3 when 2θ were 15.8°, 20.8° and 33.3°, implied that the MAP had formed along with the removal of phosphate. Fig. 3 also suggested that the best MAP crystal could be produced with initial phosphate concentration 50mg/L and pH 9.0. The MAP product was easy to gain with a high pH, while Mg (OH) 2 could be formed when pH was too high, so that the crystal formation with pH 9.0 was better than that with pH 8.5 and 9.5. When the initial phosphate concentration was high, the crystallization was easy to occur, resulted in a better MAP crystal formation with initial phosphate concentration of 50mg/L than that of 8mg/L. However, Mg3 (PO4)2 could be formed when the initial phosphate concentration was too high, so that the crystal formation with initial phosphate concentration of 50mg/L was better than that of 100mg/L.

4 Conclusions The optimum reactants molar ratio of n(N):n(Mg):n(P) were 90:25:1, 4:1.6:1 and 3:1.4:1 when pH value was 9.5 and the initial phosphate concentrations were 8mg/L, 50mg/L and 100mg/L, respectively. The phosphate removal increased with the improving of the initial phosphate concentration or pH value, even the reactants molar ratio of n (N): n (P) or n (Mg): n (P) was lower than the optimum values. The best crystal MAP was produced with initial phosphate concentration 50mg/l and pH 9.0, while the phosphate removal efficiency was 97.6%. A method of balancing the high phosphate removal efficiency and the good crystal form is important to be explored for engineering application in the future.

References [1]

[2] [3] [4]

Z. L. Ye, S. H. Chen, S. M. Wang, and L. F. Lin. “Phosphorus recovery from synthetic swine wastewater by chemical precipitation using response surface methodology,” Journal of Hazardous Materials. vol. 176, pp. 1083-1088, Apr. 2010. Simon A. P, and James D. D. “Struvite formation, control and recovery,” Water Research. vol. 36, pp. 3925-3940, Sep. 2002. G. K. Morse, S. W. Brett, J. A. Guy, and J. N. Lester. “Review: Phosphorus removal and recovery technologies,” The Science of The Total Environment. vol. 212, pp. 69-81, Mar. 1998. N. O. Nelson, R. L. Mikkelsen, and D. L. Hesterberg. “Struvite precipitation in anaerobic swine lagoon liquid: effect of pH and Mg: P ratio and determination of rate constant,” Bioresource Technology. vol. 89, pp. 229-236, Sep. 2003.

Influence of Phosphate Magnesium Ammonium Phosphate (MAP) | 377 [5] [6]

[7] [8]

Warmadewanthi, and J. C. Liu. “Recovery of phosphate and ammonium as struvite from semiconductor,” Separation and Purification Tchnology. vol. 64, pp. 368-373, Jan. 2009.Y. Y. H. Song, P Yuan, B.H. Zheng, and J. F. Peng. “Nutrients removal and recov-ery by crystallization of magnesium ammonium phosphate from synthetic swine wasterwater,” Chemosphere. vol. 69, pp. 319-324, Jul. 2007. APHA, AWWA, and WEF, Standard Methods for Examination of Water and Wastewater, 20th ed., APHA, AWWA, and WEF, Washington, DC, 1998. H. H. Mary, M. Ludonic, and A. P. Catherine. “Temperature impact assessment on struvite solubility product: A thermodynamic modeling approach,” Chemical Engineering Journal. vol. 167, pp. 50-58, Feb. 2011.

Jiang Wang1 and Wei-Gang Huang2*

Microstructure and Corrosion Resistance of CrMoVNbFex High-entropy Alloys Abstract: CrMoVNbFex high-entropy alloys (0≤x≤1) were prepared by vacuum arc furnace. The phase composition, microstructure, microhardness and corrosion resistance of CrMoVNbFex alloys were characterized respectively by using of X-Ray diffractometer (XRD), scanning electron microscope (SEM), Energy Dispersive Spectrometer (EDS), hardness tester and electrochemical workstation. The XRD results indicate that the phase of CrMoVNbFex alloys is single BCC solid solution when Fe content is 0mol and 0.2mol. However, the duplex phases of BCC solid solution and σ phase were obtained when Fe content is over 0.2mol. The microstructure of the alloys displays the dendritic and interdendritic morphology. When the Fe contents (x mol) increase from 0 to 1, the hardness increase from HV641 to HV950. The CrMoVNb alloy shows the best corrosion resistance in 1mol/L H2SO4 solution, but with the increase of Fe contents, corrosion resistance of CrMoVNbFex alloys gradually deteriorated. Keywords: High-entropy alloy; Phase composition; microstructure; corrosion resistance

1 Introduction The concept of high entropy alloys (HEAs),which was firstly proposed by professor Yeh et al in 1995[1-3], may be composed of at least five principal elemental in equal or near-equal atomic ratios in which each elemental molar ratio is more than 5% but less than 35%[4]. The high mixing entropy effect can facilitate the formation of simple solid solutions during solidification instead of intermetallic compounds. HEAs are capable of possessing higher strength and higher hardness, better ductility and better high oxidation and corrosion than traditional alloys [5-7]. Therefore, they have huge potentials to be used as engineering materials, such as tools, molds, dies, mechanical parts and furnace parts, which require high strength, thermal stability, wearing and oxidation resistance [8]. Some researchers are focusing on exploring the effects of addition of alloying elements in various HEAs on microstructure and properties. Yeh et al has studied || 1 College of Materials Science and Engineering, Sichuan University, Chengdu 610065, China 2 College of Materials Science and Engineering, Sichuan University, Chengdu 610065, China, *Corresponding author: [email protected] 10.1515/9783110516623-037 DOI 10.1515/9783110303568-037

380 | Jiang Wang and Wei-Gang Huang the effect of Al addition on the microstructure and mechanical properties of AlxCoCrFeNiCu alloys firstly [9].The results showed that AlxCoCrFeNiCu alloys consist of FCC and BCC crystal structure. When the Al contents from x = 0 to x =3, the crystal structure, microstructure and mechanical property of as-cast AlxCoCrFeNiCu alloys changed evidently. Zhangyong has investigated the effects of the amount of Ti on the microstructure and mechanical properties of CoCrCuFeNiTix alloy [10]. The study indicates that the alloy CoCrCuFeNiTix shows a good plastic performance when it has little amount of Ti. With the increase of Ti, Intermetallic compounds have separated out from grain boundaries and the strength of the CoCrCuFeNiTix alloys have been elevated with the obvious decrease of the plastic performance at the same time. Shun et al has investigated the effects of variations in the amount of Mo on the microstructure and mechanical properties of CoCrFeNiMox[11]. It was found that (Cr, Mo)-rich σ phase was observed in the face-centered cubic matrix after the addition of Mo into the alloys and the alloys had outstanding ductility. In this paper, based on the concept of HEA design, such as same crystal structure, approximative atom radius, and the similar electronegativity and so on [12-14], CrMoVNbFex alloys with different Fe contents were prepared. Owing to the element Fe has different crystal structure under different temperature, it is necessary to know how the contents of Fe would affect the structure and the performance of the alloy. So the effect of Fe content on the microstructure, hardness and corrosion resistance has been systematically investigated.

2 Experiment Details CrMoVNbFex alloys with nominal composition (x value, in molar ratio, x = 0, 0.2, 0.4, 0.6, 0.8 and 1.0, denoted as Fe0, Fe0.2, Fe0.4, Fe0.6, Fe0.8 and Fe1.0, respectively) were prepared by vacuum arc melting under a high-purity argon atmosphere on a water-cooled Cu hearth. The purity of all the raw elemental metals is above 99.9%. The alloys were melted for six times to improve chemical homogeneity. The crystalline structures of the as-cast samples were identified by X-ray diffract meter (XRD, DX-2000) using Cu Kα radiation, operated at a voltage of 40 kV and a current of 25 mA. The microstructures of the alloys were measured with scanning electron microscopy (SEM, S-3400N) equipped with an energy-dispersive spectrometer (EDS). Vickers hardness was measured with a DHV-1000Z hardness tester under a loading of 0.5 kg and a duration time of 15 s. The eight measurements were made on each sample for an average. Alloy potentiodynamic polarization curves in 1 mol/L H2SO4 solution were investigated by an electrochemical workstation (CHI660 D) at room temperature, using three-electrode system: the saturated calomel electrode as reference electrode, auxiliary electrode was a platinum electrode, specimen

Microstructure and Corrosion Resistance of CrMoVNbFex High-entropy Alloys | 381

as working electrode, the potential scan range in 1 mol/L H2SO4 solution of -2 to 2 V, the scanning rate of 1 mV/s.

3 Results and Discussion 3.1 X-Ray Diffraction Analysis The XRD patterns of as-cast CrMoVNbFex alloys with various Fe contents are shown in Fig. 1. It can be seen that when x = 0mol,i.e. CrMoVNb alloy, the XRD patterns consists of four clear diffraction peaks at 2θ = 40.58°, 59.24°, 73.82°, 88.76° position, All peaks of CrMoVNb alloy have been identified and display single body-centeredcubic (BCC) solid solution phase. When Fe content in CrMoVNbFex alloy is 0.2mol, the alloy still exhibits a single BCC phase. As Fe contents further increase over 0.2mol, FeNb phase i.e. σ phase with tetragonal structure, appears and with the increasing of Fe contents, the diffraction peak intensity of σ phase increases. It is well known that with the increasing of Fe contents the crystal structure of CrMoVNbFex alloy is composed of duplex phases of BCC solid solution and σ phase.

Fig. 1: X-ray diffraction patterns of CrMoNbVFex alloys

3.2 Microstructure The microstructures of the CrMoVNbFex alloys are shown in Fig. 2. The morphology of the alloys is typical dendrite structure, in which the bright region is dendrite marked as A and gray dark is interdendrite marked as B. As can be shown in figure 2, the microstructures of CrMoVNbFex alloys become finer with increase of Fe contents. The element distributions of different regions of CrMoVNbFex alloys determined by EDS are shown in Table 1. It could be observed from the EDS data that in the

382 | Jiang Wang and Wei-Gang Huang CrMoVNb alloy, the contents of Mo in the dendritic regions are rich Mo due to its high melting point; the interdendritic regions are rich Cr. The distribution of Nb and V is almost uniform in dendritic region and interdendritic region. With the increase of Fe content, the dendritic regions are still rich Mo, Cr and Fe are rich in the interdendritic region. However, V is rich in the dendritic region and the Nb is rich in interdendritic region. This trend can be explained by the fact that when the alloy starts to solidify from high temperature, the high melting point elements Mo and Nb first generate nucleation in the form of solid solution and then grow up in the form of dendrite (namely the bright region A). The most of low melting point elements Cr and Fe are squeezed into remain solutions so as to be rich in interdendrites (namely the gray dark region B). According to the data in table 2, Fe tends to combine with Nb to form σ phase(FeNb phase) in the interdendrites due to the negative binding enthalpy of Fe-Nb is -16kJ/mol, which make the contents of Nb lower in the dendritic region. With the increase of the Fe in the alloy, the σ phase in the dendrites is also increasing.

Fig. 2: SEM backscattered electron images of the as-cast CrMoVNbFex alloys (a) x=0; (b) x=0.2; (c) x=0.4; (d) x=0.6; (e) x=0.8; (f) x=1.0

Microstructure and Corrosion Resistance of CrMoVNbFex High-entropy Alloys | 383 Table 1: Compositions of different microstructure areas in as-cast crmovnbfex (x=0, 0.2, 0.4, 0.6, 0.8, 1) high-entropy alloys x

0

0.2

0.4

0.6

0.8

1.0

Region In fig .2

Atom fraction/% Fe

Cr

Mo

V

Nb

Normal

0

25.00

25.00

25.00

25.00

A

0

23.68

26.49

23.42

26.40

B

0

40.71

9.37

23.41

26.51

Normal

4.80

23.80

23.80

23.80

23.80

A

1.74

20.67

29.82

21.63

26.13

B

14.29

35.78

3.17

16.70

30.05

Normal

9.10

22.80

22.70

22.70

22.70

A

3.46

23.40

24.71

22.34

26.09

B

15.34

34.82

3.90

16.02

29.84

Normal

13.04

21.74

21.74

21.74

21.74

A

4.75

26.70

19.75

23.67

25.13

B

16.12

34.31

4.37

15.65

29.55

Normal

16.67

20.83

20.83

20.83

20.83

A

7.47

23.27

23.49

23.73

22.04

B

21.48

28.03

5.93

15.74

28.81

Normal

20.00

20.00

20.00

20.00

20.00

A

10.10

23.98

22.83

23.22

19.88

B

25.87

25.38

6.39

15.05

27.31

H

mix

Table 2: The values of ' (kj/mol) calculated by miedema’s model for atomic pairs between AB elements involved in this paper Element

Cr Cr

Mo

V

Nb

Fe

0

-2

-7

-1

Mo

0

-6

-2

V

-1

-7

Nb

-16 Fe

3.3 Microhardness of CrMoVNbFex Alloys Figure 3 is the hardness of CrMoVNbFex alloys with different Fe contents. It can be clearly seen that the hardness of alloy without adding Fe has higher hardness,

384 | Jiang Wang and Wei-Gang Huang HV641. With the increase of Fe contents, the hardness of CrMoVNbFex alloys increases markedly up to highest value, 950HV. The higher hardness of CrMoVNbFex can be ascribed to solid solution strengthening of Fe and precipitation strengthening of σ phase.

Fig. 3: Microhardness of CrMoVNbFex alloys with different Fe contents

3.4 Corrosion Resistance Fig 4 shows the potentiodynamic polarization curves of CrMoVNbFex alloys and S304 steel in 1mol/L H2SO4 solution. The corrosion potential (Ecorr) and corrosion current density (Icorr) could be acquired by using of extrapolation method of Tafel curve and the results are shown in Table3. The corrosion resistance of the alloys can be analyzed according to the corrosion current density. It is well known that the smaller corrosion current density (Icorr), the higher corrosion potential (Ecorr), indicating that the corrosion resistance is better. Conversely, the corrosion resistance is worse [15-18]. According to the Table 3, The Fe0 alloy has the highest corrosion potential and the lowest corrosion current density, so its corrosion resistance is the best. With the Fe content increase, the corrosion potential is reduced greatly and the corrosion current density is more “positive”, which indicates that the corrosion resistance of CrMoVNbFex alloys gradually deteriorated in 1 mol/L H2SO4 solution. The reason is that with the increasing of Fe contents, the crystal structure of CrMoVNbFex alloys are composed of duplex phases of BCC solid solution and σ phase. Due to the heterogeneous composition, micro-anode region and micro-cathode region are formed in the electrolyte solution. Anode region and cathode region constitute the corrosion cell. Therefore, the alloys with two phase structures are corroded easily.

Microstructure and Corrosion Resistance of CrMoVNbFex High-entropy Alloys | 385

Fig. 4: Potentiodynamic polarization curves for CrMoVNbFex alloys in 1mol/L H2SO4 solution Table 3: Corrosion dynamics parameters in 1mol/l h2so4 solution Alloys

Ecorr(V)

icorr(A/cm2)

Fe0

-0.18

1.11×10-7

Fe0.2

-0.22

3.78×10-7

Fe0.4

-0.24

8.57×10-7

Fe0.6

-0.32

1.25×10-7

Fe0.8

-0.40

4.61×10-6

Fe1.0

-0.41

3.72×10-5

S304

-0.72

2.45×10-6

4 Conclusions In this study, a series of CrMoVNbFex (x: molar ratio, x =0, 0.2, 0.4, 0.6, 0.8 and 1.0) HEAs were prepared by vacuum arc furnace. The effects of Fe contents on the variation of phase composition, microstructure, microhardness and corrosion resistance of CrMoVNbFex alloys were characterized. The results show that the Fe0 and Fe0.2 alloys is single BCC structure phase, Fe0.4, Fe0.6, Fe0.8 and Fe1.0 alloys are composed of duplex phases of BCC solid solution and σ phase. The morphology of the alloy is typical dendrite structure. With the increase of Fe content, the alloy hardness increase significantly and the highest hardness is 950HV. The CrMoVNb alloy has best corrosion resistance in 1mol/L H2SO4 solution, with the increase of Fe contents, corrosion resistance of CrMoVNbFex alloys gradually deteriorated.

386 | Jiang Wang and Wei-Gang Huang

References [1]

[2] [3] [4] [5] [6]

[7] [8]

[9] [10] [11] [12] [13]

[14] [15] [16] [17] [18]

Yeh Jw, Chen Sk ,Lin Sj, Gan Jy, Chin Ts, Shun Tt, Tsau Ch, Chang Sy: ‘Nanostructured highentropy alloys with multiple principal element: novel alloy design concepts and outcomes’, Adv .Eng . Mater, 2004, 6, 299-303. SHENG Guo, QIANG Hu, CHUN Ng: ‘More than entropy in high-entropy alloys: forming solid solutions or amorphous phase’, Intermetallics, 2013, 41, 96-103 ZHANG Yong, ZHOU Yj, LIN Jp, CHEN Gl, LIAW Pk: ‘Solid-solution phase formation rules for multicomponent alloys’, Adv .Eng. Mater, 2008, 10(6), 534-538... A.Manzoni, H.Daoud, R.Volkl, U.Glatzel, N.Wanderka: ‘Phase separation in equiatomic AlCoCrFeNi high-entropy alloy’, Ultramicroscopy, 2013, 132,212-215. Y.J. Zhou, Y. Zhang, Y.L. Wang, and G.L. Chen: ‘A precipitation-hardened high-entropy alloy with outstanding tensile properties’, Acta Materialia, 2016, 102,187-196. Shin-Tsung Chena, Wei-Yeh Tanga, Yen-Fu Kuoa, Sheng-Yao Chena: ‘Microstructure and properties of age-hardenable AlxCrFe1.5MnNi0.5 alloys’, Mater. Sci. Eng. A, 2010, 527, 58185825. U. Roy, H.Roy, H.Daoud, U.Glatzel, K.K.Ray: ‘Fracture toughness and fracture micromechanism in a cast AlCoCrCuFeNi high entropy alloy system’, Materials Letters, 2014, 132,186-189. LIU Yuan, CHEN Min, LI Yanxiang, CHEN Xiang: ‘Microstructure and Mechanical Performance of AlxCoCrCuFeNi High-entropy Alloys’, rare metal materials and engineering, 2009, 38(9), 1602-1607. Tung Chung-chin, Yeh Jien-wei, Shun Tao-tsung, Chen Sk, Huang Ys, Chen Hc: ‘On the elemental effect of AlCoCrFeCuNi high-entropy alloy system’, Materials letters, 2007, 61, 1-5. Zhang Y, Wang Xue Fei, Chen Guo liang, Qiao Yi, Effect of Ti on the microstructure and properties of CoCrCuFeNiTix high-entropy alloys, Ann Chim-Sci Mat, 2006, 31(6), 699-709. Tao-Tsung Shun, Liang-Yi Chang, Ming-Hua Shiu: ‘Microstructure and mechanical properties of multiprincipal component CoCrFeNiMox alloys’, Materials Characterization, 2010, 70, 63-67. REN Mingxing, LI Bangsheng, FU Hengzhi: ‘formation condition of solid solution type highentropy alloy’, Nonferr.Metal.Soc., 2013, 23, 991-995. Akira Takeuchi, Akihisa Inoue: ‘Classification of bulk metallic glasses by atomic size difference, Heat of mixing and period constituent elements and its application to characterization of the main alloying element’, Mater. Trans, 2005, 46(12), 2817-2829. Sheng Guo, C.T.Liu, Phase stability in high entropy alloys: ‘Formation of solid-solution phase or amorphous phase’,Prog Nat Sci-Mater, 2011 ,21(6),433-446. Xing-Wu Qiu, Yun-Peng Zhang, Li He, Chun-Ge Liu: ‘Microstructure and corrosion resistance of AlCrFeCuCo high entropy alloy’, Alloys Compd, 2013, 549,195-199. Bao-yu Li, Kun Peng, Ai-Ping Hu, Ling-Ping Zhou: ‘Structure and properties of FeCoNiCrCu0.5Alx high-entropy alloy’, ScienceDirect, 2013, 23, 735-741. Xing-Wu Qiu, Chun-Ge Liu: ‘Microstructure and properties of Al2CrFeCoCuTiNix high-entropy alloys prepared by laser cladding’, Alloys Compd, 2013,553, 216-220. X.W.Qiu, Y.P.Zhang, C.G.Liu: ‘Effect of Ti content on structure and properties of Al2CrFeNiCoCuTix high-entropy alloy coatings’, Alloys Compd, 2014,585, 282-286.

Xiao-Hu Li1, Xiao-Jun Li2, Xiao-Hui Wang3 and Fang-Fang Li4

Finite Element Analysis of Composite Shear Walls with Double Steel Plates and Filled Concrete for a Nuclear Island Structure under In-Plane Loading Abstract: Some finite element models are developed for composite shear walls with double steel plates and filled concrete (SCSW) using finite element software ABAQUS, which are typical prototypes for nuclear island structure. This paper investigated the seismic behavior of SCSW under the complex stress state of vertical loading and horizontal loading based on finite element analysis and tests. The effects of parameters, such as stud space, the thickness of steel plates, concrete strength, vertical loading and shear connector on the seismic behavior of SCSW, are analyzed. The results show that it is more effective on seismic performance of shear wall specimens to set stiffener in same conditions of increasing the same steel content. Finally, this paper compares the results of the finite element calculation and test results on ultimate capacity and it is found that both of them have a good agreement. Keywords: Nuclear island structure, Finite element analysis, Lateral stiffness, Ultimate strength, Composite shear wall

1 Introduction SCSW is a new kind of component to resist the lateral forces imposed by wind or earthquakes. In recent years, this structure has been more and more used in civil engineering such as a reservoir, offshore platforms and high-rise buildings, etc. However, the related research on composite shear walls with double steel plates and filled concrete for nuclear engineering just began in the 1980s. During the 1980s, a number of extensive research programs into construction feasibility, construction experience and engineering cost on the steel-concrete composite structure were studied by Japanese researchers [1~3]. Based on the internal

|| 1 Beijing University of Technology, Beijing, China, e-mail:[email protected] 2 Beijing University of Technology, Institute of Geophysics, China Earthquake Administration, Beijing, China, e-mail: [email protected] 3 Beijing University of Technology, Beijing, China, e-mail:[email protected] 4 Beijing University of Technology, Beijing, China, e-mail:[email protected] 10.1515/9783110516623-038 DOI 10.1515/9783110303568-038

388 | Xiao-Hu Li, Xiao-Jun Li, Xiao-Hui Wang and Fang-Fang Li structure of the pressurized water reactor nuclear power plant, low cyclic loading test of some 1/10 scale models was carried out to study the seismic performance of the steel-concrete composite structure. By comparing the performance of steelconcrete composite structure and the reinforced concrete structure, it was found that the former has better strength and ductility [4]. In 1998, M. Takeuchi and others studied the feasibility of a new structural system for nuclear power plant buildings. They made some 1/5 scale model of SC specimens and carried out compressive loading tests to determine how to prevent buckling [5]. In 1997, the American scholar Braverman made some analysis and summary on the modular construction of SCSW for nuclear power plant in the report [6]. In 2014, the researchers in Purdue University made some experimental database and design for out-of-plane shear tests on the steel-plate composite walls. The effect of parameters such as the shear span-todepth ratio, steel faceplate thickness, stud anchor spacing, and the presence of shear reinforcement on out-of-plane shear strength. American AP1000 and USAPWR use SC walls extensively in the containment internal structures [7]. The relative experimental investigations of the steel-concrete composite structure have also been conducted in S. Korea, Canada, and China. The design guidelines for composite SC walls have been developed by researchers in South Korea [8]. Steel-concrete composite walls have generally been used in high-rise buildings in China. This paper focuses on the seismic performance of SCSW for shielding workshop of CAP1400 nuclear power plant, which is the main problems and must be considered in the design and construction of nuclear engineering. Surrounded on the outside of the steel containment vessel, the main functions of the shielding work shop of nuclear power plant are radiation shielding, safe shutdown earthquake, internally generated missile impact and so on. Due to its special function, the structure of shear wall in the nuclear engineering is different from the shear wall in the civil construction and other projects, which belongs to the thick shear wall (it is generally greater than 1000mm) and not worthy to be reinforced in the internal concrete. In March 2011, Fukushima nuclear power plant accident happened, which was caused by 9.0 magnitude earthquake in Japan. The damage caused by the explosion and nuclear radiation was extremely serious. We should learn a lesson from this and make the seismic safety as a key problem in the design of nuclear power engineering especially for some countries such as China there earthquake activity is frequent. SCSW consist of the steel faceplates on both sides and plain concrete infill. The steel faceplates are typically attached to the concrete infill using stud and stiffener, which enables both to work together. According to the structural characteristics of cylinder shell of shielding workshop, steel faceplates in the flank of the specimen are designed to confined concrete. The structure of SCSW is shown in Fig.1.

Finite Element Analysis Structure under In-Plane Loading | 389

 Fig. 1: The structure of SCSW

As a component to resist lateral force, SCSW has the advantages as follows: (i) SCSW makes full use of the tensile strength of the steel plate and the compressive strength of concrete, which can play to their material characteristics respectively;(ii)Steel plate and concrete are a mutual constraint for each other. Steel plate can prevent the cracking and damage of the concrete, to avoid the exposure of its cracks and the splashing of the broken concrete. This can improve the usability and durability of the shear wall, increase its shear bearing capacity and enhance the seismic performance of the shear wall to a large extent. Concrete can prevent the buckling instability of the steel plate and enhance the overall stiffness of the wall. (iii)The use of modular construction technology greatly improves the construction efficiency compared to traditional reinforced concrete construction. Based on the low cyclic experiment of SCSW specimen, the finite element simulation on the specimens was carried out to study the seismic performance and mechanical characteristics of SCSW in this paper. Through lots of numerical analysis, the effect of parameters on seismic behavior of shear wall was investigated. The comparisons between finite element calculation and the test result were conducted to find the appropriate method accord with the realistic conditions of SCSW.

390 | Xiao-Hu Li, Xiao-Jun Li, Xiao-Hui Wang and Fang-Fang Li

2 Experimental program 2.1 Specimen Design The test specimens were designed to represent SCSW for a nuclear island structure and were fabricated at 1/5 scale to accommodate the capacity of the loading facility. Nine specimens of SCSW were designed and labeled SCSW1 to SCSW9, one specimen of reinforced concrete shear wall was also been designed and labeled RC10. The specimen of SCSW and RC were designed to have the same size and RC10. The specimen of SCSW1 was used as benchmark experimental test and RC10 was designed to have the same steel ratio with SCSW1. The steel plate reinforcement ratio is calculated as the total area of steel plate divided by the cross-section area of the specimen and the steel reinforcement ratio is calculated as the volume of the steel divided by the volume of the specimen. All the specimens in the test consist of loading beam, shear wall and foundation beam. The size of each part is 1020mm × 300mm × 300mm, 820mm × 220mm × 2000mm, 1820mm × 430mm × 550mm, as shown in Fig.2. The parameters of the specimen are stud space, vertical load, the thickness of steel plate, and shear connector. The specific parameters of design are listed in TABLE1

Fig. 2: Elevation view of composite shear wall specimens (Unit: mm)

Finite Element Analysis Structure under In-Plane Loading | 391 Table 1: Specimen parameters Model

Thickness of steel plate(mm)

Shear connector

Vertical load(kN)

SCSW1

4

stud˜100

800

SCSW2

4

stud˜150

800

SCSW3

4

stud˜200

800

SCSW4

6

stud˜100

0

SCSW5

6

stud˜100

800

SCSW6

8

stud˜100

800

SCSW7

4

stud˜60

800

SCSW8

4

stud+stiffener

800

SCSW9

4

stiffener

800

2.2 Material Properties The concrete used in the walls had a strength grade of C55 (the nominal cubic compressive strength, fcu,d=55MPa).Six test cubes and three prism blocks were conducted when pouring concrete and their size was 150mm × 150mm × 300mm and 150mm × 150mm × 300mm respectively. In order to get the same strength as the specimen, all the blocks and specimens were maintained under the same condition. According to Chinese standard for test method of mechanical properties on ordinary concrete (GB/T50081-2002) [9], the cube compressive strength test and the prism compressive strength test were made to get the cube compressive strength and the prism compressive strength respectively. The Young’s modulus of concrete was calculated according to the stress-strain relationship of prism blocks. Fig.3 shows the test equipment for concrete compressive strength. The test results are summarized in TABLE II.

392 | Xiao-Hu Li, Xiao-Jun Li, Xiao-Hui Wang and Fang-Fang Li

Fig. 3: Test equipment for concrete compressive strength Table2: (a) Cube test for concrete Specimen No.

Failure load(kN)

Compressive strength (MPa)

1

1014

45.07

2

1444

64.18

3

1317.5

58.56

4

992.84

44.13

5

1300

57.78

6

1317.7

58.56

Average

1231.01

54.71

Table2: (b) Prism Test for Concrete Specimen No.

Failure load (kN)

Compressive strength (MPa)

E(GPa)

1

1018.84

45

31.1

2

1017.75

45

33.4

3

1018.11

45

33.1

Average

1018.23

45

32.53

Finite Element Analysis Structure under In-Plane Loading | 393

Fig. 4: Test equipment for steel tensile strength

The steel plates used in SCSW were fabricated from Grad Q345 steel (fy=345MPa), D14 and D16 rebars were deformed steel bars, The strength grade of which in the shear wall of reinforced concrete was HRB400 (the nominal yield stress, fy=400MPa). The specimen of steel plate and rebars were made according to Chinese metallic materials-tensile testing at ambient temperature [10]. The measured yield and ultimate strength of steel bars, steel plate, and the stud are summarized in TABLE III. Table 3: Properties of steel plates and rebars Steel

Yield strength (MPa)

Ultimate strength (MPa)

E(MPa)

4mm Steel plate

352.12

497.37

1.87E+05

6mm Steel plate

348.33

494

1.97E+05

8mm Steel plate

356.33

496.67

2.08E+05

Stud D6

130.78

173.83

0.93E+05

Rebar D14mm

431.33

613

2.04E+05

Rebar D16mm

482

643.33

2.03E+05

394 | Xiao-Hu Li, Xiao-Jun Li, Xiao-Hui Wang and Fang-Fang Li ZHANG Youjia[11] and XIONG Feng[12] studied the seismic behavior of SCSW for nuclear power plant. However, the tests were forced to terminate due to the destruction of the foundation beams. The steel plate was pulled out of the foundation beam by the cyclic load and the concrete of foundation beam was broken. In order to prevent the cracking of the concrete and the pulling-out of the steel plate, this paper designed steel plate skin for foundation beam and strengthened the anchorage between the shear wall and foundation beam.

2.3 Loading Equipment and Loading System The experiment in this paper was conducted in Beijing Key Lab of Earthquake Engineering and Structural Retrofit. The foundation beam was fixed on the floor by anchor bolt. Vertical load and horizontal load were applied by hydraulic jack respectively. The vertical load should be increased to predetermined value 800 kN and remain the same before applying the horizontal load. The test used the method of load-displacement control for horizontal loading. The load should be increased step by step with 50 kN till the specimen to yield and then the method of displacement control was used. At the same time, the displacement of the top beam should be recorded as Δy and the displacement increased each time is 1/8 of Δy. Every level of the load should be cycled one time. The experiment was over when the horizontal load reduced to 85% of the ultimate load. The loading device of the test is shown in Fig.5.

Fig.5: Load system of tests

Finite Element Analysis Structure under In-Plane Loading | 395

2.4 Experimental Results The comparison of experimental phenomena between SCSW and reinforced concrete shear wall indicated that SCSW has better ductility and seismic performance than RC. All the specimens of SCSW have similar test process and damage phenomenon. The test process of SCSW under cyclic load can be divided into five phases: elastic stage, local deformation stage of the steel plate, yield stage, cracking stage of steel plate and failure stage. Comparing the nine pairs of SCSW specimens, it was found that the failure mode was different between specimen with stiffener and specimen with the stud. It could effectively delay the destruction and improve the ductility of the specimens. The failure modes of the specimens are shown in Fig.6. (a) Failure mode of specimen RC10

(b) Failure mode of specimen SCSW1~SCSW7

(c) Failure mode of specimen SCSW8 and SCSW9

Fig.6: Failure modes of specimens

396 | Xiao-Hu Li, Xiao-Jun Li, Xiao-Hui Wang and Fang-Fang Li

3 Using the Template This paper made a series of tests of SCSW. However, the data obtained from the tests of 9 specimens is not sufficient yet to develop provisions for such composite shear walls. The finite element models simulated by the finite element software ABAQUS were introduced in this paper. The linear hexahedral element (C3D8R) was used for steel, concrete, stud and stiffener. A simple process was made on the specimen and the deformation of the loading beam was ignored because of its good stiffness. The specimen was fixed on the floor by anchor bolt in the test, however, the foundation beam was fixed completely in simulation ignoring the influence of the deformation of foundation beam and the displacement of the wall. There were two analytic steps: The first step, the vertical load should be applied to the loading beam and remain the same. The second step, the method of displacement control was used to apply horizontal load and this could also achieve the same effect as applying cyclic loading. Fig.7 shows the boundary conditions and loading form of the shear wall.

 Fig. 7: Boundary conditions and loading form

In the finite element numerical simulation, damaged plasticity model was used for concrete. Realistic constitutive laws for materials and shear connection were adopted in all simulations. The compressive strength test value of concrete is 54.71MPa, Young’s modulus E=3.25×104MPa, Poisson’s ratio is 0.2, the constitutive relation curves of concrete was introduced according to the relevant norms of Chinese code for design of concrete structures (GB 50010-2010) [13].The classical-plastic model of metal was used for the constitutive model of steel plate and the ideal elas-

Finite Element Analysis Structure under In-Plane Loading | 397

tic model was used for rebars. The yield strength and ultimate strength are listed in Table 3 and the Poisson’s ratio of steel plate is 0.3. The bond-slip behavior between the steel plate and the concrete was simulated by setting contact element in ABAQUS. The hard contact was used to simulate the contact between the steel plate and the concrete on normal direction. It conforms to the mechanical properties that steel plate and concrete can separate but not embed to each other and the force which is perpendicular to the normal direction can be transferred completely. Coulomb friction model was used in the tangent direction and the friction coefficient of the contact surface was set as 0.6. The stud (stiffener) was embedded in steel plate and concrete to simulate the shear connection.

4 Parametric Study A parametric study was performed based on the finite element analysis to investigate the effect of seismic behavior on the composite shear wall behavior. There are some additional parameters being added comparing the test design in order to study the seismic behavior of SCSW more completely. Five parameters were considered in the finite element numerical simulation: three different thickness of the steel plate (4mm, 6mm and 8mm), four different concrete compressive strength (40MPa, 45MPa, 50MPa and 55MPa), five levels of the vertical load (0KN, 400KN, 800KN, 1000KN and 1200KN), four different stud space (60mm, 100mm, 150mm and 200nn), three types of structural form of shear connector (stud, stud stiffener and stiffener). Details of the parameters are described as follows.

4.1 The Thickness of the Steel Plate The design scheme of the finite element corresponds to test considering the parameter of the thickness of the steel plate: three types of thickness (4mm, 6mm and 8mm) corresponding to the test specimen SCSW1, SCSW4 and SCSW6. By comparing the skeleton curves of different steel plate thickness in Fig.8 (a), it can be found that the thicker the steel plate, the higher the stiffness and ultimate load of the specimens. Fig. 8(b) shows the changes of ultimate strength along with the thickness of steel plate: The ultimate strength increases by 36.38% when the thickness of steel plate changes from 4mm to 6mm and the steel ratio increases by 49.4%. The ultimate strength increases by 14% when the thickness of steel plate changes from 6mm to 8mm and the steel ratio increases by 32.8%. Therefore, the thickness of the steel plate has a great influence on the ultimate strength; however, with the increasing of the thickness of steel plate, the increasing of ultimate strength is decreased.

398 | Xiao-Hu Li, Xiao-Jun Li, Xiao-Hui Wang and Fang-Fang Li

Fig. 8: (a.) The skeleton curve of component of different plate thickness

Fig. 8: (b). Effect of plate thickness on ultimate load of specimens

4.2 Concrete Compressive Strength Fig. 9(a) shows that the lateral stiffness of the specimens changes little with the increasing of the strength of concrete. When the strength grade of the concrete is C40 and C45, the displacements of the loading beam are 37mm and 27mm respectively and the finite element analysis stops to calculate. As can be seen from the distribution of the stress of concrete, the concrete damaged in advance under the vertical load and horizontal load. When the strength grade of the concrete is C40 and C45, the displacements of the loading beam can be up to 60mm. Comparing with the specimens of C40 and C45, the damage of the concrete of specimen of C50 and C55 delay a lot than the former. Fig.9 (b) shows that the ultimate strength rises gradually with the increasing of the strength of concrete: The ultimate strength increases by 0.96% when the strength grade of concrete change from C40 to C45; The ultimate strength increases by 2.29% when the strength grade of concrete

Finite Element Analysis Structure under In-Plane Loading | 399

change from C45 to C50; The ultimate strength increases by 1.8% when the strength grade of concrete change from C50 to C55. The above results indicate that the concrete will be crushed earlier under the same vertical load and the ultimate strength will be decreased accordingly when the strength grade of concrete is lower than some strength grade.

Fig. 9: (a). The skeleton curve of component of different concrete strength

Fig. 9: (b). Effect of concrete strength on ultimate load of specimens

4.3 The Vertical Load The increase of the vertical load increases the depth of the compression zone and consequently decreases the ultimate capacity of the RC shear walls [14].The vertical load was thus one of the factors to consider for the design of structural walls. Fig.10 (a) shows that the lateral stiffness of the shear wall can be increased with the increasing of the vertical load to a certain extent, but the effect is not evident. Fig.10 (b)

400 | Xiao-Hu Li, Xiao-Jun Li, Xiao-Hui Wang and Fang-Fang Li indicates that the ultimate strength of shear wall increases with the increasing of the vertical load when the vertical load is less than 800kN, the specific changes just as follows: The ultimate strength increases by 0.4% when the vertical load changes from 0kN to 400kN; the ultimate strength also increases by 0.4% when the vertical load changes from 400kN to 800kN. The ultimate strength of shear wall decreases with the increasing of the vertical load when the vertical load is greater than 800kN, the specific changes just as follows: The ultimate strength decreases by 4.8% when the vertical load changes from 8000kN to 1000kN; the ultimate strength also increases by 0.7% when the vertical load changes from 1000kN to 1200kN. The above data indicates that the ultimate strength can be increased slightly with the increasing of the vertical load when the vertical load is less than 800kN. The ultimate strength can be significantly decreased with the increasing of the vertical load when the vertical load is greater than 800kN.

Fig. 10: (a). The skeleton curve of component of different vertical load

Fig. 10: (b). Effect of vertical load on ultimate load of specimens

Finite Element Analysis Structure under In-Plane Loading | 401

4.4 Stud Space Fig.11 (a) shows that the skeleton curves with different stud spacing overlap, and the stiffness and ultimate load have little change. It can be seen from Fig.11 (b) that the ultimate load has a modest increase with the decreasing of the stud spacing. The ultimate load increase by 0.11% when the stud spacing reduces from 200mm to 150mm. The ultimate load increase by 0.25% when the stud spacing reduces from 150mm to 100mm. The ultimate load increase by 0.86% when the stud spacing reduces from 100mm to 60mm. Therefore, the stud spacing has a small effect on the ultimate load of the specimens when it is more than 60mm.

Fig. 11: (a). The skeleton curve of component of different stud space

Fig. 11: (b). Effect of stud space on ultimate load of specimens

402 | Xiao-Hu Li, Xiao-Jun Li, Xiao-Hui Wang and Fang-Fang Li

4.5 Structural Form of Shear Connector The specimens of SCSW8 (stud + stiffener) and SCSW9 (stiffener) with reference to the specimen of SCSW1 in the design of this test, the structural form of the shear connector is shown in Fig.12. Fig.13 (a) shows that the specimens with different form of shear connector have the same lateral stiffness at the beginning of loading, however, the stiffness of the specimen with stiffener is improved to a great extent after the inelastic phase. From the data in Fig.13 (b) the results can be found that the ultimate strength of SCSW8 increases by 22.5% than SCSW1 and the ultimate strength of SCSW9 increases by 19.51% than SCSW8. Comparing the influence of stiffener and the thickness of steel plate on the ultimate strength of the shear wall, it can be found that the stiffener is more effective than the thickness of steel plate with the same increasing of steel content.

Fig. 12: Different structural forms of shear connector

Fig. 13: (a). The skeleton curve of component of different shear connector

Finite Element Analysis Structure under In-Plane Loading | 403

Fig. 13: (b). Effect of shear connector on ultimate load of specimens

5 Comparison between Fe Model and Experimental Walls Fig.14 shows the skeleton curves of finite element calculation and the test results of specimens. Single direction loading was used for horizontal loading of finite element simulation, and the skeleton curves in the negative direction were obtained by anti-symmetry. The skeleton curves of finite element simulation are different from the test results due to ignoring the damage of the specimen under the cyclic loading. When the finite element model was conducted the initial defects of the specimen was not being considered, this leadss to that the lateral stiffness of the specimens of FEM was greater than that of test results. The anchor fixation of foundation beam is not so strong comparing to the boundary of the finite element model; therefore the test results of the top displacement of the specimen are bigger than that of finite element model. From the comparison between finite element calculation and the test results, it can be seen that the ultimate strength of finite element calculation and the test results are in good agreement. However, the difference of the skeleton curves between them is evident after the strength of specimens reached to the ultimate strength. The causes of this problem should be further studied.

404 | Xiao-Hu Li, Xiao-Jun Li, Xiao-Hui Wang and Fang-Fang Li (a) The skeleton curve of SCSW1

(c) The skeleton curve of SCSW3

(e) The skeleton curve of SCSW5

(b) The skeleton curve of SCSW2

(d) The skeleton curve of SCSW4

(f) The skeleton curve of SCSW6

Finite Element Analysis Structure under In-Plane Loading | 405 (g)The skeleton curve of SCSW7

(h) The skeleton curve of SCSW8

(i) The skeleton curve of SCSW9

Fig. 14: Comparison of skeleton curves between the FEM and experimental results

TABLE IV shows the comparison of the results between finite element model and the test results. It can be seen from the table that the deviation between them is within 10%, so it is observed that the finite element calculation gives a very good approximation of test results.

406 | Xiao-Hu Li, Xiao-Jun Li, Xiao-Hui Wang and Fang-Fang Li Table 4: the test value and finite element value of ultimate load Specimen No.

Test value(kN)

Finite element value(kN)

Deviation (%)

SCSW1

610

619.72

1.59

SCSW2

598.61

618.2

3.27

SCSW3

596.95

617.5

3.44

SCSW4

804.4

845.16

5.07

SCSW5

728.7

771.08

5.95

SCSW6

958.4

963.5

0.53

SCSW7

612.4

625.04

2.06

SCSW8

744.3

759.14

1.99

SCSW9

906.8

907.26

0.05

6 Conclusions In this paper, the finite element models of SCSW were conducted through ABAQUS finite element software. The seismic performance of SCSW was studied according to comparing the results of finite element model and the test, the conclusions as follows: The test procedure of SCSW under cyclic load can be divided into five phases: elastic stage, local deformation stage of the steel plate, yield stage, cracking stage of steel plate and failure stage. SCSW has better ductility and seismic behaviour than RC. The finite element models of SCSW are conducted in this paper based on the tests. The effect of parameters such as stud space, the thickness of steel plates, concrete strength, vertical load and shear connector on the seismic behaviour of SCSW is analysed. The results indicate that the thickness of steel plate, shear connector, and vertical load have the greatest influence on the lateral stiffness and ultimate strength of SCSW, the concrete has some influence on the lateral stiffness and ultimate strength of SCSW, and the influence of the stud space is minimal. The results of comparison between finite element calculation and the test result indicate that the lateral stiffness of finite element calculation is generally greater than that of the test result. The skeleton curves of finite element calculation have no obvious decline phase so it has no significance to analysis the seismic performance of SCSW after ultimate strength. Therefore, the skeleton curves of decline phase. The ultimate strength of finite element calculation has a good agreement with the test results. This paper illustrated the benefit of SCSW by a series of tests and finite element models. However, the data obtained so far is not sufficient to develop the design

Finite Element Analysis Structure under In-Plane Loading | 407

provisions for SCSW. More research should be performed to the development of such composite shear walls in the future. Acknowledgement: The presented work in this paper was supported by The National Natural Science Foundation of China (51421005), the Plan to Enhance the Construction of Innovation Team of Beijing Municipal Colleges and Universities (IDHT20130507) and National Science and Technology Major Project (2013ZX06002001).

References [1] [2] [3]

[4]

[5] [6]

[7] [8] [9] [10] [11]

[12]

[13] [14]

Fukumoto, H., Kobayashi, M., et al., 1987. Concrete filled bearing walls. IABSE, vol. 5, pp. 467472. Kaneuji, A., Hara, K., et al., 1989. Feasibility study of filled steel (SC), structure for reactor building, Tenth SMiRT Conference, pp.67-72. Kobayasi, M., Sakamoto, M., et al., 1985. Experimental study of concrete filled steel bearing walls (Part 2 compression test), Proceedings Annual meeting of Arch. Inst. Japan, pp. 13251326. Akiyama, H., Sekimoto, H., Tanaka, et al., 1989. 1/10th scale model test of inner concrete structure composed of concrete filled steel bearing wall. Tenth SMiRT Conference H73, PP. 7378. M. Takeuchi, M. Narikawa, I. Matsuo, et al., 1998. Study on a concrete filled structure for nuclear power plants. Nuclear Engineering and Design, 179, 209-223. Braverman, J., Morante, R., Hofmayer, C.1997. Assessment of Modular construction for safetyrelated structures at advanced nuclear power plants. U.S. Nuclear Regulatory Commission, Washington, DC, USA. Kadir C. Sener, Amit H. Varma. 2014. Steel-plate composite walls: Experimental database and design for out-of-plane shear. Journal of Constructional Steel Research, 100, 197-210. KEPIC-SNG.2010.Specification for Safety-Related steel Plate Concrete Structures for Nuclear Facilities. Board of KEPIC Policy, Structural Committee, Korea Electric Association. Chinese standard for test method of mechanical properties on ordinary concrete (GB/T500812002) Chinese metallic materials-tensile testing at ambient temperature GB/T228-2002 ZHANG Youjia, LI Xiaojun. Experimental research on seismic behavior of wall component with double steel plate and infill concrete [J]. Engineering Journal of Wuhan University. 2015 48(5), 658-665. XIONG Feng, HE Tao, ZHOU Ning. Study on the shear strength of double steel plate composite shear wall in nuclear plant [J]. Journal of Hunan University (Natural Sciences). 2015.42(9), 3341 Chinese code for design of concrete structures (GB 50010-2010) Paulay Thomas, Priestly M.J.N. Seismic Design of Reinforced Concrete and Masonry Buildings. New York: Wiley- Interscience Publication; 1992.

Yu Zhou1, Miao-Sen Lou1, Yi-Qing Zhang1 and He-Guo Zhu2*

Exothermal Combustion Synthesis of the Composites TiB2/Ni from Ni–Ti–B System Abstract: Ni matrix composites reinforced with TiB2 was fabricated by exothermal combustion synthesis from Ni–Ti–B system. The reaction process and microstructure were analyzed by using differential scanning calorimetry (DSC), X-ray diffraction (XRD), scanning electron microscopy (SEM).The results showed that the corresponding temperature of the characteristic peak was approximately 560°C. As the heating rate increased, the peak temperature accordingly rose. And the reaction active energy of the system was calculated to 43 kJ/mol. TiB2 distributed relatively uniformly in the Ni matrix. Keywords: Exothermal combustion synthesis, Ni matrix composites, Particle reinforcement, Differential scanning calorimetry (DSC)

1 Introduction Titanium diboride (TiB2) with a high melting point, high hardness value, superior mechanical properties at high temperature and good abrasive resistance is generally used as a reinforcement phase of the composites [1-7]. When it is used as a reinforcement phase in the Ni matrix composites, the composites will obtain many excellent properties such as high temperature mechanical properties, high antioxidation properties, dimensional stability and greater wear resistance. They have been used in many advanced applications [8]. There are some reaction systems such as Ni-Ti-B-C [2], Ni–Al–Ti–BN [3], Ni–Ti–B4C–BN [9] and Zr-Ti-Ni-Al-B [10], etc. In this paper, the TiB2/Ni composites were fabricated from a Ni–Ti–B system through exothermal combustion reaction synthesis. Furthermore, thermodynamic and dynamic analysis of the reaction and reaction mechanisms of the composites were studied.

|| 1 College of Materials Science and Engineering, Nanjing University of Science and Technology. Nanjing, P. R. China 2 College of Materials Science and Engineering, Nanjing University of Science and Technology, Nanjing, P. R. China, *Corresponding author: He-Guo ZHU, E-mail: [email protected] 10.1515/9783110516623-039 DOI 10.1515/9783110303568-039

410 | Yu Zhou, Miao-Sen Lou, Yi-Qing Zhangand He-Guo Zhu

2 Experiments Procedures The raw materials used for this work were Ni powder (99.8% purity), B powder (99.0% purity) and Ti powder (99.0% purity) with average sizes of ~10µm, 20~30µm and ~50µm, respectively. According to the following reaction equation: Ti+2B→TiB2, the three powders were stoichiometric calculated according to the volume fraction of 20% determined by generally empirical method of TiB2, and then were ball-milled in a stainless steel vacuum jar for 4h. Then, the well mixed powder was cold pressed into green compacts with a diameter of 20 mm by a pressure of 100 MPa. The compacts were heated in a vacuum furnace to a certain temperature to allow the exothermic combustion reactions to occur, then held for about 5~10 min and subsequently cooled down to room temperature in the furnace. The samples made from the reacted compacts were mechanically polished and then were investigated by using methods of XRD and SEM. To obtain DSC curves, some of the mixed powder was cold pressed into a slice with the thickness of about 0.5mm by a pressure of 120 MPa. A tiny block with the weight of 5~10mg cut from the slice was put into STA449C thermal analyzer to test the DSC curves at heating rates of 15°C/min, 20°C/min, 25°C/min and 30°C/min, respectively.

3 Results and Discussion 3.1 Thermodynamic Analysis. Table 1: Possible reactions in Ni-Ti-B system No.

Reaction formula

1

Ti + Ni →NiTi

2

Ti + B → TiB

3

Ni + B→ NiB

4

Ti + 2B → TiB2

ᇞG

ᇞG1=-66900+11.7T ᇞG2=-163200+5.9T

ᇞG3=-175700+8.37T

ᇞG4=-284500+20.5T

Exothermal Combustion Synthesis System | 411

Fig. 1: Plots of Gibbs free energy of formation of the possible reactions varied with temperature.

In the Ni-Ti-B system, four possible reactions are shown in Table.1 and the corresponding plots of Gibbs free energy are shown in Fig.1. From table 1 and Fig. 1, there are four possible reactions in the Ni-Ti-B system. For the negative values of corresponding Gibbs free energy, every possible reaction can take place spontaneously in ambient temperature. The standard Gibbs free energy of TiB 2, calculated by using the thermodynamic data [11, 12] in table 1, is the lowest among the other ones. Additionally, the value of the free energy varied smoothly as temperature rises. Therefore, Ti and B would firstly react to produce TiB2 in the system. Then the NiTi was produced after production of TiB. Although the analysis of the reaction possibility was just based on thermodynamic conditions, there were still dynamic conditions needed to be met.

412 | Yu Zhou, Miao-Sen Lou, Yi-Qing Zhangand He-Guo Zhu

Fig. 2: DSC curves of the Ni–Ti–B system with the reinforcement volume fraction of 20% with four different heating rates

Fig.2 shows DSC curves of the Ni–Ti–B system with four heating rates of 15°C/min, 20°C/min, 25°C/min and 30°C/min, respectively. It can be observed that only a strong characteristic peak appeared in the temperature of 554°C, 559°C, 561°C and 565°C, therefore, only one reaction that TiB2 was produced through the exothermal combustion reaction between Ti and B occurred. Additionally, Fig. 2 shows the ignition temperature is 477°C, 478°C, 479°C and 480°C. Only when the heating rate and preheating condition was achieved, through exothermal combustion method, could the required activation energy for the reaction be met to guarantee the reaction went on wheels. Hence, there is a certain relationship between reaction process and heating rate. As the heating rate increased from 15°C/min to 30°C/min, the characteristic peak temperature shifted to higher temperature, which revealed that more heat gave off in reaction process. In the same time, the rise of heating rate would accelerate the growing rate of energy, and nickel matrix absorbed equal energy. This resulted in the decrease of the heat absorbed by nickel, compared to low heating rate. Moreover, from Fig.2, the ignition temperature rose as heating rate increased. Because of the temperature difference between center and outside of the sample, the surface of the sample reached its reaction temperature, but the center didn’t. There-

Exothermal Combustion Synthesis System | 413

fore, the required energy would be achieved in higher temperature and then the reaction could be generated simultaneously.

3.2 B. Dynamic Analysis

Fig. 3: Kissinger plot of Ni-Ti-B system.

According to the peak temperature on different heating rates, the relation of ஒ ሺ మ ሻ~1/Tm of the reaction between was plotted in Fig.3 by using a straight line and ୘ౣ setting its slope equal to –E/R. The activation energy of the reaction is 43kJ/mol when the volume fraction of the reinforcement is 20%, calculated through Kissinger formula [13, 14]:

§ E · d ¨¨ ln 2 ¸¸ © Tm ¹ § 1 · d ¨¨ ¸¸ © Tm ¹



E R

(1)

In Eq.1, Tm is the corresponding temperature of the exothermic peak, β is the heating rate, and R is air constant whose value is 8.314J/mol.

3.3 C. Microstructure. Fig.4 shows the SEM photograph and XRD diffraction pattern of the reaction results produced by exothermal combustion synthesis. From Fig.4 (a), 20% volume fractions of reinforcement phase, the composite consists of the black flocculent TiB2 and

414 | Yu Zhou, Miao-Sen Lou, Yi-Qing Zhangand He-Guo Zhu TiB2 particle according to corresponding XRD photograph (b) and relatively bright Ni matrix phase. It can be concluded that TiB2 phase distributed dispersedly in the Ni matrix. Based on the up front analysis, it can be inferred the reaction in the Ni– Ti–B system can be expressed as: Ti + 2B → TiB2.

Fig. 4: SEM photograph (a) of the composites with reinforcement volume fraction of 20%, obtained by exothermal combustion synthesis and its XRD diffraction pattern (b)

4 Conclusions Based on above analysis and discussion, the following conclusions can be drawn: The lowest Gibbs free energy of the reaction of TiB2 among the four possible reactions, singular characteristic peak observed in all the DSC curves and combination of the SEM photograph and XRD diffraction pattern reveal that there is only one reaction that Ti and B was synthesized to produce TiB2. The reaction activation energy is 43kJ/mol with 20vol% reinforcement calculated through Kissinger formula. As the heating rate increases from 15°C/min to 30°C/min and the heating temperature rises, the characteristic peak shifted to higher temperature. Acknowledgement: This work was supported by a grant from the National Undergraduate Scientific Research Training Program of Nanjing University of Science & Technology (No.201510288075), National Natural Science Foundation of China (No. 51371098, 51571118) and Natural Science Foundation of Jiangsu Province (No. BK20141308).

Exothermal Combustion Synthesis System | 415

References [1]

[2]

[3]

[4]

[5]

[6]

[7]

[8] [9]

[10] [11] [12] [13]

[14] [15]

Y.F.Yang and Q.C.Jiang. Reaction behavior, microstructure and mechanical properties of TiC– TiB2/Ni composite fabricated by pressure assisted self-propagating high-temperature synthesis in air and vacuum. Materials and Design. 49 (2013)123-129. Y.F.Yang, D.K.Mu and Q.C. Jiang. A simple route to fabricate TiCeTiB2/Ni composite via thermal explosion reaction assisted with external pressure in air. Materials Chemistry and Physics: 143(2014) 480-485. A.A. Shokat, N. Parvin, and M. Shokati. Combustion synthesis of NiAl matrix composite powder reinforced by TiB2 and TiN particulates from Ni–Al–Ti–BN reaction system. Journal of Alloys and Compounds. 585(2014) 637–643. S.P.Chen, Q.S.Meng,N. Zhang, et al. Graded Materials of (TiB2)pNi with Nickel Substrate Prepared by Field-Activated Pressure-Assisted Synthesis Process, Journal of Wuhan University of Technology-Mater. (2010)39-43. M. Narimani, B. Lotfi and Z. Sadeghian. Investigating the microstructure and mechanical properties of Al-TiB2 composite fabricated by Friction Stir Processing (FSP). Materials Science and Engineering: A. 673 (2016) 436-442. G.S. Pradeep Kumara, R. Keshavamurthyb, P. Kumaria, C. Dubeya. Corrosion behaviour of TiB2 reinforced aluminium based in situ metal matrix composite. Perspectives in Science. (2016). Y. W. Shen, X. F. Li, T. R. Hong, J. W. Geng, H. W. Wang. Effects of TiB2 particles on microstructure and mechanical properties of an in-situ TiB2-Al–Cu–Li matrix composite. Materials Science and Engineering: A. 655(2016) 265–268. W. J.Song and H. Zhong.Preparation and the New Development of TiB2.Rare Metals and Cemented Carbides. 33(2005)47-52. Y. W. Wang, F. Qiu, S. L. Shu, J. B. Lu and Q. C Jiang. Effect of Ni content on the compression properties and abrasive wear behavior of the (TiB2–TiCxNy)/Ni composites. Int. Journal of Refractory Metals and Hard Materials. 34 (2012) 8-12. H. E. Çamurlua, F Maglia. Self-propagating high-temperature synthesis of ZrB2 or TiB2 reinforced Ni–Al composite powder. Journal of Alloys and Compounds. 478 (2009) 721–725. Z.C Chen, T.Takeda, K. Ikeda,Compos. Sci. Technol. 68(2008)2245-2253. Q. Dong, Q. Tang, W.C. Li, D.Y.Wu,Mater. Lett. 55 (2002)259-264. L.C. Zhang, J. Xu and J. Eckert. Thermal stability and crystallization kinetics of mechanically alloyed TiC/Ti-based metallic glass matrix composite. Journal of Applied Physics. 100(2006) 033514. C. F. Feng and L. Froyen. In-situ P/M Al/(ZrB2+Al2O3) MMCs: Processing microstructure characterization. Acta Materilia. 47(1999) 4571-4583.

Zhi-Yuan Wu1, Shu-Hui Wang2, Xin-Li Tian3, Xiu-Jian Tang4 and JunWei Yang5

Research on Wetting Characteristics of Normal Acid, Alcohol and Alkane on Surface of Monocrystal Silicon Abstract: In this paper, the wetting rules of normal organic acid, organic alcohol and organic alkane on surfaces of monocrystal silicon were studied in three different crystal orientations. Experiment result shows that when normal alkane is adopted for wetting, with the increasing of the carbon number of alkane, the wetting angle has a trend of monotonous reducing, and it is proved that simple increasing of carbon number is beneficial to the wetting effect; a great difference exists between the wetting of organic acid and organic alkane on the surface of monocrystal silicon and the wetting of alkane, with the increasing of the carbon number, the wetting angle has a the trend of reducing firstly and then increasing, and the carbon number at inflection points is about 7-8; from mechanism analysis, it can be seen that monocrystal silicon with high interface energy is easy to obtain good wetting effect. Keywords: monocrystal silicon, crystal orientation, wetting; interface energy, organic matter

1 Introduction Wettability is one of the important characteristics of solid surface, and has important effect in industrial and agricultural production and daily life of people [1-2]. Such as oil exploitation, pesticide spraying, fabric water resistance and washing [3]. Surface wettability mainly depends on solid surface roughness and surface free energy, and the capacity often depends on the contact angle between liquid drop

|| 1 National Key Laboratory for Equipment Remanufacturing, Academy of Armored Force Engineering, Beijing, 100072, China, E-mail: [email protected] 2 Department of Scientific Research, Academy of Armored Force Engineering, Beijing, 100072, China, e-mail:[email protected] 3 National Key Laboratory for Equipment Remanufacturing, Academy of Armored Force Engineering, Beijing, 100072, China, e-mail:[email protected] 4 National Key Laboratory for Equipment Remanufacturing, Academy of Armored Force Engineering, Beijing, 100072, China, e-mail:[email protected] 5 National Key Laboratory for Equipment Remanufacturing, Academy of Armored Force Engineering, Beijing, 100072, China 10.1515/9783110516623-040 DOI 10.1515/9783110303568-040

418 | Zhi-Yuan Wu, Shu-Hui Wang, Xin-Li Tian, Xiu-Jian Tang and Jun-Wei Yang and solid surface [4-6]. In this paper, different normal matters are adopted to perform wetting experiments on the surfaces of three forms of monocrystal silicon, the influence on wetting results by solid surface property and molecular structure features of organic matters is inspected, and the rule of the internal effect of production of wetting phenomenon is explored.

2 Selection of Experimental Subject 2.1 Selection of Organic Matters. Organic matters comprise various types, the known organic compounds are close to 80 million, and performing experiments on all organic matters is unpractical, so that typical organic matters are selected to be experimented. In order to avoid the influence on experiments by isomerism, reagents selected adopt linear chain structures. Functional group is only one and arranged at one end. The selection method can greatly reduce the organic matter experiment range and qualitatively research the influence on wetting property by organic structures. Alkane, alcohol and acid selected according to the principle are as shown in Table 1, Table 2 and Table 3: Table 1: List of experimental alkane organic matters organic matter

molecular formula

Molecular weight

Carbon number

n-nonane

CH3(CH2)7CH3

128

9

n decane

CH3(CH2)8CH3

142

10

n-undecane

CH3(CH2)9CH3

156

11

n dodecane

CH3(CH2)10CH3

170

12

n-tridecane

CH3(CH2)11CH3

184

13

n-tetradecane

CH3(CH2)12CH3

198

14

n-pentadecane

CH3(CH2)13CH3

212

15

Research on Wetting Characteristics Monocrystal Silicon | 419 Table 2: List of experimental alcohol organic matters organic matter

molecular formula

molecular weight

carbon number

n-propanol

CH3CH2CH2OH

60

3

n-Butyl alcohol

CH3(CH2)2CH2OH

74

4

n-pentyl alcohol

CH3(CH2)3CH2OH

88

5

n-Hexanol

CH3(CH2)4CH2OH

102

6

n-heptylalcohol

CH3(CH2)5CH2OH

116

7

n-octyl alcohol

CH3(CH2)6CH2OH

130

8

n-Nonanol

CH3(CH2)7CH2OH

144

9

n-Decanol

CH3(CH2)8CH2OH

158

10

Table 3:List of experimental acid organic matters organic matter

molecular formula

molecular weight

carbon number

n-butanoic acid

CH3(CH2)2COOH

88

4 5

n-valeric acid

CH3(CH2)2COOH

102

n-hexylic acid

CH3(CH2)2COOH

116

6

n-heptanoic acid

CH3(CH2)2COOH

130

7

n-octylic acid

CH3(CH2)2COOH

144

8

n-pelargonic acid

CH3(CH2)2COOH

158

9

2.2 Selection of Monocrystal Silicon. Monocrystal silicon is a monocrystal of silicon, a crystal with a basically complete lattice structure, and has different properties in different directions, and is a good semi-conducting material. In order to comprehensively display the influence on the wetting process by the difference of surface structures of monocrystal silicon, monocrystal silicon in 100, 110 and 111 crystal orientations are adopted in this paper to be experimented.

420 | Zhi-Yuan Wu, Shu-Hui Wang, Xin-Li Tian, Xiu-Jian Tang and Jun-Wei Yang

3 Wetting Experiments and Analysis 3.1 Research on Wetting Rule of Normal Alkane on Surfaces of Three Types of Monocrystal Silicon. Alkane namely saturated hydrocarbon is chain hydrocarbon only has carboncarbon single bond and one of the simplest organic compounds. In this paper, normal alkane is selected to perform wetting experiments, and the influence on the wetting property by the increasing of carbon number in the same structure condition is inspected. Experiment results are as shown in Fig. 1: Fig.1 is the wetting effect of nonane to hexadecane on the surfaces of three types of monocrystal silicon. It can be easily seen that with the increasing of carbon number, the wetting angles of alkane on the surfaces of three types of monocrystal silicon have a trend of monotonous reducing. As the alkane is single in structure, and other influence factors do not exist, so that the experiment results can indicate that the increasing of carbon number is beneficial to the improvement of wetting effect. In addition, the monocrystal silicon in the 111 crystal orientation is the optimum in wetting effect, then monocrystal silicon in the 110 crystal orientation, and monocrystal silicon in the 110 crystal orientation is poorest in wetting effect.

Fig. 1: Curves of wetting characteristics of alkane on surfaces of three types of monocrystal silicon

3.2 Research on Wetting Rule of Normal Alcohol on Surfaces of Three Types of Monocrystal Silicon. Alcohol is a main class in organic compounds, is a compound formed by substituting hydrogen atom in aliphatic hydrocarbon, alicyclic hydrocarbon or aromatic

Research on Wetting Characteristics Monocrystal Silicon | 421

hydrocarbon side chains by hydroxyl. As alcohol in long carbon chain is solid in normal condition, in this paper, normal alcohol with the carbon number being 3-10 is selected to perform wetting experiments, and experiment results are as shown in Fig. 2:

Fig. 2: Wetting characteristic curves of alcohol on surfaces of three types of monocrystal silicon

From Fig.2 it can be seen that similar to alkane experiment, in the condition of the same carbon number the wetting effect of monocrystal silicon in crystal orientation 111, crystal orientation 110 and crystal orientation 100 is reduced. But the difference is that with the increasing of carbon number the wetting angles of the surfaces of the three types of monocrystal silicon is not monotonously reduced, but have a trend of reducing firstly and then increasing, and it indicates that the adding of hydroxyl in alcohol ensures that wetting mechanism is obviously changed.

3.3 Research on Wetting Rule of Normal Acid on Surfaces of Three Types of Monocrystal Silicon Alcohol is compound containing carboxyl in molecular structure. In this section, normal organic acid with the carbon number being 4-9 is selected to perform wetting experiments, and experiment results are as shown in Fig. 3:

422 | Zhi-Yuan Wu, Shu-Hui Wang, Xin-Li Tian, Xiu-Jian Tang and Jun-Wei Yang

Fig. 3: Curves of wetting characteristics of acid on surfaces of three types of monocrystal silicon

From Fig. 3 it can be seen that the wetting effect of organic acid on the surfaces of monocrystal silicon is similar to that of organic alcohol, and wetting angles have a rule of reducing firstly and then increasing with the increasing of carbon number. It should be noted that for similar carboxyl and adding of carboxyl, the numbers of inflection points of organic acid and organic alcohol realizing transforming of monotonous reducing to monotonous increasing are respectively 7 and 8, which are also very similar, it indicates that the influence on wetting effect by the adding of polar functional groups are similar.

4 Analysis on Wetting Results of Organic Matters on Surfaces of Monocrystal Silicon in Different Crystal Orientations Common used silicon monocrystal comprises three crystal orientations 100, 110 and 111 according to different dislocation degrees, and electrical characteristics of the three crystal orientations have huge difference. For wetting relevant parameters, monocrystal silicon in crystal orientation 111 is the lowest in monocrystal silicon interface energy, the monocrystal silicon in crystal orientation 110 is higher in monocrystal silicon interface energy, and monocrystal silicon in crystal orientation 100 is the highest in monocrystal silicon interface energy. The sequence is just the same with the wetting effect of organic reagents on the surfaces of three types of monocrystal silicon, namely surface with high surface energy is more beneficial to obtaining the optimum wetting effect on the surfaces of organic matters.

Research on Wetting Characteristics Monocrystal Silicon | 423

5 Summary The increasing of carbon chain is beneficial to the improvement of wetting effect, and with the increasing of carbon number; the wetting effect of organic matters shall be improved. The influence on wetting by functional group is greater than that on wetting effect of the increasing of carbon number, and the wetting effect has a trend of increasing firstly and then reducing. When organic acid and organic alcohol obtain the optimum wetting effect, the carbon numbers of organic acid and organic alcohol are 7 and 8 respectively. Monocrystal silicon with high interface energy is easy to obtain better wetting effect. Acknowledgement: The research supported by National Natural Science Foundation of China (Project number: 51275527).

References [1] [2]

[3]

[4]

[5] [6]

Hassan Pouraria, Jung Kwan Seo, Jeom Kee Paik. A numerical study on water wetting associated with the internal corrosion of oil pipelines. Ocean Engineering. 122( 2016)105-117 J.A. Prince, S. Bhuvana, V. Anbharasi, et al. Ultra-wetting graphene-based PES ultrafiltration membrane – A novel approach for successful oil-water separation. Water Research. 103 (2016) 311-318 E. György, A. Perez del Pino, A. Datcu,et al. Titanium oxide – reduced graphene oxide – silver composite layers synthesized by laser technique: Wetting and electrical properties. Ceramics International. 42(2016) 16191-16197 E. Guillen-Burrieza, M.O. Mavukkandy, M.R. Bilad, et al. Understanding wetting phenomena in membrane distillation and how operational parameters can affect it.Journal of Membrane Science. 515(2016)163-174 S. Aouini, S. Ziti, H. Labrim, L., et al. Bahmad.Wetting and layering transitions in a nanoshell structure: Monte Carlo study.Solid State Communications.241( 2016)14-19 Kaustubh Shrimali, Jiaqi Jin, et al. Behzad Vaziri Hassas.The surface state of hematite and its wetting characteristics. Journal of Colloid and Interface Science. 477(2016)16-24

Ying Xu1, Zi-Zi Zhang2, Chen-Guang Hu3 and Bian Wang4

Effect of Modified Argon Oxygen Decarburization (AOD) Stainless Steel Slag on Cementitious Properties Abstract: The stainless steel slag of argon oxygen decarburization (AOD) is a kind of alkaline waste with cementitious activity phase, which can change the β - C2S to γ C2S phase in the process of natural cooling and reduce the cementitious activity of the steel slag. What’s worse, the large difference of the density of the two crystal phases will lead the AOD slag to pulverize. In the present study, the effect of several modifiers, such as B2O3, P2O5 and CuO, which try to prevent the crystal transition of β - C2S and reduce the cementitious activity of AOD slag was studied. The result showed that the curing effect of stainless steel slag became much better with the increase of B2O3 and P2O5 contents, and the compressive strength appeared to have a decline trend after an initial ascent. In general, the activity index of the modified stainless steel slag was higher than before, while the compressive strength and activity index had no obvious changes with the increase content of CuO. Keywords: AOD stainless steel slag, cementitious activity, modifier, compressive strength, activity index.

1 Introduction The stainless steel slag of argon oxygen decarburization (AOD) is a by-product in the process of smelting stainless steel by AOD refining process. It mainly used for internal recycling of the steel industry, cement production and manufacturing ceramic, etc [1]. However, there is lower comprehensive utilization rate of AOD slag in China. As we all know, with the increased of stainless steel production year by year, the output of stainless steel slag also grows continually. However, too much stainless steel slag is not beneficial to human life, which not only occupies a lot of land, caus-

|| 1 North China University of Science and Technology College of Material Science and Engineering, Tangshan, China, E-mail:[email protected] 2 North China University of Science and Technology College of Material Science and Engineering, Tangshan, China, E-mail:[email protected] 3 North China University of Science and Technology College of Material Science and Engineering, Tangshan, China, E-mail:[email protected] 4 North China University of Science and Technology College of Material Science and Engineering, Tangshan, China, E-mail:[email protected] 10.1515/9783110516623-041 DOI 10.1515/9783110303568-041

426 | Ying Xu, Zi-Zi Zhang, Chen-Guang Hu and Bian Wang ing environmental pollution, but also causes the waste of non-renewable resources. Therefore, it needs to improve the utilization rate of the stainless steel slag and realize the resource utilization of the slag urgently [2]. The AOD stainless steel slag is also a kind of materials with a certain cementitious activity, in which the total content of CaO, SiO2, Al2O3, Fe2O3 can reach more than 85%, and these are also the main components of the cement. Therefore, it can be used to replace part of the raw material to calcined cement clinker. However, the crystal form of C2S will change from β phase to γ phase when AOD stainless steel slag is cooling in the air, and the density of the main crystal phase will change from 3.28 g / cm3 into 2.97 g / cm3 in the progressing of crystal transition then the volume of stainless steel slag will increase by 12% [3]. Therefore, the volume expansion of stainless steel slag may lead to pulverize in the process of conventional cooling. Moreover, γ-C2S did not have cementitious activity, and more γ-C2S may decrease the cementitious activity of AOD slag [4], which makes the slag cannot be used as building materials like cement directly. In order to make the stainless steel slag can be realized large-scale popularization and application in the cement[5] concrete, in this study, using modifiers like B2O3, P2O5 and CuO to inhibite the slag disintegration and dust flying, and to improve the curing rate of stainless steel slag as well as the activity index was investigated. Additionally, the compressive strength and the change characteristics of stability were also investigated to realize the performance optimization of stainless steel slag after modification.

2 Experiment 2.1 Experimental Materials The AOD stainless steel slag is obtained from a stainless steel factory. The cement is portland cement P I 52.5, and the mainly modifiers are B2O3, P2O5 and CuO. Besides, high-purity nitrogen is used as protective atmosphere, and all the reagents used in the prevent study are analytically pure. The X-ray diffraction (XRD) of AOD stainless steel slag is shown in Figure 1, and from Figure 1 we can see that the mainly minerals in AOD slag are γ-C2S, C3A, spinel (MgAl2O4) and olivine (Mg2SiO4). And there is higher γ-C2S content in AOD slag, which may leads the AOD slag to pulverize in the process of conventional cooling. The XRD spectrum of cement is shown in Figure 2, and the mainly minerals in cement are C3A, CA, β-C2S, C3S, calcium complex iron (Ca5Si2 (FeAl) 18O36) and skarn (Ca54MgAl2Si16O90).

Effect of Modified Argon Oxygen Cementitious Properties | 427

800

ƾ  ¤  C 2S   ƻ   C a 3A l2O 6

700 Intensity/cps

600

ƽ   M gA l 2 O 

ƹ   M g 2 SiO

500

4

ƾ

400 300

ƽ ƻ

200 100

ƾ

ƹ ƾ ƾƹ

ƽ ƻ

ƾƾ ƻ ƾ

ƾ ƻƾ

ƾ ƾ ƹ

ƾ

0 10

20

30

40

 © ˄ e

ƾƾ

ƾ ƾ

50

ƽƻ

ƹ

60

70

80

Fig. 1: XRD spectrum of AOD stainless steel slag

8000

Intensity/cps

7000 6000

Ʒ C3S

ƺ Ca54MgAl2Si16O90

ƽ Ʒ

4000 3000

Ʒ ƺ

2000 0 10

ƽ C2S

ͩ CA

ƻ Ca5Si2(FeAl)18O36

5000

1000

ƿ C3A

ƽƽ ƻ ƻ

ƺ ͩ ƺ ƽ ƻ ƿ ͩ ͩ

20

30

ƺ

Ʒ ƺ ƿ

40

ƽ

ƺ Ʒ

50

©˄e˅

ƺ

ƺ Ʒ

60

70

80

Fig. 2: XRD spectrum of cement

2.2 Experimental Method 2.2.1 The Curing Experiment of Aod Stainless Steel Slag First of all, the AOD slag were grinded into fine powder by using the powder system prototype, then the B2O3, P2O5 and CuO were mixed into AOD slag with different proportion, and the ratio of three kinds of modifiers are shown in Table 1. After that, the AOD slag and modifiers were mixed into the graphite crucible according to the ingredient list. Then put the graphite crucible into the furnace atmosphere box and

428 | Ying Xu, Zi-Zi Zhang, Chen-Guang Hu and Bian Wang heated up to 1400 ć, kept the thermal insulation for 120 min, and then cooled to the room temperature to take out the samples. Finally, the curing effect of samples was observed and the curing rate of these samples was calculated. Table 1: Modifier Types and the Ratio of the Experimental Table (%) modifiers

B2O3

P2O5

CuO

proportioning

0.2

0.5

1.0

0.3

1.0

2.0

0.4

1.5

3.0

0.45

2.0

4.0

0.5

2.5

5.0

0.55

3.0

-

0.6

4.0

-

0.7

-

-

The curing rate refers to the ratio of slag samples taken after modified inhibitor treatment which the proportion of slag particle size greater than 0.074mm.Wherein, according to the Equation (1) to test the curing rate of stainless steel slag.

g

( m 0  m1 ) u 100 % m0

(1)

Where, “g” is the curing rate of stainless steel slag, “m0” is the quality of stainless steel slag before curing; “m1” is the quality of stainless steel slag with less than 0.074mm after curing.

2.2.2 The Cementitious Activity Experiment of Modified Aod Stainless Steel Slag To further make sure the feasibility of AOD stainless steel slag cement as cementitious materials, the cementitious activity of cement materials which mixed the different content of AOD slag was studied [6]. First, the stainless steel slag was mixed with the cement according to the quality ratio of 0:100, 10:90, 20:80 and 30:70, and then the powder were prepared by 20mm × 20mm × 20mm slurry blocks to test. After that, used press machine to test the compressive strength of the modified AOD stainless steel slag in 3d, 7d and 28d, and choice the best dosage of the best compressive

Effect of Modified Argon Oxygen Cementitious Properties | 429

strength. Then used the best dosage of the overall performance to test the subsequent modification stainless steel slag. Using the compressive strength (R) and the activity index (H) to indicate the level of cementitious activity in the cement. Wherein, according to the Equation (2) to test the AOD stainless steel slag activity index (H)

H

R u H0 R0

(2)

Where, “H” is the activity index of “stainless steel slag - cement”, “R” is the compressive strength of “stainless steel slag - cement”, “R0” is the compressive strength of pure cement paste, and “H0” is the activity index of pure cement paste. Therefore, the greater compressive strength in “stainless steel slag - cement”, the better activity index in “stainless steel slag - cement”, which makes the best cementitious activity of the stainless steel slag.

2.2.3 The Soundness Experiment of Modified Aod Stainless Steel Slag According to the GB / T1346-2011 test method to test the stability of modified stainless steel slag.

3 Results and Discussion 3.1 The Change Mineral Composition of the Modified AOD Stainless Steel Slag The curing rate curve of three kinds of modified steel slag is shown in Figure 3, it can be seen that the curing effect is not ideal when the content of B2O3 is from 0.1% to 0.4%; But the curing rate increases significantly when the content of B2O3 reaches 0.5%, and the curing rate can reaches 90%. What’s more, the curing rate can reaches 100% when the content of B2O3 is 0.6%, which has the best effect on curing. In order to further analyse the result of the study, the XRD analysis for the best curing effect of modified steel slag was conducted, as shown in Figure 4. It can be seen from the diagram, there is no γ-C2S diffraction peaks in the modified slag samples, and the mainly minerals are β-C2S phase, spinel (MgAl2O4), cuspidine (Ca4Si2O7F2), Ca5Cr3O12. It is proved that C2S can be stabled at β phase and do not change the crystal to γ phase with the addition of B2O3, and B2O3 plays a very good pulverization inhibition effect on the AOD stainless steel slag.

430 | Ying Xu, Zi-Zi Zhang, Chen-Guang Hu and Bian Wang

Curing rate/%

110 100

B 2O 3

90

CuO

P 2O 5

80 70 60 50 40 30 0.0

0.5

1.0

1.5

2.0

2.5

3.0

3.5

4.0

4.5

5.0

Modifier content 

Fig. 3: The curing rate curve of three kinds of modifiered steel slag

600

ͩ -£ - C 2S

500 Indensity/cps

400

100 0 20

ƽ - Ca5Cr3O 12 ƶ  Ca4Si2 O 7 F2

ͩ ƽ

300 200

Ƹ - MgAl2O 4

ƽ ƶ

ƽ ƶ

Ƹƽ ͩ ͩ

ͩ Ƹ ƽ

Ƹ

ƽ ͩ ͩͩ Ƹ

ͩ ͩ ͩ

30

40

ͩ

ͩ ƶ

ƶ ƶ

ͩ Ƹ Ƹ ƶ

50

©  e

Ƹ

60

ƶ Ƹ

70

80

Fig. 4: XRD spectrum of mixing 0.6% B2O3 modified slag

It can be seen from Figure 3 that the curing effect is not obvious when the content of P2O5 is from 0.5% to 1.0%. The curing rate reaches 98% when the content of P2O5 is 2%, and the curing rate reaches 100% when the P2O5 content is 2.5%. The result shows that P2O5 has played a very good pulverization inhibition effect on AOD stainless steel slag, and the best content of P2O5 is between 2% to 2.5%. In order to further confirm the result, the XRD analysis for the best curing effect of modified steel slag was studied, as shown in Figure 5. It can be seen that there is no γ-C2S diffraction peaks in the modified slag samples, and the mainly minerals are β-C2S phase, spinel (MgAl2O4), cuspidine (Ca4Si2O7F2), Ca5MgSi3O12. It is proved that P2O5 can inhibit the crystal nuclear formation and inhibit the growth of γ - C2S, it can also

Effect of Modified Argon Oxygen Cementitious Properties | 431

make C2S to stabilize in the β phase, and all of these can inhibit the pulverization of stainless steel slag [7, 8]. 700 ͩ

600

ƶ Ca4Si2O7F2

ƶ

TE-C2S

 MgAl2O4

Indensity/cps

500

ƽ

ƺCa5MgSi3O12

ƺ

400

ͩ ƺ

300

ƺƽ

ͩƶ ƶ

200

ƶ ƺƽ

100

ͩͩͩ

ƽ

ƶ ƶ

ƶ ƶͩ

ƽ ͩ ƶ ƺͩ ƶͩ ͩ ͩ ƶ ͩ ͩ ƶ ͩ ƶ ͩͩ ƶ ƶ

ƽͩ

ƽ

0 10

20

30

40

50

60

70

80

©e Fig. 5: XRD spectrum of mixing 2% P2O5 modified slag. 600

ƾ¤&6 ƺ6L2 ƹ0J6L2 Ʒ0J2

Ʒ

500

Intensity/cps

ƾ

400

Ʒ

300

ƹ

ƾ

ƾ

200 100

ƾ

ƺ ƹ ƾ

Ʒ

ƾ

ƾ ƾ

ƾ

ƾ ƺƾ ƾ

ƺ Ʒ

ƾ

ƾƾ

Ʒ ƺ ƹ ƹ

ƺ Ʒ

ƹ

0 10

20

30

40

50

©˄e˅

60

70

80

Fig. 6: XRD spectrum of mixing 4% CuO modified slag

It can be seen from Figure 3 that the curing rate does not have obviously change with the addition of CuO. The curing rate can only reach 36% when the content of CuO is 5%. The result shows that CuO have no effect on the inhibition of pulverization of AOD stainless steel slag. In order to further analysis of the result of the study, XRD analysis for the 4% content of CuO was also investigated, as shown in Figure 6. It can be seen from the diagram, there are γ-C2S phase, olivine (Mg2SiO4), SiO2, MgO in the modified slag samples. It couldn’t find the diffraction peaks of β-C2S phase. Therefore, it shows that CuO is not an appropriate modifier for AOD slag.

432 | Ying Xu, Zi-Zi Zhang, Chen-Guang Hu and Bian Wang

3.2 The Cementitious Activity Experiment of AOD Stainless Steel Slag The compressive strength curve and activity index of “stainless steel slag - cement” are shown in Figure 7. It can be seen from the Figure 7 that the compressive strength of “stainless steel slag - cement” materials do not reduce when the content of AOD steel slag is increasing from 10% to 20%, and it satisfies the standard ordinary portland cement compressive strength. The compressive strength significantly reduces and is lower than the benchmark of cement when the content of AOD slag is 30%. Therefore, 20% of the stainless steel slag can be used as the replacing cement in the subsequent tests.

Compressive strength0SD

60 3d 7d 28d

50 40 30 20 10

0

10

20

30

40

The content of AOD slag 

100 3d 7d 28d

activity index

90 80 70 60 50 40

0

10

20

30

40

The content of AOD slag 

Fig. 7: The compressive strength and activity index of “AOD slag- cement”

Effect of Modified Argon Oxygen Cementitious Properties | 433

3.3 The Cementitious Activity Experiment of Modified AOD Stainless Steel Slag 3.3.1 Effect on Cementitious Activity of B2O3 Modified AOD Slag The compressive strength curve and activity index of “B2O3 modified AOD slag cement” is shown in Figure 8, it can be seen that the compressive strength curve of “B2O3 stainless steel slag - cement” is higher and its activity index is conformed to the stand of ordinary portland cement. The compressive strength of B2O3 modified slag is higher than AOD slag when the content of B2O3 is 0.55%, and the activity index can reach 101%. The compressive strength has a trend of decline with the increase content of B2O3 in the AOD slag. As we can see, there is not much difference when the content of B2O3 are 0.45%, 0.55%, 0.60% and 0.70% in 3 days, however, the compressive strength decreases 15.86 MPa when the content of B2O3 is increasing from 0.45% to 0.7%. And it shows that the curing effect of AOD slag is better with the content of B2O3 increasing, but its compressive strength and activity index decrease with the increase content of B2O3. The main reason maybe that the ionic radius of B3+ is smaller than Si4+, it can replace part of Si4+ and combine with Ca2+ to form other complex compounds, which makes the compressive strength and activity index decrease[9]. The reactions in the process of chemical equations are shown in Formula (3) (4):

2 B 2 O 3  2 CaO ˜ SiO B 2 O 3  2 CaO ˜ SiO

2

2

o 2 CaO ˜ 2 B 2 O 3 ˜ SiO

o 2 CaO ˜ B 2 O 3 ˜ SiO

2

2

(3) (4)

434 | Ying Xu, Zi-Zi Zhang, Chen-Guang Hu and Bian Wang

&RPSressive strength/MPa

60

3d 7d 28d

50 40 30 20 -0.1

0.0

0.1

0.2

0.3

0.4

0.5

0.6

0.7

0.8

The content of B2O 3

Actiity index/%

100

3d 7d 28d

90

80

70

60 -0.1 0.0 0.1 0.2 0.3 0.4 0.5 0.6 0.7 0.8 0.9 1.0 The content of B 2 O 3 /%

Fig. 8: The compressive strength and activity index of “B2O3 modified AOD slag - cement”

There is the highest compressive strength and activity index when the content of B2O3 is 0.55% in the modified slag, and it can prove that B2O3 has curing effect on AOD stainless steel slag, and the reasonable amount of AOD slag has good effect on the cement cementitious activity.

3.3.2 Effect on Cementitious Activity of P2O5 Modified AOD Slag The compressive strength curve and activity index of “P2O5 modified AOD slag cement” is shown in Figure 9, it can be seen that the compressive strength curve of

Effect of Modified Argon Oxygen Cementitious Properties | 435

“P2O5 modified slag - cement” is improved which compared with the AOD slag. Its compressive strength improves 10.11 MPa and the activity index improves 17% when the content of P2O5 from 1% to 3%. Then the compressive strength decreases when the content of P2O5 is 4%, and the main reason maybe that the ionic radius of P5+ is smaller than Si4+, it can replace part of Si4+ and combine with Ca2+ to form other complex compounds, which makes the compressive strength and activity index decrease. The reactions in the process of chemical equations are shown in Formula (5) (6):

2 P 2 O 5  2 CaO ˜ SiO

2

o 2 CaO ˜ 2 P2 O 5 ˜ SiO

P2 O 5  2 CaO ˜ SiO

2

o 2 CaO ˜ P2 O 5 ˜ SiO

&Rnpressive strength/MPa

60

(5)

2

2

3d 7d 28d

50 40 30 20 0

1

2

3

4

The content of P 2 O 5 /%

B C D

Actiity index/%

100

90

80

70 0

1

2

3

4

5

The content of P 2 O 5 /%

Fig. 9: The compressive strength and activity index of “P2O5 modified AOD slag - cement”

(6)

436 | Ying Xu, Zi-Zi Zhang, Chen-Guang Hu and Bian Wang There is the highest compressive strength and activity index when the content of P2O5 is 3% in the modified slag, and it can prove that P2O5 has curing effect on AOD stainless steel slag, and the reasonable amount of AOD slag has good effect on the cement cementitious activity.

3.3.3 Effect on Cementitious Activity of CuO Modified AOD Slag The compressive strength curve and activity index of “CuO modified AOD slag cement” is shown in Figure 10, it can be seen that the compressive strength and activity index of “CuO modified slag - cement” do not have any significant difference which compared to the AOD slag, and there is no regular change. Therefore, CuO do not have any beneficial effect on improving AOD slag activity index as well as the cementitious activity.

50 3d 7d 28d

&Rmpressive strength/MPa

45 40 35 30 25 20 15

0

1

2

3

4

5

The content of CuO/%

85 3d 7d 28d

Activity index/%

80

75

70

65

0

1

2

3

4

5

6

The content of CuO/%

Fig. 10: The compressive strength and activity index of “CuO modified AOD slag - cement”

Effect of Modified Argon Oxygen Cementitious Properties | 437

3.3.4 The Soundness Experiment of Modified AOD Stainless Steel Slag According to the GB / T1346-2011 test method to make samples, and then boiling the samples. Upon to the checking, the surface of the modified slag - cement samples do not have any swelling, even cracks cracking nor breakage, and the soundness of all the samples are according with the international standards.

4 Conclusion (1) The B2O3 and P2O5 have the best curing effect on AOD stainless steel slag during certain condition, but the curing effect of AOD slag is not obvious with the addition of CuO. (2) It satisfies the standard oridinary portland cement compressive strength and activity index when the content of AOD stainless steel slag is 20%, and then use the replacing cement with 20% stainless steel slag in the subsequent tests. (3) The best cementitious activity is obtained when the content of B2O3 modified slag is 0.55%, as well as the content of P2O5 is 3%. However, there is no effect on cementitious activity with the increasing concent of CuO. (4) The soundness of all the samples complies with the international standards. Acknowledgement: This research was supported by “the National Natural Science Foundation of China” and “Hebei provincial Key Laboratory of Inorganic Nonmetallic Materials, College of Materials Science and Engineering, North China University of Science and Technology”.

References [1] [2]

[3]

[4] [5]

[6]

H. Shen, E. Forssberg, U Nordstrom, “Physicochemical and mineralogical properties of stainless steel slags oriented to metal recovery,” Resour. Conserv. Recy, vol. 40, pp. 245-271, 2004. S. Virolainen, R. Salmimies, M. Hasan, A. Hakkinen, T. Sainio, “Recovery of valuable metals from argon oxygen decarburization (AOD) dusts by leaching, filtration and solvent extraction,” Hydrometallurgy, vol. 140, pp. 181-189, 2013. H.J. Odenthal, U. Thiedemann, U. Falkenreck, J. Schlueter, “Simulation of fluid flow and oscillation of the argon oxygen decarburization (AOD) Process,”. Metall. Mater. Trans. B, vol. 41, pp. 396-413, 2010. B. Lothenbach, K. Scrivener, R.D Hooton, “Supplementary cementitious materials,” Cement. Concrete. Res, vol. 41, pp.1244-1256, 2011. R.M. Santos, J. Van Bouwel, E. Vandevelde, G. Mertens, J. Elsen, “Accelerated mineral carbonation of stainless steel slags for CO2 storage and waste valorization: Effect of process parameters on geochemical properties,” Int. J. Greenh. Gas. Con, vol. 17, pp.32-45, 2013. S. C Pal, A. Mukherjee, S. R Pathak, “Investigation of hydraulic activity of ground granulated blast furnace slag in concrete,” Cement. Concrete. Res, vol. 33, pp.1481-1486, 2003.

438 | Ying Xu, Zi-Zi Zhang, Chen-Guang Hu and Bian Wang [7]

[8] [9]

K. Ezzedine, D. Malvy, E. Mauger, O. Nageotte,P. Galan, “Hydration behavior of C2S and C2AS nanomaterials, synthetized by sol–gel method,”. J. Therm. Anal. Calorim, vol. 83, pp.595-4599, 2013. S. Xu, K. Lin, Z. Wang, J. Chang, L. Wang, “Reconstruction of calvarial defect of rabbits using porous calcium silicate bioactive ceramics,” Biomaterials, vol. 29, pp.2588-2596, 2008. R.I. Iacobescu, G.N. Angelopoulos, P.T. Jones, B. Blanpain,Y. Pontikes, “Ladle metallurgy stainless steel slag as a raw material in Ordinary Portland Cement production: a possibility for industrial symbiosis,” J. Clean. Prod, vol. 112, pp.872-881, 201

Cheng-Min Chen1, Chun-Zhen Yang2, Guang-Xia Liu3, Min Xu4 and Li-Qiu Wang5

Optimization of structure Design of Physical Vapour Transport Furnace for Silicon Carbide (SiC) Crystal Growth via Numerical Simulation Abstract: High temperature is essential for the growth of high-quality crystals, and the temperature gradients impact the crystal growth rate, quality, size and so onˈ especially in PVT method. In this study, the size and shape of the cooling hole are optimized for better temperature distribution and lower thermal stress. The thermal field and thermal stress have been simulated by CrysMAS. The results show that the modified cooling hole is superior to the cylindrical cooling hole in the following parts, first, it decreases the radius temperature gradient in crystal; second, it makes the temperature in the furnace more uniform without decreasing the axial temperature gradient; third, the crystal with low thermal stress can be produced. Keywords: SiC growth, PVT, Cooling hole, Temperature distribution

1 Introduction Because of the superior function under high temperature, high-frequency and intensive-radiation conditions, SiC is a promising wide band gap material [1].The calculated results show that stoichiometric SiC would melt only at the pressure above 104Mpa and the temperature above 3200 °C. When the pressure is below104Mpa, the SiC sublimates easily instead of melting, while the temperature under 3200°C, the quality is far behind the requirement of the industrial use [3, 4]. In this occasion, the physical vapor transport method (PVT) is developed for commercial production, commonly known as the modified Lely method. The development of numerical models and software of PVT growth of SiC crystals is an attractive field of research for the following reasons. Firstly, owing to the high temperatures (above 2000°C), experimental observation of the temperature distribution inside the growth chamber is extremely difficult; Secondly, SiC growth

|| 1 Energy Research Institute, Shandong Academy of Sciences Shandong, China, [email protected]. 2 Energy Research Institute, Shandong Academy of Sciences Shandong, China, [email protected]. 3 Energy Research Institute, Shandong Academy of Sciences Shandong, China, [email protected]. 4 Energy Research Institute, Shandong Academy of Sciences Shandong, China, [email protected]. 5 Energy Research Institute, Shandong Academy of Sciences Shandong, China, [email protected]. 10.1515/9783110516623-042 DOI 10.1515/9783110303568-042

440 | Cheng-Min Chen, Chun-Zhen Yang, Guang-Xia Liu, Min Xu and Li-Qiu Wang needs accurate environment, and even a tiny disturb may lead to some defects, even the failure in the product. Third, to optimize the operation condition or improve the device, a large number of experiments need to be carried out, which cost about Tens of thousands of dollars. So simulation is a good choice to replace some experiments. Many software are used to simulate the temperature distribution and they have become effective tool in development and optimization of technical processes, such as Fluent [5-7], COMSOL[8], CGsim[9], Crys MAS[10] and so on. In these references, it can be seen that the simulation results played an important role in the system design. Better crystal quality could be obtained with modified systems. Cooling hole is a sensitive part for the temperature distribution, so it was commonly involved in simulation. In reference [11] the numerical evaluation of the gradients during the heating, growth, and cooling stages was studied toverify the influence of the cooling hole size. The results show that a smaller upper blind hole can reduce the temperature gradients both in the bulk and on the surface of the crystal with the same growth condition, and the decrease of the temperature difference is about 0.3 K/cm with the hole size decreased to 0.2 times. Reference [12] also discussed the influence of cooling hole shapes and size to the radial temperature distribution by calculating the heat transfer flux between the SiC seed and furnace lid, which give the guides to furnace design. In this paper, the influence of cooling hole in temperature distribution is analyzed. Besides that a modified cooling hole shapeis proposed, and the structure size is also discussed in this paper.

2 PVT Growth Process and Structure Design Modification A schematic illustration of the structure of PVT progress is shown inFig1. The outer device is RF coil (2), which supplies energy for the system by turning the electric field into magnetic field. When the medium frequency current is supplied to the coils (about 8-12 kHz), alternating electromagnetic field is induced around. Surrounded by RF coil is insulation (1), which prevents the heat from transferring to the ambient. Next to the insulation is the graphite susceptor (7), which generates heat in the electromagnetic field. There is Ar gas full of the growth furnace, which can adjust the pressure, concentration gradient and temperature gradient in the furnace. The SiC particle sublimates on surface of the powder (4), and cools on the surface of the SiC seed (3).

Optimization of structure Design Numerical Simulation | 441

Fig. 1: SiC growth equipment

As we can see, the cooling hole will contribute to local low temperature for the furnace, even the hole size is small. Because the SiC crystal sticks to the crucible cover, the low temperature in the cooling hole leads to large radial temperature difference in the crystal. In order to solve this problem, the cooling hole shape is modified. Fig.2 shows the modified cooling hole shape, and the bottom of the cooling hole is modified to " " shape instead of "I" shape (cylindrical cooling hole) shown as Fig.1.

Fig. 2: Modified cooling hole shape

In this paper heat flux and thermal stress on the SiC crystal, radius and axial temperature difference in the furnace are studied to analyze the influence of the cooling hole and find the optimal cooling hole size (H size in Fig.2) for modified

442 | Cheng-Min Chen, Chun-Zhen Yang, Guang-Xia Liu, Min Xu and Li-Qiu Wang structure. CrysMAS4.2.8 is used. The simulation conditionis: a coil of 15 turns, current of160 A and frequency of 10 kHz.

3 Result and Discution Five cases are simulated and analyzed, they are ''I'' shape cooling hole and " " shape cooling hole with H=5mm, 10mm, 15mm, 20mm respectively. In order to analyze the influence of the cooling hole, the heat flux in the crystal, temperature distribution, radius and axial temperature difference are calculated and compared. Fig.3 shows Temperature distribution in furnace (a) and heat flux in crystal seed (b) (half part, axial symmetry) in the furnace with''I'' shape cooling hole. It can be seen that, because of the cooling hole in the center, the temperature near the cooling hole is the lowest in the furnace, about 2514K, and it is about 70 K lower than that on SiC seed margin. It also shows that the heat flux in the center is obviously bigger than other part, which is the main reason for the big radius temperature difference, which is 426K/m. The thermal stress in crystal seed is shown in Fig.4. In the crystal, the maximal value is about 4.16×107N/m2and the minimum value is about 9.00×105 N/m2. (a)

(b)

Fig. 3: Temperature distribution in furnace (a) and heat flux in crystal seed (b)

Optimization of structure Design Numerical Simulation | 443

Fig. 4: Thermal stress in crystal seed

Fig 5 shows the crystal radius temperature distribution in the center of crystal seed. The square line is the temperature distribution with ''I'' shape cooling hole, others are the temperature distribution with " " shape cooling hole. It can be seen that the temperature is lowest on the position of R=0mm in the crystal. This phenomenon can be explained by Fig.6. The flux on the position of R=0 mm is the biggest because of the cooling hole. With the increase of "H" value, the whole temperature becomes low because of lager heat loss by cooling hole. However, the line becomes more flat, which means that the radius temperature difference becomes small, and it is benefit to decrease the thermal stress in crystal.

Fig. 5: Radius temperature distribution in the center of crystal seed

444 | Cheng-Min Chen, Chun-Zhen Yang, Guang-Xia Liu, Min Xu and Li-Qiu Wang

Fig. 6: Radius heat flux distribution in the center of crystal seed

Fig.7 shows the thermal stress distribution for 4 cases with H=5mm, 10mm, 15mm and 20mm respectively. It can be seen that the thermal stress becomes low and uniform as H value rises. In these four cases, the maximum thermal stress appears in the center of the crystal, which next to the cooling hole, and the value is about 1.58h107 N/m2, 1.10h107 N/m2, 8.90h106 N/m2, and 6.58h106 N/m2respectively. Compared with that with '','' shape cooling hole, Thermal stress decreases at least 4 times.

Fig. 7: Thermal stress in crystal seed

Axial temperature difference is the determinant factor to the growth velocity. Fig.8 compared the axial temperature difference in four lines in the furnace space. The position of four lines is also marked in the Fig.8.

Optimization of structure Design Numerical Simulation | 445 A

B

Fig. 8: Axial temperature differencefor 4 lines

From Fig.8, It can be concluded that, the maximum value appears on the position of R=0.00m, while the minimum value appears on the position of R=0.50m. The value in the position of R=0.75m is bigger than that in position of R=0.50m.This is because that the position of R=0.75m is next to the furnace, where the heat source formed. Among these lines, the axial temperature difference in the condition with ",shape cooling hole is the most non-uniform. The maximum value is about 325K/m, while the minimum value is about 25K/m. The axial temperature difference is more uniform in other four cases and the case with H=20mm is the most favorite for steady growth velocity.

446 | Cheng-Min Chen, Chun-Zhen Yang, Guang-Xia Liu, Min Xu and Li-Qiu Wang

4 Conclusion The present work is to study the influence of the cooling hole forms to the SiC crystal growth furnace by PVT method. The heat transfer characteristics such as temperature distribution, heat flux, heat difference and the thermal stress distribution in furnace have been studied numerically using steady simulation. The results show that: (1) The cooling hole plays an important role in the temperature distribution in the furnace; (2)'','' shape cooling hole leads to big radius temperature difference in crystal; (3)'' '' shape cooling hole improves the temperature field by decrease radius temperature difference, and the thermal stress in crystal is also decreased. The case with H =20mm is most favorite among these cases. It can be concluded that the '' '' shape cooling hole is superior to '','' shape cooling hole for uniform temperature field and lower thermal stress in crystal. Acknowledgement: The authors gratefully acknowledge the kind support of the Project of Independent Innovation and Achievement Transformation of Shandong Province (2014ZZCX04215); Youth Fund of Shandong Academy of Sciences (2014QN016 and 2013QN016).

References [1] [2] [3] [4] [5]

[6]

[7]

[8]

Y.M. Tairov, V. Tsvetkov, “Investigation of growth processes of ingots of silicon carbide single crystals”, Journal of crystal growth, vol.43, pp.209-212. 1978. R. Glass, D. Henshall, V. Tsvetkov, C. Carter, “SiC-seeded crystal growth”, MRS Bulletin, vol.22 , pp.30-35.1997. D.H. Hofmann, M.H. Müller, “Prospects of the use of liquid phase techniques for the growth of bulk silicon carbide crystals”, Materials Science and Engineering: vol.B 61, pp. 29-39.1999. C. Kittel, P. McEuen, P. McEuen, “Introduction to solid state physics”, Wiley New York, 1976. Lijun Liu, Qinghua Yu, Xiaofang Qi, et.al,“Controlling solidification front shape and thermal stress in growing quasi-single-crystal silicon ingots: Process design for seeded directional solidification”. Applied Thermal Engineering. vol.91, pp.225-33.2015. Thi Hoai Thu Nguyen, Szu-Han Liao, et.al,“Effects of the hot zone design during the growth of large size multi-crystalline silicon ingots by the seeded directional solidification process. Journal of Crystal Growth”.http://dx.doi.org/10.1016/j.jcrysgro.2015.12.045i. Liguo Chen, Bing Dai. “Optimization of power consumption on silicon directional solidification systemby using numerical simulations”. Journal of Crystal Growth. Vol.354, pp. 8692.2012. T.F. Li HC.Huang, H.W. Tsai, Tsai, et.al,“An enhanced cooling design in directional solidification for high quality multi-crystalline solar silicon”. Journal of Crystal Growth. Vol.340, pp.202-8.2012.

Optimization of structure Design Numerical Simulation | 447 [9] [10]

[11] [12]

E. Schmid, A. Poklad, V. Heinze, et.al,“Growth of multicrystalline silicon in a cone-shaped crucible”. Journal of Crystal Growth.vol.416, pp.1-7. 2015. Xi Yang, Wenhui Ma, Guoqiang Lv, et.al, “A modified vacuum directional solidification system of multicrystalline silicon based on optimizing for heat transfer”. Journal of Crystal Growth. Vol. 400, pp: 7-14.2014. J. Geiser, O. Klein, P. Philip, “Transient numerical study of temperature gradients during sublimation growth of SiC”, Journal of Crystal Growth,vol. 297(1), pp.20-32.2006. H.-q. Li, D.-q. Ni, X. Wu, et.al, “A Heat Transfer Analysis for SiC Single Crystal Growth by PVT Method”, Journal of Synthetic Crystals, vol. 33, pp.510-515.2004.

Peng-Fei Chen, Ying Sun, Jia-Min Zhou, Xin-Min Wu, Liang-Fa Gong and Wei Li1

Thermodynamical Analysis of the Spontaneous Combustion of FeS

Abstract: There has been a lively investigation interest on the spontaneous combustion accidents of oil storage tank which are induced by ferrous sulfide (FeS). The thermal behaviors about the various particle sizes (100~120, 150~160, and 200~220 mesh) of FeS at different heating rates of 2.5, 5, 10, 15, and 20 K·min-1 were investigated in air flow from ambient temperature to 1000 °C by thermogravimetric (TG) and differential thermal (DTA) analyses, and TG curve shows that the whole reaction process was divided into 3 stages: physical, chemical adsorptions, and chemical reaction, and the kinetics parameters (apparent activation energies and preexponential factors) were computed by Flynn-Wall-Ozawa method. The kinetic mechanism of thermal decomposing of FeS was determined by combining AcharBrindley-Sharp-Wendworth and Coast-Redfern methods. The reaction fitted AvramiErofeev (m≈2) kinetic model of random nucleation and subsequent growth well, and the integral of model function G(α) = [-ln(1-α)]1/2. The combustion heat of FeS with different particle sizes was also obtained. Keywords: FeS; kinetics; combustion heat; apparent activation energy; DTA

1 Introduction The heat-producing chemical reactions between ferrous sulfide (FeS) and oxygen will arise when the sulfide ores existed in the oil storage tank and petroleum device are exposed to air, and the spontaneous combustion will eventually take place if the generated heat is not dissipated to the exterior. This hazard not only causes huge economical losses and energetic wastes, but also leads lots of safety and environmental accidents for further production.[1] Therefore, it is necessary to investigate the mechanism of spontaneous combustion to provide some important analysis for the fire and explosion preventions. Up to now, there are many experimental methods for determining the mechanism of spontaneous combustion, including the selfheating method, adiabatic experiment, differential scanning calorimetry (DSC), temperature program oxidation method, as well as the comprehensive test method.

|| 1 College of Chemical Engineering, Beijing Institute of Petro-chemical Technology, Beijing, 102617, China, [email protected] 10.1515/9783110516623-043 DOI 10.1515/9783110303568-043

450 | Peng-Fei Chen, Ying Sun, Jia-Min Zhou, Xin-Min Wu, Liang-Fa Gong and Wei Li [2-6] However, when sulfide is deposited in ordinary environment, progressive changes occur in their chemical and physical characters. Even a small amount of oxidation may influence the spontaneous combustion. In this work, thermogravimetric (TG) and differential thermal (DTA) analyses are used to study the thermodynamics and kinetic mechanism on the oxidation process of FeS in air. This work would provide theoretical foundation for the prevention and treatment of spontaneous combustion accident of FeS.

2 Experimental 2.1 Apparatus and Reagents HCT-2 thermal gravimetric analyzer (Beijing Hengjiu Scientific Instrument Company, China), ZNLRY-2005 automatic calorimeter (Hebi Hengke Instrument Co., Ltd., China). FeS (AR, Tianjin Fuchen Chmical Reagent Factory, China).

2.2 Experimental Process Solid FeS was grinded in mortar and sieved, then the different particle sizes (100~120, 150~160, and 200~220 mesh) of FeS samples with mass of 10 mg were tested at a heating rate (β) of 2.5, 5, 10, 15, or 25 K·min-1, respectively, from ambient temperature to 1000°C. The combustion heat of FeS samples with different particle size (40~60 mesh, 80~100 mesh, 100~120 mesh, 120~140 mesh, 140~150, and larger than 150 mesh) was measured with a ZNLRY-2005 automatic calorimeter.

3 Kinetic Analysis of Oxidation of FeS 3.1 Oxidation Curve of FeS The TG and DTA curves of the FeS samples in air at a heating rate of 10 °C·min-1 are shown in Fig.1. It can be seen from the DTA curve that there is a small endothermic peak from 100°C to 200°C, but there is no weight change in this temperature interval on the TG curve, which shows that there exists phase change of FeS in the range of 100°C~200°C[4-6]. There is an exothermic peak from 400°C to 700°C, and there presents an obvious weight change in the corresponding range on the TG curve—— increasing weight first and then losing weight. The TG curve decreased slowly in the range higher than 700°C till the end of the reaction.

Thermodynamical Analysis of the Spontaneous Combustion of FeS | 451

The thermogravimetric analyses indicate that the oxidation reaction of FeS involves 3 stages: physical and chemical adsorptions, and chemical reaction. [4] And the reaction stage can be roughly divided into 3 periods: in the first period FeS reacts with O2 to form sulphates or oxides of iron accompany with the weight increasement; in the second period gas SO2 and SO3 are generated accompany with the reduction of the weight; the third period begins when reaching a certain temperature, lower valent compounds of Fe are oxidized to Fe2O3, the speed of the weight loss is slower than that of the second period [4, 6-13].

Fig. 1: Thermal analysis curve of FeS

3.2 Solution of FeS Kinetic Factors 3.2.1 Determination of Mechanism Function Using Achar Method and CoastRedfern Method: There are more than 20 kinds of integral/differential method used for dealing with the kinetics and the data obtained from thermal analysis experiments, and in this work, the kinetic model function or its integral was determined by combining Achar-Brindley-Sharp-Wendworth method and Coast-Redfern method. [14] The thermal results at a heating rate of β = 10 °C·min-1 were analyzed using both these methods with 30 kinetic models or their integral functions [f(α), G(α)] (α is the conversion rate) to obtain the kinetic parameters (the apparent activation energy E and pre-exponential factor A) of the thermal decomposition reaction of FeS. It is found that when the functions are based on the mechanism of random nucleation and subsequent growth, the values of E and A obtained using both methods were close to each other, and the reaction fitted Avrami-Erofeev (m≈2) kinetic model well, and the kinetics function of the oxidation of FeS has the following form,

452 | Peng-Fei Chen, Ying Sun, Jia-Min Zhou, Xin-Min Wu, Liang-Fa Gong and Wei Li G(α) = [-ln(1-α)]1/m

(1)

3.2.2 Calculation of Active Energy using Flynn-Wall-Ozawa method According to the TG data at various heating rates of β = 5, 10, 15 and 20 °C·min-1, plotting lgβ versus 1/T (T: the temperature corresponding to the conversion rate of 0.2, 0.3, 0.4, 0.5, 0.6, 0.7 and 0.8, respectively), one can gain E and A from the slope and intercept of the fitting curve, [6] in spite of the reaction mechanism. Using Flynn-Wall-Ozawa equation to analyze Eq. (1), the kinetic index 1/m in Eq. (1) can be obtained. The results show that the oxidation reactions of FeS with different particle sizes all follow the mechanism of random nucleation and subsequent growth, and the computed kinetic parameters are given in Table I. It can be seen that the kinetic parameters for different samples are various. Generally, E and A of smaller particle are lower than those of bigger one. Besides, the heating rate β also effects on the apparent activation energy (shown in Table 2) with particle sizes of 150-160 mesh. The larger the apparent activation energy is, the less it shows spontaneous combustion hazard. This conclusion agrees with the fact that spontaneous combustion often occurs in the places where sulfide ores have been powdered for long time. Table 1: The kinetic factors of the oxidation reaction of FeS in different particle sizes Particle size of FeS / mesh

E / kJ·mol-1

lg (A/s-1)

the kinetic index 1/m

100~120

138.785

6.5149

0.4600

150~160

158.586

8.1436

0.4619

200~220

156.574

8.2402

0.4572

Table 2: The activation energies E obtained by combining data at different heating rate β / K·min-1

2.5, 5, 10, 15

2.5, 5, 10, 15, 20

5, 10, 15, 20

E / kJ·mol

190.476

172.016

158.586

-1

It can be seen from Table 2 that the heating rate has a significant effect on E, which increases with the decrease of heating rate, and this is consistent with the results of reference [4]. The effect of the heating rate on the kinetic factors with different particle size of FeS was also studied, and it was found that the heating rate influenced E more serious for smaller particle.

Thermodynamical Analysis of the Spontaneous Combustion of FeS | 453

4 Combustion Heat of FeS The combustion heats of various FeS samples with different particle sizes were determined using the conventional oxygen bomb calorimetry, at room temperature, and the results are shown in Table 3. Table 3: The combustion heats of FeS with different particle sizes Particle size of FeS / mesh

Calorific value / J·g-1

Combustion heat / kJ·mol-1

40~60

3608.12

317.19

80~100

7671.38

674.30

100~120

7822.20

687.66

120~140

6980.14

613.63

150~160

5419.98

476.48

>150

6475.82

569.30

The results show that the combustion heat increases with the decrease of particle size generally. Whereas this relationship becomes amorphous when particle size is larger than some degree, which is probably due to the incomplete combustion of the sample [15]; when the particle size has gotten much smaller, it is also hard to predict the heating tendency, owing to the higher surface energy.

5 Conclusions In this work, the TG/DTA and calorimetry experiments were carried out on the air combustions of FeS samples with different particle sizes, and the experimental data were analyzed by thermodynamical and kinetic theory methods and some useful conclusions were drawn as follows. There are two peaks on DTA curve of FeS: an endothermic peak caused by the phase transformation and an exothermic peak due to the oxidation of FeS. The oxidation reaction process can be roughly divided into three stages: physical, chemical adsorptions and chemical reaction, the TG curve also tells us this tendency. Both the particle size and the heating rate will affect the kinetic parameters of the oxidation process of FeS in air: the apparent activation energy increases with the decrease of heating rate, especially for the case of smaller particle size. Besides, in a certain range of particle size, the combustion heat increases with the decrease of particle size.

454 | Peng-Fei Chen, Ying Sun, Jia-Min Zhou, Xin-Min Wu, Liang-Fa Gong and Wei Li The small activation energy of the oxidation of FeS makes the spontaneous combustion easy to happen. In addition, the large combustion heat of FeS is the main reason for the spontaneous combustion accident.

References [1] [2] [3] [4]

[5] [6]

[7] [8] [9] [10] [11] [12] [13]

[14] [15]

Y. Liu and M. Lian, “Prevent the spontaneous combustion of ferrous sulfide,” Cleaning World, vol. 28, 2012, pp. 40-41 H. Dong, X. Chen, H. Yang, and X. Liu, Industrial Safety and Environmental Protection, vol. 42(2), 2016, pp. 46-50. Paul Chirita, “Iron monosulfide (FeS) oxidation by dissolved oxygen: characteristics of the product layer,” Surface and Interface Analysis, vol. 41(5), 2009, 405-411, doi: 10.1002/sia.3041. X. Zhao, X. Chen, J. Zhang, W. Wang, and J. Zhang, “Application of the isotransformational method to the study of FeS thermokinetic behavior,” Journal of Safety and Environment, vol. 12(5), 2012, pp. 182-185, doi: 10.3969/j.issn.1009-6094.2012.05.040. S. Zhao and J. Jiang, “Thermal analysis hydrodynamics study on FeS,” Journal of China University of Petroleum, vol. 34(5), 2010, pp. 165-167, doi: 10.3969/j.issn.1673-5005.2010.05.030. Y. Yang, J. Jiang, S. Zhao, and G. Li, “Thermogravimetric experiment and kinetic analysis on the oxidation of ferrous sulfide,” Industrial Safety and Environmental Protection, vol. 36(12), 2010, pp. 5-7. Z. Aski, K. Matsumoto, T. Tanabe, and Y. Kondo, Metall. Trans. B, vol. 14B, 1983, pp. 109-116 P. G. Thomhill and L. M. Pidgeon, Trans. AIME, vol. 209, 1957, pp. 989-995. T. Kennedy and B. T. Sturman, J. Therm. Anal. Calorim., vol. 8, 1975, pp. 329-337. A. C. Banerjee, Ind. J. Chem., vol. 14A, 1976, pp. 845-850. N. S. Safiullin and E. B. Gitis, J. Appl. Chem. USSR, vol. 41(8),1968, pp. 1596-1602 A. V. Vanyukov, Y. B. Voitkovskii, N. N. Razumovskaya, and M. A. Butyugin, J. Appl. Chem. USSR, vol. 51(5), 1978, pp. 1080-1087 W. Y. Shao, Z. F. Tang, Z. H. Zhang, S. L. Zhao, and L. Y. Shang, “Research on the oxidation reactions of ferrous sulfide,” Journal of Safety and Environment, vol. 15(5), 2015, pp. 119-122, doi: 10.13637/j.issn.1009-6094.2015.05.026. R. Hu and Q. Shi, Thermal analysis kinetics. Beijing: Science Press, 2001, pp. 47-113. R. Walker, A. D. Steele, and D. T. B. Morgan, “Pyrophoric nature of iron sulfide,” Ind. Eng. Chem. Res., vol. 35, 1996, pp. 1747-1752, doi: 10.1021/ie950397t.

Wei-Gang Zhang1 and Guo-Yue Xu2

Cause and Prediction Model of Low Infrared Emissivity for Resin/Flaky Metal Composite Coatings Abstract: In this paper, we present a combination of theoretical and experimental study of the one-dimensional photonic structure leading to low infrared emissivity of resin/flaky metal composite coatings according to the structural characteristics of the coatings. A prediction model of low infrared emissivity for resin/flaky metal composite coatings is established by using the theories of one-dimensional photonic structure. In order to verify the feasibility of the above model, polyurethane (PU)/aluminum (Al) composite coatings were prepared by using PU and flaky Al powders as adhesives and pigments, respectively. Then the simulated infrared emissivity of PU/Al composite coatings was calculated by using the above model and the experimental value was measured by infrared emissometer. The results indicate that the calculated infrared emissivity is slightly lower than our experimental value, and the reasons are discussed in this paper. Keywords: infrared emissivity, composite coatings, prediction model, onedimensional photonic structure.

1 Introduction Low infrared emissivity materials have received considerable attention due to their civil and military applications such as solar thermal collectors and infrared stealth coatings in recent years [1-4]. Many kinds of low infrared emissivity materials such as nano-composite films [5, 6], multilayer structures [7, 8] and core-shell composites [9] have been developed. Especially, the resin/metal composite coatings have received extensive attention due to their lower infrared emissivity and excellent performance for engineering application [10-12]. The infrared emissivity of resin/metal composite coatings is between the emissivity of pure resin and metal in general. But our research results indicate that the infrared emissivity of PU/flaky Al composite coatings is significantly lower than

|| 1 College of Materials and Chemical Engineering Chuzhou University, Chuzhou, PR China, E-mail: [email protected] 2 College of Material Science & Technology Nanjing University of Aeronautics and Astronautics, Nanjing, PR China, E-mail: [email protected] 10.1515/9783110516623-044 DOI 10.1515/9783110303568-044

456 | Wei-Gang Zhang and Guo-Yue Xu both pure PU and Al powders (Fig. 1). This phenomenon shows that the low infrared emissivity of resin/flaky metal composite coatings is not only derived from the reflection of infrared radiation from flaky metal surfaces. So in this paper, according to the microstructure of resin/flaky metal composite coatings, a new prediction model of low infrared emissivity for resin/flaky metal composite coatings is established by using the theories of one-dimensional photonic structure.

Fig. 1: Infrared emissivity of different samples.

2 Experimental 2.1 Materials Al powders and PU were purchased from Nanjing Chemical Agent Limited Company, China. All reagents were analytical grade and were used as received without further treatment.

2.2 Preparation of Composite Coatings Steel substrate (10 cm×5 cm, thickness 0.3 mm), properly cleaned by ethanol and distilled water, respectively, was used as the coating substrate to measure the emissivity changes of various coatings. Firstly, fixed amounts of resin and flaky metal powders with suitable ratios were mixed together under continuous ultrasonication for 10 min. Then the mixture was painted onto the substrates by spray technique (98PSI, Japan) using an accurate speed motor and appropriate pressure. The coating thickness is controlled about 40μm. Finally the coatings were solidified completely

Cause and Prediction Metal Composite Coatings | 457

after curing for 24 h at 50 °C and kept for further characterization. In all cases, duplicate experiments were carried out to ensure reproducibility.

2.3 Characterization Infrared emissivity values at the wavelength of 8~ 14μm were measured by IR-2 infrared emissometer (Shanghai Institute of Technological Physics, China). The morphology and microstructure of the coatings were observed by scanning electron microscopy (FEI-Quanta200).

3 Prediction Model Construction Kirchhoff’s law [13] and Principle of Conservation of Energy give the relationship between the infrared emissivity (ε) and reflectivity (r) of non-transparent material such as resin/flaky metal composite coatings: ε=1ˉr

(1)

We can know from Eq. (1) that reflectivity has a decisive effect on the infrared emissivity of resin/flaky metal composite coatings. Fig. 2 shows the SEM image of resin/flaky metal composite coatings. It can be seen that the coatings are stacked by resin coated flaky metal powders, which indicates that the coatings have obvious characteristics of layered structure. According to the observed results, the microstructure of resin/flaky metal composite coatings is confirmed as Fig. 3. It can be seen that the coatings are periodic stacked by resin and flaky metal powders with different refractive index, revealing that the coatings have similar one-dimensional photonic structural characteristics [14-16]. According to the microstructure and interface characteristics of resin/flaky metal composite coatings, we speculate that the reflection of infrared radiation from the coatings includes three parts (Fig. 3): (1) the reflection from the interface of surface resin layer and air (r1), (2) the reflection from the surface of top metal layer (r2), and (3) the reflection from the one-dimensional photonic structure in the coatings (r3). Then, according to Eq. (1), the infrared emissivity of resin/flaky metal composite coatings can be expressed as:

H 1  (r1  r2  r3 ) According to Fresnel’s law, r1 can be expressed as:

(2)

458 | Wei-Gang Zhang and Guo-Yue Xu 2

r1 (T

Ti )

1 ª n1 cos Ti  n2 cos T r º 1 ª n2 cos Ti  n1 cos T r º « »  « » 2 ¬ n1 cos Ti  n2 cos T r ¼ 2 ¬ n2 cos Ti  n1 cos T r ¼

2

(3)

Where n1 and n2 are the refractive indices of air and resin, respectively; θi is the angle of incidence, and θr is the angle of reflection. We use normal emissivity in this paper, so θi=0°, θr=0°. Then, Eq. (3) can be changed into: 2

r1

1 ª n1  n2 º 1 ª n2  n1 º « »  « » 2 ¬ n1  n2 ¼ 2 ¬ n2  n1 ¼

2

(4)

The value of r2 can be obtained by measuring the emissivity of pure flaky metal powders coatings, then translated by Eq. (1).

Fig. 2: SEM image of resin/flaky metal composite coatings.

Fig. 3: Microstructure model of resin/flaky metal composite coatings.

Cause and Prediction Metal Composite Coatings | 459

In this work, we approximately think that the resin/flaky metal composite coatings have completely regular one-dimensional photonic structural characteristics for ease of calculation. So we can introduce the photonic bandgap calculation software (Translight) to calculate the reflection spectra for the one-dimensional photonic structure in resin/flaky metal composite coatings. Then, the value of r3 can be obtained from the reflection spectra. At last, according to Eq. (2) and the values of r1, r2 and r3, the infrared emissivity of resin/flaky metal composite coatings can be obtained.

4 Experimental Verification In order to verify the feasibility of the above model, the PU/Al composite coatings are introduced to investigate the infrared emissivity at the wavelength of 8~14μm in this work. For PU/Al composite coatings, according to Eq. (4) and the values of n1 (1.0) for air, n2 (1.52) for PU, the value of r1 will be calculated as 0.04. According to Eq. (1) and infrared emissivity (0.33) of pure Al powders coatings, the value of r2 for PU/Al composite coatings will be calculated as 0.67. Fig. 4 shows the calculated reflection spectra of one-dimensional photonic structure in PU/Al composite coatings. It can be seen a strong reflection peak at the wavelength of 8~14μm. According to Fig. 4, the value of r3 at the wavelength of 8~14μm for PU/Al composite coatings will be calculated as 0.11. At last, according to Eq. (2) and the values of r1 (0.04), r2(0.67) and r3(0.11), the infrared emissivity of PU/Al composite coatings will be calculated as 0.18. It is slightly lower than the measured value of 0.23. There are two reasons for this phenomenon. (1) The absorption of infrared radiation by surface adhesives is ignored in the prediction model, which leads to the calculated emissivity is slightly lower than the measured value. (2) We approximately think that the resin/flaky metal composite coatings have completely regular one-dimensional photonic structural characteristics in the prediction model, which causes the strongest reflection peak for onedimensional photonic structure in the coatings. But in reality, it is difficult to prepare completely regular coatings due to limited process conditions, which leads to the reflectivity caused by one-dimensional photonic structure in the really coatings is lower than the completely regular coatings, so the measured emissivity will be slightly higher than the calculated value.

460 | Wei-Gang Zhang and Guo-Yue Xu

Fig. 4: Calculated reflection spectra of one-dimensional photonic structure in PU/Al composite coatings.

5 Conclusions In summary, according to the SEM observation, we find that the resin/flaky metal composite coatings have similar one-dimensional photonic structural characteristics. We have illustrated that the low infrared emissivity of resin/flaky metal composite coatings is derived from the one-dimensional photonic structure in the coatings. A prediction model which can be used to calculate the infrared emissivity of resin/flaky metal composite coatings is established by using the theories of onedimensional photonic structure. The absorption of infrared radiation by surface adhesives and limited process conditions to prepare completely regular coatings are the two reasons for the phenomenon of the calculated infrared emissivity of the coatings is slightly lower than the measured value. Acknowledgement: This work was financially supported by the National Natural Science Foundation of China (51173079), University Natural Science Research Key Project of Anhui Province (KJ2016A535), Research Projects of Chuzhou University (2015PY02), Scientific Research Start Foundation Project of Chuzhou University (2015qd15), and Green Chemical Industry and Core Technology Innovation Platform of Chuzhou University. We appreciate Andrew L. Reynolds to share the software of translight.

References [1]

M. Yuste, R.E. Galindo, O. Sanchez, and D. Cano, “Correlation between structure and optical properties in low emissivity coatings for solar thermal collectors”, Thin Solid Films, vol. 518, pp. 5720-5723, August 2010.

Cause and Prediction Metal Composite Coatings | 461 [2]

[3]

[4]

[5]

[6]

[7] [8]

[9]

[10]

[11] [12]

[13]

[14]

[15]

[16]

P.K. Biswas, A. De, N.C. Pramanik, P.K. Chakraborty, K. Ortner, V. Hock, and S. Korder, “Effects of tin on IR reflectivity, thermal emissivity, Hall mobility and plasma wavelength of sol– gel indium tin oxide films on glass”, Mater. Lett. vol. 57, pp. 2326-2332, April 2003. B.P. Lin, H.J. Liu, S.X. Zhang, and C.W. Yuan, “Structure and infrared emissivity of siliconcontaining polyimide/BaTiO3 nanocomposite films”, J. Solid State Chem., vol. 177, pp. 38493852, October 2004. J. Chen, Y.M. Zhou, Q.L. Zhou, Y.Q. Sun, X.Y. ye, and Z.Q. Wang, “Synthesis, characterization and infrared emissivity study of polyurethane/TiO2 nanocomposites”, Appl. Surf. Sci., vol. 253, pp. 9154-9158, September 2007. F.Y. Zhang, Y.M. Zhou, Y. Cao, and J. Chen, “Preparation and characterization of KGM/CdS nanocomposite film with low infrared emissivity”, Mater. Lett. vol. 61, pp. 4811-4814, October 2007. F.Y. Zhang, Y.M. Zhou, Y.Q. Sun, and J. Chen, “Preparation and characterization of Chitosan/Konjac glucomannan/CdS nanocomposite film with low infrared emissivity”, Materials Research Bulletin, vol. 45, pp. 859-862, July 2010. P. Grosse, R. Hertling, and T. Muggenburg, “Design of low emissivity systems based on a three-layer coating”, J. Non-Cryst. Solids, vol. 218, pp. 38-43, September 1997. K. Chiba, T. Takahashi, T. Kageyama, and H. Oda, “Low-emissivity coating of amorphous diamond-like carbon/Ag-alloy multilayer on glass”, Appl. Surf. Sci., vol. 246, pp. 48-51, June 2005. Z.Q. Wang, Y.M. Zhou, Q.Z. Yao, and Y.Q. Sun, “Preparation, characterization and infrared emissivity study of helical polyurethane@SiO2 core-shell composite”, Appl. Surf. Sci., vol. 256, pp. 1404-1408, December 2009. H.J. Yu, G.Y. Xu, X.M. Shen, X.X. Yan, R. Huang, and F.L. Li, “Preparation of leafing Cu and its application in low infrared emissivity coatings”, J. Alloys Compd., vol. 484, pp. 395-399, September 2009. X.N. Qi, C. Vetter, and A. Harper, “Electrochemical investigations into polypyrrole/aluminum flake pigmented coatings”, Prog. Org. Coat., vol. 63, pp. 345-351, October 2008. G.W. Wu, and D.M. Yu, “Preparation of a novel infrared low-emissive coating from the Cu powder modified by the polyethylene wax”, Infrared Phys. Techn., vol. 55, pp. 26-31, January 2012. J. J. Greffet, and M. Nieto-Vesperinas, “Field theory for generalized bidirectional reflectivity: derivation of Helmholtz’s reciprocity principle and Kirchhoff’s law”, J. Opt. Soc. Am. A, vol. 15, pp. 2735-2744, October 1998. S. Enoch, J.J. Simon, L. Escoubas, Z. Elalmy, F. Lemarquis, P. Torchio, and G. Albrand, “Simple layer-by-layer photonic crystal for the control of thermal emission”, Appl. Phys. Lett., vol. 86, pp. 261101, June 2005. M. Scalora, M.J. Bloemer, M.S. Pethel, J.P. Dowling, C.M. Bowden, and A.S. Manka, “Transparent, metallo-dielectric, one-dimensional, photonic band-gap structures”, J. Appl. Phys., vol. 83, pp. 2377-2383, November 1998. L.C. David, S. Marin, and J.D. Joannopoulos, “Thermal emission and design in onedimensional periodic metallic photonic crystal slabs”, Phys. Rev. E, vol. 74, pp. 016609, July 2006.

Yue-Long Xu1, Mei-Fang Yan2 and Zhen-Fa Liu3*

Synthesis and Characterization of Modified Carbon Aerogels Abstract: Polycondensation of phloroglucinol, resorcinol and formaldehyde with ascorbic acid (VC) and starch as the additives, using sodium carbonate as the catalyst, leads to the formation of carbon aerogels. The structure of carbon aerogels with different additives were characterized by X-ray diffraction. The specific surface area, pore size distribution and pore volume were measured by surface area analyzer. The results show that the specific surface area of carbon aerogel is up to 522 m2 g-1 and the range of pore size is 4-8 nm. Keywords: carbon aerogels, ascorbic acid, starch, specific surface area, pore size.

1 Introduction Carbon aerogels are three-dimensional cross-linked carbon nanomaterials which are first reported by Pekala in the 1990s [1-2]. With the advantages of the high surface areas, the low density, the low electrical resistivity, the low thermal conductivity, the high thermal stability and potentially electronic conductivity, carbon aerogels now get more and more attention in different fields, such as hydrogen fuel storage, catalyst supports, adsorption of heavy metal ions, electrical charge storage, and chromatographic separation [3-5]. Carbon aerogels were first synthesized through the polycondensation of resorcinol and formaldehyde using sodium carbonate as the catalyst by Pekala. The traditional preparation method was widely utilized in the carbon nanomaterials field. However the traditional preparation method has more disadvantages with the development of carbon nanomaterials in recent years, such as the long gel time, the

|| 1 Institute of Energy Resources, Hebei Academy of Sciences, Shijiazhuang 050081, China, Hebei Engineering Research Center for Water Saving in Industry, Shijiazhuang 050081, China, Institute of Process Engineering, Chinese Academy of Sciences, Beijing 100190, China, Shijiazhuang 050081, China. E-mail: [email protected] 2 Institute of Energy Resources, Hebei Academy of Sciences, Shijiazhuang 050081, China, Hebei Engineering Research Center for Water Saving in Industry, Shijiazhuang 050081, China, Institute of Process Engineering, Chinese Academy of Sciences, Beijing 100190, China, Shijiazhuang 050081, China. 3 Institute of Energy Resources, Hebei Academy of Sciences, Shijiazhuang 050081, China, Hebei Engineering Research Center for Water Saving in Industry, Shijiazhuang 050081, China,* Institute of Energy Resources, Hebei Academy of Sciences, Shijiazhuang 050081, China. 10.1515/9783110516623-045 DOI 10.1515/9783110303568-045

464 | Yue-Long Xu, Mei-Fang Yan and Zhen-Fa Liu fragile structure, and the uncontroable pore size. The modify of traditional preparation method has been reported in recent years, such as the metal addition, the nitrogen addition, the graphene addition and the synergistic catalyst application [6-8]. The pore size of carbon aerogels is a very important factor in the application. However the controlled pore size is very difficult. In this paper the carbon aerogels were synthesized through the polycondensation of phloroglucinol, resorcinol and formaldehyde with ascorbic acid (VC) and starch as the additives, using sodium carbonate as the catalyst. The specific surface area, pore volume, pore size and structure properties of the carbon aerogels are studied.

2 Experimental 2.1 Materials The chemical reagents used are analytical grade phloroglucinol, resorcinol, formaldehyde (30%), ascorbic acid, starch and sodium carbonate (C). Ultima IV X-ray diffraction instrument (XRD, Rigaku, Japan), Specific surface analyzer ASAP2420 (micromeritics, USA).

2.2 Synthesis and Characterization of Carbon Aerogels Carbon aerogels were synthesized by polycondensation of phloroglucinol (P), resorcinol (R) and formaldehyde (F), using sodium carbonate as catalysts (C), with ascorbic acid (VC) and starch as additives, and deionized water as the solvent. The molar ratio of P / R was 0.15, the molar ratio of (P + R)/F was 0.5, and the molar ratio of (P + R) / C were 500. The concentration of raw material (P + R + F) in solution was 45 wt%. The molar ratio of (P + R) / VC were 10 and 25, respectively and the concentrations of starch in solution were 20 wt% and 40 wt%. Phloroglucinol, resorcinol, formaldehyde, ascorbic acid (VC), starch and sodium carbonate (C) catalyst were added into deionized water. Ultrasonic oscillator was used to dissolve the reactants to form a homogeneous solution in test tubes. Putting test tubes in water bath and keeping 50°C for some time until the hydrogels were obtained. The synthetic route of carbon aerogels is shown in Fig. 1. The hydrogels were soaked in acetone, and the acetone was exchanged once a day for 4 times. Drying was carried out at room temperature. The dried modified aerogels were carbonized at 900°C for 3 h with a heating rate of 2°C/min under a flowing nitrogen atmosphere (100 mL/min).

Synthesis and Characterization of Modified Carbon Aerogels | 465

Fig.1: The synthetic route of carbon aerogels

2.3 Characterization The modified carbon aerogels were characterized by X-ray diffraction (XRD). The Brunauer−Emmett−Teller (BET) method was used to calculate the specific surface areas in a relative pressure range from 0.0 to 1.0. The pore volumes and pore size were caculated from the adsorption-desorption isotherms using the Barrett−Joyner−Halenda (BJH) model. The total pore volumes (Vt) were estimated from the adsorbed amount at a relative pressure (P/P0) of 0.998.

3 Results and Discussion 3.1 XRD Patterns of Modified Carbon Aerogels The XRD patterns of modified carbon aerogels with different additives are shown in Fig. 2. As shown in Fig. 2 there are two obvious peaks at the 2θ of 23.5DŽand 43.8DŽ, which are the (002) peak of graphite carbon and (101) peak of the crystal plane diffraction, respectively. And there are no differences among the different quantities of additives in Fig. 2.

466 | Yue-Long Xu, Mei-Fang Yan and Zhen-Fa Liu

Fig. 2: XRD patterns of modified carbon aerogels (a: 20 mol%VC+10 wt%Starch; b: 10 mol%VC+10 wt%Starch; c: 20 mol%VC+20 wt%Starch; d: 10 mol%VC+20 wt%Starch)

3.2 Pore Structure of Modified Carbon Aerogels The specific surface area (SBET), total pore volume (Vtotal) and BJH desorption average pore diameter (Daverage) of modified carbon aerogels was listed in Table 1. As shown in table 1, when VC is 10 mol%, starch is 10 wt%, the modified carbon aerogels have the highest specific surface area, up to 522 m2/g, and the largest total pore volume, up to 0.562 cm3/g. Table 1: Textual Properties Of Modified Carbon Aerogels entry

VC (mol %)

Starch (wt %)

SBET (m2/g)

Vtotal (cm3/g)

Daverage (nm)

1

20

10

404

0.302

3.42

2

10

10

522

0.562

6.14

3

20

20

395

0.345

4.59

4

10

20

449

0.490

6.03

The N2 adsorption–desorption isotherms of different modified carbon aerogels are shown in Fig. 3. As shown in Fig. 3, all the modified carbon aerogels exhibit type-IV isotherms indicative of the existence of well-developed porous structure respond, which are corresponding to the classification of IUPAC. The isotherms of all the modified carbon aerogels exhibit the same hysteresis loop shape, which is corresponding to the evidence of mesopores existence.

Synthesis and Characterization of Modified Carbon Aerogels | 467

Fig. 3: Nitrogen adsorption – desorption isotherms of modified carbon aerogels (a: 20 mol%VC+10 wt%Starch; b: 10 mol%VC+10 wt%Starch; c: 20 mol%VC+20 wt%Starch; d: 10 mol%VC+20 wt%Starch)

The drawings of the pore size distribution of modified carbon aerogels were shown in Fig. 4. As shown in Fig. 4, the pore size distribution of modified carbon aerogels are belong to normal distribution, and the pore size range is from 4 nm to 8 nm, which is the evidence of controlled pore size. The controlled pore size is benefit for the application in the adsorption of heavy metal ions and chromatographic separation field.

Fig. 4: Pore size distribution of modified carbon aerogels (a: 20 mol%VC+10 wt%Starch; b: 10 mol%VC+10 wt%Starch; c: 20 mol%VC+20 wt%Starch; d: 10 mol%VC+20 wt%Starch)

468 | Yue-Long Xu, Mei-Fang Yan and Zhen-Fa Liu

4 Conclusions Different modified carbon aerogels were prepared through polycondensation of phloroglucinol, resorcinol and formaldehyde with ascorbic acid (VC) and starch as the additives, using sodium carbonate as the catalyst; The modified carbon aerogels of 10 mol%VC and 10 wt%Starch have the highest specific surface area, up to 522 m2/g; The pore size of modified carbon aerogels is controlled, and the pore size range is from 4 nm to 8 nm. This work opens a new avenue for obtaining modified carbon aerogels by an eco-friendly method and also broadens the potential applications of starch. Acknowledgement: This work was financially supported by the Natural Science Foundation of Hebei Province (15291407D) and (16214402D).

References [1] [2] [3]

[4]

[5]

[6]

[7]

[8]

Pekala RW, Organic aerogels from the polycondensation of resorcinol with formaldehyde J. Mater. Sci., vol. 24, 1989, pp. 3221 - 3227, doi: 10.1007/BF01139044. Pekala RW, Alviso CT and Lemay JD, In: Hench LL, West JK (eds), Chemical processing of advanced materials. Wiley, New York, 1992, pp. 671 - 683. Eo Jin Lee, Yoon Jae Lee, Jeong Kwon Kim, Minzae Lee, Jongheop Yi, Jung Rag Yoon, Jae Chun Song and In Kyu Song, Oxygen group-containing activated carbon aerogel as an electrode material for supercapacitor Materials Research Bulletin vol. 70, 2015, pp. 209 - 214, doi: 10.1016/j.materresbull.2015.04.044 X. Yuan, Y.-J. Chao, Z.-F. Ma, X. Deng, Preparation and characteriza-tion of carbon xerogel (CX) and CX – SiO composite as anode materialfor lithium-ion battery, Electrochem. Commun. vol. 10, Sep. 2007, pp. 2591–2595, doi:10.1016/j.elecom.2007.08.004. J.C. Calderón, N. Mahata, M.F.R. Pereira, J.L. Figueiredo, V.R. Fernandes, C.M.Rangel, L. Calvillo, M.J. Lázaro, and E. Pastor, Pt – Ru catalysts supported on carbonxerogels for PEM fuel cells, Int. J. Hydrogen Energy, vol. 8, 2012, pp. 7200– 7211,doi:10.1016/j.ijhydene.2011.12.029. Lijuan Zhao, Jinghong Zhao, Xijing Sun, Quan Li, Jinrong Wu and Aiping Zhang, Enhanced thermoelectric properties of hybridized conducting aerogels based on carbon nanotubes and pyrolyzed resorcinol – formaldehyde resin, Synthetic Metals, vol. 205, 2015, pp. 64 – 69, doi: 10.1016/j.synthmet.2015.03.036. H. D. Du, B. H. Li, F. Y. Kang, R. W. Fu and Y. Q. Zeng, Carbon aerogel supported Pt – Ru catalysts for using as the anode of direct methanol fuel cells, Carbon, vol.45, 2007, pp. 429– 435, 10.1016/j.carbon.2006.08.023. Youfang Zhang, Wei Fan, Yunpeng Huang, Chao Zhang and Tianxi Liu, Graphene/carbon aerogels derived from graphene crosslinked polyimide as electrode materials for supercapacitors, RSC Adv., vol. 5, 2015, pp. 1301 – 1308, doi:10.1039/c4ra13015d.

Lei-Lei Lin1, Xin-Gang Wang2* and Jie Zhang3

A Review on the Application of Photocatalytic Materials Abstract: Photocatalytic materials have an important application prospect in the field of environmental purification. Compared with other methods, the photocatalysts can be regenerated and recycled without the need of pre-treatment. In addition, some organic pollutants were damaged by solar energy in the photocatalytic process. The present research status of photocatalysts is reviewed, and the prospect of preparation and modification of photocatalytic materials in the future is also presented. Keywords: photocatalytic materials, doping modification, chalcogen photocatalysts, application, research status.

1 Introduction With the acceleration of urbanization and the unprecedented expansion of global economy, the ecological environment has been greatly polluted and destroyed. Human life and health are exposed to an unprecedented threat. Therefore, strengthening environmental protection is the only choice for mankind to achieve social sustainable development. Among them, the problem of water pollution needs to be solved urgently [1-6], which has become a serious problem all over the world. However, the traditional wastewater treatment methods only allows pollutants to be enriched, solidified and transferred, and could not completely degrade the pollutants in the water and could not achieve the ideal removal effect. For example, physical adsorption and chemical precipitation, not only could not decompose organic matter but will produce a large number of sludge containing organic matter, increase processing costs; Biological treatment could not achieve the desired degradation effect due to organic toxicity to microorganism. Therefore, developing new and efficient wastewater treatment technology actively has become one of the most important tasks of environmental protection. The photocatalytic techniques that

|| 1 School of Environmental and Chemical Engineering, Jinagsu University of Science and Technology, Zhenjiang, Jiangsu, China, [email protected] 2 School of Environmental and Chemical Engineering, Jinagsu University of Science and Technology, Zhenjiang, Jiangsu, China, [email protected] 3 School of Environmental and Chemical Engineering, Jinagsu University of Science and Technology, Zhenjiang, Jiangsu, China, [email protected] 10.1515/9783110516623-046 DOI 10.1515/9783110303568-046

470 | Lei-Lei Lin, Xin-Gang Wang and Jie Zhang emerged at the end of the twentieth century just meet these needs [7-8]. Photocatalytic technology can convert low-density solar energy into high-density chemical energy and electricity; the various pollutants of water or air are degraded and mineralized by solar energy directly. Strong oxidants such as hydroxyl radicals are used as the main oxidant, macromolecular organic pollutants are degraded into small molecule contaminants, even mineralized into carbon dioxide and water. The technology has the advantages of simple process and low cost, and can degrade low concentration, stable structure and difficult biodegradable organic pollutants under normal temperature and pressure, and is not easy to produce secondary pollution. Over the past decade, photocatalytic technology in the application of environmental protection has shown great potential for research and application prospects. Obviously, photocatalytic technology can provide efficient and feasible way for environmental pollution control.

2 Progress in Application of Traditional Photocatalytic Materials The photocatalysts include various oxide semiconductors such as titanium oxide(TiO2) Bismuth oxide (Bi2O3), zinc oxide (ZnO), tin oxide (SnO2) and zirconium dioxide (ZrO2), and partial sulfide semiconductors such as cadmium sulfide (CdS) ,In the early days, cadmium sulfide (CdS) and zinc oxide (ZnO) were also used as the photocatalytic materials, but because of their particularity, they are rarely used. TiO2 is widely used and researched because of its strong oxidation, chemical stability and non-toxic. While the bismuth-based photocatalyst in the visible range of absorption, it has become a hot research. In 1972, Fujishima and Hongda [9] published a paper on the photocatalytic activity of TiO2 on TiO2 electrode in the journal Nature. The photocatalytic behavior of TiO2 was studied in detail. Matthews et al.[11], in 1990, studied 34 kinds of organic pollutants in the photocatalytic decomposition using nano-TiO2, the results showed that the photocatalytic oxidation method could transfer the pollutants in water such as halogenated, acid, surface Active agents, dyes, nitrogen-containing organic compounds, organophosphorus pesticides into H2O and CO2 and other harmless substances. From then on, nano-TiO2 used in wastewater treatment had arouse great attention [10, 11]. Chen [12] studied the catalytic degradation of organic bromine insecticide-deltamethrin using anatase type titanium dioxide with high pressure mercury lamp as the light source. The results showed that the dosage of TiO2 30 mg / 25 ml, and 5 ml 30 % H2O2, pH = 4, at room temperature, the removal rate was 73.5%, indicating that the photocatalytic degradation of nano TiO2 was very effective. The present bismuth-based photocatalysts that have been reported include bismuth oxide, bismuth oxyhalide, bismuth vanadate, bismuth tungstate, bismuth molyb-

A Review on the Application of Photocatalytic Materials | 471

date and so on. Wang et al. [13] prepared bismuth oxide films by magnetron sputtering and studied the effects of the preparation process on the structure and photocatalytic properties of the films. The results showed that the films prepared under the oxygen / argon ratio of 20:80 has the best degradation ability. Zhang, etal.[14] prepared bismuth oxide films by Chemical bath deposition method at room temperature, and Annealing in 350 °C in the air atmosphere, pure α-Bi2O3 was prepared and their structure, photoelectric properties were studied. It was found that the forbidden band width was reduced by 0.4 eV, and its response to visible light was improved. Chang [15] prepared three common Bismuth oxyhalide compounds BiOX(X = Cl, Br, I) by oxidation-reduction method using NaBiO3 as the precursor, rhodamine B as the target pollutant to study the degradation efficiency. Shi[16] selected bismuth oxybromide (BiOBr) as the main object, using simple solvothermal method, adjusting the sample morphology Structure and size by changing the amount of surfactant polyvinylpyrrolidone (PVP), the heating temperature, and solvent type. The sample exhibited excellent response to visible light and showed excellent photocatalytic degradation of MO. Xiao [17] synthesized narrow particle size distribution, rich morphology; composition can be controlled bismuth vanadate nanomaterials with a simple solvothermal, and chose excellent performance and synthesis method through the photocatalytic degradation. Xing [18] prepared different compositions and morphologies of bismuth tungstate nanomaterials by adjusting the solution pH and the concentration of surfactant CTAB by hydrothermal method. The visible light photocatalytic degradation of methyl orange was also investigated by bismuth tungstate samples with different structures and morphologies. The results of photocatalytic methyl orange showed that the bismuth tungstate samples with different morphologies had different catalytic degradation activities to methyl orange, and the Bi2WO6 phase nanosheet was higher than that of Bi3.84W0.16O6.24 phase octahedron particles. Li et al [19] prepared bismuth molybdate photocatalyst by hydrothermal method and discussed its degradation effect on rhodamine B.

3 Doping Modification of Traditional Photocatalytic Materials TiO2 has a band gap of 3.2 eV and a corresponding absorption wavelength of 387.5 nm. The absorption of light is limited to the ultraviolet region. Therefore, the utilization rate of solar energy is only 1%, which greatly restricts the utilization of solar energy. The modification becomes the key. At present, there is several commonly used semiconductor photocatalyst modification technology, including transition metal ion doping, precious metal deposition, rare earth metal ion doping, semiconductor photocatalyst composite and other new photocatalyst development. Bismuth

472 | Lei-Lei Lin, Xin-Gang Wang and Jie Zhang photocatalysts have good photocatalytic activity under visible light, but their photocatalysts are easily overlapped with photogenerated holes. Therefore, the modification of dopant is the key to improve its photocatalytic activity. Choi et al.[20] systematically studied 21 kinds of metal ions doped TiO2 nanocrystals, and found that 11% ~ 15% Fe2+, Mo2+, Ru2+, Os2+, Re2+, V5+ and Rh2+ doped in the crystal lattice Increased photocatalytic activity. The results showed that the dopant concentration, the distribution of doping ions, the doping energy level and the matching degree of TiO2 band, the configuration of dopant D electrons, the transfer and recombination of charge and so on are very important to the photocatalytic activity. Wu et al. [21] prepared titanium dioxide photocatalysts doped with six kinds of transition metal ions, Cr, Mn, Fe, Co, Ni and Cu, respectively. The photocatalytic oxidation reaction of acetic acid aqueous solution and carbon dioxide reduction reaction were investigated and photocatalytic activity of the dopant catalyst was evaluated. The results showed that the photocatalytic activity of the dopant catalyst was improved to some extent after doping with transition metal ions. The key to improve the photocatalytic activity is how to reduce the recombination probability of photogenerated electrons and photogenerated holes. While binary or multicomponent semiconductor composites can achieve this. It has been reported that SnO2 / TiO2 [22], WO3 / TiO2 [23], MoO3 / TiO2 [24], SiO2 / TiO2 [25], CdS / TiO2 [26] can improve the photocatalytic activity of the binary composite photocatalyst reaction efficiency. LU [27] prepared TiO2 photocatalyst doped with B, P and GdB by sol-gel method. After the co-doping, the surface morphology of TiO2 was changed greatly. On the premise of maintaining the anatase phase, the grain size is reduced, so that the specific surface area becomes large. The results showed that the co - doping of rare earth elements Gd and non - metal B could reduce the grain size of TiO2, which is helpful to suppress the recombination of photo - generated electron - hole pairs, and improve the photocatalytic activity of TiO2. Jin [28] successfully prepared TiO2 nanoparticles / graphene composites with excellent photocatalytic performance by one-step hydrothermal method. By adjusting the three experimental variables of reactant concentration, reaction time and reaction temperature, the influence of the experimental parameters on the photocatalytic efficiency of TiO2 nanoparticles / graphene composites was investigated, and the experimental parameters were optimized. It was found that the photocatalytic activity was strengthened with the increase of the proportion of the graphene oxide in the TiO2 nanoparticles / graphene composites. When the ratio of graphite oxide is 44%, the reaction temperature is 120 °C and the reaction time is 6h, the photocatalytic activity of the prepared photocatalyst is the highest, which is 70% higher than that of P25. Zhu [29] synthesized α-Bi2O3 composite material modified with Ag2O by coprecipitation method. The photocatalytic performance of the composite was evaluated by degradation of methyl orange solution. The effect of Ag2O content on photocatalytic performance was analyzed. Ag2O and Bi2O3 (Ag: Bi is 3: 1) in the composite ratio was the best. Su [30] synthesized Au / BiOBr0.2I0.8 composite photocatalyst with different Au

A Review on the Application of Photocatalytic Materials | 473

contents by hydrothermal and photo-reduction method. The photocatalytic degradations of methyl orange (MO), rhodamine B (RhB) and phenol were studied. The degradation rate of MO, RhB and phenol in visible light reached 89.8%, 72.7% and 32.7%. Li [31] prepared a highly efficient composite photocatalyst for the selective deposition of silver phosphate nanoparticles on bismuth vanadate (040) crystal face by means of morphology control and heterostructure construction. The results showed that the selective deposition of silver phosphate changes the local structure of bismuth vanadate (040) crystal plane, and the selective deposition of crystal faces increases the potential difference between silver phosphate and bismuth vanadate, So that the photocatalytic activity of the composite photocatalyst is greatly enhanced. Xu [32] prepared AgI / Bi2MoO6 heterojunction composite photocatalyst by loading AgI nanoparticles on the surfaces of bismuth molybdate microspheres by a simple deposition-precipitation method at ambient temperature and pressure. The experimental results showed that, it could improve the specific surface area and absorption of light, suppress the recombination of photo-generated electrons and holes, and improve photocatalytic activity.

4 Research Status of Chalcogen Photocatalytic Materials In recent 30 years, most of the researches on photocatalysts are using TiO2 or modified TiO2 as photocatalyst. However, the research of photocatalyst has not had a great breakthrough for a long time. The key point is that its catalytic activity is not high enough. In recent years, some researchers have carried out the work of exploring new photocatalysts, and made some important progress. Such as chalcogenides, having wide range of applications in many areas because of its unique structure .such as the molybdenum disulfide has a good optical, electrical, lubrication, catalytic and other characteristics. Molybdenum disulfide has a hexagonal crystal structure, is a graphene-like structure, with high surface activity, and the appropriate band gap can guarantee the MoS2 in the visible range of photocatalytic performance. In 1999, Thurston et al. [33] used nano-MoS2 as a catalyst to degrade organic phenol by visible light, which effectively overcame the shortcomings of the small rate of Absorption Efficiency of TiO2 in Visible Region. It was found that the degradation rate of MoS2 was closely related to the size relationship. Dungey et al. [34] studied the edge structure, thermal stability and catalytic performance of the molybdenum disulfide composites. It was found that molybdenum disulfide was used as a thiophene hydrodesulfurization catalyst due to the addition of Co2+, Co3+ or Fe3+. The activity increased a lot. Zhang et al. [35] studied the modification of the AuNPs

474 | Lei-Lei Lin, Xin-Gang Wang and Jie Zhang on the surface of MoS2 nanosheets to improve the light energy absorption of the material, which will improve the photocatalytic activity of MoS2. Lin [36] synthesized TiO2/ZnS0.77Se0.23 heterojunction photocatalyst and TiO2/Co4S4.23Se3.77 heterojunction photocatalyst by solid state synthesis method and sol-gel method. The photocatalytic activity of the samples was evaluated by the degradation efficiency of methylene blue. Li [37] synthesized cadmium hydroxide nanoparticles - cadmium sulfide nanorod complex in alkali hydroxide solution by one-step method with cadmium oxide and sodium sulfide as raw materials. The results showed that a certain amount of cadmium hydroxide could effectively enhance the photocatalytic hydrogen production of cadmium sulfide. Yu et al [38] synthesized ZnIn2S4 / CdIn2S4 composite photocatalyst by hydrothermal method and investigated its photocatalytic efficiency. Wang [39] successfully prepared graphene and reduced graphene / cadmium sulfide (RGO / CdS) nanocomposite materials by solvothermal method and studied the photocatalytic degradation performance of samples.

5 Prospects for Preparation and Modification of Photocatalytic Materials With the development of industry, organic wastewater pollution is serious, and photocatalytic technology used in sewage treatment has good advantages, but there are still many shortcomings, the photocatalyst sould be improved from the following aspects; (1) Searching for new visible light response photocatalyst; (2) Reducing the band gap of the existing photocatalyst and improveing the response to the visible light; (3) Preparing the composite material to modify the traditional photocatalyst; (4) The photocatalytic mechanism should be studied in details; (5) The development of new applications of photocatalyst.

References [1] [2]

[3] [4]

J. B. Ellis. Pharmaceutical and personal care products (PPCPs) in urban receiving waters [J]. Environmental Pollution, 2006, 144 (1): 184-189. Segura P A, Francois M, Gagnon C, et al. Review of the occurrence of anti-infectives in contaminated wastewaters and natural and drinking waters [J]. Environ Health Persp, 2009, 117(5):675-684. Ternes T A, Joss A, Siegrist H. Scrutinizing Pharmaceuticals and personal care products in wastewater tre atment [J]. Environ Sci Technol, 2004, 38(20): 392-399. Zhou Xue fei, Zhang Ya lei, Dai Chao meng, Studies on the Removal Mechanism of PPCPs in the Municipal Wastewater Treatment [J]. Science of Environmental Protection, 2009, 35(2): 1517.

A Review on the Application of Photocatalytic Materials | 475 [5]

[6] [7] [8]

[9] [10] [11] [12] [13] [14] [15] [16] [17] [18]

[19]

[20]

[21] [22] [23] [24] [25]

Hu Hong ying, Wang Chao, Guo Mei ting, Current Status and Research Progress of Environmental Pollution Caused by Drugs and Personal Care Products (PPCPs) [J]. Ecosystem, 2005, 14(6): 947-952. Qian yi, Tang Xiao yan.Enviromental Protection and Sustainable Development [M]. Beijing, Higher Education Press, 2000. Jiang Yueshun, Li Tiejin, Wang Weiping. Photochemistry [M]. Beijing. Chemical Industry Press, 2005. Davide V, Claudio M, Valter M, et al. Degradation of Phenol and benzoic acid in the presence of a TiO2-based heterogeneous photocatalyst [J]. Applied Catalysis B: Environmental, 2005, 58(2):79-88. Fujishima. Hondak. Electrochemical photolysis of water at a semi-conductor electrode. Nature, 1972.238(5258):37-38. Mills A, Davies R H, Worsley D. Water Purification by Semiconductor Photocatalysis [J].Chem Soc Rev, 1993, 22 ( 6):417-425. Hoffman M R, Martin S T, Choi W et al. Environmental Applications of Semiconductor Photocatalysis [J].Chem Rev, 199595: 69-96. Chen Mei lan. Photocatalytic Degradation of Methylene Blue by Titanium Dioxide [J]. Zhejiang Chemical Industry, 2000, (02):31-33. Wang Liu gang, Zhang Jun ying, Li Chun zhi, Yang Jin an. Preparation of Bismuth Oxide Thin Film and Its Photocatalytic Activity [J]. Functional Materials, 2011, 02:355-358. Zhang Zheng guang,Wang Xiu feng,Wang Li li,Tian Qing quan.Preparation and Characterization of Bismuth Oxide Thin Films [J]. Bulletin of the Chinese Ceramic Society, 2008, 02:411-414. Chang Xiaofeng. Preparation of Bismuth Oxide and Its Photosensitive Decomposition of Rhodamine B [D]. Nanjing University of Aeronautics and Astronautics, 2014. Shi Xiaoqing. Preparation and Photocatalytic Activity of Nanometer Structure Bismuth Oxide [D]. Henan University, 2013. Xiao jun. Syntheses and Characterization of Photocatalytic Properties Bismuth Vanadate Nanumaterials [D]. Liaoning University, 2014. Xing Guang jian,Li Yu mei,Zhao zheng,Wang yi,Wu Guang ming.Preparation and Photocatalytic Properties of Bismuth Tungstate Nanomaterials with Different Morphologies[J]. Journal of Synthetic Crystal, 2010, 05:1265-1271. Li Xinyu, Fang Yanfen, Xiong Shiwei, Jia Keman, Huang Yingping. Preparation of Bismuth Molybdate Photocatalyst and Its Photocatalytic Activity [J]. Environmental Chemistry, 2013, 09:1611-1618. Choi W, Termin A, Hoffmann M R.The role of metal ion dopants in quantum-sized TiO2: correlation between photoreactivity and charge carried recombination dynamics. J Phys Chem, 1994, 98(5):13669-13679. Wu Shuxin, Ma zhi, Qin Yongning. Study on Photocatalytic Performance of Doped TiO2 Nanoparticles. Chinese Journal of Physical Chemistry. 2004, 20(2):138-143. Pilkenton S,Raftery D.Solid-state NMR studies of the adsorption and photooxidation of ethanolon mixed TiO2/SnO2photocatalysts. J Solid Nucl Magn Reson, 2003, 24: 236-253. Tatsuma T, Takeda S. Saitoh S et al. Bactericidal effect of an energy TiO2/WO3 photocatalyst in dark. J Electrochemistry Communications, 2003,5:793-796 Takahashi Y,Nagotrakanwiwat P,Tatsuma T. Energy storage TiO2/MoO3 photocatalysts. J Electrochimica Acta, 2004, 49:2025-2029. Kumar A, Jain A K. Photophysics and photochemistry of colloidal CdS-TiO2 coupled semiconductors-photocatalytic oxidation of indole. Journal of Molecular Catalysis A: Chemical, 2001, 165:265-273.

476 | Lei-Lei Lin, Xin-Gang Wang and Jie Zhang [26] [27] [28] [29] [30] [31] [32] [33] [34] [35] [36] [37] [38] [39]

Thurston T. R., Wilcoxon J. P. Photooxidation of organic chemicals catalyzed by Nanoscale MoS2 [J]. J. Phys. Chem. B, 1999, 103(1): 11-17. [27]Lu xing. Research on Photocatalytic Properties of Nonmetal and Rare Earth Doped TiO 2 [D]. Henan Normal University, 2012. Jin Chun ji. Synthesis and Photocatalytic Performance of TiO2-Graphene Nanocomposite [D]. Jilin University, 2014 Zhu lin. Controlled Synthesis and Photocatalytic Activity of Bismuth Oxide and Its Composite [D]. Harbin Normal University, 2013. Su yun. Novel Bismuth Oxyhalides-Based Composite Photocatalysts:Synthesis and their Visible- light Photocatalytic Activity[D]. Shanghai University, 2013. Li Chang jiang. Rational Design, Synthesis, and Characterization of BiVO4-based Heterojunction Photocatalysts[D]. Tianjin University, 2014. Xu ming. Synthesis, Characterization and Visible Light Photocatalytic Activity of Bi2MoO6based Photocatalysts[D]. South China University of Technology, 2015. Dungey K. E. Curtis M. D. Hahn James E. P. et al. Behavior of MoS2 intercalation compounds in HDS catalysis [J]. J. Catal., 1998, 175(1): 129-134. SHAW J C, ZHOU H, CHEN Y, et a1. Chemical Vapor Deposition Growth of Monolayer MoSe2 Nanosheets [J]. Nano Research. 2014, 7(4):1-7. BOUGOUMA M, BATAN A, GUEL B et al Growth and Characterization of Large, High Quality MoSe2 Single Crystals [J]. Journal of crystal growth, 2013, 363:122-127. Lin Wan feng. Syntheses,Structures and Properties of New Chalcogenide Semiconductor Photocatalysts [D]. Nanchang Hangkong University, 2013. Li tan.Farbrication and Visible-light Photocatalytic Hydrogen Production Activity of Metal Sulfide-based Photocatalyse [D]. Wuhan University of Technology, 2014. Yu Yao guang.Preparation of Zinc-and Cadmiunm-based Sulfide Photocatalysts for Photocatalytic Hydrogen Production [D]. Harbin Institute of Technology, 2014. Wang Xinwei. Synthesis and Photocatalytic Activity of Graphene and Graphene-based Metal Sulfid Hybrid Materials [D]. Jilin University, 2014.

Xiao-Cai Yu1*, Xiao-Lin Shang2, Jian Zhang3, Qiu-Yi Ji4, Tao Chen5 and Jin-Fang Chen6

The Preparation of Nano ZnO/PVC and the Photocatalytic Degration of Waste Water from Seafood Processing Abstract: ZnO/PVC photo catalyst was successfully synthesized by two step synthesis method. The crystal structure, bonding, crystal shape, particle size, surface morphology, etc were characterized by thermo gravimetric analysis, XRD, SEM, and FTIRS. Thermo gravimetric analysis was carried that ZnO/PVC composite begin to formate into conjugated polymer around 223 °C. In the infrared spectrum comparison, ZnO and PVC’s characteristic peaks were observed respectively, and the absorption of Zn-O-C bonding peak was found. XRD patterns show that at 150 °C, only ZnO’s peaks in the complex characteristic were apparent, and with the temperatures rise, ZnO’s characteristic peaks gradually disappeared, diffraction peak of ZnO/PVC composite was formed, and their dispersion was higher. Their photo catalytic activities were investigated under the conditions of visible light source using the waste water from seafood processing as target pollutant. According to the results, the influence orders of degradation as follows: proportion between ZnO and PVC> calcination time> calcination temperature> reaction time>photo catalyst dosage for ammonia-N and calcination temperature> calcination time>reaction time>proportion between ZnO and PVC> photo catalyst dosage for COD under visible light. According to the orthogonal experiment, ammonia-N and COD removal rates can reach 77.4% and 66.7%, respectively at the optimum experimental conditions. Keywords: no/PVC, photo catalytic degradation, visible light, preparation of catalysts; characterization of photo catalysts.

1 Introduction Over the past few decades, the photo catalytic technique has been shown to be one || 1 College of Ocean Technique and Environment department, Dalian Ocean University, China. [email protected]. 2 College of Ocean Technique and Environment department, Dalian Ocean University, China. 3 College of Ocean Technique and Environment department, Dalian Ocean University, China. 4 College of Ocean Technique and Environment department, Dalian Ocean University, China. 5 College of Ocean Technique and Environment department, Dalian Ocean University, China. 6 College of Ocean Technique and Environment department, Dalian Ocean University, China. 10.1515/9783110516623-047 DOI 10.1515/9783110303568-047

478 | Xiao-Cai Yu, Qiu-Yi Ji, Tao Chen and Jin-Fang Chen of the most promising processes for wastewater treatment because of its advantages over traditional techniques. The photo catalytic treatment of wastes containing dyes has also been widely documented [1-3]. In the current work, ZnO/PVC photo catalyst were successfully synthesized by two step synthesis method and the morphology of these photo catalysts were characterized through XRD and SEM techniques. Furthermore, the photo catalytic abilities of as-prepared powders were evaluated by utilizing them in the experiments of waste water from seafood processing under visable lamps.

2 Experimental 2.1 The Preparation of ZnO/PVC Catalyzer[4] Direct precipitation method is used in the preparation of nanometer zinc oxide. In room temperature, weigh 4.800g NaOH into 80mL distilled water to get NaOH solution. In room temperature, weigh 17.220g ZnSO4·7H2O into 80mL distilled water until it is completely dissolved, then drop 16mL polyethylene glycol 400 and mix it, quickly drop it into NaOH solution and stir fully to get white precipitation. Stewing after 3h Ultrasonic concussion (250W); then centrifuge it and wash several times by distilled water and absolute alcohol; then place it into constant temperature vacuum drying box to dry in high temperature (110°C); grind into powder and calcinate 2h in 500°C to get nano-ZnO material. Add a certain amount of nanometer zinc oxide into appropriate amount of absolute alcohol and ultrasonic disperse for 1h to make suspension, then use a certain amount of THF to dissolve corresponding mass mass ratio PVC, then drop it one by one into the previous suspension. Magnetic stirring for 1h to make it completely mixed, then dry to form cake precursor in 80°C. Calcination different hour in different temperature, then grind to get compound material [5].

2.2 Chemicals and Apparatus The prepared ZnO /PVC catalyst was characterized by carious techniques such as Xray diffraction (XRD) and Infrared spectrometer (FTIR), scanning electron microscope (SEM). The morphology and size of particles were analyzed by SEM, which was purchased from Japanese Electronics Company.

The Preparation of nano Wa aste Water from m Seafood Proc cessing | 479 4

2.3 2 Photo Catalytic Study S An A expected p proportion of waste water from seafood d processing was w produced d as a sort s of simulaated pollutantt. Different kiinds of photoo catalysts weere added into o the mixture m respectively for diffferent experim ments. The poollutant load used in the ex xperiments was ab bout 900mg/L L COD and 100 0mg/L NH4+- N. The meth hods of measu urement were e quick openiing-tube mea asurement me ethod for nd spectropho otometer for am mmonia nitroogen. f COD [6] an

3 Resultts and Disscussion n 3.1 3 Characcterization of Photo Catalysts. C 3.1.1 3 Thermo o Gravimetric Analysis A

Fig. F 1: Thermo grravimetric analyssis of precursor ZnO/PVC

Figure F 1 show ws that there iss a thermal weight w loss in 2223°C accomp panied by an obvious o exothermiic phenomeno on. Then with h the rise of teemperature, the equality re educes. e The weighttlessness ends at 595°C to achieve a a balaance. After 59 95°C, PVC is to otally decomposed d aand only ZnO O that cannott be decompoosed by high h temperature e left. Therefore, T thee calcinationss temperature e of ZnO/PVC C is better ch hosen to be about a 223°C. 2 It migh ht because tha at ZnO and PV VC are well b bonded at thiss temperature e and interact to form m conjugated d polymer and d effective cataalyst [5].

480 | Xiao-Cai Yu, Qiu-Yi Ji, Tao Chen and Jin-Fanng Chen 3.1.2 Infrared Spe ectrometer (FT TIR) nfrared spectrrum of ZnO/P PVC photocatalysts made by two-stepp Figuree 2 is the in metho od. PVC can be transform med into con njugated poly ymer which contains basee group ps C=C, -OH with w polars [7]], it compoun nds with ZnO by chemical bonds. b In thee FTIRss of ZnO/PVC, near 1 612.2 cm-1 c is asymm metric stretchiing vibration absorption off conju ugated doublee bonds, whicch shows thatt conjugated structure s is fo ormed in PVC C calcin nations by dro opping HCl[5]. The peak neear 470cm-1 is considered to be stretch-ing viibration [8, 9]. The absorpttion peak at 12223cm-1 is thee characterized peak of Zn-O-C [110]. The absorrption peak ne ear 3584cm-1 match to -OH H [7] on Polymer chain. Comparing Fig gure (a) (b) (cc), it shows an n obvious shiift at the charracterized ab-sorptiion peak of Zn nO. In Figure (a), in differeent calcinatio on temperaturre, as the cal-cinatiion ascends, the characte erized peak oof ZnO gradually changed d into 421cm-1,499ccm-1, 487cm-1, 479cm-1. Att 150°C, ZnO aand PVC are not n well comb bined, only byy physical mixing an nd there is no o change on th he peak of Zn nO. As the tem mperature risee to abo out 200°C, PV VC dehydroge enate to bond d with ZnO to form conjuga ated polymer.. he effect of in The ch haracterized peak p of ZnO shifts s due to th nteraction. In Figure (b), ass the m mass ratio betw ween ZnO and d PVC reducees the charactterized peak of o ZnO weakss gradu ually. The cha aracterized pe eaks of ZnO are at 433.19 94cm-1, 445cm m-1, 478cm-1,, 487cm m-1. In Figure (c), as the ca alcinations tim me increases, the characterrized peaks off ZnO aare at 423cm-1, 445cm-1, 489cm-1, 4 488. 7cm-1. Comparing Figure (a) (b) (c), ass thecalcinations tem mperature risses and calciinations timee increases, and a the masss ratio b between ZnO and PVC asccends the inteensity of H-O--H near 3500c cm-1 increasee then reduces. The more hydrox xyl on catalyyst surface, th he more hydrroxyl radicalss generrate and the reeactivity of ph hotocatalyst iss improved [11]. (a)

The Preparattion of nano Wa aste Water from m Seafood Processing | 481 4 (b) (

(c)

Fig. F 2: The FTIRs of ZnO/PVC. (a) Different calcination temperatuure. (b) Differentt proportion betw ween ZnO Z and PVC, (c)) different calcin nation minutes

482 | Xiao-Cai Yu, Qiu-Yi Ji, Tao Chen and Jin-Fang Chen 3.1.3 X-Ray Diffraction (XRD)

Intensity

=Q239& ˖ ˈ ć ˈ K

=Q239& ˖ ˈ ć ˈ K =Q239& ˖ ˈ ć ˈ K

=Q239& ˖ ˈ ć ˈ K 20

30

40

50

60

70

80

90

2 - T h e t a - S c a le

Fig. 3: XRD of as-prepared ZnO/PVC

From Figure3, with the calcination increases, the characterized peak of ZnO in XRD disappeared. The rising temperature decomposes PVC and keys ZnO into the structure of PVC. When the temperature reaches 150°C, the dehydrogenation decomposition of PVC fails, and the characterized peak of ZnO in compound appears obviously. Through comparing JCPDS, it is hexagonal wurtzite and the lattice constants of a, b, c are 3.2488, 3.2488 and 5.2054Å respectively. Accodign to Scherreer formula (101), the average grain diameter is 31.84. When the mass ratio of ZnO and PVC reaches 3:1, the prepared catalyst, except the characterized of ZnO, shows an obvious peak when 2θ= 26.7588°. When the temperature reaches 200-250 °C, and 2θ=26.7588° and 26.7588°, a diffraction peak appears different from ZnO. It is proved that ZnO disperses in PVC to form a diffraction peak with new structure due to a high disparity and a low diffracted intensity. At 150°C, no new diffraction peak appears at 2θ=26.7588°.

3.1.4 Electron Microscope (SEM) Figure 4 shows the augment of 60000 times the SEM of ZnO/PVC compound material made under different preparation condition.

The Preparatiion of nano Wa aste Water from m Seafood Proc cessing | 483 4 (a) (

(d)

(f) (

(b)

(c)

(e)

(g)

Fig. F 4: SEM imag ges of ZnO/PVC (a) ( ZnO/PVC, 200°C, 2:1,0.5h (b b) ZnO/PVC, 200°C, 2:1,1h (c) ZnO/PVC, Z 200°C C, 2:1,2h (d) ZnO/PVC, 200°C, 1:11, 1h (e) ZnO/PV VC, 250°C, 1:1,1h (f) ZnO/PVC, 20 00°C, 1:2,1h 1 (g) ZnO/PV VC, 50°C, 1:1,1h

484 | Xiao-Cai Yu, Qiu-Yi Ji, Tao Chen and Jin-Fang Chen Comparing Figure (a) (b) (c), with the same mass ratio of ZnO and PVC and calcination temparature, as calcination time increases, the structures of compound catalyst changes correspondingly. With calcination time increases, the decomposition degrees of PVC are different. When the temperature is 0.5h, ZnO granule lies on the particle surface. As the time increases, PVC dehydrogenation decomposes to bond with ZnO, showed cellular structures. When calcination time continues to increase, PVC bonds with ZnO, showed filamentous mosaic. Comparing Figure (d) (e) (f), with the same calcination time and mass ratio of ZnO and PVC, calcination temperature has great effect on the structure of catalyst. In Figure 6-1, from the thermogravimetric analysis of precursor ZnO/PVC shows that before 223°C, thermal weight loss is slow. When the temperature reaches 223°C, the severe heat release shows that PVC dehydrogenates to form conjugated polymer with ZnO. At 150°C, PVC fails to decompose and ZnO granule attaches to PVC particle surface. At 200 °C, the structure of PVC/ZnO changes. That is because of the effect of ZnO, PVC particle forms a more regular edge wall structure, with ZnO granules exist between edge walls. At 250°C, there is a uniform distribution of general granule and the size reaches nanometer level. PVC edge wall structure further decomposes, carbonation of partial PVC begins to form carbon particles similar to ZnO particles and together attach to the surface of PVC. Comparing Figure (b) (d) (f), at the same calcination time and temperature, different mass ratio of ZnO and PVC show different morphology of photocatalysts. When the mass ratio of ZnO and PVC reaches 2:1, ZnO is much more than PVC, showed cellular structures. When the mass ratio of ZnO and PVC reaches 1:1, the linkage of ZnO and PVC is adequate. When the mass ratio of ZnO and PVC reaches 1:2, ZnO particles disperse on the surface of PVC.

3.2 Optimization of Reaction Condition. On the basis of single-factor experiments above, an orthogonal experiment is carried out to optimize the experimental condition. The design and results of the L16 (54) orthogonal array are revealed in Table 1. It reveals that the influence of five factors on degradation of NH4+-N is ranked in decreasing order isthe mass ratio of ZnO/PVC>calcination time>calcination temperature> illumination time>adding amount, the mass ratio of ZnO/PVC =2:1 is the most effective combination, with the calcination time 90min, calcination temperature 300°C, illumination time 4h, and adding amount 0.9g/L. The factors influencing COD degradation are: calcination temperature>calcination time> illumination time>the mass ratio of ZnO/PVC>adding amount. The mass ratio of ZnO/PVC=1:1 is the most effective combination, with calcination time 90min, calcination temperature 250°C, illumination time 1h and adding amount 0.3g/L.

The Preparation of nano Waste Water from Seafood Processing | 485

In the best condition, the removal rate of ammonia nitrogen and COD will reach 77.4% and 66.7% respectively. Table 1: Designed Matrix And Experimental Results For Orthogonal Array Under Visable Light Experiment Calcination Calcination m(ZnO):m(PVC) Photocatalyst reaction NH4+-N COD time[min] temperature dosage [g/L] time[h] Removal Removal [°C] Rate[%] Rate[%] 1

1

1

1

1

1

59.5

56.4

2

1

2

2

2

2

73.1

21.8

3

1

3

3

3

3

58.7

54.7

4

1

4

4

4

4

73.0

24.4

5

2

1

2

3

4

72.1

37.8

6

2

2

1

4

3

64.0

20.0

7

2

3

4

1

2

57.6

43.1

8

2

4

3

2

1

72.0

29.8

9

3

1

3

4

2

76.3

60.0

10

3

2

4

3

1

63.5

34.2

11

3

3

1

2

4

57.9

67.1

12

3

4

2

1

3

77.4

32.4

13

4

1

4

2

3

54.7

55.6

14

4

2

3

1

4

69.3

40.4

15

4

3

2

4

1

59.6

57.3

16

4

4

1

3

2

50.0

26.2

The influence of ammonia nitrogen degradation K1

264.312

262.548

231.459

263.871

267.399

K2

265.745

269.934

282.171

257.587

244.247

K3

275.006

233.885

276.328

244.358

254.831

K4

233.664

272.360

248.767

272.911

272.249

R

41.341

38.475

50.712

9.040

28.002

The influence of ammonia nitrogen degradation K1

157.333

209.778

169.778

172.444

203.556

K2

130.667

116.444

149.333

174.222

125.333

K3

193.778

222.222

184.889

152.889

162.667

K4

179.556

112.889

161.778

161.778

169.778

R

63.111

105.778

35.556

21.333

44.444

486 | Xiao-Cai Yu, Qiu-Yi Ji, Tao Chen and Jin-Fang Chen

4 Summary (1)ZnO/PVC compound photo catalyst material is prepared through two-direct method, using thermo gravimetric analysis, infrared spectrum, XRD and SEM to characterize the bonding, crystallition, particle size and morphology. The preparation condition has great influence on the structure and ability of photo catalyst. By thermo gravimetric analysis, ZnO/PVC begins to form conjugated polymer at 223°C. By infrared spectrum, the absorption peak of Zn-O-C bonding is observed. Through the contrasting of XRD, at 150°C, only the characterized peak of ZnO in the compound is obvious. As the temperature ascends, the characterized peak of ZnO disappeared gradually and the diffraction peak formed by bonding ZnO/PVC, with a high degree of dispersion. (2) In the condition of visible light, decomposing the ammonia nitrogen and COD in the simulation of waste water in seafood processing. It is proved by orthogonal test, as for ammonia nitrogen, the factors are: the mass ratio of ZnO/PVC>calcinations time>calcinations temperature>illumination time>adding amount, the mass ratio of ZnO/PVC =2:1 is the most effective combination, with the calcinations time 90min, calcinations temperature 300°C, illumination time 4h, and adding amount 0.9g/L. The factors influencing COD degradation are: calcinations temperature>calcinations time> illumination time>the mass ratio of ZnO/PVC>adding amount. The mass ratio of ZnO/PVC=1:1 is the most effective combination, with calcinations time 90min, calcinations temperature 250°C, illumination time 1h and adding amount 0.3g/L. (3) Under the condition of visible light, with appropriate experimental condition, the removal rate of ammonia nitrogen and COD will reach 77.4% and 66.7% respectively. Acknowledgement: This work has been supported by a grant from Marine research and special funds public service sectors of Sate Oceanic Administration People’s Republic of China (201305002), General project of Liaoning provincial Education Department (L2013279), industrial enterprise technology correspondent action Scientific and technological cooperation project funds Department of Science and Technology of Liaoning (20130106).

References [1]

[2]

Bianco-Prevot A, Basso A, Baiocchi C, Pazzi M, Marci G, Augugliaro V, Palmisano L, Pramauro E. Analytical control of photo catalytic treatments: degradation of a suffocated azo dye. Anal Bioanal Chem, 2004, 378: 214-220. Kansal S K, Singh M, Sud D. Studies on photo degradation of two commercial dyes in aqueous phase using different photocatalysts. J Hazard Mater, 2007, 141: 581-590.

The Preparation of nano Waste Water from Seafood Processing | 487 [3] [4] [5]

[6]

[7]

[8] [9] [10] [11]

[12]

Liu Y, Chen X, Li J, Burda C. Photocatalytic degradation of azo dyes by nitrogen-doped TiO2 nanocatalysts. Chemosphere, 2005, 61: 11-18. Yu Xiao-cai, Chen Yue-xia, Liu Pei. Application of Nano-ZnO in the Wastewater Containing Cadmium [J]. Journal of Shenyang Institute of Chemical Technology. 2010,24(2): 122-125 Dong Pengfei,HanJing,Shao Qiwei et al. Study on the photo catalytic property of ZnO nanorod/PVC composite (Chinese)[J]. Journal of East China Normal University (Natural Sc, 2009, 2009(5): 29-39, 8. Long Tengfa, Li Lei,Yan Changqi, el al. Preparation and Properties of ZnO/Bi203 Multiphase Photo catalytic Materials Response to Visible Light. Journal of synthetic crystals [J]. 2011, 40(6): 1607-1611. Ma Zhanying, Min Shixiong, She Shixiong, Su Bitao . Catalytic Property of ZnO/Conjugated Polymer Complex Particles under Natural Light [J]. Chinese Journal of Applied Chemistry, 2005, 22(10): 1137-1140. Jimnez-Gonz lez A E, Soto UruetaJ A, Surez-Parra R. Optical and electrical Characteristics of aluminum - doped ZnO thinfilms prepared by sol - gel techni Cue [J]. cryst. Growth, 1998, 192: 430. Study on IR, UV-Vis Spectra of Nano- ZnO and Their Thin Films [J]. The Journal of Light Scattering, 2003, 15(3): 197-199 Yi Jianjun;Yu Peng;Xu Xuexiang;Zhao Wei;Jing Zhenhua. Synthesis Of Novel Halfmetallocene Complexes ([O, O]CpTiCl Containing Bisphenoxy Ligands And Their Catalytic Properties For Ethylene Polymerization[J]. Chemical Journal of Chinese Universities. 2001, (03): 342. Yu Changlin, Yang Kai, Yu Jimmy C, Peng Peng, Cao Fangfang, Li Xin, Zhou Xiaochun. Effects of Rare Earth Ce Doping on the Structure and Photocatalytic Performance of ZnO[J]. Acta Phys. -Chim. Sin.2011, 27(02): 505-512.

Liang Jiang1, Ling-Bing Qiu2, Yi-Zhou Li3, Lei Guo4, De-Liang Duan5, Wei Wang6 and Jia-Qiang Wang7*

Efficient Adsorptive Removal of Arsenic from Water by Titanium-Based Metal-Organic Frameworks (MIL-125)

Abstract: The titanium-based metal organic framework (MIL-125) was synthesized for removal of arsenic from water for the first time. The samples were characterized by XRD and N2 adsorption-desorption measurements. The results show that the adsorption capacity of MIL-125 can reach around 123.5mg·g-1 after the reaction time of 4h when the initial concentration of As(V) was 40mg·L-1 at pH values from 4 to 10,

|| 1 Yunnan Provincial Collaborative Innovation Center of Green Chemistry for Lignite Energy, Yunnan Province Engineering Research Center for Photocatalytic Treatment of Industrial Wastewater, The Universities’ Center for Photocatalytic Treatment of Pollutants in Yunnan Province, School of Energy, School of Chemical Sciences & Technology, Yunnan University, Kunming, 650091, China, [email protected]. 2 Kunming Center of Environmental Monitoring, Kunming, 650228, China, [email protected]. 3 Yunnan Provincial Collaborative Innovation Center of Green Chemistry for Lignite Energy, Yunnan Province Engineering Research Center for Photocatalytic Treatment of Industrial Wastewater, The Universities’ Center for Photocatalytic Treatment of Pollutants in Yunnan Province, School of Energy, School of Chemical Sciences & Technology, Yunnan University, Kunming, 650091, China, [email protected]. 4 Yunnan Provincial Collaborative Innovation Center of Green Chemistry for Lignite Energy, Yunnan Province Engineering Research Center for Photocatalytic Treatment of Industrial Wastewater, The Universities’ Center for Photocatalytic Treatment of Pollutants in Yunnan Province, School of Energy, School of Chemical Sciences & Technology, Yunnan University, Kunming, 650091, China, [email protected]. 5 Yunnan Provincial Collaborative Innovation Center of Green Chemistry for Lignite Energy, Yunnan Province Engineering Research Center for Photocatalytic Treatment of Industrial Wastewater, The Universities’ Center for Photocatalytic Treatment of Pollutants in Yunnan Province, School of Energy, School of Chemical Sciences & Technology, Yunnan University, Kunming, 650091, China, [email protected]. 6 Yunnan Provincial Collaborative Innovation Center of Green Chemistry for Lignite Energy, Yunnan Province Engineering Research Center for Photocatalytic Treatment of Industrial Wastewater, The Universities’ Center for Photocatalytic Treatment of Pollutants in Yunnan Province, School of Energy, School of Chemical Sciences & Technology, Yunnan University, Kunming, 650091, China, wangwei2ynu.edu.cn. 7 Yunnan Provincial Collaborative Innovation Center of Green Chemistry for Lignite Energy, Yunnan Province Engineering Research Center for Photocatalytic Treatment of Industrial Wastewater, The Universities’ Center for Photocatalytic Treatment of Pollutants in Yunnan Province, School of Energy, School of Chemical Sciences & Technology, Yunnan University, Kunming, 650091, China, [email protected]. 10.1515/9783110516623-048 DOI 10.1515/9783110303568-048

490 | Liang Jiang, Ling-Bing Qiu, Wei Wang and Jia-Qiang Wang which is much higher than that of other metal organic frameworks (MOFs) materials reported so far. The adsorptive property of MIL-125 is hardly affected by temperature and it could be used in a wide pH range. These results indicate that MIL-125 is a promising adsorbent for efficient removal of arsenic from water. Keywords: removal of arsenic, adsorption, metal-organic frameworks, MIL-125.

1 Introduction Metal organic frameworks (MOFs) have received a great deal of interest because of most of them have large specific surface area, flexible channel structure, strong chemical stability, the unique crystal structure, and therefore can be applied in the catalysis [1], adsorption separation [2,3], optical materials [4] and magnetic materials [5,6], etc. Most of MOFs materials are used in gas adsorption and catalytic synthesis [7-14]. And most of the other MOFs materials are applied in the removal of pollutants in water or air owing to their unique properties, such as the treatments of benzothiophene [15], methyl orange and methylene blue [16], phthalic acid and diethyl phthalate [17], nitrobenzene [18], volatile organic compounds [19] and so on. But so far, MOFs materials for the treatments of heavy metal ions in water have received much less attention while environmental pollution by heavy metal ions, especially by arsenic has been one of the most problematic worldwide issues because of its effects on human health and ecological systems [20,21]. There are few literatures are reported, for example, Zhu [22] et al reported that the adsorptive capacity of As(V) by the iron and 1,3,5-benzenetricarboxylic metal-organic coordination polymers (Fe−BTC) was 57.7mg·g-1 when the initial As(V) concentration is 5 mg·L-1, Yi-nan Wu [23] et al presented that the adsorptive capacity of hierarchical zeolitic imidazolate framework-8 (ZIF-8) is up to 90.92 mg·g-1 when the initial concentration of As(V) is 5.0 mg·L-1. However, MIL-125 has never been reported for the removal of As (V) as of today. Herein, it is more important to establish efficient methodology to use MIL-125 to remove As (V) from water because previous studies have focused mostly on the adsorption and catalysis [24, 25]. This article reported an efficient absorbent of MIL-125 with higher adsorption capacity of As (V), and the effects of reaction time, temperature, pH on the adsorption rate and adsorption capacity were also investigated.

Efficient Adsorptive Metal-Organic Frameworks (MIL-125) | 491

2 Experimental 2.1 Materials All chemicals were used without further purification.

2.2 Synthesis MIL-125 was synthesized following the procedure reported by M. A. Nasalevich [26] et al. 3.53 g of terephthalic acid and 56 mL of anhydrous DMF were mixed and placed in a round bottom flask. The mixture was then heated at 105°C for 1h to dissolve the acid and remove the water residuals. Keeping the temperature of the solution at 105 oC 14 mL of anhydrous methanol was added and a reflux condenser was applied. The solution was boiled under stirring for 1 h longer. After that 4.2 mL of titanium is protoxide was added. The resulting mixture was kept under stirring and refluxed for 72 h at 100oC. After cooling down to room temperature and filtering the mixture a white solid was isolated. It was washed with DMF for 24 h at 155 oC and then methanol at 100 oC. The white product was dried in air at 100 oC to remove methanol from the pores.

2.3 Characterization Powder X-ray diffraction (XRD) experiments were conducted on a D/max-3B spectrometer with Cu Kα radiation (Rigaku, Japan). Brunauer-Emmett-Teller (BET) surface areas and pore volumes were measured by the nitrogen adsorption/desorption measurements using a NOVA 2000e gas sorption analyzer (Quanta, USA).

2.4 Adsorption Measurements 0.02 g samples were added into a beaker with 100 mL of solution containing arsenic. The pH value of solution was adjusted by HCl and NaOH and measured with pH meter (Lei Ci made in Shanghai) without buffer before the adsorption. H5As3O10 (A.R.) was used as the source of As (V). All experiments were performed at 25 oC except for the effect of temperature experiment. Finally, the samples were centrifuged and analysed for the arsenate concentration. The adsorption capacity of the adsorbents for As (V) was calculated according to the following equation: qe=V (C0-Ce) / m

(1)

492 | Liang Jiang, Ling-Bing Qiu, Wei Wang and Jia-Qiang Wang Where C0 and Ce represent initial and equilibrium concentrations of arsenate solution (mg·L-1), respectively. V is the volume of As (V) solution (mL), and m is the mass of adsorbent (mg).

3 Results and Discussion 3.1 The Characterization of MIL-125

Intensity (a.u.)

The XRD pattern of the MIL-125 synthesized in this work is displayed in Fig. 1. The pattern from the MIL-125 in this article was practically identical and was in good agreement with the simulated XRD patterns of MIL-125 reported by Se-Na Kim [24] et al., which indicated the presence of the crystalline titanium MOF structure. As shown in Fig. 2, the N2 adsorption/desorption isotherm of MIL-125 can be classified as IUPAC type IV, suggesting the presence of mesopores. The Brunauer–Emmett– Teller (BET) surface area and average pore volume are 1340.1 m2·g-1 and 0.17 cm3·g-1, respectively.

5

10

15

20

2-T h eta ( d eg re e )

Fig.1: XRD pattern of MIL-125

25

3

Volume Absorbed cm / g

Efficient Adsorptive Metal-Organic Frameworks (MIL-125) | 493

500 480 460 440 420 400 380 360 0.0

0.2

0.4

0.6

0.8

Relative Pressure P / P0

1.0

Fig.2: N2 adsorption/desorption isotherm of MIL-125

3.2 Effect of the Initial Concentration of Arsenic Solution on As(V) Removal

140 120

q (mg/g) e

100 80 60 40 20 0

0

10

20

30

Co(mg/L)

40

50

60

Fig. 3: As (V) removal using MIL-125: The mass of MIL-125, 0.2 g·L-1; pH =7.0; T=25 oC

494 | Liang Jiang, Ling-Bing Qiu, Wei Wang and Jia-Qiang Wang

40

Ce / qe

30 20 10 0 0.00 0.05 0.10 0.15 0.20 0.25 0.30 0.35 0.40

Ce (mg / L)

Fig. 4: The Langmuir isothermal adsorption curve of MIL-125

The effect of the initial concentration of arsentic on As (V) removal is shown in Fig.3. It is seen that the As(V) removal increased rapidly at the initial concentration of arsenic solution was less than 40 mg/L, decreased slowly at the initial concentration was from 40 mg·L-1 to 50 mg·L-1, and even decreased rapidly at the initial concentration was more than 50 mg·L-1. The main reason is that the pores of MIL-125 were blocked because the As (V) was adsorbed by MiL-125, which hindered more As (V) ions entering into the pores of MIL-125. The results of the As (V) adsorption isotherms (Fig. 3) on MIL-125 fitted to the Langmuir equation (Fig.4). The maximum adsorptive capacity was calculated to be 123.5 mg·g-1 when the initial concentration of As (V) was 40 mg·L-1 after 4h. MIL-125 exhibited faster adsorption kinetics as well as higher adsorption capacities compared with the reported literatures [22, 23].

3.3 Effect of the Seaction Time on As(V) Removal The variation of adsorption capacity with reaction time over MIL-125 is shown in Fig.5. It is seen that MIL-125 was very effective in removing As (V) (maximum adsorption capacity was 123.5 mg·g-1 when the reaction time was 4h) and achieved adsorption equilibrium after 4 h.

Efficient Adsorptive Metal-Organic Frameworks (MIL-125) | 495

120

q (mg / g) e

100 80 60 40 0

2

4

6

8 10 12 14 16 18 20 22 24

t (h)

Fig. 5: Effect of reaction time on adsorption capacity of As (V): initial concentration, 40.0 mg·g-1; the mass of MIL-125, 0.2 g·L-1, pH=7; T=25 oC

qe(mg/g)

130 125 120 115 110 10

20

30

40

50

T(ć )

60

70

80

90 100

Fig. 6: Effect of temperature on adsorption capacity of As (V): initial concentration, 40.0mg·g-1; the mass of MIL-125, 0.2 g·L-1; pH=7

496 | Liang Jiang, Ling-Bing Qiu, Wei Wang and Jia-Qiang Wang

140

qe(mg/g)

120 100 80 60 40 20 2

4

6

pH

8

10

12

Fig.7: Effect of pH on adsorption capacity of As (V): initial concentration, 40.0 mg·g-1; the mass of MIL-125, 0.2 g·L-1; T=25 oC

3.4 Effect of Temperature on As(V) Removal The adsorption capacity was affected by temperature was presented in Fig. 6. It was found that the adsorption capacity could reach about 123.5 mg·g-1 at the temperature from 20 to 60 oC and decreased slowly from 60 to 90 oC. This indicates that temperature has little influence on adsorption capacity, and removing As (V) by MIL-125 could be carried out at the room temperature.

3.5 Effect of pH of Arsenic Solution on As(V) Removal The effect of pH on adsorption capacity was also investigated and depicted in Fig. 7. It reveals that adsorption capacity of MIL-125 increased when pH from 2 to 4 and it tended to approach a maximum value (about 123.5 mg·g-1) at pH between 4 and 10. A remarkable observation was that, adsorption capacity decreased with increasing pH at pH>10, which can be attributed to the precipitation reaction between hydroxyl ions and As (V) ions. Therefore, pH variation between 4 and 10 was found to have less effect on adsorption capacity.

Efficient Adsorptive Metal-Organic Frameworks (MIL-125) | 497

4 Conclusions In this work, MIL-125 as an efficient adsorbent exhibited excellent adsorption capacity for removal of arsenic from water, which may provide reference for treatments of other heavy metal ions by MOFs materials. Acknowledgement: This research was financially supported by the National Science Foundation of China (Project 21263027, 21573193), Program for Innovation Team of Yunnan Province, Innovative Research Team (in Science and Technology) in Universities of Yunnan Province, and Key Laboratory of Advanced Materials for Wastewater Treatment of Kunming. The authors also thank Key project from Yunnan Educational Committee (Project ZD2012003) for financial support.

References [1] [2] [3] [4] [5]

[6]

[7] [8] [9]

[10] [11]

[12]

[13]

W. Kaneko, M. Ohba, S. Kitagawa, A flexible coordination polymer crystal providing reversible structural and magnetic conversions, J. Am. Chem. Soc. 129 (2007) 13706-13712. J.L.C. Rowsell, O.M. Yaghi, Metal-organic frameworks: a new class of porous materials, Microporous Mesoporous Mater. 73 (2004) 3-14. E.J. Cussen, J.B. Claridge, M.J. Rosseinsky, et al, Flexible sorption and transformation behavior in a croporous metal-organic framework, J. Am. Chem. Soc. 124 (2002) 9574-9581. J. Yu, L. Zhou, H. Zhang, Efficient electroluminescence from new lanthanide (Eu3+,Sm3+) complexes, Inorg. Chem. 44 (2005) 1611–1618. W.X. Zhang, Y.Y. Yang, SB Zai, et al, Syntheses,structures and magnetic properties of dinuclear copper(II)-lanthanide(III) complexes bridged by 2-hydroxymethyl-1-methylimidazole, Eur.J. Inorg. Chem. 2008 (2008) 679-685. X.J. Zheng, L.C. Li, S Gao, et al, Hydrothermal syntheses, structures and magnetic properties of two transition metal coordination polymers with a square grid framework, Polyhedron 23 (2004) 1257-1262. K. Yang, Q. Sun, F. Xue, et al, Adsorption of volatile organic compounds by metal-organic frameworks MOF-177, J. Environ. Chem. Eng. 1 (2013) 713-718. N. Heymans, S. Vaesen, G. De Weireld, A complete procedure for acidic gas separation by adsorption on MIL-53 (Al), Microporous Mesoporous Mater. 154 (2012) 93-99. J.R. Karra, B.E. Grabicka, Y.G. Huang, et al, Adsorption study of CO2, CH4, N2, and H2O on an interwoven copper carboxylate metal–organic framework (MOF-14), J. Colloid Interface Sci. 392 (2013) 331-336. J.M. Yang, Q. Liu, W.Y. Sun, Shape and size control and gas adsorption of Ni(II)-doped MOF5nano/microcrystals, Microporous Mesoporous Mater. 190 (2014) 26-31. N.D. McNamara, G.T. Neumann, E.T. Masko, et al, Catalytic performance and stability of (V) MIL-47 and (Ti) MIL-125 in the oxidative desulfurization of heterocyclic aromatic sulfur compounds, J. Catal. 305 (2013) 217-226. T. Van Vu, H. Kosslick, A. Schulz, et al, Influence of the textural properties of Rh/MOF-5 on the catalytic properties in the hydroformylation of olefins, Microporous Mesoporous Mater. 154 (2012) 100-106. X.K. Qian, Z.Y. Zhong, B.L. Yadian, et al, Loading MIL-53(Al) with Ag nanoparticles: Synthesis, structural stability and catalytic properties, Int. J. Hydrogen Energy 39 (2014) 14496 -14502.

498 | Liang Jiang, Ling-Bing Qiu, Wei Wang and Jia-Qiang Wang [14] [15]

[16]

[17]

[18] [19]

[20] [21] [22]

[23]

[24] [25]

[26]

W. Kleist, M. Maciejewski, A. Baiker, MOF-5 based mixed-linker metal–organic frameworks: Synthesis, thermal stability and catalytic application, Thermochim. Acta 499 (2010) 71-78. E. Haque, J.E. Lee, I.T. Jang, et al, Adsorptive removal of methyl orange from aqueous solution with metal-organic frameworks, porous chromium-benzenedicarboxylates, J. Hazard. Mater. 181 (2010) 535-542. E. Haque, J.W. Jun, S.H. Jhung, Adsorptive removal of methyl orange and methylene blue from aqueous solution with a metal-organic framework material, iron terephthalate (MOF-235), J. Hazard. Mater. 185 (2011) 507-511. N.A. Khan, B.K. Jung, Z. Hasan, et al, Adsorption and removal of phthalic acid and diethyl phthalate fromwater with zeolitic imidazolate and metal–organic frameworks, J. Hazard. Mater. 282 (2015) 194-200. L.T. Xie, D.H. Liu , H.L. Huang, et al, Efficient capture of nitrobenzene from waste water using metal–organic frameworks, Chem. Eng. J. 246 (2014) 142-149. K. Yang, Q. Sun, F. Xue, et al, Adsorption of volatile organic compounds by metal–organic frameworks MIL-101: Influence of molecular size and shape, J. Hazard. Mater. 195 (2011) 124131. H.J. Sun, B. Rathinasabapathi, B. Wu, et al, Arsenic and selenium toxicity and their interactive effects in humans, Environ. Int. l69 (2014) 148-158. T.R. Etmannski, R.C. Darton, A methodology for the sustainability assessment of arsenic mitigation technology for drinking water, Sci. Total Environ. 488 (2014) 505-511. B.J. Zhu, X.Y. Yu,Y. Jia, et al, Iron and 1,3,5-benzenetricarboxylic metal−organic coordination polymers prepared by solvothermal method and their application in efficient As(V) removal from aqueous solutions, J. Phys. Chem. C 116(2012) 8601-8607. Y.N. Wu, M.M. Zhou, B.R. Zhang, et al, Amino acid assisted templating synthesis of hierarchical zeolitic imidazolate framework-8 for efficient arsenate removal, Nanoscale 6(2014) 1105-1112. S.N Kim, J. Kim, H.Y. Kim, et al, Adsorption/catalytic properties of MIL-125 and NH2-MIL-125, Catal. Today 204 (2013) 85- 93. N.D. McNamara, G.T. Neumann, E.T. Masko, et al, Catalytic performance and stability of (V) MIL-47 and (Ti) MIL-125 in the oxidative desulfurization of heterocyclic aromatic sulfur compounds, J. Catal. 305 (2013) 217-226. M.A. Nasalevich, M.G. Goesten, T.J. Savenije, et al, Enhancing optical absorption of MetalOrganic Frameworks for improved visible light photocatalysis, Chem. Commun. 9(2013) 1057510577.

Hong-Quan Li1, Gai-Li Yue2* and Na Zhao3

The Research of SVG in Three-Phase Four-Wire Power System Abstract: In three-phase four-wire system, there are common problems such as unbalanced three-phase voltage and zero sequence current. The paper puts forward the positive sequence and negative sequence component decoupling method to solve the unbalanced three-phase voltage and the influence of the distortion of phase lock loop. In order to improve the power quality, the paper also puts forward a method based on the instantaneous of symmetrical component of reactive current, negative sequence and zero sequence current. The SVG system simulation was set up to validate the above method. Simulation results show that the reactive power generator based on the method not only can accurately detect the negative sequence and zero sequence current and reactive current and improve power quality and eliminate the influence of voltage unbalance. Keywords: SVG, Three-phase four-wire power system, Instantaneous symmetrical component method, Zero sequence current, Reactive current.

1 Introduction With the large use of non-linear electrical equipment, especially with the improvement of power network intelligence, power electronic devices will be widely used in power grid, but these devices will consume large amounts of reactive power. The lack of reactive power will cause the lower end of the line voltage, and even beyond the allowable range of voltage, resulting in some of the electrical equipment cannot be used properly. Therefore, the function of static var generator will be more and more significant, and the research on its performance is of great significance. At present, most of the low voltage users in our country adopt the three-phase four-wire connection method. The three-phase four-wire system (380V) has a large proportion in the current power grid of China. Under this voltage level, if the threephase load asymmetry will cause the neutral point offset, the neutral line flows through the zero sequence current [1]. The existence of the zero sequence current will not only increase the power loss of the transformer and line, and zero sequence current too large will cause transformer overheating and insulation failure that || 1 Xi’an University of Science and Technology, Xi’an China 710054, [email protected] 2 Xi’an University of Science and Technology, Xi’an China 710054, [email protected] 3 Xi’an University of Science and Technology, Xi’an China 710054, [email protected] 10.1515/9783110516623-049 DOI 10.1515/9783110303568-049

500 | Hong-Quan Li, Gai-Li Yue and Na Zhao reduces the service life of the transformer and even burn winding. Therefore, the compensation of zero sequence current in three-phase four-wire system is of great significance [2].

2 SVG Mmathematical Model The working principle of SVG is equivalent to connect to the same grid frequency in the grid side; the size of output AC voltage source is controllable. Taking into account the connection reactors and converter itself has a certain loss. The equivalent circuit diagram of SVG is shown in Fig. 1.

Fig.1: SVG equivalent circuit and working principle

US sin(90$  M )

UL sin G

Where δ is the phase difference between

UI sin(90$  M  G )

U I and U S ; M

(1)

connected reactor imped-

ance angle. Can be got from the above equation:

U L=

U S s in G cosM

(2)

The effective values of reactive current and active current absorbed by SVG in steady state:

IQ

UL 2

R X

2

sin(90 $  G )

US sin 2G 2R

(3)

The Research of SVG in Three-Phase Four-Wire Power System | 501

IP

UL 2

2

R  X

cos(90 $  G )

US (1  cos 2 G ) . 2R

(4)

The reactive power and active power absorbed by the power grid are:

Q P

I QU S

I PU S

U S2 sin 2 G 2R

U S2 (1  co s 2 G ) 2R

(5) (6)

According to the formula (5) (6), δ is the phase between converter voltage and the grid voltage. Change the size of δ, and change the size of the

U I , the amplitude and

x

phase of the current I will be changed, so as to adjust the size of the reactive power absorbed by the SVG. The SVG system mainly includes signal acquisition part, DSP control circuit, driving circuit and main circuit. In this paper, SVG adopts 4 forms, the fourth arm bridges into the middle line phase, which is used to realize the compensation of zero sequence current, as shown in Fig. 2.

Fig. 2: Four bridge arm SVG model

During the operation of the power system, the three-phase voltage and current is symmetrical or not, and the voltage waveform distortion of the power system will affect the accuracy of the detected current signal. So the accuracy of the signal acquisition (the accurate extraction of the compensation current command signal) will have an important impact on the effect of SVG compensation.

502 | Hong-Quan Li, Gai-Li Yue and Na Zhao

3 Reactive Current and Negative Sequence and Zero Sequence Current Detecting Method At present, the detection method of reactive current which is widely used in static var generator is based on instantaneous reactive power theory ( p  q method and i p  iq method). The basic idea is that the input of the three-phase power signal is transformed by the transformation matrix, and the active component and reactive component are decoupled. The research object of this paper is a three-phase four-wire system. It is inevitable to deal with the imbalance problem, whether the power system voltage is unbalanced or the output current is unbalanced. This paper presents a symmetric component method that makes the asymmetric phase summarization.

3.1 The Symmetric Component Method The instantaneous currents in three-phase asymmetric

iaǃibǃic is divided into

three groups of symmetrical vector of the positive sequence current component

ia (1)ǃib (1)ǃic (1)

,the negative sequence component electric

zero sequence current component

ia (0)ǃib (0)ǃic (0)

ia (2)ǃib (2)ǃic (2)

and the

. Taking the A phase current as an

example, the relation expression is: ª ia (1) º « » «ia (2) » « » ¬ia (0) ¼

Type:

ª1 a 1« 1 a2 3 «« 1 1 ¬

a 2 º ªia º » a » «ib » « » 1 » «¬ ic »¼ ¼

ªia º s «ib » . « » «¬ ic »¼

(7)

iaǃibǃic respectively for the instantaneous value of the three-phase current,

ia(0)ǃib(0)ǃic(0)

respectively for a phase of positive sequence, negative sequence and

zero sequence current. The zero sequence current of each phase is:

ia (0)

ib (0)

ic (0)

1 (ia  ib  ic ) . 3

Each phase positive sequence current component as follows:

(8)

The Research of SVG in Three-Phase Four-Wire Power System | 503

ªia (1) º « » «ib(1) » « » ¬ ic (1) ¼

ª1 1« 2 a 3 «« ¬a

a 1 a2

a 2 º ªia º » a » «ib » . « » 1 ¼» «¬ic »¼

(9)

3.2 The Reactive, Negative and Zero Sequence Current Detection From the three-phase coordinate system to the two-phase stationary coordinate system transformation that is

ªiD º «i » ¬E¼

abc  DE

transformation [5, 6] we can get:

1 1 º ª ªi º ªia (1) º «1  2  2 » « a (1) » « » » «ib(1) » C32 «ib(1) » 2/3« 3 3 « »« » «ic (1) » ¬ ¼ «¬0 2  2 »¼ ¬ic(1) ¼

(10)

To solve the voltage unbalance and distortion of phase-locked loop, and put forward the double synchronous rotating frame method for positive sequence and negative sequence component decoupled, on a phase of positive sequence voltage component phase-locked loop [7]and get a sine and cosine signal with A phase of positive sequence voltage component in phase. The positive sequence, negative sequence and zero sequence reactive current detection principle as shown in Fig. 3.

Fig. 3: Zero, negative and positive sequence reactive current detection

4 The Fuzzy Control of SVG The traditional current as shown in Fig. 4, the use of double closed loop feedback control (the inner loop for the current loop, the outer loop for the voltage loop).

504 | Hong-Quan Li, Gai-Li Yue and Na Zhao

Fig. 4: Schematic diagram of direct current control method

In Fig.4, the output current reference value iq (1) ref back value of iq (0)

 i(0) ref , idref and the feed-

 iq (1) , id through the PI regulator current tracking control can be

achieved without steady-state error. In view of the deficiency of the traditional PI control, this paper puts forward the fuzzy PI control, using fuzzy control to adjust the parameters of PI controller. The basic idea is: the fuzzy rule is used to control the PI parameter, which is automatically adjusted according to the requirement of the system performance, and ultimately improve the static and dynamic properties of compensation of SVG. The current direct control method based on fuzzy PI control as shown in the Fig. 5.

Fig. 5: Direct current control of fuzzy PI control

The Research of SVG in Three-Phase Four-Wire Power System | 505

5 The SVG System Simulation and Result Analysis When the three-phase load is asymmetric resistance inductive load, the voltage and current waveform of the load side are shown in Fig. 6, the current and voltage are different in phase, the current lags voltage, and the amplitude of three-phase current is not equal. At this time, the current contains the reactive component and the unbalanced component (including negative sequence component and zero sequence).

Fig. 6: The waveform of voltage and current before compensation

The Fig. 7 is the A phase compensation network side voltage and current waveform. From the figure can be seen, the SVG system incorporated into the power grid, due to the load is resistive and inductive load, when t in [0 0.04], grid side current waveform lagging voltage waveform, and the voltage and current in the same phase after 0.04 seconds, the purpose of reactive power compensation is achieved.

Fig. 7: A phase voltage and current waveform

506 | Hong-Quan Li, Gai-Li Yue and Na Zhao From Fig. 8 can be seen: about 0.06 three-phase current basically is a set of symmetric pharos, the net side current and voltage is same phase and the power factor are significantly improved, the zero sequence and negative sequence unbalance current are effectively inhibited.

Fig. 8: The grid side of the three-phase current

6 Conclusions This article describes the three-phase four-wire 380V power grid compensation work SVG in unbalanced operating conditions. Static var generator has the compensation of reactive current, and the compensation performance of the unbalanced current is suppressed. Therefore, it plays a better role in improving the power factor and power quality, ensuring reliable operation of the power grid.

References [1]

[2]

[3]

[4]

[5]

Yang Xuan, Wu Fang, Zhang Zhixiong, Ye Jie, Analysis of zero-sequence current control in Three-phase Four-wire grid-connected System[J]. Journal of Huazhong University of Science and Technology, 2014, 42 (10): 83-87 Zhu Caihong, Huang Shanshan, Gao Jiansen, Li Zongli, Li Lingling, Research on SVG Reactive Power Detection Method Based on Adaptive Theory and the Control System[J]. Journal of electrical engineering and technology, 2013, 28(3):309-314 Hu Yinghong,Wang Jianze,Ren Jiajia,Ji Yanchao,Balance Component Decomposition and Compensation Method for Unbalanced Load[J]. China Electric Machine Engineering Journal, 2012,32 (34 ) :98-104 Chen Xuezhe, Shen Fenglong, Wang Jianhui, Piao Xianguo, Reactive Power Compensation for Power System based on Instantaneous Symmetrical Components Method[J]. Electric power system and its automation, 2012, 24(2):107-112 Zhu Jingming, Pang Dan, Wang Yao, Wang Zhenhao, Three-phase Four-wire D-STATCOM Control based on Instantaneous Symmetrical Components Method[J]. Electrical measurement and instrumentation, 2014, 51(23):48-54

The Research of SVG in Three-Phase Four-Wire Power System | 507 [6] [7]

Li Ming, Wang Yue, Fang Xiong, Research on single-phase DQ phase-locked loop without imaginary signal generation [J]. Chinese Journal of Electrical Engineering, 2011, 31(15):27-32 Chen Guodong, Zhu Miao, Cai Xu, Li Rui, Song Jinfeng, Zhou Yue, A New Algorithm for Software Phase Locked-loop and Voltage Sag Detection[J]. China Electrical Engineering, 2014, 34(25):4385-4394

Fei-Huang Chu, Cheng-Wen Zhang1* and Hong-Bing Yu2

The Application of CDMA Technology in the Measurement of Antenna Array Abstract: In view of the current measurement of antenna array radiation phase characteristics, this paper proposes a method for measuring the radial phase characteristics of antenna array based on multi-channel CDMA excitation and multichannel CDMA receiving technique. The method using amplitude and phase can be adjusted precisely multiplexing code division multiple access (CDMA) signals as the antenna array each element incentive and use multi-channel receiver in the far field and receives, multipath CDMA signal separation, get the brightest point on the test signal is generated by the relative amplitude and phase characteristics of incentive, combined with antenna array position and structure, measuring point position information and measurement point synthetic field size and solve the antenna array radiation characteristic parameters. The simulation results show that this method can effectively measure the radial phase characteristics of the antenna array, and the method are more simple and direct than other methods. Keywords: antenna array measurement, amplitude and phase characteristics, CDMA.

1 Introduction Antenna is an important device in front of any radio communication systems which are cannot do without it, the task of high frequency current energy transmitter output (wave) converted into electromagnetic radiation out, or when the space wave signal into high frequency current energy to receiver. In practical applications, in order to enhance the directivity of the antenna, and to obtain a higher transmission power, most of the methods used to make the antenna array [1-2]. Antenna array can realize the direction of electric scanning capability in space, and through using multi beam technology, in order to achieve true multi target interference ability, in addition to the use of antenna arrays, spatial power synthesis can be achieved under the optimal incentive, so as to solve the limitations of a single amplifier output power. But for the antenna array for measuring the amplitude and phase characteristics, in the actual situation faced enormous challenges, especially large size antenna array through the existing measurement method is difficult to antenna array || 1 403 Department of Electronic Engineering College of Anhui Province, China. [email protected] 2 [email protected] 10.1515/9783110516623-050 DOI 10.1515/9783110303568-050

510 | Fei-Huang Chu, Cheng-Wen Zhang and Hong-Bing Yu radiation characteristics, accuracy is relatively limited, which greatly affect the working efficiency of the system of radio equipment. Summarized in this paper from an existing antenna array measurement method, the CDMA communication technology and its application in the measurement of antenna array, using amplitude and phase can be adjusted precisely multiplexing code division multiple access (CDMA) signals transmitted through the antenna out, and in the far field through the CDMA receiver to distinguish multiple signals and get the phase difference between the various signal amplitude and the signal, combined with the total field intensity far field radiation characteristics of the antenna parameters are obtained.

2 Theoretical Analysis 2.1 Antenna Array Coupling Matrix When the measurement of the antenna array is not high and the antenna spacing is larger, the ideal work and mutual interference between the antenna elements can be considered. But in fact, the mutual coupling effect between the array elements has a certain influence on the measurement accuracy, especially the array element spacing is relatively small, the mutual coupling effect on the performance of the direction finding is very obvious. In order to ensure high precision measurement, the mutual coupling between antenna array elements and antenna array elements must be considered [3]. When the antenna array consisting of two or more antenna elements, each antenna element except for the electromagnetic field generated by the current itself, but also by the electromagnetic field produced by other units of the current array, introducing the coupling current. This effect is called mutual coupling. The mutual coupling is inherent to the antenna array characteristics, due to the between each unit through the interaction and influence of space electromagnetic field and electromagnetic coupling effect, especially when the antenna element spacing is small, coupling behave is more strongly [4]. Unlike a single antenna in free space, the results of this electromagnetic coupling (or induction) will cause the current and impedance of each element of the antenna to be changed. At this point in the measurement, it can be concluded that the impedance of the antenna unit is composed of two parts, a part of is not considering the effect of mutual coupling when the impedance, known as self-impedance; another part is caused by the mutual coupling impedance and mutual impedance. The mutual coupling effect can be analyzed by the concept of mutual impedance [4]. In general, the mutual impedance is a complex number, which is related to the geometric position of the array. When the antenna array element spacing increases, the interaction impedance will be reduced.

The Application of CDMA Technology in the Measurement of Antenna Array | 511

The current, voltage and admittance of the antenna can be expressed by the knowledge of the circuit theory:

> I @ >Y @>V @ In the formula ,the

(2-1)

> I @ , >Y @ and >V @ matrix representing the antenna network

current column vector,MN dielectric admittance matrix and voltage column vector, then the m array current distribution vector is tation voltage vector

I m , the m array element of the exci-

Vm , the m array element and the n array element of the mutu-

al admittance matrix is

Ymn , then: I V Y Im

> I1 , I 2 ,L , I N @ T >V1 ,V2 ,L ,VN @ >Ymn @N uN T

N

¦Y n 1

V

mn n

(2-2) (m, n 1, 2, L N )

As far as the radiation field of the antenna is concerned, the field strength of the antenna radiation field can be expressed as the following formula:

E In which

*

*I

(2-3)

is expressed as the wave propagation characteristic parameter for the

measurement of the array element. Obviously, if known antenna array of the individual oscillator current distribution, according to the general far-field method can calculate the radiation characteristics of the antenna pattern, directivity, impedance, in measuring moment methods, assuming that the oscillator current distribution satisfies sine law, so that the antenna array each dipole current

> I n @ [5] :

I i ( z ) Ci1 sin E (hi  z ) In the formula:

Ci1 (i 1, 2L N )

press the phase velocity;

is the current coefficient of antenna;

(2-4)

E ex-

hi express the long antenna arm. By the method of mo-

ments can be to find out the current coefficient, so as to obtain the current distribu-

512 | Fei-Huang Chu, Cheng-Wen Zhang and Hong-Bing Yu tion on the antenna array every antenna element, then according to each unit of the antenna current distribution and the radiation characteristics of the antenna pattern, directivity, impedance is obtained. For far field measurements, the radiation field of the antenna at the far field is equal to the sum of the radiation field at the point of the antenna at the point. The antenna's

f E (M

0,T )

And the antenna's

f H (T

1 Sin T

N

¦ i 1

E

surface radiation direction function is [6]:

I i > cos( E hi cosT )  cos E hi @  jE xi sin T e sin E hi

(2-5)

H surface radiation direction function of the antenna is:

90o ,M )

N

¦ i 1

I i >1  cos E hi @  j E xi cos M e sin E hi

(2-6)

Due to the method of moments in the large amount of calculation, and in practical application is limited, in order to more measurement is more simple and reduce computational complexity, more in line with the practical application, is presented in this paper by using CDMA signal measuring unit antenna current distribution, thus get radiation characteristics of the antenna parameters.

2.2 Advantages of CDMA Application Measurement CDMA (code division multiple access) communication is using orthogonal (or as much as possible orthogonal) code allocation to modulation signals of different users and achieve multiple users simultaneously using the same frequency access system and network communication, code division multiple access communication [7]. The principle of this method is similar to satellite navigation and positioning system, multipath CDMA signal through the antenna to send out, in the far field by CDMA receivers accept multi-channel signal, various signal amplitude and phase of the relative time delay, combined with the position of antenna array, multiple point measurement position and measurement field size, so as to obtain the antenna array parameters. Compared with the existing methods of measurement, measurement of antenna array with multichannel synchronous CDMA signal source can be full agreement from the transmit antenna array of the various signal reception characteristics, to avoid the due to cause by the different received signal characteristics of phase and amplitude delay error and greatly reduce measuring error; obtained simultaneously by a multipath CDMA receiver demodulation signal magnitude difference and phase difference, compared to existing measurement method can be more abundant and

The Application of CDMA Technology in the Measurement of Antenna Array | 513

precise parameters, and between the receiver signal delay has higher measurement accuracy can reach 0.1ns precision or higher.

3 Using Cdma Signal to Measure the Radiation Characteristic Parameters of Antenna Array According to get array elements antenna amplitude difference of the known parameters, the need to array antenna far field formula of electric intensity of expression to distinguish the amplitude and phase of the two parts and amplitude and phase difference were calculated. Here setting measured array antenna array element number is ments antenna excitation voltage is set for

N , array ele-

Vn , antenna unit distribution of current vector

I n , array element between the mutual admittance matrix for Ymn

(i.e. the m

array element and the n between array elements), each antenna section divided by K a unit composed of power array, consider each unit of the mutual coupling of the generalized impedance matrix:

Y

In the formula,

Y

ª Y11 Y12 L «Y O « 21 « M M O « ¬YN 1 YN 2 L

Y1N º Y2 N » » M» » YNN ¼

(3-1)

is expressed as the admittance matrix between the mutual admit-

tance matrix of each element of the antenna array and the units in the unit antenna. When the antenna element number, each unit antenna segmentation unit block more. B matrix will is a very large matrix, but through the observation is not difficult to find the matrix is a block of the teoplitz matrix, the computation and storage of some matrices of a column or a line can be the matrix, thereby greatly reducing the time of calculation. The relationship between the matrix elements of each block is as follows:

514 | Fei-Huang Chu, Cheng-Wen Zhang and Hong-Bing Yu

­Yn1,m1 Yn.m ® ¯ Yn ,m Ym ,n

(3-2)

Using the circuit theory, the relationship between the antenna current, voltage and admittance is expressed as follows:

ª I1 º «I » « 2» « M» « » ¬IN ¼

ª Y11 Y12 «Y Y22 « 21 « M M « ¬YN 1 YN 2

L

Y1N º ª V1 º » «V » »x« 2» M » « M» » « » YNN ¼ ¬VN ¼

O O L

(3-3)

As shown in the relation matrix, the voltage source as excitation modes, due to the antenna array mutual coupling admittance matrix to produce each unit antenna current distribution, so to get antenna current distribution need admittance matrix, and the antenna far-field radiation expression such as equation (2-3) is shown, in the formula

*

is expressed as:

*

jZP exp( jkr ) 2S kr

(3-4)

In the case of known transmission environment and transmission distance can be calculated, then according to the formula (2-3) and the formula (3-3) can be obtained: ª E1 º «E » « 2» « M» « » ¬ EN ¼

ª *1 º ª Y11 Y12 « * » «Y Y22 « 2 » x « 21 « M» « M M « » « ¬ * N ¼ ¬YN 1 YN 2

L O O L

Y1N º ª V1 º » «V » »x« 2» M » « M» » « » YNN ¼ ¬VN ¼

(3-5)

Because the voltage source incentive model, so in the far field of amplitude and phase delay as the excitation signal through the antenna and transmission path caused by the amplitude and phase delay errors, select the n element array and the m array element: Vn x > *1 L

Vm x > *1 L

* N @ x >Y1n L T

* N @ x >Y1m L T

YNn @

YNm @

An  j (Mn Mm ) e Am

(3-6)

At the same time, according to the size of obtained at the point of measurement to measure the field strength of the antenna array synthesis can calculated the admit-

The Application of CDMA Technology in the Measurement of Antenna Array | 515

tance matrix of array antenna, to get the array elements antenna current distribution, and then get the antenna array direction function, radiation pattern and gain size antenna radiation characteristic parameters.

4 Experiment and Simulation Analysis Antenna, as an important part of radio transceiver system, is a device to radiate or receive electromagnetic waves from space. Straight line antenna not only constitutes the basis of many antenna problems, but also reveals the characteristics of the general antenna. The linear antenna is analyzed by the model of infinitesimal dipole and finite length dipole. The so-called dipole is a charged body that is much smaller than the wavelength. The straight antenna can be approximated by a combination of many dipoles. An infinitely short line segment antenna is an infinitesimal dipole whose length

L

is much smaller than the wavelength

O

. The amplitude, phase

and direction of the current on the infinitesimal dipole can be set to [8]. So the specific antenna can through an infinite number of infinitesimal dipoles according to a certain structure of stitching and, through the antenna geometry, size and excitation conditions can get the reality of various types of antenna [9]. Therefore, this paper uses two infinitesimal dipole as the simulation model. The system is simulated, and the system parameters, including the excitation voltage, the position coordinate, the mutual coupling coefficient matrix and the position of the measuring point, are given by the two infinitesimal dipoles. In this position, the measured value of the theory is calculated, and the parameters of the measurement error are introduced to calculate the actual value. By comparing the theoretical value and the actual value, the influence of measurement error on the measurement and calculation of the amplitude and phase characteristics of the antenna array is obtained. In free space conditions, two infinitesimal dipole coordinates and measurement coordinates such as table 1 shows, two infinitesimal dipole excitation voltage source

for the same amplitude and phase is 1 v , the frequency of the signal is 300 MHz, the distance between two infinitesimal dipole 0.5 O , antenna mutual coupling coeffi-

cient matrix such as table 2 shows, the paper goes on to two infinitesimal dipole similar element, so the unit of the self-same impedance, also because of the reciprocity of the antenna can be obtained:

Z nm

Z mn .

516 | Fei-Huang Chu, Cheng-Wen Zhang and Hong-Bing Yu Table1: Coordinate Position of Each Point Point source number

Infinitesimal dipole A

Infinitesimal dipole B

Coordinate [m]

(-0.25,-0.07,-0.28) (0.25,-0.07,0.28)

Measurement point X

Measurement point Y

(43.10,78.73,46.83) (53.52,118.23, 46.83)

Table2: Mutual Coupling Coefficient Matrix of Antenna Array Zmn

1

2

1

75.9365+36.4010i

-12.7311-27.8571i

2

-12.7311-27.8571i

75.9365+36.4010i

Two measurement points are given in the maximum direction of the antenna, therefore, under a given condition, the measured point X, the measured value of the measured point Y and the phase measurement values are shown in table 3: Table3: Theoretical Values of Measurement Point Amplitude Ratio and Phase Ratio Measured amplitude ratio

Measured phase difference [degree]

Measurement point X

0.9779

2.4579

Measurement point Y

0.9662

2.6207

Obtained by measuring the amplitude ratio and phase difference, according to the exact coordinates of the antenna array and the measuring point value, can be used to calculate the Hsing yuan between admittance matrix, so as to get the antenna "s amplitude and phase characteristic parameters can see that even in a small power transmission, array mutual coupling of antenna amplitude and phase characteristics of certain impact. In the actual operation, the error of the receiver can not be avoided, and the error parameter of the measured value is simulated and analysed. Firstly, considering the measurement point, the phase difference between the receiver and the receiver is introduced. Design precision of phase difference is + 0.1 degrees, the error satisfies uniform distribution

x : U (0.1o ,0.1o ) , theory of

measurement value and the given error range for 10000 times of experiments, in

Y Y order to get the effect of error range of admittance of 11 and 12 , according to the simulation diagram can get when the receiver phase difference error + 0.1 degrees,

The Application of CDMA Technology in the Measurement of Antenna Array | 517

Y Y the admittance of 11 and 12 phase change at 4.46 degrees, as shown in Figure 1 and Figure 2: Effect of phase difference on the admittance Y11 when the error of ± 0.1°

140

The number of changes in the phase

120 100 80 60 40 20 0 -4.56 -4.54 -4.52

-4.5 -4.48 -4.46 -4.44 -4.42 Error caused by phase change

-4.4

-4.38 -4.36 -3

x 10

Fig. 1: Effect of phase ratio error on admittance Y11

140

Effect of phase difference on the admittance Y12 when the error of ± 0.1°

The number of changes in the phase

120 100 80 60 40 20 0 4.36

4.38

4.4

4.42 4.44 4.46 4.48 4.5 Error caused by phase change

4.52

4.54

4.56 -3

x 10

Fig. 2˖Effect of phase ratio error on admittance Y12

Secondly, when the receiver is measured at the measuring point, the amplitude ratio of the receiver is introduced. Design amplitude ratio error accuracy is + 0.01 +error meet the uniform distribution

x : U (0.01,0.01) . According to meas-

urement theory value and the given error range of measurement theory value and the given error range for 10000 times of experiments, thus to get error range of ad-

518 | Fei-Huang Chu, Cheng-Wen Zhang and Hong-Bing Yu

Y Y mittance of 11 and 12 , according to the simulation diagram can get when the receiver amplitude difference error in 0.01, the variation of amplitude variations in

Y Y the admittance of 11 and 12 , as shown in Figure 3 and Figure 4: 140

Effect of the amplitude ratio of the error value of ± 0.01 on the admittance Y12

The number of changes in the magnitude

120

100

80

60

40

20

0 -1

0

1

2

3 4 5 6 7 Amplitude variation caused by errors

8

9 -3

x 10

Fig. 3: Effect of amplitude ratio error on admittance Y11

140

Effect of the amplitude ratio of the error value of ± 0.01 on the admittance Y11

The number of changes in the magnitude

120

100

80

60

40

20

0 -10

-9

-8

-7

-6 -5 -4 -3 -2 Amplitude variation caused by errors

-1

Fig. 4: Effect of amplitude ratio error on admittance Y12

0 -3

x 10

The Application of CDMA Technology in the Measurement of Antenna Array | 519

5 Concluding Remarks This paper presents a new method for measuring the amplitude and phase characteristics of the antenna, the antenna section of the antenna array is divided into infinitesimal dipole K units, the N element antenna array consists of infinitesimal dipole array N*K, and then use the multi-channel CDMA signal transmitted through the N antenna array, demodulation different signals in the far field using multichannel CDMA signal receiver, the measured phase difference between different signal and amplitude ratio, according to the synthesis of magnetic field intensity of antenna array and the measuring point accurate location and measurement point, get mutual admittance matrix antenna array in the presence of mutual coupling, the current distribution of antenna array to the antenna, and antenna array direction function, radiation pattern and gain of the amplitude and phase parameters, this paper also presents the multi-channel CDMA receiver in the actual. The simulation results show that the measurement method is feasible and has practical value.

References [1] [2] [3] [4] [5] [6]

[7] [8] [9]

Mao Naihong, the new club. Antenna Measurement Handbook ,M. Beijing: National Defense Industry Press, (1988)222-250 Proceedings of the Nie, Nie in equality. Antenna Engineering Handbook, M.Beijing: Publishing House of electronics industry, (2002)52-53 White Harue. Analysis of direction finding antenna array mutual coupling effect of electromagnetic field and microwav, J.e.41, 10(2011), pp. 40-43. Wu Shilong. Direction of short wave log periodic antenna and its array, J. Ship Electronic Engineering.2004, 4:95-98. Kazakhstan Lyndon electromagnetic field calculation method of moments, M. Wang Erjie, Xiao Liangyong, transl. Beijing: National Defense Industry Press. (1981) Lu Shi-yang. H, Hui, BAILKOWSKI M. and the MIMOchannel capacities under the the influence of antennamutual coupling, J. IEEE antennas and wireless PropagationLetters, 7, 9, (2008) pp. 287-290. Zhu Jinkang.CDMA communication technology ,M. Beijing: Chen Wanshou publishing house, (2001)11 Zhang Qingquan, Ji Anping. Simulation and analysis of the dipole radiation characteristics based on MATLAB, J. Instrumentation and analysis monitoring. (2011)3, pp.21-23. Zhao Navy. The radiation resistance of electric dipole antenna, J. modern electronic technology, 2009, 32 (21): 74-75.

Qiao-Ling Li1, Jun-Jian Li2, Bei Chen3 and Min Li4

Synthesis and Bactericidal Properties of MgO/TiO2 Nano-Composites Abstract: MgO/TiO2 nano-composite was prepared by sol-gel method and liquid phase precipitation method. The samples were characterized by using scanning electron microscope (SEM), transmission electron microscope (TEM), energy dispersive spectrometer (EDS) and X-ray diffraction (XRD). The results revealed that the composite with mass ratio of magnesium to titanium dioxide 5:2 exhibited the best bactericidal properties among the investigated samples. The diameter of bacteriostatic circle reached 17.7mm when the composite acted on escherichia coli, .while the diameter reached 13.6mm when the composite acted on bacillus subtilis. Keywords: Titanium dioxide; Sol-gel method; Magnesium oxide; Bactericidal

1 Introduction With the development of science and technology, our life quality is gradually improved, at the same time we pay more and more attention to our health [1]. In many aspects of human health problems, the impact of microbes is one of the most obvious influence one. Microbes seriously affect people's health and even threaten people's life, and they bring significant economic losses to people. The research and development of antibacterial materials has become the focus of the study in twentyfirst century [2, 3]. As photocatalytic materials, TiO2 has been extensively studied, but the research about its antibacterial property is infrequent. According to the literature, TiO 2 can use the UV light from sunshine and fluorescent lamp as excitation source to produce the antibacterial effect [4, 5]. As a new type of inorganic antibacterial material, MgO has broad application prospects and market value. Studies show that MgO has a strong antibacterial activity against gram positive / negative bacteria and spores [6].

|| 1 The North University of China Department of Chemistry, School of science ,NUC, Taiyuan, China. [email protected] 2 he North University of China, Department of Chemistry, School of science, NUC, Taiyuan, China. [email protected] 3 The North University of China, Department of Chemistry, School of science, NUC, Taiyuan, China. [email protected] 4 The North University of China, Department of Chemistry, School of science, NUC, Taiyuan, China. [email protected] 10.1515/9783110516623-051 DOI 10.1515/9783110303568-051

522 | Qiao-Ling Li, Jun-Jian Li, Bei Chen and Min Li When the particle size of MgO reduces to nanometer magnitude, large amount of defects will appear on the surface of nano MgO. These defects make nano MgO have a strong adsorption capacity and catalytic activity, and these defects will breed a large number of O2-, which makes nano MgO has strong ability of antibacterial, sterilization and decomposition of some compounds [7-9]. In this paper, MgO/TiO2 composite was prepared by sol-gel method and liquid phase precipitation method, respectively [10-13]. The bactericidal properties of composite materials were detected by using Escherichia coli and Bacillus subtilis as the test bacteria. The relationship between the content of TiO2 and MgO and the bactericidal ability was investigated.

2 Experimental 2.1 Preparation of Titanium Dioxide 18mL of anhydrous ethanol and 12mL tetrabutyl titanate were mixed, stirring evenly and marking as solution A; 6 mL of anhydrous ethanol, 6mL distilled water and 6mL of glacial acetic acid were mixed stirring evenly and marked as solution B. Solution B was added to solution A, stirring to achieve colloidal, which was aged in 3h and dried in an oven, than calcinated at 600oC for 2h and the heating rate was 6oC/min. Finally, grinding the calcined sample into powders to get TiO2 nanoparticles.

2.2 Preparation of MgO/TiO2 Composite 2.2.1 Sol Gel Method A quantity of magnesium chloride and a certain amount of spare titanium dioxide were dissolved in about 20 mL distilled water, stirring evenly and marking as solution A; some citric acid was dissolved in about 20 mL distilled water, stirring evenly and marking as solution B. Solution B was added to solution A dropwise, stirring to sol under the conditions of water bath at 80oC. The gel was placed about 2h than dried in an oven and grinded into powder. The powders were placed in the crucible and subjected to calcination at 600oC for 2h. Grinding calcined sample to obtain MgO/TiO2 of composite materials.

2.2.2 Liquid Phase Deposition Method A certain amount of magnesium chloride, titanium dioxide and 10 mL polyethylene glycol 400 were added in 50 mL anhydrous ethanol, stirring evenly and marking as

Synthesis and Bactericidal Properties of MgO/TiO2 Nano-Composites | 523

solution A. 15ml ammonia was added in 15ml anhydrous ethanol, stirring evenly marking as solution B. Solution B was added to solution A dropwise, stirring evenly under the conditions of water bath at 50oC, stirring 1.5h continually after the reaction was completed, than filtrating to neutral with circulating water type multipurpose vacuum pump. The obtained precipitate was dried in an oven than placed in the crucible and subjected to calcination at 600oC for 2h, grinding calcined sample to obtain MgO/TiO2 of composite materials.

3 Results and Discussion 3.1 Effect of Magnesium Salt Concentration on the Rate of Gel Fig. 1 shows the relationship curve of the concentration of magnesium salt and the speed of the gel. When the concentration of magnesium salt was 1.5mol/L, the formation of the gel needs 100min, and the gel time was relatively short.

150

140

t (min)

130

120

110

100 0.5

1.0

1.5

2.0

2.5

concentration (m ol/L)

Fig. 1: Effects of magnesium salts concentration on gelatin speed

3.2 SEM Characterization and Analysis The surface morphology of the samples was analyzed by SU-1500 scanning electron microscope, and the distribution of the particles was studied. Fig. 2a shows the characterization of composite surface prepared by the sol gel method. Fig. 2b shows the characterization of composite surface prepared by the liquid phase deposition method (MgO/TiO2mass ratio=5:2). The composite prepared from both the sol-gel method and liquid phase direct precipitation method had certain reunion phenom-

524 | Qiao-Ling Li, Jun-Jian Li, Bei Chen and Min Li enon, but the composite particles prepared by liquid phase direct precipitation were relatively soft and fluffy.

Fig. 2: SEM images of samples: (a) sol gel method, (b) liquid phase deposition method

3.3 TEM Characterization and Analysis The micro morphology and particle size of nano MgO/TiO2 composites were observed by transmission electron microscope (Hitachi H-800). The fig. 3a shows TEM figure of MgO/TiO2 composite with liquid phase precipitation method (white sample); The fig. 3b shows TEM figure of MgO/TiO2 composite with the sol-gel method (black sample). The fig. 3a shows that the particle size of the composite is about 50nm, and the fig. 3b shows that the particle size of the composite is about 90nm. Compared with the particle size of MgO/TiO2 composites prepared by sol gel method, the particle size of MgO/TiO2 composite prepared by liquid phase deposition method is smaller (about 50nm) and the dispersion is uniform.

Synthesis and Bactericidal Properties of MgO/TiO2 Nano-Composites | 525

Fig. 3: TEM image of the composites of nanometer MgO/TiO2: (a) sol gel method, (b) liquid phase deposition method

3.4 EDS Characterization and Analysis The sample was analyzed by 4490A-1NUS-SN energy-dispersive spectroscopy made by USA-AKO. The characterization results are shown in fig. 4. The fig. 4a shows EDS spectrum of MgO/TiO2 composite prepared by liquid phase precipitation method; the fig. 4b shows EDS spectrum of MgO/TiO2 composite prepared by the sol-gel method. Mg (OH)2 precipitation as the precursor was calcined to obtain the white MgO powders by liquid phase precipitation method. But magnesium complex as the precursor was calcined with carbonization and incomplete decarburization so that obtain the black sample. The fig. 4 shows that titanium element is not detected in nano MgO/TiO2 composite prepared by liquid phase precipitation method, which reason was that the surface of TiO2 was coated nano MgO completely so that the electronic excitation of titanium element was shielded. (a)

526 | Qiao-Ling Li, Jun-Jian Li, Bei Chen and Min Li (b)

Fig. 4: EDS spectra of composites: (a) liquid phase deposition method, (b) sol gel method

3.5 XRD Characterization and Analysis X ray diffraction analysis of the samples was carried out by the D/Max-r B type diffraction apparatus of Japanese Neo Confucianism. The fig.5 shows the XRD diagram of the composite material (mass ratio MgO: TiO2=5:2) prepared by the sol-gel method (B) and the liquid phase direct precipitation method (C). The TiO2 of the sample is anatase phase, identified by JCPDs File no. 21-1271, and the MgO is periclase phase, identified by JCPDs File no. 45-0946. The TiO2 of the sample have anatase (101), (112), (211), (116) and (220) diffraction peaks at 25.26°, 38.02°, 54.9°, 68.62° and 70.26°, respectively, which indicates that the TiO2 of the composite prepared by the sol-gel method is anatase. The XRD diagram of the composite material prepared by liquid phase precipitation method, have not appeared the characteristic peaks of TiO2. The reason is likely that the nano MgO coated on the surface of TiO2, or Ti turned into MgO lattice, failing to appear the characteristic peaks of TiO2, and consistent with energy spectrum analysis. The MgO of the sample have face-centered cubic (111), (200), (220), (311) and (222) diffraction peaks at 36.9°, 42.84°, 62.24°, 74.64° and 78.46°, respectively. The left shift of characteristic peaks of MgO may be attributed to the doping of titanium atoms increasing the magnesium oxide lattice parameters and interplanar spacing.

Synthesis and Bactericidal Properties of MgO/TiO2 Nano-Composites | 527

2

1

1--TiO2

2--MgO 2 1

1 2

B

11

11

2

2

2

2

10

2 2

2

C 20

30

40

50

60

70

80

2Tq

Fig. 5: XRD pattern of composites

3.6 UV-Vis Diffuse Reflectance Spectra Analysis The purple UV-2600 visible spectrophotometric meter with a diffuse reflection measuring device integrating sphere produced by Shimadzu was used to characterize sample. Instrument parameters: monochromator system configuration, resolution (0.1 nm), near infrared wavelength measure (the longest 1400nm). Scanning speed of ISR-2600 Plus integral ball was highest speed and the test range is 200800nm. The fig. 6 shows the UV-Vis absorption spectra of the composite material (mass ratio MgO: TiO2=5:2) prepared by the sol-gel method. It shows that magnesium oxide absorption is higher than that of titanium dioxide in the visible light range, and composite sample is higher than each component.

528 | Qiao-Ling Li, Jun-Jian Li, Bei Chen and Min Li

1.2

1.0

Absorption

0.8

1---TiO2 2---composite 3---MgO

2 1

0.6

0.4

3

0.2

0.0

200

300

400

500

600

700

800

O�nm)

Fig. 6: The UV-vis absorption spectra

3.7 Bactericidal Performance Test The Gram-positive bacillus subtilis and the Gram- negative bacteria E.coli were selected as the representative strains to investigate the broad bactericidal properties of the samples. The bactericidal effect of the sample was tested by the antibacterial circle method under the radiation of 30W incandescent lamp to cultivate 12h at 37oC. The bactericidal effect is shown in Fig. 7 and Fig. 8. The effect on E.coli is also better than that of Bacillus subtilis. When the quality ratio of MgO/TiO2 is equal to 5:2, the composite material has the best bactericidal effect on Escherichia coli and Bacillus subtilis. Prepared by the liquid phase deposition method, the inhibition zone diameters were 16.9mm, 12.7mm, while the inhibition zone diameters of the composite material prepared by sol-gel method were 17.7mm, 13.6mm, and respectively. The Fig. 8 shows that the composite material prepared by sol-gel method has a better sterilization, and both of the composite materials have a better bactericidal effect on Escherichia coli of Gram negative bacteria. One of the reasons is that the composite samples prepared by sol-gel are more homogeneous and the other is that the titanium dioxide which was introduced improves the absorption and profit rate of the visible light. Synergistic effect in the sterilization process further improves the bactericidal effect of the composite.

Synthesis and Bactericidal Properties of MgO/TiO2 Nano-Composites | 529 (a)

(b)

Fig. 7: The sterilization effect on E.coli of composites: (a) liquid phase deposition method, (b) sol gel method a

b

17.0

A B

16.5 16.0 15.5

18.0 17.5 16.5

15.0

16.0

14.5

15.5

14.0

15.0

13.5

D (mm)

D (mm)

A B

17.0

13.0 12.5 12.0

14.5 14.0 13.5 13.0

11.5

12.5

11.0

12.0

10.5

11.5

10.0

11.0 10.5

9.5 1

2

3

4

sample

5

6

7

10.0

1

2

3

4

5

6

7

sample

Fig. 8: The sterilization effect of composites: A) Escherichia coli, B) Bacillus subtilis; (1) MgO, (2) 10:1, (3) 10:2, (4) 10:4, (5) 10:3, (6) 10:5 and (7) 10:10 (quality ratio of MgO/TiO2)

4 Conclusions In summary, we have successfully fabricated MgO/TiO2 nanoparticle composites using sol-gel method and liquid phase precipitation method. When the concentra-

530 | Qiao-Ling Li, Jun-Jian Li, Bei Chen and Min Li tion of magnesium chloride solution is 1.5mol/L, the gel velocity is relatively fast. The sample prepared by sol-gel method has a better sterilization effect. When the quality ratio of MgO/TiO2 is equal to 5:2, the composite material has the best bactericidal effect on Escherichia coli and Bacillus subtilis. And the diameter of the inhibition zone achieve respectively 17.7mm and 13.6mm. Composite samples have larger absorption in the visible region, and homogeneous composite of TiO2 and MgO will significantly improve the sterilization effect. Acknowledgement: This work was supported by the National Natural Science Foundation (No.51272239). Key Laboratory of the Ministry of Education at the North University of China.

References [1] [2] [3] [4]

[5]

[6]

[7]

[8]

[9] [10]

[11]

[12]

K. Lee, D. Kim and S. Berger, “Anodically formed transparent mesoporous TiO2 electrodes for high electrochromic contrast” J. Mater. Chem., vol.22, pp. 9821-9825, Mar 2012. D. Chen and R.A. Caruso, “Recent progress in the synthesis of spherical titania nanostructures and their applications.” Adv. Funct. Mater. vol.23, pp.1356-1374, Mar 2013. T. Tachikawa and T. Majima, “Single-molecule, single-particle fluorescence imaging of TiO2based photocatalytic reactions.” Chem.Soc.Rev, vol.39, pp. 4802-4819, May 2010. Z. Hu, Q. Zhang and J. Gao, “Photocatalysis triggered ionrectification inartificial nanochannels based on chemically modified asymmetric TiO2 nanotubes.” Langmuir, vol.29, pp. 4806-4812, May 2013. M. Faure, F. Gerardin and J.C. Andre, “Study of photocatalytic damages induced on E.coli by different photocatalytic supports (various types and TiO2 configurations).” Journal of Photochemistry and Photo-biology A: Chemistry, vol.222, pp. 323-329, Aug 2011. D.Z. Gao, M.B. Watkins and A.L. Shluger, “Transient mobility mechanism of deposited metal atoms on insulating surfaces: Pd on MgO (100).” J.Phys. Chem. C, vol.116, pp. 14471-14479, Jul 2012. R. Ceylantekin and C. Aksel, “Improvements on the mechanical properties and thermal shock behaviors of MgO-spinel composite refractories by ZrO2 incorporation.” Ceram. Int., vol. 38, pp. 995-1002, Mar 2012. G.S. Lee, J.Y. Lee and Y.B. Cheon, “Influence of hydrogen-doped MgO thin films on the discharge characteristics in plasma display panels.” Thin Solid Films, vol. 519, pp. 3037-3042, Mar 2011. Z.L. MO, R.R. HU and Y.W. Wang, “Antibacterial materials and antibacterial mechanism.” Materials review, vol. 28, pp. 50-52, Sep 2014. N. Bayal and P. Jeevanandam, “Synthesis of TiO2-MgO mixed metal oxide nanoparticles via a sol-gel method and studies on their optical properties.”Ceramics International, vol. 40, pp. 15463–15477, Dec 2014. L. Todan, T. Dascalescu and S. Preda, “Porous nanosized oxide powders in the MgO-TiO2 binary system obtained by sol-gel method.” Ceramics International, vol. 40, pp. 15693–15701, Dec 2014. Z. Wen, X. Yu and S.T. Tu, “Biodiesel production from waste cooking oil catalyzed by TiO2MgO mixedoxides.” Bioresour. Technol, vol. 101, pp. 9570-9576, Dec 2010.

Synthesis and Bactericidal Properties of MgO/TiO2 Nano-Composites | 531 [13]

H. Jeon, Y.J. Min and S.H. Ahn, “Graft copolymer templated synthesis of mesoporous MgO/TiO2 mixed oxide nanoparticles and their CO2 adsorption capacities.” Colloid Surf. A., vol. 414, pp. 75-81, Nov 2012.

Li-Zhu Yuan1 and Hong-Wen Yu2*

Effects of Assisting Agents Concentrations on Energy Consumption during the Electrokinetic Treatment of Contaminated Kaolin Abstract: The effects of assisting agents concentrations on energy consumption in electrokinetic remediation of multi-metals (Cd, Cu, Ni, Pb, Zn) contaminated kaolin has been investigated. The results showed that the electric current and energy consumption gradually increased with the increase of assisting agents concentration. The change of HCl concentration will produce a more significant change of energy consumption than that of citric acid (CA). Keywords: electrokinetic remediation; assisting agents; heavy metals; energy consumption

1 Introduction Soils were widely contaminated by heavy metals caused by a range of anthropogenic activities. Heavy metals in soils tend to concentrate in living organisms and cause toxic and carcinogenic to humans, animals, and plants, which would cause serious environmental risk and potential health threat Various remediation techniques have been applied to remove heavy metals from soil such as soil washing [1], phytoremediation [2], and electrokinetic (EK) remediation [3]. Among of them, EK remediation is widely used [4] for extracting heavy metals from fine-grained soils [5] and seem to be a promising remediation process for in-situ or ex-situ remediation heavy metals in soil [4, 6, 7]. During the EK remediation process, enhancement techniques are developed to solubilize heavy metals in soil for improving removal efficiency. Recent studies have proved that assisting reagents can effectively keep heavy metals in the mobile state and improve their removal efficiencies [8, 9]. Kim et al. [5] reported that hydrochloric acid (HCl) and citric acid (CA) are effective in extracting heavy metals (Pb, Zn, Cu and Ni) from dredged marine sediment. The electric power consumption is an important variable to be considered in || 1 Key Laboratory of Wetland Ecology and Environment, Northeast Institute of Geography and Agroecology, Chinese Academy of Sciences, Changchun, China 2 University of Chinese Academy of Sciences, Beijing, China. E-mail: [email protected] 2 Key Laboratory of Wetland Ecology and Environment, Northeast Institute of Geography and Agroecology, Chinese Academy of Sciences, Changchun, China. E-mail: [email protected] 10.1515/9783110516623-052 DOI 10.1515/9783110303568-052

534 | Li-Zhu Yuan and Hong-Wen Yu large scale applications because it will define a significant fraction of the operationoperational costs [10]. In the previous studies, solar cell panels have been applied in EK process to reduce the energy consumption [11]. In addition, several researchers have tried to use a pulsed current system to save electrical energy consumption [12]. However, few studies reported the effects of assisting agent concentrations on energy consumption in EK process. In our previous study reported a novel assisting agents for the electrokinetic remediation of heavy metal-contaminated kaolin. The effects of assisting agents concentrations on removal efficiency of heavy metals has been investigated [13]. However, we have no detailed discussion toward the influence of assisting agents’ concentrations on energy consumption. Thus, in this study, we investigated the influence of CA and HCl concentration on the electric current and energy consumption in EK remediation of multi-metals contaminated kaolin.

2 Material and Methods 2.1 Chemicals In the experiments all the chemicals used were analytical grade. HCl was purchased from Beijing Chemical Works (China). All other chemicals were obtained from Sinopharm Chemical Reagent Co., Ltd (China). Milli-Q water was used in all the experiments.

Effects of Assisting Agents Treatment of Contaminated Kaolin | 535 Table 1: The chemical properties and the mineralogical characterization of the kaolinite clay soil. Characteristics

Value

Particle size analysis (%) Sand (%)

2.02

Silt (%)

51.17

Clay (%)

46.81

Organic matter (%)

0.02

CEC (cmol/kg)

2.65

pH

6.28

Electrical conductivity (μS/cm)

266

Zeta potential (mV)

-29.4

Ratio of mineral (%) SiO2

52.55

Al2O3

42.16

TiO2

2.57

P2O5

0.98

Fe2O3

0.92

CaO

0.36

K2O

0.14

2.2 Simulated Heavy Metal-Contaminated Kaolin Commercial kaolin was used as a model of soil in this experiment which obtained from the Sinopharm Chemical Reagent Co., Ltd (China). The chemical properties and the mineralogical characterization of the kaolinite clay soil were summarized in our previous study [14]. The preparation of heavy metal-contaminated kaolin also has been reported in our previous study [14]. A total of 410 g of the kaolin was loaded into the test cell using a tamper. The initial pH and zeta potential of contaminated kaolin was 4.32 and -27.6 mV. The initial heavy metal concentrations in dry kaolin were: 41.60 mg/kg for Cd, 293.7 mg/kg for Cu, 233.1 mg/kg for Ni, 280.9 mg/kg for Pb, and 252.2 mg/kg for Zn.

536 | Li-Zhu Yuan and Hong-Wen Yu

Fig. 1: A schematic view of the electrokinetic laboratory setup: (1) The cell for soil sample, length: 15 cm, width: 3.8 cm, height: 6 cm. (2) Perforated polymethyl methacrylate and a filter paper. (3) Electrode. (4) Electrode chamber. (5) Peristaltic pump. (6) Electrolyte reservoirs. (7) Logger. (8) DC power supply.

2.3 EK Experiments The EK cell was constructed using polymethyl methacrylate which was divided into three compartments: a soil cell and two electrode chamber (Figure 1). The EK cell and experiments conditions were similar to our previous work [13]. The electrolytes were circulated from electrolyte reservoir into the corresponding electrode chamber using peristaltic pump at the rate of 10 mL/min and the electrolyte level in the electrode chamber was maintained equally. Table 2: The summary of the electrokinetic experimental conditions. Test

Electrolyte Type

Electrode

Voltage

Time

Concentration (mol/L)

CA

n CA

n=0, 0.01, 0.05, 0.1, 0.2, 0.5

Graphite

1 V/cm

72 h

HCl

n HCl

n=0, 0.01, 0.05, 0.1, 0.2

Graphite

1 V/cm

72 h

All the experiments were conducted at room temperature, without pH control. A steady potential gradient of 1 V/cm was applied for 72 h. Graphite electrodes (7 cm × 3.5 cm × 1 cm) were used for the anode and cathode, respectively. The electrolytes of CA, and HCl were used individually and deionized water was employed as a control set. Each electrolyte was prepared with different concentrations and used as anolyte and catholyte throughout the experiment. Each electrolyte reservoir was filled with 600 mL of catholyte or anolyte. A summary of all the run test conditions applied is listed in Table 1. During the experimental period, electric current was monitored by using a logger (MW100, Yokogawa Electric Corporation, Japan).

Effects of Assisting Agents Treatment of Contaminated Kaolin | 537

2.4 Power Consumption The following equation was used for electrical energy consumption analysis [15]. ൌ

ͳ න ܸ‫ݐ݀ܫ‬ ܸ௦

Where E is the electrical energy per unit volume (kWh/m3), I is the applied current (mA), V is the voltage (V), t is the duration (d), and Vs is the soil volume (m3).

3 Results and Discussion 3.1 Changes of Electric Current during the EK Treatment Figure 2 shows the changes of electric current during the whole EK process using different concentrations of assisting agents as electrolyte.

Fig. 2: Changes of electric current using differents concentrations of a) CA and b) HCl in electrolyte in the EK treatment of mutil-heavy metal contaminated kaolin.

538 | Li-Zhu Yuan and Hong-Wen Yu The electric current in the deionized water treatment showed no significant shift in whole EK process and all the electric current values were less than 1 mA. When the assisting agents were used as electrolyte, the electric current was improved significantly. As shown in Figure 2a, the electric current gradually increased with the increase of CA concentrations. In the different concentrations CA treatments, the electric current showed a decreasing trend within first 30 h. And the electric current continued to decrease at the following 42 h in the 0.01 mol/L CA treatment. In the 0.05 and 0.1 mol/L CA treatment, the electric current reached the equilibrium after 30 h. In the 0.2 and 0.5 mol/L CA treatment, the electric current gradually increased within the next 42 h. Similar to the CA treatment, the electric current gradually increased with the increase of HCl concentration (Figure 2b). In the 0.01 mol/L HCl treatment, the electric current gradually decreased from 15 mA to about 1 mA with the prolongation of the EK treatment time. However, the electric current in the 0.05 mol/L HCl treatment showed no significant difference within first 50 h and maintained about 22 mA, thereafter gradually decreased at the following 22 h. In the 0.1 and 0.2 mol/L HCl treatments, the electric current gradually increased within first 40 h, and then gradually decreased at the following 32 h.

Fig. 3: Changes of energy consumption using differents concentrations of a) CA and b) HCl in electrolyte in the EK treatment of mutil-heavy metal contaminated kaolin.

Effects of Assisting Agents Treatment of Contaminated Kaolin | 539

Compared the same concentration of CA and HCl treatment, the electric current in HCl treatment was significantly higher than that in CA treatment. The changes of electric current indirectly indicated the changes of total electric resistance in the EK system. The difference of electric current in different EK treatments can be explained using the ions concentration in the kaolin [16]. The ions concentration in the kaolin gradually increased with the increase of assisting agent concentration. The increased ions concentration can improve the soil conductivity and electric current. In the HCl treatment, H+ and Cl- respectively migrated from anolyte and catholyte in soil, therefore, the electric current sharply increased with the increase of HCl concentration. However, in the CA treatment, H+ from anolyte met Citrate3from catholyte in soil, formed neutral H3-Citrate molecules, resulting in the decrease in the soil conductivity. Therefore, the electric current just presented a slight increase with the increase of CA concentration [17].

3.2 Changes of Energy Consumption during the EK Treatment The electric power consumption is an important variable to be considered in large scale applications because it will define a significant fraction of the operational costs [10]. Figure 3 shows the changes of energy consumption during the whole EK process using different concentrations of assisting agents as electrolyte. As seen in Figure 3, the accumulated energy consumption increased with the increase of assisting agent concentration. Compared the same concentration of CA and HCl treatment, the energy consumption in HCl treatment was significantly higher than that in CA treatment.

Fig. 4: Correlation between the concentration of assisting agents and energy consumption.

540 | Li-Zhu Yuan and Hong-Wen Yu The correlation between the concentration of assisting agents and the accumulated energy consumption after 3 days EK treatment were analysed (Figure 4). The regression coefficient values (R2) of CA and HCl treatment were 0.94 and 0.98, respectively. The results showed that the concentration of assisting agents significantly influenced the energy consumption in EK process. The slope of CA and HCl treatment were 71.62 and 2978.49, respectively. The results indicated that the change of HCl concentration will produce a more significant change of energy consumption than that of CA. Our previous study reported that the relationship of CA and HCl concentrations and the removal efficiencies of heavy metals [13]. The changes of energy consumption to remove 1% soil heavy metals (kWh per 1% soil heavy metals) at the different concentrations of assisting agents were showed in Figure 5. The results showed that the energy consumption to remove 1% soil heavy metals significantly increased with the increase of HCl concentration. However, the concentration of CA just has a little influence on the energy consumption to remove 1% soil heavy metals. The results were ascribed to the amount of H+ and Clincreased with the increase of HCl concentration which consumed a part of energy consumption to migrate. However, H+ and Citrate3- associated into neutral H3Citrate molecules which were hard to migrate and the increase of CA concentration produced a little increase of energy consumption.

Fig. 5: Changes of energy consumption to remove 1% soil heavy metals (kW h per 1% soil heavy metals) at the different concentrations of assisting agents in the EK treatment of heavy metal contaminated kaolin.

Effects of Assisting Agents Treatment of Contaminated Kaolin | 541

4 Summary In this study, we investigated the effects of assisting agent concentrations on energy consumption in electrokinetic remediation of multi-metals contaminated kaolin. The results showed that assisting agent concentration significantly influenced the electric current and energy consumption in the EK process. The energy consumption increased with the increase of assisting agent concentration. The change of HCl concentration produced a more significant change in energy consumption than that of CA. Acknowledgement: This work was supported by the National Natural Science Foundation of China (No. 21277142), “Cross-disciplinary Collaborative Teams Program for Science, Technology and Innovation” of Chinese Academy of Sciences, the “Hundred Talents Project” of the Chinese Academy of Science, CAS Interdisciplinary Innovation Team, and the Science and Technology Service Network Initiative (STS) Project of Chinese Academy of Sciences.

References [1] [2] [3] [4]

[5] [6] [7] [8]

[9]

[10] [11] [12]

Z. Zou, R. Qiu, W. Zhang, H. Dong, Z. Zhao, T. Zhang, X. Wei, X. Cai, The study of operating variables in soil washing with EDTA, Environ. Pollut. 157 (2009) 229-236. L.Q. Ma, K.M. Komar, C. Tu, W. Zhang, Y. Cai, E.D. Kennelley, addendum: A fern that hyperaccumulates arsenic, Nature 411 (2001) 438-438. R.F. Probstein, R.E. Hicks, Removal of contaminants from soils by electric fields, Science 260 (1993) 498-503. H.A. Kim, K.Y. Lee, B.T. Lee, S.O. Kim, K.W. Kim, Comparative study of simultaneous removal of As, Cu, and Pb using different combinations of electrokinetics with bioleaching by Acidithiobacillus ferrooxidans, Water Res. 46 (2012) 5591-5599. K.J. Kim, D.H. Kim, J.C. Yoo, K. Baek, Electrokinetic extraction of heavy metals from dredged marine sediment, Sep. Purif. Technol. 79 (2011) 164-169. B.G. Ryu, G.Y. Park, J.W. Yang, K. Baek, Electrolyte conditioning for electrokinetic remediation of As, Cu, and Pb-contaminated soil, Sep. Purif. Technol. 79 (2011) 170-176. K.Y. Lee, K.W. Kim, Heavy Metal Removal from Shooting Range Soil by Hybrid Electrokinetics with Bacteria and Enhancing Agents, Environ. Sci. Technol. 44 (2010) 9482-9487. Giannis, D. Pentari, J.Y. Wang, E. Gidarakos, Application of sequential extraction analysis to electrokinetic remediation of cadmium, nickel and zinc from contaminated soils, J. Hazard. Mater. 184 (2010) 547-554. M.G. Nogueira, M. Pazos, M.A. Sanromán, C. Cameselle, Improving on electrokinetic remediation in spiked Mn kaolinite by addition of complexing agents, Electrochimica Acta 52 (2007) 3349-3354. Cameselle, Enhancement of Electro-Osmotic Flow during The Electrokinetic Treatment Of A Contaminated Soil, Electrochimica Acta (2015). Hassan, E. Mohamedelhassan, E.K. Yanful, Solar powered electrokinetic remediation of Cu polluted soil using a novel anode configuration, Electrochimica Acta (2015). D.-H. Kim, S.-U. Jo, J.-C. Yoo, K. Baek, ex situ pilot scale electrokinetic restoration of saline soil using pulsed current, Sep. Purif. Technol. 120 (2013) 282-288.

542 | Li-Zhu Yuan and Hong-Wen Yu [13]

[14]

[15]

[16]

[17]

L. Yuan, X. Xu, H. Li, N. Wang, N. Guo, H. Yu, Development of novel assisting agents for the electrokinetic remediation of heavy metal-contaminated kaolin, Electrochimica Acta 218 (2016) 140-148. L. Yuan, H. Li, X. Xu, J. Zhang, N. Wang, H. Yu, Electrokinetic remediation of heavy metals contaminated kaolin by a CNT-covered polyethylene terephthalate yarn cathode, Electrochimica Acta 213 (2016) 140-147. T.R. Sun, L.M. Ottosen, P.E. Jensen, G.M. Kirkelund, Effect of pulse current on acidification and removal of Cu, Cd, and As during suspended electrodialytic soil remediation, Electrochimica Acta 107 (2013) 187-193. M.T. Ammami, F. Portet-Koltalo, A. Benamar, C. Duclairoir-Poc, H. Wang, F. Le Derf, Application of biosurfactants and periodic voltage gradient for enhanced electrokinetic remediation of metals and PAHs in dredged marine sediments, Chemosphere 125 (2015) 1-8. Li, X.Y. Tan, X.D. Wu, C. Pan, P. Xu, Effects of electrolyte characteristics on soil conductivity and current in electrokinetic remediation of lead-contaminated soil, Sep. Purif. Technol. 135 (2014) 14-21.

Bo Zhou1, Chao Bian2*, Jian-Hua Tong1 and Shan-Hong Xia1

Development of a Solid State pH Sensor Based on Electrodeposited Iridium Oxide Films for Water Quality Detection Abstract: Water quality is very essential for the environmental protection. So, it is indispensable for real-time monitoring and early warning. The monitoring strategy used now relies on the deployment of sensors in large scale. Thus reducing the cost and size of the sensors is of great importance. In this paper, a solid state miniature pH sensor, consisting of an iridium oxide film based pH electrode and a solid state reference electrode, was developed for water quality detection. Scanning electron microscopy (SEM) observation indicated that the iridium oxide nanoparticles were deposited on the surface of Pt electrode. X-ray photoelectron spectroscopy (XPS) survey illustrated that the atomic ratio of Ir (III) to Ir (IV) is about 1.38. The pH electrode exhibited a good linearity with the high sensitivity of -75.8 mV/pH. The characterization result of the on-chip reference electrode indicated that the proposed reference electrode has a good potential stability. The sensor could be fabricated in batches, thus the cost could be controlled to be acceptable for the use in large numbers. Keywords: water quality; pH sensor; iridium oxide; reference electrode; MEMS

1 Introduction Water is the most essential factor for the sustainable development of the global societies. The quality of water does affect all people’s lives. Water contamination, as one of the unintended consequences of development of industry and agriculture, is becoming more and more serious. In order to achieve effective determination strategies, governments have proposed series of projects to measure the water quality onsite for the water distribution systems. pH is one of the main parameters that must be detected, since water with unusual pH value may indicate problems, such as leaching, nitrification or presence of microorganisms, which may lead to gastrointestinal irritation, and corrosion of metal pipes[1].

|| 1 State Key Laboratory of Transducer Technology, Institute of Electronics, Chinese Academy of Sciences, Beijing, China. *e-mail: [email protected] 2 State Key Laboratory of Transducer Technology, Institute of Electronics, Chinese Academy of Sciences, Beijing, China, *e-mail: [email protected] 10.1515/9783110516623-053 DOI 10.1515/9783110303568-053

544 | Bo Zhou, Chao Bian, Jian-Hua Tong and Shan-Hong Xia A glass composite pH electrode was traditionally used to detect pH of the water, due to the good sensitivity, selectivity, stability and long life time. However, there are some drawbacks limiting its applications in on-site and integrated measurements, such as relatively high price, mechanical fragility, and unachievable miniaturization. In addition, the liquid junction brings some difficulties to the maintenance. To address these shortcomings, numerous methods were considered as alternatives to realize novel pH sensors, such as optical fiber pH sensors[2], ion selective field effect transistors[3], and solid state potentiometric electrodes[4]. Potentiometric ion selective electrodes based on metal oxides stand out among them, because of the good stability over wide pH range, fast response, as well as high temperature and pressure endurance[5]. Furthermore, simple detection procedure and mechanical robustness make it easy to miniature and integrate the metal oxide electrodes using modern technologies, including micro-electro-mechanical system (MEMS) and thick-film techniques[6]. Researchers have studied numbers of metal oxides as pH sensitive material, such as RuO2[7], Ta2O5[6], SnO2[8], TiO2[4], IrO2[9]. Due to the chemical stability, fast response, and wide pH sensitive window, iridium oxide has been considered to be the most promising[9]. There are many methods for the preparation of iridium oxide, including thermal oxidation[10], sputtering[9], sol-gel[11], and electrochemical method[12]. With the need of expensive Ir metal as the substrate or target, thermal oxidation and sputtering methods always involve high cost. The cost of sol-gel process is acceptable, because iridium tetrachloride is usually used as the precursor. However, a heat treatment at high temperature (typically, 300°C) is always necessary, which might lead to problems when developing integrated sensors, since high temperature may disturb some steps in the fabrication process. Thus, electrodeposition is an attractive method to produce iridium oxide for pH sensor at low temperature. A robust reference electrode is a requisite component to miniature electrochemical sensors, especially in unattended measurements for long periods of time. Although pseudo-reference electrode was often integrated in direct contact with sample solutions, the potential of such electrodes was unstable and affected by the external solutions [13]. A practical and reliable solution is to miniaturize a conventional reference electrode. In this work, we fabricated a miniature pH sensor using MEMS technique. Iridium oxide nanoparticles were deposited on the surface of Pt electrode acting as the pH sensory material. The properties of the iridium oxide films were investigated using SEM and XPS. Moreover, the performance of the pH electrode was studied and the results indicated that the proposed pH sensor has potentials of replacement of glass pH electrodes. In order to achieve the mechanical robustness, miniaturization of the sensor, and prevention the use of the extra bulk glass reference, an on-chip solid state Ag/AgCl reference electrode was fabricated, whose potential stability was evaluated.

Development of a Solid State Based Films for Water Quality Detection | 545

2 Experimental 2.1 Chemicals and Apparatus All chemicals were analytical grade and used without further purification. Iridium (IV) chloride (99.95%) was supplied by Alfa Aesar. Hydrogen peroxide (30%), potassium carbonate, oxalic acid, boric acid, phosphoric acid, potassium chloride were obtained from Beijing Chemical Works. All water used in the experiments was deionized using a Millipore Direct-Q 3 UV system. A CHI620 electrochemical workstation was used to control the electrochemical experiments. A pHS-3C meter (INESA, Shanghai) was used to verify the pH of solutions. A field emission scanning electron microscopy (FE-SEM) of Merlin Compact (Zeiss, Germany) was used to investigate the morphologies of the obtained films. An imaging X-ray photoelectron spectrometer of Axis Ultra (Kratos, Japan) was used to probe the chemical composition of the surface of iridium oxide films.

2.2 Preparation of pH Sensing Electrode The standard MEMS technique was used to fabricate the electrodes, which was shown in Fig.1 (A). Briefly, a thin Ta/Pt film (30nm/300nm) was sputtered on silicon wafer, and then patterned using lift-off technique, functioning as the substrate electrode. The negative photoresist SU-8 was used as the dielectric material, thus exposing the sensing area of 1mm2 and pads. The other thick SU-8 layer was patterned as a micro-pool surrounding the reference electrode. The iridium oxide was synthesized from the iridium tetrachloride and oxalic acid contained solution introduced by Yamanaka [14]. The process of electrodeposition was conducted using threeelectrode system. The Pt electrode was connected to the workstation as the working electrode, with a Pt foil acting as the counter electrode. A commercial Ag/AgCl (sat.KCl) electrode was employed as the reference. The potential of the working electrode was cycled between 0 to 0.7V, with a scan rate of 100mV/s. This process was lasted for 100 cycles.

2.3 Fabrication of Solid State Reference Electrode The fabrication process of the coupled solid state reference electrode was presented as follows. Pt electrode was coated with Ag/AgCl ink, and annealed at 90°C for 1hour. Then a small amount of KCl saturated agar was sealed in the micro-pool with epoxy adhesive. A sectional view of the completed sensor was shown as Fig.1 (B).

546 | Bo Zhou, Chao Bian, Jian-Hua Tong and Shan-Hong Xia

2.4 Methods The morphology of iridium oxide films was investigated by SEM observation, and the chemical composition of the films was detected using XPS survey. pH measurement was conducted by recording the open-circuit potential between the working electrode and commercial Ag/AgCl reference electrode. The static characteristics, such as sensitivity and repeatability, of the electrode were tested using standard buffer solutions of various pH levels. The dynamic response of the pH electrode was studied with a titration test, in which KOH and HCl solutions were used. The solutions were adjusted firstly from acidic to alkaline, and then from alkaline to acidic. The open-circuit potential was recorded by an electrochemical workstation during the processes. The potential stability of the reference electrode was evaluated using a commercial Ag/AgCl based glass reference electrode as comparison. All the experiments was performed at room temperature (25°C).

Fig. 1: (A) The schematic of fabridated electrodes. (B) A sectional view of the completed sensor.

3 Results and Discussion 3.1 Properties of the Iridium Oxide Film From the prepared electrolyte solution, iridium oxide could be synthesized using different procedures, such as constant current, constant potential, and cyclic potential methods. Although all the iridium oxides prepared by these three methods have a similar pH response, controlled potential protocol was proved to create more uniform films than that created by constant current method[15]. Constant potential is the most favorable way to produce thickest films, while, increasing the thickness may lead to less uniform and more stressed layers [16]. Cyclic potential procedure creates denser and more uniform films with smaller capacitance, which facilitates reducing the errors caused by interface capacitance [17]. In this paper, cyclic voltammeters were employed to prepared iridium oxide. The CV curves of iridium oxide deposition are shown in Fig.2 (A). The anodic peak at 0.28Vand the catholic peak at

Development of a Solid State Based Films for Water Quality Detection | 547

0.22V were derived from the redox reaction between Ir(III) and Ir(IV), which implied that the deposited film is a composition of Ir(III) oxide and Ir(IV) oxide. The surface morphology of as prepared iridium oxide was investigated using SEM, and the images were shown in Fig.2 (B) and (C), which indicated that iridium oxide nanoparticles with the size of tens of nanometers have been deposited on the surface of the electrode homogeneously.

Fig. 2: (A) Cyclic voltammogrames of iridium oxide during deposition on Pt electrode at different cycles. (B) and (C) SEM images of the surface of iridium oxide film.

XPS has been used to probe the chemical composition of the film, and the results were shown in Fig.3. From the high-resolution spectra of the Ir4f region (Fig.3 (A)), it can be found that the binding energy of Ir 4f7/2 and Ir 4f5/2 lines are located at 62.4eV and 65.4eV, respectively. According to the curve fitting which was performed with the constrains described in [18], the ratio of Ir(III) to Ir(IV) was calculated to 1.38. The O1s signal (Fig.3 (B)) has illustrated the present of hydroxide and water of hydration on the surface of the film.

Fig. 3: XPS spectra of the surface of iridium oxide film. (A)The detailed Ir4f region. (B) The detailed O1s region.

548 | Bo Zhou, Chao Bian, Jian-Hua Tong and Shan-Hong Xia

3.2 PH Response The pH sensors were calibrated using solutions of various pH levels, which were adjusted by mixing 0.2M NaOH and Britton-Robinson buffer solutions with various volume ratio. The solutions from pH1.87 to pH12.3 were prepared, which were verified by a calibrated commercial pH meter. The iridium oxide electrode and reference electrode were dipped into these individual solutions. After equilibrium state was reached, the potential response was recorded. Between the measurements, the electrode was washed with deionized water and dried. Each electrode was tested for at least three times. Then, the potential responses were plotted against pH values, and a typical calibration curve was displayed in Fig.4 (A). The iridium oxide showed a sensitivity of -75.8 mV/pH, with good linearity (R2 = 0.9985).

Fig. 4: (A) The potential responses of the pH electrode to buffer solutions from pH = 1.87 to pH = 12.3. (B) Repeatable response in the standardsolutions of pH = 4.01, 6.86, and 9.18.

The output of the pH sensor based on metal oxides is the half-cell potential, generated in the interface between the electrode and the solution, which varies with the concentration of proton in the electrolyte. As for the case of iridium oxide, the possible mechanisms could be written as the following reactions [19]: ‫ݎܫ‬ଶ ܱଷ ൅ ͸‫ ܪ‬ା ൅ ͸݁ ି ൌ ʹ‫ ݎܫ‬൅ ͵‫ܪ‬ଶ ܱሺͳሻ

‫ܱݎܫ‬ଶ ൅ Ͷ‫ ܪ‬ା ൅ Ͷ݁ ି ൌ ‫ ݎܫ‬൅ ʹ‫ܪ‬ଶ ܱሺʹሻ

ʹ‫ܱݎܫ‬ଶ ൅ ʹ‫ ܪ‬ା ൅ ʹ݁ ି ൌ ‫ݎܫ‬ଶ ܱଷ ൅ ‫ܪ‬ଶ ܱሺ͵ሻ

According to the Nernst equation, the potential is determined by  ൌ  ଴ െ ʹǤ͵Ͳ͵

ୖ୘ ୊

’ ൌ  ଴ െ ͲǤͲͷͻͳ͸’ ሺͶሻ

Development of a Solid State Based Films for Water Quality Detection | 549

Where E0 is the standard electrode potential with a value of 577mV for an Ag/AgCl reference electrode. R, T, and F are gas constant, temperature, and Faraday’s constant, respectively. The pH sensitivity is theoretically calculated to be -59mV/pH at room temperature (25°C). However, the pH response of iridium oxide based electrode may vary with the preparation methods. For example, iridium oxide films prepared by sputtering or sol-gel are usually anhydrous, which show the sensitivity near to -59mV/pH [9][20]. On the other hand, the presence of hydrated water and  ି groups in the electrochemically prepared iridium oxide layers, always generates a response greater than -59mV/pH, referred as super-Nernstian response [21]. The XPS investigation indicated that the iridium oxide film in our work is strongly hydrated and should exhibit a super-Nernstian response, which matched the calibration result. Repeatability was investigated using standard pH buffer solutions of pH4.01, 6.86, and 9.18. In the experiment, pH sensor was placed in the solutions repeatedly, with the potential response recorded and shown in Fig.4 (B). According to the results of four repeated measurements, the maximum relative deviation for each pH level was less than 2.7%, which implied that the sensor exhibited a good repeatability. The dynamic property of the electrode was tested by a titration experiment. The test was carried out from acid to alkaline, and then the process was reversed. Specifically, KOH solution was quickly added into HCl solution in which the electrode was immersed. After that, the electrode was placed in KOH solution, and HCl solution was quickly added into it. During the measurements, the pH of the solution was monitored by pH meter, and the transient potential response of the electrode was recorded by an electrochemical workstation. Response time is defined as the time required reaching 90% of the equilibrium value for the characterization of dynamic property. Fig.5 shows the response time of the electrode, indicating that it only takes several seconds to reach a new equilibrium state from the former state. The quick response facilitates reducing the detection time, so the power consumption could be reduced, which is very important for remote measurement.

550 | Bo Zhou, Chao Bian, Jian-Hua Tong and Shan-Hong Xia

Fig. 5: Transient response in titration test (A) from pH = 1.4 to pH = 12.06, (B) from pH = 11.3 to pH = 2.2.

3.3 Performance of the Reference Electrode A stable reference electrode was the most essential component to electrochemical experiments. The potential of an Ag/AgCl based reference electrode was determined by the Žି concentration, which could be expressed by [13] ோ்

‫ ܧ‬ൌ ‫ ܧ‬଴ െ ʹǤ͵Ͳ͵ ቀ ቁ ݈‫݃݋‬ଵ଴ ሾ‫ ି ݈ܥ‬ሿఈ ሺͷሻ ௡ி

To achieve a better performance for miniaturized reference electrode, many efforts were took to prevent the leakage of inner electrolyte [22]. In our case, KCl saturated agar was used as solid state electrolyte, avoiding the complicated operation for the encapsulation of a small amount of liquid. Epoxy adhesive was coated on the electrolyte to keep the agar from dissolving in the sample solution. A test was carried out to investigate the stability of the fabricated reference electrode, in which the electrode was dipped in the demonized water and the open-circuit potential versus a commercial reference electrode was recorded. The potential remained stable in the continuous measurement as shown in Fig.6, indicating that the epoxy adhesive efficiently prevented the Žି from diffusing into the water. This potential around 23mV is probably due to the unequal concentration of Žି for the agar and the inner KCl solution of commercial reference electrode.

Development of a Solid State Based Films for Water Quality Detection | 551

Fig. 6: The potential response of on-chip reference electrode over 10 hours.

4 Conclusions In this paper, we developed a miniature solid state pH sensor for water quality detection. A Pt electrode, coated with hydrous electrodeposited iridium oxide film, acted as the pH sensing electrode, which showed the features of high sensitivity, good repeatability, and short response time. Moreover, integrated on the chip was a solid state reference electrode, whose potential was stable enough, so that no extra glass reference electrode is needed. The test results indicated that the proposed sensor could be used in the fields where glass pH electrode usually adopted. Because of no liquid junction involved, the proposed sensor is easy to maintain. The low cost allows mass production, so it could be used in distribution measurement system, where large numbers of sensors might be in urgent need. Meanwhile, the mechanical robustness and the small size make it possible for detecting water quality in harsh environment, where glass electrode was unsuitable. Acknowledgement: The authors acknowledge financial support from the National Basic Research Program of China (973 Program) (No. 2015CB352100) and the National Natural Science Foundation (No. 61671433).

References [1]

[2]

Y. Qin, H. Kwon, M. M. R. Howlader, and M. J. Deen, “Microfabricated electrochemical pH and free chlorine sensors for water quality monitoring: recent advances and research challenges,” RSC Adv., vol. 5, no. 85, pp. 69086–69109, 2015. Y. Zheng et al., “Miniature pH Optical Fiber Sensor Based on Fabry–Perot Interferometer,” IEEE J. Sel. Top. Quantum Electron., vol. 22, no. 2, pp. 331–335, 2016.

552 | Bo Zhou, Chao Bian, Jian-Hua Tong and Shan-Hong Xia [3]

[4] [5]

[6] [7]

[8] [9]

[10] [11] [12] [13]

[14]

[15]

[16]

[17]

[18]

[19] [20] [21]

N. Bahari, A. M. Zain, A. Z. Abdullah, D. Bien, C. Sheng, and M. Othman, “Study on pH sensing properties of RF magnetron sputtered tantalum pentoxide (Ta2O5) thin film,” Proc. IEEE International Conference on Semiconductor Electronics (ICSE2010)pp. 76–78, 2010. R. Zhao, M. Xu, J. Wang, and G. Chen, “A pH sensor based on the TiO2 nanotube array modified Ti electrode,” Electrochim. Acta, vol. 55, no. 20, pp. 5647–5651, 2010. D. K. Maurya, A. Sardarinejad, and K. Alameh, “Recent Developments in R.F. Magnetron Sputtered Thin Films for pH Sensing Applications—An Overview,” Coatings, vol. 4, no. 4, pp. 756–771, 2014. N. Uria, N. Abramova, A. Bratov, F. X. Muñoz-Pascual, and E. Baldrich, “Miniaturized metal oxide pH sensors for bacteria detection,” Talanta, vol. 147, pp. 364–369, 2016. A. Sardarinejad, D. K. Maurya, and K. Alameh, “Physical The effects of sensing electrode thickness on ruthenium oxide thin-film pH sensor,” Sensors Actuators A. Phys., vol. 214, pp. 15–19, 2014. C. Pan, J. Chou, T. Sun, and S. Hsiung, “Development of the real-time pH sensing system for array sensors,” Sensors and Actuators, B Chem.vol. 108, pp. 870–876, 2005. L. M. Kuo, Y. C. Chou, K. N. Chen, C. C. Lu, and S. Chao, “A precise pH microsensor using RFsputtering IrO2 and Ta2O5 films on Pt-electrode,” Sensors Actuators, B Chem., vol. 193, pp. 687–691, 2014. F. Huang, Y. Jin, L. Wen, D. Mu, and M. Cui, “Effects of Thermal Oxidation Cycle Numbers and Hydration on IrOx pH Sensor,” J. Electrochem. Soc., vol. 160, no. 10, pp. B184–B191, 2013. C. M. Nguyen et al., “Sol-Gel Iridium Oxide-Based pH Sensor Array on Flexible Polyimide Substrate,” IEEE Sens. J., vol. 13, no. 10, pp. 3857–3864, 2013. C. M. Nguyen et al., “Micro pH Sensors based on Iridium Oxide Nanotubes,” IEEE Trans. Nanotechnol., vol. 13, no. c, pp. 1–1, 2014. S. Kyung, H. Lim, T. Dong, and H. Chan, “A miniaturized electrochemical system with a novel polyelectrolyte reference electrode and its application to thin layer electroanalysis,” Sensors and Actuators, B Chem,vol. 115, pp. 212–219, 2006. K. Yamanaka, “Anodically electrodeposited iridium oxide films (AEIROF’s) from alkaline solutions for electrochromic display devices,” Jpn. J. Appl. Phys., vol. 28, no. 4. pp. 632–637, 1989. H. A. Elsen, C. F. Monson, and M. Majda, “Effects of Electrodeposition Conditions and Protocol on the Properties of Iridium Oxide pH Sensor Electrodes,” J. Electrochem. Soc., vol. 156, no. 1, pp. F1–F6, 2009. J. D. Blakemore et al., “Characterization of an Amorphous Iridium Water-Oxidation Catalyst Electrodeposited from Organometallic Precursors,”Inorganic Chemistry, vol. 52, pp.1860-1871, 2013. H. A. Elsen, K. Slowinska, E. Hull, and M. Majda, “Determination of the capacitance of solidstate potentiometric sensors: An electrochemical time-of-flight method,” Anal. Chem., vol. 78, no. 18, pp. 6356–6363, 2006. I. G. Casella, M. Contursi, and R. Toniolo, “Anodic electrodeposition of iridium oxide particles on glassy carbon surfaces and their electrochemical/SEM/XPS characterization,” J. Electroanal. Chem., vol. 736, pp. 147–152, 2015. W. D. Huang, H. Cao, S. Deb, M. Chiao, and J. C. Chiao, “A flexible pH sensor based on the iridium oxide sensing film,” Sensors Actuators, A Phys., vol. 169, no. 1, pp. 1–11, 2011. C. M. Nguyen et al., “Sol-gel deposition of iridium oxide for biomedical micro-devices,” Sensors (Switzerland), vol. 15, no. 2, pp. 4212–4228, 2015. P. Steegstra and E. Ahlberg, “Electrochimica Acta Influence of oxidation state on the pH dependence of hydrous iridium oxide films,” Electrochim. Acta, vol. 76, pp. 26–33, 2012.

Development of a Solid State Based Films for Water Quality Detection | 553 [22]

H. Suzuki and H. Shiroishi, “Microfabricated Liquid Junction Ag/AgCl Reference Electrode and Its Application to a One-Chip Potentiometric Sensor,” Analytical Chemistry, vol. 71, no. 22, pp. 5069–5075, 1999.

Juan Xie1 and Ying-Fang Lu2

Simple Fabrication of ZnO Hierarchical Structures with Enhanced Photocatalytic Activity Abstract: Three kinds of three-dimensional ZnO hierarchical structures were successfully prepared by a facile, economical and environment-friendly aqueous solution route without using any template or structure-directing agent. X-ray diffraction (XRD), field emission scanning electron microscopy (FESEM), transmission electron microscopy (TEM) and UV–vis diffuse reflectance spectra (UV-vis DRS) were used to characterize the products. Photocatalytic activity of the as-prepared ZnO powders, evaluated by degradation of methyl orange and methylene blue under UV light irradiation, is found to be closely related to the particle morphology. Moreover, the maximum degradation efficiency of methyl orange and methylene blue approaches 100% within 5 h and 6 h, respectively. Keywords: ZnO; hierarchical structure; photocatalysis; methyl orange; methylene blue

1 Introduction Oxide semiconductor-mediated photocatalytic purification of polluted air and wastewater is a promising environmental remediation technology, especially for low levels of organic contaminants [1]. Among the oxide semiconductors employed, TiO2 is the most extensively used photocatalyst due to its biological and chemical inertness, strong oxidizing power and long-term stability against photo- and chemical-corrosion. In fact, ZnO is also an important semiconductor photocatalyst, because the wide direct band gap (3.37 eV) of ZnO is almost the same as that of TiO2 (3.2 eV), and its photodegradation mechanism is similar to that of TiO2 [2]. Other advantages of ZnO are that it absorbs over a larger fraction of the solar spectrum than TiO2 [3] and its quantum efficiency is significantly greater than that of TiO2 [4]. Some researchers have highlighted the performance of ZnO on degradation some organic compounds, even in aqueous solutions [5, 6].

|| 1 College of Mathematical Science and Engineering, Hebei University of Engineering, Handan, China. e-mail: [email protected] 2 College of Chemistry and material science, Hebei Normal University, Shijiazhuang, China. e-mail: [email protected] 10.1515/9783110516623-054 DOI 10.1515/9783110303568-054

556 | Juan Xie and Ying-Fang Lu It is well known that ZnO exhibits the richest range of morphologies among the wide band gap semiconductors, but there is still not much known about the regulation of photocatalytic activity of ZnO particles with different morphologies. So far, welldefined ZnO nano- or microstructures with various shapes have been reported, for instance nanorods, nanowires, nanobelts, nanotubes, nanosheets, hollow microspheres, complicated hierarchical architectures and so on. Compared with monomorphological ZnO structures, hierarchical ZnO structures consisting of nanometerscale building blocks (e.g., nanoparticles, nanorods, nanosheets, etc.) exhibit outstanding optical, electronic, and catalytic properties, and thus have many potential applications in photocatalysts, gas sensors, solar cells, and other fields [7-9]. However, existing methods for preparing ZnO hierarchical structures suffer from high temperature, high cost by combination of solvothermal procedure and/or calcinations. Therefore, there still remains an enormous challenge to exploit simple, mild, and economic routes for the synthesis of ZnO hierarchical structures, and subsequently develop their potential applications. Herein, we present a simple technique for the preparation of ZnO powders, directly from aqueous solution. By controlling the alkalinity of reaction solutions, several three-dimensional (3D) ZnO hierarchical structures were successfully obtained. Meanwhile, photocatalytic activity of these samples was evaluated by measuring the degradation of methyl orange (MO) and methylene blue (MB) under UV light irradiation.

2 Experimental 2.1 Materials All of the chemicals were of analytical grade and used as received. Deionized water was used throughout.

2.2 Preparation According to the molar ratio of Zn2+ to OH-, some amount of NaOH (4 mol·L-1) was added dropwise into 20 mL of 1 mol·L-1 Zn (NO3)2 aqueous solution with certain volume of distilled water under strong magnetic stirring to get a 100 mL mixture solution. Then the aforementioned solution was heated and refluxed for 3 h. White product was collected by filtration, washed with distilled water, and air-dried at ambient temperature. The obtained products with Zn2+/OH- molar ratios of 1:2, 1:3, 1:4 and 1:5 were labeled as Sample-A, Sample-B, Sample-C and Sample-D, respectively.

Simple Fabrication of Enhanced Photocatalytic Activity | 557

2.3 Characterization X-ray diffraction (XRD) data were collected from powder samples using a Bruker D8 Advance diffractometer with Cu Kα radiation. Field emission scanning electron microscopy (FESEM) images were taken by using Hitachi S-4800. Transmission electron microscopy (TEM) was conducted on a Hitachi H-9000 instrument, operating at 200 kV. UV-vis diffuse reflectance spectra (UV-vis DRS) were recorded on a Hitachi UV-3010 spertrophotometer equipped with an integrating sphere.

2.4 Evaluation A 125 W high pressure mercury lamp was used to provide light irradiation, and the distance between the lamp and the reactor was about 10 cm. A total of 0.15 g photocatalyst powders were added into 100 mL of the MO solution (10 mg·L-1) or MB solution (10 mg·L-1). Before illumination, the suspension was stirred continuously in the dark for 30 min to ensure adsorption equilibrium. Suspension (5 mL) containing degradation object (MO or MB) and powder catalyst, taken out at given time intervals, was centrifugally separated and filtrated through millipore filter to remove the catalyst. The kinetic photodecomposition process was monitored by measuring the residuary concentration of MO and MB with a UV-vis spectrophotometer at 462 nm and 664 nm, respectively.

3 Results and Discussion Fig. 1 illustrates the XRD patterns of different ZnO samples. All diffraction peaks of products can be well indexed as a pure hexagonal ZnO structure, which are in agreement with the literature value (JCPDS No. 36-1451). No characteristic peaks from impurities are observed. According to the intensity and half width of the XRD pattern, these ZnO microparticles crystallize well. The peaks of Sample-C and Sample-D are much narrower and higher as compared to those of Sample-A and SampleB, indicating an increase in crystallinity.

558 | Juan Xie and Ying-Fang Lu

Sample-D

Intensity (a.u.)

Sample-C

Sample-B

Sample-A

20

30

40

50

60

70

80

2-Theta-Scale

Fig. 1: XRD patterns of different ZnO samples. FESEM images of the obtained ZnO samples are shown in Fig. 2. Sample-A appears to be ZnO spheres with average diameter of 49.6 nm. The backbone-like ZnO hierarchical structures (Sample-B) are made of many spherical and conical ZnO nanoparticles. The flower-like ZnO hierarchical structures (Sample-C) are assembled from a large number of nanosheets as "petals", whose thickness is about 40 nm. From the FESEM image of Sample-D, we can see that the sample particles are constructed by nanosheets and nanorods, and the nanorods are vertically distributed on both sides of mutually staggered nanosheets. Actually, the TEM image of Sample-D (Fig. 3) indicates that the nanosheets are also composed by nanorods. Therefore, these ZnO hierarchical structures look very much like numerous Chinese double-edged fine-toothed combs placed side by side.

Simple Fabrication of Enhanced Photocatalytic Activity | 559

Fig. 2: FESEM images of different ZnO samples with low magnification and high magnification. (a,b) Sample-A; (c,d) Sample-B; (e,f) Sample-C; (g,h) Sample-D

The absorption spectra of the four kinds of ZnO particles are shown in Fig. 4. It is clearly seen that compared with Sample-A which only absorbs the ultraviolet light, the adsorption edges of other samples move remarkably with a red shift to visible light region, and the more complex the sample structure, the lager the red shift. The strongest visible light absorbance ability can be found in Sample-D. This result suggests that the above ZnO hierarchical structures have potential for photocatalysis using the visible part of the spectrum.

560 | Juan Xie and Ying-Fang Lu

Fig. 3: TEM image of Sample-D.

Sample-A Sample-B Absorbance (a.u.)

Sample-C

300

Sample-D

400

500

600

700

800

Wavelength (nm)

Fig. 4: UV-vis diffuses reflectance spectra of different ZnO samples.

Fig.5 displays the degradation efficiency of (a) MO and (b) MB versus irradiation time over different samples. Blank study (absence of catalyst) was carried out under the same experimental conditions. It is observed that without photocatalyst, only small amount of MO or MB was degraded due to photolysis. In contrast, when catalysts were placed in the solution and UV light was turned on, the degradation efficiencies of MO and MB were all higher than direct photolysis. It can be found that flower-like ZnO hierarchical structures exhibited the best photocatalytic activity,

Simple Fabrication of Enhanced Photocatalytic Activity | 561

whether it's MO or MB. MO and MB were almost completely degraded within 5 h and 6 h, respectively. In addition to photocatalytic efficiency, the reusability of photocatalyst is also a key issue for practical application. Therefore, recycling tests with repeated use of flower-like ZnO photocatalyst in three consecutive reactions were carried out under the same conditions. As shown in Fig. 6, after two recycles of MO and MB degradation, the flower-like ZnO hierarchical structures still showed comparatively high photocatalytic activity. It confirms that the as-prepared ZnO hierarchical structures are stable and not photocorroded. 100

100

(a)

90

60

Degradation efficiency (%)

Degradation efficiency (%)

80

70

UV only Sample-A Sample-B Sample-C Sample-D

50 40 30 20 10 0

(b)

90

80

70 60

UV only Sample-A Sample-B Sample-C Sample-D

50 40 30 20 10

0

30

60

90

120

150

180

Time (min)

210

240

270

300

0

0

40

80

120

160

200

240

280

320

360

Time (min)

Fig. 5: Degradation efficiency of (a) MO and (b) MB versus irradiation time over different samples.

562 | Juan Xie and Ying-Fang Lu 100

(a)

Degradation efficiency of MO (%)

90 80 70 60 50 40 30 20 10 0

1

2

Reused number

3

100

(b)

Degradation efficiency of MB (%)

90 80 70 60 50 40 30 20 10 0

1

2

Reused number

3

Fig. 6: Reuse of flower-like ZnO hierarchical structures.

4 Conclusions By controlling the alkalinity of reaction solutions, several 3D ZnO hierarchical structures were successfully prepared via a fast and green boiling reflux method. Experiment results show that the as-prepared ZnO hierarchical structures not only have good catalytic activity under UV light irradiation, but also have excellent circulation stability. Acknowledgement: This work was financially supported by grants from the National Natural Science Foundation of China (51541403), the Natural Science Foundation of Hebei Province, China (B2014402062), and the Science and Technology Research Foundation of Hebei Education Department for Young Teachers in University (QN20131085).

Simple Fabrication of Enhanced Photocatalytic Activity | 563

References [1]

[2]

[3]

[4]

[5]

[6]

[7]

[8]

[9]

X. F. Li, K. L. Lv, K. J. Deng, J. F. Tang, R. Su, J. Sun, L. Q. Chen, “Synthesis and characterization of ZnO and TiO2 hollow spheres with enhanced photoreactivity,” Materials Science and Engineering B, vol. 158, Feb. 2009, pp. 40–47, doi: 10.1016/j.mseb.2008.12.036. C. Hariharan, “Photocatalytic degradation of organic contaminants in water by ZnO nanoparticles: revisited,” Applied Catalysis A, vol. 304, May. 2006, pp. 55–61, doi: 10.1016/j.apcata.2006.02.020. E. Yassıtepe, H. C. Yatmaz, C. Öztürk, K. Öztürk, C. Duran, “Photocatalytic efficiency of ZnO plates in degradation of azo dye solutions,” Journal of Photochemistry and Photobiology A, vol. 198, July. 2008, pp. 1–6, doi: 10.1016/j.jphotochem.2008.02.007. S. Chakrabarti and B. K. Dutta, “Photocatalytic degradation of model textile dyes in wastewater using ZnO as semiconductor catalyst,” Journal of Hazardous Materials, vol. 112, Aug. 2004, pp. 269–278, doi: 10.1016/j.jhazmat.2004.05.013. S. K. Kansal, M. Singh, and D. Sud, “Studies on photodegradation of two commercial dyes in aqueous phase using different photocatalysts,” Journal of Hazardous Materials, vol. 141, Mar. 2007, pp. 581–590, doi: 10.1016/j.jhazmat.2006.07.035. N. Sobana and M. Swaminathan, “The effect of operational parameters on the photocatalytic degradation of acid red 18 by ZnO,” Separation and Purification Technology, vol. 56, Aug. 2007, pp. 101–107, doi: 10.1016/j.seppur.2007.01.032. N. T. Khoa, S. W. Kim, D. V. Thuan, D.-H. Yoo, E. J. Kim, S. H. Hahn, “Hydrothermally controlled ZnO nanosheet self-assembled hollow spheres/hierarchical aggregates and their photocatalytic activities,” CrystEngComm, vol. 16, July. 2014, pp. 1344-1350, doi: 10.1039/C3CE41763H. M. Y. Ge, T. M. Xuan, G. L. Yin, J. Lu, D. N. He, “Controllable synthesis of hierarchical assembled porous ZnO microspheres for acetone gas sensor,” Sensors and Actuators B, vol. 220, Dec. 2015, pp. 356–361, doi: 10.1016/j.snb.2015.05.054. D. Pugliese, F. Bella, V. Cauda, A. Lamberti, A. Sacco, E. Tresso, S. Bianco, “A Chemometric Approach for the Sensitization Procedure of ZnO Flowerlike Microstructures for DyeSensitized Solar Cells,” ACS Applied Materials & Interfaces, vol. 5, Oct. 2013, pp. 11288–11295, doi: 10.1021/am403527m.

Hong-Yuan Zhao1, Shan-Shan Liu2, Ming Tan2, Zhen-Wei Wang3, Yu Cai3 and Xing-Quan Liu4

Enhanced Cycling Stability of Multi-Cations Doped Spinel Lithium Manganese Oxide for Rechargeable Lithium Batteries

Abstract: In order to promote the industrialization application of LiMn2O4, highperformance multi-cations doped spinel (LiAl0.03Si0.05Mg0.05Mn1.87O4) has been firstly prepared via a simple, low-cost and mass production preferred solid-state method. The light-weight elements Al (III), Mg (II) and Si (IV) occupy the octahedral (16d) sites to replace the manganese ions, and the introduction of these elements does not change the intrinsic spinel structure of LiMn2O4. No other detectable impurity phase suggests the high purity of the obtained multi-cations doped spinel. Compared with the undoped spinel, the multi-cations doped spinel shows higher crystallinity and relatively more regular surface morphology. When cycled at room temperature, the multi-cations doped spinel shows an initial discharge capacity of 118.7 mAh g-1 at 0.5 C-rate, which is lower that of the undoped spinel, but the corresponding capacity retention can reach up to 97.1% with a high discharge capacity of 115.2 mAh g-1 after 50 cycles. By contrast, the undoped spinel only shows much lower capacity retention of 74.6% with a very undesirable discharge capacity of 95.1 mAh g -1. Moreover, the multi-cations doped spinel can show much better elevated-temperature cycling stability. Keywords: Lithium-ion battery; LiMn2O4; Multi-cations doping; cycling stability; Solid-state method

1 Introduction LiMn2O4 has many advantages such as high thermal stability, low-cost, abundant

|| 1 State Key Laboratory of Electronic Thin Film and Integrated Devices, University of Electronic Science and Technology of China, Chengdu, China, [email protected] (H. Zhao) 2 State Key Laboratory of Electronic Thin Film and Integrated Devices, University of Electronic Science and Technology of China Chengdu, China 3 State Key Laboratory of Electronic Thin Film and Integrated Devices, University of Electronic Science and Technology of China, Chengdu, China 4 State Key Laboratory of Electronic Thin Film and Integrated Devices, University of Electronic Science and Technology of China, Chengdu, China, [email protected] (X. Liu) 10.1515/9783110516623-055 DOI 10.1515/9783110303568-055

566 | Hong-Yuan Zhao, Shan-Shan Liu, Yu Cai and Xing-Quan Liu manganese resources and environmental friendliness [1−3]. However, it always shows relatively poor cycling stability, especially at elevated temperature, which can have an adverse effect on the industrialization application of LiMn2O4. This is mainly because the electrochemical performance of LiMn2O4 is affected intensely by the Jahn-Teller distortion, dissolution of manganese in the electrolyte and nonuniform particle-size distribution [4−6]. To address those issues, doping the manganese sites with other cations has been widely considered as an effective approach to enhance the electrochemical performance of LiMn2O4. According to the existing literatures [7,8], equimolar Mg (II) and Si (IV) co-doping can effectively improve the cycling stability of LiMn2O4 at room temperature, and the further introduction of a certain amount of Al(III) ions can remarkably improve the elevated-temperature performance. However, it is important to note that the sol-gel method cannot be widely-used in the actual industrialization process. It is generally known that solidstate method is a simple, low-cost and mass production preferred synthetic strategy. And, Zhao et al., [14] have reported that the equimolar Mg (II) and Si (IV) co-doped LiMn2O4 can be prepared by a simple and mass production preferred solid-state. The obtained sample shows better cycling stability than that of the undoped spinel, but this result still can't meet the requirement of large-scale industrial production. In order to promote the industrialization application of LiMn2O4, high-performance multi-cations doped spinel (LiAl0.03Si0.05Mg0.05Mn1.87O4) has been successfully prepared via a simple, low-cost and mass production preferred solid-state method. The multi-cations doped spinel can show extremely superior cycling stability and elevated-temperature performance.

2 Experimental The multi-cations doped spinel (LiAl0.03Si0.05Mg0.05Mn1.87O4) has been successfully prepared via a simple, low-cost and mass production preferred solid-state method. Firstly, a certain amount of electrolytic manganese dioxide (EMD) was pretreated by ball-milling for 8 h. The precursor was obtained by mixing the pretreated EMD, lithium carbonate, aluminum nitrate, magnesium nitrate and ethanol solution of tetraethylorthosilicate (TEOS) in a planetary ball mill. After ball-milling, the obtained slurry was dried at 70 °C and ground into powder in an agate mortar. The obtained powder was maintained at 450 °C for 6 h in muffle furnace and then reground after cooling down naturally. Finally, the resulting sample was prepared by sintering at 825 °C for 18 h in muffle furnace. The synthetic crystalline phases were characterized by powder X-ray diffraction (XRD) using a Phillips Pro MPD DY1291 diffractometer equipped with Cu KD radiation (O=0.15406 nm). The morphology was observed by transmission electron microscopy (TEM, JEOL JEM-3010)

Enhanced Cycling Stability Rechargeable Lithium Batteries | 567

To evaluate the electrochemical performance, the simulated batteries were fabricated in an argon-filled glove box, using lithium foil as the anode and Celgard 2400 polymer as diaphragm. The positive electrode was prepared by mixing active materials, acetylene black and polyvinylidene fluoride dissolved in N-methyl-2pyrrolidone with the weight ratio of 85:10:5. The electrolyte was 1 M LiPF6 in a mixture of ethylene carbonate, dimethyl carbonate and ethyl methyl carbonate (EC: DMC: EMC=1:1:1). Galvano static cycling was performed between 3.20 and 4.35 V at 0.5 C-rate on NEWARE battery testing system.

3 Results and Discussion

Fig. 1: XRD patterns of the obtained samples.

Fig. 1 shows the XRD patterns of the LiMn2O4 and LiAl0.03Si0.05Mg0.05Mn1.85O4 samples prepared via a simple, low-cost and mass production preferred solid-state method. As shown here, both the two samples show the characteristic diffraction peaks of LiMn2O4 (JCPDS No. 35-0782), suggesting that the introduction of Al3+, Si4+ and Mg2+ ions has a little impact on the spinel structure of LiMn2O4. It is reported that manganese ions locate at the octahedral (16d) sites and lithium ions occupy the tetrahedral (8a) sites in the ideal spinel structure [10]. According to previous studies [11], the (220) peak, which corresponds to the tetrahedral sites, will appear in the XRD pattern if the tetrahedral sites are occupied by other cations. As shown in Fig. 1, we did not find the existence of the (220) peak, suggesting that the tetrahedral sites have not been occupied. Add that into the consideration with no other impurity phases

568 | Hong-Yuan Zhao, Shan-Shan Liu, Yu Cai and Xing-Quan Liu and decrease of crystal lattice constant, we can conclude that the silicon and magnesium ions have occupied the octahedral (16d) sites to replace the manganese ions. Table 1 lists the crystal parameters of the obtained samples. Compared with the undoped spinel, the multi-cations doped spinel exhibits the higher intensity ratio of (311)/(400) peaks, than that of the undoped LiMn2O4 due to the introduction of aluminium, silicon and magnesium ions in the spinel structure, which are closely associated with the cycling stability and crystalline quality [12]. This suggests that multidoping the manganese sites with aluminium, silicon and magnesium ions may exert an important influence on the electrochemical performance. Table 1: crystal parameters of the obtained samples calculated from the xrd patterns. Sample

Space

a (nm)

Volume (nm3)

I311 /I400

LiMn2O4

Fd-3m

0.82453

0.56056

0.8625

LiAl0.03Si0.05Mg0.05Mn1.87O4

Fd-3m

0.82359

0.55864

1.0371

Fig. 2 shows the SEM images of the LiMn2O4 and LiAl0.03Si0.05Mg0.05Mn1.85O4 samples. It can be clearly observed from Fig. 2(a) that the undoped spinel particles show irregular surface morphology and non-uniform particle size distribution. By contrast, the multi-cations doped spinel particles shown in Fig. 2(b) possess regular octahedron or polyhedron crystal morphologies and uniform particle size distribution. This indicates that the introduction of Al3+, Si4+ and Mg2+ ions can effectively improve the crystalline quality and reduce the aggregation of particles.

Fig. 2: SEM images of (a) the undoped spinel and (b) the multi-cations doped spinel.

Fig. 3 shows the EDS patterns of the undoped and multi-cations doped LiMn2O4 samples. From the Fig. 3(a), it can be noted that the characteristic peaks of manganese and oxygen elements are observed in the EDS pattern of the undoped spinel. As for the Mg2+, Al3+ and Si4+ multi-doped spinel, the EDS pattern (Fig. 3(b)) reveals the presence of aluminum, magnesium and silicon elements, regardless of the oxy-

Enhanced Cycling Stability Rechargeable Lithium Batteries | 569

gen element. Considering that the XRD result (Fig. 1), it can be concluded that the magnesium ions, aluminum ions and silicon ions are populated into the cubic spinel structure. Furthermore, the chemical homogeneity is an important issue for the doped materials.

Fig. 3: EDS patterns of the resulting samples: (a) undoped spinel and (b) multi-cations doped spinel.

Fig. 4 show the cycling stability and elevated-temperature performance of the LiMn2O4 and LiAl0.03Si0.05Mg0.05Mn1.85O4 samples cycled at 0.5 C-rate between 3.20 and 4.35 V. As shown in Fig. 4(a), the undoped LiMn2O4 sample shows relatively poor cycling stability. The initial discharge capacity can reach up to 127.4 mAh g-1, which is higher than that of the multi-cations doped spinel, but the discharge capacity rapidly decreases to 95.1 mAh g-1 with low capacity retention of 74.6% after 50 cycles. By contrast, the Mg2+, Al3+ and Si4+ multi-doped spinel shows better cycling stability. It can exhibit the initial discharge capacity of 118.7 mAh g-1, which is slightly lower than that of the undoped spinel. As expected, the discharge capacity can still be up to 115.2 mAh g-1 after 50 cycles with capacity retention of 97.1%, which is much better than that of the undoped spinel. Fig. 4(b) shows the elevatedtemperature performance of the LiMn2O4 and the multi-cations doped spinel can show an initial discharge capacity of 118.3 mAh g-1 at 0.5 C-rate, which is slightly below that of the undoped spinel, but the capacity retention of multi-cations doped spinel can reach up to 93.4% with a high discharge capacity of 110.5 mAh g-1 after 50 cycles. By contrast, the undoped spinel only shows much lower capacity retention of 57.0% with a very undesirable discharge capacity of 72.3 mAh g-1. These results indicate that the LiAl0.03Si0.05Mg0.05Mn1.87O4 samples prepared in this work can be a promising candidate material for high-performance rechargeable lithium batteries and the simple, low-cost and mass production preferred solid-state method promote the industrial application.

570 | Hong-Yuan Zhao, Shan-Shan Liu, Yu Cai and Xing-Quan Liu

Fig. 4: (a) Cycling stability and (b) Elevated-temperature performance of the undoped spinel and the multi-cations doped spinel.

4 Conclusions The multi-cations doped spinel has been firstly prepared via a simple, low-cost and mass production preferred solid-state method. XRD characterization indicated the introduction of Mg2+, Al3+ and Si4+ ions does not change the intrinsic spinel structure of LiMn2O4. Moreover, the multi-cations doped spinel showed higher purity, relatively regular surface morphology and uniform particle size distribution. When cycled at 0.5 C-rate, the multi-cations doped LiMn2O4 sample can show much better cycling stability and elevated-temperature performance, which can be attributed to the fact that the introduction of Al3+, Si4+ and Mg2+ ions in the spinel structure could fully utilize the synergistic enhancement effect to significantly enhance the electrochemical performance of LiMn2O4. Acknowledgement: This work was financially supported by the National Natural Science Foundation of China (No. 21071026) and the Outstanding Talent Introduction Project of University of Electronic Science and Technology of China (No. 08JC00303).

References [1]

[2]

H.K. Song, K.T. Lee, M.G. Kim, L.F. Nazar, and J. Cho, “Recent progress in nanostructured cathode materials for lithium secondary batteries”, Adv. Funct. Mater, 20 (2010), pp. 3818– 3834. X. Gao, Y. Sha, Q. Lin, R. Cai, M.O. Tade, and Z. Shao, “Combustion-derived nanocrystal line LiMn2O4 as a promising cathode material for lithium-ion batteries”, J. Power Sources, 275 (2015), pp. 38–44.

Enhanced Cycling Stability Rechargeable Lithium Batteries | 571 [3]

[4]

[5]

[6]

[7]

[8]

[9]

[10]

[11]

[12]

H. Zhao, F. Li, X. Liu, W. Xiong, B. Chen, H. Shao, D. Que, Z. Zheng, and Y. Wu, “A simple, low-cost and eco-friendly approach to synthesize single-crystalline LiMn2O4 nanorods with high electrochemical performance for lithium-ion batteries”, Electrochim. Acta, 166 (2015), pp. 124–133. M. Hirayama, H. Ido, K.S. Kim, W. Cho, K. Tamura, J. Mizuki, and R. Kanno, “Dynamic Structural Changes at LiMn2O4/Electrolyte Interface during Lithium Battery Reaction”, J. Am. Chem. Soc., 132 (2010), pp. 15268–15276. M.H. Rossouw, A. de Kock, L.A. de Picciotto, M.M. Thackeray, W.I.F. David, and R.M. Ibberson, “Structural aspects of lithium-manganese-oxide electrodes for rechargeable lithium batteries”, Mater. Res. Bull., 25 (1990), pp. 173–182. Y. Xia, T. Sakai, T. Fujieda, X.Q. Yang, X. Sun, Z.F. Ma, J. McBreen, and M. Yoshio, “Correlating Capacity Fading and Structural Changes in Li1+yMn2−yO4−δ Spinel Cathode Materials: A Systematic Study on the Effects of Li/Mn Ratio and Oxygen Deficiency”, J. Electrochem. Soc., 148 (2001), pp. A723–A729. H. Zhao, F. Li, X. Liu, C. Cheng, Z. Zhang, Y. Wu, W. Xiong, and B. Chen, “Effects of equimolar Mg (II) and Si (IV) co-doping on the electrochemical properties of spinel LiMn2−2xMgxSixO4 prepared by citric acid assisted sol–gel method”, Electrochim. Acta, 151 (2015), pp. 263–269. H. Zhao, S. Liu, Z. Wang, Y. Cai, M. Tan, and X. Liu, “Enhanced elevated-temperature performance of LiAlxSi0.05Mg0.05Mn1.90-xO4 (0≤x≤0.08) cathode materials for high-performance lithium-ion batteries”. Electrochim. Acta, 199 (2016), pp. 18–26. H. Zhao, S. Liu, Y. Cai, Z. Wang, M. Tan, and X. Liu, “A simple and mass production preferred solid-state procedure to prepare the LiSixMgx Mn2−2xO4 (0≤x≤0.10) with enhanced cycling stability and rate capability”, J. Alloy. Compd., 671 (2016), pp. 304–311. D. Guo, B. Li, Z. Chang, H. Tang, X. Xu, K. Chang, E. Shangguan, X. Yuan, and H. Wang, “Facile synthesis of LiAl0.1Mn1.9O4 as cathode material for lithium ion batteries: towards rate and cycling capabilities at an elevated temperature”, Electrochim. Acta, 134 (2014), pp. 338– 346. D. Capsoni, M. Bini, G. Chiodelli, P. Mustarelli, V. Massarotti, C.B. Azzoni, M.C. Mozzati, and L. Linati, “Inhibition of Jahn−Teller Cooperative Distortion in LiMn2O4 Spinel by Ga3+ Doping”, J. Phys. Chem. B, 106 (2002), pp. 7432–7438. Y.S. Lee, N. Kumada, and M. Yoshio, “Synthesis and characterization of lithium aluminumdoped spinel (LiAlxMn2−xO4) for lithium secondary battery”, J. Power Sources, 96 (2001), pp. 376–384.

Yan-Qi Cui1 and Ying-De Cui2

Review on the Applications of Phase Change Materials (PCMs) for Building Envelopes Abstract: Building envelopes play an important role in buildings. They not only supply the living conditions for the residents but also prevent the negative effect from the nature climate to the indoor. Integrate phase change materials with building enclosure could improve human comfort with low energy consumption. This review paper focuses on the characteristics and applications of Phase Change Materials (PCMs) for building envelopes. It analyzes the thermal properties, chemical properties and physical properties of the appropriate phase change materials and reviewed the primary works on the PCM wallboards, roofs, ceilings, windows and floors. And finally, it is ended by the suggestions of the future study. Keywords: Phase change material; thermal storage; building envelope; sustainable buildings;

1 Introduction With the improvement of living standard, people’s demand for the indoor environment becomes higher and higher. The use of phase change materials provides a new and reliable way to improve indoor comfort and building energy consumption. As phase change material (PCM) can store or release large amounts of energy when the environmental temperature raises or decreases. Integrate the phase change material with building envelopes could increase the heat capacity of the building enclosures and reduce the influence of external temperature changes on the indoor temperature with low energy consumption. Meanwhile, the characteristics of the heat storage of the phase change material could store the (heat/cool) during the off-peak electricity period and use them at the peak electricity period.

|| 1 Urban Construction Department Zhongkai University of Agriculture and Engineering, Guangzhou, P. R. China. [email protected] 2 Guangzhou Vocational College of Science and Technology, Guangzhou, P. R. China. [email protected] 10.1515/9783110516623-056 DOI 10.1515/9783110303568-056

574 | Yan-Qi Cui and Ying-De Cui

2 Characteristics of Phase Change Materials (PCMs) for Building Envelopes The ideal phase change materials for building envelops should be satisfied with the following requirements in thermal properties, chemical properties and physical properties [1]: The most important factors of the PCM thermal properties is the suitable phase change temperature. 22°C - 26°C is human comfortable temperature range which is the recommended phase change point. Heat conductivity of the PCM is also significant in thermal properties. High heat conductivity would raise the efficiency of the charging and discharging of the heat storage. Chemical stability is another important characteristic of PCM. It relates to the long term application and building quality. PCM can suffer from the degradation, chemical decomposition, and incompatibility with materials of construction; it should be non-toxic, non-flammable, and non-explosive. Physical properties include favorable phase equilibrium which has high energy storage and density that would allow a smaller size of container and less vapor pressure. In addition, it should have small volume change, no super cooling and sufficient crystallization rate.

3 Applications of Phase Change Materials (PCMs) for the envelope of Buildings Improving the thermal property of envelope construction not only saves building energy consumption and reduces CO2 emission but also enhances the human comfort. The applications of PCM on the building envelopes can absorb heat in buildings during the day and release it to the indoor when the temperature falls at night. The PCM envelopes include wallboard, roof, ceiling, window and floor [2].

3.1 Application on Wallboards and Concrete Block The PCM integrates with wallboard material which can improve the thermal inertia and reduce the temperature fluctuation in the room. And this has been proved by many researchers. J .Onishi et al [3] studied the Trombel Wall with PCM by conducting four CFD simulations. Trombe Wall is a primary of passive cooling wall proposed by Professor Felix Trombe in 1956. It consists of a thick masonry wall and a layer of glass which was installed in front of the wall surface. The heat is collected

Review on the Applications Building Envelopes | 575

in the space between the wall and the layer of glass. When the indoor room temperature is lower than the wall surface, the heat is transferred to the room. Heat loss of the wall can be adjusted by an insulating curtain which was fixed between the glazing and the wall. The working principle of Trombe Wall is shown in Figure 1[4]

Fig. 1: The working Principle of Trombe Wall [4]

Kedl and Stovall et al. [5] presented the concept of the paraffin wax impregnated wall board from small samples to full size sheets successfully. Neeper et al. [6] had examined the gypsum wallboards impregnated by fatty acids and paraffin wax as PCMs. All the researches showed that the thermal storage provided by PCM wallboard would be more sufficient to store solar energy. Yan Quanying and Liang Chen

576 | Yan-Qi Cui and Ying-De Cui [7] investigated the thermal storage performance of compound PCM wallboard and found that the compound PCM with different phase change points can be obtained by adjusting the mixed materials proportion. Hawes et al. [8] and Hawes and Feldman [9] have studied the thermal performance of PCMs in different types of concrete blocks. These studies have covered the effects of concrete alkalinity, temperature, immersion time and PCM dilution on PCM absorption during the impregnation process. They examined the mechanisms of absorption and developed the new PCM concrete blocks whose thermal storage has increased to about 300% [10].

3.2 Application on Roofs and Ceiling Roofs and ceilings are important parts of the buildings. They can prevent the sunlight, the rain, the wind and the snow for the residents, and also insulate the heat or the cool between the indoor and outdoor. Therefore, improving the thermal performance of roofs and ceilings is an effective way for building energy conservation and inhabitants’ comfortable level. Unisa [11] has developed a PCM roof which is used to store the heat during the day time, and supply the heat at the night time. A·Pasupthy et al. [12] developed a ceiling system with PCM which can store energy in peak times and release it at the off -peak time. Thus the electric cost of conventional cooling will be decreased. Another new approach proposed was that applying microencapsulated PCM slurry in cooled ceiling system [13]. MPCM slurry worked as heat transfer and heat storage media. The flow and heat transfer characteristics of MPCM slurries have been investigated in recent years [14–18]. Wang and Niu [19] designed a combining system of cooled ceiling and MPCM slurry storage (Figure 2) which was shown better performance from both energy saving and cooling demand shifting aspects.

Fig. 2: Schematic diagram of cooled-ceiling integrated with MPCM slurry tank [19]

Review on the Applications Building Envelopes | 577

3.3 Application on Window The function of the window is to adjust the temperature, the light and the ventilation of the room. Using PCMs in the window can improve the comfort of room temperature and save energy. There are two ways to integrate PCM with windows. One is PCM shutter which is placed outside of window areas. During day time, the shutter is opened, the PCM melt and absorb solar energy from the outdoor. At the night time, the shutter is closed, and the PCM freeze and release the heat to the room. The other approach is to fill the window plates with PCM which can adjust the room temperature [20], [21].

3.4 Application on Floor The common ways of utilizing phase change material with floor is PCM floor panel. Amir et al. [21] studied the performance of two heating floor panels containing PCM in a concrete structure. It is found that PCM had a much lower surface temperature fluctuation and the ability of the floor to provide the necessary warmth during the remaining period of the day after shutting off the heating. Farid and Kong [22] have constructed two concrete slabs; one of them containing encapsulated PCM, similar conclusion was drawn.

4 Summary Although the research on the applications of Phase Change Materials (PCMs) for building envelopes has been studied for decades in the world, it is still a new issue in China. Following suggestions are made for the future research: More types of phase change material (PCM) applied in building envelopes should be studied. Nowadays, most of the research focuses on the economic inorganic salts and paraffin. Although other phase changes materials show great superiority in studies, due to their disadvantages, such as high price and poor compatibility, they are limited applied in the building enclosure. It is important to develop a variety of phase change materials with good performance to achieve temperature control and energy saving in buildings. Accurate thermal performance analysis is the key to the research, so it is the orientation of the researchers. The phase change heat transfer problems have the characteristics with strong nonlinearity. Moreover, liquid flow, volume change and other complex factors, make the analysis on the thermal performance of PCM building envelopes more difficult. Using the experimental method and numerical method is effective to study the thermal insulation performance of the phase change enclosure.

578 | Yan-Qi Cui and Ying-De Cui In short, the applications of phase change materials for building envelopes is the future direction that save energy and maintain the human sustainable development.

References [1] [2]

[3]

[4] [5]

[6]

[7]

[8] [9] [10]

[11] [12] [13] [14]

[15]

[16]

[17]

Atul Sharma, V.V.Tyagi,C.R.Chen, Review on thermal energy storage with phase change materials and applications, Renewable and sustainable Enerfy Reviews 13 (2009) 318-345 Belen Zalba, Jose M.Marin, Luisa F.Cabeza, Harald Mehing, Review on thermal energy storage with phase change: materials, heat transfer analysis and applications, Applied Thermal Engineering 23 (2003) , P251-283; Onishi J , Soeda J ,Mizuno M .Numerical simulation of distributed heatstorage system in a residential room with a massive wall [A] .Proc.of7th international conference on thermal energy storage[ C] .Sapporo ,Japan :Hokkaido University , 1997 .343-348 . “Building with phase change wallboard in Shenyang Area”, Phd Thesis, 2010, P1-10.Chen Qizhen, Application Research on passive solar; Kedl RJ, Stovall TK. Activities in support of the wax-impregnated wallboard concept. U.S. Department of Energy: thermal energy storage researches activity review. New Orleans, Louisiana, USA, 1989; Neeper DA. Potential benefits of distributed PCM thermal storage. In: Coleman MJ, editor. Proceedings of 14th National Passive Solar Conference. Denver, Colorado, USA: American Solar Energy Society; 1989. p. 283–8; Yan Quanying, Liang Chen, Zhang Lin, Experimental study on the thermal storage performance and preparation of paraffin mixtures used in the phase change wall, Solar Energy Materials & solar cells 92(2008) P1526-1532; Hawes DW, Banu D, Feldman D. Latent heat storage in concrete II. Solar Energy Mater 1990; 21:61–80. Hawes DW, Feldman D. Absorption of phase change materials in concrete. Solar Energy Mater Solar Cells, 1992; 27:91–101. Amar M. Khudhair, Mohammed M. Farid, A review on energy conservation in building applications with thermal storage by latent heat using phase change materials, Energy Conversion and Management 45 (2004) 263–275 R.Velraj, A.Pasupathy, Phase change material based thermal storage for energy conservation in building architecture, International Energy Journal: Vol. 7, No. 2, June 2006; Pasupathy, R.Velraj, Effect of double layer phase change material in building roof for year round thermal management, Energy and Buildings, 40(2008) P193-203; D. Zhou , C.Y. Zhao , Y. Tian, Review on thermal energy storage with phase change materials (PCMs) in building applications, Applied Energy, Volume 92, April 2012, Pages 593-605; Charunyakorn P, Sengupta S, Roy SK. Forced convection heat transfer in microencapsulated phase change material slurries: flow in circular ducts. Int J Heat Mass Transfer 1991; 34(3):819–33. Hu XX, Zhang YP. Novel insight and numerical analysis of convective heat transfer enhancement with microencapsulated phase change material slurries: laminar flow in a circular tube with constant heat flux. Int J Heat Mass Transfer 2002; 45:3163–72. Inaba H, Dai C, Horibe A. Natural convection heat transfer of microemulsion phase-changematerial slurry in rectangular cavities heated from below and cooled from above. Int J Heat Mass Transfer 2003; 46:4427–38. Zeng RL, Wang X, Chen BJ, Zhang YP, Niu JL, Wang XC, et al. Heat transfer characteristics of microencapsulated phase change material slurry in laminar flow under constant heat flux. Appl Energy 2009; 86:2661–70.

Review on the Applications Building Envelopes | 579 [18]

[19]

[20] [21] [22]

Zhang GH, Zhao CY. Thermal and rheological property characteristics of PCM microcapsule slurrie. In: 5th International renewable energy storage conference IRES 2010, Invited Keynote paper, Berlin, Germany; 2010 Wang XC, Niu JL. Performance of cooled-ceiling operating with MPCM slurry.Energy Convers Manage 2009;50:583–91 [20] Kmal A.R.Ismail, Carflos T. Salinas, Jorge R.Henriguez, Comparison between PCM filled glass windows and absorbing gas filled windows, Energy and buildings, Vol.40, Issue 5, 2008, P710-719; Ismail KAR, Henriquez.JR, Thermally effective windows with moving phase change material curtains, Apply Thermal Engineering, 2001, 21P 1909-1923; Amir M, Lacroix M, Galanis N. Comportement thermique de dalles chauffantes electriques pour le stockage quotidien. Int J Therm Sci 1999; 38:121–31; Farid MM, Kong WJ. Underfloor heating with latent heat storage. Proc Instn Mech Engrs 2001; 215:601–9.

Qiao Song1, Yi Huang2, Hao Tang3 and Yan-Jun Chang4*

Damage Analysis of Cast Iron Specimen with Different Crack Forms Abstract: This paper researches the stiffness of the cast iron specimens with unilateral crack and bilateral crack on the basis of the uniaxial tensile simulation, and the main conclusions are as follows: the stiffness of the model shows nonlinear decline with the crack propagation; the stiffness decreases very slowly in initial stage and then gets fast with the crack propagation; the stiffness is more affected with the unilateral crack than the center crack when the length of crack is equal; the greater angle between the unilateral crack and the horizontal direction, the higher the stiffness; with the increase of the longitudinal spacing of bilateral crack, the model stiffness reduces and is greatly influenced. Keywords: damage; crack propagation; stiffness

1 Introduction The damage of the same crack is different under different load patterns; therefore the concept of isotropic damage cannot be used. Isotropic damage exists only in the case of small whole damage. The total area of the crack often exceeds the total bearing area of the object under multiple cracks, according to the original microscopic theory, the object has been completely damaged with no bearing capacity, but actually the object still has a certain bearing capacity as the cracks are not collinear. The damage is not completely proportional to the effective bearing area, and it’s related

|| 1 (College of Civil Engineering and Architecture, Guangxi University), (Guangxi Key Laboratory of Disaster Prevention and, Engineering Safety), (Guangxi, China), (Key Laboratory of Disaster Prevention and Structural, Safety of Ministry of Education), (Guangxi University), [email protected] 2 (College of Civil Engineering and Architecture, Guangxi University), (Guangxi Key Laboratory of Disaster Prevention and Engineering Safety), (Guangxi, China), (Key Laboratory of Disaster Prevention and Structural, Safety of Ministry of Education), (Guangxi University), [email protected] 3 (College of Civil Engineering and Architecture, Guangxi University), (Guangxi Key Laboratory of Disaster Prevention and Engineering Safety), (Guangxi, China), (Key Laboratory of Disaster Prevention and Structural, Safety of Ministry of Education), (Guangxi University), [email protected] 4 (College of Civil Engineering and Architecture, Guangxi University), (Guangxi Key Laboratory of Disaster Prevention and, Engineering Safety), (Guangxi, China), (Key Laboratory of Disaster Prevention and Structural, Safety of Ministry of Education), (Guangxi University), [email protected] 10.1515/9783110516623-057 DOI 10.1515/9783110303568-057

582 | Qiao Song, Yi Huang, Hao Tang and Yan-Jun Chang to the location and quantity of the damage. Classical damage theory is suitable to describe the object with fewer cracks. But comparing multiple small injuries with a large damage, which of them has a larger effect on the object, whether position has effect on the damage, whether simple superposition method is suitable, these problems should cause the attention of the mechanics workers and carry on the thorough study. The uniaxial tension simulation test was carried out to study the tensile damage properties of four kinds crack models in this paper. The crack lengths are 5mm and 10mm.The crack forms are: center horizontal crack; center oblique crack; horizontal offset crack and bilateral crack. The second part introduces the loading mode and the model size, and states the damage theory of the material with crack, and compares and analyzes the stiffness of different crack models. The last part presents the conclusions.

2 Model and Analysis 2.1 Damage Analysis of Cast Iron Specimens with Different Crack Forms(Fig1, Fig2) The material used in this paper is cast iron, Elastic modulus is 102GPa, and Poisson’s ratio is 0.3.

2.2 Damage Theory of Materials with Cracks Rabotnov [1] defined the damage variable on the basis of "continuity factor" as: D

( A0  A ) A 1 A0 A0

(1)

Dis the damage variable, A0is the initial crosssectional area of non-destructive material, A is the residual area after damage. A A0 , D 0 ; After the material is damWhen the material is non-destructive, A 0 , D 1 aged completely, . Lemaitre [2-5] defined the damage variable on the basis of the assumption of strain equivalence as: D

( E0  E ) E0

1

E E0

(2)

E0is the elastic modulus of non-destructive material, E is the residual stiffness of damaged material.

Da amage Analysis s of Cast Iron Specimen S with Different Crack k Forms | 583 5

The T damage eexpression ba ased on the asssumption of strain equiva alence is gene erally accepted a becaause of the sim mple formula and clear phyysical meanin ng. Eq. (2) illu ustrates the fo ormula of stre ess vs. strain ccurve; it is needed to derive the damage d expreession by thee force vs. dissplacement ccurve which reflects r the macro m performance p o of the structurre. D

C0  C C0

1-

C C0

(3)

C0 C is the stiffn ness of the ma aterial withou ut damage; C iis the residua al stiffness of damd aged a material.

Fig. F 1: (a) Sketch of center horizo ontal crack model; (b) Sketch off horizontal offse et crack model; (c)Sketch of centter oblique crack k model; (d)Skettch of bilateral ccrack model

584 | Qiao Song, Yi Huang, Hao H Tang and Y Yan-Jun Chang

 Fig. 2: Sketch of mode el size and loadin ng

2.3 Damage Analysis of Center C Horrizontal Cra ack Model Fig.3 shows the ten nsile damage curve of centeer horizontal crack model with w differentt crack lengths, the damage base ed on the tenssile stiffness of the model is calculatedd by thee Eq.(3). he stiffness o Th of the model with w initial shoort crack decrreases very sllowly and thee decrease gets fast with the cracck grows, thee increase of damage d rate based on thee tensille stiffness off modelis slow w at first and then gets fasst. It shows th hat the linearr increaase of damagee based on th he classical eqquivalent area a damage theoryis not rea-sonab ble.

Fig. 3: The crack length h vs. stiffness damagecurve of ccenter horizonta alcrack model with different crack lengths

Da amage Analysis s of Cast Iron Specimen S with Different Crack k Forms | 585 5

2.4 2 Stiffne ess Analysiis of Single e Crack witth Two Kind ds of Lengtths at Diffe erent Horizzontal Posiitions 2.4.1 2 Damage e Analysis of 5mm Long Cra ack Horizontaal Offset Model Fig.4 F represen nts the horizontal offset disstance vs. stifffness curve of o 5mm long crack, and a the centeer of the cracck offsets a ce ertain distancce to the left.. When the ce enter crack c is shiftin ng to the left, the stiffness of the model has a downw ward trend, bu ut the decrease d is no ot obvious; when w the cracck is shifted to12.5mm, th he crack offse ets to unilateral u cracck, stiffness will w dump. Itt shows that tthe stiffness of o the same crack c length is moree affected by the t unilaterall crack than th he center cracck. But in the view of o the changee ratio, even if i the embedd ded crack beccomes unilateeral crack, the decrease c of the sstiffness is less than 2% of the t total stiffn ness.

Fig. F 4: The horizo ontal offset dista ance vs. stiffnes ss curve of 5mm long horizontall offset crack mo odel

586 | Qiao Song, Yi Huang, Hao H Tang and Y Yan-Jun Chang 2.4.2 Damage ana alysis of 10mm m Long Crack Horizontal Offfset Model

Fig. 5: The horizontal offset o distance vs. v stiffness curvve of 10mm long g horizontal offse et crack model

Fig.5 represents th he curve of ho orizontal offseet distance vs.. stiffness with 10mm longg crack; the center of o the crack offsets a certaiin distance to o the left. When the centerr crack is shifting to the left, the stiffness s of th e model has a downward trend, t but thee decrease is not obv vious; when the crack is sh hifted to 10mm m, the crack offsets o to uni-lateraal crack, stiffn ness will dump p. It shows th hat the stiffnesss of the same e crack length h is morre affected by y the unilatera al crack than the center cra ack. This is co onsistent with h the co onclusion obtained when th he crack lengtth is 5mm. B But in the vieew of the cha ange ratio, th he embedded crack becom mes unilaterall crack, the decreasee of stiffness was w 11kN, excceeding 10% of o the total stiffness, which h has a great influen nce on the mo odel. The bearring ability off the structure e can producee large mutations at the time the crack c extendss to the bound dary. Comparing Fig g.4with Fig.5, it can be cconcluded tha at: the mutattion value off 10mm m long unilateeral crack and d embedded ccrack is more than 11kN, ex xceeding 10% % of thee total stiffnesss. The mutattion value of 5mm long cra ackis less tha an 2kN, lowerr than 22% of the tota al stiffness. Itt illustrates th hat the effect of unilateral crack on thee stiffneess is greater than that of embedded e craackwhen the in nitial crack is longer.

Da amage Analysis s of Cast Iron Specimen S with Different Crack k Forms | 587 5

2.5 2 Damag ge Analysiss of the Cen nter Obliqu ue Crack Model M The T stiffness ccurve of 5mm long center oblique o crack w with differentt angle of horizontal t direction iis showed in Fig.6, which indicates thee nonlinear growth g of the stiffness, n the largeer the angle, the t greater the e model stiffn ness. But when n the angle is 90o, the t stiffness of the horizonttal crack is on nly 3.0kN and the increase is less than 3% %. It is conclluded that the crack stiffness increasess with the increase of the angle a between b the ccrack and thee horizontal liine, but it haas less influen nce on the ov verall stiffness s of thee model.

Fig. F 6: The angle vs. stiffness curve of 5mm long g center oblique crack model

2.6 2 Damag ge Analysiss of Bilaterral Crack M Model with Different D Longitudinal Spa acing in Cra ack Propag gation 2.6.1 2 Stiffnesss Analysis off Edge 5mm Bilateral Crackk with Differen nt Longitudinal Spacing g Fig.7 F shows th he stiffness vss. crack length h curves of 5m mm long bilatteral crack mo odels of o which the lo ongitudinal spacing was 5m mm, 10mm, 115mm and 20m mm. It can be seen that t the stiffn ness shows no onlinear decre ease with thee crack propagation, the lo onger t crack prop the pagation, the lower the mo odel stiffness . When the crrack extends from ess exceeds 177kN, more tha 5mm 5 to 9mm, the decreasess of the stiffne an 15% of the total vely speaking model, m which has a great in nfluence on th he bearing cap pacity. Relativ g, the influence of lo ongitudinal sp pacing is small.

588 | Qiao Song, Yi Huang, Hao H Tang and Y Yan-Jun Chang

Fig. 7: The stiffness vs. crack length cu urves of edge 5m mm bilateral crack models with graded longitudinal spacing

2.6.2 Stiffness Analysis of Edge e 10mm Bilateeral Crack witth Different Lo ongitudinal Spacing

Fig. 8: The stiffness vss. crack length cu urves of edge 10 0mm bilateral crrack models with h graded longitudinal spacing

Fig.8sshows the stifffness vs. cracck length curvves of 10mm long bilateral crack modelss of wh hich the longittudinal spacin ng was 5mm, 10mm, 15mm m and 20mm. It I can be seen n that tthe stiffness shows s nonline ear decrease with the cracck propagation, the longerr the crrack propagattion, the lowe er the model stiffness. When the crack extends from m

Damage Analysis of Cast Iron Specimen with Different Crack Forms | 589

10mm to 14mm, the decreases of the stiffness exceeds 30kN, more than 25% of the total model, which has a great influence on the bearing capacity. Relatively speaking, the influence of longitudinal spacing is small.

3 Conclusions The uniaxial tension simulation test for the crack models with different types and locations was carried out to research the tensile damage properties of four kinds crack models. The crack lengths are 5mm and 10mm, the crack forms are: (1) center horizontal crack; (2) center oblique crack; (3) horizontal offset crack; (4) bilateral crack. The main conclusions are as follows: For the center horizontal crack model, the stiffness shows nonlinear decline with the crack propagation. The stiffness decreases very slowly in the initial stage and then gets fast with the crack propagation. It demonstrates that the linear decrease of stiffness based on the equivalent area damage theory is incorrect. For the horizontal offset crack model, the longer distance from the crack to the boundary, the lower stiffness, but the decrease is not obvious; the stiffness will dump when the single crack offsets to unilateral crack; the stiffness of the same crack length is more affected by the unilateral crack than the center crack; when the embedded crack offsets to unilateral crack, the longer crack length, the larger influence on stiffness. The crack stiffness increases with the increase of the angle between the crack and the horizontal line, but it has less influence on the overall stiffness. The stiffness shows nonlinear decrease with the increase of the longitudinal spacing, which has a great influence on the stiffness, as well as the variation of the bilateral crack length. Acknowledgement: This work was financially supported by the National Natural Science Fund (11262001 and 51465002), the Systematic Project of Guangxi Key Laboratory of Disaster Prevention and Structural Safety (2016ZDX07) and the Guangxi Natural Science Fund (2012GXNSFBAO53145)

References [1] [2] [3] [4] [5]

RabotnovYN.Creeprupture.Proc.12th.Inter, Cong.Appl.Mech.IUTAM, 1968. Lemaitre J. A course non damage mechanics. Berlin: Springs-Verlag, 1992 Lemaitre J. A continuous damage Mechanics model for ductile fracture. Engng. Mater. Tech., 1985, 107: 83-89 Lemaitre J, Dufailly J. Damage measurements. Engng. Fract. Mech., 1987, 28(5 /6): 643-661 Lemaitre J, Chaboche J L. Mechanics of solid materials. Cambridge: Cambridge University Press, 1990

Xin-Yu Xiong1, Zhong-Fei Ma2 and Hong-Ling Xie3

Study on the Performance of a High-Pressure Water Jet Dust Collector in a Powder Feeding Port of Explosive Sites Abstract: In order to meet the needs of explosion-proof suction dust collective system in explosive working places, performance of a high-pressure water jet dust collector was studied on the basis of high-pressure water jet dust collection technology. The orthogonal experiment range analysis method and the AHP model analysis method were used for the optimization of relevant experimental data. Through research and analysis, we found that the nozzle diameter, compressed air flow, diffusion angle had great influence in the amount of suction and the efficiency of the dust collector. The influential degrees for the three factors are ranking from high to low were: compressed air flow, nozzle diameter and diffusion angle. When the compressed air flow was 25 m3/h, the nozzle diameter was 12mm and the diffusion angle was 15°, which are the best matching parameters, the dust removal efficiency and air suction volume of high-pressure gas would reach the peak. The results can give statistical support for developing high pressure and water jet dust collector with high efficiency. What’s more, it is full of realistic meanings. Keywords: high-pressure water jet; dust collector; performance study At home and abroad, most of the existing ventilation and dust removal devices are composed of separate fan and dust collector. As for the ventilator, scholars at home and abroad mainly adopt mechanical impeller fan powered by electricity. In recent years, scholars have carried out related researches on other power-driven methods. As for the dust collector, main dust collectors used include mechanical filter, wet dust collector, filter separator, electrostatic precipitators, compound dust collector, etc[1,2]. Although the performance of dust removal equipment is being improved gradually, there are still some shortcomings in varying degrees. For example, dust removal equipment in dust removal process is easily to be in danger of fire due to friction of the impeller, making it not applicable to the explosive places. The need for taking electricityas power makes it not applicable to non-electricity places and complex structure leading to the higher cost. Nozzle is easy to be blocked and dust removal effect is poor. High-pressure gas and water jet suction dust collector com|| 1 School of environment and safety engineering, Jiangsu University, Zhen Jiang 212013,China,[email protected] 2 School of environment and safety engineering, Jiangsu University, Zhen Jiang 212013,China,[email protected] 3 School of environment and safety engineering, Jiangsu University, Zhen Jiang 212013, China 10.1515/9783110516623-058 DOI 10.1515/9783110303568-058

592 | Xin-Yu Xiong, Zhong-Fei Ma and Hong-Ling Xie bines air suction and dust removal. And it can effectively avoid the danger of fire due to friction of propeller compared to traditional impeller fan and dust collector system. It can be used safely in places where there is a hazard of dust explosion. However, the current pressure gas and water jet suction dust removal device usually exist the problems of low dust removal efficiency and low suction air volume. It is necessary to study the performance of the dust collector to develop high efficiency dust collector to meet the needs of places in dust explosion hazard.

1 Principle of High-Pressure Gas and Water Jet Suction Dust Removal Technology

Fig. 1: Structure diagram of pressure gas and water jet suction dust removal device

As shown in the Figure 1, the mechanism involving pressure gas and water jet suction dust removal device suction was proposed. The compressed air was from the air compressor travels through air supply pipeline. Pneumatic water was from compressed air pump travels through the compressed air and water pipeline. Before compressed air water and compressed air go out through the mouth of the nozzle jet, they will be combined and form a kind of mixed fluid in the pipeline. When the fluid mixture flows out from the nozzle, the speed of the discontinuity face between highspeed fluid and still air indoor is discontinuous, big speed difference of the discontinuity face will cause strong disturbance, and then it will lose its stability and generates vortex. Finally, the vortex would automatically roll around the air into the jet, which was called suction. Then moving vortex would gradually split and deform. At the nozzle outlet, due to the jet boundary layer turbulence diffusion and viscous effect, momentum exchange will occur between the air in the air water jet and the dust collector. Then the negative pressure generated will absorb air with dust through the dust suction hood to the bronchia, making the dust collector produce suction effect.When the dusty gas and water bubbles fully contacted with each other,

Study on the Performance Port of Explosive Sites | 593

the dust particles would be wetted due to the good wettability of the dust. Therefore, the coherency of dust would be improved, which result in gaining weight with dust agglomeration and separating afterwords. The whole dust removal process included gravity settlement, inertia impact, interception, diffusion and so on. The mechanism involving pressure gas and water jet suction dust removal device was proposed. Outside air with dust is inhaled through suction chamber to jet pipe due to the effect of entrainment of the dust collector. The vortex state of the jet tube let gas with dust mix with water. After the mixed fluid flows into the bronchia, gas with dust and water mix further due to the decrease of the flow area and the increase of the velocity. As energy and mass exchange, dust and water in the jet will collide and condense. Meanwhile, most of the dust will be captured due to collision with the water as the mixing phase continued to move forward into the diffusion section. The velocity of the mixed phase will gradually decrease. During this stage, water and dust will continue to appear inertial collision. Meanwhile, part of the condensed drops of water begins with sedimentation due to gravity, part of the water with dust changes into dust flow due to the change of viscosity effect of the pipe wall. During the mixing phase travels through the two swirl flow guiding device, the guide vanes in the flow guiding device are fixed. So the mixed phase will produce secondary rotation through the blade. At the same time, most of the water of the residue in the mixed phase (especially the dust laden water) was separated out, forming a continuous flow. And the aim of dust removal is achieved.

2 Pressure Gas and Water Jet Suction Dust Removal Device Performance Study 2.1 Construction of Experimental Device and Selection of Experimental Method To analyze high-pressure gas and water jet suction dust removal device of the nozzle diameter, compressed air flow, diffusion angle and other parameters connected to dust removal efficiency effect, we must get the best combination of three parameters to optimize dust removal efficiency and the suction air volume. We constructed a high-pressure gas and water jet suction dust removal experiment device. The main devices are shown in Figure2.

594 | Xin-Yu Xiong, Zhong-Fei Ma and Hong-Ling Xie

Fig. 2: Experiment device of pressure gas and water jet suction dust removal

1:high pressure water pump;2:pressure gauge;3,4: one-way check valve; 5:flowmeter;6:air compressor;7:water tank;8:dust generator 9:wind collector; 10:nozzle;11:reducer;12:thermometer;13:hygrometer;14:bronchia;15: diffusion tube;16:fixed swirl vane dehydrator;17:dust sampler; 18:fan; 19:compensated micromanometer. Short diffusion tube is conducive to spraying while long diffusion tube is conducive to suction. So the long diffusion tube was used in the experiment of dust suction and dust removal; Compressed air was provided with high pressure water pump water, rated pressure was 15 Mpa, the flow was40L/min, throat nozzle distance was 70 mm. The nozzle diameters were 10 mm, 12 mm, 14 mm respectively; Diffusion tube angle alpha took 10 o, 15 o and 20 o respectively; Compressed air flow were15 m3/h, 20 m3/h, 25 m3/h respectively. Orthogonal experimental method was adopted in the experiment. Test factors and levels were shown in Table 1. Table1: Factors and Levels level

A (nozzle diameter mm)

B (diffusion angle o)

C (compressed air flow m3/h)

1

10

10

15

2

12

15

20

3

14

20

25

As there was no interaction between three experimental factors adopted in the laboratory research and analysis, we used testing scheme with L9 (34) orthogonal table arrangement. The test results are shown in Table 2. The method of determining air absorption volume [3]: the air suction volume was measured by the conical suction hood method. The schematic diagram of the method was shown in Figure 3.Pipe inlet expanded into a conical pipe angled at

Study on the Performance Port of Explosive Sites | 595

45o,and then connected a static pressure tube on the pipe. The principle of this method was to convert the measured suction air volume Q into the static pressure measurement Pst. The step-down value was proportional to the flow so we can calculate the air suction volume. The static pressure Pst was measured by the compensation micro pressure meter. The formula for calculating the air suction volume was: Q

P

SD 2

19 .6 p st

4

U

Q: Air suction;μ: Set port flow coefficient; D:Diameter of the pressure measurement; Pst :Value of micro pressure meter; ρ: the density of the air.

Fig. 3: Schematic diagram of the measurement of air suction

The method of determining dust removal efficiency: We used atmospheric dust sampling instrument to measure concentration the dust, and then calculated the total efficiency of the pressure gas and water jet suction dust removal device. Calculation formulas of dust removal efficiency were as follows: C1

m1  m Qt

0

u 10

6

C

2

m

2

 m Qt

0

u 10

6

K

C

1

- C C1

2

u 100

%

m0:The initial mass of the filter membrane before sampling; m1:The initial mass of the filter membrane after sampling(Dust removal device is not activated); m2:The initial mass of the filter membrane after sampling(Dust removal device is activated); t:time; Q:Sample flow; C1:The initial concentration of dust; C2:Dust concentration after dust removal; η:Dust removal efficiency.

596 | Xin-Yu Xiong, Zhong-Fei Ma and Hong-Ling Xie

2.2 The Orthogonal Experiment Analysis We combined every experiment according to the regulations of the orthogonal experiment scheme in Table 2.After finishing the experiment; the dust removal efficiency and the suction air volume were obtained. As shown in Table2. Table 2: Experimental Plan Table and Results NO

A (nozzle diameter mm)

B (diffusion angle o)

C dust removal suction air (compressed efficienvolume air flow m3/h) cyη(%) Q(m3/s)

dust removal efficiency Ș ×suction air volume Q

L1

10

10

15

91.71

0.1732

15.8842

L2

10

15

20

93.72

0.3198

29.9717

L3

10

20

25

92.72

0.3904

36.1979

L4

12

10

20

91.21

0.3796

34.6233

L5

12

15

25

94.72

0.4077

38.6173

L6

12

20

15

87.79

0.1807

15.8637

L7

14

10

25

90.70

0.3550

32.1985

L8

14

15

15

88.94

0.1981

17.6190

L9

14

20

20

86.43

0.2443

21.1148

The experimental data in table 3 was analyzed by the range method. The sum and average of each factor indicator was calculated at the same level (Kij). I: the level of factors Affecting; j: the influence factor [4].Using the range calculation formula, we got the data for computing dust removal efficiency, which are shown in Table3.

Study on the Performance Port of Explosive Sites | 597 Table 3: Data Analysis Program dust removal efficiency η

suction air volume Q

dust removal efficiency Ș ×suction air volume Q

A

B

C

K1j

278.15

273.62

268.44

K2j

273.72

277.38

271.36

K3j

266.07

266.94

278.14

CK1j

92.72

91.21

89.48

CK2j

91.24

92.46

90.45

CK3j

88.69

88.98

92.71

Rj

4.03

3.48

3.23

K1j

0.8834

0.9078

0.5520

K2j

0.9680

0.9256

0.9437

K3j

0.7974

0.8154

1.1531

CK1j

0.2945

0.3026

0.1840

CK2j

0.3227

0.3085

0.3146

CK3j

0.2658

0.2718

0.3844

Rj

0.0569

0.0367

0.2004

K1j

82.0538

82.7060

49.3669

K2j

89.1043

86.2080

85.7098

K3j

70.9323

73.1764

107.0137

CK1j

27.3517

27.5687

16.4556

CK2j

29.7014

28.7360

28.5699

CK3j

23.6441

24.3921

35.6712

Rj

6.0573

4.3439

19.2156

Data analysis of dust removal efficiency using range method: from the data in Table 4 we got: RA>RB>RC. Influence of the three factors on the dust ranking from high to low is: removal efficiency of the order of nozzle diameter, diffusion angle and compressed air flow respectively. Data analysis of suction air volume using range method: through calculation we can get: RC>RA>RB. Influence of the three factors on the suction air volume ranking from high to low is: compressed air flow, nozzle diameter and diffusion angle respectively. Data analysis of comprehensive index using range method: during the suction dust removal operations, dust removal effect is better when the suction air volume is larger. So we choose the product of the dust removal efficiency and the suction air volume as a comprehensive index and further analyzed. From the data in Table 4 we can get: RC>RA>RB. Influence of the three factors on the suction air volume ranking

598 | Xin-Yu Xiong, Zhong-Fei Ma and Hong-Ling Xie from high to low is compressed air flow, nozzle diameter and diffusion angle respectively. The relationship between dust removal efficiency, air volume, comprehensive index and the influencing factors were shown in the Figure 4.

Fig. 4: Factors and index analysis from the diagram, we can see that:

Study on the Performance Port of Explosive Sites | 599

(1)CK1A>CK2A>CK3A,CK2B>CK1B>CK3B,CK3C>CK2C>CK1C.It can be concluded that the best parameter combination of improving dust removal efficiency was A1B2C3.Under the condition that, the nozzle diameter was 10 mm, diffusion angle was 15 o, compressed air flow was 25 m3/h, the dust removal efficiency was the best. (2)CK2A>CK1A>CK3A,CK2B>CK1B>CK3B,CK3C>CK2C>CK1C.It can be concluded that the best parameter combination of improving dust removal efficiency was A2B2C3.Under the condition that, the nozzle diameter was 12 mm, diffusion angle was 15 o, compressed air flow was 25 m3/h, and suction air volume was the highest. (3)CK2A>CK1A>CK3A,CK2B>CK1B>CK3B,CK3C>CK2C>CK1C.It can be concluded that the best parameter combination of improving dust removal efficiency was A2B2C3.Under the condition that, the nozzle diameter was 12 mm, diffusion angle was 15 o, compressed air flow was 25 m3/h, and comprehensive index was the best. In conclusion, in order to make the suction air volume, dust removal efficiency of pressure gas and water jet suction dust removal device achieves the optimal quantity, we must choose A2B2C3from the experimental results.The key parameters of pressure gas and water jet suction dust removal device were: nozzle diameter was 12 mm, diffusion angle was 15 o, and compressed air flow was 25 m3/h.

2.3 The AHP Analysis Model The experimental data were analyzed by orthogonal test AHP model without considering interaction [5, 6].The analysis of the composite indicator were as follows:

Z

ASC

T

ª 0 . 3389 « 0 . 3681 « « 0 . 2930 « 0 « « 0 « 0 « « 0 « 0 « « 0 ¬

0 0

0 0

0

0

0 . 3416

0

0 . 3561

0

0 . 3023 0

0 0 . 2039

0

0 . 3541

0

0 . 4420

º » » » » » » » » » » » » ¼

ª 0 . 2045 « 0 . 1467 « ¬« 0 . 6488

º » » ¼»

ª 0 . 0693 « 0 . 0753 « « 0 . 0599 « « 0 . 0501 « 0 . 0522 « « 0 . 0444 « 0 . 1323 « « 0 . 2297 « 0 . 2868 ¬

º » » » » » » » » » » » » ¼

From the above factors on the level of the impact of composite indicators on the value of weight ω, we can see that the best combination to improve the comprehensive index of the optimal parameter was A2B2C3.In order to make the suction air volume, dust removal efficiency of pressure gas and water jet suction dust removal device achieve the optimal quantity, we choose A2B2C3 through AHP method. That the key parameters of pressure gas and water jet suction dust removal device were:

600 | Xin-Yu Xiong, Zhong-Fei Ma and Hong-Ling Xie nozzle diameter was 12 mm, diffusion angle was 15 o, and compressed air flow was 25 m3/h. Based on the above two experimental results, the parameters such as the nozzle diameter, diffusion angle and compressed air flow have a significant influence on dust removal efficiency and suction air volume of the pressure gas and water jet suction dust removal device. The influence degree ranking from high to low is: compressed air flow, nozzle diameter and diffusion angle.

3 Conclusion (1)The parameters such as the nozzle diameter, diffusion angle and compressed air flow have a significant influence on dust removal efficiency and suction air volume of the pressure gas and water jet suction dust removal device. The influence degree ranking from high to low is: compressed air flow, nozzle diameter and diffusion angle. (2)Nozzle diameter: as found from the factor index analysis diagram, when changing from 10 mm to 12 mm, the dust removal efficiency decreases while the suction volume and the comprehensive index increased; When it changes from 12 mm to 14 mm, the three indicators decreases. It shows that when Factor A was less than 10 mm, it can improve the dust removal efficiency. When the factor A was equal to 12mm, the suction air volume and comprehensive index will be the largest. (3)Diffusion angle: when it changes from 10 o to 15 o, the three indicators increases. When it changes from 15 o to 20 o, the three indicators decrease. This showed that when the diffusion angle was around 15 o, the quality was better. (4)Compressed air flow: the compressed air flow rate showed upgrade gradually. So we’ll achieve results when compressed air flow is higher. But due to the limitations of operation environment, also considering low carbon environmental protection. We take compressed air flow was 25 m3/h and it will completely meet the requirements of dust removal. (5)In order to obtain the optimal efficiency of the suction air volume and dust removal, and the device could be reasonably applied to the workplace dust removal. The key parameters for pressure gas and water jet suction dust removal device were: nozzle diameter was 12 mm, diffusion angle was 15 o, and compressed air flow was 25 m3/h. Acknowledgement: The thesis was subsidized by the Open Research Fund (SJZZ16_0191) of Jiangsu province ordinary university graduate student scientific research innovation projects. Diameter and diffusion angle.

Study on the Performance Port of Explosive Sites | 601

References [1] [2] [3] [4] [5] [6]

Zhongfei Ma. Industrial ventilation and dust control [M]. Beijing: China's labor and social security press, 2009. Hu Zhiguang, Jia Bojiang. Comparison and analysis of current situation of China electric dust collector and bag filter [J].Environmental Science and management, 2012, 12:93-97. Xie Hongling. Comprehensive tunneling working face air water jet suction dust removal technology research [D]. Zhenjiang: Jiangsu University, 2014 Shen Fangfang, Tao Huichun, full jade spring. Poor Method Application in the Physics Experiment [J]. Journal of Jilin construction engineering college, 2013, 12:63-66. Guo Jinyu, Zhang Zhongbin, Sun Qingyun. Application of Analytic Hierarchy Process in Safety Science Research [J] .China Safety Science and Technology, 2008,02: 69-73. Liu June, Fu Hao, Zhang-lin Guo. Comprehensive frequency analysis method in the application of the multi-target orthogonal test design [J]. Value engineering, 2016, 24:124-126.

Yun-Ming Jia1, Mei Zhang2*, Hong-Wei Li3* and Jian-Ming Wang4

Self-Assembled Grapheme / Carbon Nanotube Fibers as Electrodes for Super Capacitors Abstract: Functional fiber materials play a critical role in today's society. Especially, unique one-dimensional carbon nanotubes and two-dimensional grapheme fibers with high electrical conductivity have attracted the attention of numerous researchers. We develop a simple method of chemical reduction at low temperature and induced self-assembly to prepare the ordered grapheme / carbon nanotube composite fibers (G/CNTs), which have good flexibility and excellent specific capacitance. Furthermore, the G/CNTs can be flexible electrode materials for super capacitors. Keywords: grapheme; carbon nanotubes; self-assembly; flexibility; conductivity; super capacitors

1 Introduction High flexibility, strength, conductivity, and light weight are simultaneously required as electrode materials in energy storage areas [1-2]. To achieve the goals. One-dimensional (1D) carbon nanotubes and two-dimensional (2D) grapheme fibers are prepared and show high electrical conductivity. Super capacitors have attracted much attention because of their high power density, long cycle life. Compared with other fibers, the composite fibers as electrodes for super capacitors show many advantages, including excellent electronic migration rate, large specific surface area and high tensile strength et al [3-6]. These performances provide guarantee for flexible super capacitors. We propose the strategy of chemical reduction and induced self-assemble to synthesize the grapheme/carbon nanotubes fibers at low temperature, which reduce the impact of the strong π-π interactions [3, 6]. The as-prepared G/CNTs not only have good flexibility and strength, but also have good electrochemical performance. They deliver high specific capacitance of

|| 1 College of Materials Science and Engineering, Beijing Institute of Fashion Technology, Beijing, China. [email protected] 2 College of Materials Science and Engineering, Beijing Institute of Fashion Technology, Beijing, China. [email protected] 3 College of Materials Science and Engineering, Beijing Institute of Fashion Technology, Beijing, China. [email protected] 4 College of Materials Science and Engineering, Beijing Institute of Fashion Technology. Beijing, China. [email protected] 10.1515/9783110516623-059 DOI 10.1515/9783110303568-059

604 | Yun-Ming Jia, Mei Zhang, Hong-Wei Li and Jian-Ming Wang 148 F g-1 after 500 cycles when the current density is 200 mA g-1. Grapheme and carbon nanotubes composite fibers as a new member of the carbon-based fibers will become the potential binder-free electrodes for flexible super capacitors.

2 Experimental 2.1 Synthesis of Materials Grapheme oxides (GO) solution with high concentration was prepared by modified Hummers method. At the same time, the carboxylic carbon nanotubes (CO-CNTs) were obtained from the carbon nanotubes (CNTs) by using oxidizing agent of H2SO4 and HNO3. Grapheme oxides and carboxylic carbon nanotubes were combined by chemical reduction induced self-assembly method during the low-temperature processes, and the synthesis procedures was shown in Fig.1. The preparation of G/CNTs could be divided into three steps: first, the GO solution was diluted to 7mg ml-1, and the mixing of GO and CO-CNTs was put in an ultrasonic bath for 30 min, and then add a certain amount of the reducing agent (ascorbic acid) into the solution. Second, the obtained mixtures were sealed into the specified diameter glass tube and put it in the oven at 90 °C for 2h, and then the temperature increased to 120 °C until the fibers fully formed. The G/CNTs with mass ratio values of 6:1 could be named as G6/CNTs.

Fig. 1: Scheme of the G6/CNTs synthesis procedures.

2.2 Characterization and Electrochemical Testing The structures and morphologies of G6/CNTs were tested by Infrared spectrum (FTIR), X-ray diffraction (XRD), Field emission scanning electron microscopy (FESEM), Tensile strength (DMA). The electrical conductivity of the G6/CNTs was

Self-Assembled Electrodes for Super Capacitors | 605

obtained by four-point probe measurement and the electrochemical performance of the as-synthesized G6/CNTs was performed in a three-electrode system.

3 Results and Discussion Figure 2a represents the XRD patterns of Graphite, GO, G6/CNTs. As can be seen, the representative peak of GO centered at 11.7° and the G6/CNTs display a broad peak at about 2θ = 25.9° assigned to the plane of the stacked grapheme sheets after the reduction process [7-8]. As shown in Figure. 2b, the FTIR spectra display several typical peaks corresponding to the oxygen function groups of the G6/CNTs, such as C-O epoxy groups (1072 cm-1 and 1328 cm-1) and C=O stretching of carbonyl and carboxyl groups (1766 cm-1) decreased dramatically and some of them disappeared entirely after the reduction of the GO and CO-CNT with ascorbic acid, which agrees with the XRD results [9-10].

Fig. 2: (a) XRD patterns of a Graphite, GO, G6CNTs and (b) FT-IR spectra of Graphite, GO, CNTs, COCNTs, G6CNTs

606 | Yun-Ming Jia, Mei Zhang, Hong-Wei Li and Jian-Ming Wang

Fig. 3: Scanning electron microscopes of CNTs (a), CO-CNTs (b) and G6/CNTs (c-d)

The morphologies and structures of CNTs, CO-CNTs, G6/CNTs are shown in Figure.3. The CNTs (Figure.3a) and CO-CNTs (Figure.3b) display similar morphologies, indicating the structures of carboxylic carbon nanotubes are not destroyed by the oxidizing agent. The as-prepared G6/CNTs are composed of densely packed graphene sheets and carbon nanotubes (Fig.3c-d). High-magnification cross-sectional SEM images of the G6/CNTs reveal ordered microstructures. The G6/CNTs were prepared by chemical reduction induced self-assembly method during the lowtemperature process, which could provide guarantee for flexibility and porous structure. The flexibility of the G6/CNTs was evaluated, as shown in Fig 4. The tensile strength of G6/CNTs was up to about 111 MPa, which implies high flexibility.

Self-Assembled Electrodes for Super Capacitors | 607

Fig. 4: Tensile strength of the G6/CNTs

Fig. 5: Electrochemical performance of G6/CNTs (a-b) and CV curves of G6/CNTs (c)

608 | Yun-Ming Jia, Mei Zhang, Hong-Wei Li and Jian-Ming Wang The electrical conductivities of the G6/CNTs at room temperature showed high conductivity of about 2.36×104 S/m after the test over and over again. In order to investigate the electrochemical performance, we measured cyclic voltammogram (CV) and the charge/ discharge processes. It can be seen that the charge/discharge curve show triangle shape, indicating a capacitive behavior (Figure 5a). A high specific capacitance of 199 F g -1 is obtained at a current density of 200 mA g-1, and it retains 148 F g-1 after 500 charge/ discharge cycles (Figure 5b). This confirms that the G6/CNTs electrodes show a very good electrochemical stability. As shown in Figure 5c, the CV curves of the G6/CNTs electrodes exhibit nearly rectangular shape, showing a relatively good capacitive behavior under the measured scan rates from 20 mV s-1 to 100 mV s-1 [10]. Therefore, the G/CNTs can be utilized as flexible electrode materials for energy storage.

4 Conclusions In summary, the G/CNTs have been developed with high tensile strength, porous, electrical conductivity and electrochemical activity, which was prepared by a facile low temperature, induced self-assembly strategy. The as-synthesized G6/CNTs not only have excellent flexibility, but also have a high specific capacitance and good cycle stability which reach 199 F g-1 at a current density of 200 mA g-1 and good stability. These good performances confirm the fibers can be promising materials for flexible and portable electronic device. Acknowledgement: We acknowledge financial support from the General Program of Science and Technology Development Project of Beijing Municipal Education Commission of China (SQKM201610012002), the Beijing Municipal Key Laboratory Program (2015ZK-4).

References [1] [2] [3] [4] [5] [6] [7] [8] [9] [10]

M F El-Kady, R B Kaner, Nature Commun.4 (2013) 1475-1484. Y Gogotsi, Nature, 509 (2014) 568–570. H Cheng, Z Dong, C Hu, Y Zhao, Y Hu, L Qu, N Chena and L Dai, Nanoscale, 5 (2013) 3428-3434. M F El-Kady, V Strong, S Dubin and R B Kaner, Science, 335 (2012) 1326-1330 Y Meng, Y Zhao, C Hu, H Cheng, Y Hu, Z Zhang, G Shi, L Qu, Adv. Mater., 25 (2013) 2326-2331. W Ma, S Chen, S Yang, W Chen, Y Cheng, Y Guo, S Peng, S Ramakrishna and M Zhu, J. Power Sources, 306 (2016) 481-488. Z Tian, C Xu, J Li, G Zhu, Z Shi and Y Lin, ACS Appl. Mat. Interfaces, 5 (2013) 1489-1493. S Park, J An, I Jung, R D Piner, S J an, X Li, A Velamakanni, R S Ruoff, Nano Lett., 9 (2009) 1593-1597. J Su, M H Cao, L Ren, C W Hu, J. Phys. Chem. C 115 (2011) 14469-14477. M Zhang, Y Wang and M Jia, Electrochim. Acta, 129 (2014) 425–43

Tai-Hua Zhang1, Zi-Hao Wang2 and Xian-Hong Meng3

Fatigue Life Prediction of a Kind of Frequentlyused Bolt under Random Excitations Abstract: The fatigue life of connecting bolts has significant influence in mechanical structure. In this paper, the fatigue tests of a kind of bolt are carried out. According to the results, the median fatigue life curve (S-N curve) is obtained, and fatigue life curves under different survival probability (p-S-N curve) are obtained based on the median fatigue life curve and theory of damage mechanics. In addition to the fatigue life curves, the stress response of bolts under random excitations is obtained by finite element method (FEM) and frequency domain method. With the stress response of bolts and the fatigue life curves under different survival rates, the fatigue life of connecting bolts under different survival probability are estimated by using linear fatigue damage cumulative rule. Keywords: Fatigue life; Damage Mechanics; Finite Element Metho; Linear Fatigue Damage Cumulative Rule

1 Introduction The fatigue performance of connecting bolts has significant influence in mechanical structures. The damage accumulation of metal materials is difficult to observe and the fatigue failure of metal components can be sudden [1]. So it is important to estimate the fatigue life of important parts in mechanism. Connecting bolts are vital parts in mechanism, because the failure of bolts could cause the failure of the mechanism. And the fatigue failure of bolts can be sudden and unexpected. In this paper, the connecting bolts studied are used in the aero-engine of an airship. The consequence of their failure can be more severe than those in terrain machines. Exact estimation of fatigue life of bolts can reduce the rate of accident of the airship. Frequency domain method is used to estimate the load of bolts. Fatigue curve is the basis for the prediction of the fatigue life of members. Due to the dispersion of the data obtained from fatigue tests, the estimation of fatigue life might not be extremely accurate. Therefore, p-S-N curve (i.e. the probabilistic

|| 1 Academy of Opto-Electronics, Chinese academy of sciences. Beijing, 100094, China University of Chinese Academy of Science, Beijing, 100049, China 2 School of Aeronautic Science and Engineering, Beihang University, Beijing, 100191, China. E-mail: [email protected] 3 School of Aeronautic Science and Engineering, Beihang University, Beijing, 100191, China 10.1515/9783110516623-060 DOI 10.1515/9783110303568-060

610 | Tai-Hua Zhang, Zi-Hao Wang and Xian-Hong Meng fatigue curves) can be obtained to solve this problem. According to aviation standards issued in 1986 and the experience of experiments, to obtain the p-S-N curves whose survival rate is 99.9% (the curve mentioned in the following is p-SN with survival probability equal to 99.9%), the number of samples and tests cycles required are 1.5 to 3 times more than the S-N curve. With the improvement of the reliability requirements, the number of samples, the test period, and the cost of experiments will increase greatly. In order to reduce the cost, the method of damage mechanics is used to obtain the p-S-N curve based on the median S-N curve and the correspondent experimental data [2]. In the following, vibration loads are applied on bolts. Vibration loads are random, and the response of loads is random. So one statistical method is used to determine the loads applied on bolts [3]. Finite element method is also used to analyze the response of bolts. Commercial fem software ANSYS is used to carry out the computational process.

2 P-S-N Curves 2.1 S-N Curve Two methods, including up and down method and group method are used to obtain the S-N curve of bolts. For up and down tests, the number of fatigue test specimens should not be less than 14 and not less than 5 for each group when group method was used to get fatigue life. The fatigue test specimens are shown in Fig. 1.

Fig. 1: fatigue test specimen

Fatigue experiments of bolts are conducted according to standard issued by Chinese national standards (GB/T 3075-2008). In this series of experiments, alternating load is imposed on bolts, the stress ratio of the load (R) is 0.1, and the frequency is 15Hz. The parameters of fatigue experiments are shown in Table 1. In up and down tests, the load differential is 0.3kN, and the number of fatigue test specimens is 14. Four load levels are used in grouping tests. Test points are shown in Fig. 2.

Fatigue Life Prediction Bolt under Random Excitations | 611 Table1: The parameters of fatigue experiments name of specimen

up and down method

group method

target of cycle times/cycles

stress ratio

load/kN

stress ratio

/Hz

bolts

1×106

0.1

7.1, 8.5, 10, 11.5

0.1

15

600

frequency

ımax/MPa

test data S-N curve

500

400

300

104

105

N/cycles

106

Fig. 2: S-N curve

S-N curve is calculated using a three-parameter model:

lg N 7.075  1.093lg(V max  317.9)

V

(1)

V

Where N is the fatigue life (cycles), max is the peak stress of cyclic loading. max is calculated by load in experiments and the effective sectional area of bolts. The relaV tionship between N and S ( max ) is shown in Fig. 2.

2.2 P-S-N Curve The p-S-N curve can be obtained with the median S-N curve and the experimental data by using damage mechanics method The concept of the initial damage degree D0 (between 0 and 1) is introduced to express the initial damage degree of test specimens. The p-S-N curves are the S-N curves with arbitrary value of D0 (see (5)). When D0 =0 , the S-N curve should pass through the outermost point, and there is no test point above this curve. This S-N curve can be expressed as:

612 | Tai-Hua Zhang, Zi-Hao Wang and Xian-Hong Meng 1

V

§ 10 A0 · B V th 0  ¨ ¸ © N ¹

(2)

In this formula:

V th 0 V thm / (1  D0m )1/2 A0

Am  (

m  1) lg(1  D 0 m ) 2

(3) (4)

Am , V thm , and m B

can be obtained from (1). Change the value of D0m , the S-N curve (2) can be calculated, when this curve pass the outermost point of tests data, A the value of D 0 m is true. And 2 important parameters: V th 0 and 0 can be calculated. The expression of p-S-N curve is: A0 m /2 1 1 V (D0 ) V th0 (1  D0 )1/2  (10 (1  D0 ) )B

N

(5)

With the value calculated from tests data, the p-S-N curve can be expressed as:

V (D0 )

362.3(1  D0 )1/2

(

1 107.251 (1  D0 )1.547 1.093 ) N

(6)

Change the value of D0, count the test points above the curve, the corresponding probability of failure is calculated.

F (D 0 )

n N

(7)

Where N is the sum of test points, n is the test points above the curve. The relationship between D0 and

F (D0 ) is fitted by a sine-like function (8). The

curve is shown in Fig. 3.

F (D 0 )

S

sin14.93 ( (1  D 0 )) 2

(8)

For a given survival probability p, the corresponding failure probability is, and the p-S-N curve will be obtained by (6) and (8). P-S-N curves are shown in Table 2 and Fig. 4.

Fatigue Life Prediction Bolt under Random Excitations | 613

3 Probability Density Functions of Stress Amplitude The bolts are used in an aero-engine, and the engine is working under random vibration load. The probability density functions of stress amplitude (p(S)) are used to express the stress response of bolts under random vibration. P(S) is calculated by finite element method [4]; the load of finite element model is applied by power spectral density (PSD). And PSD is obtained with the data of vibration tests using Matlab [5-6].

3.1 PSD Curve The rotation frequency of the aero-engine is between 15 and 142 Hz. According to the working condition of the engine, the rotation frequency of the engine can be assumed to be a function of time [7]. In this study, the rotation frequency is assumed to be random. The PSD of the acceleration applied on the engine is calculated by periodogram method of Matlab, as shown in Fig. 5, in which the “Frequency” is the rotation frequency of the aero-engine, the “PSD” is the power spectral density of the aero-engine under different frequency.

3.2 Probability Density Functions of Stress Amplitude The finite element model is established using ANSYS workbench as shown in Fig. 6. The connecting bolts in this model is simplified, the screw thread is ignored to simplify the procedure of establishment of the model. The simplified model of the aero-engine is built by ANSYS workbench as shown in Fig.6. The detailed bolts model is established individually to calculate the fatigue notch factor of the bolts (Fig. 7) [8]. Table 2: P-S-N CURVES Survival rate p/%

Expectation of S-N curves

50

V

325.6  (1.281 u 107 / N)0.9174

90

V

293.3  (1.281 u 107 / N)0.9174

99

V

262.6  (1.281 u 107 / N)0.9174

99.9

V

238.6  (1.281 u 107 / N)0.9174

99.99

V

215.4  (1.281 u 107 / N)0.9174

614 | Tai-Hua Zhang, Zi-Hao Wang and Xian-Hong Meng

F(D0)

1.0 0.8 0.6 0.4 0.2 0.0 0.0

0.5

1.0

sin((1-D0)S/2) Fig. 3: The relation between D0 and F ( D0 )

600

load/MPa

test points p=50% p=90% p=99% p=99.9% p=99.99%

500

400

300

104

Fig. 4: P-S-N curves

105

N/cycles

106

Fatigue Life Prediction Bolt under Random Excitations | 615

Frequency/Hz Fig. 5: PSD on the engine

Fig. 6: Finite element model of engine

616 | Tai-Hua Zhang, Zi-Hao Wang and Xian-Hong Meng

Fig. 7: Finite element model of the bolt

p(S)

0.012 0.010 0.008

Equation

y = Intercept + B1*x^1 + B2*x^2 0.9869

R

Intercept B1 B2

B

0.006

Value

0.01153 -9.92457E-5 2.12009E-7

calculating points fitted curve

0.004 0.002 0.000 0

50

100

150

200

250

ı/MPa

300

Fig. 8: P(S) curve

The engine used in this study is a two-cycle engine, the main kind of loads are coming from 2 aspects: the rotation of the aero-engine rotor, and the burning gas pressure. In this analysis, the engine is made by high machining precision, and the working condition and the engine is assembled in the aircraft by high accuracy. Therefore, the load caused by the external environment is ignored. The PSD load is applied on the model, and the stress response is obtained accordingly. As shown in Table 2, the fatigue limit of bolts is 215.4MPa when the survival probability is 99.99%. The lower limit of integration in (10) is 108.8MPa, so the stress response less than 108.8MPa of the finite element model is ignored. With the different possibility of the maximum stress in this model, the maximum stress is obtained by ANSYS, and the stress response correspondent to different probability of stress amplitude are shown in Fig. 8.

Fatigue Life Prediction Bolt under Random Excitations | 617

The expression of p(S) is fitted by the numerical points obtained from finite method using quadratic curve:

p(s) as2  bs  c

(9)

As shown in Fig. 8, the correlation coefficient (R) between the curve and points is 0.9869; the expression of p(S) can satisfy the demands of engineering.

4 Results and Discussion Linear fatigue damage cumulative rule is used to calculate fatigue life of connecting bolts:

T=



Sb / k f

Se / k f

1 p S

N Sk f



(10)

dS

Where Q is the average rotational velocity k f is the fatigue notch factor of the bolts (1.98 in this study), N ( Sk f ) is p-S-N curves obtained from Table 2. S e is the fatigue limit of bolts, and Sb is strength limit of bolts. Fatigue life of different survival probability is obtained from (10), as shown in Table 3. Table3: Fatigue life of different survival rate Survival rate p/%

Fatigue life (cycles)

Fatigue life (hours)

50

3.920×107

136

90

6.035×106

21.0

99

1.737×10

6

6.03

99.9

7.405×105

2.57

99.99

3.404×105

1.18

With damage mechanics method and finite element method, the fatigue life under different survival probability is obtained by the method of damage mechanics. By making full use of the experimental data, the p-S-N curve is obtained with comparatively fewer test specimens in contrast with the traditional method. The p-S-N curve is under different survival probability and then this method can meet different demand in engineering. By using finite element method, the stress response of finite element model corresponds well with the actual situation.

618 | Tai-Hua Zhang, Zi-Hao Wang and Xian-Hong Meng From the results of fatigue life in Table 3, for different survival probability, the prediction of fatigue life of bolts varies tremendously. It is caused by the dispersion of initial damage of test specimens. The difference of the fatigue life between different specimens under the same load is significant (see test points in Fig. 2). In order to satisfy different demands, the fatigue life under different survival probability is estimated. The higher survival probability is taken, the shorter fatigue life will be obtained, and the safer it is for the correspondent fatigue life used in engineering. Compared with other researches about fatigue life of components [9], the method in this paper includes the scatter of components and obtains more information from the tests. Acknowledgement: This research was financially supported by the National Natural Science Foundation of China (No.11172022).

References [1] [2] [3] [4] [5] [6] [7] [8] [9]

Tan Zhen, Liu Daoxin, Zhang Guanglai, Fatigue Behavior of TC16 Titanium Alloy Bolts and 30CrMnSiA Steel Joint Holes [J]. Mechanical Science and Engineering, 2006, 25(7):767-770. Yuan Xi, Li Shunming. Research Status and Development of Forecast Method of Fatigue Life [J]. Aeronautical Manufacturing Technology, 2005(12):80-84. Wang Mingzhu. Research on Life Analysis Method for Structure Vibration Fatigue [D]. Nanjing University of Aeronautics and Astronautics, 2009. Xing Zhiwei. Vehicle Body Fatigue Analysis Method Study Base on Vibration Fatigue [D]. Henan University of Technology, 2014 Website for MATLAB http://www.mathworks.com/products/matlab/. Zhang Chenbin, Xue Chengqi. Anslysis of Engine Vibration and its Measurement Method [J]. Electro-Mechanical Engineering, 2005(6):1-3. Yang Wanjun, Shi Rongming, Research on Stress Amplitude Distribution of Random Vibration [J]. Machine Design and Research, 2011, 27(6):16-20. Li Deyong. Nominal Stress Approach for Life Prediction of Notched Members under Vibration Loading [D]. Nanjing University of Aeronautics and Astronautics, 2011. Zhang Chengcheng, Yao Weixing. Typical fatigue life analysis approaches for notched components [J]. Journal of aerospace power, 2013, 28(6):1223-1230.

Xu-Dong Zhao1, Xing-Yong Gao2, Guo-Qing Liu3, Yu-Ling Zhang4

Research on Development of Armor Protection Materials and Technology Abstract: In order to improve the survival ability of armored vehicles and reduce casualties in modern warfare, the protection technology has been paid great attention by all the military powers in the world. The current research situation and application of armor protection materials are described, including armour steel, aluminum alloy, and titanium alloy, ceramic and composite materials. The research status of several typical armor protection techniques such as electromagnetic armor, explosive reaction armor and grille armor are introduced. And on this basis, the development direction of armor protection technology is also discussed, which is of great significance to improve the protection capability and battlefield survivability of armored vehicles. Keywords: armored protection; armored material; protection technology; development trend

1 Introduction With the development of anti-armor weapon technology, the battlefield survivability of weapons and equipment poses a higher requirement for the performance of armor protection materials, which also promotes the development of armor protection materials [1]. In addition to the requirements of high impact resistance, antipenetration and anti-caving capacity, modern armor materials should also be fully considered the quality and cost of materials and other factors in the design process, so armor protection materials should be as high as possible to meet the requirements of high strength, high hardness, high toughness and low cost. In order to improve the protective effect of armored vehicles, while minimizing the weight of the vehicle, countries around the world has invested a lot of manpower and resources in the armor protection materials. At present, the armor protection materials used in various countries mainly consist of steel armor, aluminum alloy, titanium alloy, and ceramic and fiber composite material. The typical armor protection technologies include electromagnetic armor, explosive reaction armor and

|| 1 Ordnance Engineering College, Shijiazhuang, China. [email protected] 2 Ordnance Engineering College, Shijiazhuang, China 3 Ordnance Engineering College, Shijiazhuang, China 4 Ordnance Engineering College, Shijiazhuang, China 10.1515/9783110516623-061 DOI 10.1515/9783110303568-061

620 |Xu-Dong Zhao, Xing-Yong Gao, Guo-Qing Liu, Yu-Ling Zhang grille armor.

2 Development of Armored Protective Materials 2.1 Armor Steel At present, despite the development of armor protection technology, there have been many new armor materials, but the armor steel still have a strong advantage in the ballistic performance and structural applications. The research on the armor steel with advanced performance has been carried out in the United States, Germany, Sweden and other Western countries. The ultra-high hard armor steel standard divide into MIL-A-12560H, MIL-A-46100D, MIL-DTL-46177, MRMIL-A-46186 and MIL46193A in US military. The Brinell hardness of ARMOX 600T producted in Swedish is 600, Brinell hardness of ARMOX ADVANCE is more than 650[2-3].

2.2 Aluminum Alloy The template is used to format your paper and style the text. All margins, column widths, line spaces, and text fonts are prescribed; please do not alter them. You may note peculiarities. For example, the head margin in this template measures proportionately more than is customary. This measurement and others are deliberate, using specifications that anticipate your paper as one part of the entire proceedings, and not as an independent document. Please do not revise any of the current designations.

2.3 Titanium Alloy Titanium alloy which has high strength, low density, impact resistance and good plastic toughness, is the excellent armor protection materials. Compared with the traditional armor steel, the density of titanium armor is 60% of armor steel, and titanium armor can increase the protection performance of 30%-40% under the condition of equal weight. Compared with aluminum alloy armor, toughness of titanium armor is better than that of aluminum armor, and its protective properties is superior 30% or more to aluminum alloy armor under the condition of equal weight. Thus titanium alloy is used to improve the protection performance and reduce the weight of armor by the world military powers. M1 Abrams reduce weight by 4t only the use of cast titanium turret instead of rolling armored steel turret. M2 Bradley infantry reduce the weight of 35% using titanium alloy replace aluminum alloy, and the bullet-proof capability of it in-

Research on Development of Armor Protection Materials and Technology | 621

creased greatly. Russia T-80 main battle tank, with BT6 and BT1-0 titanium material manufacturing engine shell doors and turret, reduce weight of more than 40% replacing steel with titanium alloy[6]. However, the cost of titanium alloy is higher than the same protective performance of steel armor about 10 to 20 times, so its application is basically limited to the typical protection unit, mainly for the car hatch, additional top armor, engine cover, turret seat wait. The M1A2 tank is shown in Figure 1.

Fig. 1: M1A2 tank of the United States.

2.4 Ceramic Armor Material Ceramic material with high hardness and compression strength can defend the high-speed armor-piercing projectile erosion. Its density is about 25% to 50% of homogeneous armor steel, in favor of reducing the weight of armor. Ceramic material, which has heat resistance, is conducive to resist the erosion of high-temperature jet. Ceramic material has poor plasticity, low fracture strength, forming small size and other shortcomings, so it cannot be used as homogeneous armor alone. It is usually used as composite armor with metal materials, fiber composite materials. At present, at home and abroad the ceramic materials used on the armor are mainly alumina, silicon carbide, boron carbide, titanium boride, silicon nitride and so on[7]. The density of boron carbide (B4C) is the lowest, and the hardness of it is the highest. So it is an ideal lightweight armor ceramic material, mainly for the very strict quality requirements of aircraft, vehicles, and ships and so on. Although the B4C armor is expensive, but in the weight loss as the primary premise of the protection system, B4C is still the preferred material. Such as the United States Black Hawk helicopter passenger seat using the B4C and Kevlar composite armor. The United States and Israel produced body armor embedded B4C ceramic chip in the Kevlar fabric.

622 |Xu-Dong Zhao, Xing-Yong Gao, Guo-Qing Liu, Yu-Ling Zhang At present, the research focus of ceramic armor material is to improve its toughness and reduce production costs. The United States used microwave sintering technology to improve production efficiency, significantly reduce production costs, and achieve the large-scale production of silicon carbide and titanium boride. In order to improve the ballistic resistance, the United States plans to develop fully dense silicon carbide, alumina, titanium boride and boron carbide and other elemental ceramic materials, ceramic matrix composites and transparent ceramic materials [8].

2.5 Fiber Composites Fiber composites consist of laminated matrix bonded reinforcing fibers that provide a continuous phase to the substrate to transfer the load to harder fibers, including Eglass, S-glass and kevlar fibers (Kevlar 29, Kevlar 49, Kevlar 129, and Kevlar KM 2). Fiber composite material mainly uses the elongated plastic deformation and fracture of fiber to absorb energy of the penetrator, so as to achieve the bullet-proof function [9]. Fiber composite material has good anti-corrosion, insulation, noise and stealth performance, under the premise of the same anti-ballistic capacity improving the structural performance and reduces the body weight. The fiber composite prevents the back of the armor from collapsing to damage the occupant and equipment, thereby avoiding additional weight due to the use of additional body liners. At present, some countries are studying the use of fiber composite materials as the body structure materials, including the United States advanced composite armored vehicles (CAV) platform and the United Kingdom advanced composite armored vehicle platform (ACAVP) program [2].

3 Development of Armor Protection Technology 3.1 Electromagnetic Armor With the development of anti-armor technology, the traditional armor protection technology is difficult to resist the powerful anti-armor technology, so we must find new armor protection technology to meet the demand, electromagnetic armor came into being. In 1970s, Walker first proposed the concept of electromagnetic armor. Electromagnetic armor is a kind of protection device that protects the combat vehicle by means of the stored electromagnetic energy, which makes the incoming projectile lose or reduce the penetrating power, or through active interception[10]. Electromagnetic armor can be divided into active and passive. Active electromagnetic armor based on the initiative to attack the projectile to intercept, to make it deflect or loss of penetration in the certain distance. First active

Research on Development of Armor Protection Materials and Technology | 623

electromagnetic armor detects and locates the projectile's azimuth, velocity and distance through the detection device, and then the launch system launch metal plate or other interception objects, so that the projectile explosion in advance or deflection. Passive electromagnetic armor is to have a certain gap distance between the two armored plates and high-power capacitors are connected to the poles, when the armor-piercing metal jets or armor piercing through the outer shell close to the inner plate, the insulation between the two boards hit the magnetic field generated in the jet or the bomb core will be destroyed by the Lorentz force and the ohmic heating effect, which will cause the jet or the core to break, thereby reducing its penetration capability.

3.2 Explosive Reaction Armor Explosive reaction armor is usually used in the way of attached or wrapped, its basic structure is similar to the "sandwich", that is, placing a steel plate (panel and backplane) in a layer of blunt explosives on both sides of each. When the jet penetration breakdown panel, the charge was detonated and the detonation wave pushes the panel and backplane in the opposite direction. The panel and the backplane interfere and destruct to penetrator in the process of flight, and make the penetrator reduce or loss the ability of penetrates to ease the damage to the main armor [11]. Its basic working principle is shown in Figure 2.

1--Panel movement direction;2—Panel;3—Charge;4—Backplane;5--Backplane movement direction;6—Jet;7--Shaped charge warhead Fig. 2: The basic principle of explosive reaction armor.

Israel, Russia and other countries are in the lead in the field of explosive reaction armor. Israel has developed five generations of products since it first installed reaction armor on main battle tanks in 1982. In 1983, the United States purchased

624 |Xu-Dong Zhao, Xing-Yong Gao, Guo-Qing Liu, Yu-Ling Zhang reactive armor technology from Israel, and then began to develop their own reactive armor, and used in the M60 main battle tanks and Bradley infantry fighting vehicles. Russia developed "contact-5" explosive reaction armor, which can make the tank armor-piercing missile protection capacity increased by 20% to 40%. It has been installed in the T-72, T-80, T-90 and other main Battle tanks, can withstand the M829A1 depleted uranium armor-piercing projectile. The Romo A and the Warma 2 reaction armor were developed respectively in the United Kingdom, and the Romo A was applied to the Challenger 1 main battle tank and the Samurai infantry fighting vehicle.

3.3 Grill Armor Grill armor is developed to prevent the shaped charge of rocket detonation, which installed outside the armored vehicle.It is the unconventional armor, which using rocket structure characteristics to achieve its protective performance. After the war in Iraq, bar grille armor began application in large scale. In order to achieve the purpose of weight loss, the British BAE Systems developed a LROD anti-rocket grille armor protection kit. The armor has been widely applied in the US Army RG31, RG31A1 anti-mine vehicle; MRAP III bison mine destruction vehicle, AAV7 amphibious vehicles, the new RG-33 anti-mine vehicle and other types of MRAP. LASSO linenet armor which Sweden Rugger Company developed is the use of diamond-shaped network composed of 4mm high-strength steel wire, and its surface density of about 15-20 kg/m2. It is installed on the M113 armored transport vehicles in Denmark. Foster Miller is also developing a line-net armor (PRGNet line-net armor). The armor was installed on the French VBCI infantry fighting vehicle at the 2010 European Sartori equipment exhibition. The Polish modified Black Badger armored vehicle also used the PRGNet line-net armor [12].

4 Conclusion Anti-armor technology and attack capabilities will continue to strengthen in the future. Single passive armor protection has been difficult to adapt to the battlefield environment and operational requirements of the development of the task, so the survival of tanks and armored vehicles are facing a great threat. Therefore it greatly promotes the development of new armor protection materials and armor protection technology. Armor protection technology is developing in the toughening, lightweight, multi-functional and efficient direction. The application of the new highperformance materials and advanced technology will greatly improve the capability of combat vehicles.

Research on Development of Armor Protection Materials and Technology | 625

References [1] [2] [3] [4]

[5] [6]

[7] [8] [9]

[10] [11]

[12]

SONG Xin-bin. The status and trend of modern tank synthesis protecting system [J]. Modern Military Affairs, 2010, (12): 36-39.(in Chinese) FANG Ling-hui, ZHENG Xiang-yu, MA Li, et al. Armor protection development of tank & armored vehicle[J]. Sichuan Ordnance Journal, 2014, (2): 23-16.(in Chinese) CAO He-quan, ZHANG Guang-ming, SUN Su-jie, et al. Status and development of protection technology of armored vehicles [J]. Acta Armamentarii, 2012, 33(12): 1549-1554.(in Chinese) WANG Qi-lei, LIU Tian-sheng. The present research situation and development trend of armored vehicles protective materials [J]. Mechanical Management and Development, 2012, (5): 17-18.(in Chinese) ZHANG Yu. Development of sandwich armor and aluminum alloy armor materials [J]. Science and Technology of Baotou Steel, 2011, 37(5): 4-7.(in Chinese) ZHAI Jing, XIN Wen-jun, GUO An-zhen, et al. Protection properties and ballistic mechanism of titanium alloy armour [J]. Ordnance Material Science and Engineering, 2014, 37(5): 106-109.(in Chinese) Medvedovski E. Alumina ceramics for ballistic protection [J]. American Ceramic Society Bulletin, 2002, 81(4): 45-50. LIU Wei, YANG Jun. Current status and development of armor protective material [J]. Hot Working Technology, 2011, 40(2):108-111.(in Chinese) HUANG Ying, LIU Xiao-hui, LI Yu-zhong. Application of composites in tank armored protection fiber reinforced plastics/composites [J]. Glass-steel Composite Material, 1999, (3): 1520.(in Chinese) Wickert M. Electric armor against shaped charges: analysis of jet distortion with respect to jet dynamics and current flow [J]. TEEE Transaction on Magnetics, 2007, (43): 426-429. LI Ben-peng, PAN Yu-tian, LI Yong-qiang. The response analysis of the road about ammunition of the self-propelled artillery [J]. Mechanical Management and Development, 2011, (2): 2931.(in Chinese) CAO He-quan, ZHAO Bao-rong, XU Long-tang. Armour protecting technology [M]. Beijing: The Publishing House of Ordnance Industry, 2012.(in Chinese)

Xue-Gang Xiong1, Kai-Hua Zhang2, Xiao-Yu Ye3 and Yao Xiao4

Cold forming Cracking Reason and Solution Method of SS400 Hot Rolled Steel Abstract: The reason of that SS400 hot rolled steel cracked during cold-forming was analyzed. Metallographic examination showed that, the gather of cementites at grain boundaries was the main cause of the cracking during SS400 formation. Fracture morphology observation showed that, the fracture with some inclusions was brittle mode. Therefore, chemical composition and hot-rolling process were optimized: the content of silicon was reduced to below 0.10%, the sparse laminar cooling system was used, and the coiling temperature was controlled within 680±20°C. With the application of the process optimization, SS400 hot rolled plate showed lower yield strength and higher elongation thereby getting better forming performance. Keywords: SS400 hot rolled plated; cracked during cold-forming; cementites in the grain boundaries; yield strength.

1 Introduction Recently, the social problems of environmental protection and energy conservation are more and more serious, and the trend of sustainable development has become inevitable. Therefore, steel sheets with good formability, a kind of future iron and steel materials, should be developed to meet the need of economical society. With the development of automotive and mechanical engineering industries, steel sheets with good formability has become the developing trend of iron and steel materials to improve bearing capacity and service life of automobile and engineering machinery [1-5]. Steel is the basic structural material of automobile, many automotive structure parts are produced by stamping forming of steel sheet, and the forming process is complicated. Stamping forming performance of steel sheet is closely related with its yield strength and ductility. In order to ensure the formability, enough strength and good ductility of steel sheet should be ensured. In this article, the reason of that SS400 strip steel cracked during stamping forming was analyzed, and the chemical

|| 1 Pangang Group Research Institute Co., Ltd. Panzhihua, Sichuan, China. [email protected] 2 Pangang Group Research Institute Co., Ltd., Panzhihua, Sichuan, China. [email protected] 3 Pangang Group Research Institute Co., Ltd. Panzhihua, Sichuan, China. [email protected] 4 Pangang Group Research Institute Co., Ltd. Panzhihua, Sichuan, China. [email protected] 10.1515/9783110516623-062 DOI 10.1515/9783110303568-062

628 | Xue-Gang Xiong, Kai-Hua Zhang, Xiao-Yu Ye and Yao Xiao composition and rolling process was optimized to improve the formability of SS400 strip steel, so as to provide theoretical guidance and reference data for industrial production.

2 Experimental Material and Method The experimental material was automotive structure part (thickness: 3.1mm) which cracked during stamping forming. Tab. I shows the chemical composition. The experimental material was sampled for microstructure observation and fracture analysis. The samples for microstructure observation were eroded in 3% nitric acid alcohol solution, and then observed through ZEISS MEF3 metallographic microscope. Scanning Electron Microscope (SEM) was carried out through FEI-MLA 600 SEM with a scanning voltage of 20kV to measure the fracture morphology, and energy spectrum analysis was carried out through METEK- EDAX EDS to analyze the inclusions. Table1: Chemical components of SS400 automobile structure parts. /% C

Si

Mn

P

S

Als

0.083

0.195

0.344

0.016

0.009

0) in the perfectly competitive market, ’ത is the maximum price of coal;

Study on the Optimal Extraction Ecological Environment | 819

୲ ( ୲ ), the cost of mining at time t, that gives ǡ ൐ Ͳǡ  ǡǡ ൐ Ͳ.Thereమ the influence of ୠୖ technical progress and remaining reserves is ignored, so ୲ ( ୲ ) = ౪ (b>0); ଶ r, discount rate; ୲ ( ୲ ), the ecological environment capacity at time t, we have ሶ=αR(α>0),α is supposed to be the self-purification coefficient of ecological environment, namely the ratio of the reduction factor of heat of coal combustion and the average capacity that global forest absorb the greenhouse gas discharged by coal combustion. Then dynamic optimal control issue means: ୘

ƒš ൌ ‫׬‬଴ ሾ’୲  ୲ െ ୲ ሺ ୲ ሻሿ ‡ି୰୲ dt s.t: ሶ=-ǡ ଴ =ǡ ୘ =0, ሶ=α,

Make ɉଵ ǡ ɉଶ to be the shadow price, the Hamilton function is: ൌ ሾ’୲  ୲ െ ୲ ሺ ୲ ሻሿ‡ି୰୲ െ ɉଵ  ୲ ൅ ɉଶ α ୲ ,

(1)

(2)

With optimal control theory, the present value of the Hamiltonian is defined as:  ୡ ൌ ’୲  ୲ െ ୲ ሺ ୲ ሻ െ ଵ  ୲ ൅ ଶ α ୲ ,

(3)

Hereଵ ൌ ɉଵ ‡୰୲ ǡ ଶ ൌ ɉଶ ‡୰୲ ,

The first-order conditions and cross-sectional conditions are: பୌౙ பୖ౪

=’ത-(2ƒ ൅ „ሻ ୲ െ  ଵ +ଶ Ƚ=0, பୌౙ

ሶ ଵ =-

பୗ౪

+rଵ = rଵ ,

 ሶ ଶ =-

பୌౙ

ப୑౪

+rଶ = ”ଶ ,

ሾ ୡ ሿ୲ୀ୘ ൌ Ͳ;

୘ ɉଶ ሺሻ=0.

(4) (5) (6) (7) (8)

3 The Solution of Model By the formula (8) and ୘ ≥0, we have ଶ ሺሻ= ଶ ሺͲሻ‡୰୘ ൌ0, so we have: ଶ‫ כ‬ൌ Ͳ ,

(9)

820 | Sha Li, Jin-Suo Zhang and Xiao-Xia Yan By (4) and S (0) =ǡ ሺሻ=0, we have ሺሻ=െ

ഥି୫భ ሺ୘ሻା୫మ ሺ୘ሻ஑ ୮

Then the solutions are:

ଵ‫ כ‬ሺͲሻ=

ଵ‫ כ‬ൌ

‫ ୲כ‬ൌ

.T+S=0,

ଶୟାୠ

(10)

ഥǤ୘ିሺଶୟାୠሻǤୱ ୮ ୣ౨౐ Ǥ୘

ഥǤ୘ିሺଶୟାୠሻǤୱ ୮ ୣ౨౐ Ǥ୘



ଶୟାୠ

୲‫ כ‬ൌ െ ‫ –† ୲כ ׬‬൅ =െ

ሺ’ത െ ଵ

(11)

.‡୰୲ ,

(12)

ഥǤ୘ିሺଶୟାୠሻǤୱ ୮

୰ሺଶୟାୠሻ

ୣ౨౐ Ǥ୘

ሺ’ത െ

.‡୰୲ ),

(13)

ഥǤ୘ିሺଶୟାୠሻǤୱ ୮ ୣ౨౐ Ǥ୘

.‡୰୲ ) +S.

(14)

Discussion of optimal control result: (1) To consider the optimal reserves path and environment capacity path, we could get: The bigger t is, the smaller is୲‫ כ‬. Here ୲‫ כ‬is decreasing function of t. (2)The higher original reserve S is, the curve ୲‫ כ‬moves upwards. (3) The bigger discount rate r is, the steeper is the curves୲‫ כ‬. (4)The larger marginal cost b leads to increase of the vertical intercepts of curves୲‫ כ‬. Since part of the power increases the slope of the curve, meanwhile part of the power decr-eases the slope of the curve. The increase or decrease of the curves’ slope is unable to deter-mine.

4 Conclusion In this paper, we try to study the optimal extraction scale of coal resources under the constraint of ecological environment capacity, using the profit as the maximization target, in a perfectly competitive market. The result above shows that the optimum solution of  ୲ doesn’t contain α, and the shadow price of ecological environment capacity is 0. The result means that: under the premise of the profit maximization goal, if only consider the ecological environment as a constraint rather than costs, then the ecological environment will have no effect on the optimal extraction scale of coal resource. The realistic significance is that from the perspective of resource holders, a constraint that has no effect on profits would not be considered as a reference for capacity planning.

Study on the Optimal Extraction Ecological Environment | 821

References [1] [2] [3] [4] [5] [6] [7] [8] [9] [10] [11] [12] [13] [14] [15]

[16]

Hotelling H. The economics of exhaustible resources [J]. Journal of Political Eco-nomy, 1931, 39(2):137-175. Ito, K... Stochastic Integral [J]. Proceedings of the Imperial Academy Tokyo, 1944, Vol.20:519524. Ito, K... On a Stochastic Integral Equation [J]. Proceedings of the Imperial Academy Tokyo, 1946, Vol.22: 32-35. Ito, K... Lectures on Stochastic Process [M]. Bombay: Tata Institute for Fundamental Research, 1961. Ito, K... Diffusion Process and Their Samples Paths [M]. New York: Academic Press, 1964. Bellman, R... Dynamic Programming [M]. Princeton: Princeton University Press, 1957. Dasgupta P, Heal G. The optimal depletion of exhaustible resources [J]. The Review of Economic Studies, 1974, 41:3-28. Solow R M. Intergenerational equity and exhaustible resources [J].The Review of Economic Studies, 1974, 41:29-45. [9]Stiglitz J. Growth with exhaustible natural resources: Efficient and optimal growth paths [J].The Review of Economic Studies, 1974, 41:123—137. Weinstein, M.C., and Zeckhauser, R.J... The Optimum Consumption of Depletable Natural Resources [J]. The Quarterly Journal of Economics, 1975, 89: 371-392. R.F. Conrad, R.B. Hool. Intertemporal Extraction of Mineral Resources under Variable Rate Taxes [J]. Land Economics, 1984, 60 (4):319~327 R.C. Kumar. How Long to Eat a Cake of Unknown Size? Optimal Time Horizon under Uncertainty. Canadian Journal of Economics,2002,35(4):843~853 KrautKraemer J A. Optimal growth, resource amenities, and the preservation of natural environment[J].Review of Economic Studies,1985,52(1):153-169. Lyon K S, Lee D M. Nonrenewable resource extractions with a polluted side eff-ect: A comparative dynamic analysis [J]. Natural Resource Modeling, 2004, 17(4):377-392. Xiaoxiao ZHOU, Xiaoping WEI,Xinyu WANG. A comparative study of interterm-poral mining path of fossil energy under the restriction of environment [J]. Statistics & Information Forum, 2014, 29(7):103-108. Xiaoxia YAN, Jinsuo ZHANG, Shaohui ZOU. Study of exhaustible resources con-sumption under the constraint of pollution [J]. System Engineering Theory and Pra-ctice, 2015, 35(02):291-299.

Yuan-Yuan Wang1* and Ming-Hui Su2

Research on the Stability Calculation and Treatments of the Liyu Landslide in Zhuzhou City, Center Hunan Province Abstract: On the basis of detailed field survey and test results, we found out that, the Liyu landslide was a small type soil body, with width of 98m, size of 0.7×104m2 and volume of 4.5×104m3. In the paper, we illustrated the basic characteristics, genesis and developing trend of the Liyu landslide. Finally, we put forward to a comprehensive control measure of cleaning up soil on the slope and setting anti slide piles. Keywords: Basic characteristics, Genesis, Stability, Treatments, Landslide

1 Introduction Since 2014, the Liyu landslide began to deform and outbreak. Field survey results showed, the leading edge of the Liyu landslide had width of 98m, size of 0.7×104m2 and volume of 4.5×104m3. At present, the Liyu landslide is seriously threatening the safety of more than 6000 people’s lives and many industrial houses. Therefore, it is urgent to research the stability and its control of the landslide.

2 Engineering Geological Conditions 2.1 Hydrometeorology The study area was located at the field of subtropical monsoon humid climate, and there were clear four seasons, mild climate and abundant rainfall. The mean annual precipitation was 1410mm, and the maximum precipitation over the years was 2000mm. The annual average temperature was 17.5°C, and extreme maximum temperature was 40.5°C. Water quality analysis showed that the groundwater was slightly corrosive to the concrete structure and the steel bar in the reinforced concrete.

|| 1 Wuhan University of Technology Huaxia College, Wuhan Hubei 430223, China. NO. 589, Guanshan Avenue, Hongshan District, Wuhan City. Email: [email protected] 2 Wuhan University of Technology Huaxia College, Wuhan Hubei 430223, China. NO. 589, Guanshan Avenue, Hongshan District, Wuhan City. Email: [email protected] 10.1515/9783110516623-081 DOI 10.1515/9783110303568-081

824 |Yuan-Yuan Wang and Ming-Hui Su

2.2 Topography and Geomorphology The landform type of study area belonged to hilly terrain. The whole terrain showed the trend of high northern and low southern and relative elevation was about 32m. The mountain slope terrain was slow, and the slope was 30 to 15 degrees. After the excavation, study area had formed three slopes and declined.

2.3 Lithology The lithology of the study area was silty sandstone and conglomerate, which included the fully, strongly and moderately weathered rocks [1]. Fully weathered rocks were divided into muddy silty sandstone and conglomerate, and the later one was located above the former rock. When rainwater infiltrated to the top of the muddy silty sandstone, the formation of a sliding belt would happen in the bottom of this strata.

3 Basic Characteristics 3.1 Spatial Figure The spatial shape of Liyu landslide was a sector (Figure 1). The width of leading edge was about 98m, with an square 0.7×104m2 and volume of 4.5×104m3. In term of type, the Liyu lanslide belonged to a small soil landslide. The sliding direction of landslide was due to north (88°), and mountain slope was slow (15-24°).

Research on the Stability Calculation Zhuzhou City, Center Hunan Province | 825

Fig. 1: The panorama (a), felling in back edge (b) and side slopes (c, d) of the Liyu landslide

The rocks and soils of the sliding body were composed of fully weathered conglomerate, with reddish brown colour and cohesive soil shape. Its thickness was 5.0-8.0m.

3.2 Sliding Belt The sliding belt was generally distributed in the bottom of the fully weathered conglomerate, with distribution of the plane. Soil of sliding zone was wet, and was disturbed. Water softening phenomenon could be produced at the bottom of all weathered rock strata, where formed the soft surface. And then, the fully weathered rocks were sliding along the surface of the strongly weathered rock strata.

3.3 Sliding Bed The sliding bed was composed of fully weathered muddy sandstone, and the underlying bedrock was strongly weathered silty sandstone and moderately weathered muddy sandstone.

826 |Yuan-Yuan Wang and Ming-Hui Su

4 Experimental Analysis and Results The results of experimental analysis from eight group samples showed that, the slide zone soil and rocks had the different values of density (ρ0), internal friction angles (φ) and cohesive force (C). The analysis results were listed in Table 1. Table1: The Main Physical Parameters Of Slide Zone Soil From Liyu Landslide Types

Density (g/cm3)

Internal friction angles (°)

Cohesive force (kPa)

sliding belt soil

19.5

13.5

11.0

fully weathered rocks

19.7

20.1

39.5

strongly weathered rocks

22.0

35.5

80.0

moderately weathered rocks

22.6

39.0

300

5 Genesis and Development Trend 5.1 Genesis Factors such as the excavation of the mountain and the sparse vegetation provided the favorable conditions to deform. The weathered soil on the slope was loose, which provided the necessary material foundation for the deformation of the landslide. Surface water infiltrated into the top of fully weathered rocks and assembled, and flowed along the surface of surface of the low lying area. Due to the erosion and softening of water [2, 3], the soft structure surface was easy to be formed at the bottom of all weathered conglomerate. The through slip surface was formed by the long term effect of water and the enchantment of structural plane. And then, under the action of self-gravity, especially under the condition of full water, the landslide was very easy to creep along the slip surface. The Liyu landslide had been formed finally.

5.2 Development Trend According to field investigation, the back edge of Liyu landslide fell and the leading edge bulged, toe area scarp cut out, and multiple tensile cracks arise on the surface of the body. Combined with the features of soft plastic surface between the fully weathered conglomerate and silty sandstone, all these factors implied that, at present, the Liyu landslide was unstable. Especially, under the heavy rain conditions, the risk of further decline along the weak side was great.

Research on the Stability Calculation Zhuzhou City, Center Hunan Province | 827

6 Stability Analyses In this paper, we adopted the transfer coefficient method [4, 5] to calculate and evaluate the stability of the Liyu landslide. The calculation formula was as follows: n 1

n 1

K

¦ ((W i 1

f

i

(cos a i  A sin a i ) tan I i  C i L i ) – \ j )  R n j 1

n 1

n 1

¦ (W i 1

i

(sin a i  A cos a i ) – \ j )  T n j 1

Here, we selected the characteristic values of shear strength, according to experimental results, current stability situation and engineering experience. The shear strength values of sliding zone (C and φ) were 13kPa and 10.5° in natural condition, and 11kPa and 8.5° in saturation state. Under different working condition I (weight) and II (weight and rain), we selected some sections to calculate (Figure 2). The results of stability calculation showed, under I condition, the stability coefficient (Fs) was 0.99- 1.04, under II condition, the value Fs was 0.82~0.86. Therefore, the landslide body was in an unstable state, and it is of great danger.

Fig. 2: The selected section diagram of the Liyu landslide

7 Treatments Based on the results of stability calculation and field investigation, we put forward to some treatments. Firstly, the soil body on the leading edge should be cleaned up, and cracks should be sealed and filled. Secondly, the fell soil body on back edge should be compacted and leveled. Thirdly, anti-slide piles should be mounted near to the foot of slope. In short, we suggested a comprehensive method including cleaning up soil on the slope and setting anti slide piles.

828 |Yuan-Yuan Wang and Ming-Hui Su Acknowledgement: This research was financially supported by the grant B2015366 of Hubei provincial Department of Education’s Science research project and the teaching team construction of Geotechnical engineering project of Wuhan University of Technology, Huaxia College 2013.

References [1] [2] [3] [4] [5]

Specification of geological investigation for landslide stabilization. DZ/T0218-2006. Beijing: Chinese Standard Press (2006). Rahardjo, H., Li, X. W., Toll, D. G. The effect of antecedent rainfall on slope stability. Geotechnicaland Geological Engineering, 19 (3): 371-399 (2001). S. Chen, G. L. Xu, Research on engineering geology characteristics of rail in sliding zone of Huangtupo landslide in Three Gorges Reservoir area. Rock Soil Mech, 30(2009): 3048-3052. Code for investigation of geotechnical engineering. GB50021-2001. Peng, Y. L, Guo, D. L., Hu, X. W., Gu, C. Z., Zhou, J. 2011. Characteristics and stability analysis of a landslide in Kuancheng country, Hebei province. Journal of Mountain Science, 29(5): 591597.

Qing-Lin Kon1 and Xiu-Huan Li2

Procurement Cost Control of New Energy Vehicles Manufacturing Enterprise under Supply Chain Management Abstract: New energy is an important issue in the field of environmental economics. Under the pressure of energy shortage and environmental protection, new energy vehicles will no doubt become the direction of automobile’s future. New energy vehicles cost is composed of many contents, and the procurement cost is the most important part, which plays a crucial role in the sales price of the product. The main research methods of this paper are comprehensive analysis and documentation method. This paper attempts to analyze procurement cost control of new energy vehicles manufacturing enterprise under the supply chain management from the aspect of supply chain management and procurement cost control strategy under the circumstances of environmental economics. This thesis aims to analyze new energy vehicles manufacturing enterprise’s procurement cost control strategy so as to provide reference for these firms to promote sustainable development. Keywords: New energy; Environmental economics; Procurement cost; Supply chain management

1 Introduction In recent years, China advocates the development of low-carbon economy in order to change the mode of economic development and establish a resource-saving and environment-friendly society. As a pillar industry of China's national economy, the automotive industry has gradually got onto the right track of internationalization and globalization. However, the major car companies have invested and set up factories in China, bringing about great challenges of fierce competition and diversified demand change, which requires the automotive industry to reduce the cost, increase efficiency of production and energy usage, enhance the competitiveness of enterprises in the supply chain and shorten time-to-market. The requirements of procurement links for the cost reduction and efficiency improvement are becoming

|| 1 School of Accountancy, Chongqing University of Technology, Chongqing City. China. [email protected] 2 School of Accountancy, Chongqing University of Technology, Chongqing City. China. [email protected] 10.1515/9783110516623-082 DOI 10.1515/9783110303568-082

830 | Qing-Lin Kon and Xiu-Huan Li greater, and the requests for the optimization of auto parts procurement is more urgent. Procurement is playing a more and more important role in new energy vehicles manufacturing enterprise’s product research, supply chain management and management capabilities. As the important content of new energy vehicles manufacturing enterprise’s management and the core part of the supply chain, the purchase management level plays a pivotal role in production process, profit and cost control. Along with the development of globalization and regional economy, there is undergoing significant changes in people's understanding towards procurement management. Grasping the essence of modern procurement management is an important guaranty for various enterprises’ survival against the background of globalization and environmental protection, and it is a necessary requirement for modern enterprises to focus on development to enhance their competitiveness, for the purchasing cost directly affects the price of the final product and the profit of the whole supply chain. Thus, the purchase cost control has become new energy vehicles manufacturing enterprise’s one of important means in management optimization, which makes it effectively react to outer environmental economics. The procurement cost control level has gradually become one of the important standards to measure new energy vehicles manufacturing enterprise’s competition strength size simultaneously.

2 Procurement Cost Control Under Supply Chain Management 2.1 Supply Chain Management The concept of supply chain evolved through a long period. It originally originated in Peter F. Drucker who brought up the "economic chain" concept, and then the concept developed into the "value chain", and finally formed the "supply chain". Conceptually, the supply chain is a huge system, involving many subjects, such as suppliers, manufacturers, retailers and customers, etc. As numerous subjects are involved, it requires a scientific and effective supply chain management to increase the efficiency of the supply chain. Supply chain management refers to a process of planning, coordination, control and optimization to the whole supply chain system, so as to ensure the smooth operation of the whole supply chain, and make the lowest total cost of the supply chain. Interconnected or interlinked networks, channels and node businesses are involved in the provision of products and services are required by end customers in a supply chain (figure1). The end of supply chain management is customer, and the supply chain management is to meet customers demand. It requires a change from

Procurement Cost Control of New Energy Vehicles Chain Management | 831

managing individual functions to integrating activities into key supply chain processes for a successful supply chain management. Only when ensuring the coordination and communication between the enterprises in the supply chain can it ensure the effective operation of the entire supply chain. All participants in the supply chain system should improve the efficiency of supply chain management, and deal with the complex environmental changes in the market in order to meet customers changing needs.

Fig. 1: Automobile manufacturing supply chain management

2.2 The Transformation of Purchasing Function under Supply Chain Management In the supply chain, the procurement connects to the upstream and downstream and links up the production and materials supply. In the general, new energy vehicles manufacturing enterprise, procurement cost takes up over 80% of the total cost of an enterprise, which exerts a major influence on the profitability of an enterprise. The speed and efficiency of the procurement will directly affect the timely response to the needs of end customers and purchase cost will affect the price of the final product and the profit of the whole supply chain. The traditional procurement still sees the price as the main performance indicators. Price is important to the enterprise's profitability, but it is likely to deviate from the new energy vehicles manufacturing enterprise’s strategic objectives if it is paid attention to only when buying adornment material price is negotiated on main material, oversight the price of accessary material. For a long time, there is a saying goes 'we should at the right time, with the right quality, at the right amount, with

832 | Qing-Lin Kon and Xiu-Huan Li the right price and the right suppliers to get the right products and services. ‘Obviously, this statement is flawed. Therefore, the concept of procurement in the new environment must rise to the strategic point of view combining with the enterprises strategic management, and re-examine the procurement by using the idea of supply chain management. According to the Council of Supply Chain Management Professionals (CSCMP), supply chain management encompasses the planning and management of all activities involving sourcing, procurement, conversion, and logistics management. It also includes coordination and collaboration with channel partners, which could be suppliers, intermediaries, third-party service providers, or customers. Supply chain management integrates supply and demand management within and across companies. More recently the Extended Enterprise has been mentioned, which is defined as loosely coupled, self-organizing network of businesses that cooperate to provide product and service offerings.

2.3 Differences between Traditional Procurement Cost Control and Procurement Cost Control under Supply Chain Management Comparing with the traditional procurement cost control, there is a large difference in procurement cost control under supply chain management especially in management and procurement targets. In another words, procurement cost under supply chain management has been much improved. It is mainly embodied as fowling three changes. 1) The transition from the traditional inventory procurement cost model to order cost purchasing model; 2) The transition from traditional mode of internal product cost accounting to mode of combining inner-firms product cost accounting with besides firms product cost accounting; 3) the transition from the business relationship of buying and selling to strategic and cooperative relationship. Enterprises in supply chain management share the risk, responsibility and profit in the operation process of product. In the meantime, consumers place the orders to suppliers according to their own needs for products, which will increase the risk of enterprises’ response to variation of a product price and transform the competitive relationship to mutual cooperative relationship between enterprises. Under the circumstances of supply chain management, not only can it reduce each enterprise’s cost of the inventory, but also greatly solving the enterprise's financial problems, strengthening economic cooperation and transforming traditional procurement cost control model into model of procurement cost control under supply chain management.

Procurement Cost Control of New Energy Vehicles Chain Management | 833

3 The strategies of Procurement Cost Control under Supply Chain Management 3.1 Strategic Control of Procurement Cost The strategic cost management under supply chain management includes two aspects. First, procurement strategy should be made according to the enterprise strategy from point of view of cost analysis, selection and optimization of enterprise strategy; the second refers to achieve the procurement strategy control the purchase cost. The former is the cost side of the enterprise strategy. The latter, based on the former, try to find a solution to improve the effectiveness of the cost management and the cost management system, and so on. The core of the cost leadership strategy is to reduce enterprises cost through all possible means to become the lowest product cost in the market, so as to gain the competitive advantage by establishing better price. In another word, Cost leadership strategy is essentially a cost strategy. Target aggregation strategy is divided into two forms: cost aggregation strategy and diversity strategy. Cost aggregation strategy is to find the difference in the cost behavior in the market, and to seek the cost advantage in the target market. The diversity strategy is to exploit customers’ special needs in market segments and pursuit the differentiation advantage in target market. Cost aggregation strategy is a kind of low cost strategy, which takes competitive measures against competitors in the market to a particular demand in terms of cost. If an enterprise is able to achieve lasting cost leadership or in a diversity position on its target market, it is possible to obtain a higher profit than the average profit level. From the theory of competitive strategy, it logically follows that no matter what kind of strategy the enterprise adopts, the cost issue is always the key problem to be considered in the process of strategy formulating, selecting and implementing. As for the enterprises, how to use cost strategy to win cost advantage and competitive advantage is an important content of enterprise’s strategic management, but also an important content of cost management, which constitutes an important part of strategic cost management.

3.2 Outsourcing Procurement Business T Procurement outsourcing is a business strategy to outsource some non-core procurement, which should be purchasing department’s responsibility, to professional and efficient products and services suppliers, in order to make full use of enterprise external outstanding specialized resources and focus on its core competencies, thereby reducing procurement costs, improving purchasing efficiency and strengthening their own competitive advantage. Outsourcing procurement enhances the

834 | Qing-Lin Kon and Xiu-Huan Li competitive advantage in the core procurement business through outsourcing all or most of the non-core procurement business to contractor thus ended the procurement mode of self-sufficiency. The philosophy of procurement outsourcing is that if the enterprises in the supply chain is not the world's best and does not have their own core competitive advantage, and also has no influence in customers, then enterprises should outsource the procurement business to the enterprises with core competitive advantage which is beneficial for the enterprises. In other words, enterprises should unmistakably know their core competitive advantage and concentrate on those with a core competitive advantage, then outsource the rest of the service to the world's best enterprises. As the enterprise's ability and resources are limited, there is no enterprise can do anything. So it is necessary to select one or several industry's top firms, creating technical advantages and scale advantages and becoming the leading manufacturers in the field. Otherwise, it has to withdraw from the field, and the business will be outsourced to other manufacturers. As outsourcing enterprises reduce the financial troubles by 2/3 than non-outsourcing enterprises, so that the annual scale of outsourcing in United States and Europe reaches 35%. The proportion of hightech enterprises outsourcing accounted for 30% of the total outsourcing. It is predicted that high-tech enterprises will reach 50% in a few years. Allocation of resources in the supply chain management is a value-added decision-making process, if the enterprise can obtain a lower cost than the purchase of a higher value of resources, then outsourcing should be considered. Procurement outsourcing can not only lower procurement costs, provide higher efficiency procurement services, and improve the efficiency of procurement operations, but also brings together intelligence and resources to focus on core procurement business, and improve enterprise competition ability in new competitive environment.

3.3 Building Vendor Managed Inventory Management Systems In general, the inventory is managed by the owner of the inventory. We need inventory because we cannot know exactly the state of the user's demand and supply. This kind of inventory management mode is not always optimal. For instance, supplier will build commercial inventory to meet the unpredictable needs or a user's unstable demand, in a similar way the user will also build inventory to cope with unstable internal demand or uncertainty in supply chain. Different organization in supply chain operate independently according to their needs, which leads to repeated establishment of inventory, and therefore cannot reach the minimum cost in the whole supply chain, which leads to the inventory’s substantial increase in the whole supply chain system along with the increase of the length of supply chain. With scientific and integrated management thoughts applied to inventory manage-

Procurement Cost Control of New Energy Vehicles Chain Management | 835

ment, VMI (Vendor Managed Inventory) management system will be able to break through the traditional inventory management mode, and make the supply chain system run concurrently. Vendor Managed Inventory (VMI) is a cooperation strategy between suppliers and buyers in which the buyer of a product provides certain information to a vendor supplier of that product and the supplier takes full responsibility for maintaining an agreed inventory of the material at the buyer's consumption location. A third-party logistics provider can also be involved to make sure that the buyer has the required level of inventory by adjusting the demand and supply gaps. The main idea of VMI is to set up the stock under the user's permission to determine the level of inventory and replenishment strategy, while supplier possessing inventory ownership.

4 Conclusion Supply chain management is the result of the development of modern enterprise management system, which has a special significance for enterprises improvement of the competitiveness. New energy vehicles manufacturing enterprise should change the old concepts and adapt new situation, and push forward the establishment of standardized procurement system so as to achieve effective control of procurement cost and improve procurement efficiency, and ultimately to enhance the level of enterprises production and management. For enterprises internal supply chain environment, it should optimize the procurement process, inventory management mode, and build an information zed and automate platform to improve the efficiency of economic activities, and strengthen supervision in the procurement activities. On the other side, for the enterprises external supply chain environment, it should pay more attention to the supply chain management, perfecting the evaluation and selection of suppliers, and control suppliers bargaining power. As a result, the anti-risk ability of the whole supply chain would be increased. Meanwhile, ensuring the effectiveness of purchasing process is one of the enterprises core competitiveness, which requires active response to the fluctuations of raw materials price.

References [1] [2] [3]

Houlihan, “International supply chain management”, The International journal of materials management, vol.16, pp. 20-24, 1985. W.X.M, “Analysis of determinants of customer satisfaction”, Foreign Economies & Management, vol.4, pp. 5-6, 2015. [4] Ayi Tejaningrum,Anton Mulyono Azis,Maya Irjayanti.Mapping, “The Supply Chain Issues SMEs and Impact for Quality Products”, management review, vol.1, pp.9-15,2016.K. Elissa, “Title of paper if known,” unpublished.

836 | Qing-Lin Kon and Xiu-Huan Li [4] [5] [6]

Giannakis, Mihalis, Papadopoulos, Thanos, “Supply chain sustainability: A risk management approach”, International Journal of Production Economics, vol.171, pp.455-470, 2016. Cuicui Luoa, Desheng Wub, “Environment and economic risk: An analysis of carbon emission market and portfolio management”, Environ Res, vol.149, pp.297-301, 2016. https://en.wikipedia.org/wiki/Supply_chain_management#cite_note-3.

Chu-Chu Zeng1, Yu Qian2* and Yong-Sheng Liu3

Domino Effect Index for Chemical Plants Based on Fishbone Analysis Abstract: Due to the rapid development of chemical industry in China, chemical accidents frequently occurred. The domino effect had a key role in these accidents but was neglected in the current risk assessment method. Therefore, this essay proposed a new evaluation method, the domino effect index (DEI), which was based on the fishbone diagram to evaluate the risk of chain accidents. According to the fishbone analysis, the DEI has six main sub-indexes: process and equipment, materials, staff, safety management, environmental management, and emergency aid system. In addition, 14 parameters for 6 sub-indexes of the DEI were determined, and the corresponding calculation methods were made. A comparison with the new method in the case study revealed that the current traditional assessment underestimated the risk level and needed some adjustment. Moreover, with the new evaluation method, the chemical plant could identify and improve the vulnerable parts and avoid the domino effect. Keywords: Fishbone Analysis, Domino Effect Index, Environmental Risk.

1 Introduction With the rapid development of chemical industry, catastrophic accidents frequently occurred, during which the domino effect was a critical factor. The domino effect refers to the phenomenon that one risk source causing primary events may influence other sources, thereby leading to more serious consequences [1]. According to previous researches, 38.6% of accidents are likely to trigger domino events, and 47% of domino accidents evoked three subsequent events or more, with growing accident occurrences and casualties [2, 3]. Documents on risk assessment for chemical plants in China include the Guide|| 1 State Key Laboratory of Pollution Control and Resource Reuse, School of the Environment, Nanjing University, Nanjing, China [email protected], 2 State Key Laboratory of Pollution Control and Resource Reuse, School of the Environment, Nanjing University, Nanjing, China [email protected], 3 State Key Laboratory of Pollution Control and Resource Reuse, School of the Environment, Nanjing University, Nanjing, China [email protected] 10.1515/9783110516623-083 DOI 10.1515/9783110303568-083

838 | Chu-Chu Zeng, Yu Qian and Yong-Sheng Liu book of Risk Assessment for Environmental Emergency Accidents in Companies. The Guidebook does not consider the domino effect during the assessment. Simultaneously, chemical plants are subject to the supervision of both safety control and environmental protection departments, which splits the risk control system in chemical plants. Therefore, risk assessment in chemical plants requires an analysis tool (fishbone diagram) to identify the domino effect systematically, breaking the boundary between safety and environmental management. Based on the fishbone analysis, the domino effect index (DEI) for chemical plants was established to assess the probability of chain accidents.

2 Dei for Chemical Plants Based on the Fishbone Diagram The fishbone diagram was first introduced by Ishikawa in 1943, and then widely used in manufacturing quality control and management [4]. As a tool for comprehensively identifying the cause-and-effect relationship in a problem, this diagram resembles a fishbone, with the head representing the analyzed problem and the ribs explaining major causes [5]. The fishbone often comes from brainstorms of experts in relevant fields or through paper collection. The fishbone diagram for chemical plants was built after paper collection. The domino effect was considered in each sub-index in the view of cause-and-effect relationship. By applying the fishbone diagram in terms of safety, environmental protection, technology, and management, the causes of the domino effect in chemical plants are systematically summarized as: process and equipment, materials, staff, safety management, environmental management, and emergency aid system. A fishbone diagram for chemical plants is demonstrated in Fig. 1.

Domino Effecct Index for Chem mical Plants Bassed on Fishbone Analysis | 839 8

Fig. F 1: The fishbo one diagram for analyzing cause es of the dominoo effect in chemiical plants

DEI is buiilt based on th he fishbone diiagram. The ssub-indexes of DEI and rele evant parameters p fo or its sub-indeexes are: proccess and equip pment (p1), which w includes the dangerousnes d ss of the proccess (p11), the e advancemen nt of equipmeent (p12), and d the maintenance m ffor equipmen nt (p13); materials (p2), alth hough no parrameters were e set; staff s (p3), in tterms of theirr awareness of o safety and eenvironmenta al protection (p31) (p4), n safety and environmenta and a training in e al protection ((p32); safety management m including safeety control meeasures (p41), safety alarm m devices (p42), and safety y dist tances (p43); environmental manageme ent (p5), whicch includes th he dangeroussness of o the environ nmental proceess (p51), the e advancemen nt of environm mental equipm ment (p52), ( and th he maintenan nce for enviro onmental equ uipment (p533); emergency y aid system s (p6), in ncluding the completenesss of emergenccy plan (p61), the availabiliity of emergency e su upplies (p62), emergency training (p63) , and the distribution of emere gency g aid bran nches (p64).

2.1 2 Processs and Equiipment (p1)) The T dangerou usness of a prrocess is relatted to temperrature (T), prressure (P), eq quipment m unit capacity (V), and d reaction type e (R). Accordiing to existing g criteria [6, 7]], p11

840 | Chu-Chu Zeng, Yu Qian and Yong-Sheng Liu is calculated by Eq. 1. The advancement of equipment assesses the domino effect in terms of automation (A), safety measures (S), and type of equipment (E); p12 is calculated with Eq. 2 using the criteria in Table 1. The maintenance for equipment is calculated with Eq. 3, which considers maintenance frequency (C1) and service life of equipment (C2). p11 = (T + P + V + R) / 4

(1)

p12 = A + S +

(2)

p13 = C2 / C1 × 10

(3)

Table 1: scores set for the parameter p12 Parameters of p1

Factors for p12

Advancement Automation of equipment (A) (p12)

Safety measures (S)

Criteria

Scores

Completely manual

4

Semi-automatic

2

Completely automatic

1

Lightning and electrostatic protection devices

Yes: 0; No: 1

Flow, pressure and flame detection interlock

Yes: 0; No: 1

Temperature, pressure and liquid level monitoring devices

Yes: 0; No: 1

Good ground connection

Yes: 0; No: 1

Type of Universal or customized equipment (E) Domestic or imported

Customized: 0; Universal: 1 Imported: 0; Domestic: 1

2.2 Materials (p2) The risk of chemicals is reflected in toxicity, inflammability, and explosiveness. We assume that NT and NF&E are the number of relatively toxic or flammable and explosive substances, respectively. When the toxicity standard reaches Level III [6], the risk substance is regarded as a relatively toxic substance; if the process is one of

Domino Effect Index for Chemical Plants Based on Fishbone Analysis | 841

the first three types in the inflammability and explosiveness standard [6], the materials in this process are considered as flammable and explosive substances. The subindex p2 is calculated by Eq. 4. The penalty coefficient Q is determined by the amount of risk substances and corresponding thresholds in Eq. 5, where k is the number of types of risk substances. mi and mi0 are the quantity and the threshold of each risk substance, respectively (0 < i ≤ k). p2 = (NT / k + NF&E / k) / 2 × Q × 10 Q = 1 / k × ∑min {mi/mi0, 1}

(4) (5)

2.3 Staff (p3) Questionnaires on knowledge of the domino effect are used to investigate the awareness of staff in chemical plants, including technical and administrative personnel. The parameter p13 is calculated with Eq. 6, where Score is the average score of all the persons under investigation and Stotal is the full score of the questionnaire. N is set as the number of annual safety and environmental protection trainings for staff. Therefore, p32 is calculated with Eq. 7. p31 = (1 - Score / Stotal) × 10 p32 = 1 / N × 10

(6) (7)

2.4 Safety Management (p4) The criteria used for determining the situation of safety control measures are: (1) fire protection measures like fire dikes and blast walls in the tank area; (2) fire protection equipment to cope with leak of flammable and explosive substances; (3) terminal valves, emergency vent valves, and explosion-proof doors in the furnace area; (4) safety valves, rupture disks, flame arresters, and emergency shut-off valves in the pressure pipelines; (5) fireproof materials used in risk parts of pump stations and compressor rooms; (6) overhead safety valves and emergency vent valves in the tower area. The number of negative answers to the existence of measures above is added together as NO1. Meanwhile, the criteria used for deciding the situation of safety alarm devices are: (1) alarm devices for flammable and toxic gas release detection; (2) an adaptive control system to automatically monitor the situation of process, storage and transportation; (3) a fire monitoring and alarm system; (4) emergency radio and telephone systems; (5) flow detection devices, high-level alarm devices, and an explosion-proof detection and alarm system in the tank area. The

842 | Chu-Chu Zeng, Yu Qian and Yong-Sheng Liu number of negative answers to the existence of these measures is added together as NO2. Therefore, p41 and p42 is calculated with Eq. 8 and Eq. 9 respectively. p41 = NO1 / 6 × 10

(8)

p42 = NO2 / 5 × 10

(9)

The factor J is used to estimate the existence of large risk sources in the plant and its neighborhood, as well as the potential of domino effect caused by risk sources. The higher is the value of J, the more potential of domino effect does the plant have. For different risk sources and different target equipment, the effective distance Reff is decided by the TNT equivalent method [8] and thresholds of escalation effects [9]. Rreal is the real distance between the risk source and target equipment. The parameter p43 receives one point when J > 5. The highest score of p43 is 10. This parameter represents the situation of safety distances within the plant and its neighborhood. If p43 is higher, the situation of safety distances is poorer and the probability of the domino effect is larger. J = Reff / Rreal

(10)

2.5 Environmental Management (p5) The dangerousness of an environmental process is related to temperature (T′), pressure (P′) and equipment unit capacity (V′). On a basis of the similar criteria for p11, p51 is calculated with Eq. 11. The advancement of environmental equipment assesses the domino effect in terms of automation (A′), monitoring devices (S′), and type of equipment (E′). The calculation for p52 is set in Eq. 12. Table 1 also presents the criteria for p52. To replace safety measures with monitoring devices, we mainly considered waste water monitoring devices, gas monitoring devices, and temperature, pressure, and humidity monitoring devices. The number of negative answers is the score for S′. The maintenance for environmental equipment considers maintaining frequency (E1) and service life of equipment (E2) as calculated by Eq. 13. p51 = (T′ + P′ + V′) / 3 p52 = A′ + S′ + E′ p53 = E2 / E1 × 10

(11) (12) (13)

Domino Effect Index for Chemical Plants Based on Fishbone Analysis | 843

2.6 Emergency Aid System (p6) The parameters for p6 include the completeness of the emergency plan (p61), the availability of emergency supplies (p62), emergency training (p63), and the distribution of emergency aid branches (p64). The proportion of pages on the domino effect in the whole emergency plan is used to scale p6 in Eq. 14. The parameter p62 assesses the domino effect in the two dimensions considering whether all risk substances have corresponding supplies and whether all supplies are easily available, calculated by Eq. 15, where d is the distance between two risk sources in the plant and d′ is the distance between the risk source and emergency supplies. The parameter p63 is scaled in the following three aspects: the trained personnel (TP), content of trainings (TC), and the number of trainings (TN), calculated by Eq.16. The distances from emergency aid branches to the plant (Da) are converted to the time consumed when going by different vehicles. The more time is consumed, the slower is the emergency response, which means a higher risk. Therefore, p64 is calculated by Eq. 17, where vmax and vmin are the maximum and minimum limits of the vehicles’ speed, respectively. P61 = (1 - Pdomino / Ptotal) × 10

(14)

p62 = [(1 - k′ / k) + 1 / k × ∑min {d′ / d, 1}] / 2 × 10

(15)

p63 = TP + TC + 1 / TN × 4

(16)

p64 = [∑ (Da / vmax) / ∑ (Da / vmin)] × 10

(17)

2.7 Domino Effect Index (DEI) DEI represents the probability of the domino effect occurring in the chemical plant. The bigger is the DEI score, the higher risk it represents. Each sub-index falls in the range of 0 to 10 and is demonstrated in Eq. 18 (0 < j ≤ n, 0 < i ≤ 6). Finally, the calculation of DEI is the average of the sub-indexes in Eq. 19. When DEI  [0, 2), the plant has low risk. When DEI  [2, 5), the plant is at medium risk. When DEI  [5, 10], the plant is at high risk. pi = 1 / n × ∑pij

(18)

DEI = 1 / 6 × ∑pi

(19)

844 | Chu-Chu Zeng, Yu Qian and Yong-Sheng Liu

3 Case Study 3.1 Basic Information on the Case Company Fig. 2 is the layout of the case company (in the upper area) and its neighboring companies. The company has annual output of a 300 000 ton tar processing project. Coal tar, sodium hydroxide, and coke oven gas are used as main raw materials, whereas its products include naphtha, solvent oil, absorber oil, maltha, crude naphthalene, and anthracene oil. For production, the company has several processes, such as coal tar distillation, fraction washing, and crude naphthalene distillation. In environmental risk assessment report of this company, it didn’t identify large and dangerous risk sources which may cause chain accidents and with certainty causeand-effect analysis of domino effect was unlikely to be taken into account in the report. Looking through the emergency plan for the company in environmental accidents, domino effect and corresponding measures rarely appeared in the text.

Fig. 2: Layout of the case company and its neighbor companies.

3.2 Results with the Guidebook Assessment Method According the current Guidebook, the ratio of the quantity of risk substances and their thresholds belongs to Q2. The water downstream needs to meet the standards for surface water quality. Thus, the type of the parts vulnerable to environmental risk belongs to E1. Based on relevant data, the level of process and risk control in the plant belongs to M1. Therefore, the company risk level is medium. However, the

Domino Effect Index for Chemical Plants Based on Fishbone Analysis | 845

assessment process does not include the identification or prevention measures for the domino effect.

3.3 Results with the DEI Method Based on the above mentioned method, the results are listed in Table 2. The DEI of the case company is 5.09, which implies the high risk in the plant. According to the relationship among the sub-indexes (p6 > p4 > p3 > p5 > p1 > p2), the most possible problem to cause the domino effect comes from the emergency aid system, followed by safety management, staff, environmental management, process and equipment, and materials. Due to neglecting the domino effect, identification and preventive measures for chain accidents were not taken into account when building the emergency aid system. Compared with the previous result, the evaluation of the company risk level with the Guidebook should be adjusted from medium to high. Table 2: Dei and sub-indexes for the case company. Sub-indexes of DEI

Scores of sub-indexes

Score of DEI

Process and equipment (p1)

p1 = 4.52

DEI = 5.09

Materials (p2)

p2 = 3.02

Staff (p3)

p3 = 5.63

Safety management (p4)

p4 = 5.67

Environmental management (p5)

p5 = 5.24

Emergency aid system (p6)

p6 = 6.48

4 Summary Currently, the domino effect has not been considered in risk assessment for chemical plants when based on the Guidebook. In this essay, the DEI method based on fishbone analysis of the domino effect was proposed for the plants. Furthermore, the new assessment and corresponding calculations of 6 sub-indexes and the 14 parameters for these sub-indexes were obtained. By employing the DEI method for risk evaluation of the case company, the DEI score shows high risk in the plant, which differs from the results based on the current Guidebook to imply that the company has medium risk. The current assessment underestimates the risk level and needs some adjustment. By applying DEI and its sub-indexes, we can determine

846 | Chu-Chu Zeng, Yu Qian and Yong-Sheng Liu the risk level and find potential vulnerable parts and possible causes of domino accidents in chemical plants. Thus, the company can strengthen the vulnerable parts by technical and management approaches and can employ appropriate measures to prevent the occurrence of chain accidents and reduce the level of environmental risk. Acknowledgement: This research was financially supported by the National Natural Science Foundation of China (Program Number is 13001023 and Program Name is “Study on Environmental Risk Management Based on the Domino Effect”).

References [1] [2] [3]

[4]

[5] [6] [7] [8] [9]

L. Zhang, Y. Qian, Y. Cai, Regional environmental risk assessment under the scenarios of domino accidents, J. China Environ. Sci. 33 (2013) 569-575. S.P. Kourniotis, C.T. Kiranoudis, N.C. Markatos, Statistical analysis of domino chemical accidents, J. Hazard. Mater. 71 (2000) 239-252. B. Abdolhamidzadeh, T. Abbasi, D. Rashtichian, S.A. Abbasi, Domino effect in processindustry accidents - an inventory of past events and identification of some patterns, Journal of Loss Prevention in the Process Industries, 24 (2011) 575-593. D.N. Tran, L.A. Bero, Barriers and facilitators to the quality use of essential medicines for maternal health in low-resource countries: An Ishikawa framework, J. Glob. Health, 5 (2015) 93-101. K. Ishikawa, Introduction to quality control, third ed., JUSE, Tokyo, 1990. E.B. Hu, Practical techniques, methods and cases for environmental risk assessment, first ed., China Environmental Science, Beijing, 2009. C.S. Miao, J.P. Zhao, on the risk fuzzy assessment for pressure vessel (1) – intrinsic danger evaluation and risk level evaluation, Journal of Pressure Vessels 22 (2005) 1-4. F. Kadri, E. Chatelet, G.P. Chen, Method for quantitative assessment of the domino effect in industrial sites, Process Safety and Environmental Protection 91 (2013) 452-462. V. Cozzani, A. Tugnoli, E. Salzano, and Prevention of domino effect: From active and passive strategies to inherently safer design, J. Hazard. Mater. 139 (2007) 209-219.

Ji-Wei Wang1*, Li-Jun Xu2 and Xiao-Jing Hou3

Xinjiang Wind Power under "the Belt and Road Initiatives" Facing the Opportunities and Challenges Abstract: With the country to the advancement of "the Belt and Road Initiatives" strategy of Xinjiang is positioned as a national strategic energy base, the development of renewable energy is an important part in the development of energy industry in Xinjiang and occupy the important status of wind power, to the Xinjiang economy and play an important role in promoting the development of clean energy. This paper introduces the development status quo of wind power industry in Xinjiang, analyzed under the background of "the Belt and Road Initiatives", the development of wind power industry is facing opportunities and challenges in Xinjiang, and in view of the current challenges, and the solution is given. Keywords: the Belt and Road Initiatives, Renewable energy sources, Xinjiang wind power.

1 Overview Wind power as the most potential market in Xinjiang and the competitiveness of renewable energy, with resources development condition is good, easy to realize scale development and the construction of large wind farms become the main way for the development and utilization of wind power in Xinjiang. In the mid-1980s, Xinjiang wind power gradually digestion and absorption has completed the home has many advantages of large wind farms, by churning out generations grasp good wind power technology professional talents, and built with high level of large fan equipment manufacturing base. By the end of 2015, Xinjiang area of wind power output up to 15.2 billion KWH, accounts for about 8.16% of the total wind power across the country, ranking second in the country [1]. “The Twelfth Five-Year Guideline” period, Xinjiang breakthrough 13 million KW wind power production scale, and the third [2]. To at present, in the "area" strategy, under the propulsion of Xinjiang is positioned as a national strategic energy base, will bring huge opportunities for the development of wind power industry in Xinjiang, at the same time, the wind

|| 1 Xinjiang College of Engineering, Urumqi. [email protected] 2 Xinjiang College of Engineering, Urumqi 3 Xinjiang College of Engineering, Urumqi 10.1515/9783110516623-084 DOI 10.1515/9783110303568-084

848 | Ji-Wei Wang, Li-Jun Xu and Xiao-Jing Hou power industry in Xinjiang is in a multitude of challenges.

2 The Present Status of Wind Power Industry in Xinjiang Our country can develop wind energy reserves, land area of 3.2 billion KW, the world's first, Xinjiang region onshore wind resource accounts for about forty percent of the country's total [3]. Survey shows that although Xinjiang to develop wind power ranking second in the country, but its quality ideal wind resources, wind frequency distribution in accordance with the requirements of the development, devastating hurricane appear probability is extremely low, and even higher than other area twice the size of the wind power density. "Three mountains and two basins" of Xinjiang landscape layout, has the high scale development of the value of "nine gale area" in the mountain and hills between strip, a total of up to 15 square kilometers, the wind area of wind energy resources assessment are shown in table 1. Xinjiang meteorological department synthetically evaluation "nine gale area" of the wind power total installed capacity of 80 million kilowatts, available wind break through 24 billion KWH, and the installed capacity will reach five important conclusions of the three gorges hydropower station. Table 1: Nine gale areas in xinjiang wind energy resource estimates. The wind zone

area(km2)

Effective power density (kwh/m2)

Annual average wind speed (m/s)

The available time (h/a)

Can be installed capacity(MW)

DaBanChengwind valley area

1500

350-500

5.0-6.2

5500-6500

4200

Turpan westwind 1000 area

200-350

4.0-5.0

4500-5500

2000

Hundred Kilome- 3000 tres Gale Area

200-350

4.5-5.5

4500-6000

7400

Hami south gobi wind area

33200

150-250

4.5-5.5

5500-6500

13500

Hami north gobi wind area

16800

300-400

5.0-6.2

5500-6000

16700

ZhunGeEr basin in the west wind area

14000

100-250

4.0-5.0

4500-5500

20000

Xinjiang Wind Power Opportunities and Challenges | 849

The wind zone

area(km2)

Effective power density (kwh/m2)

Annual average wind speed (m/s)

The available time (h/a)

Can be installed capacity(MW)

The irtysh river valley wind area

12000

150-250

4.0-5.5

5000-6700

5000

Ala shan kou fetch

3000

350-450

6.0

5500-6000

8500

Lop nur area wind

5000

100-250

5.0

4500-6000

47000

Summation

124300

Countries since the period of " The Eleventh Five-Year Guideline ", "Xinjiang electricity delivery" faster overall project in Xinjiang, the realization of 750 KV in 2010 in Xinjiang and the northwest power grid connected with, the Xinjiang power grid formally incorporated into the national grid. In the central work in Xinjiang in recent years, such as "the Belt and Road Initiatives" strategy policy, under the drive of the development of wind power industry in Xinjiang plays a great role in promoting. As a large-scale enterprises to continuously with the rapid development of domestic enterprises, by 2015, Xinjiang now wind power grid generation total installed capacity of 2 million kilowatts, wind power equipment is in the leading level in the whole country, in 2015 China's provinces (autonomous regions and municipalities) the cumulative wind power installed capacity is shown in fig1.

Fig. 1: In 2015 China's provinces (autonomous regions and municipalities) the cumulative wind power installed capacity.

850 | Ji-Wei Wang, Li-Jun Xu and Xiao-Jing Hou

3 The Problems Existing in the Wind Power Industry in Xinjiang In recent years, wind power equipment market competition day by day the heat, to achieve the sustainable development of the industry must be effectively adjusting the industrial structure. In the backdrop of the industry to adjust, the enterprise needs to properly handle the relationship between the project R&D and gross margin. For wind power reserves in Xinjiang, the development of wind power industry will take effective solutions in a timely manner. However, when the wind power industry in Xinjiang intensify development of at the same time, have the wind "home electricity, electricity rationing" serious adverse situation. Table 2: Part of the province in 2015 abandoned wind statistics. Province (autonomous region area, city)

Abandon the wind power (million kilowatt hour)

Abandon the wind rate

Gansu

82

39%

Jilin

27

32%

Heilongjiang

19

21%

Xinjiangbingtuan

1

19%

Inner Mongolia

91

18%

Ningxia

13

13%

Hebei

19

10%

Xinjiang

70

32%

At present the problems existing in the wind power industry in Xinjiang, mainly have a big difficult, less dosage, transmission and so on. Due to the Xinjiang region economic development compared with the developed areas is still there is a big gap, resulting in Xinjiang and other regions, although new energy accumulation, given power ability is very weak, but the region, according to its Chinese Xinjiang power company in 2014 in Xinjiang that wind power, discard of up to 2.1 billion KWH, 2015 is expected to achieve four times as many as 2014, Xinjiang region abandon wind power above 2014 Xinjiang abandoned the wind power, discard the total of 5 billion KWH, abandon the wind rate of more than 30%. Scientific and reasonable planning. Decades of accelerate the development of wind power industry in Xinjiang, has achieved a large scale, but compared with the current thermal power, water and electricity, its overall cost is too high, still affect the healthy development of the entire wind power industry chain. Wind power equipment manufacturing industry in the process of rapid development, due to various reasons the blind expansion, excess capacity in bad situation.

Xinjiang Wind Power Opportunities and Challenges | 851

4 Xinjiang Wind Power Industry is Faced with Opportunities 4.1 Policy Support In order to further promote the long-term healthy development of wind power industry in China, since 2005; from the national level have issued a series of policy support for wind power development. After the country put forward the strategy of " the Belt and Road Initiatives ", in order to further reflect the status of strategic energy base in Xinjiang, autonomous regions have issued relevant policy to support the development of new energy, Among them "Much starker choices-and graver consequences-in" energy development planning in Xinjiang, The silk road economic belt energy development planning, Electrochemical work in Xinjiang. The state-owned assets supervision and administration commission of the Xinjiang Uygur autonomous region in 2014-2020 development (draft), points out that the strong support of wind power and new energy sources such as Xinjiang after foreign transport. The Xinjiang Zhun Dong new energy base construction plan has been the national development and reform commission is a formal approval, planning, points out that Xinjiang Zhun Dong new energy base of wind power scheme out a total construction scale up to 5.2 GW wind up to 5.2 GW, photoelectric, among them, the whole Xinjiang 4.2 GW wind power construction scale; The whole Xinjiang PV construction scale 2.5 GW. Plan to be completed by the end of 2017 the Zhun Dong east China 1.1 million KV high-voltage direct current transmission channel, implementation of clean energy and thermal power package delivery abroad.

4.2 Cultivation of Talents In 2020, according to the our country electric power engineering science and technology talent demand forecasting and supply and demand balance analysis forecast shows that by the end of "much starker choices-and graver consequences-in planning professionals need to all kinds of wind power in China up to 185000 people[4]. At present, although many parts of the wind power industry development in our country has begun to take shape, but most of the core of wind power technology are introduced from abroad will still need to improve our capacity for independent innovation, especially in wind power professional and technical personnel, business personnel and after-sales management personnel[5]. At present, Xinjiang university, Shihezi University in Xinjiang, Xinjiang agricultural university, Xinjiang college of engineering, combined with Xinjiang's actual open electrical or related professional, especially in the country in recent years to aid the development of colleges and

852 | Ji-Wei Wang, Li-Jun Xu and Xiao-Jing Hou universities in Xinjiang, Xinjiang university, for example, Tsinghua University, Xi 'an Jiao tong University and other colleges and universities counterpart support Xinjiang university college of electrical engineering, achieved gratifying results, a steady stream of cultivating professional talents for Xinjiang electric power industry, provide a strong guarantee. State grid electric power company in Xinjiang also further strengthen electric power training, by the end of 2015, completed nearly 2000 training programs, training nearly 78000 person-time, Full training rate is about 91%, proportion of skilled talents around 67% [6].

4.3 Power Grid Construction In June 2013 and January 2014, has completed and put into use the northwest Xinjiang-the second line of 750 KV main networking engineering, and the first extrahigh voltage (EHV) HaMi in Xinjiang south-Zhengzhou-800 KV HVDC project, further implement the Xinjiang energy resource advantage to economic advantage of dream, direct drive investment 300 billion Yuan RMB, for GDP growth play an important role in Xinjiang. Xinjiang power grid "much starker choices-and graver consequences-in pointed out that" to "much starker choices-and graver consequences-in planning the end of the year," in terms of "Xinjiang electricity delivery", plan implementation in Xinjiang domestic Zhun Dong to Chengdu, Zhun Dong to east China twice + 1100 KV and Hami north to Chongqing +800000 volts high-voltage direct current transmission engineering;Ili to abroad (Pakistan) + 660 KV HVDC project, Xinjiang Ruoqiang to Ginghai HuaTuGou of up to 750 KV power transmission and transformation project, as shown in fig2.

Fig. 2: Extra-high voltage (EHV) new channels.

Xinjiang Wind Power Opportunities and Challenges | 853

4.4 Countermeasures and Suggestions In order to further promote the healthy development of the new energy industry, national "much starker choices-and graver consequences-in planning is pointed out the direction of the development of new energy. Therefore, we need to crack the difficulties encountered in the process of new energy development, need to strengthen the top planning, activate the national new energy application of each link to form a chess game. Xinjiang wind power industry based on the actual situation and problems, mainly from the following aspects: One hand is the power given ability is limited; the other is the power transmission and transformation project and construction of power transmission channel. Solve the problem of "abandon the wind power brownouts", need to walk "two legs" in Xinjiang, the first thing to gradually reduce the proportion of coal; Second, step up "outside Xinjiang electricity to send" engineering construction; The third to improve the ability of Xinjiang local power given, it is suggested that in the whole Xinjiang pilot and promote "abandoned electric heating, and intensify the development of new energy vehicles. For example, the two regions in Xinjiang by pilot wind heating [7], to a certain extent, improve the ability of local electric power given; Four to build extra-high voltage (EHV) power transmission project, according to the construction of the Silk Road economic belt as an opportunity to explore the grid connection of central Asia, transmitted to the central Asian countries. Seize all the way " the Belt and Road Initiatives " under the strategic energy base important opportunities of Xinjiang, through continuously reduce the proportion of coal, "Xinjiang electricity delivery" effective statistics, such as the timely and effective to get rid of the dilemma facing the wind power industry development in Xinjiang. Acknowledgement: This work is supported by International Technological Cooperation Fund Project of Xinjiang588 China (20156007) and Doctoral Fund of Xinjiang Institute of Engineer-ring (2015BQJ021812).

References [1] [2] [3] [4]

[5] [6] [7]

Information on http: //www.nea.gov.cn Information on http://www.Xinjiang.gov.cn Information on http://newenergy. in-en.com Zhiguo Shui,Zhenfang Xun.In 2020,our country electric power engineering science and technology talent demand forecasting and supply need to balance analysis [J]. China power education, 2008, (2):21. Yunchao Li. In mechanical and electrical specialty training plan increase in wind power module to broaden employment channel [J]. Science Tribune, 2012, (5): 68-69. Information on http://xjny.ts.cn Information on http://www.xj.xinhuanet.com

Wei-Jun Pan1, Zi-Feng Zhou2, Qing-Hai Zuo3, Yue-Xiao Pan4, Xing-Yu Zhuo5 and Jing-Wei Tan6

Analysis of the Fuel Efficiency of Airport EndAround Taxiway

Abstract: In civil aviation, environmental influence is an important factor to measure the development of this sector. And reducing fuel consumption is one of the most direct way to become more environmental-friendly. On the other side, with the demand booms sharply, airports build multi-runways to increase the capacity, and fuel consumption also increases at the same time. After analyzing many studies before, we studied the effect of EAT (End-around taxiway) usage to the environment and how to make the EAT choice. The conclusion is that with the increase of runway usage frequency, the advantage of EAT usage is increasing, and this advantage will contain significant more fuel saved and less gas given out rather than normal pattern. In addition, a random-repeating simulation has been made to increase the reliability of the conclusion. This study may have some reference value to airport running and environment protecting in civil aviation. Keywords: Civil Aviation, End-around Taxiway, Fuel Efficiency, Environmental Influence.

1 Introduction The Fig.1 shows the greenhouse gas emission by economic sector in 2014 for U.S. And during a period of time (1990 - 2014), the emission by economic sector can be shown as Fig.2. As we can see from the figure, the transportation sector covers about 26% of the

|| 1 School of Air Traffic Control, Civil Aviation Flight University of China, Guanghan, China, Email: [email protected] 2 School of Air Traffic Control, Civil Aviation Flight University of China, Guanghan, China, Email: [email protected] 3 School of Air Traffic Control, Civil Aviation Flight University of China, Guanghan, China, Email: [email protected] 4 School of Air Traffic Control, Civil Aviation Flight University of China, Guanghan, China, Email: [email protected] 5 School of Air Traffic Control, Civil Aviation Flight University of China, Guanghan, China, Email: [email protected] 6 School of Air Traffic Control, Civil Aviation Flight University of China, Guanghan, China, Email: [email protected] 10.1515/9783110516623-085 DOI 10.1515/9783110303568-085

856 | Wei-Jun Pan, Zi-Feng Zhou and Jing-Wei Tan total emission. Although the U.S.A. is a developed country with high technology, the emission of transportation is still heavy. The emission reduction of technology development is generally “balanced” by the increase of flow. In China, as a developing country, perhaps the situation would not be so good, so the need to reduce transportation emission is also of great necessity. And civil aviation, as a part of transportation, has an urgent demand to cut the emission, indeed.

Fig. 1: Greenhouse gas emission by economic sector in 2014 for U.S. [1]

Analysis of the Fuel Efficiency of Airport End-Around Taxiway | 857

Fig. 2: Greenhouse gas emission by economic sector for U.S. during 1990 and 2014 [1]

As the development of the civil aviation, more and more airports are functioning at or near the maximum capacity to ensure their best profit and meet the demand of the air traffic. With the amount of flights increasing sharply, the consumed fuel, which results in the emission of carbon dioxide (about 71%), water vapor (about 28%), Nitrogen oxides (NOx, about 1%, but it is the most important emission) [2] and other environment unfriendly kinds of gas, also increased as predicted [3], and the situation is predicted to be worse in the future [4]. Although the fuel consuming and emission might have a significant cut with the improvement of the engine, the amount will be still quite heavy, however. While aviation brings considerable economic profits, the growth also increased environmental pressures, and consequently resulted in a growing need to improve the environmental performance of the industry. As an important part of a flight, low-altitude operation, which is mainly on the ground, has significant contribution to emission, and operation in a relativelyhigher altitude give out less, taking HC as an example [5]. This can be easily concluded Fig.3.

858 | Wei-Jun Pan, Zi-Feng Zhou and Jing-Wei Tan

Fig. 3: Distribution of aviation emissions by altitude in the studied period [6] [7]

2 Introduction of the End-Around Taxiway Taxiway is the road for aircraft to taxi, linking runways, hangars and the terminal of an airport. With the construction of multi-runways, which provides more capacity, aircrafts will use the runway nearer to the terminal to depart, and the further runway to land [8]. For higher capacity and less conflicts, taxiways bypassing runways, whose availability does not need air traffic controllers’ special permission, are constructed, and these special taxiways are called as EATs [9]. As we can analyze from the definition of EATs, The taxi distance would be longer, which means longer taxi time and more fuel consumed, resulting in the low usage frequency of EAT. However, they can reduce the runway-crossing risks and necessary communication between pilots and controllers, resulting in higher capacity and efficiency.

Analysis of the Fuel Efficiency of Airport End-Around Taxiway | 859

3 The Influence of Flow to End-Around Taxiway Usage and the Relationship between End-Around Taxiway Usage and Fuel Consumption From many studies before and the analysis of real situations, we can always notice that when the amount of the aircrafts which uses taxiways and runways is larger, the advantage of using EATs will be more obvious. Because of the longer waiting time due to the higher field-usage frequency, the time and economy cost will be higher. And in comparison with EATs, which almost maintains the same cost in all different-flow situations, the consequence that EAT usage is more convenient and economy-efficient can be concluded. In contract, using EAT will takes much more unnecessary cost when the flow is low. So to get some convincible conclusions, we have carried out repeat random simulations for many times. We use the number of aircrafts in a constant period of time as x, the independent variable, and the EAT usage ratio as y, the dependent variable. And we take a double-runway airport, one side of the Baiyun Airport, as the environment, when the departing and landing number, in other words, the usage number of two runways is equal; we get the result figure as figure 3-1 below. As the consequence we can get from the simulation result in the figure below, when flow increases, or more accurately, the usage frequency of taxiways and runways increases, the frequency of EAT usage will increase relatively slow first, but dramatically later. Usually, because of the consideration of taxi time, pilots and controllers will choose a time-less way to use. But when we analyze the relationship between taxi time and taxi fuel consumption, we can find some similar characteristics, just as Fig.4 shows:

860 | Wei-Jun Pan, Zi-Feng Zhou and Jing-Wei Tan

Fig. 4: The relationship between the aircraft amount and EAT usage ratio

In the figure above, the red line uses fuel consumption as the standard, while the blue line use taxi time as the standard to choose whether to use EATs. So we can notice that although pilots and controllers mainly consider taxi time, the reduction of fuel consumption will also be realized to some degree. On the other hand, we will find that it does not have a same result when we use taxi time as the standard, in comparison to the usage of fuel consumption as the standard. Because of the existence of the starting-up fuel consumption and no flameout state, when an aircraft choose to wait to cross the runways, there must be extra fuel consumption exists, and this create the main parts of differences. It makes sense that when an aircraft turns to another direction, there will be some extra fuel consumption being produced. But considering that the environment is various in different airports and the complexity, we did not take turning into consideration in simulation. So we can conclude that when the flow of an airport reach a certain point like the figure below shows (the point is determined by the condition of the airport), using EATs will reduce a lot of fuel consumption, which can release much environment pressure. In the figure below, the red line stands for the consumption when all aircrafts choose normal taxiway, and the blue line stands for the consumption when all aircrafts choose EATs. Because choosing EATs is not influenced by other factors considered, so it is a horizontal line as is shown in Fig.5. Although the y label in Fig.5 indicates fuel consumption, while the result is similar when the y label is replaced by time. And because of the differences between different kinds of aircrafts, the figure just reflects the relationship between consumption and flow.

Analysis of the Fuel Efficiency of Airport End-Around Taxiway | 861

Fig. 5: The consumption when all-normal taxiing and all-EATs taxiing

4 Relationship between End-Around Taxiway Usage and Environmental Influence In the last chapter, we concluded that compare to normal taxiing, EAT usage will be of more worth saving fuel when the flow reach a certain point. However, when we considering saving fuel, we ignore that saving fuel is even not proportional to emission reduction, not to mention environmental influence. What’s more, when we calculating the saved fuel consumption and time consumption, we just simply considering the taxi distance and taxi time, while ignoring some other conditions that also have influence to the volume of the fuel saved. x When using the normal taxiing, waiting will directly lead to restarting-up or a no flameout state. However, when an aircraft is starting up or keeping a no flameout state, what’s happening is not simply just more fuel consumption. The fuel would burn in low efficiency during starting-up, releasing more gas. And in the gas produced, there is perhaps much methane existing, which is known not only as fuel, but also as a kind of greenhouse gas, causing much more serious influence than carbon dioxide. x When some certain situation occurs, in a light-foggy day, for example, or even in some normal situations, sometimes using EATs can make the pilots feel less tense, which can reduce the unstable operation of pilots. And as a result of more stable operation, less acceleration and deceleration may reduce little fuel consumption, and the rate of mistake can be decreased.

862 | Wei-Jun Pan, Zi-Feng Zhou and Jing-Wei Tan And some special situation like water, snow and icing surface may make waiting and restarting condition in normal taxi even worse, resulting in much more fuel consumption and environmental influence. So to reduce the restarting up and no flameout state, which may influence the environment much more than normal, the EATs would be used more. And in many situations, EAT usage has not only more advantageous effects in reducing fuel consumption. x

5 Conclusion The decision making of using EATs is related to a complicated situation. It can be influenced by many factors, including relationship of runways, the air traffic flow, and many ignored factor in this simulation like the load and the weight of the aircrafts, the different engines of the aircrafts and many other factors. Although these factors may change the result when other conditions are fixed, they do not influence the integral conclusion. When we consider about efficiency, economy or environment, we may get different result in a same situation. But when the air traffic flow reaches a certain point, the difference will disappear and EATs will be chosen to use. Therefore, although sometimes these targets may not be reached at the same time, we can still conclude that when flow reach a certain point determined by a certain airport condition, EAT usage can save much fuel and time, while causing less environmental influence. In other words, with a decision making, EAT usage has a great advantage in economy and environment influence of civil aviation. Acknowledgement: This work is from the project that supported by the Natural Science Foundation of China (Grant No.71573184). Pan W., Zhou Z., Zuo Q. and Pan Y. thanks for all members of our group and other relevant organizations and personnel.

References [1] [2] [3] [4] [5]

U.S. Greenhouse Gas Inventory Report: 1990-2014, https://www.epa.gov/ghgemissions/usgreenhouse-gas-inventory-report-1990-2014 Penner, J.E., Lister, D., Griggs, D., Docken, D., MacFarland, M., 1999. “Aviation and the Global Atmosphere,” Cambridge University Press, New York. P28 Vedantham, A., & Oppenheimer, M. (1998). “Long-term scenarios for aviation: Demand and emissions of CO2 and NOx,” Energy Policy, Volume 26, Issue 8, July 1998, pages 625-641. Bethan Owen, * David S. Lee, and Ling Lim, “Flying into the Future: Aviation Emissions Scenarios to 2050,” Environmental Science & Technology Jasper Faber, et al., “Lower NOx at Higher Altitudes Policies to Reduce the Climate Impact of Aviation NOx Emission,” Delft, CE Delft, October 2008

Analysis of the Fuel Efficiency of Airport End-Around Taxiway | 863 [6]

[7]

[8] [9]

Viet Van Pham*, Jiangjun Tang, Sameer Alam, Chris Lokan, Hussein A. Abbass, “Aviation emission inventory development and analysis,” Environmental Modelling & Software 25 (2010) 1738-1753 Alan Mortlock and Richard Van Alstyne, “Military, Charter, Unreported Domestic Traffic and General Aviation 1976, 1984, 1992, and 2015 Emission Scenarios,” National Aeronautics and Space Administration, March 1998 James W. Patterson, Jr., “End-Around Taxiway Screen Evaluation,” the National Technical Information Services (NTIS), Springfield, Virginia 22161, 2007.03, DOT/FAA/AR-TN06/59 Advisory Circular, Federal Aviation Administration, 2012.01.05, AC 150/5300-13A

Fan Wu1 and Zong-Hua Wu2

Spatiotemporal Analysis on Pesticide Using in different Agriculture Lands over China Abstract: Agriculture land-use in China changed significantly in past 10 years. Spatiotemporal analysis on effects of the changes on pesticide using was done based on the data in China Statistic Yearbooks from 2004 to 2014. The results show that the increase in the sowing area of non-grain crops was related to the decrease in total amounts of used pesticide during the 10 years. This is different from the results in many studies that plantation of non-grain crops needed more pesticide. But the temporal analysis indicated that the regions with higher ratio of non-grain crop sowing area used more pesticide. The analyses illustrated that the forest coverage rate was significant positive correlation with average amounts of used pesticide consume. Amounts of pesticide consume increased with enlarging of drainage area, more pesticide was used in regions with larger wet-land area. The results in this study are valuable for agricultural sustainable development. Keywords: Spatiotemporal analysis, Pesticide, Agriculture Land-use, multiple regression analysis.

1 Introduction Pesticide is considered as a chemical product to inhibit growth of pest, and reduce agriculture loss. Pesticide is used widely in farming, but it is found recently that pesticide was overused for agriculture, forestry and other fields in China to protect crops and saplings, and prevent disasters caused by insert pest. Even pesticide has played an important role for the modern agriculture, more and more problems to its using are carried out recently for its’ harm to Ecosystem and people’s health. Many literatures have evaluated the pesticide application from effects of social character of farmers [1-3] or relationships between economy growths [4], but few of them analyzed effects of changes of agriculture land-use on pesticide using. The agriculture land-use has been altered largely in China in recent years. From 1990 to 2010, cultivated land area was reducing in the south of China, but it was increasing in the north of China [5]. The reclamation in the north of China was fo-

|| 1 College of Minnan Science and Technology, Fujian Normal University, Nan’an City, Fujian Province, China, E-mail: [email protected] 2 College of Materials Science and Engineering , Fujian Normal University , Fuzhou City, Fujian Province, China, E-mail: [email protected] 10.1515/9783110516623-086 DOI 10.1515/9783110303568-086

866 | Fan Wu and Zong-Hua Wu cusing on the North-eastern part in the past, but the focus point reclamation was shifting to the oasis agriculture area in North-western. In addition, the forest area was increasing after the reduction, and the grassland was continued to reduce in this period. Moreover, the plantation structure was changing from the single structure that focused on growing grains to the diversified structures that plant different kinds of crops [6]. The pesticide using could be affected by the changes in agriculture land-use. The insect pests are easier to growth up in the area of large sowing area, high forest cover rate [7]. In addition, because non-grain crops need more pesticide to growth [8], amounts of pesticide using would increase with rise in ratio of non-grain crops sowing area in the plantation structure [9]. For agriculture sustainable development, it needs to understand effects of change of agriculture land-use on the pesticide using. Moreover, China is a big country with many different kinds of climate and landforms. This paper would analyze effects of changes in agriculture land-use on pesticide using.

2 Methodology 2.1 Multiple Linear Regression Analysis The multiple linear regression analysis is a method to examine the relationship between one depend variable and serval independent variables. It could be described as follow model.

Y

E o  E1 X 1  E 2 X 2  E 3 X 3  H

(1)

Here, Y is dependent variable. Xk is independent variable. βk is the parameter. ߝ is error. The multiple linear regression analysis was used widely in variable field. The paper would apply the method of spatiotemporal analysis that based on the multiple regression models to evaluate effects of changes in agriculture lands on pesticide using based on the data from the China Statistic Yearbook [10]. The analysis involved two parts. One is the multiple linear analysis based on spatial data, the other is the analysis based on temporal data.

Spatiotemporal Analysis Agriculture Lands over China |867

2.2 Spatial Analysis Model (2) was used to analyze the impact of plantation structure changes, afforestation, and alter of drainage area on the pesticide using from 2004 to 2014. The data are from the China Statistic Yearbook. The model (2) is shown as follow. ln PEC i

D  D 1 ln PLS i  D 2 ln Forest i  D 3 ln DRAi  P

(2)

In the model (2), PECi means the total amount of pesticide using in China in ith year. PLSi means the ratio of non-grain crops sowing area to the grain crops sowing area in ith year. Foresti means the afforestation area in ith year. DRAi means the drainage area in ith year. a means constants. a1~a3 are parameters. μ is an error.

2.3 Temporal Analysis Model (3) based on temporal data is used to evaluate effects of plantation structure, forest coverage rate, wetland coverage rate, and grassland coverage rate to average amounts of pesticide using in 31 provinces in China, which were based on the data of the China Statistic Yearbook. The data in year 2012 as showed in Table 1 is selected to evaluate effects of landforms to the pesticide use in a certain technology level. Less drought and float disaster in year 2012 than other years were observed. Model (3) is shown as follow. In the model (3), PECi* means the average amount of pesticide using in i province. PLSi* means the ratio of non-grain crops sowing area to the grain crops sowing area in i province. Foresti* means the forest cover rate in i province. Wetlandi* means the rate of wetland on the total land area in i province. Grasslandi* means the ratio of grassland area on the total land area in i province. β means the constant. β1 ~ β4 are the parameters. μ is the error. Table 1: Disaster area for each year in China 1998

2000

2007

2012

2013

2014

Drought

14236

40541

20738

9340

14100

12272

Float

22292

12734

29386

7730

8757

4718

Note: unit is 1000ha Source: The China Statistic Yearbook

ln PEC i

E  E 1 ln PLS i  E 2 ln Forest i  E 3 ln Wetland

i

 E 4 ln Grassland

i

P

(3)

868 | Fan Wu and Zong-Hua Wu

3 Results and Discussion 3.1 Spatial Analysis on Pesticide Using in Different Agriculture Lands Table 2: The spatial analysis on the impact of land-use change Beta

S.C1

S.T.E.

T-value

Sig.

a

-10.556***

2.742

-3.850

0.006

lnPLSi

-1.442***

-0.551***

0.258

5.588

0.001

lnForesti

0.166***

0.482***

0.038

4.409

0.003

lnDRAi

2.696***

0.449***

0.658

4.096

0.005

Adjusted R2

0.924

F-ratio

41.429***

Note: 1. S.C means standard coefficient 2. The data was from the result of analysis with model (1) 3. ***means significant at P stem > leaf, which consistent with the results of related studies [10]. The result indicated the organochlorine pesticides in soils contribute greatly to the content of organochlorine pesticides in plants [11]. The roots absorbed the organochlorine pesticides in the soil and then transported to the leaves through the stems, but the growth dilution would have a significant impact on the accumulation of organochlorine pesticides [9]. So the organochlorine pesticides concentration in leaves and stems is lower than in roots.

OCPs˄ng/g˅

60

root stem leaf

50 40 30 20 10 0 grass

taro

rape

pteris

Fig. 4: Contents of OCPs in different tissues.

4 Conclusions Fifteen kinds of organochlorine pesticides were detected in four kinds of plants (grass, taro, rape and pteris) in Qingshitan reservoir area, but the residue level did not exceed the upper limit stipulated by national food safety standard. There were differences in organochlorine pesticide residues in different plants collected from Qingshitan reservoir area. The highest levels of OCPs were detected in rape at an average concentration of 40.04 ng·g-1, and the lowest levels were detected in pteris at an average concentration of 24.85 ng·g-1. The organochlorine pesticide residues in different tissues of plant showed as follows: root > stem > leaf.

904 | Xin Fu, Hong-Hu Zeng, Yan-Peng Liang and Li-Tang Qin Acknowledgement: The authors thank the financial supports from the National Natural Science Foundation of the People’s Republic of China [grant numbers 51268008 and 51578171]; Project of High Level Innovation Team and Outstanding Scholar in Guangxi Colleges and Universities [grant number 002401013001]; the Guangxi Talent Highland for Hazardous Waste Disposal Industrialization; Guangxi Scientific Experiment Center of Mining, Metallurgy and Environment [KH2012ZD004].

References [1]

[2]

[3]

[4]

[5]

[6]

[7]

[8]

[9]

[10]

[11]

Yang Xiaomei, Ta Na, Xu Yongming and Bao Jing, “Status Quo of Monitoring Organochlorine Pesticides in China,” Environmental Protection of Chemical Industry, vol. 33, Aug. 2013, pp. 123–128, doi:10.3969/j.issn.1006-1878.2013.02.008. Die Qingqi, Nie Zhiqiang, Huang Qifei and Zhu Xiaohua, “Organochlorine Pesticides (OCPs) in Soils of Pearl River Delta, China,” Journal of Agro-Environment Science, vol. 33, Feb. 2014, pp. 298–304, doi:10.11654/jaes.2014.02.014. Zeng Honghu, Qin Ruqiong, Mo Lingyun and Qin Litang, “Research on tocixity of organochlorine pesticides to human health,” Journal of Guilin University of Technology, vol. 34, Aug. 2014, pp. 549–553, doi:10.3969/j.issn.1674-9057.2014.03.024. Shen Ping, “STOCKHOLM CONVENTION and Persistent Organic Pollutants (POPs),” CHINESE JOURNAL OF CHEMICAL EDUCATION, vol. 26, Aug. 2005, pp. 6–9, doi:10.3969/j.issn.10033807.2005.06.003. Hu Chunhua, Zhou Wenbin, Xiao Huayuan, Wang Maolan and Chen Wenfang, “Distribution Features and Health Risk Assessment of the Organochlorine Pesticides in Vegetables around the District of Poyang Lake,” JOURNAL OF CHANGJIANG VEGETABLES, Nov. 2009, pp. 68–72, doi:10.3865/j.issn.1001-3547.2010.16.023. Wu Haibing, Zeng Honghu, Liang Yanpeng and Mo Lingyun, “Determination of Organochlorine Pesticides in Water Using Integrated Solid Phase Extraction Coupled with GC-ECD,” ndustrial Safety and Environmental Protection, vol. 40, Dec. 2014, pp. 4–7, doi:10.3969/j.issn.1001-425X.2014.12.002. Wang Jianxin, Feng Nuan and Gao Ruqin, “Survey on the pyrethrin pesticide residues in commercial vegetables,Qingdao city,2010-2011,” Prev Med Trib, vol. 22, Jul. 2016, pp. 494–495, doi:10.16406/j.pmt.issn.1672-9153.2016.07.006. Zhao Wen, Qin Zhiwei, Wu Peng and Zhou Xiuyan, “Comparative Analysis of Epicarp Tissue Anatomical in Low Pesticide Residue Cucumber Strain,” China Vegetables, May. 2013, pp. 32– 38, doi:10.3969/j.issn.1000-6346.2013.20.005. Zhou Xiaoyan, Cui Zhaojie, “Residues and Distributions of HCH and DDT in Orchard Soil and Apple Trees,” Environmental Science & Technology, vol. 32, May. 2009, pp. 62–65, doi:10.3969/j.issn.1003-6504.2009.05.015. YUNUSJAN Turahun, “Research on Transference and Accumulation of Pollutants in Irrigated Soil-plant System,” Journal of Anhui Agricultural Sciences, vol. 40, Oct. 2012, pp. 17270-17272, doi:10.3969/j.issn.0517-6611.2012.35.103. Hu Chunhua, Chen Lulu, Li Yanhong, Wang Maolin, Zhou Xiaolan and Wu Xuan, “Distribution and health risk assessment of organ chlorine pesticides in rice and soil in the area around Poyang Lake,” Environmental Chemistry, vol. 35, Feb. 2016, pp. 355–363, doi:10.7524/j.issn.0254-6108.2016.02.2015042803.

Yang Deng1, Chi-Shan Wu2, Yan-Peng Liang3 and Hong-Hu Zeng4

Application and Research Progress of Toxicity Test of Daphnia Magna Abstract: Because of the properties of short life cycle, fast reproduction, economic, convenient and sensitive to the toxic, Daphnia magna is the internationally recognized standard test organisms, which makes many countries widely, used in aquatic toxicity test and established the standard method, which has broad application prospect. In this paper, based on a large number of published studies, we summed up the latest research status in recent years of Daphnia magna toxicity test application, and put forward some suggestions for future research work of Daphnia magna toxicity test. Keywords: daphnia magna, toxicity test, Research progress.

1 Introduction With the rapid development of industry and agriculture, the constantly increasing of new pollution and the types and quantity of toxic substances, the environmental contamination becoming more and more serious. A variety of new pollutants turn out to be more complex and more toxic, which leads to the difficulties of detections of pollutants while using a single physical and chemical indicators. However, biological monitoring can do much better in reflecting the degree and toxic of pollutant. Daphnia is the internationally recognized standard test organisms, which has some properties such as a short life cycle, breeding fast, economic, convenient and sensitive to the toxic properties. Currently, the use of Daphnia in toxicity tests in terms of heavy metals and organic pollutants is extensively studied and has been applied in toxicity testing of industrial pollution source monitoring, on-line water quality early warning monitoring pesticides, pharmaceuticals and other chemicals, and established a new method to evaluate the water biological safety.

|| 1 College of Environmental Science and Engineering, Guilin University of Technology, Guilin, China, E-mail: [email protected] 2 College of Environmental Science and Engineering, Guilin University of Technology, Guilin, China, E-mail: [email protected] 3 Guangxi Key Laboratory of Environmental Pollution Control Theory and Technology, Guilin University of Technology, Guilin, China, E-mail: [email protected] (Corresponding author) 4 Collaborative Innovation Center for Water Pollution Control and Water Safety in Karst Area, Guilin University of Technology, Guilin, China, E-mail: [email protected] 10.1515/9783110516623-090 DOI 10.1515/9783110303568-090

906 | Yang Deng, Chi-Shan Wu, Yan-Peng Liang and Hong-Hu Zeng

2 Research in the Field In recent years, Daphnia is mainly used to study the toxic effects of heavy metal ions and organic pollutants in domestic; it has also been applied in the toxicity testing of industrial pollution sources monitoring on-line water quality early warning monitoring, pesticides, pharmaceuticals and other chemical

2.1 Toxicity of Heavy Metal Ions In many industrial and agricultural production processes, it will produce ion which is harmful to human body. So Daphnia is widely used in the toxicity test of heavy metal ions. So far, there are many studies in the single and combined toxicity of copper, lead and zinc plasma [1]. Based on the single experiment of copper, lead and zinc, the additive index method of aquatic toxicity combined effect marking , according to the toxicity ratio 1:1 and concentration ratio 1:1 two different concentration ratio, carrying on the both and the three combined experiment. The results show that in both ratio only lead ion and zinc ion showed antagonistic effects of combined toxicity, while the other three groups showed a synergistic effect. It means that there are no relationship with poison ratio and exposure time, only with combination of poison. The toxicity of Cu and Zn to the joint toxicity of Daphnia [2] was predicted by the toxic unit of the biological ligand model (BLM). BLM model which bases on the Toxic unit (TU), optimize the combination of cationic water quality parameters (Ca, Mg, Na, pH) and the effect of heavy metal concentration ratio method of mixture concentration ratio (50% concentration ratio) Study on the toxic effects of potassium dichromate on breeding growth of Daphnia magna during the 21d reproduction, no observed effect concentration was 0 03mg/L growth and the lowest observed effect concentration was 0.05mg/L [3]. According to the study, combined toxicity effect to Daphnia magna of glyphosate and trivalent arsenic in water environment, conducted by Xu and Li [4], the combined toxicity of glyphosate and As (III) was antagonistic under the condition of equal toxicity concentration. Eunhye Bae [5] et al. studied the effects of oxidative stress and copper toxicity on the three generation Daphnia magna under temperature changes, Daphnia magna was more concentrated on defense mechanism than on growth and reproduction. ELIZABETHM and TRAUDT [6] .et al. do a heavy metals (Cd, Cu, Ni, Zn) research of single and mixed binary toxicity test on Daphnia magna.

2.2 Research and Application of Toxic Organic Pollutants In addition to heavy metals, the destruction of toxic organic pollutants in the ecological environment has also caused concern at home and abroad. A lot of progress

Application and Research Progress of Toxicity Test of Daphnia Magna | 907

has been made in the toxicity test of the Large Flea as the tested object. Polychlorinated biphenyls (PCB28 and PCB153) have adverse effects on the growth and reproduction of Daphnia magna, which would perform with the corresponding inhibition and promotion effect of different concentration [7]. Packet [8] were determined the toxicity of phenol, aniline and benzoic acid compounds to Daphnia magna under 38 different pH conditions (6.0, 7.8, 9.0) , the influence of pH on the ionizable organic toxic compounds, so as to explain the toxicity mechanism of ionizable organic compounds, and establishe the QSAR models separately with the appropriate physical and chemical parameters . Yu Miao [9] found that 1- hexyl bromide -3- methyl imidazole have embryonic toxicity that remains concentration dependence and phase sensitivity to Daphnia magna.

2.3 Study on the Toxicity of Industrial Wastewater The acute toxicity test of the large flea on the waste water discharged from the enterprise can evaluate the main industrial pollution sources from the biological point of view. There are many kinds of pollutants in printing and dyeing wastewater, which may be converted into more toxic pollutants in wastewater treatment process [10]. Therefore, we must introduce the aquatic toxicity index in the wastewater discharge standard, instead of only using physical and chemical indicators, so as to protect the ecological safety of surface water. The tanning wastewater is complex and contains many kinds of toxic and harmful substances, and it is a kind of industrial waste water which is difficult to be treated. Zeng et.al. [11] Using Daphnia magna activity inhibition test, to test the effluent of tannery wastewater treatment system in all aspects, to evaluate the processing effect, to provide reference for the application of anaerobic technology for simultaneous desulfurization, decolorization and denitrification.

2.4 Study on the Toxicity of Pesticides Large flea is a very sensitive biological pesticide in water ecosystem, and it was listed as one of the target organisms in pesticide registration by countries all over the world. Insecticides like flubendiamide, chlorantraniliprole and bromine cyantraniliprole have different effects of inhibition on Daphnia growth and reproduction; it can also affect on the endpoints, such as Daphnia Magna's life, body length, number and length of the first molt, fetal fetal number, the number of single female Daphnia production. When clearify the endpoints of the insecticide sensitivity, it can provide reference for the evaluation of pesticides to Daphnia magna toxicity and chronic medication guide field [12]. Difenoconazole is a highly effective broadspectrum three azole fungicides the level of toxicity of 10% Difenoconazole water

908 | Yang Deng, Chi-Shan Wu, Yan-Peng Liang and Hong-Hu Zeng dispersible granule, 20% Difenoconazole micro emulsion, 15% Difenoconazole suspension and 30 g/L Difenoconazole on Daphnia were separately strong toxic, highly toxic, highly toxic and highly toxic. According to the acute toxicity effect of benzene ether of 4 kinds of commonly used forms of albendazole on aquatic organisms, the environmental safety of of albendazole was preliminarily evaluated [13]. Acute toxicity of 5% Nicosulfuron - 21% atrazine dispersed oil suspending agent to daphniamagna was determinated by Chen Liang [14], and the safety assessment shows toxic poisoning. Thus it should be noticed that it should be carefully used in paddy field and nearby to avoid causing harm to aquatic organisms. We determine the acute toxicity of 3 forms of acute toxicity of 4 kinds of preparations-----Cyhalothrin EC, urea formaldehyde resin microcapsule suspending agent, polyurea microcapsule suspension and emulsion to Daphnia magna, and the the body length, feeding and sub-acute toxicity indexes were compared, referring to the method of "environmental safety evaluation of chemical pesticide testing standards", to make sure the effect of formulations on pesticide toxicity. When the concentration is 1 x 10-4mg/L, 4 kinds of preparation of 3 formulations will have an effect on body length, feeding subacute index. And Cyhalothrin in different forms daphniamagna body length is the order of strength: urea formaldehyde resin microcapsule suspending agent, emulsion > polyurea microcapsule suspending agent, water emulsion, feeding effect: EC > urea formaldehyde resin microcapsule suspending agent, polyurea microcapsule suspending agent and water emulsion [15]. Xu Yan [16] established Daphnia toxicity test system consists of "water" and "sediment" phase, and found that chlorpyrifos, fipronil, Fenvalerate and cyhalothrin, bifenthrin have an acute toxicity to Daphnia magna through the system test, therfore provide scientific basis for the ecological safety evaluation of relevant pesticides, at the same time, it provides a simple and effective method to carry out the evaluation test under the condition of closer to the actual exposure state. The four generation of enrofloxacin in Daphnia survival, growth and reproduction with the increased toxicity algebra will also increase the inhibition effect [17]. Berhan M. Teklu [18] tested three Daphnia water biological with endosulfan and diazinon, and the test results are compared with the literature values , in order to put forward a method for the use of analytical resources and a validation test for limited concentration toxicity tests are presented.

2.5 Study on the Toxicity of Medical Articles In the development of the medical industry, the production of various drugs and the abuse of the health of the biological potential risks. Three kinds of typical nonsteroidal anti-inflammatory drug diclofenac (DFC), acetaminophen (APAP) and Bloven (IBP) have significant effect of was time and concentration dependent on Daphnia magna [19]. The research of PPCPs Carbamazepine, as the target compound,

Application and Research Progress of Toxicity Test of Daphnia Magna | 909

its acute toxicity test of Daphnia magna (96h) and chronic toxicity test (21d) conducted by Zhang Fengzhao [20] . Results showed that CBZ had certain toxic effects on Daphnia magna after reaching a certain concentration. In chronic experiment, the number of daphniamagna parity, total number of eggs, body length and intrinsic growth rate, the overall change trend was continuously decreased with the increase of concentration. Comprehensive evaluation of propranolol mother liquor and its photolysis products of acute toxicity to Daphnia magna and 21d two chronic toxicity to Daphnia magna reproduction toxicity by Peng Na [21].

2.6 Study on the Toxicity of Nano Grade Toxic Pollutants The research on the biological effects of nanoparticles has been made in China. Wang Jingkun [22] did research about toxicity of nano cerium oxide (CeO2) to Daphnia magna and transformation in Daphnia magna in morphology. Largely, Daphnia mainly exists in the form of Ce (IV), about 3% into Ce (III), high concentration of CeO2 nanoparticles aqueous suspension can inhibit the large Daphnia the activity, and caused the death of Daphnia magna. Li Yi [23] study on nanometer titanium dioxide (nTiO2) and copper (Cu2+) toxicity to Daphnia magna, the activity of superoxide dismutase (SOD) and glutathione (GSH) in Daphnia magna demonstrate that firstly induced and then inhibition. Malondialdehyde (MDA) content of lipid peroxidation increased gradually. In subacute concentrations, nC 60 enhanced the toxicity of Zn 2 + and Cr 6 + on Daphnia, improve large Daphnia Zn 2 + and Cr 6 + accumulation, and increase the activity of free radicals of Daphnia magna [24]. LIZABETH M. T RAUDT E et.al. [25] Study on the toxicity of multi walled carbon nanotubes to the large flea, the presence of multi walled carbon nanotubes, can increase the toxicity of arsenic.

2.7 Study on the Toxicity of Transgenic Organisms As an internationally recognized standard test organism, the large flea has also related to the safety of genetically modified organisms. Li Zhang et.al. [26] ,who treat Daphnia magna with feeding transgenic and non-transgenic wheat flour, and observe the growth and reproduction parameters, finally transgenic rice btshanyou63 (GM) was determine to be a kind of safety transgenic rice according to different parameters evaluation. Keng-Po Lai et al [27]. Studied the expression of histone H2B in the genetic transcription of the large flea generations in the anoxic environment, and the inhibition of H3 and H4 histone proteins 4 (HDAC4) showed genetic alterations. Li Guangsheng [28] studied the effects of Bt cotton and Bt rice straw on Daphnia magna, results show that the survival rate of large flea, during 13 days’ feeding period, gradually decreased to 0 in non Bt paddy water, while the

910 | Yang Deng, Chi-Shan Wu, Yan-Peng Liang and Hong-Hu Zeng final survival rate remained at about 60% in Bt paddy water. Daphnia began to produce larvae in seventh days, the number of young produced in Bt paddy water is about 20 times the number of non Bt paddy water, there are extremely significant difference between the treatments.

3 Conclusions and Prospects The application of Daphnia magna has been used in the large scale biological test technology for toxicological testing has been carried out extensively and deeply in the world. The report has been widely used in industry, agriculture, medicine and other fields. However it still need further research on heavy metal ions, the effection of acute and chronic toxicity of organic pollutants, as well as the study of inorganic pollutants. In the aspect of detection technology and research, there exists a large gap between different countries, it will have a greater breakthrough in the application if we combine a variety of detection technology and toxicology test in the course of the study and improve the detection sensitivity and applicability, Current research is mostly on the detection different single toxic substances, while the diversification and variety of pollutants in the time of high-speed development of industry and agriculture, which makes the detection of toxic pollutants more difficult. Therefore, it is necessary to focus on the detection of multiple mixed pollutants in different areas, and even the research of the interwoven in different fields in our futher research. Acknowledgement: He authors thank the financial supports from the National Natural Science Foundation of the People’s Republic of China [grant numbers 51268008 and 51578171]; Project of High Level Innovation Team and Outstanding Scholar in Guangxi Colleges and Universities [grant number 002401013001]; the Guangxi Talent Highland for Hazardous Waste Disposal Industrialization; Guangxi Scientific Experiment Center of Mining, Metallurgy and Environment [KH2012ZD004].

References [1] [2]

Ding Chanjuan. Copper, lead and zinc on the large [D]. Study Daphnia toxicity of Shandong Normal University, 2013. Wang Feifei, Zhang Yahui, Cao Ying, et al. BLM method to predict toxicity unit joint toxicity of [C]//Cu and Zn on daphniamagna prediction of joint toxicity of Cu and Zn on Daphnia magna toxicity unit method based on BLM. Based on the chemical environment risk assessment and reference/International Symposium, standard Chinese society of toxicology and ecotoxicology of environmental Specialized Committee Fourth Symposium, China Institute of Environmental Sciences and environmental standard reference Specialized Committee 2015 symposium, E Chinese society of toxicology and ecotoxicology of environmental Specialized

Application and Research Progress of Toxicity Test of Daphnia Magna | 911

[3]

[4]

[5]

[6]

[7] [8] [9] [10]

[11] [12]

[13] [14]

[15] [16]

[17] [18]

[19]

[20]

Committee (COMMITTEE OF, ECOLOGICAL TOXICOLOGY CSOTCOES, CRITERIACS F ESCRAOES Place Published: 2 China, Beijing. Wu Juan, Hu Chuanlu, Duan Lu. Potassium dichromate on the growth and reproduction of Daphnia magna toxicity evaluation [J]. Chinese Journal of environmental science, 2016, (02): 82-87. Xu Yanggui, Li Jing, Qin Junhao, and et al. of glyphosate trivalent arsenic in water environment evaluation of joint toxicity to Daphnia magna [J]. Journal of agro environment science, 2015, (11): 2076-2082. Bae E, Samanta P, Yoo J, et al. Effects of multigenerational exposure to elevated temperature on reproduction, oxidative stress, and Cu toxicity in Daphnia magna [J]. Ecotoxicol Environ Saf, 2016, 132: 366-371. Traudt E M, Ranville J F, Smith S A, et al. A test of the additivity of acute toxicity of binarymetal mixtures of Ni with Cd, Cu and, Zn to Daphnia magna, using the inflection point of the concentration-response curves [J]. Environ Toxicol Chem, 2016, 35 (7): 1843-1851. Li Na, Nie Xiangping, Li Huashou, et al. PCBs (PCB_ (153) and PCB_ (28)) to Daphnia magna toxicity research [J]. Journal of agro environment science, 2012, (05): 891-897. Bao Xin, Zhang Xujia, Zhao Yuanhui. Study on toxicity and QSAR [J]. Journal of chemical ecology, ionizable organic pollutants to Daphnia magna 2016, (02): 720-731. Yu Miao, Liu Chuanhu, Li Xiaoyu, et al. 1- -3- hexyl bromide 2-methylimidazole acute toxicity to Daphnia magna embryo [J]. Fishery science, 2012, (08): 477-480. Zhang Hongchang. Evaluation of the toxic effects of three kinds of aquatic organisms in the treatment of printing and dyeing wastewater [J]. Water purification technology, 2015, (03): 5963, 75. Zeng state drive, Jia Xiaoshan, Chen Jinlin, al. et wastewater treatment system at all levels of the effluent of the eco toxicity evaluation [J]. Eco environmental journal, 2014, (06): 1014-1021. Lin Tao, Lin Ronghua, swimming, et al. effect of three kinds of diamide insecticide formulations on Daphnia growth and reproduction of [J]. Journal of chemical ecology, 2016, (01): 306312. Chen Yuan, Chen ang, Jiang Guifang, al. et for the assessment of the acute toxicity of [J]. Pesticides in aquatic organisms, 2014, (12): 900-903. Chen Liang, Shen Yan, sun Ruyi, et al. 5% Nicosulfuron - 21% atrazine can disperse the toxicity of [J]. Oil suspension of 2 kinds of aquatic organisms in Anhui Agricultural Science Bulletin, 2016, (17): 34-36. Li Hua, Li Xiuhuan, Zhang Daxia, et al. of different dosage forms of Cyhalothrin on Daphnia magna toxicity [J]. Journal of Environmental Sciences, 2014, (06): 1615-1620. Xu Yan, Li Shaonan et al., Wenjie edge, 5 kinds of pesticides in water - artificial sediment system in acute toxicity to Daphnia magna and [J]. Journal of agro environment science, 2011, (05): 855-859. Dalla Bona M, F Lizzi, A Borgato, al. Increasing toxicity of enrofloxacin et over four generations of Daphnia magna [J]. Ecotoxicol Environ Saf, 2016, 132:397-402. Teklu B M, Retta N, Van Den Brink P J. Sensitivity of Ethiopian aquatic macroinvertebrates to the pesticides endosulfan and diazinon, compared to literature data [J]. Ecotoxicology, 2016, 25 (6): 1226-1233. Du, J., Mei, C. F., Ying, G. G., & Xu, M. Y. (2016). Toxicity Thresholds for Diclofenac, Acetaminophen and Ibuprofen in the Water Flea Daphnia magna. Bull Environ Contam Toxicol, 97(1), 84-90. doi: 10.1007/s00128-016-1806-7. Zhang Fengzhao. C Masi Bing of Chlorella, Daphnia, zebrafish toxicity of [D]. Shandong Agricultural University, 2016

912 | Yang Deng, Chi-Shan Wu, Yan-Peng Liang and Hong-Hu Zeng [21] [22]

[23] [24]

[25]

[26] [27] [28]

Peng Na, et al. Zhang Peiqin, Yan Wei, propranolol and photodegradation products of Daphnia magna toxicity [J]. Journal of safety and environment, 2015, (06): 387-391. Wang Jingkun, Ma Yuhui, Zhao Xin, et al. two nano cerium oxide toxicity on Chlorella pyrenoidosa and Daphnia magna and in large Daphnia species transformation of [J]. Ecological toxicology 2016, (01): 362-368. Li Yi, Yin Yayuan, Chao W, [J]. et al. Journal of Hohai University joint toxicity of nano titanium dioxide and copper on Daphnia magna (NATURAL SCIENCE EDITION), 2016, (02): 95-100. Yu Yanxiang, Wei Hua, Tao Xian Ji, et al. nano water stable type C_ (60) 60 (n_ (60)) and Cr~ (2+) promoted Zn~ (6+) in Daphnia magna in absorption, oxidation resistance and acute toxicity of [J]. Toxicology 2014, (03): 569-577. Wang X, Qu R, Allam A A, et al. Impact of carbon nanotubes on the toxicity of inorganic arsenic [AS (III) and AS (V)] to Daphnia magna: The role of certain arsenic species [J]. Environ Toxicol Chem, 2016, 35 (7): 1852-1859. Zhang L, R Guo, Z Fang, al. genetically modified rice Bt-Shanyou63 expressing et Cry1Ab/c protein does not harm Daphnia magna [J]. Ecotoxicol Environ Saf, 2016, 132:196-201. Lai K-P, J-W Li, C Y-S Chan, al. Transcriptomic alterations in Daphnia Magna embryos from mothers exposed to hypoxia [J]. Aquat Toxicol et, 2016, 177: 454-463. Li Guangsheng. The degradation characteristics of Bt cotton and Bt rice straw and its influence on several soil and water bodies [D]. Huazhong Agricultural University, 2014

Qiu-Lin Li1, Yi Lu2 and Mei-Hui Li3

Literature Mining-oriented Risk Management of Climate Change Abstract: Greenhouse gas emissions have significantly altered global climate with extreme weather events occur frequently. Climate change brings the serious uncertainty to people's life and property safety, enterprise production and business operation activities and social economic development. When climate risk caused the wide attention of the world, this paper analyzed the risk management of climate change through literature mining and gained the research road, hotspots, and future trend of climate risk. Conventional risk management stimulus - response type and current adaptive collaborative risk management were analyzed in detail, and risk management framework was built under the current situation. Climate risk management is not a clear solution but a dynamic planning following the climate changes. And we talked about the practical action of physical adaptation, technical adaptation and institutional adaptation to enhance the adaptation capacity. Keywords: Literature mining, climate change, risk management, adaptive collaborative risk management.

1 Introduction Climate change has become one of the hot issue that attracts the most attention to the international community today, its main performance are some serious climate problems as global warming with the main characteristics, such as water resources shortage, desertification, glacier retreat, sea levels rising, infectious diseases and so on, which brought a serious influence to the survival and economic life of people. Increasing emissions of greenhouse gases are now widely acknowledged by the scientific community as a major cause of recent increases in global mean temperature (about 0.58C since 1970) and changes in the world’s hydrological cycle (IPCC, 2007a), including a widening of the Earth’s tropical belt [1]. The cause of climate change is natural and man-made reasons, in which human reason is the main one.

|| 1 Uncertainty Decision-Making Laboratory, Sichuan University, Chengdu, China, 610064, Email: [email protected] 2 Uncertainty Decision-Making Laboratory, Sichuan University, Chengdu, China, 610064, Corresponding author, email: [email protected] 3 Uncertainty Decision-Making Laboratory, Sichuan University, Chengdu, China, 610064, emial: [email protected] 10.1515/9783110516623-091 DOI 10.1515/9783110303568-091

914 | Qiu-Lin Li, Yi Lu and Mei-Hui Li However, climate change is not a problem one country or region can resolve alone, but need the mankind to face it, which is comprehensive issues involved in economic, politic, diplomatic, energy, and the field of ecology. Risk refers to the possibility of making human precious things in jeopardy and the result is unknown [2]. IPCC assessment put risk into the field of climate change, climate risk is the possibility that climate system change influenced on the natural ecological system and human social and economic system, which mainly refers to the possibility of negative effects, such as loss, damage or destroy etc. Risk comes from not only the climate change itself, but at the same time from the process of human social development and governance [3]. Climate change risk is the focus of the countries all over the world, and also the hot issue in the study field. Climate change risks include a series of climate change issues that human beings commonly face weather risk and so on. Take the climate change risks as its core idea, IPCC's latest 5th assessment report established risk management based conception framework of risk management to address climate change, and put forward eight classes of key risk including land and inland water ecosystems, biodiversity and related ecosystem functional loss[4]. The second working group report of the IPCC AR5 pointed out that climate change has influenced all areas across from the tropics to the poles, from the island to all the region of the mainland, from the richest countries to the poorest[4]. Faced with the climate change and its serious impact, the concept of risk management of climate change was put forward, taking quantitative analysis of the risks and taking corresponding risk management strategies to reduce losses and the abnormal fluctuations of production and business activities caused by climate change risk. The characteristics of the risk management determine it cannot provide absolute solution, and is largely determined by the specific policy makers’ values and ideas. At present, the global climate change has not been treated with effective risk management strategies. Therefore, starting from the decision-making level, formulating proper framework and solution of risk management strategies in the basis of strict security threat analysis of climate change is significantly important to response to global climate change.

2 Literature Mining This paper further studies the existing strategies of risk management of climate change and the trend in the future based on the methods of literature mining. Literature mining has also been shown to be a powerful method for elucidating major trends across time in published scientific literature so that topic maps can be built [5]. Garfield and Merton first proposed that the citation indexing of academic literature is crucial for the bonding of similar research topics [6]. A citation index is a

Literature Mining-oriented Risk Management of Climate Change | 915

synthesized result based on journal articles, keywords, publication dates and abstracts and is able to separate and highlight the various influences in a specific field, allowing for the research with the greatest impact to be easily identified.

2.1 The Data Analysis System Peer-reviewed scientific literature can assist potential researchers to identify the latest developments and ascertain the future directions of a specific research field [7]. WoS was chosen as the primary database allowing for an in-depth exploration of the specialized sub-fields within an academic or scientific discipline. Further, many analyses based on this scientific research has been published in the IPCC-AR5 [8]. Therefore, for our research, it is essential to construct a sufficient and effective data analysis system based on keywords and publication dates [9]. To estimate trends in the literature related to climate-induced risk management, we searched with the string of “TS = risk management of climate change” in the ISI Web of Science TM# core collection database over the available interval from 1990 to 2016. When the search was complete, the plain text of the 5624 related articles was imported in Cite Space as the basic data [10]. And initial data from the 5624 researches were dealt and we can get the summary of clusters in Table 1. Table 1: cluster summary Clus Size ter ID

Silhou- Mean hou(Year) ette

Top Terms(tf* idf weighting)

Top Terms (log-likelihood ratio, plevel)

Terms(mutu al information)

0

32

0.543

2001

(10.43) biological diversity; (10.43) boreal forest ecosystem;

biological diversity (16.38, key tool 1.0E-4

1

26

0.494

2000

(12.97) skill; (11.86) building knowledge; (11.86) potential value

building knowledge (23.25, 1.0E-4)

sustainable forestry

2

25

0.56

1998

(8.42) industry structure; (8.42) livestock production system;

invertebrate biodiversity (16.31, 1.0E-4)

key tool

3

23

0.577

1998

(8.42) multi-scale remote sensing technologies; (8.42) short-term assessment;

short-term assessment (11.6, 0.001);

Florida

4

22

0.545

1998

(8.94) following

mapping vulnerability

change-an

916 | Qiu-Lin Li, Yi Lu and Mei-Hui Li

Clus Size ter ID

Silhou- Mean hou(Year) ette

Top Terms(tf* idf weighting)

Top Terms (log-likelihood ratio, plevel)

Terms(mutu al information)

wildfire; (8.94) landscape disturbance; (8.94) mapping vulnerability;

(14.7, 0.001);

insurance perspective

5

21

0.567

2002

(10.43) facilitating assessing vulnerability adaptation; (10.43) (14.79, 0.001); assessing vulnerability; (9.07) resilience;

flooding systems resiliency

6

21

0.714

2001

(7.21) plant disease drought policy (10.92, management; (6.89) 0.001); drought policy; (6.89) arid land;

dynamic

7

21

0.552

2000

(8.42) upstream level; upstream level (13.01, (8.42) risk manage0.001); risk management ment paradigm; paradigm (13.01, 0.001);

sustainable forestry

8

19

0.579

1997

(8.6) ecosystem service; (8.42) fire size;

ecosystem service (31.57, 1.0E-4); effect (18.17, 1.0E-4); comparison (15.68, 1.0E-4);

temporal trend

9

19

0.509

1998

(10.43) ozone; (8.42) human-welfare risk; (7.21) environmental regulation

characterizing tropospher- coastal ic ozone risk(13.13, 0.001) habitat

10

18

0.556

2001

(8.94) aquatic ecosystem functioning; (7.21) indigenous forest;

aquatic ecosystem functioning (15.44, 1.0E-4); health (9.65, 0.005)

11

18

0.512

2000

(10.43) multi-scale multi-scale coastal vulner- British coastal vulnerability ability index (16.26, 1.0E- Columbia index; (10.43) coastal 4); phoenix (12.55, 0.001); manager;

12

18

0.527

1999

(9.15) alternative forest management strategies; (9.15) risk analysis;

alternative forest management strategies (16.82, 1.0E-4); risk analysis (16.82, 1.0E-4);

ecological issue

13

17

0.706

2001

(10.43) competitive intelligence; (8.42) adaptation tool;

international-business (18.17, 1.0E-4); adaptive capacity (12.97, 0.001);

water

14

17

0.534

1999

(9.15) safety culture; (9.15) effectiveness; (8.42) greenhouse effect;

training (21.26, 1.0E-4); safety culture (21.26, 1.0E-4); effectiveness (21.26, 1.0E-4);

support

British Columbia

Literature Mining-oriented Risk Management of Climate Change | 917

Clus Size ter ID

Silhou- Mean hou(Year) ette

Top Terms(tf* idf weighting)

Top Terms (log-likelihood ratio, plevel)

Terms(mutu al information)

15

16

0.662

2001

(8.42) carbon budget; hazardous environment (7.21) inter organiza- (10.63, 0.005) tional approach; (6.49) sensitivity

public

16

15

0.733

2000

(18.09) 21st century perspective; (18.09) chronic obstructive pulmonary disease;

21st century perspective (131.57, 1.0E-4)

hot humid environment

17

13

0.615

1994

(16.89) incidence; (16.89) intracranial aneurysm rupture;

incidence (91.05, 1.0E-4)

probabilistic method

18

13

0.736

2001

(8.94) precipitation; (8.42) adaptive capacity deficit; (8.42) economic system;

adaptive capacity deficit (13.04, 0.001); economic system (13.04, 0.001);

coastal habitat

19

11

0.545

2003

(10) bracken distribu- bracken distribution tion; (10) marginal (25.11, 1.0E-4); great land; (9.2) sustaina- Britain (25.11, 1.0E-4); ble management;

20

7

0.286

1998

(13.88) intestinal infection; (13.88) lactobacilli; (5.72) role;

21

4

0.25

1993

(10.43) pupil; (10.43) pupil (32.48, 1.0E-4); inattention; inattention (32.48, 1.0E4); teacher problem (32.48, 1.0E-4);

22

4

0.75

1994

(11.86) severe sepsis; (11.86) discussion; (11.86) controlled clinical-trial;

... severe sepsis (39.99, 1.0E-4);controlled clinicaltrial (39.99, 1.0E-4);

23

4

0.75

1997

(10.43) north Queensland; (10.43) dry land salinity hazard;

Dry land salinity hazard (32.91, 1.0E-4); upper burdekin catchment (32.91, 1.0E-4);

24

3

0.667

1991

...

agricultural soil (8.2, agricultural 0.005); short-term carbon soil sequestration (8.2, 0.005);

25

3

0.667

1998

(10.43) smog analysis; (10.43) conceptual design; (10.43) dynamic model;

conceptual design (36.45, ... 1.0E-4); dynamic model (36.45, 1.0E-4);

brahmaputra floodplain

intestinal infection (63.84, role 1.0E-4); lactobacilli (63.84, 1.0E-4); role (36.99, 1.0E-4); sea level rise

...

918 | Qiu-Lin Li, Yi Lu and Mei-Hui Li

Clus Size ter ID

Silhou- Mean hou(Year) ette

Top Terms(tf* idf weighting)

Top Terms (log-likelihood ratio, plevel)

Terms(mutu al information)

26

3

0.333

1999

(10.43) community pennsylvanias susquewater system manag- hanna river basin (33.37, er; (6.46) weather; 1.0E-4);view (33.37, 1.0E4);

weather

27

3

0.667

1999

(10.43) clinical risk clinical risk management management; (10.43) (34.42, 1.0E-4); principle patient information; (34.42, 1.0E-4); (10.43) principle;

...

28

3

0.333

1991

(3.81) pest; (0.11) men;

pyrenee (9.34, 0.005); ungulate population (9.34, 0.005); cydia pomonella (9.34, 0.005);

using multi criteria decision analysis

29

2

0.5

2015

...

whole-of-science research costa rice agenda (8.36, 0.005); regarding ecosystem service (8.36, 0.005);

30

2

0.5

2000

(7.21) agro meteorological aspect; (5.97) disease management; (1.19) management

Agro meteorological aspect (20.75, 1.0E-4); disease management (20.75, 1.0E-4);

Agro meteorological aspect

31

2

0.5

1997

(2.07) risk;

zoonotic risk (13.16, 0.001); environmental health policy (13.16, 0.001);

risk

32

2

0.5

2001

(8.42) ensuring vaccine safety; (3.64) perspective;

ensuring vaccine safety (28.01, 1.0E-4); perspective (19.02, 1.0E-4); adaptation (0.1, 1.0);

perspective

33

1

0

1999

...

biological control (14.34, ... 0.001); conventional production system (14.34, 0.001);

34

1

0

2014

...

non-indigenous pest (8.61, 0.005); potential geographical distribution (8.61, 0.005);

35

1

0

2002

...

flooding systems resilien- ... cy (15.39, 1.0E-4); adaptation (0.03, 1.0); risk (0.02, 1.0);

36

1

0

2016

(8.42) pacific; (7.4) governance; (7.21)

flooding (21.95, 1.0E-4); understandadaptation (11.46, 0.001); ing uncer-

role

Literature Mining-oriented Risk Management of Climate Change | 919

Clus Size ter ID

Silhou- Mean hou(Year) ette

Top Terms(tf* idf weighting)

Top Terms (log-likelihood ratio, plevel)

Terms(mutu al information)

37

1

0

2001

...

prescription (13.16, 0.001); air pollution (13.16, 0.001);

use

38

1

0

2004

...

long-term forecast (15.39, protection 1.0E-4); protection (12.62, 0.001); adaptation (0.05, 1.0);

39

1

0

2012

...

method (9.37, 0.005); potential risk (9.37, 0.005); food insecurity (9.37, 0.005);

method

40

1

0

2002

(2.73) ecosystem;

ecosystem vulnerability (12.42, 0.001); sustainable ecosystem management (12.42, 0.001);

southern Africa

41

1

0

2004

...

France (15.39, 1.0E-4); sea-level rise (11.57, 0.001); adaptation (0.05, 1.0);

sea-level rise

42

1

0

2006

...

life history (11.67, 0.001); species stability (11.67, 0.001); distribution model

43

1

0

2015

(2.59) forest;

Yosemite national park (8.36, 0.005); invasive plant research (8.36, 0.005);

Yosemite national park

44

1

0

2000

...

nitrogen composition (13.66, 0.001); soil management (13.66, 0.001);

influence

45

1

0

1997

...

UK infrastructure (18.16, 1.0E-4); adaptation (0.03, 1.0); risk (0.02, 1.0);

...

46

1

0

2008

(0.08) men;

management alternative (12.42, 0.001); critical load (12.42, 0.001);

California

47

1

0

1999

...

developing realistic treatment standard (14.34, 0.001);

...

48

1

0

2003

...

mitigation challenge (12.76, 0.001); carbon cycle uncertainty (12.76,

...

stakeholder;

tainty

920 | Qiu-Lin Li, Yi Lu and Mei-Hui Li

Clus Size ter ID

Silhou- Mean hou(Year) ette

Top Terms(tf* idf weighting)

Top Terms (log-likelihood ratio, plevel)

Terms(mutu al information)

49

1

0

2008

(3.84) flood; (0.08) men;

flood (15.73, 1.0E-4); using multi-criteria analysis (10.57, 0.005);

insurance

50

1

0

2003

...

current state (13.16, 0.001); anthropogenic change (13.16, 0.001);

prospect

51

1

0

2014

(3.64) uncertainty; (2.73) rate; (2.57) risk;

disaster risk (10.82, 0.005); integrated management strategies analysis (10.82, 0.005);

understanding uncertainty

52

1

0

2015

...

adapting cities (14.34, 0.001);

vulnerable resource management system

53

1

0

2016

(2.59) forest; (2.2) land;

Agro ecosystem fire management (10.13, 0.005);

drought risk

0.001);

2.2 Timezone Analysis The modularity of the merged network was 0.9146, which was a rather high value and indicated that there were dense connections between the nodes within the modules but sparse connections between the nodes in the different modules. Fig.1 illustrates the keyword network produced in the timezone analysis with the nodes from 1960 to 2016, which can be divided into three main stages as it was been combined with the conception of “technology paradigm” [11]. The first stage came from 1990 to 1997, and it was mainly talked about the conception of climate risk and its bad effect such as sea-level rise. Phase II was from 1998 to 2005, which was centered by the keywords of risk management, adaption and policy. And the latest stage was from 2006 to 2016, with the issue mostly studied of climate change adaptation, strategies and risk assessment.

Literature Mining-oriented Risk Management of Climate Change | 921

climate-change adaptation risk-management strategies population adaptive capacity risk-assessment temperature optimization variability social-ecological systems adaptation risk assessment Phase III policy sea-level rise risk management ecosystems climate change biodiversity risk

Phase II

Phase I

Fig. 1: Timezone of the keywords of related researches

2.3 Cluster Analysis Through cluster analysis in Cite Space, we got fifty three groups clustering related research’s focus. As shown in Fig.2, the mean silhouette score of 0.342 indicated the homogeneity of these clusters was medium. The red fonts with the symbol as “#” expressed the key word in different categories, and the colorful bar on the top of Fig.2 showed the time series from 1990 to 2016, which was different year with each color. The fifteenth cluster group was labeled with “carbon budget” for example.

3 Hotspot-Based Risk Management Framework Through the literature mining, we found not only the traditional understanding of climate risk management( PhaseIand PhaseII), also saw the research focus at present stage(PhaseIII), with the change of the key words evSery year, we can also infer the future research trends. The previous two phases were talked about together as the traditional risk management and the last phase was mainly focused on the adaptive collaborative risk management, which is the research hotspot from related study and IPCC reports up to date. At last, we build a management framework based

922 | Qiu-Lin Li, Yi Lu and Mei-Hui Li on the current situation and previous work, as shown in Fig.3, and it combined the conception of “technology paradigm” with the literature mining consequence.

3.1 Conventional Risk Management We can summarize conventional risk management in “competition stage” and “diffusion stage” as shown in Fig.3 and how it is being advanced as a tool for climate change adaptation, the first stage explored climate risk on the surface, which was centered on preliminary acquaintance of risk and climate change and the studies on climate affect. The second stage was advanced at a turning point that we get more knowledge about the conception and relationship between risk management and climate change, and first put forward the conception of “climate risk”, and lots of researches were taken on the specific work in a management framework, which contains risk assessment, cause and adaptation, namely the stimulus - response type as responded to climate risk [12]. However, the risk management in this period wasn’t mature without enough preparations for knowledge, capital, technology, transparency.

Fig. 2: Clusters of risk management of climate change

Literature Mining-oriented Risk Management of Climate Change | 923 Degree of maturity & development of potential

Competition stage

Diffusion stage

risk management

risk assessment

risk Innovation

Updated management framework

social-ecologi cla system

adaptation climate change

Shift stage

climate-change adaptation turning point

next paradigm Trajetory defined

Trajectory constricted

ĉ: preliminary understanding of risk and climate change Ċ˖combine the conception inĉand take "the stimulus response type" ċ˖update the assements and take adaptive collaborative risk management

Time

Fig. 3: The research map of risk management of climate change

Based on the previous two phases’ research, we can have an intensive realize of the key issue. Climate change risk is produced after the superposition of vulnerability and exposure. Vulnerability reflects the lack of preparation in front of climate change, while exposure said people or assets exposed to the harm of the effects of climate change to some degree, and the superposition of the two things can trigger the dangers of climate events or trends. Therefore, risks of climate change is driven by the climate system and the social economic development process, its core elements include the dangers, the vulnerability and exposure degree of climate change, the path of social economy, adaptation, slow plan and governance, etc. [13].

3.2 Cite Space Analysis-Based ACRM Adaptation is an adjustment reaction when nature or human system under the stimulus of actual or anticipated climate evolution [14]. There are three main purposes, one is to enhance adaptability, the second is to reduce the vulnerability, and the last is to develop the potential development opportunities. The short-term goal of adaptation is to reduce the risk of climate, enhance the adaptation ability, and the long-term goal should be consistent with sustainable development [15]. Adaptive management is different from the traditional risk management, which mainly is stimulus-response type, adaptive management emerged under the big background of global environment change, and gradually became systematic on the theory and method after years of development and practice. Therefore, the most promising management model shall begin from the perspective of adaptation, and combine

924 | Qiu-Lin Li, Yi Lu and Mei-Hui Li with comprehensive assessment of risk itself, decision makers and objects being affected or will be, that is adaptive collaborative risk management (ACRM). Fig.1 and Fig.3 both showed that the research hotspots these years were focused on social-ecological system, risk assessment and climate-change adaptation. As previously identified, social-ecological systems research offers knowledge and experience in dealing with uncertainties, questions of how to meaningfully engage participants, and in considering governance issues [16]. Risk assessment was different from the previous one with more comprehensive analysis of key risks, new risks and future climate risks. Adaptive collaborative risk management was characteristic with two critical features of collaboration and adaptation.

3.3 Risk Management Framework From the strict mitigation targets and loose mitigation targets, researching how to respond to climate change risks and building a "three level" risk management framework based on the goal that limits global climate change standard, which contains effective adaptation policies, contingency plans and risk situations of higher level for possible due to the underestimate of slow plan and climate sensitivity. A complete set of comprehensive risk management of climate change plan shall include the following scenario and content. Scenario I: Target to keep global warming within 2oC. a) Adequate mitigation targets. b) Increasing investment in research and demonstration of transformation. c) Elastic, flexible mechanism of global climate. d) Independent risk assessment of climate change. Scenario II: Building long-term plans for climate change. a) Including the catastrophe prediction and adaptation strategies for the mutual influence of regional events. b) Improving the cooperation between the preventive measures and reasonable intervention. c) Improving the flexible management mechanism for international resources. d) Preparing the required data and tools for the decision-maker. Scenario III: Building contingency plans for climate warming. a) Emergency "fast slow" plans. b) System monitoring the critical point.

Literature Mining-oriented Risk Management of Climate Change | 925

4 Discussion Adaptation is one of the main ways to cope with climate change, also is the main purpose of the risk management of climate change adaptive collaborative risk management involves different factors and object in the practical application. Fig.4 showed the relationship between the theoretical knowledge about climate risk, climate risk management system and how factors functioned as respond to climate change risk. As the whole figure illustrated, theoretical preparation and actual operation were both a dynamic planning for climate risk produced or on the way. Establish risk sharing and transfer mechanism at local, national, regional and global level can improve the strain capacity of extreme climate (medium reliability). These traditional risks sharing mechanism can serve as a combination with livelihood aid, disaster recovery, reconstruction, vulnerability reduction, information providing, policy incentives, disaster mitigation and adaptation measures.

4.1 Physical Adaptation Physical adaptation refers to adopting the engineering construction measures to enhance the adaptation capacity for social and economic system in terms of physical capital, including the construction of water conservancy facilities, environment infrastructure, cross-basin water transfer projects, disease surveillance network, weather monitoring stations, etc. And the physical adaptation was shown as the specific projects in adaptation in (a) and different sectors’ function in (c) in Fig.4.

926 | Qiu-Lin Li, Yi Lu and Mei-Hui Li (a) Theoretical knowledge for climate risk managment

good effet bad effet

Impact

core elements

The social and economic process

vulnerability Natural changes

hazards

Man-made climate changes

The social and economic path

risk

Adaptation and slowing path

exposure

A d v erse effects o f clim ate ch an g e

climate

damage, loss

Prevention Insuranc sy stems e part Macro and micro insurance sy stem

Against losses

Adapt to the adverse effects Adaptation activities Slow plans

Risk management

governance

Risk prevention

Multilateral intergovernmental organizations

(b) Risk Management system of climate change

Related sectors climate change

Climate Risk list Climate scenario analysis change

Related sectors

Infrastructure list

classification of risks

(c) Factors and functions respond to climate risk

National Level:

Identify Risk

High risk

Insurance fund of climate Slow the adverse effects of climate

Emissions and land use change

Defining Risk

Low risk Middle risk

Risk assessment

Risk map

Risk management

Risk policy advice probability

Risk strength

Assess trade-offs

Program options

National Level: government, legislative branch, research institutions

local Level: Individuals, private organizations, local government departments

Factors

global goal

International Level Principle, agreement, capital, technology, resource

nationa development goal and sector goal

local Needs, desire, and culture

From bottom to top

National Level Policy, strategy, capital, resources Local project

Global climate prediction

national climate prediction

Scientific knowledge and local experience

Vulnerability assessment, risk and adaptation From top to bottom

Fig. 4: Theoretical preparation and actual operation of ACRM

4.2 Technical Adaptation Technical adaptation can enhance the adaptation capacity through scientific research, technology innovation, such as carrying out climate risk assessment research, developing new crop varieties, developing ecological system adaptation technology, control and prevention technologies for disease, risk monitoring and early warning information technology, etc. It could be seen as the whole risk management system in (b) and how the factors respond to climate change in (c) in Fig.4.

4.3 Institutional Adaptation Institutional adaptation means that we can enhance the ability of adapting to climate change through the institutional construction such as policy, legislation, administrative, fiscal, tax, supervision and management. For example, it can provide institutional guarantee to strengthen the ability to adapt with the help of policy incentives in the areas of carbon tax, carbon sink forest, river-basin ecological compensation, climate insurance, social security, education and training and science

Literature Mining-oriented Risk Management of Climate Change | 927

popularization. And it was indicated in governance and risk prevention in (a) and international/national/local response to climate risk in (c) in Fig.4.

4.4 Updated views in WGII-AR5 Compared with the previous report, AR5 focus more on the assessment of the social and economic aspects of climate change and the impact on the sustainable development, regional aspects, risk management and delimit the range of solutions through adaptation and slow plans, as shown in Table 2. Meanwhile, AR5 pointed out that we should not only adapt to existing climate change impacts, also focus on understanding and evaluation of future climate change risk, then develop and implement policies and measures to reduce the risk of climate change[4]. Table 2: IPCC reports’ progress Time

Name

Progress

1992

FAR

utilized updated greenhouse gas emissions scenarios called "IS92"

1995

SAR

improvements in the treatment of the carbon cycle

2001

TAR

become possible in sustainable development, and fair environment

2007

AR4

Construction of urban resilience and adaption for rural areas

2014

AR5

The effects and vulnerability of climate change and co-adaption

5 Conclusions Based on the literature mining in the Cite Space, key words analysis from 1990 to 2016 in climate-induced risk researches, also with the work made in conventional climate risk management and current adaptive collaborative risk management, we can get the conclusion that adaptive collaborative risk management is the best efficient path to respond to climate risk. And we can know that the transition of risk management in the direction of participation, learning, and governance can be accelerated with insights from adaptive co-management. Meanwhile, Successful climate change adaptation requires careful consideration of technical and social dimensions. Risk management is part of a comprehensive suite of tools for climate change adaptation with international and national standards being developed to assist governments, businesses, and communities. Due to climate change brings different types and levels of risk, all countries need to have effective risk management processes, clearly define the risk assumption, and set up a baseline to determine the measure’s effectiveness. If not or proves

928 | Qiu-Lin Li, Yi Lu and Mei-Hui Li wrong, a set of re-evaluation system and plan need to be launched to ensure the existent risks of effective management. Facing the current global climate change and the profound influence, different subject should continue develop new analytical tools and model systems based on the existing risk research, start the climate change risk management measures, and support the policy makers to make the best response to climate change risk. In addition, subjects should also combine with the situation of international negotiations and timely adjust the corresponding risk management strategy for the political influence of climate change. Acknowledgement: This research is supported by the Program of the Social Science Foundation of Sichuan (Grant No.SC15C016) and the Research Funding of Sichuan University (Grant No. skqy201640; 2016SCU11036).

References [1] [2] [3] [4] [5] [6] [7] [8]

[9] [10] [11]

[12] [13] [14]

[15]

Smith P F. Architecture in a Climate of Change [M]. Routledge, 2006. Slovic P E. The perception of risk [M]. Earthscan publications, 2000. Adger W N. Vulnerability [J]. Global environmental change, vol. 16(3), pp. 268-281, 2006. IPCC. C limate change 2014: impact, adaptation, and vulnerability [M/OL]. Cambridge: Cambridge University Press, 2014 [2014-05-06]. http://www.ipcc.ch/report/ar5/wg2/ B. De Bruijn, J. Martin, Getting to the (c) ore of knowledge: mining biomedical literature, International journal of medical informatics,vol. 67 (1) ,2002,pp.7–18. Garfield, E.; Merton, R.K. Citation Indexing: Its Theory and Application in Science, Technology, and Humanities.Wiley: New York, NY, USA, Vol. 8, 1979. Jensen, L.J.; Saric, J.; Bork, P. Literature mining for the biologist: From information retrieval to biological discovery. Nat. Rev. Genet. 2006, vol. 7, pp. 119–129. IPCC. Climate Change 2014: Mitigation of Climate Change. Contribution of Working Group III to the Fifth Assessment Report of the Intergovernmental Panel on Climate Change; CambridgeUniversity Press: Cambridge, UK; New York, NY, USA, 2014. Buchwald, H.; Avidor, Y.; Braunwald, E.; Jensen, M. D.; Pories, W.; Fahrbach, K.; Schoelles, K.Bariatric surgery: A systematic review and meta-analysis. 2004, vol. 292, pp.1724–1737. C. Chen, Searching for intellectual turning points: Progressive knowledge domain visualization, Proceedings of the National Academy of Sciences vol.101, 2004, pp.5303-5310. Huang E M, Truong K N. Breaking the disposable technology paradigm: opportunities for sustainable interaction design for mobile phones[C] Proceedings of the SIGCHI Conference on Human Factors in Computing Systems. ACM, 2008, 323-332... SmitB, Burton I, Klein R J T, et al. An anatomy of adaptation to climate change and variability [J]. Climatic change, 2000, vol.45 (1), pp. 223-251. FüsselH M. Vulnerability: a generally applicable conceptual framework for climate change research [J]. Global environmental change, 2007, vol.17 (2), pp. 155-167. McCarthy J J, Canziani O F, et al. Climate Change 2001:Impacts ,Adaptation &Vulnerability .Contribution of Working Group II to the Third Assessment Report of the Intergovernmental Panel on Climate Change (IPCC)[ M] . Cambridge: Cambridge University Press , 2001 Center for European Policy Studies .Adaptation to Climate Change: Why Is It needed and how can it be implemented? [ EB/OL] .CEPS policy brief , 2008 :161.http ://www .ceps .eu

Literature Mining-oriented Risk Management of Climate Change | 929 [16]

May B, Plummer R. Accommodating the challenges of climate change adaptation and governance in conventional risk management: adaptive collaborative risk management (ACRM) [J]. Ecology & society, 2011, vol.16 (1), pp. 47

Di-Rong Xu1, Jun Gang2, Lu Gan3 and Zhong-Qin Li4

Economic Evaluation of Renewable Energy Saving Technology Based on Analytic Hierarchy Process and Data Envelopment Analysis Method Abstract: In order to promote the application of energy saving technology, it is necessary to evaluate the economy, especially the lowest cost control in the case of consumer acceptance. Therefore, this paper combines the analytic hierarchy process and the data envelopment analysis (AHP-DEA), which evaluates the economy of energy saving technology application. It takes the use of solar water heater as a case study to verify the proposed model. In this paper, there are three important conclusions. Firstly, get the ideal control cost in the case of consumer satisfaction, through the application of AHP-DEA model. Secondly, it is necessary to promote the utility of renewable energy source. Thirdly, in order to promote the application of green building energy saving technology, cost should be considered and controlled. Finally, through analyzes the adjusted cost, initial cost and economic benefit, some references are provided for different decision makers. Keywords: energy saving technology; analytic hierarchy process; data envelopment analysis; consumer satisfaction; cost controlling

1 Introduction According to the United Nations Environment Programmer’s Green Economy Report, energy consumption of buildings in most of the industrialized countries accounts for around one-third of CO2 emissions [1]. Therefore, advocating the development of energy saving technology is one of the important tasks of the current construction industry. In order to promote the development of green building, the state promul-

|| 1 College of Architecture and Urban-Rural Planning, Sichuan Agricultural University, Dujiangyan, China, 611830, Email: [email protected] 2 Ministry of Science and Technology, Sichuan Institute of Building Research, Chengdu, China, 610081, Email: [email protected] 3 College of Architecture and Urban-Rural Planning, Sichuan Agricultural University, Dujiangyan, China, 611830, Corresponding author, email: [email protected] 4 College of Architecture and Urban-Rural Planning, Sichuan Agricultural University, Dujiangyan, China, 611830, Email: [email protected] 10.1515/9783110516623-092 DOI 10.1515/9783110303568-092

932 |Di-Rong Xu, Jun Gang, Lu Gan and Zhong-Qin Li gated the "Assessment Standard for Green Building". However, there is a big misunderstanding about the cost of energy saving technology. Namely, if the buildings in the construction and operation stage adopt the green or environmental protection measures, the cost must greatly increase and resulting in the green building is difficult to democratize. Consequently, economy becomes the key factor that affects the promotion of green building, and it is the root of promotion hardly. In order to break the bottleneck hindering the development of green building, it is necessary to study the cost control of energy saving technology, and the cost control is conducive to analyze and evaluate the economic feasibility of the adopted energy saving technology. There are many articles on the incremental cost of green building. For example, Li Ju and Sun Daming [2] make a statistics for green residential building and analyze the factors of affecting the incremental cost. Zhao Zenghui and Han Chunyin [3] also briefly discuss the incremental cost of a residential building in envelope and heating system. In order to achieve a low incremental cost with high green star, Tang Li [4] discusses the composition and evaluation scores of the incremental cost in the water saving part. Gebreslassie [5] explores the minimum cost and the impact on the environment in a given cooling demand, using nonlinear optimization to find the minimum total cost, the result shows technology is feasible while economy is not optimistic. However, the economy evaluation method of energy saving technology is not perfect. For example, the world's major green building evaluation standard in addition to the GBC of Canada has been mentioned the evaluation methods, for other countries, such as the Assessment Standard for Green Building of China and the LEED of America, mainly to state the incremental cost range and performance evaluation standard for different stars. There is no specific measuring method about the cost and benefit. Of course, it has not formed a perfect system of economic evaluation method. Compared with the evaluation standard, the literature research is more abundant, such as Chai Hongxiang et al. [6] simulate and verify their proposed integrated model about benefit and economy, Liu Yuming [7] conducts an empirical research for the green building of Chinese Vanke City on economic benefit. Li Jing and Tian Zhe [8] use fuzzy comprehensive evaluation and analytic hierarchy process to quantify incremental indirect benefit, and construct the whole life cycle incremental cost and benefit model of green building. Wang Fang [9] combines with gray theory and AHP to establish a comprehensive evaluation model and compare the economic performance of different programs for green building. Masternak-Janus [10] uses the data envelopment analysis to assess the comprehensive region ecology benefit. It is significant to promotion green building, if green building energy saving technology in the economy achieves the consumer satisfaction. There are some relevant literatures to research from the consumer point as follows. Mell [11] carries out a large-scale survey about the willingness to pay based on quality, comfort and function for the green infrastructure construction. Chau [12] analyzes the residents'

Economic Evaluation Saving Data Envelopment Analysis Method | 933

willingness to pay for the green building properties by applying discrete choice experiment. Wang Jianting et al. [13] also build a model based on the consumer's contribution to the incremental cost and benefit of green building. Edwards [14] explores the resulting cost and benefit because of improving the housing conditions and people's health. In summary, the above literatures either count the incremental costs, or use different methods to measure the cost and benefit, or analyze the consumer willingness to pay. There are few papers focusing on the cost control of energy saving technology of green building based on the consumer utility. Therefore, this paper explores the cost control of energy saving technology, and puts forward the analytic hierarchy process and data envelopment analysis (AHP-DEA) comprehensive model based on consumer utility. By taking the use of solar water heater in Xichang as an example, the proposed model is verified. At the same time, comprehensive analysis of the adjusted cost, initial cost and economic benefit, to provide some references for different decision makers. This paper is organized as follows. The second part describes the analysis of the technical process. The third part establishes a comprehensive model AHP-DEA. The fourth part takes the solar water heater as a case analysis to test the practicality of the model, and provides the results and discussions. The fifth part draws the conclusion, and puts forward three valuable directions to research further.

2 Framework Analysis The main purpose of this paper is to explore the cost control of energy saving technology. Therefore, an integrated model combining the analytic hierarchy process (AHP) and data envelopment analysis (DEA) is put forward based on consumer satisfaction? First, the consumer satisfaction is quantified and then the comprehensive satisfaction is got. Secondly, the various cost because of using energy saving technology and the consumer comprehensive satisfaction as the input and output items, respectively. Then through the application of DEA method, effective and ineffective decision making units are received, and then the ineffective decision unit is adjusted to the effective. Thirdly, calculate the optimal investment cost and obtain the ideal cost control. Finally, comprehensive analysis with the initial cost, optimal cost and economic benefit, and provide some references for different decision makers. In order to verify the operability and effectiveness of the model, take the use of solar water heater as a case analysis. The flow chart is as shown in Fig. 1.

934 |Di-Rong Xu, Jun Gang, Lu Gan and Zhong-Qin Li

Fig. 1: The flow chart

3 AHP-DEA Modeling 3.1 Determine the Input and Output This paper mainly combines AHP and DEA, in which the DEA method involves the determination of the input and output items, so it is a prerequisite to determine the input and output indexes. The AHP-DEA modeling proposed as in Fig. 2 and shows in detail at section B and C of chapter II.

Economic Evaluation Saving Data Envelopment Analysis Method | 935

Fig. 2: The AHP-DEA modeling.

Input index: input index includes the items that increase cost in the life cycle, such as the purchase fees, installation fees, maintenance fees, renewal fees, etc. According to the literature and survey, the fee of initial purchase, update, using and maintenance are chosen as the input index in this paper. Output index: through look up literature, reflecting the level of consumer satisfaction indexes mainly are economy, comfort and function for the product or technology [11]-[13]. The comprehensive consumer satisfaction is determined as the output index in this paper. Economic benefit: economic benefit is the cost saving in the whole life cycle. That is to say, reduce the consumption of energy in the applied stage. This is mainly reflected the savings of electricity, gas, etc. In this paper, the economic benefit of using electricity and liquefied gas are analyzed before using the solar water heater, respectively.

3.2 Calculate the Comprehensive Consumer Satisfaction 3.2.1 Determine The Index Weight: (a) Judgment matrix: Construct the judgment matrix based on the answers of the investigated respondents by using AHP [15], as in (1).

936 |Di-Rong Xu, Jun Gang, Lu Gan and Zhong-Qin Li ª1 «a « ef «  « «¬ aef

ª¬ aef º¼

A

1/ a

a

aef 1  aef

 aef º  aef »»   » »  1 »¼

(1)

a t0

fe Here $ is a reciprocal matrix, ef , and ef . (b)Mathematical analysis: Calculate the maximum eigenvalue and the corresponding eigenvector of the judgment matrix, as in (2), (3) and (4) [15].

Omax ˜ W

A ˜W 1/ m

W

(2) 1/ m

§ m · ¨ – aef ¸ ©f 1 ¹

§ m · ¨ – a fe ¸ ¦ e 1© f 1 ¹

(3)

Omax

1 m ( AW )e ¦ m e 1 We

(4)

m

Here W , Omax are the eigenvector and the corresponding largest eigenvalue of the matrix W , respectively. m is the number of criteria being compared in matrix A . a) Consistency checking: Carry out the consistency checking, as in (5) and (6) [15]:

CI

Omax  m m 1

CI RI

CR

(5) (6)

Here CI is the consistency index; CR is the consistency ratio; RI is the average random consistency index. It is acceptable when C R  0.10 [16]. b) Relative weight: Get the relative weight of each respondent:

Wi

w , w i1

i2

, , wij , , wim

(7)

Here i=1,2,···,n; j=1,2, ···,m.

3.2.2 The Calculation of the Comprehensive Satisfaction: Through combine the qualitative and quantitative method, the degree of satisfaction is defined as completely unaccepted as 1 points, unaccepted as 3 points, accept as 5

Economic Evaluation Saving Data Envelopment Analysis Method | 937

points, better than acceptable as 7 points, completely accepted as 9 points, in the middle as 2, 4, 6, 8, respectively. The questionnaire survey is used to obtain the satisfaction level of the consumer in different aspects, and then combines with the weight calculated by the AHP, the comprehensive satisfaction level was obtained, as in:

Vi

m

¦V j 1

ij

u W ij

(8)

3.2.3 Screening the Decision Making Unit: According to the consumer comprehensive satisfaction is calculated by (8), eliminating the comprehensive satisfaction of the survey less than 5 scores, and the rest of each survey as a decision making unit in DEA.

3.3 Build DEA Modeling 3.3.1 C2R Model in DEA: DEA is proposed first by Charnes et al in 1978 [17]. This paper uses the C2R model with non-Archimedes infinitesimal which is proposed by Charnes et al in 1981 [18]. The form of input and output data as shown in Table 1 and the C2R model as in (9): r m ª º min «T  H (¦ s  ¦ s )» VDH t 1 j 1 ¬ ¼ n ­  °¦ xi Oi  s T x0 °i 1 °n  s.t. ®¦ yi Oi  s y0 °i 1 °Oi t 0, i 1,2,, n °   ¯s t 0, s t 0, t 1,2,, r, j 1, 2,, m

(9)

relative efficiency score. H is an arbitrary small “non-Archimedean” Here T is the   s s number. , are the slack variable and the surplus variable, respectively. VD is H the optimum value. xi is the involvement of input by DMUi. y i is the produce of output by DMUi. O i is used to judge the return to scale of DMU.

938 |Di-Rong Xu, Jun Gang, Lu Gan and Zhong-Qin Li Table 1: The input and output data of decision making units DMU

Inputs

Outputs

1

2

···

r

1

2

···

m

1

x11

x21

···

xr1

y11

y21

···

ym1

2

x12

x22

···

xr2

y12

y22

···

ym2

n

x1n

x2n

···

xrn

y1n

y2n

···

ymn















3.3.2 Adjust the Ineffective Decision Making Unit to Effective: According to the calculation results of (9), the effective and ineffective decision making unit are determined through judging the T :

T 1, decision making unit is effective T z 1, decision making unit is ineffective

(10)

Based on (11), adjust the ineffective decision making unit to effective, as follows [19]: xˆ 0

T 0 x0  s 0

yˆ 0

y 0  s 0

(11)

Here T 0 , s0 , s 0 are the optimal solutions of the linear programming corresponding to the DMU. ( xˆ0 , yˆ 0 ) is the projection on the relative effective surface corresponding to the previous DMU ( x 0 , y 0 ) .

3.3.3 The Ideal Cost Control: According to the adjustment of each cost, the total cost of each decision making unit is calculated, that is, the ideal cost control, as follow:

Xˆ i

r

¦ xˆ t 1

it

(12)

Economic Evaluation Saving Data Envelopment Analysis Method | 939

4 Case Analysis 4.1 Acquire the Input and Output Parameter This paper takes the use of solar water heater in Xichang, Sichuan as a case analysis. Through the survey and application of AHP method referred in section A of chapter ċ, the input and output parameters are received. There are 61 valid questionnaires, as shown in Table 2. Table 2:The input and output parameter R Input (RMB) es p I2 o I1 n d e nt

Output I3

O1

R Input (RMB) es p I2 o I1 n d e nt

Output I3

O1

1

6350.0 0

17170.04 5587.13(4785.0 5)

6.887 3 7 2

4500.0 0

12167. 74

4488.02(3953. 6.9993 31)

2

7700.0 0

20820.36 4488.02(3953.3 1)

7.908 3 3 3

5300.0 0

14330. 90

5587.13(4785. 3.8575 05)

3

4500.0 0

12167.74 4488.02(3953.3 1)

8.817 3 3 4

2800.0 0

7571.0 4

3388.91(3121. 5.1123 56)

4

3650.0 0

9869.39

4488.02(3953.3 1)

8.575 3 2 5

3200.0 0

8652.6 2

4488.02(3953. 5.2000 31)

5

4500.0 0

12167.74 3388.91(3121.5 6)

8.817 3 3 6

3300.0 0

8923.0 1

4488.02(3953. 3.7754 31)

6

3750.0 0

10139.78 4488.02(3953.3 1)

7.908 3 3 7

3200.0 0

8652.6 2

4488.02(3953. 6.3327 31)

7

5300.0 0

14330.90 4488.02(3953.3 1)

5.181 3 3 8

3200.0 0

8652.6 2

4488.02(3953. 7.9341 31)

8

4500.0 0

12167.74 5587.13(4785.0 5)

8.817 3 3 9

3200.0 0

8652.6 2

5587.13(4785. 5.3328 05)

9

6350.0 0

17170.04 5587.13(4785.0 5)

8.572 4 2 0

4100.0 0

11086. 16

5587.13(4785. 4.7147 05)

1 0

3300.0 0

8923.01

4488.02(3953.3 1)

6.400 4 6 1

3750.0 0

10139. 78

5587.13(4785. 4.8177 05)

1 1

4500.0 0

12167.74 5587.13(4785.0 5)

8.260 4 5 2

3200.0 0

8652.6 2

4488.02(3953. 2.9997 31)

1 2

3750.0 0

10139.78 3388.91(3121.5 6)

9.000 4 0 3

3300.0 0

8923.0 1

4488.02(3953. 4.3329 31)

940 |Di-Rong Xu, Jun Gang, Lu Gan and Zhong-Qin Li 1 3

4100.0 0

11086.16 4488.02(3953.3 1)

8.778 4 6 4

4750.0 0

12843. 73

5587.13(4785. 6.0420 05)

1 4

4500.0 0

12167.74 4488.02(3953.3 1)

8.999 4 1 5

4500.0 0

12167. 74

5587.13(4785. 6.7149 05)

1 5

5300.0 0

14330.90 5587.13(4785.0 5)

8.789 4 6 6

3750.0 0

10139. 78

4488.02(3953. 9.0009 31)

1 6

4100.0 0

11086.16 4488.02(3953.3 1)

8.999 4 1 7

4500.0 0

12167. 74

5587.13(4785. 5.2675 05)

1 7

3750.0 0

10139.78 3388.91(3121.5 6)

9.000 4 0 8

3750.0 0

10139. 78

4488.02(3953. 5.0005 31)

1 8

3750.0 0

10139.78 5587.13(4785.0 5)

5.797 4 6 9

3750.0 0

10139. 78

4488.02(3953. 8.3060 31)

1 9

3650.0 0

9869.39

5587.13(4785.0 5)

6.999 5 3 0

3750.0 0

10139. 78

5587.13(4785. 5.2000 05)

2 0

4100.0 0

11086.16 5587.13(4785.0 5)

3.594 5 9 1

5300.0 0

14330. 90

4488.02(3953. 6.1137 31)

2 1

2800.0 0

7571.04

4488.02(3953.3 1)

5.800 5 0 2

4500.0 0

12167. 74

4488.02(3953. 4.9995 31)

2 2

4100.0 0

11086.16 5587.13(4785.0 5)

2.143 5 1 3

3300.0 0

8923.0 1

4488.02(3953. 5.0000 31)

2 3

2800.0 0

7571.04

3388.91(3121.5 6)

1.945 5 8 4

4500.0 0

12167. 74

5587.13(4785. 5.3217 05)

2 4

3300.0 0

8923.01

5587.13(4785.0 5)

5.999 5 4 5

3300.0 0

8923.0 1

4488.02(3953. 4.8524 31)

2 5

2800.0 0

7571.04

4488.02(3953.3 1)

4.999 5 5 6

3750.0 0

10139. 78

5587.13(4785. 4.9995 05)

2 6

3300.0 0

8923.01

3388.91(3121.5 6)

5.666 5 1 7

4500.0 0

12167. 74

5587.13(4785. 6.1099 05)

2 7

3750.0 0

10139.78 5587.13(4785.0 5)

4.787 5 6 8

7700.0 0

20820. 36

4488.02(3953. 6.3327 31)

2 8

3200.0 0

8652.62

3388.91(3121.5 6)

4.052 5 6 9

5300.0 0

14330. 90

5587.13(4785. 5.9458 05)

2 9

3300.0 0

8923.01

4488.02(3953.3 1)

5.666 6 1 0

3750.0 0

10139. 78

4488.02(3953. 8.1439 31)

3 0

3750.0 0

10139.78 4488.02(3953.3 1)

5.000 6 0 1

4000.0 0

10815. 77

4488.02(3953. 5.8577 31)

3 1

3750.0 0

10139.78 4488.02(3953.3 1)

2.333 1

Table 2 shows the consumer comprehensive satisfaction is less than 5, which the number is 20, 22, 23, 25, 27, 28, 31, 33, 36, 40, 41, 42, 43, 52, 55, 56. Therefore, 45 decision making units can be used for the DEA model.

Economic Evaluation Saving Data Envelopment Analysis Method | 941

4.2 DEA Model Application According to (9), the relative efficiency of each decision making unit for electricity and liquefied gas is calculated, respectively. Then adjust the ineffective decision making unit to effective by (11), and calculate the adjusted cost, initial cost and economic benefit. The results show in the Table 3. Table 3: The results of the adjusted cost, initial cost and economic benefit by using electricity and liquefied gas DMU

Electricity (RMB)

Liquid gas (RMB)

Adjusted cost Initial cost

Economic benefit

Adjusted cost

Initial cost

Economic benefit

1

13223.44

29107.16

26404.56

13017.40

28305.09

18215.31

2

15182.90

33008.38

18381.08

14947.02

32473.66

12143.54

3

17165.79

21155.76

18381.08

16771.09

20621.05

12143.54

4

17254.70

18007.41

18381.08

16759.81

17472.70

12143.54

5

16927.91

20056.66

10357.60

16665.98

19789.30

6071.77

6

15839.84

18377.81

18381.08

15398.58

17843.09

12143.54

7

9947.33

24118.92

18381.08

9793.98

23584.20

12143.54

8

17770.51

22254.87

26404.56

17187.98

21452.80

18215.31

9

16502.19

29107.16

26404.56

16201.35

28305.09

18215.31

10

13108.13

16711.03

18381.08

12691.93

16176.32

12143.54

11

16648.87

22254.87

26404.56

16102.47

21452.80

18215.31

12

17278.69

17278.70

10357.60

17011.34

17011.34

6071.77

13

17332.96

19674.19

18381.08

16892.50

19139.47

12143.54

14

17519.09

21155.76

18381.08

17117.53

20621.05

12143.54

15

17254.17

25218.02

26404.56

16773.76

24415.95

18215.31

16

17767.76

19674.19

18381.08

17317.39

19139.47

12143.54

17

17278.69

17278.70

10357.60

17011.34

17011.34

6071.77

18

11939.45

19476.91

26404.56

11548.86

18674.84

18215.31

19

14415.08

19106.52

26404.56

13943.36

18304.45

18215.31

20

11946.04

14859.06

18381.08

11555.09

14415.94

12143.54

21

12355.29

17810.14

26404.56

11951.01

17237.05

18215.31

22

11078.22

15611.92

10357.60

10876.23

15665.14

6071.77

23

11604.14

16711.03

18381.08

11236.07

16634.28

12143.54

24

10015.90

18377.81

18381.08

9735.19

18346.85

12143.54

25

13626.42

21155.76

18381.08

13312.94

21216.40

12143.54

26

10259.42

13759.95

10357.60

10031.75

14179.54

6071.77

942 |Di-Rong Xu, Jun Gang, Lu Gan and Zhong-Qin Li 27

10709.65

16340.64

18381.08

10359.20

16538.66

12143.54

28

13043.10

16340.64

18381.08

12616.29

16630.25

12143.54

29

16340.64

16340.64

18381.08

15805.93

16676.05

12143.54

30

10983.15

17439.74

26404.56

10623.85

17553.59

18215.31

31

12067.95

23180.86

26404.56

11692.92

23523.69

18215.31

32

13533.18

22254.87

26404.56

13090.50

22643.50

18215.31

33

18028.63

18377.81

18381.08

17525.49

19079.59

12143.54

34

10615.57

22254.87

26404.56

10269.46

22735.09

18215.31

35

10015.90

18377.81

18381.08

9736.97

19171.18

12143.54

36

16637.43

18377.81

18381.08

16172.98

19216.97

12143.54

37

10710.13

19476.91

26404.56

10359.63

20094.52

18215.31

38

11736.50

24118.92

18381.08

11556.26

25049.68

12143.54

39

10240.52

16711.03

18381.08

9914.46

17733.38

12143.54

40

10724.62

22254.87

26404.56

10374.57

23055.66

18215.31

41

12313.62

22254.87

26404.56

11910.59

23193.05

18215.31

42

12157.68

33008.38

18381.08

11969.97

34259.71

12143.54

43

11670.90

25218.02

26404.56

11348.53

26247.80

18215.31

44

16312.14

18377.81

18381.08

15857.16

19720.73

12143.54

45

11611.23

19303.79

18381.08

11308.37

20692.51

12143.54

4.3 Result and Discussion

Account (100 RMB)

Based on the data in Table 3, the change and relationship among the adjusted cost, initial cost and economic benefit in two cases of electricity and liquefied gas are analyzed, as shown in Fig. 3 and Fig. 4.

400

Adjusted cost

200 0

Intial cost

1 4 7 10 13 16 19 22 25 28 31 34 37 40 43

Economic benefit

Fig. 3: The change and relationship among the adjusted cost, initial cost and economic benefit with electricity

Account (100 RMB)

Economic Evaluation Saving Data Envelopment Analysis Method | 943

400

Adjusted cost

200 0

Intial cost 1 4 7 10 13 16 19 22 25 28 31 34 37 40 43

Economic benefit

Fig.4: The change and relationship among the adjusted cost, initial cost and economic benefit with liquefied gas

From the Fig. 3 and Fig. 4, the initial cost is obviously higher than the economic benefit. However, through the application of DEA, the adjusted cost is markedly reduced, and even less than the economic benefit. It shows if the cost is controlled and optimized reasonably, using solar water heater will not bring the increased cost, on the contrary, bring economic benefit.

5 Conclusions This paper explores the economy of renewable energy saving technology, and puts forward an AHP-DEA integrated algorithm based on consumer satisfaction. Take the use of solar water heater in Xichang as an example. On the one hand, the effectiveness of the model is verified. On the other, the results show that the adjusted cost is obvious lower than the initial cost, even less than the economic benefit, through a comprehensive analysis of the adjusted cost, initial cost and economic benefit. Besides, in order to promote the application of energy saving technology, cost is advised to consider and control. Decline cost is not only a huge challenge for developers, but also a great potential to promote the energy saving technology. There are three worthy areas advised to research further. First, explore the ideal cost control of the different energy saving technologies in the different regions. Second, establish a preferable model to solve the cost control of green building energy saving technology. Third, apply the model into more energy saving technologies or areas. Further research in each area mentioned above, there is a great significance to the sustainable development strategy. Acknowledgement: This research was supported by the Youth Funds of Sichuan Provincial Education Department (Grant NO.14ZB0014), the Key Funds of Sichuan Social Science Research Institution “System Science and Enterprise Development Research” (Grant NO.Xq15B09; Xq15C14), and the Humanities Social and Sciences Research Funds of Education Ministry (Grant NO.15XJC630001).

944 |Di-Rong Xu, Jun Gang, Lu Gan and Zhong-Qin Li

References [1] [2] [3]

[4]

[5]

[6]

[7]

[8] [9]

[10]

[11]

[12]

[13]

[14]

[15] [16] [17]

United Nations Environment Programme, “Towards a green economy: pathways to sustainable development and poverty eradication,” http://web.unep.org/greeneconomy/, 2011. J. Li and D. Sun, “Incremental cost statistical analysis of green ecological technology in residential buildings,” Housing Science, vol. 28, Aug. 2008, pp. 16–19. Z. Zhao and C. Han, “Application analysis of energy saving building and green building,” New Technologies and Products of China, 2011, vol. 28, pp. 175–176, doi:10.3969/j.issn.16739957.2011.13.174. L. Tang, C. Liu, X. Yang, X. Xu and X. Meng. “Incremental cost analysis of water saving design in green residential building,” Architecture Technology, vol. 46, Dec. 2015, pp. 1135-1138, doi:10.3969/j.issn.1000-4726.2015.12.022. B. H. Gebreslassie, G. Guillén-Gosálbez, L. Jiménez and D. Boer, “Solar assisted absorption cooling cycles for reduction of global warming: a multi-objective optimization approach,” Solar Energy, vol. 86, July 2012, pp. 2083-2094, doi:org/10.1016/j.solener.2012.04.010 H. Chai, X. Hu, S. Peng and Y. Wang, “Incremental-cost economy model in full life cycle of water-saving projects for green building,” Journal of south China university of technology (natural science edition), vol. 38, Nov. 2010, pp. 59-63, doi:10.3969/j.issn.1000565X.2010.11.011. Y. Liu, X. Guo and F. Hu, “Cost-benefit analysis on green building energy efficiency technology application: a case in China,” Energy & Buildings, vol. 82, Oct. 2014, pp. 37-46, doi:org/10.1016/j.enbuild.2014.07.008 J. Li and Z. Tian, “Incremental cost-benefit of life cycle green buildings,” Journal of Engineering Management, vol. 25, Oct. 2011, pp. 487-492, doi:10.3969/j.issn.1674-8859.2011.05.003. F. Wang and P. Yu, “The establishment of evaluation index system of green building economy and the comparison of the schemes,” Journal of Henan Normal University (Natural Science Edition), vol. 40, Mar. 2012, pp. 167-170, doi:10.3969/j.issn.1000-2367.2012.02.043. A. Masternak-Janus, “Comprehensive regional eco-efficiency analysis based on data envelopment analysis: the case of polish regions,” Journal of Industrial Ecology, vol. 481, Jan. 2016, pp. 196, doi:10.1111/jiec.12393. I. C. Mell, J. Henneberry, S. Hehl-Lange and B. Keskin, “To green or not to green: Establishing the economic value of green infrastructure investments in the Wicker, Sheffield,” Urban Forestry & Urban Greening, vol. 18, Aug. 2016, pp. 257-267, doi:org/10.1016/j.ufug.2016.06.015. C. K. Chau, M. S. Tse and K. Y. Chung, “A choice experiment to estimate the effect of green experience on preferences and willingness-to-pay for green building attributes,” Building & Environment, vol. 45, Nov. 2010, pp. 2553-2561, doi:org/10.1016/j.buildenv.2010.05.017. J. Wang and M. Wang, “Analysis of green building incremental cost effectiveness based on perspective of consumers' demand,” Journal of Engineering Management, vol. 29, Nov. 2015, pp. 6-11, doi:10.13991/j.cnki.jem.2015.05.002. R. T. Edwards and N. Bray, “The warm homes for health project: exploring the costeffectiveness of improving population health through better housing,” Lancet, vol. 384, Nov. 2014, pp. S80, doi:org/10.1016/S0140-6736(14)62206-6. T. L. Saaty, “The analytic hierarchy process,” New York: McGraw-Hill; 1980. S. Si, “Mathematical modeling algorithm and application,” National Defense Industrial Press, Beijing, China, 2011. A. Charnes, W. Cooper and E. Rhodes, “Measuring the efficiency of decision making units,” European Journal of Operational Research, vol. 2, Nov. 1978, pp. 429-444, doi: 10.1016/03772217(78)90138-8.

Economic Evaluation Saving Data Envelopment Analysis Method | 945 [18]

[19]

A. Charnes, W. W. Cooper and E. Rhodes, “Evaluating program and managerial efficiency: an application of data envelopment analysis to program follow through,” Management Science, vol. 27, Jun. 1981, pp. 668-697, http://www.jstor.org/stable/2631155. Z. Ma, “Data envelopment analysis model and method,” Science Press, Beijing, China, 2010.

Zhi-Yong Huang1, Hong-Bo Liu2* and Ping He3

Study on Modified Zeolite for Absorption of Fluoride in Water Abstract: Three methods as high temperature calcinations, acid treatment and basic treatment were used to modify natural zeolite. Treatment conditions as temperature, acid concentration, basic concentration and absorption time were studied. Finally, the best modification condition was obtained: natural zeolite was cooled down to room temperature after calcined at 400oC for 2h, and was then soaked in 8% hydrofluoric acid for 50min under 45oC, and it was finally washed by deionized water thoroughly. The absorption ability of modified zeolite was studied. The results showed that absorption ability of zeolite for fluoride in water was greatly improved after modification. The absorption ability reaches 0.272mg/g for fluoride water with concentration of 20mg/L. Keywords: modified zeolite; absorption ability; high temperature calcinations; acid treatment; basic treatment

1 Introduction Fluorine is one of the essential trace elements for life. Appropriate amount of intake of fluorine plays a promoter role to teeth and bones formation, while excessive intake of fluorine will harm humans’ health [1-3]. Therefore, it is quite important to find out an economic and effective method to reduce the fluoride in water. Zeolite is a kind of normal absorber [4]. But natural zeolite only has ability to absorb fluoride in water after modification. In this paper, natural zeolites were used as raw materials and were modified in order to remove fluoride in water.

|| 1 School of Materials and Environmental Science, Beijing Institute of Technology, Zhuhai, Zhuhai, China, E-mail: [email protected] 2 School of Materials and Environmental Science, Beijing Institute of Technology, Zhuhai, Zhuhai, China, E-mail: [email protected] 3 School of Materials and Environmental Science, Beijing Institute of Technology, Zhuhai, Zhuhai, China 10.1515/9783110516623-093 DOI 10.1515/9783110303568-093

948 | Zhi-Yong Huang, Hong-Bo Liu and Ping He

2 Experimental 2.1 Pretreatment Method of Zeolite Natural orthorhombic zeolite with particle size of 0.5~1.0mm was used in the experiment. At first, zeolite was washed with deionized water for 3-5 times and it was then dried in oven at 105 oC.

2.2 Modification Method of Zeolite 2.2.1 High Temperature Calcinations Method The obtained zeolite was put in muffle furnace at certain temperature (room temperature, 300oC, 400 oC, 500 oC, 600 oC) calcined for a different period of time (50min, 80min, 120min, 150min, 200min). 3g calcined zeolite was weighed and put in fluoride-containing water absorbed for 30 min at 45 oC in a thermostatic oscillator. The above clear solution was cooled down to room temperature in order to test its potential value.

2.2.2 Hydrochloric Acid Soaking Method The obtained zeolite was first soaked in hydrochloric acid with different solution concentration (2%, 4%, 6%, 8%, 10%) and was then put in a thermostatic oscillator for a different period of time (20min, 30min, 50min, 80min, 120min) at 45 oC. It was finally washed by deionized water and dried. It was then treated as above 1).

2.2.3 Sodium Hydroxide Solution Soaking Method The obtained zeolite was first soaked in sodium hydroxide solution with different solution concentration (0.5mol/L, 1mol/L, 1.5mol/L, 2mol/L, and 2.5mol/L) and was then treated as above 2).

Study on Modified Zeolite for Absorption of Fluoride in Water | 949

2.3 Preparation of Reagent 2.3.1 Preparation of Fluoride Ion Standard Storage Solution 0.2211g NaF was weighted by analytical balance, which was dried at 120 oC for 2h. 100mg/L fluoride ion storage solution was obtained by dissolving NaF in a 1000mL volumetric flask.

2.3.2 Preparation of Fluoride Ion Standard Solution 200mL the above fluoride ion storage solution was sucked up by pipette, and was then transferred into a 1000mL volumetric flask. Deionized water was added to dilute the solution to reach the standard calibration line. Finally, 20mg/L fluoride ion standard solution was obtained after shaking the mixture.

2.3.3 Preparation of Total Ionic Strength Adjustment Buffer 58.8g trisodium citrate dihydrate (C6H5Na3O7•2H2O) and 85.0g NaNO3 were weighted and dissolved by deionized water. The pH value of the solution was adjusted by hydrochloric acid to 5~6. The solution was then transferred to a 1000mL volumetric flask, diluted by deionized water to reach the standard calibration line, shaked the mixture, and finally the total ionic strength adjustment buffer was obtained.

2.4 Experiment Method 2.4.1 Drawing of Fluoride Standard Curve 1.00, 3.00, 5.00, 10.00, 20.00, 30.00mL fluoride ion standard solution was sucked up by pipette respectively and transferred into a 50mL volumetric flask. 10mL total ionic strength adjustment buffer was added into the above flask respectively. Deionized water was added to dilute the solution to reach the standard calibration line, the mixture was shaked and transferred to a 100mL beaker. The beaker was put on a magnetic stirrer and an electrode was put into the solution in the order of solution concentration from low to high. The value of potential was read when it was stable. The standard curve is: E = AC + B E is the value of potential and C is the concentration of fluoride.

(1)

950 | Zhi-Yong Huang, Hong-Bo Liu and Ping He 2.4.2 Absorption of Fluoride 3g zeolite was put in a PE bottle containing 50mL fluoride solution with concentration of 20mg/L. It was then put in a thermostatic oscillator for 30 min at 45 oC with rate of 120r/min. The value of potential E was measured by fluorine selective electrode. The concentration of fluoride was obtained by the standard curve. Adsorption capacity of fluoride was calculated by the following formula: Q = (C0-C) V / m

(2)

Q is the adsorption capacity of fluoride (mg/g), C0 and C is initial concentration and equilibrium concentration, respectively (mg/L), m is the mass of the zeolite (g), V is the volume of the water sample (L).

3 Results and Discussion 3.1 Fluoride Standard Curve Fig. 1 is the obtained fluoride standard curve. Its equation is: E = -63.352lgC + 233.

3.2 Calcination Temperature The absorption capacity of fluoride of zeolites with different calcination temperature is showed in fig.2. It can be observed that the zeolite without calcination almost has no absorption capacity. After calcination at high temperature, the absorption capacity of fluoride has obviously increased. It reaches a max value of 1.51 mg/g at 400 oC. While after that, the absorption capacity of fluoride becomes decreased with the increase of the calcination temperature. Thus 400 oC is chosen as the calcination temperature.

Study on Modified Zeolite for Absorption of Fluoride in Water | 951

Fig. 1: The obtained fluoride standard curve

Fig.2: The absorption capacity of fluoride of zeolites with different calcinations temperature

3.3 Calcination Time The absorption capacity of fluoride of zeolites with different calcination time is showed in fig.3. It can be observed that the zeolites with different calcination time has similar curve with calcination temperature. The absorption capacity of fluoride is increased with calcination time from 50min to 120min. But it is decreased when continue to extend calcination time. And the value keeps unchanged from 150min to 200min. It means that 120min has the best absorption capacity of fluoride of modified zeolite. Thus 120min is chosen as the calcination temperature.

952 | Zhi-Yong Huang, Hong-Bo Liu and Ping He

Fig.3: The absorption capacity of fluoride of zeolites with different calcinations time

3.4 Hydrochloric Acid Concentration The absorption capacity of fluoride of zeolites with different hydrochloric acid concentration is showed in fig.4. It can be observed that the absorption capacity of fluoride is increased with increase of hydrochloric acid concentration. It has a max value when the hydrochloric acid concentration is 8%. The absorption capacity of fluoride is decreased when continue to increase concentration of hydrochloric acid. Thus hydrochloric acid concentration of 8% is chosen as the best modification condition.

Fig.4: The absorption capacity of fluoride of zeolites with different hydrochloric acid concentration

3.5 Sodium Hydroxide Solution Concentration The absorption capacity of fluoride of zeolites with different sodium hydroxide solution concentration is showed in fig.5. It can be observed that the absorption capacity of fluoride is increased with increase of sodium hydroxide solution concentration.

Study on Modified Zeolite for Absorption of Fluoride in Water | 953

The max value of absorption capacity of fluoride is 0.59 mg/g when the sodium hydroxide solution concentration is 2.5mol/L. Thus 2.5mol/L is chosen as sodium hydroxide solution concentration to modify zeolite.

Fig.5: The absorption capacity of fluoride of zeolites with different sodium hydroxide solution concentration

3.6 Soaking Time The absorption capacity of fluoride of zeolites with different soaking time is showed in fig.6. It can be observed that with the extent of soaking time, the absorption capacity of fluoride of both methods are increased at first, and it then becomes decreased. For the hydrochloric acid soaking method, soaking 50min reaches the best absorption capacity, while 30min is best for sodium hydroxide solution soaking method. It is also can be concluded that the hydrochloric acid soaking method shown much better absorption capacity of fluoride than the sodium hydroxide solution soaking method at the same soaking time.

954 | Zhi-Yong Huang, Hong-Bo Liu and Ping He

Fig.6: The absorption capacity of fluoride of zeolites with different soaking time

3.7 Absorption Time Absorption time is an important factor to affect the absorption capacity of fluoride. The absorption capacity of fluoride of zeolites with different absorption time is showed in fig.7. It can be observed that with the extent of absorption time, the absorption capacity of fluoride is increased, and 30min reaches a max value. The absorption capacity then becomes stable and then decreased when extent absorption time. Therefore, 30min is enough for zeolite to absorb fluoride in water.

Fig.7: The absorption capacity of fluoride of zeolites with different absorption time

Study on Modified Zeolite for Absorption of Fluoride in Water | 955

3.8 Absorption Temperature Absorption temperature is also an important factor to affect the absorption capacity of fluoride. The absorption capacity of fluoride of zeolites with different absorption temperature is showed in fig.8. It is shown in the figure that the absorption capacity decreases with the growth of the absorption temperature. Room temperature has the best absorption capacity of fluoride. It can be concluded that lower temperature has better absorption capacity.

Fig.8: The absorption capacity of fluoride of zeolites with different absorption temperature

4 Conclusions Nature zeolites were modified and their absorption capacities of fluoride were studied in this paper. Three methods of high temperature calcination, hydrochloric acid treatment, and sodium hydroxide solution treatment were used and effect of calcination temperature and time, hydrochloric acid and sodium hydroxide solution concentration, soaking time, absorption time and temperature were studied. The results show that the best modification conditions of nature zeolite are as below: natural zeolite was cooled down to room temperature after calcined at 400 oC for 2h, and then was soaked in 8% hydrochloric acid for 50min under 45 oC, and finally washed by deionized water thoroughly. The modified zeolites were obtained. The absorption ability of modified zeolite was greatly improved after modification. The absorption ability reaches 0.272mg/g for fluoride water with concentration of 20mg/L, and the removal rate of fluoride in water reaches 81.6%.

956 | Zhi-Yong Huang, Hong-Bo Liu and Ping He

References [1] [2]

[3] [4]

S. Xingbin and X. Chengju, “Study on modification and fluoride-adsorption capacity of zeolite,” [J]. Harbin Univer. Commer. Harbin, vol. 24, pp. 539–542, May 2008. S. Zhenhua and Z. Yuxian, “An Experimental Study on Fluoride Removal of Drinking Water by Modified Zeolite,” Sinosteel Corp. Wuhan Safe. Envir. Protec. Resear. Ins. Wuhan, vol. 32, pp. 14–16, March 2006. M. Zhijun and L. Bingchuan, “Study on Modification and Fluorine Removal of Natural Zeolite from Fuxin,” Chin. Cera. Soc. Beijing, vol. 33, pp. 676–681, March 2014. Y. Yanguo, L. Bingchuan and M. Zhijun, “Study on the Preparation of Modified Zeolite and Its Fluorine Removal Performance,” Chin. Cera. Soc. Beijing, vol. 33, pp. 1949–1654, July 2014

Ming-Liang Zhang1

Removal of Heavy Metal Ions from Aqeous Solution Using Bottom Ash as an Adsorbent Abstract: The objective of the present study was to evaluate bottom ash as one low cost material to remove Cd and Ni from aqueous solution. Various factors such as pH, contact time, and multiple-solute competitive effect were investigated. The adsorption of Cd and Ni on bottom ash fit the Freundlich isotherm model well. Adsorption efficiency increased with increasing pH and the maximum was achieved at around 6.0. The adsorption processes reached equilibrium within 120 min and followed pseudo-second-order kinetic model. The adsorption occurred through physical mechanism and surface complex. The energy-dispersive X-ray (EDS) patterns of bottom ash provided a direct evidence for Cd and Ni adsorption on the surface of bottom ash. Keywords: Adsorption, bottom ash, heavy metal, mechanism

1 Introduction Heavy metals (e.g. Cd and Ni) have been considered as one of the most severe contaminants, which can result in serious environmental pollution. The removal of heavy metals has become one of the key problems in the world for recent years. The most common treatment processes used for the removal of heavy metals from aqueous solutions include chemical precipitation, solvent extraction, membrane separation, ion-exchange, reverse osmosis, oxidation-reduction, electrochemical treatment and adsorption [1]. These common adsorbents include activated carbon, clay minerals, oxides of alumina, silica and ferric, etc., but high cost of these materials has limited their practical applicability on a large scale [2]. Numerous agricultural, industrial and natural waste materials have been used as adsorbents in recent years, but there is still a growing demand to find new low-cost and efficient adsorbents for the heavy metals removal [3]. Coal ash is one kind of solid waste generated from coal burning power plants. The amounts of coal ash are enormous, such as, nearly 140 million tons were produced in 2010 in the USA, and the production exceeded 370 million tons in 2009 in China. The proper disposal of the large amounts of coal ash has become a heavy burden to mining company since it can cause serious contamination of surrounding || 1 School of Resources and Environment, University of Jinan, Jinan, China, email:[email protected] 10.1515/9783110516623-094 DOI 10.1515/9783110303568-094

958 | Ming-Liang Zhang environment if not properly disposed. Currently, coal ash has been studied as a potential adsorbent for the treatment of wastewater containing heavy metals or organic compounds, because of its major chemical components and physical properties (e.g., specific surface area and porous structure) [4]. Much work on heavy metal adsorption by fly ash and other industrial waste has been studied in recent years, but most of them focused on single heavy metal adsorption, there is little information available for the simultaneous removal of Cd and Ni from wastewater by bottom ash [5]. In the present study, bottom ash was used as one low-cost adsorbent for the treatment of synthetic wastewater containing Cd and Ni. The adsorption of the two heavy metal ions on bottom ash was evaluated under various conditions such as pH, and contact time. Since wastewater usually contains several heavy metals, the competitive adsorption and interaction of multiple metals were also investigated.

2 Materials and Methods 2.1 Materials and Chemicals Bottom ash was collected from one coal burning thermal power plant in Jinan city, China. The chemical composition of the bottom ash was determined by X-ray fluorescence spectroscopy (XRF, Bruker S8 tiger, Germany). The paste pH of bottom ash was measured by pH meter (Leici, China) in 1:2.5(w/v) ash/water suspensions. The point of zero charge (pHPZC) was determined by measuring the surface charge of the sample in deionized water at various pHs using Zeta Meter electrophoresis (Malvern, UK). The specific surface area of bottom ash sample was determined by the N2 gas adsorption method with the data being subjected to BET analysis (Micromeritics, ASAP 2020, USA). Surface morphology of bottom ash samples was examined by a scanning electron microscope (SEM, Quanta FEG 250, and USA) and energy dispersion spectrometer (EDS, X-Max50) was used to analyze the chemical constituents of the adsorbent before and after adsorption of metal ions. Fourier transform infrared (FTIR) spectra were analysed in the wavenumbers range of 400–4,000 cm−1 using FTIR spectrometer (Nicolet 380, Thermo Scientific, USA). The aqueous solutions of Cd (II) and Ni (II) were prepared by dissolving Cu (NO3)2, Ni (NO3)2 in distilled water. Lower concentrations were prepared by further dilution of the stock solution with deionized water.0.5 mol/L NaOH and HNO3 were used for solutions pH adjustment. All chemicals were of analytical reagent grade. The concentrations in of Cd and Ni in the following experiments were measured by an atomic absorption spectroscopy (AA-7000 model spectrometer, Shimadzu, Japan).

Removal of Heavy Metal Ionsg Bottom Ash as an Adsorbent | 959

2.2 Adsorption Experiment Adsorption experiments were conducted in 50 mL plastics bottles. Bottom ash samples were dried at 105 °C for 24 h in an oven to remove moisture and prepared for use. In adsorption isotherm experiments, 0.5 g bottom ash and 50 mL heavy metal solution with different molar concentrations were put into polypropylene centrifuge tubes. The pH of the solutions was adjusted to be 5.0. The mixtures were put into a thermostatic water bath shaker with a speed of 200 rpm for 120 min, which was enough to reach adsorption equilibrium. And then the mixtures were centrifuged and filtered for heavy metal concentration analysis. The effect of contact time on metal adsorption was studied. For the effect of contact time on adsorption studies, 0.5 g bottom ash and 50 mL of 0.8 mmol/L and 1.6 mmol/L heavy metal solution were agitated at 200 rpm in a water bath shaker. At required time intervals, samples were collected and filtered through for metal ion concentration analysis.In order to study the pH effect on single heavy metal adsorption on bottom ash; 0.5 g bottom ash and 50 mL single heavy metal (0.4 mmol/L) solution were added into plastics bottles and agitated. The solution pH was adjusted within the range of 2.0-7.0 by drop wise addition of HNO3 or NaOH.

3 Results and Discussion 3.1 Characteristics of Bottom Ash The chemical composition of the bottom ash is given as follows: SiO2 (42.95%), Al2O3 (17.13%), Ca (28.53%), Na2O (0.65%), CaO (7.55%), MgO (0.71%), Fe2O3 (4.13%), K2O (1.13%), etc. The point of zero charge (pHPZC) is 5.3, which indicates at pH less than 5.3 the surface of the adsorbent is predominated by positive charges, while at pH greater than 5.3 the surface is distributed by negative charges. The specific surface area of bottom ash was found to be 3.39 m2/g. The paste pH of bottom ash is 12.6. The SEM image of bottom ash is shown in Fig. 1. ()

960 | Ming-Liang Zhang

Fig. 1: SEM image of bottom ash sample

3.2 Effect of pH The pH of heavy metal solutions has been considered as one important variable affecting the adsorption of heavy metals, because solution pH determines the surface charge of the adsorbent and the chemical speciation of heavy metal ions [6-9]. Fig. 2 shows the removal efficiency of the two heavy metals as a function of pH. As shown, the adsorption efficiencies of the two heavy metals increased with increasing pH. Such as, it increased from 43.63% to 98.84% as pH increased from 4.0 to 6.0 for Cd, and it increased from 33.33% to 95.53% as pH from 4.0 to 6.0 for Ni. The surface charge development of the bottom ash is pH dependent. Bottom ash surface is negatively charged at pH>pHZPC, which can increase adsorption of metal ions because of electrostatic attraction between metal ions and bottom ash surface. With pH increasing, the adsorption efficiency of Cd and Ni increased and reached the adsorption maximum at pH around 6.0, which was larger than pHZPC.

Removal of Heavy Metal Ionsg Bottom Ash as an Adsorbent | 961

Fig.2: Effect of pH on the adsorption of Cd and Ni

3.3 Adsorption Isotherm The Langmuir and Freundlich isotherm models were used to fit the experimental data [10]. The Langmuir isotherm assumes monolayer coverage of adsorbate over a homogeneous adsorbent surface, and the biosorption of each molecule onto the surface has equal biosorption activation energy. The Freundlich isotherm is an empirical expression that assumes the heterogeneity of the surface and multilayer adsorption to the binding sites. It was found that the Langmuir isotherm model was not suitable for the adsorption of the two heavy metals on bottom ash (correlation coefficient (R2) ta, V V 0 >V s , then

H (t )

V Vs Ks

§ A § t  ta ¨1  ˜ exp ¨ n © nt0 ©

·· ¸¸ ¹¹

(4)

Integrating the both side of Equation 4 with t from ta to t, we can get the creep equation

H (t )

(V 0  V s ) § § t  ta · · ¨ t  At0 exp ¨ ¸¸ Ks © nt0 ¹ ¹ ©

(5)

Combining the Maxwell and Kelvin model, the stress-strain relationship of the total nonlinear MKBM model can be expressed as E  Kt ­ V V V  t (1  e K K ), °H EM K M EK ° 0  V  Vs. ° EK °  t V V V (V  V s ) °H t t,  (1  e KK )  ° Ks EM K M EK ° V t V s t d t a . ® E °  Kt V V V °H t  (1  e K K )  EM K M EK ° ° (V  V s ) § § t  ta · · ° ¨ t  At0 exp ¨ ¸¸,  ° Ks © © nt0 ¹ ¹ ° V t V s , t ! ta . ¯

(6)

Expanded the one dimensional form to three dimensional form by using the isotropic elastic constitutive relationship

Vm

3K H m , Sij

2Geij

(7)

Where K and G are the bulk modulus and shear modulus, respectively. Sij and eij are the deviatoric stress and strain tensors, respectively. σm=σii/3 and Hm=Hii/3 are the spherical stress and strain tensor, respectively. The three dimensional form can be expressed as

A Nonlinear Rheological Model the Tertiary Creep Stage | 1025

G  Kt ­ 1 1 t 1 V mG ij  Sij  Sij  (1  e KK ) Sijˈ ° H ij 2GM 3K 2K M 2GK ° ° F  0. ° ° G  Kt 1 1 t 1 °H ij V mG ij  Sij  Sij  (1  e KK ) Sij  ° 2GM 3K 2K M 2GK ° m ° 1 § F · wF ® tˈ F t 0, t d ta . ° K s ¨© F0 ¸¹ wV ij ° G  Kt ° 1 1 t 1 Sij  V mG ij  Sij  (1  e KK ) Sij  ° H ij 2GM 3K 2K M 2GK ° ° m ° ° 1 ¨§ F ¸· wF §¨ t  At0 exp ¨§ t  ta ¸· ·¸ , F t 0, t ! ta . © nt0 ¹ ¹ ¯° K s © F0 ¹ wV ij ©

(8)

Where F0=1 is the initial yield function, F is the yield function

F

J2 V s / 3

(9)

Where J2=[(σ1-σ2)2+(σ2-σ3)2+(σ3-σ1)2]/6 is the second invariant of deviatoric stress tensor, σi are the principal stresses, σs is the long-term stress strength.

3 Model Verification According to the results of the trixial test, using the proposed model the parameters with confining stress 15MPa can be obtained and showed in Table 1 and the comparison of the theoretical curves and the test curves can be seen in Figs. 3-4.

1026 | Mo-Li Zhao and Wen Wang

Fig. 3: Theoretical curves of diabase with 15Mpa confining stress loading between 15MPa-120MPa

Fig. 4: Theoretical curves of diabase with 15MPa confining stress loading between 140MPa-180MPa

It is observed from Figs. 3-4 that the theoretical values of the model were consistent with the test results. The nonlinear rheological model can describe the accelerated creep stage and illustrate the rationality of the model.

A Nonlinear Rheological Model the Tertiary Creep Stage | 1027 Table 1: Rheological parameters of diabase with 15mpa confing pressure σ(MPa)

K(GPa)

GM(GPa)

G (GPa)

KK(GPa·h)

15

29.07

23.48

1.55e8

0.15

40

27.22

16.00

2.47e8

0.15

60

28.93

15.94

2755.55

0.15

80

32.94

16.15

612.36

14.60

100

34.33

16.32

773.47

7.02

120

37.52

16.31

752.61

110.67

140

38.48

16.40

845.47

40.38

160

40.99

16.35

1084.83

1036.74

170

40.47

15.22

596.33

15.19

9804.22

180

42.23

13.99

157.93

479.89

4875.98

Average

35.218

16.616

Ks(GPa·h)

A

n

6.85

0.86

3860.07

4 Numerical Simulation A cylinder specimen with the height 100mm and diameter 50mm (see Fig. 5) is used to illustrate the model. The sample is divided into 8000 units, 8421 nodes. The bottom surface of the model is constrained by the vertical Y coordinate direction, and the top surface of the specimen is loaded with uniform distribution. The Cvisc rheological model of FLAC3D and the self-defined creep model are used to compare the results with the same specimen and the same conditions.

1028 | Mo-Li Zhao and Wen Wang

Fig. 5: computational model mesh figure compression with

The parameters of the Cvisc model are used with bulk modulus K=10GPa, Kelvin shear modulus Kshear=20GPa, Maxwell shear modulus mshear=15GPa, Kelvin viscosity kvisc=5GPa˜d, cohesion c =5MPa, friction angle φ=45º. The pressures of 5MPa, 10MPa, 15MPa, 20MPa, 25MPa were applied to the top of the model as five increasing progressive stages and the creep time of each stage was 10 days except for the 25MPa load. The additional parameters of the self-defined creep model are ta=40.0, A=2.5, n=3, Ks=5e10Pa˜d with the same loading conditions. The displacement over time curves of the center point at the top surface is shown in Fig. 6 with Cvisc model and Fig. 7 with self-defined model.

A Nonlinear Rheological Model the Tertiary Creep Stage | 1029

Fig. 6: Displacement time curve of uniaxial CVISC model in dry condition

Fig. 7: Displacement time curve of uniaxial compression with self-defined model in dry condition

1030 | Mo-Li Zhao and Wen Wang

Fig. 8: Displacement time curves comparison of uniaxial compression with CVISC model and selfdefined model in dry condition

Fig. 9: Displacement time curves comparison of uniaxial compression with self-defined model in dry and saturated condition

Fig. 8 shows the comparison diagram of displacement over time based on the Cvisc model and the self-defined model in dry condition. It can be seen from the Figure 8 that the curves have the good consistency at the medium and low stress load which verifies the correctness and the feasibility of the self-defined model vis-

A Nonlinear Rheological Model the Tertiary Creep Stage | 1031

coelastic strain. When the load reaches 25MPa exceeded the instantaneous plastic yield strength, the deformation of Cvisc model increases rapidly. It cannot be shown the viscoplastic deformation to describe the accelerate creep progress, while the self-defined model can do this. The phenomenon is consistent with the experiment of the second part. Fig. 9 shows the comparison diagram of displacement over time based on the self-defined model in dry and saturated condition. The instantaneous deformation in saturated condition is smaller than that of the dry condition, but it increases rapidly and exceeds the dry condition. The creep deformation of each stage is larger than that in the dry state, which is in agreement with the experimental results.

5 Conclusion From the data of the trixial creep test, it is shown that the time-dependent behavior has great impact on the whole deformation progress. Considering the viscoelastoplastic properties, a rheological model named nonlinear MKBM model consists of Maxwell model, Kelvin-Voigt model and a modified Bingham model is established. Model verification and numerical simulation show that the model can describe the stress-strain relationship in the whole process. The deformation of self-defined has the good consistency with that of the Cvisc model at the medium and low stress load. Self-defined model can describe the accelerated creep stage but the Cvisc cannot, which illustrate the rationality of the self-defined model. Acknowledgement: The authors appreciate the support of the National Natural Science Foundation of China (No.51509145), the Natural Science Foundation of Shandong Province (No.ZR2015EQ005), China Postdoctoral Science Foundation funded project (Nos.2015M582092, 2016M592213) and the Fundamental Research Funds of Shandong University (No. 2015GN030).

References [1] [2] [3] [4] [5]

W. Korzeniowski, Rheological model of hard rock pillar, Rock Mech. Rock Eng., 1991, 24(3):155-166. W. Yang, et al. Estimation of in situ viscoelastic parameters of a weak rock layer by timedependent plate-loading tests. Int. J. Rock Mech. Min. Sci., 2014, 66(1):169-176. E. Maranini, M. Brignoli, Creep behaviour of a weak rock: Experimental characterization, Int. J. Rock Mech. Min. Sci., 1999, 36(1):127-138. J. Jin, N. D. Cristescu, An elastic/viscoplastic model for transient creep of rock salt, Int. J. Plasticity, 1998, 14(s1–3):85-107. C. Yang, et al. Experimental investigation of creep behavior of salt rock. Int. J. Rock Mech. Min. Sci., 1999, 36(2):233-242.

1032 | Mo-Li Zhao and Wen Wang [6] [7] [8]

G. Wang, A new constitutive creep-damage model for salt rock and its characteristics. Int. J. Rock Mech. Min. Sci., 2004, 41:61-67. B. R. Chen, et al. Time-dependent damage constitutive model for the marble in the Jinping II hydropower station in China, B. Eng. Geol. Environ., 2013, 73(2):499-515. H. W. Zhou, et al. A creep constitutive model for salt rock based on fractional derivatives, Int. J. Rock Mech. Min. Sci., 2011, 48(1):116-121.

Qing-Feng Zhao1 and Lin-Shan Ma2

Construction of Multilayer Geo-Metadata Management System Abstract: The standard and scientific management of geo-metadata is the key question to solve on the geo-information integration and sharing. And the effective method of solving this problem is to build a high quality of the geo-metadata management system. Article on the basis of summarizing the geological characteristics of metadata; put forward the geo-metadata management system based on multilayer structure of the building. Discusses the multilayer geo-metadata management system design idea, design principle and system structure and main characteristics of the system. Keywords: Geo-information; Information Integration; geo-metadata; information system.

1 Introduction Implementation of metadata are part of the information integration, the most important work is the integrated use of metadata stored in the various tools. And, in some of the implementation of metadata architecture and component needs to separate design and construction, the need to identify and isolate the content, and then build strong metadata database. The effective storage and use of massive amounts of geo-information, avoid the bottleneck for high performance and high scalability is crucial. In the geoinformation storage system, the operation of the metadata is about 50% to 80%, the access of metadata is a potential bottleneck. The management of metadata is an important and complex part in the storage of geo-information. In the geoinformation storage and utilization system, the effective way of metadata management, is the premise to realize high performance and high scalability.

2 The Plight of Geo-Metadata Management Due to the characteristics of the geo-information is different from other disciplines,

|| 1 College of computer science and Engineering, Shandong University of Science and Technology, Qingdao, China. Email: [email protected] 2 Hefei University Library, Hefei College, Hefei, China, Email: [email protected] 10.1515/9783110516623-102 DOI 10.1515/9783110303568-102

1034 | Qing-Feng Zhao and Lin-Shan Ma this causes on geo-information metadata management process there are some difficulties:

2.1 The Lack of the Unified Metadata Information Standards and Specifications Geo information due to a lack of unified standard, various scientific research production department or organization according to their respective needs and objectives established a number of different data formats and information standards. [1].

2.2 More Metadata Information Data Items Content is complex, because of the large amount of geo-information data, wide coverage, so the corresponding metadata involves the organizational structure of spatial data set type, quality evaluation, source, and many other aspects, the management difficulty is very big.

2.2.1 The Metadata Information of Complex Internal Relations Internal relationship between the complex of the metadata information also is bound to increase the difficulty of the geo-information metadata management.[2][3] At present, the computer database technology, network technology and the development of other GIS relevant technology made it possible to manage a large number of geo-information and data.[4][5] we can make full use of existing technology, analysis the defects of the current system, developed can provide users with a friendly user interface and convenient method, the user can easily of geospatial metadata information browse, edit, insert, delete, etc of metadata management system, which greatly improve the efficiency of spatial information metadata management and security.

3 Construction of Geo-Metadata Management System 3.1 Geo-Metadata Management System Design According to study the overall architecture of sharing platform of information integration, in order to satisfy the information demand of geo-information demanders

Construction of Multilayer Geo-Metadata Management System | 1035

can again at the same time through the system for geo-information metadata management and improve the utilization rate of the system, to reduce repetitive work in a wide range of data maintenance, reducing costs and errors, database consistency maintenance, solve the metadata collection, storage, modify, and query analysis and so on several issues and products. Metadata management system needed to realize the basic function of the following: x Collect new useful metadata. x Permanent storage metadata, and provides the metadata management interface. x Tool integration. x The database domain of the whole system and the structure of the database node relation query and editing functions. x Divided according to the parallel region of the table in a database node structure query and editing functions. x Store large amounts of data in parallel database query, edit, import, export, loading, etc. x Parallel database, the same sequence of parallel domain, indexes, stored procedures, table space information is consistent, the function of the implementation of this information queries and edit. In the structure of the large-scale transaction processing system, require the same parallel domain under multiple nodes at the same table structure, the need for consistency problem diagnosis and modification scheme is put forward.

3.2 Geo-Information Metadata Management System Design Principle x

x

x

Geo-information metadata management system for network oriented spatial metadata storage, management, and provide a complete solution, involves many standard specification, and computer technology, it is a complex software system design process. In order to ensure the project to achieve expected purpose, in the design process should follow the following principles: The standardization principle, system design and development shall follow the software engineering standard, norm effective design documentation and software code. System should be adopted and support a variety of mainstream international and domestic standards.[6] Advanced principle: choose the industry mainstream technology in system development platform, should be innovative in design idea, in accordance with geo-information metadata technology development trend and application requirements.

1036 | Qing-Feng Zhao and Lin-Shan Ma x

x

x

x

x

x

The security principle: geo-information metadata is an important data resource, to provide the data sharing at the same time; the system should be to ensure the data security. Compatibility principles: support different data formats and different sources of environmental data management, processing and sharing; has strict unity between system call interface, to ensure that system upgrade flexibility and scalability. The expansibility principle: the system should provide good architecture, security system scalability, and can adapt to the change of the metadata standards, its capability of providing data update database extensions. Applicability principle: system from the perspective of pre-study, the developed system can meet the needs of small metadata application, at the same time, the user-oriented design style, provides friendly user interaction and simple operation environment. [7]. Can helps for principle: system design should embody the metadata present situation and trend of technology development, technology and design concept should be taken for further technical research and development of the system provide a good reference. Stability principle: the system should have good stability, using the current mainstream development tools, to ensure that the system scalability, in order to better adapt to the development and change in the future. [8][9].

3.3 Geo-Metadata Management System Architecture Geo-metadata management system adopts multi-layer system structure, divided into the data layer, application service layer, common interface layer and presentation layer. Thus ensure the geo-metadata management system has a good portability, able to support the operation of the mainstream platform, at the same time have high stability, scalability, security, and transaction processing ability. As shown in Fig. 1.

Construction of Multilayer Geo-Metadata Management System | 1037

Fig. 1: The geo-metadata management system architecture diagram

x

x

Data layer. Geo-metadata database is the core content of the data layer, storage, and provide the system required for processing the data; Application service layer including metadata application servers and web servers, its function is to provide the network and the application of data processing tools; the presentation layer is in the light of the specific application of the user. In the data layer, need to stay the nature and characteristics of management of metadata itself, establish metadata storage classification. Operational metadata is relative to technical metadata tends to static, once established, is little changed. So the operational metadata storage should provide a relatively independent database node in the cluster. And technical metadata is dynamically distributed to each database node, the node information system work when the database is dynamic and it is difficult to be unified. For technical metadata, makes little sense to provide independent database node of the cluster, to modify the database node clusters frequent visits and need to pay the cost of network communication. Therefore technical metadata storage or use of the existing commercial database storage mechanism of scattered in various database node system tables. Storage equipment metadata. Application service layer. Application service layer consists of storage, access and manage the relationship between the geo-information metadata database servers. Users access to data request, through the presentation of the client software provides the user interface of input, and after the presentation layer of the client software, the application service layer into the metadata application server to the request of the data layer, data layer after server processes the request, the results through the application service layer, returned to the presentation layer, again by the presentation layer display and output the result according to user's requirements. Application service layer is mainly composed of

1038 | Qing-Feng Zhao and Lin-Shan Ma

x

x

metadata application server; they contain a RMB for data processing and analysis of logic. Application service layer converts the request put forward by the presentation layer to the request of the data layer, and submit the presentation layer will return to the results of the data layer. In application service layer, operational metadata stored in the data dictionary in the library, the relatively static, and with other database node in logical basic data exchange and therefore operational metadata to add, delete, modify operation can be provided by the data dictionary on library services, namely, to establish data dictionary service. Technical metadata is to add, delete, and modify the database node database software automatically. Operational metadata and metadata technical read operations are provided by commercial database software programming interface implementation. Operational metadata read operations, of course, according to the need can be provided by the data dictionary service. Common interface layer. Common interface layer is mainly a set of transaction processing middleware based on CORBA, do not need to distinguish between operational and technical metadata, metadata to provide support for cross-platform and distribution management system. Can also be achieved by the form of intelligent agent and other application systems. Presentation layer. Presentation layer: mainly is the client software, the realization of the metadata of the browse and query, and other functions. The presentation layer and application service layer communication protocol using HTTP and TCP/P. Through these agreements call Web server page. The presentation layer to provide users with a simple, unified data access interface. Through application service layer provides metadata management interface, yuan information from the data layer and the synthetical analysis presented to the user, or modify the user intent to send to the layers below. And, can also provide consistency check and system error recovery function. In general, the user access layer should be a tool integration environment for user requirements. Performance is mainly system and user data exchange layer, integration of all system and user's data exchange page, mainly includes three types of data access page, the first page, for public access to public access and browse the metadata, the public can have access to this page, not set any certification; The second page is used for database management and maintenance, it is mainly used for data managers at all levels to use, requires authentication to access; The second type is user management program, it is the super administrator and data acquisition and data administrator for authorization data use, requires authentication. Using the above four

Construction of Multilayer Geo-Metadata Management System | 1039

layer structure model of geo- information system can realize the maintainability, scalability and adjustable.

4 The Characteristics of the Geo-metadata Management System We build the multi-layered metadata management system has the following characteristics:

4.1 Cross-Platform Mainly based on the following two factors, on the one hand, is the system itself has nothing to do with the platform, can make the system has good portability, has a wider scope of application. Another aspect is to support system heterogeneous environment. As is known to all, is the most distinguishing feature of the Java language and platform independence and portability, compile once, run anywhere.

4.2 Support for the Data Source At present, there are a variety of database management system on the market, and for most users, the main database management system mainly includes: the Oracle database and DB2 database. There may also be used essentially, Mysql, Sybase database, etc. When designing the metadata management system, therefore, to consider it as much as possible to support multiple data sources. And Java provides a unified geo-metadata management general data interface JDBC access to the application of metadata, JDBC to access data across a network, cross-platform support different types of data sources, the difference between working for after order to provide a unified view of the data.

4.3 Extendibility Mainly considering the extension of application of the software, as the system application, some users may accord their own business need, to be conducted on the system function expansion. And modular design can meet the above requirements, the function between the various modules are independent of each other, allows the user to dynamically add new application module based on the requirements without affecting the original module function.

1040 | Qing-Feng Zhao and Lin-Shan Ma

4.4 Integratability Can integration mainly considering the many ETL tools need to put the metadata management system embedded in their respective systems, the embedded may only need the core metadata management function, without the need for interface. In this case, the design, using the MVC pattern, separating the model, view, control, need to carefully consider the various modules of the whole system interface, as far as possible in the call interface data.

4.5 Interoperability Interoperability can mainly displays in the system through the transformation process of intelligent management use including based on mapping, based on the framework to achieve interoperability. Avoid using the function in the process of data transformation method.

5 Conclusions This system is aimed at learning in the process of information integration and sharing of the needs of the geo-metadata management and the design and construction. The multilayer system structure is designed with other metadata management system in the field of the main difference and improvements. Make the system in such aspects as integration, scalability and interoperability can satisfy more study the integration and sharing of information resources. The layers of metadata management system has realized the main functions of the geo-metadata management, and application in the geo-information integration and sharing platform prototype system. With the constantly emerging of the new geo-information needs, corresponding to geo-metadata management put forward higher request, because of the multilayer geo-metadata management system has good expansibility, so at the bottom of the individualized information demand metadata management problems are well solved. Hope in the further work; constantly improve study demand of metadata management in data mining. Acknowledgement: This research was financially supported by the Shandong University of science and technology talent introduction research start funded projects (Project No. 2014RCJJ050).

Construction of Multilayer Geo-Metadata Management System | 1041

References List and number all bibliographical references in 9-point Times, single-spaced, at the end of your paper. When referenced in the text, enclose the citation number in square brackets, for example [1]. Where appropriate, include the name(s) of editors of referenced books. The template will number citations consecutively within brackets [1]. The sentence punctuation follows the bracket [2]. Refer simply to the reference number, as in [3]—do not use “Ref. [3]” or “reference [3]” except at the beginning of a sentence: “Reference [3] was the first . . .” Number footnotes separately in superscripts. Place the actual footnote at the bottom of the column in which it was cited. Do not put footnotes in the reference list. Use letters for table footnotes. Unless there are six authors or more give all authors’ names; do not use “et al.” Papers that have not been published, even if they have been submitted for publication, should be cited as “unpublished” [4]. Papers that have been accepted for publication should be cited as “in press” [5]. Capitalize only the first word in a paper title, except for proper nouns and element symbols. For papers published in translation journals, please give the English citation first, followed by the original foreign-language citation [6]. [1] [2] [3]

[4] [5]

[6]

[7]

[8]

[9]

Guler, Yalcin. Geo-metadata in spatial data infrastructure and e-governance [J]. African Journal of Business Management. vol. 5, Jun. 2011, pp. 4650-4656. Yuan Xiu-Xiao, Fu Ying-Chum. Spatial metadata catalog service enabled Integration of multigeo-reference data [J]. Science of Surveying and Mapping. vol. 33, Apr. 2008, pp. 76-81. Southwick, Silvia B,Lampert, Cory. Metadata Dictionary Database: A Proposed Tool for Academic Library Metadata Management [J]. Journal of Electronic Resources Librarianship. vol. 23, Apr. 2011, pp. 339-360. Chang He, Gao Jian-Guo, Pan Ping, Guo Zhi-hai. Design and Development of Multi-Source Geo-information system [J]. Gold Science and Technology. vol. 24, Oct.2016, pp. 102-107. Nogueras-Iso J, Zarazaga-Soria, F.J, Lacasta, J. Béjar, R. Muro-Medrano, P.R..Metadata standard interoperability: application in the geographic information domain [J]. Computers, Environment & Urban Systems. vol. 28, Jun. 2004, pp. 611-634. Song Jian,Jiang Tao1,Xu Xue-chun. Design and Implementation of Xingcheng Geological Information Sharing System Based on Google Earth [J]. Coal Technology. vol. 33, Apr. 2014, pp. 65-67. Shen Fei, Yuan jia, Huan Wei-Wei, Zha Liang-Song. Analysis on spatiotemporal characteristics and driving forces of HEFEI urban expansion based on Geo-Informatic Map [J].vol. 24, Feb. 2015, pp. 202-211. Yue Peng,Gong Jianya,Di Liping.Augmenting geospatial data provenance through metadata tracking in geospatial service chaining [J]. Computers & Geosciences. vol. 36, Mar. 2010, pp. 270-281. Diviacco P,Lowry R,Schaap D. Marine seismic metadata for an integrated European scale data infrastructure: The FP7 Geo-Seas project [J].Bollettino di Geofisica Teorica ed Applicata . vol. 53, Jun. 2012, pp. 243-252.

Wei-Jie Gou1 and Li-Hong Wang2

Automobile Body Shop Optimization Design of Displacement Ventilation Abstract: This paper introduces an optimized design of displacement ventilation system based on low air supply. Using CFD method to simulate the indoor flow field and the concentration distribution of welding fumes in welding workshop, proposed optimal design of being conducive to control dust concentration as an engineering guide. Practice has proved that displacement ventilation system based on CFD optimized design is energy-efficient, and can improve air quality of workplace effectively. Keywords: kdisplacement ventilation, Fluid Dynamics, welding fumes, energy conservation.

1 Introduction During automobile manufacturing, the process of manufacturing BIW includes stamping, welding, molding, exterior finishing, polishing etc., and finally a vehicle is assembled by spraying and other assemblies. During the process of welding and grinding white car body, a lot of smoke and dust are produced and discharged directly into the work area, which causes air pollution. In welding shop respirable dust particulate of diameter 0.1 ~ 0.4μm account for 98.9% of total dust, and they can get into lung through human upper respiratory, the deposition rate is more than 50%, and even cause lung cancer and other respiratory diseases [1-3 ]. If dust in workshop cannot be discharged, it will directly affect the health of workers, the establishment of efficient ventilation and dust removal system is the key to solve the dust problem, and to protect the health of the staff members.

2 Displacement Ventilation Dust Principle and Airflow Characteristics Analysis of ventilation and dust from mixing ventilation principle known it can‘t thoroughly purify the air in workspace. In mixing ventilation workshop, air terminal || 1 Beijing Polytechnic, Beijing 100026, China,E-mail:[email protected] 2 Beijing Polytechnic, Beijing 100026, China, E-mail: [email protected] 10.1515/9783110516623-103 DOI 10.1515/9783110303568-103

1044 | Wei-Jie Gou and Li-Hong Wang is mounted on the upper space of the work area, after the new air is sent to the workshop; it first mixed with the air with high-concentration dust near the outlet, of the air service operator to respirable air dilution zone after welding fumes polluted air. The displacement ventilation can directly send clean air to the operators’ breathing zone. That is, through air terminal attached to side of workshop, clean air of lower temperature is sent to the ground near the work area. Because of the large air density, the air of low temperature will sink and spread to the entire ground indoors under the influence of gravity. Air temperature within the welding area rises due to welding heat, and hot aggregate flow generates natural convection and rising entraining suction. Ideally, under the influence of the driving force of new air at the end of the air terminal, roll suction of hot air in work area, and suction of exhaust units of return air, a one-way flow stream is formed, then the welding fumes are sent through the exhaust units of the work area into air purification equipment. (a) cold wind

(b) warm

(b) The new wind

(d)structure of blast pipe

Fig.1: the form of air outlet in different seasons

Automobile Body Shop Displacement Ventilation | 1045

In displacement ventilation workshop, the flow of smoke will have the phenomenon of thermal stratification in certain height and direction, the height is called stratification height. All surfaces composed of stratified height are called thermal interface [4]. In the upper part of the interface is the turbulent flow and dust concentration is high; in the lower part of the interface clean air approximately becomes unidirectional laminar flow, and flow from the bottom up, so air cleanliness is high. Therefore, the height of stratification surface directly reflects of and dust removal effect and capability, and it can be used as indicators to judge the dust removal effect. Factors affecting interface are: blowing amount, position of blowing end, temperature difference between indoor and outdoor, wind speed indoors and "vortex" near the blowing end etc. The amount of wind at blowing end will generates the gradient in the height and direction and form layered air, indoors air supply in lower layer is large, and gradually decreases in height direction. This "layered" air terminal can reduce the "vortex" effect on the direction of air flow and transport distance. In summer cold air is used, in spring and autumn totally new air is used, in winter mixed warm air is used, and different outlet angles are used in different seasons, thus air terminal can effectively improve the blasting distance at the air outlet [5-6]. Figure 1 shows the form of air outlet and the structure of blast pipes in different seasons.

3 Digital Simulation and Parameter Optimization of Displacement Ventilation The design of dust removal system aims through reasonable arrangements of the air volume, air terminal location and distribution, to match distribution and location of the air terminal with the overall space of workshop, thus effectively control the direction of work zone airflow, and reduce dust concentration. In the research according to characteristics of workshop, welding shop model of displacement ventilation is designed, by using method of CFD (Computational Fluid Dynamics), by means of simulation analysis of the effect of different parameters on the flow field and dust concentration distribution in welding shop with computer software, optimization design of helping to improve efficiency of ventilation and energy efficient proposed.

3.1 Model and Boundary Conditions [7-8] In mechanical ventilation room air flow is usually in turbulent state [7], the model is simplified according to the actual situation of the workshop, and model workshop is 20mX35mX10m. Since the airflow in the room is affected by many factors, idealized assumptions are used in parameters calculation, and complex conditions affecting

1046 | Wei-Jie Gou and Li-Hong Wang the calculation are simplified. In model calculations the outflow is used as outlet boundary and velocity-inlet as entrance boundary. The model is equipped with 10 welding machines, and the heat release is 10x60W / unit; there are 12 air-terminals, and installation height can realize parameterized adjustment; air terminals are mounted at the top of the workshop with the height of 10 meters. In this article Κ-ε turbulence standard model is used as equation describing turbulent flow characteristics in the workshop. The calculation procedure is: first control equations are discretized with the method of control volume; then SIMPLE algorithm is used to solve the discrete equations, and wall function method is used to solve the flow near the wall zone airflow; Finally, Euler method is used to simulate the effect of different parameters on welding fumes concentration distribution in the welding shop.

3.2 Air Volume and Average Concentration of Dust In car body shop with welding fume pollutants, to calculate air volume according to the concentration dilution of air pollutants is determined based on the amount of indoor harmful substances [9]. The formula is:

Q

M Cm  CS

(1)

In the formula, M is the amount of welding fume emission, mg / h; Cm is the maximum allowable concentration of welding fumes, mg / m3; Cs is the dust concentration of new fresh air which enters workshop, mg / m3. Cm is occupational limit 4mg / m3, clean air Cs is 0. By calculation amount and calculation formulas we know, that calculating air volume-- Q in accordance with the concentration dilution of air pollutant, both to meet the required amount of mixed ventilation mode, but also to meet ventilation volume in ventilation displacement. According to the calculated amount of smoke generated by welding equipment and technology in body shop, we can yield the equivalent of welding shop M = 8700mg / h. In the model, Q = 34800 m3 / h. When mounting height of the air terminal is 2 meters, respectively, air volume is set as Q, 80%, 60%, 40%, CFD software is used to calculate and draw out the curve of air supply, height of workshop, and average dust concentration of each plane, as shown in Figure 2 and the air volume and average concentration of dust.

Automobile Body Shop Displacement Ventilation | 1047

Fig. 2: Air volume and average concentration of dust

Air supply have a direct impact on the concentration of dust, with decrease of air volume, the dust concentration in the welding shop entirely increases; macro trend of each curve is consistent, change of air supply at air terminal does not change the distribution trend of dust concentration ; although air volume is different, dust concentrations first increases with the increase of vertical height, then leveled off after rising to a certain height, and there is a small concentration of dust in staff activity area under interface of 2 meters. The effect of air supply on concentration stratification of air is not large, concentration curve trend of different is consistent, and greater air supply leads to lower concentration curve. However, the dust concentration from the simulation shows that, when the air supply is greater than Q60%, the concentration of dust in the work area can meet the occupational limit; the value provides a theoretical basis for studying low wind and energy-saving systematically.

3.3 Simulation Calculation of Installation Height Parameter of Air Terminal Installation height is the vertical distance from effective outlet of air terminal to the ground. When the air volume is set to 80%, respectively, height of air supply end is set 1m, 2m, 3m, we calculate by using CFD software, and draws the curve of position of air terminal, height of workshop, and average concentration of every plane, as FIG. 3 is the average concentration of different blasting height.

1048 | Wei-Jie Gou and Li-Hong Wang

Fig. 3: The average concentration of different blasting height

Analysis of air terminal installation height and dust concentration curve shows that, despite the mounting height is different, but the basic trend of the three curves are similar; dust concentration increases gradually in height direction of the plant, and air quality is in line with occupational limit value in the work area with the height of 2m or less; in height of less than 2m, the higher the height is , the higher the dust concentration at the blowing end is, in the height above 2m, the higher the height is, the lower the dust concentration is at the blowing end. In the work area of welding place the air quality less than 2m should be first considered, and therefore, when installing air-terminal the installation height should be reduced as much as possible.

3.4 Simulation Parameters and Calculation of Blast Distance Blast distance is horizontal distance from the air terminal to the welding station. When the height of air terminal is 1.9m, horizontal distance from the welding station to the air terminal is respectively set 2m, 3m, 4m, air volume is set to Q80%, and CFD software is used to calculate the average concentration of dust at different heights in the workshop. Figure 4 shows the effects of different blast distance on average concentration of dust.

Automobile Body Shop Displacement Ventilation | 1049

Fig. 4: Effect of different blast distance on average concentration of dust

Three curves in different conditions are essentially coincident, the inflection point of curve were all at about 3m, and the horizontal distance between air terminal and welder’s working position hardly affects the height distribution of dust concentration; when the average value of dust concentration in the face of different heights is less than 4mg / m3, displacement ventilation system can effectively remove the welding fumes produced from welding station. The higher the boundary layer of dust concentration is, the more beneficial it is to clean up the air quality of the work area, seen from the distribution curve, when the air position is at about 2m, the dust concentration is lower, ventilation is better, this program can be used during the construction.

4 Application and Analysis Evaluation of Optimum Design in Welding Shop 4.1 Design of Displacement Ventilation and Dust removal System Auto welding shop is 10 across 20mX140m; with a total area of about 27000m2, removing all closed paint shop, the effective height is about 12 meters. The workshop is mixing plant for the press line, welding line, assembly and quality inspection line. Calculating based on optimization model, the full amount of ventilation is Q = 1392000m3 / h, the stroke volume of temperature control unit in 14 sets of dust removal system is 1400000m3 / h, 8 sets 85000m3 / h units are installed in4 across welding line which can produces a large amount of smoke, each stride install two units. The remaining six sets of 120000m3 / h are installed in other six across pro-

1050 | Wei-Jie Gou and Li-Hong Wang duction areas. Installing cartridge stratified air terminal, the height is 1.9m from the bottom to the ground, 2m to 4m from the welding station. Return air installation is under other restrictions of equipment, and is installed in the position at 10m above the ground.

4.2 Data Detection Specification Based on GBZ159-2004 workplace sampling specification of monitoring hazardous substances in air, during the detection process 12 representative detection point in the welding area is selected, the height is 1.60 meters from ground. # 1 -- # 8 are distributed in the welding area, 9 # -12 # are distributed in body assembly area. Detection equipment of P-5L2C portable microcomputer dust tester is used. When measuring, outdoor temperature is 1-12 °C, and indoor air-conditioning temperature is set at 22 °C. Data is tested in northern winter; air of air terminal is mixed air of clean air and return air from air filter.

4.3 Detection and Data Analysis 4.3.1 Data Detection When measuring experimental value, taking into account the impact of duct resistance towards the air volume during the blowing process, the air volume of thermostat unit in displacement ventilation workshop is respectively set to 70% Q and 90% Q, the test dust concentration, temperature and wind speed in real time is detected and recorded, each testing time is 5min, averaging value of 3 times is Measurement data. Comprehensive measurement data is shown in Table 1.

Automobile Body Shop Displacement Ventilation | 1051 Table 1: Table i comprehensive measurement data Test items and conditions mode

1#

2#

3#

4#

5#

6#

7#

8#

9#

10#

11#

12#

70% Q

3.31 5

3.62 3

3.36 3

2.75 5

2.80 8

2.14 6

1.98 3

1.92 1

3.13 5

3.15 5

3.23 3

2.785

90% Q

2.64 0

3.01 8

2.30 4

2.51 5

2.45 2

1.86 3

1.78 5

1.52 2

1.83 1

2.25 5

2.54 1

2.132

Wind velocity (m/s)

70% Q

0.07

0.12

0.13

0.18

0.14

0.11

0.12

0.13

0.14

0.21

0.16

0.26

90% Q

0.18

0.20

0.19

0.18

0.23

0.20

0.20

0.32

0.24

0.26

0.20

0.27

Temperature measuring point (°C)

70% Q

19.6

19.2

19.5

19.3

19.4

19.5

19.8

19.4

19.3

18.9

18.7

18.5

90% Q

18.8

19.5

18.7

18.4

18.5

19.2

18.8

19.3

18.4

18.8

18.7

18.6

Dust concentration (mg/m 3 )

When the air supply is 70% of designed air volume, average dust concentration in displacement ventilation workshop: 2.852 (mg • m-3), dust concentration of air vents: 4.36 (mg • m-3); the maximum dust concentration: 3.623 (mg • m-3), the highest wind speed: 0.26 (m / s); within occupational exposure limit (4mg • m-3) and welding required range (0.5m / s). When the air supply is 90% of the designed air volume, average dust concentration of displacement ventilation workshop: 2.238 (mg • m-3), dust concentration of air vents: 3.83 (mg • m-3); the maximum dust concentration: 3.018 (mg • m-3); the highest wind speed: 0.27 (m / s), the indicators are in the required range, and the maximum dust concentration and average dust concentration reduced significantly.

4.3.2 Data Analysis and Evaluation Dust concentration at test point is impacted by the amount of fresh air delivery, air flowing speed, formation of smoke plume and welding smoke. When the diverging source of welding fumes and air terminal position remain unchanged, efficiency of dust removal system in displacement ventilation Workshop increases with the amount of air increases. Analysis of test data shows that displacement ventilation system can make the dust concentration reach occupational limit in the lower amount of air (Q70%). When the air supply is from

1052 | Wei-Jie Gou and Li-Hong Wang 70% to the 90%, the average dust concentration of stratified air supply reduced 21.5%. When the air supply is Q70% and Q90%, ventilation efficiency were 1.53 and 1.71. If ventilation efficiency in displacement ventilation plant is high, and temperature controlling is stable (18+ 1OC), we can effectively improve workplace air quality at low air volume.

Fig. 5: Analog dust concentration and measured dust concentration

As shown in Figure 5 is in two conditions the comparison of the measured curves and simulated curves of dust concentration at test points. Since the analog value reflects more average concentration of the point, and measured data reflect dust concentration in real time at the current test point. Therefore, the numerical simulations curves are smoother, measured curves fluctuate larger, but there are some deviations in magnitude. Although these test points are discrete in different sampling points in the same plant, the basic curve trend is relatively unified, which can illustrate the application of CFD calculation method can reflect the relationship between the organization of airflow in welding shop and the dust concentration distribution, and is fit for Flow Field calculation and simulation tests in welding workshop.

5 Conclusion Practice shows that the CFD method can reflect real characteristics of flow field and dust distribution in displacement ventilation plant, and can be used as mathemati-

Automobile Body Shop Displacement Ventilation | 1053

cal tools and theoretical guidance of designing dust removal system in displacement ventilation workshop. Application of CFD method is used to establish mathematical model to optimize design parameters, simulate the relationship between air volume, air altitude, air distance and the welding fume concentration distribution and optimize analysis, thus it achieves digitization, reduces large number of experiments, and shortens the design cycle. Displacement ventilation dust removal system is based on CFD, by which air flow is reasonable , efficiency of ventilation is high, thermal comfort is good, to achieve high efficiency with low energy, energy-saving design idea , it can be used as reference to solve similar problems of dust removal or flow field calculation.

References [1] [2] [3]

[4] [5] [6] [7] [8] [9] [10] [11] [12]

W hazardous substances [J] welding machines, 2004,11 (34): 60-64 Moronia B, VitibGrain C, Size, chemistry, and strcture of fine and ultra-fine particles in stainless steel welding fumes [J] Journal of Aerosol Science, 2009, 40, (11):. 938-949. SOLANO-LOPEZ C, ZEIDLER-ERDELY P C. Welding Fume Exposure and Associated Inflammatory and Hyper plastic Changes in the Lungs of Tumor Susceptible A / J Mice [J] Toxicologic Pathology, 2006.34: 364-372. Liu Meng, Long Weiding height displacement ventilation Numerical Study [J] thermal stratification HVAC, 2009,39 (8): 112-115 Li Bo, Hu Guangsheng welding fumes harm the plant and the overall dust treatment programs [J] metalworking, 2012.2: 37-37 Zhang Jiazhen, welding shop dust characteristics and countermeasures [J] SAFETY AND ENVIRONMENTAL 2006.32 (3): 9-11 Yang Ke, welding workshop displacement ventilation Design [D] Tongji University, 2008: 4056 Wang Fujun, computational fluid dynamics analysis software -CFD Principles and Applications [M], Tsinghua University Press, 2004: 113-123 You Guoxiang, Liu chunju, Ge Fenghua welding plant ventilation system application [J]. China Resources Comprehensive Utilization, 2008, 26 (4): 29-32. GBZ2.1-2007 workplace harmful factors Occupational exposure limits - Chemical hazardous agents [S] GBZ 159-2004 harmful substances in workplace air monitoring sampling specification [S] ei Kang, where legislation on welding and allied processes

Xin Zhao1, Yan Shi2*, Ying-Ying Feng3 and Ying Zhao4

The Research Progress of Polycyclic Aromatic Hydrocarbons Processing Technology in Coking Wastewater Abstract: There are quantities of organic contaminants in coking wastewater so that it’s difficult to process. Thus, how to handle the Polycyclic Aromatic Hydrocarbons in coking wastewater effectively has been the research hotspot of relative studies both at home and abroad. This thesis introduces the characteristics and detriment of Polycyclic Aromatic Hydrocarbons. And it sums up recent years’ research progress of Polycyclic Aromatic Hydrocarbons processing technology in coking wastewater from the following four aspects: bioaugmentation technology, ozonization method, ultrasonic method, and microwave technology, etc. And it mainly focuses on action principle, feature, application status and existing problems of microwave method. This article analyzes merits and demerits of present methods by comparing with each other; it shows that the microwave technology is supposed to be a new technology for processing Polycyclic Aromatic Hydrocarbons. Keywords: coking wastewater, PAHs, processing technology, microwave.

1 Introduction Coking industry, as the basic industry of the nation, plays an important role in economic and social development. However, coking industry produces a great number of by-products such as wastewater which are harmful. Wastewater occurring in the process of coking is a kind of organic wastewater with high concentration and high pollution. Its composition is complex, mainly including phenols, heterocyclic and polycyclic aromatic hydrocarbons and other organic pollutants. After pretreatment and depth processing, some contaminants such as Ammonia, nitrogen and phenolic in the wastewater can be removed, but the high toxicity of polycyclic aromatic hy-

|| 1 Metallurgy and Energy College, North China University of Science and Technology, Tangshan, China, E-mail: [email protected] 2 Metallurgy and Energy College, North China University of Science and Technology, Tangshan, China, E-mail: [email protected] 3 Metallurgy and Energy College, North China University of Science and Technology, Tangshan, China, E-mail: [email protected] 4 Metallurgy and Energy College, North China University of Science and Technology, Tangshan, China, E-mail: [email protected] 10.1515/9783110516623-104 DOI 10.1515/9783110303568-104

1056 | Xin Zhao, Yan Shi, Ying-Ying Feng and Ying Zhao drocarbons in the wastewater makes it so difficult to degrade and deal with. At present, all kinds of processing technologies cannot completely remove polycyclic aromatic hydrocarbons [1]. There are still a lot of polycyclic aromatic hydrocarbons organic pollutants releasing into the environment. These substances emissions will do harm to ecological environment, but also pose a potential threat to human health [2]. In 2012, the national latest coking wastewater discharge standard has added emissions standard of polycyclic aromatic hydrocarbons, demanding total concentration of polycyclic aromatic hydrocarbons is lower than 0.05 mg/L and Benzoapyrene is under 3×10-5 mg/L. And the implement of the new standard is due to start in 2015. Thus, we need to make efficient and feasible degradation method under the premise of not influencing the operation of coking industry. And it’s urgently required to realize the economic and environmental friendly development, to improve wastewater recycling, and to reduce emissions polycyclic aromatic compounds.

2 The Characteristics and Harms of the Polycyclic Aromatic Hydrocarbons PAHs widely exist in the natural environment of human life. Its molecular structure is containing two or more than two kinds of benzene ring Hydrocarbon Compounds [3]. Although molecules contain benzene ring, its physicochemical properties are quite different from benzene. PAHs not only exist in the surface water, but also detect the presence of PAHs in groundwater and seawater. The polycyclic aromatic hydrocarbons in water can be dissolved in water or emulsified state. Some are adsorbed on suspended solid. The concentration of different kinds of polycyclic aromatic hydrocarbons in coking wastewater is different; the content of naphthalene is the largest among them, accounting for 36.70% ~ 86.78% of the total PAHs [4]. PAHs belong to the refractory organic pollutants, which have very strong carcinogen [5] and light toxic effect [6]. The toxicity and carcinogenicity of PAHs are related to its types and structure changes of themselves. The higher the benzene ring is, the more toxicity and carcinogenicity are. As PAHs enrich continuously, it will seriously pollute water and soil, then it enters human body through biological enrichment, which is greatly threatening the health of human.

The Research Progress Processing Technology in Coking Wastewater | 1057

3 The Degradation of Polycyclic Aromatic Hydrocarbons in Coking Waste Water Method 3.1 Bioaugmentation Bioaugmentation is a kind of technology, by adding some microorganisms of special function into wastewater, to enhance the capacity of removing pollutants of wastewater treatment system to degrade the organic wastewater [7] and to degrade the polycyclic aromatic hydrocarbons (PAHs) organics by improving the microbial activity in the process of wastewater treatment. Compared with the traditional biological treatment technology, the effect of Bioaugmentation is obvious in improving system running stability and pollutant treatment without secondary pollution, so it gets the wide attention of experts both at home and abroad. Shengnan Shi [8] studied the Arthrobacter sp. W1 removal efficiency of common metabolic heterocyclic aromatic biological reaction system to naphthalene. The results showed that, when running steadily, the removal rates of free cell reinforcement system and unreinforced reaction system to naphthalene were 88% and 94% respectively. While the removal rate of Magnetic immobilized cells and strengthen the reaction system to naphthalene has reached 98%. The steady of reaction facility is to say that the strengthen of Magnetic fluid cells has a better processing effect to naphthalene. Bioaugmentation has obvious effect in the treatment of coking wastewater in the laboratory. But the coking wastewater treatment system is a half-openly even completely openly complex ecosystem. Due to the complex wastewater composition, there are some inhibitory substances, the growth and metabolism of which affect the degradation of polycyclic aromatic hydrocarbons in wastewater. The PH and temperature of waste water, and probiotics in it will affect the treatment of strengthening system. That’s why the effect of Bioaugmentation in wastewater is not obvious.

3.2 Ozone Oxidation Method In recent years, the ozone oxidation has achieved good results in wastewater treatment. Its strong ability of oxidation can break down most of the organic matters in water, and it can be decomposed into oxygen itself [9]. Due to its features of high processing efficiency and no secondary pollution, as well as the effect of sterilization, ozone method is used more and more widely in wastewater treatment. Jia Zhenmin [10] dealt with polycyclic aromatic hydrocarbons in coking wastewater by ozone method. Its initial content of benzopyrene in wastewater is 3mg/L. Treated wastewater with a certain concentration of ozone, 30 mins later, the

1058 | Xin Zhao, Yan Shi, Ying-Ying Feng and Ying Zhao benzopyrene decomposition rate is 80%, and after 60 mins’ processing, the benzopyrene can be completely decomposed. The high cost of equipment and operation, low efficiency, and high toxic factors of ozone oxidation process of coking wastewater treatment restrict the development of ozone oxidation technology. The reaction of ozone and organic matter is also restricted by dose and time. And the intermediate sometimes would prevent further oxidation of ozone. The concentration and PH value of wastewater component also affect the ozone treatment process, so it is mainly used for the disinfection of drinking water at present.

3.3 Ultrasonic Method The main principle of ultrasonic water treatment technology is to make organic chemical bond rupture, pyrolysis, and free radical oxidation reaction by producing high temperature and high pressure in a moment through ultrasonic cavitations effect, so as to achieve the purpose of the degradation of organic pollutants [11]. Some research results show that the ultrasonic method can degrade a variety of organic pollutants including monocyclic aromatic hydrocarbons and polycyclic aromatic hydrocarbons. In order to make further study on removing organic matter in the coking wastewater by the ultrasonic method, Cheng Zewei[12] combined with the analysis results of gas chromatography-mass spectrometry instrument, and then he found that the ratio of naphthalene and anthracene in coking wastewater treated by ultrasonic-Fenton has changed from 6.44%, 5.44% to 1.26%, 6.44% respectively. It can be concluded that the proportion of refractory organics naphthalene and anthracene reduced significantly in coking wastewater after treatment, which shows that ultrasonic-Fenton makes a very good effect in treating polycyclic aromatic hydrocarbons in coking wastewater. Each single organic matter has its specific frequency and sound intensity, so it is effective to deal with by ultrasonic treatment. But the coking wastewater is composed of a large number of different organic matters. Its composition is complex, so using single frequency of ultrasonic to deal with coking wastewater has lots of shortcomings obviously. Ultrasonic cavitation effect is affected by the ultrasonic power, frequency, duration, environment and other factors, so further studies on application are necessary.

3.4 Microwave Method Microwave often refers to electromagnetic wave whose wavelength is within 1 mm ~ 1 m [13], as well as between infrared and radio waves. The current domestic common

The Research Progress Processing Technology in Coking Wastewater | 1059

usage is two kinds of microwave frequency: 915 MHz and 2450 MHz. With the continuous development of water treatment industry, Microwave technology is already a mature technology, especially in the treatment of refractory organic wastewater where has made very big breakthrough. It has huge development prospects in water treatment [14]. Yuan Maobiao[15] used the microwave coagulation-Fenton method to deeply process coking wastewater. The dosages of aluminium polychlorid and polyacrylamide are 120 mg/L, 5 mg/L; and the dosages of FeSO4 and H2O2 are 120 mg/L, 600 mg/L respectively. When the PH value of supernatant fluid initially is 6, the microwave power is 450W, and the microwave time is 35 mins, the effect is the best. The study shows that the removal rate of COD, chromaticity and turbidity are 87.69%, 98.87%, and 99.16% respectively. After processing, the wastewater meets the emission requirement. Wang Yingying [16] chose wastewater in some coking plant after biochemical treatment as the research object, and she did research on removing NH3-N treatment by using the microwave blow off technique. At the same time, they investigated NH3-N removal effect by different PH value, power and time using. The results showed that when the PH =11, after 10 mins, and power is 700W, the NH3-N removal rate can reach to over 90%.

4 Study on the Treatment of Polycyclic Aromatic Hydrocarbons in Coking Wastewater by Microwave Method There are two ways to degrade organic pollutants in wastewater by microwave method. When it directly effects on wastewater, it can make some strong polarity molecule in wastewater forming high temperature, inducing molecular polarization rotation effect, increasing activity of organic molecules, and intensifying molecular chemical bond rupture, and degrading organic pollutants [17]. Some organic matters in the wastewater can’t absorb microwave directly, but it can firstly use microwave radiation to absorb medium (activated carbon, steel slag, etc.), which passes microwave energy to organic matters needing degradation by absorbing medium, in order to achieve the purpose of the degradation of organic wastewater[18]. Activated carbon is not only a typical microwave absorber, but also a kind of sensitizing agent, which can be widely applied in wastewater treatment. Activated carbon will produce instantaneous high temperature in the microwave radiation, which greatly enhances the ability of microwave processing wastewater [19]. The main reaction mechanism of microwave degradation of waste water includes the following processes:

1060 | Xin Zhao, Yan Shi, Ying-Ying Feng and Ying Zhao microwave P  o( P ) 

(P for water molecules, pollutant molecules) microwave ( P )   H 2O  o P  H 2O 

microwave H 2O   H 2O   o H 3O   OH microwave (M as sensitizer) M  oM* * microwave ngM  mgSS  o( M * )n( SS )m p

(SS as the suspended solids)

microwave OH  R  o HO  R

(R for organic matter)

microwave ngM *  mgHO  R  o( M * )n( HO  R )m p  gas n

The reactions include physical and chemical reaction of microwave energy. Under the combined action of physical and chemical reaction, the organic pollutants and inorganic pollutants in coking wastewater can be better removed. Activated carbon can produce high temperature “hot spots” under microwave irradiation. The wastewater will produce hydroxyl radicals (•OH) under the action of microwave and activated carbon. The process is similar to the wet air oxidation producing the •OH. But the microwave radiates wastewater directly will not produce •OH, which shows that activated carbon can improve the ability of microwave treatment of coking wastewater. The specific reaction is as follows:

O 2  ogO  gO

O  H 2O  o 2gOH

(1) (2)

•OH is strong oxidizing free radicals, which is easy to oxidize various kinds of organic and inorganic matters, and whose efficiency of oxidation is high. So under the common effect of microwave and activated carbon, it can be effective in treating polycyclic aromatic hydrocarbons and other organic matters in coking wastewater. Chih.G[20] adsorbs dimethyl benzene, naphthalene and other organic materials by using granular activated carbon, and then desorbs activated carbon and degrades pollutants through the low degree of microwave radiation. The results show that the decomposition rate of organic matter is very high, and the water quality after treatment can keep long-term stability. Yang Fazhong [21] studied that microwave could degrade the polycyclic aromatic hydrocarbons, with conventional method and microwave method to degrade naphthalene and anthracene in wastewater respectively. Studies found that conventional methods cannot degrade naphthalene, only degrade a small number of anthracene. While the microwave heating can degrade most of naphthalene and all of the anthracene. With the action of microwave heating and H2O2 and O3 oxidant, it

The Research Progress Processing Technology in Coking Wastewater | 1061

can completely degrade naphthalene, anthracene and fluorene in wastewater. With the coaction of Microwave heating and Chlorine-based auxiliary degradation agent (Cl2), pyrene can be fully biodegradable in wastewater. All the above research results show that dealing with polycyclic aromatic hydrocarbons in waste water with the microwave heating method has high efficiency. And wastewater meets the requirements of discharge after treatment. Compared with traditional methods, microwave technology not only has the advantages of high degradation rate and short reaction time, but also reduces the mass of water treatment facilities, saves cost, and realizes the miniaturization of wastewater treatment engineering; especially it is adapted to the current enterprise sewage treatment demand. Although the effect of microwave technology wastewater treatment is very good, processing polycyclic aromatic hydrocarbons in waste water is still in the experimental stage, and its practical application is not so much. What’s more, the relevant microwave wastewater treatment technology and process are not yet mature, which still needs further study.

5 Conclusion By analyzing the characteristics and harm of polycyclic aromatic hydrocarbons, we can see that different kinds of polycyclic aromatic hydrocarbons present different states in coking wastewater and concentration differences are big. The emission of polycyclic aromatic hydrocarbons not only pollutes the water and soil, and even does harm to human health. Generally speaking, there are three demands to judge the efficient utilization of coking wastewater treatment technologies: the low cost of production, good treatment effect, and no secondary pollution. Bioaugmentation, ozone oxidation method, and ultrasonic method can all deal with polycyclic aromatic hydrocarbons in coking wastewater; however, there are still some disadvantages such as poor processing effect, high production cost and low production efficiency, as well as deficiency in practical application. Microwave makes good effect in dealing with pollutants such as Ammonia nitrogen in coking wastewater. The removal rate of pollutants is so high that it enhances the study on degradation of polycyclic aromatic hydrocarbons with microwave method in coking wastewater. Studies show that microwave method has more incomparable advantages in treatment polycyclic aromatic hydrocarbons in wastewater than other methods. The effect is more obvious when microwave and absorbing medium (such as activated carbon, SiC, etc.) work together to eliminate polycyclic aromatic hydrocarbon. As the increasing stringent emission standards becomes, various countries’ scholars have made some positive exploration in treating harmful organisms such

1062 | Xin Zhao, Yan Shi, Ying-Ying Feng and Ying Zhao as polycyclic aromatic hydrocarbons in coking wastewater. Although the microwave method treatment of polycyclic aromatic hydrocarbons is not mature enough, its potential value and advantages in wastewater treatment cannot be ignored. With the gradual mature of microwave and the continuous development in wastewater treatment field, microwave technology, as a potential treatment method, is expected to become the new technology of processing polycyclic aromatic hydrocarbons. Acknowledgement: The national natural science fund project (51274084); Hebei province natural science fund project-Steel joint fund (E2014209152)

References [1] [2] [3] [4]

[5]

[6] [7] [8]

[9] [10] [11] [12] [13] [14] [15]

Xu Guoliang. Cooking process of polycyclic aromatic hydrocarbons (PAHs) emissions characteristics research [D]. Taiyuan University of technology, 2011. Xing Guangen Cui Mingwen. Coking wastewater treatment [J]. Journal of hengshui college journal, 2007, 01:104-106. Yang Fazhong, Yan Yang, Zhang Zezhi, Su Yongqing. PAHs research progress [J]. Journal of chemical industry in yunnan province, 2005, 11:44-48. Zhou Haijun, Tuan Liang, Shi Yanju, He Jiang. Composition of polycyclic aromatic hydrocarbons in coking waste water spectrum and pollution characteristics [J]. Journal of environmental monitoring in China, 2014, 11:58-61. Luo X J, She J C, Mai B X, et al. Distribution, source apportionment, and transport of PAH in sediments from the Pearl River Delta and the Northern South China Sea [J].Archives of Environmental Contamination and Toxicology, 2008, 55(1):11-20. Sun Hongwen, Li Shuxia. The light of polycyclic aromatic hydrocarbons, toxic effect [J]. Journal of environmental science, 1998, and practices: 2 ~ 12. Fantroussi ES, Agathos SN.Is bioaugmentation a feasible strategy for polltant removal and site remediation [J]. Curr Opin Microbiol,2005,8(3):268-275 Shengnan Shi, Yuanyuan Qu, Fang Ma, Ji Ti Zhou. Bioremediation of coking wastewater containing carbazole, dibenzofuran and dibenzothiPHene byimmobilized naphthalenecultivated ArthrObacter sp. W1 in magnetic gellan gum. Bioresource Technology, 2014, 166: 79-86 Alvares A, Diaper C, Parsons S A. Partial oxidation by ozone to remove recalcitrance from wastewaters-a review [J]. Environmental Technology, 2001, 22(4):409-427. Jia Zhenmin. Ozone in coking PHenol cyanogen waste water treatment in special applications [J]. China construction information (water industry market), 2008, 01:59-62. Entezari M H,Abbas H,Ali S Y.A combination of ultrasound and inorganic catalyst: removal of 2-chloroPHenol from aqueous solution. Ultrason Sonochem, 2005, 12(1):137. Cheng ZeWei, Cang Daqiang. Factors affecting ultrasonic treatment of coking wastewater [J]. Journal of Beijing University of science and technology, 2009, 11:1385-1389. Sun Weiyi, Song Baozeng. Microwave method of water treatment technology research progress [J]. Journal of environmental science and management, the preceding 2007:93-96. MenendezJ A, Menendez E M, Inglesias M J,et al. Modifi-cation of the surface chemistry of active carbons by means of microwave induced treatments[J].carbon,1999b,37(7):1115-1121. Yuan Maobiao. Combination microwave coagulation -- Fenton oxidation process depth treatment of coking wastewater research [D]. Wuhan University of science and technology, 2014.

The Research Progress Processing Technology in Coking Wastewater | 1063 [16]

[17]

[18] [19]

[20] [21]

Wang Yingying,Yu Ping, Deng Zhenwei, yun-bai luo. Microwave to remove method of ammonia nitrogen in the treatment of coking wastewater research [J]. Water treatment technology, 2014, 11:24-27. Xu Wenqian, zheng guanghong, huang Zhongting. Application of microwave technology in water pollution control [J]. Journal of environmental science and technology in jiangsu, 2006, 01:26-27 + 30. TAI H S,JOU C G. Application of granular activated carbon packed-bed reactor in microwave radiation field to treat PHenol[J].ChemosPHere,1999,38(11):2667-2680. Liu X T, Quan X, Bo L L, etal. Temperature Measurement of GAC and Decomposition of PCP Loaded on GAC and GAC-supported Copper Catalyst in Microwave Irradiation. Applied Catalysis A: General, 2004, 264(1):53-58. Chih G. Application of Actived Carbon in a Microwave Radiation Field to Treat Trichloroethylene [J].Carbon, 1998, 36(11):1643-1648. Yang Fazhong. Microwave energy in the application of PAHs degradation research [D]. Yunnan normal university, 2005.

Guo-Xin Tian1, Jun Huang2*, Pei-Pei Guo3, Qian-Lan Tang4 and LinZhu Sun5

Experimental Investigation on Flexural Properties of Sisal Fiber Reinforced Foam Concrete

Abstract: With high tensile strength, sisal fiber is used to improve the mechanical properties of the foam reinforced concrete. The first, the effects of the contents of sisal fibers on the bending properties of composites are studied. The second, in order to increase the concrete porosity, the foam agent is selected to investigated the mechanical properties of fiber reinforced foam concrete. Finally, with varied concrete age, the composites will have different mechanical properties; this characteristic of concrete is also discussed in this study to analyze the bending properties of composites. Compared the experiment data with previous literatures, the results are well in accordance with that of other experiments. Keywords: Foam concrete, Sisal fiber, Flexural strength, Experiment.

1 Introduction At present, with the change of global temperature, people have been looking for friendly building materials, especially with the large-scale urban development of developing countries. In order to reduce energy consumption, different types of lightweight concrete (fire resistance, thermal insulation, low cost and so on) are studied by many researchers [1-4]. Foam concrete with many excellent performances are also gradually emerging, people have accelerated the pace of research and

|| 1 School of Civil Engineering and Architecture, Guangxi University of Science and Technology, Liuzhou, Guangxi 545006, China, Email:[email protected] 2 School of Civil Engineering and Architecture, Guangxi University of Science and Technology, Liuzhou, Guangxi 545006, China College of Civil Engineering and Architecture, Wenzhou University, Wenzhou, Zhejiang, 325035, China, Email: [email protected] 3 School of Civil Engineering and Architecture, Guangxi University of Science and Technology, Liuzhou, Guangxi 545006, China, Email: [email protected] 4 School of Civil Engineering and Architecture, Guangxi University of Science and Technology, Liuzhou, Guangxi 545006, China, Email: [email protected] 5 College of Civil Engineering and Architecture, Wenzhou University, Wenzhou, Zhejiang, 325035, China, Email:[email protected] 10.1515/9783110516623-105 DOI 10.1515/9783110303568-105

1066 | Guo-Xin Tian, Jun Huang, Pei-Pei Guo, Qian-Lan Tang and Lin-Zhu Sun had more discussion on its performance [5-7]. Foam concrete is a kind of porous concrete (300-1900 kg/m3), applied in civil engineering as a light weight construction materials. Foam concrete is widely applied because of its simple production and process [8-10]. In practice, foam concrete is applied in different building structure in many countries, such as Germany, Britain, the Philippines, Turkey and Thailand, etc. [11, 12]. Concrete is extensively researched and discussed by adding artificial fiber, synthetic fiber and plant fiber [13, 14]. Compared with chemical fiber, plant fiber has the characteristics of low price, environmental protection, and sustainable development and so on. Sisal fiber is a kind of plant fiber; it has the advantages of hard texture, good elasticity, high tensile strength, friction resistance, seawater corrosion resistance, etc. In order to find the relationship between sisal fiber content and the flexural strength of foam concrete, the effect of different contents of sisal fiber on the flexural strength of foam concrete is investigated in this study, it can provide a certain experimental data for the mechanical properties of sisal fiber reinforced foam concrete.

2 Experiment Materials Yufeng production of P • O42.5 grade ordinary Portland cement is selected from Yufeng Guangxi Group CO., LTD., the main product information are shown in Table 1. Sand, using medium coarse sand, poly carboxylic acid high efficiency water reducing agent produced by a company in suzhou, water reducing rate of ≥14%. Foaming agent of commercially available industrial hydrogen peroxide with 30% concentration. Stable foam agent (calcium stearate), ordinary tap water. Sisal fiber is produced from Poyang, Jiangxi province, various performance indexes can meet the specification requirements. Physical properties are shown in Table 2. Table 1: P • O42.5 ordinary portland cement Setting time/min

Flexural strength/MPa

Compressive strength/MPa

MgO/%

SO3/%

LOSS/%

Cl-/%

Initial Final set setting

3d

3d

28d

≤4.5

≤3.2

≤5.0

≤0.06

≥45

≥4.5 ≥7.5

≥22.0

≥44.5

≤450

28d

Experimental Investigation Sisal Fiber Reinforced Foam Concrete | 1067 Table 2: sisal fiber physical properties Place of origin

Length/cm

Impurity/%

Moisture regain/%

Strength/N

Elongation/%

Density/ɡ·cm-3

Poyang Jiangxi

90-130

800

5

1.34

3 Preparation of Foam Concrete The length of sisal fiber is 10-15 mm in this experiment, sisal fibers are placed into a concentration of 1% NaOH solution for 1 h before the test, then rinse and dry to remove the impurities on the sisal fiber. Sisal fibers are added according to the percentage of dry aggregate, such as 0.1% (40 g), 0.2% (80 g), 0.3% (120 g), 0.4% (160 g), 0.5% (200 g), mix ratio are shown in Table 3 in detail. Table 3: proportion of sisal fiber content per cubic meter % Serial Cenumber ment/kg

Sand/k g

Water/kg

FoamWater reducing ing agent/kg agent/L

Stable foam Sisal fiber/% agent/kg

A0

940

900

410

7.5

1

0

0

A1

940

900

410

7.5

1

0

0.1

A2

940

900

410

7.5

1

0

0.2

A3

940

900

410

7.5

1

0

0.3

A4

940

900

410

7.5

1

0

0.4

A5

940

900

410

7.5

1

0

0.5

B0

940

900

410

7.5

1

3

0

B1

940

900

410

7.5

1

3

0.1

B5

940

900

410

7.5

1

3

0.5

Cement, sand, water reducing agent and stable foam agent are poured into mixer for 2.5 min according to the mixing proportion of table 3, and then sisal fibers are added to stir for 3 min (the step with no sisal fiber is skipped), finally the dilution of a certain proportion of the foaming solution mixing with water is added for stirring. It’s better to pour slurry into the oiled mould and place it on the vibration table to vibrate and screeding. Removing the mould after 24 h and immediately moving into the curing room for maintenance under the standard condition. This experiment is mainly aimed at the study on flexural properties of foam concrete, so the block with the size of 100 mm×100 mm×300 mm is carried out for a

1068 | Guo-Xin Tian, Jun Huang, Pei-Pei Guo, Qian-Lan Tang and Lin-Zhu Sun preliminary study. The study on the different age of block (7 d, 14 d, and 28 d) and the flexural properties of foam concrete with different sisal fiber contents is carried out.

4 Three Point Bending Test Flexural strength is also called the bending tensile strength, and the tensile strength of foam concrete can be evaluated to a certain extent. The effect of sisal fiber on tensile properties of composites can be intuitively reflected by the flexural strength of sisal fiber foam concrete. Studying the flexural strength of fiber foam concrete can provide a certain design basis to the engineering structures under bending load.

4.1 Experiment Steps The hydraulic universal material testing machine (WE - 30) is adopted in the bending test, the loading range is 0~300 KN and the specimen size is 100 mm×100 mm×300 mm. The test steps are listed as follows: (1)The surface of specimen taken from the curing room needs to smooth and clean, and then test immediately. (2)Checking the appearance of block and measuring the section size. The appearance of block should have no obvious defects and dimensional measurement accuracy reaches to 1 mm. (3)Carrying the continuous uniform loading. Load speed of this test is controlled in 0.1~0.5 KN/s. (4)Recording the value of dashboard when the block damages.

4.2 Experiment Results There are six specimens in each test group (the same sisal fiber content), the flexural strengths of foam concrete under different content of sisal fiber and different age are determined, and then the average value is taken from the measured values of six specimens as the flexural strength of the group. Figure 1 is the failure section randomly selected from a specimen. It is easy to see that the distribution of sisal fiber in the specimen is not uniform. The reasons may be caused from the non-uniformity of sisal fiber in the specimen, the settlement of concrete etc.

Experimental Investigation Sisal Fiber Reinforced Foam Concrete | 1069

Fig.1: The section of sisal fiber reinforced foam concrete

The phenomenon of agglomeration is found in the experiment when sisal fiber is stirred in the mixer, and it is particularly obvious when the sisal fiber content increases. Studying on the failure surface of foam concrete specimen, the distribution of sisal fiber is not uniform dispersion but discrete distribution. It can be speculated that the practicability of sisal fiber decreases due to the phenomenon of agglomeration, and the non-uniform distribution of sisal fiber in the specimen is one of the reasons from which the comparison of the flexural strength of sisal fiber reinforced foam concrete with the different content is not very obvious. Table 4 contains the data of this flexural experiment. The flexural strength of the foam concrete including a certain content sisal fiber under the different age may follow a certain regulation, so the age 7 d, 14 d of specimen A4 and the age 7 d of the specimen A5 are ignored. The results are not completely in accordance with the expectation after the tests, but the flexural strength of sisal fiber reinforced foam concrete in different sisal fiber content and different age has a certain degree of

1070 | Guo-Xin Tian, Jun Huang, Pei-Pei Guo, Qian-Lan Tang and Lin-Zhu Sun improvement. Based on the experimental results, sisal fibre can enhance the flexural strength of the foam concrete. Table 4: the experiment data of flexural strength No.

7d

14d Load /kN

28d

Load /kN

Strength/ Mpa

Rate /%

Strength/ Mpa

Rate /%

Load /kN

Strength /Mp

Rate /%

A0

13.3

2.5

1

14.5

2.6

1

16.1

2.8

1

A1

14.8

2.6

1.04

16.2

3.1

1.19

16.9

3.3

1.18

A2

14.8

2.8

1.12

17.7

3.3

1.27

19.5

3.8

1.36

A3

14.5

2.8

1.12

18.2

3.4

1.31

19.1

3.7

1.32

A4

/

/

/

/

/

/

17.8

3.5

1.25

A5

/

/

/

15.1

2.8

1.08

18.1

3.5

1.25

B0

12.9

2.4

0.96

13.8

2.5

0.96

14.3

2.7

0.96

B1

13.9

2.5

1

15.5

2.8

1.08

16.4

3.0

1.07

B5

13.7

2.5

1

15.4

2.8

1.08

17.3

3.2

1.14

The flexural strength of foam concrete can be effectively improved by adding a certain sisal fiber into the foam concrete which can be seen from the chart data, and the flexural strength of foam concrete has been evidently improved when the sisal fiber content is 0.2%. The flexural strength of foam content is effectively improved with sisal fiber in the early age and then tends to be gentle. The flexural strength of foam concrete with 0.2% content has reached the relative increase value of 1.36 in the different sisal fiber content, and then its flexural strength begins to decrease and tends to be gentle with the content increasing. Compared with the related research of sisal fiber reinforced concrete [13,14], it shows that sisal fiber can enhance the mechanical properties of foam reinforced concrete with fiber content increasing, and then, the bending strength of composites begin to decrease. From Figure 2, you can see the flexural strength of foam concrete decreases after adding a certain amount of foam agent. External damage to the bubble is relatively small from the analysis in the plain foam concrete, and the flexural strength of foam concrete decreases at a certain degree. Sisal fiber can damage a certain amount of bubbles; it results in the reduction of the amount of porosity and increases the strength of composites. The stability of bubble has enhanced after adding the stabilizing agent and results in the reduction of the damage of the pore, and increases the maintenance of the pore, so, the flexural strength of sisal fiber reinforced foam concrete decreases.

Experimental Investigation Sisal Fiber Reinforced Foam Concrete | 1071

Fig. 2: The effect of stabilizing agent on the flexural strength

Through the comparison of Figure 3, we can see that the change law of bending strength curve of foam concrete under different age exist a certain similarity. The flexural strength exists a certain downward trend when the sisal fiber content exceeds 0.3%.

Fig. 3: The effect of sisal fiber content on the flexural strength of foam concrete

There are two aspects by analyzing the reasons of the above cases, on the one hand, the adhesion of sisal fiber can delay the destruction of the interface, and then the flexural strength of foam concrete is improved, so the flexural strength is greatly improved when the sisal fiber content is 0.2%. On the other hand, the flexural strength begins to decrease gradually with the sisal fiber content increasing. The water absorption of sisal fiber has a certain influence on the strength of the foam concrete. It is easy to see from this experiment that the bleeding of the foam concrete can be effectively reduced with the sisal fiber content increasing, especially when the sisal fiber content is 0.5%. The mixing proportion is under certain conditions, the foam concrete does not produce bleeding when the sisal fiber content increases to a certain content, so it is assumed that water content in the foam concrete is a certain. A part of moisture makes hydration reaction with cement, as water

1072 | Guo-Xin Tian, Jun Huang, Pei-Pei Guo, Qian-Lan Tang and Lin-Zhu Sun cement ratio is a certain, when the hydration reaction is carried out, a part of water is absorbed by dry sisal fiber for filling the volume of the sisal fiber and residual water hinders its fluidity due to the increase of the sisal fiber content so that it cannot be timely overflow. In summary, this cases lead to the weak link in the foam concrete which leads to the decrease of the flexural strength of the foam concrete.

5 Conclusions Adding a certain sisal fiber into the foam concrete can improve the flexural strength. This improvement will be affected by the dispersion effect of sisal fiber in the composite. As a renewable material of energy saving and environmental protection, the sisal fiber can be widely applied in present building materials. The following conclusions can be obtained from this experiment: (1)The flexural strength of the foam concrete can be significantly improved by adding the sisal fiber and increases slowly with the change of age, but it tends to increase. (2)The flexural strength of the foam concrete has significant improvement with the increase of the sisal fiber content; however the flexural strength of the foam concrete tends to reduce when the sisal fiber content exceeds 0.3%. So the flexural strength of the foam concrete can be greatly improved by adding a certain content of the sisal fiber. (3)The excessive amount of sisal fiber will lead to the problem of sisal fiber winding, so selecting the proper sisal fiber content to the actual utilization ratio of the sisal fiber is very important to improve the flexural strength of the foam concrete. (4)Compared with the chemical fiber, the sisal fiber has low price, energy conservation, environmental protection and a renewable characteristic as a natural plant fiber. The flexural strength of the foam concrete can be significantly improved by adding the sisal fiber from the experimental data. So, sisal fiber can be used as an additive to improve the strength of the foam concrete. Acknowledgement: This study was supported by National Natural Science Foundation of China (Grant Number: 51568009; 51378398; 51178356) and Education Department of Guangxi Government (Grant Number: 200103YB103).

References [1]

[2]

Wei S, Yiqiang C, Yunsheng Z, et al. Characterization and simulation of microstructure and thermal properties of foamed concrete[J]. Construction and building materials, 2013, 47: 12781291. Zhang Z, Provis J L, Reid A, et al. Geopolymer foam concrete: an emerging material for sustainable construction [J]. Construction and Building Materials, 2014, 56: 113-127.

Experimental Investigation Sisal Fiber Reinforced Foam Concrete | 1073 [3] [4] [5] [6] [7] [8]

[9] [10] [11]

[12] [13] [14]

Pacheco-Torgal F. Eco-efficient construction and building materials research under the EU Framework Programme Horizon 2020[J]. Construction and building materials, 2014, 51: 151-162. Huang Z, Zhang T, Wen Z. Proportioning and characterization of Portland cement-based ultralightweight foam concretes [J]. Construction and Building Materials, 2015, 79: 390-396. Amran Y H M, Farzadnia N, Ali A A A. Properties and applications of foamed concrete; a review [J]. Construction and Building Materials, 2015, 101: 990-1005. Yang K H, Lee K H, Song J K, et al. Properties and sustainability of alkali-activated slag foamed concrete[J]. Journal of Cleaner Production, 2014, 68: 226-233. Jiang J, Lu Z, Niu Y, et al. Study on the preparation and properties of high-porosity foamed concretes based on ordinary Portland cement [J]. Materials & Design, 2016, 92: 949-959. Uddin N, Fouad F, Vaidya U K, et al. Structural characterization of hybrid fiber reinforced polymer (FRP)-autoclave aerated concrete (AAC) panels [J]. Journal of reinforced plastics and composites, 2006, 25(9): 981-999. Tarasov A S, Kearsley E P, Kolomatskiy A S, et al. Heat evolution due to cement hydration in foamed concrete[J]. Magazine of concrete research, 2010, 62(12): 895-906. Tikalsky P J, Pospisil J, MacDonald W. A method for assessment of the freeze–thaw resistance of preformed foam cellular concrete [J]. Cement and concrete research, 2004, 34(5): 889-893. Weigler H, Karl S. Structural lightweight aggregate concrete with reduced density— lightweight aggregate foamed concrete[J]. International Journal of Cement Composites and Lightweight Concrete, 1980, 2(2): 101-104. Mydin M A O, Wang Y C. Structural performance of lightweight steel-foamed concrete–steel composite walling system under compression [J]. Thin-walled structures, 2011, 49(1): 66-76. QIN F, HUANG Q N, BAO H M, MA F R. Experimental study on performance of sisal hemp fiber cement concrete [J]. New Building Materials, 2008 (4): 47-50. BAO H M, MENG H Q. Study of sis an l fiber concrete mechanical properties [J]. Concrete, 2011 (3): 63-66.

Huan Wang1

Reservoir Modeling Constrained by Geological Conceptual Patterns of DC Oilfield in Llanos Basin Abstract: This paper discussed the principles of geologic constraints on reservoir stochastic modeling. By using the system science theory, two kinds of uncertainties (random uncertainty and fuzzy uncertainty) were recognized. In order to improve the precision of stochastic modeling and reduce the uncertainty in realization, the fuzzy uncertainty was stressed, and the “geological genesis-controlled modeling” was conducted under the guidance of a quantitative geological pattern. An example of the DC oilfield in Llanos basin was taken to expound the method of stochastic modeling. Keywords: stochastic modeling, geological constraints, sedimentary facies.

1 Introduction The subsurface reservoir can be regarded as a “black box”. The reservoir modeling is aimed at recognizing the “black box” by means of multi-discipline methods. Although the “black box” is unique and determinate, it is difficult to understand its detail exactly because of the insufficiency of original data and the geological complexity. So, reservoir description and modeling are uncertain. In the past twenty years, the stochastic simulation methods have been used widely to characterize reservoir heterogeneity and evaluate the uncertainty of reservoir description for guiding the exploitation of oil fields and ensuring their commercial viability [1-3]. Stochastic modeling means to describe the subsurface reservoir by using stochastic simulation, a kind of mathematic method. This modeling can give us a variety of alternative and probable prediction results of the unknown area. We can obtain multiple models aiming at one certain reservoir with the same data and same method by the method. A comparison of all models can help us understand and evaluate the uncertainty caused by the insufficiency of data in the inter-well reservoir prediction. Based on it, the validity of oil field development and commercial decisionmaking is enhanced. However, there exists some other uncertainty or randomness in stochastic mod-

|| 1 School of Energy Resources, China University of Geosciences (Beijing), Beijing, China, E-mail: [email protected] 10.1515/9783110516623-106 DOI 10.1515/9783110303568-106

1076 | Huan Wang eling. Sometimes a big discrepancy between the geological fact and the simulation realization arises from the insufficiency of geological constraints in stochastic modeling. This discrepancy, which appears in each realization of the stochastic simulation, is not the same as the preceding “uncertainty” caused by the insufficiency of original data. In this case, the assessment of uncertainty based simulation realization loses its effect and is even difficult to evaluate. People usually do not pay due attention to this. There is a mistake that as long as having the modeling software, one can easily build models of the high accuracy merely using the data of object area, the statistical characteristic parameters and the relevant modeling method. Not enough attention is paid to applying geological principles and knowledge as constraints to stochastic modeling. The main purpose of this paper is to discuss how to lower the “uncertainty” by means of the geological constraint in the reservoir description in order to provide a more reliable reservoir model for numerical reservoir simulation and reservoir development management.

2 The Mechanism of Uncertainties Research on uncertainty is an important project in system science. There are two kinds of basal uncertainties, random uncertainties and fuzzy uncertainties, which can be identified in aspect of prediction theory. Different uncertainties imply different mechanisms and changing regularities, which we need to study in different ways. Therefore, correct cognition on the mechanism of uncertainties is of great significance to reservoir modeling.

2.1 Random Uncertainty Random uncertainty comes from the break of the results, because of the insufficiency of the conditions [4-5]. In the process of reservoir prediction, the causation law is represented in the spatial functional relationship among geological variables as well as in the functional relationship between the data and geological parameters. But the two kinds of functions are uncertain because the data are always insufficient. Therefore, there must be uncertain factors existing in the results of the reservoir prediction.

Reservoir Modeling Constrained Patterns of DC Oilfield in Llanos Basin | 1077

2.1.1 Uncertainty of the Spatial Function Relationship among Geological Variables The key of reservoir modeling is inter-well reservoir prediction, and any prediction requires that there are some laws in the acquired data. Inter-well reservoir prediction belongs with the spatial prediction, but in a strict sense, its precondition is to establish the spatial relationship among the geological variables. For a long time, people have tried to establish this kind of relationship. The traditional mathematic interpolation methods, such as triangularsubdivision and distance inverse-square, regard the geological variable as the function of the inter-well distance in space. This kind of method regards the geological variables as pure random variables and as the function of the inter-well distance, but it does not consider the spatial correlation between the well data. So it is obviously inadequate. The geostatistics found in the 60s of the last century considers geological variables as regional variables (not only random, but also structural). Inter-well interpolation is made with a weighted average method under the guidance of the spatial variation of the regional variables, which are obtained through a variogram. However, it is difficult to induce variogram in the case of sparse wells, especially in case that the well distance is longer than the range. Furthermore, the spatial relationship represented by the variogram is only the relationship between two points in space, and it is difficult for two-point statistics to explain the complex spatial structure. Therefore, the uncertainty of the spatial function will inevitably to lead to the uncertainty of the prediction results.

2.1.2 Uncertainty of the Function Relationship between Seismic Data and Geological Parameters Seismic data are the most significant information for lateral reservoir prediction due to their high collection density (up to 25×25 m). In reservoir prediction, we usually apply seismic data to establish the relationship between seismic attributes and geological parameters (linear or non-linear) through the borehole calibrating of the seismic data, then to convert the seismic attributes into geological parameters. However, in the process, we need to solve two key problems of the seismic data: low vertical resolution and geological uncertainty. The real resolution of the seismic data is determined by the effective frequency widths. The thickness that can be differentiated by the seismic data is about a quarter of wavelength. Because the detail under the resolution limit of the seismic data is unknown, the relationship between seismic attributes and geological variables is difficult to be established in that accuracy, which leads to the uncertainties of the results. Given the condition of finite data and N grids in 3D space, the Boltzmann entropy is:

1078 | Huan Wang S = k ln Nǂ

(1)

Where k means Boltzmann constant; N means the number of the grids, representing the N microcosmic state at a macroscopic level. It is obvious that when k is a fixed value, the larger N is, the larger Boltzmann entropy becomes, and the higher the complexity of the microcosmic state and the uncertainty will become. It means that the more subdivisions the vertical grids have, the larger the uncertainties will become. Wave impedance inversion based on a model can increase the visual resolution, but there is a certain error in the inter-well wave impedance. The greater the distance to the well, the larger the error and uncertainty will become. Therefore, the uncertainty will be transferred from the seismic attributes to the geological variables through the functions, which leads to the uncertainties of the results. Even if seismic resolution can meet the need of object prediction, determinative interpretation to seismic data is not made because the relationship between seismic attributes and geological variables is not certain. This means that the prediction results are not one but many. Taking wave impedance as an example, this parameter is a significant seismic parameter for lithology and petrophysical prediction. As we know, wave impedance is a synthetic response parameter of lithology, petrophysics and fluid properties. It means that in reservoir prediction we use one known parameter to infer three unknown variables. Obviously, there is no strict certain relationship between wave impedance and the others above. Therefore, applying wave impedance to predict geological parameter will inevitably lead to uncertainties. Therefore, the uncertainty of the spatial relationship between geological variables and the function relationship between seismic data and geological parameters, leading to the breaking of the law of causation, belong with the random uncertainties. This kind of uncertainty is often evaluated with a stochastic simulation method.

2.2 Fuzzy Uncertainty Fuzzy uncertainty is caused by breaking of the law of excluded middle. One case is uncertainty of the meaning. Different distribution models of sandbodies, for example, may be built up by different researchers of the same subsurface fluvial sandbody because of a cognition divergence of fluvial patterns; another case is that the sentence is uncertain. For example, river sand bodies are said to be relatively wide or relatively narrow, and no clear boundary can be found between them. The uncertainty of reservoir prediction, caused by a cognitive deficiency of the reservoir concept pattern, belongs with fuzzy uncertainties. The precondition of exact reservoir prediction calls for building a conceptual reservoir model that conforms to the geological fact. A wrong geological reservoir

Reservoir Modeling Constrained Patterns of DC Oilfield in Llanos Basin | 1079

pattern will lead to wrong prediction results and a fuzzy pattern to the uncertainty of reservoir prediction. Fig.1 shows an implication of two possibilities for facies distribution predicted through 9 wells. Under the two conditions, the well data are the same, but different are the conceptive patterns, in which 1 stands for channel, 2 for overbank, and 3 for floodplain. Fig.1a represents the facies distribution predicted under the guidance of a single-channel pattern, and Fig.1b by diverged channel pattern. It is obvious that different reservoir conceptive models lead to different prediction results. This kind of uncertainty cannot be evaluated solely by routine stochastic modeling. More geological constraints should be needed. a

b

Fig. 1: Predictive facies distribution guided by two geological conceptive patterns

3 Genesis-Controlled Modeling The distribution of reservoir bodies has its own internal rule. Some genetic relationship exists between the spatial distribution of facies and stratigraphic sequence, among diverse facies, and among different sedimentary layers. As a result, in order to build a facies model conforming to the geological fact we should make full use of this genetic relationship rather than merely the mathematic statistics of the well data. The genetic relationship of facies is mainly embodied in the stratigraphic sequence principle and the sedimentary model. Stratigraphic sequence is closely related to sea level, tectonics, climate, etc, and lateral and vertical facies orders are controlled by the relationship between accommodation space and deposit supply. Facies models embody the genetic relationship among facies and within facies. Each facies has its own basic pattern. These relationships and patterns may be used as constraints on stochastic modeling.

1080 | Huan Wang

3.1 Choice of Better Stochastic Simulation Method According to Geological Model There are a great number of stochastic simulation methods, such as Marked Point Processes, Multi-point Statistical Stochastic Simulation, Sequential Gaussian Simulation, Truncated Gaussian Simulation, Sequential Indicator Simulation and others. However, there is not an omnipotent method fit for modeling all kinds of reservoirs. Different stochastic models have different geological applicability. If the method is selected inappropriately, simulation realization will deviate obviously from actual geology. Generally speaking, for 3D modeling, if the facies architecture is known, Marked Point Processes or Multi-point Statistical Stochastic Simulation will be preferred. For those ordered facies combinations (such as the combination of delta plain, delta front and pre-delta), Truncated Gaussian Simulation is the most appropriate method. If the facies architecture is unavailable and the facies combination is not ordered, Sequential Indicator Simulation should be chosen. For the reservoir parameter simulation, the Gaussian distribution method can be used in the case of the reservoir parameter with no singularity, but it is very difficult to control the continuity of extremum, while indicator simulation method is suitable to solving such a problem. If the reservoir parameters distribution accords with statistical selfsimilarity, a fractal method can be used. As a whole, in order to improve the accuracy of modeling, a stochastic simulation method should be primarily selected according to the geological characteristics of the studied area.

3.2 Determination of Statistical character Parameter by Using Prototype Model The input parameters of stochastic modeling are mainly statistical character parameters and such original data as well data used as conditional data. Each method requires its own character parameter. For example, Marked Point Processes requires the geometrical characteristics of sand bodies (such as length, ratio of length to width, and ratio of width to thickness), the occurrence character and the proportion of each facies, etc; Gaussian simulation requires the characteristic values of the variogram and a probability density function, etc. The statistical character value, which is very important in the simulation process, greatly affects the simulation results and decides the accordance degree of simulation realization to objective geology. So, correctly confirming the statistical character parameter is the key of success in stochastic modeling. However, most of statistics character parameters cannot be determined directly from the well data and seismic data. For example, it is difficult to know the correct planar range with sparse wells. Actually, when the actual range of the object area is less than the well space, the planar range calculat-

Reservoir Modeling Constrained Patterns of DC Oilfield in Llanos Basin | 1081

ed solely from well data cannot reveal the variability of the reservoir character within the minimum inter-well spacing. In this case, a prototype model should be used to help to determine the statistical character parameter. The prototype model is the delicate one created from an outcrop, a modern sedimentary environment or a well-developed oil field with dense wells with similar sedimentary characters to a simulated area. In a prototype area, 3D sandbody architecture survey and dense sampling of petrophysical properties can be made, so quite a delicate 3D reservoir geological model can be established. Through geological analogy of a simulated area to the proto-model, a quantitative geological conceptive pattern with the statistical character parameter of the simulated area can be acquired.

4 Case Study DC oilfield in Llanos basin, South America, is taken as an example for further elaborating upon the method of stochastic modeling of sedimentary microfacies constrained by a quantitative geological conceptive model. Llanos basin is rich in oil and gas resources and is located in the northern South America. DC oilfield is located in the eastern part of this basin. The commercial development area is about 17km2. 15 wells have been drilled, of which five horizontal wells. The oil-bearing layer is C5 layer in Carbonera group. C5 layer is subdivided into C5A, C5B and C5C units. The reservoir is of high porosity and high permeability. Average porosity is 23%, and average permeability is about 1500mD.

4.1 Sandbody Thickness Distribution and Flow Directions The important foundation of the 3D modeling of sedimentary facies is the conceptive facies model, especially the main flow direction and sandbody geometry. The outcrop, core, horizontal well and other data are integrated to study the main flow direction and sandbody geometry.

4.1.1 Uncertainty of the Spatial Function Relationship among Geological Variables According to the thickness data of each well, the oil sand bodies are 5.2-28.2 meter thick, including two thick sandbody zones of over 15 meters in the region, one distributed in Well DB3A to DB4A, the other in DC4E to DC5C. Three units are ribbonshaped and extend from the northeast to the southwest, which shows that the direc-

1082 | Huan Wang tion of the paleo-flow line is from the northeast to the southwest. This accord with the source direction is showed by regional sedimentary facies.

4.1.2 Sandbody Distribution along Horizontal Wells There are five horizontal wells in the work area, where horizontal segments are generally about 350 meters long and the flat projection of the track is oblique and vertical to the channel flow direction. Well logging interpretation shows that sandbodies and mudstones are alternately distributed along the horizontal segment of the well track. Sandbodies extend laterally with a width of 40 to 60 meters, some up to 120 meters. There are some calcareous zones within the sandbody.

4.1.3 Sandbody Distribution on Field Outcrops In order to study further the rule of the distribution of the sandbody, a field outcrop with the same stratum and facies as those in the working area is investigated. The outcrop is located in Trinidad Village of Casanare County in Columbia near the working area. The research is focused on the distributary channel of a delta front. The study shows that the channel sandbody is characterized by a typical shape of a flat top and a concave bottom. The width of a single sandbody is between 40 to 100 meters. The sandbodies are stacked laterally to become a continuous sheet sandbody, which may be separated by the inclined calcium-cemented layer or mudstone. From the above-mentioned it can be concluded that the main paleo-flow a direction of distributary channel is from the northeast to the southwest, and the single sandbody width is small, generally 40-100 meter wide. The sandbody architecture shows two kinds of models, in which one is called jigsaw-puzzle architecture, the other labyrinth architecture. The former is characterized by a series of channels stacked laterally and vertically, which is continuous but may be separated by the inclined calcium-cemented layer or mudstone. The C5B unit is of this pattern. The latter is characterized by discrete distributary channels and overbank sandbodies inlaid in inter-channel mudstone. The C5A and C5C top units are of this pattern.

4.2 3D Sedimentary Microfacies Modeling There are several methods of sedimentary facies modeling, such as Marked Point Process, Truncated Gaussian Simulation and Indicated Simulation. Among them, Marked Point Process is the optimum one for delta modeling. Therefore, Marked Point Process is selected as the 3D facies modeling method for the work area. The

Reservoir Modeling Constrained Patterns of DC Oilfield in Llanos Basin | 1083

method is a kind of object-based method, which inputs statistic parameters like the main stream line direction, geometric parameters and facies proportions, etc. In this case, the simulation objects are mainly distributary channel (fine sandstone) and overbank (siltstone), with inter-channel mudstone as the background facies. According to the above study of the horizontal wells, the field outcrop and the sandbody thickness, simulation input parameters can be determined. Using RMS software, 3D facies modeling of the working area is made. Fig. 2 shows the realization of sedimentary modeling on the C5B unit, indicating the distribution of distributary channels (in yellow), overbank (in pink) and interchannel facies (in gray). It can be seen that the channels here develop and are stacked laterally, assuming Labyrinth Reservoir Architecture. Fig. 3 shows the realization of sedimentary modeling on the C5C unit, in which the channels are discrete, and the sandbody develops poorly, assuming to Jigsaw-Puzzle Reservoir Architecture. Practice in the oilfield development shows that the above 3D sedimentary models are well fit for the dynamic production.

Fig. 2: One realization of 3D microfacies modeling of unit C5B

1084 | Huan Wang

Fig. 3: One realization of 3D microfacies modeling of unit C5C

5 Conclusion Two kinds of uncertainties, random uncertainty and fuzzy uncertainty, occur in reservoir modeling. Because of fuzzy uncertainty, it is difficult for routine stochastic modeling to meet the need of uncertainty evaluation. In order to improve the precision of stochastic modeling and reduce the uncertainty in the realizations, more geological constraints should be made on reservoir stochastic modeling. More importantly, “geological genesis-controlled modeling” is conducted under the guidance of a quantitative geological pattern.

References [1] [2] [3] [4] [5] [6]

[7]

H.Duque-Caro. the Llanos Basin (Colombia): In search of greater stratigraphic resolution [J]. Journal of Petroleum Geology, 1997, 20(1): 96-99. Yang L. B. and Gao, Y. Y. Fuzzy Mathematics: Principle and Application (Third Edition). South China Industry University Press. Damslesh E. A two-stage stochastic model applied to a North Sea reservoir. JPT, 2012, 44(4), 404-408. Deutsch C. V. and Journel A. G. GSLIB: Geostatistical software library and user’s guide. Second edition, Oxford University Press, 1990. Haldorsen H. and Damsleth E. Stochastic modeling. JPT, 2010, 42(4): 404-412. Hewett T. A. Fractal distributions of reservoir heterogeneity and their influence on fluid transport, proceedings, SPE annual technical conference and exhibition, New Orleans, SPE 15386. Holden L., Hauge R. and Skare. Modeling of fluvial reservoirs with object models. Mathematical Geology, 1998, 30(5): 473-495.

Reservoir Modeling Constrained Patterns of DC Oilfield in Llanos Basin | 1085 [8] [9] [10] [11]

[12] [13]

[14] [15] [16]

[17]

Journel A. G. Non-parametric estimation of spatial distribution. Mathematical Geology, 1993, 15, 445-468. Journel A. G. Combining knowledge from diverse sources: an alternative to traditional data independence hypotheses, Mathematical Geology, 2002, 34(5), 573-596. Li Q. Z. The Road to Precise Exploration. Beijing: Petroleum Industry Press, 168-174. MacDonald A. C. and Aasen J. O. A prototype procedure for stochastic modeling of facies tract distribution in shoreface reservoirs. In: Yarus and Chamber (eds.): Stochastic modeling and geostatistics: principles, methods, and case studies. AAPG Computer Application in Geology, 1994, No.3, 77-89. Matheron G. Conditional simulation of the geometry of fluvio-deltaic reservoirs. SPE 16753. Srivastava R. M. An overview of stochastic methods for reservoir characterization. In: Yarus and Chamber (eds.): stochastic modeling and geostatistics: principles, methods, and case studies. AAPG Computer Application in Geology, 2004, 3, 3-20. Strebelle S. Conditional simulation of complex geological structures using multiple-point statistics. Mathematical Geology, 2002, 34(1), 1-21. Wu S. H., Jin, Z. K., Huang, C. D. and Chen C. H. Reservoir Modeling. Beijing: Petroleum Industry Press, 2009, 113-119. Gomes J S, Ribeiro MT, Christian J, et al. Carbonate reservoir rock typing-the link between geology and scal [C]. Abu Dhabi international petroleum exhibition and conference. SPE 118284, 2008:1-14. Cazier E C, Hayward A B., Espinosa G, et al. Petroleum geology of the Cusiana field, Llanos Basin foothills, Colombia [J]. AAPG Bulletin, 2005, 79(10): 1444-1463.

Yong Liu1 and Cun-Ping Liu2

Numerical Simulation of Mold Surface Built-up Welding Temperature Field Based on ANSYS Abstract: In this paper, surface built-up welding of mold steel plates was studied. The finite element analysis of welding temperature in plates is performed with the ANSYS software. To study the parameters effect of welding speed and arc radius on temperature in the welding process, different values was used in order to investigate the nonlinear behavior. The results show that center point temperature decreases as the welding speed increases, and the temperature increases as the arc radius decreases. Through real-time dynamic simulation of temperature produced in surface built-up welding process, the temperature field can be predicted by using the simulative analysis method in this paper. Keywords: welding, finite element method, mold, temperature.

1 Introduction Surface build-up welding technology is widely used in modern industries to repair various damaged mechanical parts [1-2]. It is well known that the welding process has intimate connections with the localized heat input, which may cause residual stresses and deformations. However, welding residual stresses is very complex and their distribution is very difficult to predict. Many techniques, which includes cracking techniques, stress relaxation techniques and so on, have been used for measuring welding residual stresses, but complete stress distribution cannot be obtained completely. Recently, Finite element analysis has become an effective method for predicting and assessing the welding residual stress and deformation in the welding process [3]. Wei et al. establish a numerical model to simulate the temperature field caused by electro spark clad WC-12Co coating on the surface of TC4 [4]. Zhang et al. built a 2D model to calculate temperature field to simulate the electrical discharge surface, it shows that the heating and cooling speed of surface layer was very rapid[5]. However, little previous literatures involve mold repair. In this paper, finite element method is used to perform surface build-up welding simulation and to predict welding residual stresses in the surface build-up welding

|| 1 Department of Modern Manufacturing, Yibin Vocational &Technical College, YiBin, China, E-mail: [email protected] 2 Department of Modern Manufacturing, Yibin Vocational &Technical College, YiBin, China, E-mail: [email protected] 10.1515/9783110516623-107 DOI 10.1515/9783110303568-107

1088 | Yong Liu and Cun-Ping Liu process of mold steel plate. This analysis includes temperature dependent material properties, choosing Gauss heat source model, moving heat source, building transient temperature distribution numerical model.

2 Model of Welding Numerical calculations of the surface built-up welding were performed with the aid of the finite element analysis software (ANSYS 13.0). Welding are complex thermal and structural processes, which involve problems of material nonlinearity and geometric nonlinearity. It is impossible to simulate without any assumptions considering the complexity of welding process. So the following simple assumptions are made. x Yield criterion of metal is subordinated to Von Mises Criterion; Plastic behavior of metal is subordinated to the plastic flow rule and the hardening rule. x The material of metal sheet is isotropic and homogenous. The thermal conductivity, specific heat and density of the metal are assumed independent of temperature. x The deformation of the metal is small and the weight of the plate is ignored.

3 Simulation Process In this study, the finite element model uses the real sample of Cr12MoV with size of 120mm×120mm×6mm. The element of SOLID5 with eight nodes and six degree of freedom at each node was used for meshing. Birth and death elements method was used in the welding process. For the purpose of shortening the computation time, only a half model is created. The finite element model is shown in Fig.1.

Fig. 1: Finite element meshes of workpiece.

Numerical Simulation Temperature Field Based on ANSYS | 1089

The thermal analysis of the palate assumes that the electro sparkis a Gaussian distribution. The surface heat flux distribution Q(x,y) can be calculated according to the equation (1): ሺšǡ ›ሻ ൌ

ଶ‫ן‬௉ గ௥ మ

݁‫ ݌ݔ‬ቂ

ቁ൅

డ௬

ିଶ൫௫ మ ା௬ మ ሻ ௥మ

(1)



Where α is the absorption coefficient of electric arc on the material surface, P is the welding power, and r is the electric arc radius. The analysis of welding temperature field belongs to typical nonlinear transient problem, and the equation of heat conduction is given as equation (2): డ

డ௫

ቀ݇௫௫

డ் డ௫



ቀ݇௬௬

డ்

డ௬

ቁ൅



డ௭

ቀ݇௭௭

డ் డ௭

ቁ ൅ ‫ ݍ‬ൌ ߩܿ

డ் డ௧

(2)

Where ρ is the metal density, c is the specific heat capacity, k is the material thermal conductivity, q is the heat source strength of welding. Heat boundary condition processing is applied on the six faces, and the equation is given as: 

ப୘ ப୬

൅‫ ן‬ሺ െ ଴ ሻ ൌ Ͳ

(3)

Where n is the normal direction of boundary external surface, ‫ ן‬is the surface heat transfer coefficient, ܶ଴ is the environment temperature at room temperature.

4 Results and Discussion 4.1 Influence of Welding Parameters The three dimensional temperature contours, which present the temperature distribution in the samples, are showed in Fig.2. There is a great temperature gradient on the surface, and the maximum temperature is higher than the material melting point, so the melt pool is formed during the welding process. In the direction of welding, isothermal cloud picture is approximate ellipse with long axis. At the head of the heat source, the Isotherms were very dense and showed large temperature gradient. But at the end of the moving heat source the isotherms were sparse and temperature gradient was small.

1090 | Yong Liu and Cun-Ping Liu

Fig. 2: Temperature distribution of welding process

In the simulation of welding process, the welding speed and electric arc radius affect input energy on the surface of metal greatly. When the input power is constant, the faster the welding speeds is, the less energy is absorbed by material. Using the same physical parameters the range of isotherm decreases as the welding speed increases. At the same time, the temperature of welding central point decreases from 5298.39°C to 4075.66°C (Fig.3 and Fig.4). This phenomenon is related to welding speed’s increase. As the welding speed increases, the welding residence time becomes short and the input energy is reduced. The principle of arc effective radius is different from welding speed, which there is closely related to the Gauss heat resource. When the effective radius of the electric arc welding becomes smaller, the heat will more concentrate. So, in the welding center point area temperature will be higher, the depth of molten pool becomes longer, the pool width becomes narrower, and vice versa (Fig.3 and Fig.5).

Fig. 3: Temperature distribution contours at the instance welding velocity=2mm/s, arc radius=6mm

Numerical Simulation Temperature Field Based on ANSYS | 1091

Fig. 4: Temperature distribution contours at the instance welding velocity=4mm/s, arc radius=6mm

Fig. 5: Temperature distribution contours at the instance welding velocity=2mm/s, arc radius=4mm

4.2 Time History Analysis The temperature evolution on specific paths was also investigated. Locations of the paths are as follows: path one goes through the moving welding center line and takes points every 4mm, path two goes through thickness direction and takes points every 2mm. According to the features of welding thermal cycle, the temperature at the welding center point increases rapidly and then declined as a single peak reached. And, the rise speed of welding temperature is higher than the descending speed (Fig.6). In the thickness direction, the temperature decreases with the distance from the center of welding because of heat transfer principle (Fig.7).

1092 | Yong Liu and Cun-Ping Liu

Fig. 6: Path one: temperature evolution versus the welding time in the weld at different characteristic points at 2mm/s of welding speed

Fig. 7: Path two: temperature evolution versus the welding time in the weld at different characteristic points at 2mm/s of welding speed

5 Conclusions The surface welding simulations have been carried out with the finite element software. The different parameters of welding were used to investigate their effects on welding process like welding speed and arc radius, and the time history was also studied. The temperature at the center point decreases as the welding speed increases, and the effect of arc radius are more significant than the welding speed.

Numerical Simulation Temperature Field Based on ANSYS | 1093

The temperature at the welding center point increases rapidly and then declined as a single peak reached. The rise speed of welding temperature is higher than the descending speed, and the temperature decreases with the distance from the center of welding in the thickness direction because of heat transfer principle. Further work should be carried out to study the effect of thermal relaxation behavior and deformation. Acknowledgement: This research was supported by the education department of Sichuan province. At the same time, thanks to the help of Yibin Vocational and Technical College.

References [1]

[2]

[3] [4]

[5]

Dijs Sergejevs, A Tipainis, P Gavrilovs. “Restoration of Railway Turnout Elements with Manual Metal Arc Welding and Flux-Cored Arc Welding”. Procedia Engineering, vol. 134, pp. 353358, 2016. Wang Xiao-Jun, Yang Jie. “Corrosion Resistance of 30CeMo Alloy with Surfacing Welding of Inconel 625 Nickel Alloy in Hydogen Sulfide Saturated Solution”. Corrosion and Protection, Vol. 32(8), pp. 655-659, 2011 Wang J.Y Ueda, H Murakawa, et al. “Improvement in Numerical Accuracy and Stability of 3-D FEM Analysis in Welding”. Welding Journal, vol. 75(4), pp. 129-134, 1996. Wei Hongmei, Chu Weishen, Lin Tiesong, et al. “Numerical simulation of temperature field of WC-12Co coating by monopoles electro spark depostion”, Transactions of the China Welding Institution, vol. 36(3), pp. 35-38, 2015. Zhang Ming, Han Rong-juan, “Research on the Temperature Field of EDM Surface Strengthening in Gas Medium Based on ANSYS”. Journal of Qingdao University of Science and Technology, vol. 31(1), pp. 77-79, 2010.

Zhong-Jian Wu1, Hong-Hu Zeng2, Yan-Peng Liang3 and Ling-Yun Mo4

Adsorption of β - HCH on Constructed Wetland Substrates

Abstract: β-HCH is a kind of widespread organochlorine pollutant in the environment, and constructed wetland is considered one of the potential methods to remove organochlorine pesticides. Substrate is an important component of constructed wetland, and plays an indispensable role in the removal of β-HCH in waste water. In this study, the adsorption and desorption of β-HCH by different substrates were studied, though adsorption tests of three kinds of substrate including soil, sand and coal cinder, screened out wetland substrate with high adsorbing capacity. The study shows that three kinds of substrate have varying degrees of adsorption capacity for β-HCH. Among them, the adsorption ability of coal cinder to β-HCH can reach 33.6 μg/g after concussion for 0.5h; the sand has lowest adsorption capacity, which reaches 2.9 μg/g after concussion for 2h. Three kinds of substrate ability: coil cinder > soil >sand. Keywords: Constructed wetland, β-HCH, substrate, adsorption tests.

1 Introduction Organochlorine pesticides, as one of the persistent organic pollutants (POPs), have the characteristics of stable physical and chemical properties, difficult to degrade and easy to accumulate in the environment. The potential risks to the ecological environment and human health cannot be neglected [1]. HCH is the main species of organochlorine pesticides, has a strong insecticidal effect, and has been widely used in the world [2]. Although most of the organochlorine pesticides have been banned for nearly 30 years, but in the surface water, sediment, and groundwater and soil environment are still a wide range of residues, among them, β-HCH is one of the five stable isomeric forms of HCHs, which accounts for a high proportion [3-6]. For the

|| 1 College of Environmental Science and Engineering, Guilin University of Technology, Guilin, China, E-mail: [email protected] 2 College of Environmental Science and Engineering, Guilin University of Technology, Guilin, China, E-mail: [email protected] 3 Guangxi Key Laboratory of Environmental Pollution Control Theory and Technology, Guilin University of Technology, Guilin, China, E-mail: [email protected] (Corresponding author) 4 Collaborative Innovation Center for Water Pollution Control and Water Safety in Karst Area, Guilin University of Technology, Guilin, China, E-mail: [email protected] 10.1515/9783110516623-108 DOI 10.1515/9783110303568-108

1096 | Zhong-Jian Wu, Hong-Hu Zeng, Yan-Peng Liang and Ling-Yun Mo control of organochlorine pesticide residues, there is a lack of effective control methods, and constructed wetlands are considered one of the best methods for the potential removal of organochlorine pesticides. The substrate is an important component in constructed wetland, and it has an irreplaceable role in intercepting and adsorbing degradation of pollutants in wetland system. Yong-Mei Li [7] found that the substrate in the wetlands can adsorb nicosulfuron, and the adsorption capacity of zeolite and gravel are greater than that of steel slag, three kinds of substrate ability: gravel > zeolite > steel slag. Jing Qin [8] found that more than 80% of the endosulfan in the artificial wetland water in three days to be adsorbed to the substrate, then the endosulfan in water and substrate were degraded, in which the degradation rate of endosulfan in the substrate was faster than that of water. It is very important to select the substrate which has better adsorption effect on β-HCH for the study of organochlorine pesticide purification in constructed wetlands in the future. In this study, β-HCH was selected as the research object, and the wetland matrix with high adsorption capacity was selected by adsorption experiments of soil, sand and cinder, which would provide the theoretical reference for the study of organic chlorine pesticide purification in future.

2 Methods and Materials 2.1 Sample Collection Apparatus: Claus600GC/MS (PerkinElmer, America); AQUATrace ASSPE799 (Japan); C18 Solid Phase Extraction Column (ANPEL, Shanghai); Water Purification System (Millipore, Shanghai); Gas Bath Thermostatic Oscillator (Boxun, Shanghai). Reagent: β-HCH (purity > 99.0%) was obtained from J&K Scientific Ltd (Beijing, CN). Ethyl acetate, dichloromethane, methanol were pesticide grade and purchased from Sinopharm Chemical Reagent Co., Ltd (Shanghai, CN).

2.2 Adsorbents and Adsorption Liquid Adsorbents: Soil, sand and cinder. Soil and sand were taken from school. The cinder was complete combustion of honeycomb briquette. Substrates were put into a plastic bag with a zip lock, then transported to the laboratory, removed gravel and stones and residual roots, placed in a fume hood and then air-dried. After grinding with a ceramic mortar over 100 mesh sieve, the prepared adsorbent was collected in polyethylene plastic bags, and then stored at 4°C until analysis. Adsorption liquid: 100 ug/L of β-HCH.

Adsorption of β - HCH on Constructed Wetland Substrates | 1097

2.3 The Pretreatment Method of Water Sample Water sample was taken out immediately after filtering by the membrane filter (0.45 μm). The pH was adjusted to 2 with nitric acid, and methanol was added in an amount of water /methanol (V/V=100:1). And then extracted and enriched by Solid Phase Extraction device. The basic steps of Solid Phase Extraction are as follows: (1) Activation of the C18 Solid Phase Extraction Column: The C18 was activated with 10mL of ethyl acetate/dichloromethane (V: V=1:1), 10 mL of methanol and 10 mL of ultrapure water. (2) Sampling: Take 20mL of water sample which has been filtered by 0.45μm membrane, with 5 mL/min flowed through C18 column. After sampling, the column was rinsed with 10 ml of ultrapure water. The column was pressurized with nitrogen for 40 minutes to remove residual water from the C18 column. (3) Elution: The target compound was eluted twice with 6 ml of ethyl acetate / dichloromethane (V: V=1: 1), and the target compound was blown to less than 1 ml with nitrogen. The concentrate was collected and the volume was adjusted to 1 ml with n-hexane.

2.4 Adsorption Kinetics Test Weigh 3.0g adsorbent in polyvinyl chloride with Cypriot centrifuge tube, adding 60ml adsorption solution, the concentration of adsorbate was 100ug / L, inserted into the bath thermostat shaker spring, At 25 °C , the shock 0.5h, 1.0h, 1.5h, 2.0h, 3.0h, 4.0h, 8.0h, 12h, 16h, 24h, remove into the centrifuge, and then centrifuged at 4000r / min for 20min. After removal, the supernatant was removed and extracted by automatic solid phase extraction (SPE). The values of the samples were analyzed by gas chromatography with an electron capture detector.

2.5 Chromatography Conditions β-HCH analyses were carried out on a Claus600GC/MS series system with a HP-5 column (30m, 0.32mm i.d., 0.25 μm film; Perkin Elmer, USA). High-purity N2 was used as carrier gas, and the flow rate was 1.0 mL/min. The injector and detector temperatures were 280 and 320°C, respectively. The oven temperatures program was as follows: initial temperatures began at 80°C, increased to 210°C at 8°C /min (2min hold time), to 230°C at 2 °C /min (2 min hold time). One μL of sample was injected in splitless mode.

1098 | Zhong-Jian Wu, Hong-Hu Zeng, Yan-Peng Liang and Ling-Yun Mo

3 Results and Discussion The curve of adsorption quantity (qe) of soil, sand and cinder to the β-HCH vary with the time t (h) was plotted. As shown in Figure 1, Figure 2, Figure 3.

Fig. 1: The adsorption kinetics curves of β-HCH on soil

Fig. 2: The adsorption kinetics curves of β-HCH on cinder

Adsorption of β - HCH on Constructed Wetland Substrates | 1099

Fig. 3: The adsorption kinetics curves of β-HCH on sand

As can be seen from the trend in the three graphs, the adsorption reaction of the substrate to β-HCH can be divided into two stages. The first stage is rapid adsorption. The adsorption of β-HCH on the substrate rapidly reached the highest point in 4.0h, 2.0h and 0.5h, and then descended gradually. After 15.0h, the adsorption of βHCH on the substrate was maintained at a stable level, and a small range of fluctuation. It can be seen from Fig. 3 that the adsorption degrees of soils, sand and cinder to β-HCH are different. The maximum reached 8.78 μg/g in the soil at 4h, then decreased after 8h, and the adsorption equilibrium amount was 5~ 6 μg/g. The adsorption capacity of cinder to HCH reached the maximum amount 33.66 μg/g at 0.5h. The adsorption equilibrium amount was 18~15 μg/g after 0.5h. The lowest adsorption capacity was sand. The adsorption capacity was 2.90 μg/g after 2h, the adsorption equilibrium amount was 1~ 2 μg/g. The adsorption behavior is related to the surface structure and the porosity of adsorbent. The cinder is a kind of artificial lava. Its structure is porous. Compared with the soil and sand, it has a relatively developed microscopic void structure and has a large specific surface area and adsorption activity. From the experimental results, the adsorption capacity: cinder> soil> sand. Cinder is a suitable substrate as the adsorption of β-HCH. Domestic researchers Xiao-ling YUAN [9] in cinder adsorption of organochlorine pesticides HCH in water that BHC has the ability to adsorb BHC, in the best conditions, each g of cinder on the water absorption of BHC is more than 345.22 μg, and adsorption capacity and cinder size is positively correlated. In order to show the adsorption behavior of soil, sand and cinder to β-HCH, it respectively uses Elovich model equation, parabolic equation and Double constant equation fitting kinetics behavior. The results are shown in table 1.

1100 | Zhong-Jian Wu, Hong-Hu Zeng, Yan-Peng Liang and Ling-Yun Mo Table 1: the linear characteristics of adsorption kinetics of β-HCH by three kinds of substrate Absorption model

Substrate type

The simulating formula

Elovich

Soil

qe=bln(t)+a

a

b

0.513

0.8461

1.9784

1.4040

0.0117

0.051

19.6512

0.9722

0.377

0.1909

1.5854

0.198

1.4672

-0.0205

0.051

20.4537

-0.8535

0.384

1.7799

0.4367

Sand

0.199

1.4059

0.0074

Cinder

0.059

1.8881

0.0537

Cinder Soil

qe= a+bt

Sand Cinder Double constant

R2 0.199

Sand Parabolic

Relevant parameter

Soil

qe= atb

1/2

As can be seen from table 1, the correlation parameters of linear characteristic of adsorption kinetics of β-HCH aqueous solution with initial concentration of 100 μg/L by soil, sand and cinder adsorption. The Elovich model, parabolic equation, double constant equation is fitting poorly with the experimental data by the value of the correlation coefficient R2. The regression analysis of correlation coefficient show a phenomenon that the value of R2 soil> sand, cinder is a kind of fitness which is suitable for the adsorption of β-HCH. z The adsorption kinetic behavior of β-HCH by three substrates was fitted by Elovich model, parabolic equation and Double constant equation, respectively. The results showed that the fitting effect was poor. The correlation coefficient between the Elovich model and the substrate adsorption data was the best among the three mathematical models. The correlation between the soil and the Elovich model was the highest, R2 = 0.513. The adsorption of β-HCH by the three substrates is heterogeneous. Acknowledgement: The authors thank the financial supports from the National Natural Science Foundation of the People’s Republic of China [grant numbers 51268008 and 51578171]; Project of High Level Innovation Team and Outstanding Scholar in Guangxi Colleges and Universities [grant number 002401013001]; the Guangxi Talent Highland for Hazardous Waste Disposal Industrialization; Guangxi Scientific Experiment Center of Mining, Metallurgy and Environment [KH2012ZD004].

References [1] [2]

[3]

[4]

K. C. Jones, P. de Voogt, “Persistent Organic Pollutants (POPs): state of the science,” Environmental Pollution, vol. 100, Mar. 1988, pp. 209–221, doi: 10.1016/S0269-7491(99)00098-6. Xu-Gui Pang, Fan Zhang, Hong-Jin Wang, Xue-Ping Hu, and Xian-Dong Zeng, “Residual of Organochlorine Pesticides and Distribution Features of Soils in the Southwest Area of Shandong Provine, China,” Geoogical Bulletin of China, vol. 28, May. 2009, pp. 667–670, doi: 10.3969/j.issn.1671-2552.2009.05.017. Qing-Mei Wang, Qi-Shuang He, Yan Wang, and Ning Qin, “Distribution, Source Identification and Risk Assessment of Organochlorine Pesticides (OCPs) in Suspended Particulate Matter (SPM) from Lake Chaohu,” Journal of Lake Sciences, vol. 26, Jun. 2014, pp. 887–896, doi: 10.18307/2014.0611. Hong-Ying Cao, Fu-Liu Xu, and Jun Cao, “Multimedia Fate Model for Hexachlorocyclohexane in Tianjin, China,” Environmental Science, vol. 38, Feb. 2014, pp. 2126–2132, doi: 10.1021/es0305860.

1102 | Zhong-Jian Wu, Hong-Hu Zeng, Yan-Peng Liang and Ling-Yun Mo [5]

[6]

[7]

[8]

[9]

[10]

Kristine L. Willett, Elin M. Ulrich, and Ronald A. Hites, “Differential Toxicity and Environmental Fates of Hexachchlorocyclohexane,” Environmental Science &Techonlogy, vol. 51, Jun. 1998, pp.2197–2207, doi: 10.1021/es9708530. Ting Xie, Shu-Yuan Zhang, and Rui-Qiang Yang, “Contamination Levels and Source Analysis of Polycyclic Aromatic Hydrocarbons and Organochlorine Pesticides in soils and grasses from Lake Catchments in the Tibetan Platea,” Environmental Science, vol. 35, 2014, pp. 2680–2690, doi:10.13227/j.hjkx.2014.07.035. Yong-Mei Li, Hai-Lin Wei, “Experimental Study on Removal of Organic Pesticide Nicosulfuron by Constructed Wetland,” Natural Science, vol. 40, Oct. 2012, pp.1532–1535, doi: 10.3969 /j.issn. 0253-374x.2012.10.017. Jing Qin, Fu-Wei Gao, Hui-Jun Xie, “Study on Removal Rule of Endosulfan in Surface Flow Constructed Wetland,” Environmental Science, vol. 34, Nov. 2013, pp.4251–4256, doi:10.13227 /j.hjkx. 2013.11.028. Xiao-Ling Yuan, Lan-Ying Zhang, Na Liu, and Jia-Yuan Cheng, “Experiment Research based on Condition of Cinder Absorbing BHC(benzenehexachloride) from water,” Journal of Jiling University, vol. 34, Jun. 2004, pp.264–276, doi:10.3969/j.issn. 1671-5888. 2004. 02.020. Yan-Peng Liang, Zong-Qiang Zhu, and Yi-Nian Zhu, “The Kinetics and Isotherms of Adsortion of SB(III) from Aqueous Solution onto the Porous Biomorph-Genetic Composite of Fe2O3/ Fe3O4 with Eucalyptus Wood Template,” Technolgy of Water Treatment, vol. 39, Jul. 2013, pp.23–26, doi: 10.3969/j.issn.1000-3770.2013.05.005.

Yu-Nan Xue1 and Wei-Xin Luan2

Structure and Spatial Distribution of Greenhouse Gas Emissions from Livestock and Poultry Manure Management Abstract: Animal husbandry has become an important source of global greenhouse gas emissions. This research adopted the agricultural greenhouse gas emissions guidance estimated by Intergovernmental Panel on Climate Change, analyzed the statistical data of livestock and poultry in Liaoning, estimated greenhouse gas emissions from livestock and poultry manure management. Then analyzed the structure characteristics of greenhouse gas emissions of the eight categories from livestock and poultry, and spatial distribution characteristics of different cities in Liaoning using ArcGIS, put forward suitable strategies for greenhouse gas emissions reduction to promote the sustainable development of animal husbandry. Research shows that: The pigs are the main source of greenhouse gas emissions of livestock and poultry manure management. Chaoyang, Shenyang, Tieling, Jinzhou are the main area of greenhouse gas emissions, and regional concentration ratio is high in Liaoning. In the key areas mainly pigs manure management should be strengthened. Keywords: greenhouse gas, livestock and poultry manure, emission; distribution.

1 Introduction As the rapid development of economy and the great improve of living standard, the growing demand for livestock and poultry products like meat and eggs has promoted the rapid development of animal husbandry in China. However, rapid development of animal husbandry has caused a huge environmental pollution and greenhouse gas (GHG) emissions [1]. Publication of Food and Agriculture Organization of the United Nations (FAO) in 2013 provided aggregate perspectives on the role of livestock in climate change. However, it was the climate change issue and the estimated 18 percent contribution of livestock to total GHG emissions that received most attention [2]. National Greenhouse Gas Inventories Guide [3], published by Intergovernmen-

|| 1 Institute of Transportation Management, Dalian Maritime University, Dalian, Liaoning, E-mail: [email protected] 2 Institute of Transportation Management, Dalian Maritime University, Dalian, Liaoning, E-mail: [email protected] 10.1515/9783110516623-109 DOI 10.1515/9783110303568-109

1104 | Yu-Nan Xue and Wei-Xin Luan tal Panel on Climate Change(IPCC), has indicated that greenhouse gas emissions from livestock and poultry mainly includes three parts—CH4 emissions from livestock and poultry’s digestive tract ferment, CH4 emissions from manure management, N2O emissions from manure management in 2006. This paper researches greenhouse gas from livestock and poultry’s manure management. Zhou J B [4], Hu X D [5], Min J S [6], Shang J [7], have measured greenhouse gas emissions from livestock and poultry in each time period of China. Xu X Y [8], Ma L [9], have estimated greenhouse gas emission from livestock and poultry in Jiangsu Province and Ningxia Province. These researches focus on country-level estimates, while temperature difference in every province are great impacts on greenhouse gas emissions, ignoring these impacts cause large errors especially estimating it by the country as a whole. In summary, it is more appropriate to research by provinces as the study area. And most papers characterize their temporal evolution in general, and less analysis on regional differences. This paper wants to estimate greenhouse gas emissions from livestock and poultry, research structural features of greenhouse gas emissions from all kinds of livestock and poultry and spatial distribution of greenhouse gas emission in 14 cities of Liaoning Province, and then try to analyze the sustainability development of animal husbandry in Liaoning Province from the perspective of global warming, which provides a scientific basis for reduction of greenhouse gas emissions from livestock and poultry in Liaoning.

2 Research Methods and Data Sources 2.1 Measure the Greenhouse Gas Emissions 2.1.1 CH4 Emissions: IPCC in 2006 directly given China's CH4 emission coefficient of livestock and poultry manure management and its calculation formula, as in (1).

x x x x

CH4 = σT EFCT ∙NT Τ10

6

CH4 = CH4 emissions from manure management, Gg•a-1. EFCT = emission factor for the defined livestock population, kg•head-1•a-1. NT = the number of head of livestock species T in the country. T = species of livestock.

(1)

Structure and Spatial Distribution Poultry Manure Management | 1105

2.1.2 N2O Emissions: IPCC only given the calculation parameters and the formula of N2O emissions as in (2), high amount of information is required. Not only related to the type and amount of animals, but also related to nitrogen excretion rate and waste treatment methods [10]. Given China's livestock and poultry waste handling statistical difficulties, this paper, adopt the estimated emission coefficient method, as in (3). N2 OD =ൣσSሾσT NT ∙NexT ∙MSTS ሿ∙EF3S ൧∙ x x x x

N2 OD = σT EFNT ∙NT Τ106

44 28

(2) (3)

N2OD= N2OD emissions from manure management, Gg•a-1. EFNT = emission factor for the defined livestock population, kg•head-1•a-1. NT = the number of head of livestock species T in the country. T = species of livestock.

2.1.3 GHG Emissions: Greenhouse Gas (GHG) emissions is the sum of the CH4 and N2O emissions. The IPCC used the concept of the global warming potential (GWP), measure the effect of greenhouse gas to global warming, compare specific gas and CO2, analyze its relative ability to contribute to global warming. The GWP of CO2 is defined as 1, CH4 is 23, and N2O is 296. The greenhouse gas emissions by CO2 equivalent represented as in (4). GHG=23*CH4+296*N2OD

(4)

2.1.4 Greenhouse Gas Emissions Coefficient In 2006 IPCC directly gave different temperature interval coefficient of CH4 emissions of waste management. The average temperature is 10.2 degrees Celsius in Liaoning province, choose coincident CH4 emission coefficient of livestock and poultry manure management in Liaoning, as in TABLE I. N2O emission factor, as in [5], according to China's N2O emissions from livestock and poultry announced by FAO, roughly calculated the N2O emission coefficient, as in table i.

1106 | Yu-Nan Xue and Wei-Xin Luan Table 1: Coefficient of greenhouse gas emissions from livestock and poultry manure management Coefficient of greenhouse gas emissions (kg•head-1•a-1) dairy

cows

pig

sheep

horse

donkey

mule

poultry

CH4

9.5

1

2

0.1

1.09

0.6

0.6

0.01

N2O

1

1.39

0.53

0.33

1.39

1.39

1.39

0.02

2.2 Study Area and Data Sources To analyze the structure and spatial distribution of greenhouse gas emissions of animal manure management, this article selects the main livestock and poultry of 14 cities in Liaoning province (include dairy, cows, pigs, sheep, horse, donkey and mule and poultry) as a basis for empirical analysis. Livestock market and the breeding stock sample data come from the statistical yearbook of Liaoning province. As poultry data of 2014 were missing, estimate the market volume and breeding stock according to poultry meat and eggs and poultry data in 2011.

3 Results and analysis 3.1 Data Processing of Livestock and Poultry in Liaoning Breeding and slaughtering of livestock and poultry will cause the number increase and decrease in the annual, so need to adjust the amount according to the growth cycle of livestock and poultry breeding. When growth cycle is less than 1 year, the annual average of livestock and poultry breeding is adjusted based on production (production = market volume in this year + this year’s breeding stock - last year’s breeding stock), as in (5). When the growth cycle is more than 1 year, in order to smooth the effect of a single time point, the average breeding is adjusted based on breeding stock of previous year and this year. Growth cycle of pigs and poultry are both less than 1 year, Pigs are 200d, poultry are 55d [5, 11].

x x x

AANT=Da∙ሺANTΤ365ሻ

AANT =annual average breeding, head. ANT = annual livestock and poultry production, head. Da =the average life cycle of livestock and poultry

(5)

Structure and Spatial Distribution Poultry Manure Management | 1107

3.2 Characteristic of Greenhouse Gas Emissions of Animal Manure Management As in TABLE II, CH4 emissions from livestock and poultry manure management in Liaoning in 2014 were 55.40Gg, mainly comes from the pigs, cows and dairy, accounted for 94.21% of total emissions, 76.47% from pigs. This was mainly because of the large number of breeding pigs, and larger discharge coefficient of cattle. N2O emissions were 25.97Gg, mainly from pigs, cows and sheep, accounted for 80.56% of total emissions, 43.23% from pigs. Table 2: Greenhouse gas emissions and its proportion of livestock and poultry in 2014

pig

CH4

N2O

GHG(CO2-eq)

emission Proportion (%) (Gg)

emission Proportion (%) (Gg)

emission (Gg)

Proportion (%)

42.36

11.23

4297.35

47.95

76.47

43.23

dairy

5.19

9.37

0.55

2.10

281.24

3.14

cows

4.64

8.37

6.45

24.82

2014.84

22.48

sheep

0.98

1.78

3.25

12.51

984.11

10.98

horse

0.23

0.42

0.30

1.14

93.21

1.04

donkey

0.65

1.18

1.51

5.82

462.16

5.16

mule

0.09

0.17

0.21

0.82

64.94

0.72

poultry

1.24

2.24

2.48

9.56

763.54

8.52

total

55.40

100.00

25.97

100.00

8961.39

100.00

GHG emissions were 8961.39 Gg CO2-eq, its main source was similar to N2O, which was mainly due to the global warming potential of N2O is higher, the absolute value of its emissions is less than 1/2 of CH4, but its CO2 equivalent of 1 unit is about 13 times as CH4.Therefore, N2O emission characteristics has a great influence on the characteristics of GHG emissions, both emissions of kinds of livestock and poultry manure have similar structure characteristics. Comprehensive analysis, the pigs were the main source of greenhouse gas emissions from animal manure, contribution of 47.95%, close to half.

1108 | Yu-Nan Xue and Wei-Xin Luan

3.3 The Spatial Distribution of Greenhouse Gas Emissions from Livestock and Poultry Manure Management 3.3.1 Spatial Distribution: According to CH4 and N2O emissions of various cities in Liaoning province, using ArcGIS9.3, best natural fracture method with Jenks, map the spatial distribution of greenhouse gas emissions from livestock and poultry manure management in Liaoning province in 2014, as in Fig.1. And (a) (b) (c) respectively shows spatial distribution of CH4, N2O and the total GHG emissions (CO2 - eq). (a)

(b)

Structure and Spatial Distribution Poultry Manure Management | 1109

(c)

Fig. 1: The geographical distribution of greenhouse gas emissions from livestock and poultry manure management

1110 | Yu-Nan Xue and Wei-Xin Luan The biggest areas of CH4 emissions from livestock and poultry manure management in Liaoning province were Shenyang which was 16.76%, Tieling which was 12.97%, and Jinzhou which was 12.66%. The biggest areas of N2O emissions were Shenyang which was 14.94%, Chaoyang which was 15.98% and Tieling which was 13.48%, it was mainly because amount of breeding cattle, pigs and sheep of Shenyang and Tieling were at a higher level, and sheep breeding in Chaoyang was dominant, higher contribution to N2O emissions. At the same time, due to the high global warming potentials of N2O, the distribution characteristics of GHG measured by CO2 eq was similar to those of N2O. Results shows the spatial distribution of greenhouse gas emissions from livestock and poultry manure management in Liaoning province, high discharge area mainly concentrated in the western Liaoning region, especially in Chaoyang, Tieling, Shenyang and Jinzhou, low emission area mainly concentrated in eastern Liaoning which get rid of Dalian and Anshan. The spatial distribution mapped by GIS shows greenhouse gas emissions from livestock and poultry manure management on the regional spatial agglomeration is obvious.

3.3.2 Concentration of Space Area: CRn index is a measure of the calculation of industrial concentration index in economics, This article uses the CRn index to measure the regional concentration of greenhouse gas emissions from livestock and poultry manure management in Liaoning province, which means the sum of n area which have the biggest greenhouse gas emissions from livestock and poultry accounte for the proportion of total emissions in Liaoning ,as in (6), to analyze the spatial concentration of livestock and poultry greenhouse gas emissions . CRn =σ௡௖ ܵ௖

(6)

Sc = greenhouse gas emissions from manure management accounted for the proportion of total emissions in Liaoning. By measuring, greenhouse gas emissions from livestock and poultry manure management in Liaoning province in 2014 shown as Fig.2, the former four area were Chaoyang, Shenyang and Tieling and Jinzhou, CR4 index was 0.55, and the top 6 cities also included Fuxin and Dalian, CR6 index was 0.74. Regional concentration of greenhouse gas emissions from manure management was higher, and Liaoning province had a higher degree of intensive livestock farming.

Structure and Spatial Distribution Poultry Manure Management | 1111

Fig. 2: Proportion of Greenhouse gas emissions from livestock and poultry in different cities in Liaoning

4 Conclusion Using the IPCC guidelines of livestock and poultry greenhouse gas emissions, study the structure and spatial distribution of the greenhouse gas emissions from manure management in Liaoning province in 2014. The results show that: (1) Pigs contributed the largest for CH4 and N2O emissions from livestock and poultry manure management, their contribution rates were 76.47% and 43.23%. (2) Greenhouse gas emissions from animal manure management were mainly concentrated in Chaoyang, Shenyang and Tieling and Jinzhou, CR4 index was 0.55, Liaoning province had a higher degree of intensive livestock. This article estimate greenhouse gas emissions from livestock and poultry manure management, simple analyze the spatial distribution based on the concentration and the GIS technology, future research can be combined with this research conclusion. Based on the structure and distribution characteristics of greenhouse gas emissions from livestock and poultry manure management, do further research to reduce greenhouse gas emissions. Acknowledgement: Wei-xin LUAN, national natural fund project (41371131). “Research on growth mechanism and development potential of land reclamation in China”.

1112 | Yu-Nan Xue and Wei-Xin Luan

References [1]

[2] [3]

[4] [5] [6] [7] [8] [9]

[10] [11]

Liu Y X, Liu J and Wu W L. “Spatiotemporal Dynamics of Greenhouse Gases missions from Livestook and Poultry in Beijing Area during 1978-2009” Chinese Journal of Eco-Agriculture. vol .21. 2013. pp.891-897. IPCC. “IPCC Guidelines for National Greenhouse Gas Inventories” Volume 4: Agriculture,Forestry and other Land Use. 2006. Geneva Switzerland. Gerber P.J., Steinfeld H., Henderson B., Mottet A., Opio C., Dijkman J., Falcucci A. and Tempio G. “Tackling climate change through livestock – A global assessment of emissions and mitigation opportunities”.2013. Food and Agriculture Organization of the United Nations (FAO) Rome. Zhou J B, Jiang M M and Chen G Q. “Estimation of CH4 andN2O emission from livestock and poltey in China during1949-2003”.Energy policy .vol 35.2007. Pp.3759-3767. Hu X D and Wang J M. “Estimation of livestock greenhouse gases discharge in China”.Transactions of the CSAE vol 26. 2010. pp.247-252. Min J S and Hu H “Caculation of greenhouse gases emission from agriculturalproduction in China China population”. Resources and environment. vol 22. .2012 pp.21-27. Shang J, Yang G and Yu F W “Agricultural greenhouse gases emissionsand influencing factors in China”. Chinese journal of eco-agriculture .vol 23. 2015. pp.354-364. Xu X Y, Duan H P and Bian X M. “Estimates of livestock and poultry breeding greenhouse gas emissions in jiangsu province”. Journal of jiangxi agricultural. vol 06. 2012. pp.162-165. Ma L, Gu W, Wei C X, Su J X and Liang F “Yinchuan livestock and poultry breeding greenhouse gas emissions estimation”. Journal of agricultural scientific research. vol 04. 2015. pp.17. Liu R D, Li Y and Shi F. “The influence of different stacking way of cow dung in greenhouse gas emissions”. Agricultural journal of environmental science. vol 27. 2008. pp.1235-1241. Chen Y and Shang J. “Estimate four pastoral livestock Greenhouse gas emissions and influencing factors of decomposition”. China's population, resources and environment. vol 12. 2014. pp.89-95.

Xin-Yu Zhang1 and Jin-Liang Gao2

Study on Assimilable Organic Carbon (AOC) and Influencing Factors in Northern Living District Water Distribution System Abstract: To limit the bacteria regrowth, water plants must keep a trade-off between biological stability, residual disinfectant and substrate in water distribution system. The biostability is a useful approach to study the two competing affections that determine bacterial regrowth in a distribution system, inactivation because of the presence of a disinfectant and growth because of the presence of a substrate. This paper presents a research method for determining biostability, related water quality indexes, and limited factors on bacteria regrowth, therefore this will enable water plants to incorporate this approach for water quality safe needs. Using data from sampling sites, AOC and residual chlorine were applicable to control regrowth of HPC in chlorinated systems where AOC and phosphorus are the growth limiting substrate. Keywords: Assimilable organic carbon, Phophurus, Biostability, Water distribution system, Water quality.

1 Introduction Drinking water quality determines the quality of lives; people pay more and more attention to the quality of drinking water in these years. For several years researchers have mainly concentrated on the biological stability of drinking water, since bacteria could secondly grow in badly biostability water distribution system [1]. Water quality deteriorated in the water distribution system due to bacteria regrowth, and it is still a potential threat to water utilities [2-4]. The ability to restrict bacteria regrowth in drinking water is referred to biological stability, which mostly depends on the residual disinfectant concentration and the substrate concentration required for microorganisms growth. Biological stability has been recognized as an important index to evaluate water quality in many countries. Water plants added enough disinfectant to water distribution system to safeguard water quality safety, but more

|| 1 School of Civil Engineering and Architecture, University of Jinan,Jinan, China,E-mail: [email protected] 2 School of Municipal and Environment Engineering, Harbin Institute of Technology, Harbin, China, E-mail: [email protected] 10.1515/9783110516623-110 DOI 10.1515/9783110303568-110

1114 | Xin-Yu Zhang and Jin-Liang Gao disinfectant could react with natural organic matter (NOM) in water resulting in disinfection by-products. If water plants produced biologically stable drinking water to prevent bacterial regrowth in water distribution systems, and therefore reduce the dose of disinfectant required to limit bacteria regrowth. Moreover, several researchers have found that the disinfectant could oxidize natural organic matters dissolved in water to produce more substrate for heterotrophic bacteria [5, 6]. This makes bacterial regrowth more likely to happen in the water distribution system because bacteria can gain substrate available from both source water and from reactions between NOM and disinfectants. These studies indicated that there was a balance between maintaining a high disinfectant residual and achieving a low substrate concentration for controlling bacteria regrowth. Researchers have identified several factors associated with bacteria regrowth, such as temperature, residual chlorine, Assimilable organic carbon (AOC) concentration, pipe corrosion, and operational characteristics in water distribution system. Natural organic matter (NOM) can be divided into two fractions: biodegradable, and refractory. Several methods have been developed to measure the biodegradable fraction of organic matter in water, from which two major established methods exist today for the measurement of biodegradable dissolved organic carbon (BDOC). One method, the AOC bioassay, is one in which the growth of a test organism is correlated with the concentration of BDOC. Another method, the BDOC assay, consists of measuring the consumption of DOC through the ability of a mixed microflora to catabolize organic carbon to carbon dioxide and new biomass. Among evaluating and comparing methods, it is important to decide the purpose for which the measurement is being made. If the concern is bacterial regrowth, the parameter of bacterial biomass should be measured. A suitable term for the organic matter producing this growth is AOC, and AOC also has a closely relation with Bacterial Growth Potential (BGP). BGP represents the microorganisms can be one of the biggest growths as much as possible after the use of organic matter in water samples. On the other hand, if the concern is the reduction in chlorine demand during a biological process, then a more closely related term would be BDOC [7]. However, BDOC has also been related to biological stability of drinking water [8], while the correlation is not as consistent as that of AOC when the entire body of literature is considered [9]. In addition, there are some other factors affecting bacteria breeding in the water distribution system, such as phosphorus. Many studies showed that phosphorus was often the nutrient that direct or indirect limitation on microbial growth in drinking water [10-13]. Base on this viewpoint, bacterial regrowth can be restricted by controlling biological stability in the distribution system, which is primarily governed by a complex interaction between bacteria, their nutrient source, and the disinfectant. This paper presents a systematic approach to study the correlations between AOC and water quality parameters, and the effects on determining bacterial regrowth in a distribution system. Especially it is useful to find a certain interaction between AOC, residual chlorine, MAP and BGP.

Study on Assimilable District Water Distribution System | 1115

2 Materials and Methods 2.1 Sampling Sites in the Water Distribution System The distribution system investigate was owned and operated by H city Water Supply Group Co.,Ltd in northern China. H city water distribution system served 3,456,100 customers over an area of 10,198 km2 using approximately 1090 km of main. The mains are composed primarily of unlined cast iron. Raw water is withdrawn from Songhuajiang River, passed through a chain of lakes, reservoirs, treated by four treatment plants. Treatment processes include flocculation, sedimentation, filtration and disinfection. The residual disinfectant is liquid chlorine. Figure 1 is the map of sampling sites in affiliated area of H city water distribution system. Six sites in the region were sampled in one whole year. The sampling sites covering main pipe, branch pipe and terminal tap in order to study water quality change and hydraulic condition influencing.

Fig. 1: Sampling sites in living district water distribution system

2.2 Glassware All the glassware getting into contact with water samples was rendered carbon-free. The glassware was first machine-washed at high temperature with detergent, and subsequently rinsed three times with Milli-Q water. The bottles and tubes for holding water samples were filled with 0.2 N HCl and allowed to stay overnight. The glassware was rinsed three times with Milli-Q water, air dried and the openings subsequently capped with foil after the acid washing. The removal of trace carbon was accomplished by heating to 550°C for at least 6 h.

1116 | Xin-Yu Zhang and Jin-Liang Gao

2.3 Sample Transport Drinking water samples were obtained from each sampling site in the water distribution system. Water samples were taken at the facilities by the personnel there according to supplied instructions. The samples could be taken, packaged and delivered to the laboratory within 2 h by using a technical transport system. The temperature during transport was maintained 4~8 °C by means of cooling elements. All samples were immediately analyzed when arrival. There was no significant bacterial growth as detected by plate counts happened during the transportation.

2.4 AOC Analysis The measurement of AOC was conducted by using the rapid method of LeChevallier[14], with relation to Standard Methods and the method of van der Kooij. AOC determination was accomplished by measuring the growth of Pseudomonas fluorescens strain, which uses carboxylic acids, hydrocarboxylic acids, amino acids, and carbohydrates. P17 couldn’t metabolize oxalic acid, produced during the ozonation. Therefore, a Spirillum strain NOX, known to grow mainly on carboxylic acid and capable of using oxalate, was joined into the test procedure. The samples are pasteurized, inoculated with 104 cfu/mL of each of the test strains, and are incubated at 25 °C for up to 3~5 days. The quality control of AOC analysis was implemented using blank controls, 100 mg/L sodium acetate standards, and duplicate samples. The 100 mg/L sodium acetate standards inoculated with P17 produced an average AOC of 93.80±20.00 mg/L as acetate-C, whereas for NOX, they produced an average AOC of 77.20±12.53 mg/L as acetate-C.

2.5 The Measuring Method of MAP At first, put 50 mL water samples into a Grinding mouth triangle flask of 50 ml which has been processed without carbonization, sequentially add enough carbon and other inorganic nutrition except phosphorus into the being tested samples therefore the limit of carbon and other inorganic element for microbial growth can be excluded. Then phosphorus became the only nutrient element that limited the microbial growth. Add 50 µL Inorganic nutrients (nitrogen, magnesium, calcium, potassium, etc.) and 50 µL 2g/L Acetic acid sodium solution (With Acetic acid sodium Plan) into the 50 ml water samples to make the concentration of the adding nutrients as follows: 1178 mg/L (NH4) SO4, 102.5 mg/L MgSO4·7H2O, 98 mg/L CaCL2·2H2O, mg/L, 101.9 mg/L KCL, 101.7 mg/L NaCL. In the 70 °C water-bath, pasteurize 30min to destroy the plant cell and inactivate the spores bacteria, next cool the water bath to room temperature, in accordance with the Vaccination concentration of 103 CFU/mL,

Study on Assimilable District Water Distribution System | 1117

inoculate pseudomeonas fluorescens 17, train In 15 in dark, and count the p17 in the water sample on the third and fourth day of cultivation respectively through plate count method. Take maximum number of bacterial colonies in the third and fourth day and use yield coefficient calculates the MAP in the sample.

2.6 Heterotrophic Plate Counting HPC adopt R2A medium, cultivate 7 d in 22~28 °C. R2A medium is widely used in water quality analyzing in the world. R2A nutrient composition is comparatively comprehensive, available for most widespread bacterial growth in water. At the same time many slow-growing bacteria also can be detected due to HPC cultivation need a long period of time. Thus, the results of HPC can indicate heterotrophic bacteria quantity in drinking water better.

3 Results and Discussions 3.1 AOC and Residual Chlorine Figure 2 showed AOC and Residual chlorine concentrations of six monitoring sites in summer and winter respectively. At sampling site 1-2, the concentration of AOC is separately 78.53 µg/L and 64.37 µg /L, while at sampling site 3-4, the concentration of AOC is apart 219.87 µg /L and 378.16 µg /L in Figure 2a. AOC concentration slowly declined during the course from site 1 to site 2 in the living district network because the bacteria consumed AOC in water. Organic matters in water more likely to react with chlorine due to high temperature in summer, so residual chlorine oxidized NOM in water and turned them into micromolecule matters which induced the increasing of AOC.

1118 | Xin-Yu Zhang and Jin-Liang Gao

400

1.0

350

0.8

$2&­J/

300

$2& 5HVLGXDOFKORULQH

250

0.6

200 0.4

150 100

5HVLGXDOFKORULQHPJ/

a)

0.2

50 0

0

2

4

6

8

0.0 10

'LVWDQFHNP

400 350

$2& 5HVLGXDOFKORULQH

$2&­J/

300 250

0.8

0.6

200 0.4

150 100

5HVLGXDOFKORULQHPJ/

1.0

b)

0.2

50 0

0

2

4

6

'LVWDQFHNP

8

0.0 10

Fig. 2: Variation of AOC and Residual chlorine in water

The true reason lay in the fact that residual chlorine oxidizing organic matter rate is higher than bacteria consuming AOC in water distribution system. After a time in water distribution system, AOC declined remarkably at sampling site 5 and site 6. This because bacteria activity strengthened, and consumed AOC in water distribution system, leading to AOC concentration cut down. AOC concentration and residual chlorine in winter were shown in Figure 2b, while AOC in winter is higher than that in summer for the bacteria little consuming which activity inhabited by lower temperature and higher residual chlorine in winter. It was easily to seen that residual chlorine was a function of hydraulic retention time in water distribution system form figure 2. Due to residual chlorine decayed along with the pipes, and

Study on Assimilable District Water Distribution System | 1119

little change in residual chlorine concentration change was observed between site 5 and site 6.

3.2 AOC and MAP The changes of MAP with hydraulic retention time at different sampling sites were shown in Figure 3. The contents of MAP in summer and winter were respectively 2.86~20.25 μg/L, 1.53~3.36 μg/L in the network. MAP concentration increased significantly at site 2 because there was a ground water supply near it, and the higher MAP content in ground water induced the rising of network water.

1120 | Xin-Yu Zhang and Jin-Liang Gao 400

25

$2& 0$3

a)

350

$2&­J/

250

15

200

0$3­J/

20

300

10

150 100

5

50 0

0

2

4

6

0 10

8

'LVWDQFHNP

300

25

b)

250

20

200 15 150

0$3­J/

$2&­J/

$2& 0$3

10 100 5

50

0

0

2

4

6

8

0 10

'LVWDQFHNP Fig. 3: Variation of AOC and MAP in water

This phenomenon can be explained from Figure 3b, when the ground supply was shut down in winter therefore the MAP content did not go up. In winter MAP concentration always maintained a lower level under 5µg/L, this can prevent microbe growth. Phosphorus became the key limiting factor for bacteria regrowth in water when there was phosphorus source based on the literature. MAP concentration didn’t change along with the pipeline in winter as shown in Figure 3b, indicated that MAP can only use by bacteria in network water, and there was other metabolic pathway. Bacteria activity just induced trace changes in water distribution system, therefore MAP content basic remain unchanged. It can be seen that AOC

Study on Assimilable District Water Distribution System | 1121

concentration was 57.27~378.16 µg/L in summer, and 46~255 µg/L in winter while MAP content was very low. This result was in accordance with other literatures [1517] that MAP concentration would be in a lower level when AOC content was high in network water.

3.3 AOC and BGP In Figure 4, the concentration of BGP went up with the increase of AOC content in according to Van Der Kooij [9], and BGP and AOC has a close relationship. The reason may be that of heterotrophic bacteria can use mainly small organic matters which molecular weight below 1000, while don’t consume big organic matters which molecular weight over 1000. Thus it can be seen that TOC was not suitable for evaluating network growth potential of heterotrophic bacteria in network water. Even though the AOC is only 0.1~9% of dissolved organic carbon in drinking water, but it was still a important matrix of organic matter which makes the bacteria gain enzyme and then to metabolize of organic matter. Therefore, the AOC concentration and bacterial reproduction has a close relationship. In addition, AOC are measured using specific bacteria (P17), the bacteria widely exists in the pipe network of water. So the AOC heterotrophic bacteria in the water supply network for evaluation indicator parameters of secondary growth potential. 400 30

$2& %*3

300

25

$2&­J/

250

20

200

15

150 10

100

5

50 0

0

2

4

6

'LVWDQFHNP Fig. 4: Variation of AOC and BGP in water

8

0 10

%*3 h &)8P/

350

1122 | Xin-Yu Zhang and Jin-Liang Gao

3.4 BGP(n) and BGP(p) The variation of BGP (P) and BGP (n) at different sampling sites were shown in Figure 5, BGP (P) value is greater than that of BGP (n) at all sampling sites. This exactly illustrated that P element was the growth limiting factor of microorganisms in network water. BGP(P) was added in the water (including 50 g/L of bacterial growth potential of PO43--P(KH2PO4), and Bacterial growth potential of the BGP (n) means that raw water don't need to add any material. On the basis of discussed results earlier have proved that AOC was a major determinant factor for microbial growth, AOC content reached a maximum of 380 µg/L, according to the ratio (C:P=100:1.5~2.0), the concentration of P should be should be in 7.6µg/L. If phosphorus still significantly affects the growth of microorganisms under nutritional level, this can explain that the limited effect of C is almost the same as P constraint. But in fact, at each sampling site, the concentration of BGP(P) is still higher than BGP(n), even if adding phosphorus to 50 µg/L (not including the actual water samples in the MAP), phosphorus still show the certain factor limiting effect, therefore, phophurus is more important limiting factors.

35

%*3 Q  h &)8P/

30 25

25

20

20

15

15 10

10

5

5

0

0

2

4

6

8

%*3 S  h &)8P/

%*3 Q %*3 S

30

0 10

'LVWDQFHNP Fig. 5: Variation of BGP (n) and BGP (p) in water in summter

4 Conclusions The concentration of residual chlorine decreased with the extend of hydraulic retention time; however the change of AOC content was interaction between residual chlorine and bacteria consuming. BGP and AOC has a close relationship in water

Study on Assimilable District Water Distribution System | 1123

distribution system, therefore AOC was still an important indicator of bacteria regrowth. The concentration of MAP was in a lower level when AOC content was high in network water. And Phosphorus was another key limiting factor for bacteria regrowth in water distribution system. Acknowledgement: This work was financially supported by the Shandong Provincial Natural Science Foundation (ZR2014EL033) and European FP7 Marie Curie IRSES Smart Water project (EC318985).

References [1]

[2] [3]

[4]

[5] [6] [7] [8] [9] [10] [11]

[12] [13]

[14] [15]

I.C. Escobar, A.A. Randall, “Assimilable organic carbon (AOC) and biodegradable dissolved organic carbon (BDOC): complementary measurements,” Wat. Res, vol. 35, pp. 4444-4454, 2001. S. Srinivasan, G.W. Harrington, “Biostability analysis for drinking water distribution systems,” Wat. Res, vol. 41, pp. 2127-2138, 2007. M.N.B. Momba, R. Kfir, S.N. Venter, and T.E. Cloete, “An overview of biofilm formation in distribution systems and its impact on the deterioration of water quality,” Water SA , vol. 26, pp. 59-65, 2000. W. Liu, H. Wu, Z. Wang, S.L. Ong, J.Y. Hu, W.J. Ng, “Investigation of assimilable organic carbon (AOC) and bacterial regrowth in drinking water distribution system,” Water Res, vol. 36, pp. 891-898, 2002. B.E. Rittmann, V.L. Snoeyink, “Achieving biologically stable drinking water,” J. Am. Water Works Assoc, vol. 76, pp. 106-114, 1984. J. Skadsen, “Nitrification in a Distribution System,” J. Am. Water Works Assoc, vol. 85, pp. 95103, 1993. P.M. Huck, “Measurement of biodegradable organic matter and bacterial growth in drinking water,” J. Am. Water Works Assoc, vol. 82, pp. 78-86, 1990 C. Volk, C. Renner, C.Robert, J.C. Joret, “Comparison of two techniques for measuring biodegradable dissolved organic carbon in water,” Environ. Technol, vol. 15, pp. 545-556, 1994. D. van der Kooij, “Assimilable organic carbon as an indicator of bacterial regrowth,” J. Am. Water Works Assoc, vol. 84, pp. 57-65, 1982. P. Monika, H. Koen, V.K. Chris,“Investigation of microbially available phosphorus (MAP) in flemish drinking water,” Wat. Res, vol. 39, pp. 2267–2272, 2005. M.J. Lehtola, I.T. Miettinen, T.Vartiainen, J.M. Pertti, “Changes in content of microbially available phosphorus, assimilable organic carbon and microbial growth potential during drinking water treatment processes,” Wat. Res, vol. 36, pp. 3681-3690, 2002. S. Srinivasan, W.G. Harrington, “Biostability analysis for drinking water distribution systems,” Wat. Res, vol. 41, pp. 2127-2138, 2007. A. Sathasivan, S. Ohgaki, “Application of new bacterial regrowth potential method for water distribution system – a clear evidence of phosphorus limitation,” Wat. Res, Vol. 33, pp. 137144, 1999. M.W. LeChevallier, N. Shaw, L. Kaplan, T. Bott, “Development of a rapid assimilable organic carbon method for water,” Appl. Environ. Microbiol, vol. 59, pp. 1526-1531, 1993. M.J. Lehtola, I.T. Miettinen, T. Vartiainen, P.J. Martikainen, “Microbially Available Organic Carbon, Phosphorus and Microbial Growth in Ozonated Drinking Water,” Wat. Res, vol. 35, pp. 1635-1640, 2001.

1124 | Xin-Yu Zhang and Jin-Liang Gao [16]

[17]

M.J. Lehtola, I.T. Miettinen, T. Vartiainen, P.J. Martikainen, “A New Sensitive Bioassay for Determination of Microbially Available Phosphorus in Water,” Appl Environ Microbiol, vol. 65, pp. 2032-2034, 1999. I.T. Miettinen, Terttu Vartiainen. Pertti J Manikajne, “Phosphoms and Bacterial Growth in Drinking Water,” Appl. Environ. Microbiol, vol. 63, pp. 3242-3245, 1997.

Lin Yang1, Sheng-Fang Li2, Wei-Jun Song3 and Chun-Yan Sun4*

A New Magnetic Pb (II)-Imprinted Polymer as a Highly Selective Sorbent for Preconcentration and Determination of Lead Ions in Wastewater Samples Abstract: A magnetic Pb (II)-imprinted polymer (Pb (II)-IIP) aimed at the selective adsorption and preconcentration of Pb (II) was prepared via surface ion-imprinted technique using magnetic Fe3O4@SiO2 microspheres as supporter, Pb (II) as template ion, Gly-Gly-Gly as monomers, glutaraldehyde as cross linker. The product was characterized through Fourier-transform infrared, energy dispersive spectrometry, X-ray diffraction, scanning electron microscopy, and vibrating sample magnetometer. Pb-IIP showed higher affinity and selectivity for template lead ions. The maximum capacity of Pb-IIP (158.56 mg·g-1) is higher than that of other lead imprinted material. The relative selectivity coefficient (k′) were 3.758, 2.366, 1.373 and 2.601 to Co(II)/Pb(II), Cu(II)/Pb(II), Cd(II)/Pb(II) and Zn(II)/Pb(II) binary solutions, respectively, higher than those of NIP. Desorption and regeneration studies showed that Pb (II)-IIP can be used five times without decreasing their adsorption capacities significantly. The linear range (LR), relative standard deviation (RSD%) and limit of detection (LOD, 3Sb/m) for graphite furnace atomic absorption spectrometry (GFAAS) determination of lead ion, after its selective extraction by the prepared Pb(II)-IIP, were evaluated as 0.5-50.0 μg·L-1, 1.45% and 3.18 ng·L-1, respectively. Furthermore, Pb (II)-IIP was successfully applied for preconcentration and determination of Pb (II) from wastewater samples. Keywords: Solid-phase extraction; Surface imprinting; Magnetic ion-imprinted polymer; Adsorption; lead ion; Wastewater treatment

1 Introduction Lead is an important compound used as an intermediate in the processing industries such as plating, paint and dyes, and lead batteries [1]. However, lead is also

|| 1 Department of Chemical Engineering, Qinghai University, Xining, China 2 Department of Chemical Engineering, Qinghai University, Xining, China 3 Department of Chemical Engineering, Qinghai University, Xining, China. 4 Department of Chemical Engineering, Qinghai University, Xining, China. E-mail: [email protected] 10.1515/9783110516623-111 DOI 10.1515/9783110303568-111

1126 | Lin Yang, Sheng-Fang Li, Wei-Jun Song and Chun-Yan Sun one of the most significant trace elements due to its high toxicity even at very low concentrations. With the development of industry, a large number of industrial waste water enters our lives. Through water and the food chain system of soil-plantanimal-human, Pb (II) is transferred into animals and human beings [2]. The U.S. Environmental Protection Agency (USEPA) has set the action level for Pb(II) in drinking water at 15.0 μg·L-1 [3]. Thus, the determination of trace amounts of this element in the environmental is essential. Various detection techniques has been developed, including inductively coupled plasma-optical emission spectrometry (ICP-OES), inductively coupled plasma-mass spectrometry (ICP-MS), flame atomic absorption spectrometry(FAAS), sequential multi-element flame atomic absorption spectrometry, hydride generation atomic absorption spectrometry and graphite furnace atomic absorption spectrometry (GFAAS) [4-9]. GFAAS nowadays is still one of the most frequently used analytical techniques for the determination of trace amounts of lead due to its low detection limits, high sensitivity, and low cost [10]. However, it is difficult for the straight determination of trace concentration of lead in the presence of relatively high concentration of other diverse ions. So, it is necessary to separate and preconcentrate prior to the lead detection, particularly when they exist at trace levels of concentration. Among such enrichment techniques, solid phase extraction (SPE) is the most commonly used due to many advantages such as simplicity, no emulsification, low sample and solvent consumption, and easy-toautomate [11]. Molecular imprinting technique (MIT) is a method that enables the formation of tailor-made recognition materials by copolymerizing suitable monomers in the presence of a desired print molecule [12]. This polymer often has an affinity and selectivity toward molecular templates and so called molecular imprinted polymers (MIPs). Furthermore, if some ions are employed as the templates, the polymer obtained is called the ion-imprinted polymers (IIPs) [13-16]. There are many technologies for MIPs and IIPs synthesis typically including bulk polymerization, in-situ polymerization, suspension polymerization, and atom transfer radical polymerization (ATRP) [17-19]. These conventional techniques have defects, such as low reshipment ability, binding affinities, polymeric network, and delay in template transport, slow adsorption rate and incomplete removal of templates. In order to overcome these drawbacks effectively, the surface molecular/ion imprinting technique has been developed, based on the surface modification of matrix materials. The surface imprinted polymers have high selectivity, high adsorption capacity for target ions, easy to be eluted and regenerated, low resistance of ion exchange, which have been studied widely [20-25]. But it is still time-consuming and complicated to process imprinted polymers due to indispensable filtration, centrifugation, and other handlings. In order to avoid tedious centrifugation or filtration procedures magnetic solidphase extraction (MSPE) based on the use of magnetic or magnetizable materials, has also been developed in the recent years. Their separation and collection are

A New Magnetic Determination of Lead Ions in Wastewater Samples | 1127

easier and faster than conventional SPE methods. Magnetic imprinted polymer is a combining method involving Fe3O4 particles for easy separation and imprinted polymer for selective extraction of analytics from complex systems [26]. In recent decades, magnetic imprinted polymers have received much attention, due to the separation of magnetic sorbent from the crude sample matrix can be easily achieved by the action of an external magnetic field [27], thus making extensive studies in many potential applications [28-31]. In the present study a new magnetic ion-imprinted polymer (Pb (II)-IIP) as a MSPE sorbent was synthesized with surface imprinting technique. Pb (II)-IIP was prepared using magnetic Fe3O4@SiO2 microspheres as the supporter, Pb (II) ion as the template, glutaraldehyde as cross linker, and Gly-Gly-Gly as the functional monomer. The structural characteristics and adsorption behaviors of the Pb (II)-IIP were discussed in detail. Finally, the Pb (II)-IIP was successfully applied for extraction and determination of Pb (II) ions in the wastewater samples.

2 Experimental 2.1 Instruments Flame atomic absorption spectrometer (FAAS) (ZEEnit 700P, Germany) and graphite furnace atomic absorption spectrometry (GFAAS) (AA6300C, Shimadzu Japan) were used to measure the concentrations of Pb(II) and other metal ions such as Co(II), Cd(II), Cu(II), Zn(II). Fourier transmission infrared spectra (FT-IR, 4000-400 cm-1) in KBr were recorded on a NICOLET NEXUS 4700 FT-IR apparatus (Spectrum Two, USA). The morphologies of Pb (II)-IIP were observed by a scanning electron microscope (SEM, JEOL, JSM-7001F, USA) operated at 15 Kv. The XRD patterns of the samples were obtained on a powder X-ray diffract meter (D8 FOCUS, Bruker, Germany) using CuKa radiation, tube voltage of 40 kV, tube current of 40 mA, and counting the time of 2s per step. Energy dispersive spectrometry (EDS) was performed to confirm the existence of elements in Pb (II)-MIIP (JSM-5610LV/INCA, United Oxford Instruments). Magnetic properties were measured with a vibrating sample magnetometer (VSM, 7400, Lakeshore, USA) at room temperature. The magnetic separation was done by a super magnet with 6500 Gs magnetic field (Nd-Fe-B, 5×2×1 cm). An Electric mixer was used for stirring liquid evenly (Shanghai Shuoguang Electronic Technology Co., shanghai, China). All the solutions were prepared with ultra-pure water (18.25 MΩ*cm resistivity) obtained from a Milli-Q Direct 16 water purification system (Millipore, Bedford, MA, USA).

1128 | Lin Yang, Sheng-Fang Li, Wei-Jun Song and Chun-Yan Sun

2.2 Chemicals and Reagents FeCl3·6H2O (AR), ethylene glycol (AR), anhydrous sodium acetate (NaAC, AR), Pb (NO3)2, tetraethylorthosilicate (TEOS, AR) and acetone (AR) were purchased from Sinopharm Chemical Reagents Co., Ltd., (Shanghai, China). Polyethylene glycol (PEG 10000, AR), Gly-Gly-Gly (≥98.5%), 3-aminopropyltriethoxysil-ane (APES, 98%), and glutaralde-hyde solution (50%) were bought from Aladdin reagent Co., Ltd., (Shanghai, China) and Pb (NO3)2 was used to prepare the standard stock solution of Pb (II) (1.0 g·L−1).

2.3 Sample Preparation Water samples, including tap water (Xining, Qing hai, China), aluminum ingot cooling water and flue cooling water (a certain aluminum plant in Qing hai, China) were collected. 50.0 mL of water samples were adjusted to pH 6.0 with 0.01 mol·L-1 H2SO4 and 0.01 mol·L-1 NaOH prior to analysis. All the water samples were filtered through a 0.22 μm pore size filter (MS PES Syringe Filter, Aladdin), and subjected to the MSPE procedure and subsequent GFAAS measurement after pH adjusting.

2.4 Preparation of Magnetic Fe3O4@SiO2 Microspheres Fe3O4 nanoparticles were prepared according to a typical procedure [32] with a few modifications by hydrothermal synthesis. 5.4 g FeCl3·6H2O was dissolved in 160.0 mL ethylene glycol to form a clear solution, followed by the addition of 14.4 g NaAC and 4.0 g PEG-10000. The mixture was stirred vigorously for 30 min and then sealed in teflon-lined stainless steel autoclaves (50 mL). The reaction was maintained at 200 °C for 8 h. When it cooled to room temperature, the black products were washed several times with ethanol to remove the solvent. Finally, the Fe3O4 nanoparticles were collected by an Nd-Fe-B permanent magnet, dried under vacuum at 60 °C for 24 h. Taking 1.0 g prepared Fe3O4 nanoparticles added to 100 mL three mouth flask, then add 70.0 mL ethanol and 10.0 mL distilled water, after 15 min ultrasonic oscillation (power 100%), followed by slowly dropping 3.5 mL NH3·H2O (28%, v/v) and 4.0 mL TEOS. The mixture was left for reaction under stirring at 25 °C for 24 h. The solid phase was recovered by magnetic separation, washed with ethanol and distilled water for a few times, dried for 12 h [33].

A New Magnetic Determination of Lead Ions in Wastewater Samples | 1129

2.5 Surface Modification of Fe3O4@SiO2 Microspheres 2.0 g Fe3O4@SiO2 and 50.0 mL toluene were added to 100 mL three mouth flask, ultrasound dispersed 15 min. Then 4.0 mL APES was slowly added drop wisely to the above solution. The mixture was left for reaction with stirring at 110 °C for 12 h under nitrogen atmosphere. The amino modified Fe3O4@SiO2 microspheres (Fe3O4@SiO2-NH2) were then magnetically separated, rinsed with ethanol and acetone, and vacuum-dried at 60 °C for 24 h [34]. To prepare the Fe3O4@SiO2-CHO particles, 1.0 g Fe3O4@SiO2-NH2 particles were added to 25.0 mL glutaraldehyde (5%, w/w), the mixture reacted for 1 h at room temperature. The solid was obtained by magnetic separation and rinsed with ethanol and acetone, and vacuum-dried at 60 °C for 24 h.

2.6 Preparation of Pb (II)-IIP Pb (NO3)2·6H2O was dissolved in an aqueous solution containing 10.0 mmol·L-1 NaBH4 and 10.0 mmol·L-1 Gly-Gly-Gly, wherein Pb (II) concentration was also 10.0 mmol·L-1. Then 1.0 g Fe3O4@SiO2-CHO was added to 25.0 mL above solution and the reaction was kept at 50 °C for 2 h. The product was separated by the magnet and washed repeatedly with ethanol and acetone to removal unreacted materials. Chelated Pb (II) was removed from the imprinted polymer by extracting with 1.0 mol·L-1 H2SO4. The eluates were analyzed with FAAS to ensure that there no Pb (II) left in the polymer. Finally, the product was dried at 60 °C for 24 h. The NIP was prepared as a blank in parallel, without the addition of Pb (NO3)2·6H2O.

2.7 Adsorption Experiments 2.7.1 Static Adsorption Experiments Adsorption of Pb (II) from aqueous solutions was investigated in batch experiments. The 20.0 mL formulated Pb (II) solution (20.0-1000.0 mg·L -1) was added to a 50 mL erlenmeyer flask, then the pH was adjusted to 6.0 with 0.01 mol·L-1 H2SO4 and 0.01 mol·L-1 NaOH solution. 20.0 mg of Pb (II)-IIP was added and shaken for a period of time under water bath at 25 °C. Then the sorbent was separated by magnet. The residual amount of Pb (II) in the supernatant was determined by FAAS. The adsorption ratio (E %), absorption capacity Qe (mg·g-1) at equilibrium, and adsorption amount Qt (mg·g-1) at time t (min) were calculated as follow: E

C0  Ce C0

u 100%

(1)

1130 | Lin Yang, Sheng-Fang Li, Wei-Jun Song and Chun-Yan Sun (C 0  C e )V

Qe

m

Qt

(C 0  C t )V m

(2)

(3)

Where C0 (mg·L-1), Ce (mg·L-1) and Ct (mg·L-1) were concentrations of Pb (II) at initial, equilibrium and time t (min), respectively. V (L) and m (g) were the volume of solution and the mass of adsorbent, respectively.

2.7.2 Selectivity experiments In order to investigate the selective recognition ability of polymer, Pb(II)-IIP and NIP were evaluated by using binary metal Pb(II)/M(II) (M= Co, Cu, Cd, Zn) mixed solutions. 20.0 mg of Pb-IIP or NIP was added into a erlenmeyer flasks, in which contained 20.0 mL of 20.0 mg·L-1 binary metal Pb(II)/M(II) (pH= 6.0) mixed solution under constant temperature water bath at 25 °C for 6 h. When separated by magnet, each metal ion concentration in the supernatant was determined by FAAS. The binding amounts of Pb (II)-IIP or NIP for Pb (II) and the competition metal ions were calculated as the procedure of static adsorption studies. The distribution coefficient Kd (mL·g-1), selectivity coefficient k, and the relative selectivity coefficient k′ were given as follow:

(Ci  C f )V

Kd

Cf m

k

kc

Kd1 Kd 2 k IIP k NIP

(4)

(5)

(6)

Where Ci (mg·L-1) and Cf (mg·L-1) represent the initial and equilibrated concentrations of the given metal ions in solution, respectively. Kd1 and Kd2 were the static distribution coefficients of Pb (II) and competitive metal ions. kIIP and kNIP represent the separation factors of Pb(II)-IIP and NIP, respectively.

A New Magnetic Determination of Lead Ions in Wastewater Samples | 1131

2.7.3 Desorption and regeneration studies Pb(II) in solution (20.0 mL, 20.0 mg·L-1) was adsorbed onto Pb(II)-IIP (0.02 g) at initial pH 6.0 for 6 h and then the Pb(II)-IIP were collected by magnet and washed with deionized water several times. After that the adsorbents were regenerated with 1.0 mol·L-1 H2SO4 at 25 °C for 12 h. The effects of concentration and volume of the optimal leaching solution on desorption efficiency were also investigated. Desorption efficiency (D) was calculated using the following equation:

D (%)

Wd Wa

u 100%

(7)

Where Wd was the mass of desorbed Pb (II) (g) and Wa was the preadsorbed Pb (II) (g) onto Pb (II)-IIP.

2.8 Magnetic Solid Phase Extraction Procedure The MSPE procedure was similar to that reported in ref [35]. In the sorption step, 50.0 mL of real sample solution was transferred into a 100 mL beaker, and its pH was adjusted to 6.0. Then, 30.0 mg of Pb (II)-IIP was added and dispersed under constant temperature water bath at 25 °C for 30 min, then isolated from the suspension with an Nd-Fe-B strong magnet, and washed with 1.0 mL high purity water. In the elution step, 2.0 mL of 1.0 mol·L-1 H2SO4 was added to desorb the Pb (II) ions from the Pb-IIP under ultrasonication for 30 min. Finally, the eluent was directly introduced into GFAAS for determination of Pb (II) ions.

3 Results and Discussion 3.1 Preparation of Pb (II)-IIP Synthesis of Pb (II)-IIP could be divided into five steps, as showed in Scheme 1. (1) Magnetic Fe3O4@SiO2 microspheres were prepared. (2) The amino group was introduced onto the surface of the magnetic Fe3O4@SiO2 microspheres through silanization reaction. (3) Further functionalization of Fe3O4@SiO2 with glutaraldehyde. After the reaction between glutaraldehyde and NH2-Fe3O4@SiO2, the typical C=N in Schiff base and the -CHO were introduced to the surface of Fe3O4@SiO2. (4) Gly-Gly-Gly was fixed on the aldehyde-decorated Fe3O4@SiO2. At the same time, surface imprinting was conducted and the polymer networks formed after the coordination between Pb (II) and the groups grafted on Fe3O4@SiO2. (5) A large number of imprinting cavities

1132 | Lin Yang, Sheng-Fang Li, Wei-Jun Song and Chun-Yan Sun of Pb (II) would be configured within the surface layer of Fe3O4@SiO2 microspheres after Pb (II) was eluted by using sulfuric acid.

Scheme 1: Preparation procedures of imprinted polymer

3.2 Characterization 3.2.1 FT-IR Analysis FT-IR spectroscopy was used to study the chemical structure of the magnetic particles. As shown in Fig. 1, the peak at 587 cm-1 corresponding to the Fe-O stretching vibration was observed in all the samples, indicating that the Fe3O4 nanoparticles were encapsulated inside of the materials. The adsorption peaks near 803 cm-1, 1087 cm-1 and 462 cm-1 (symmetric, asymmetric stretching and bending vibration of Si-OSi, respectively), indicating that silicone were coated on the Fe3O4 particles successfully. The wide absorption band near 3410 cm-1 belonged to stretching vibrations of Si-OH in Fe3O4@SiO2, and the peak around 2924 cm-1 presented in Fig. 1 b, c and d was ascribed to the C-H stretching vibration of organic groups, indicating that the CHO was introduced to the surface of the Fe3O4@SiO2. In addition, the emerged band at 1450 cm-1 was attributed to coordinate role of Pb (II) and Schiff bases. Furthermore, the peak around 1639 cm-1 for Pb(II)-IIP (d) was mainly assigned to the characteristic peak of -CONH- in Gly-Gly-Gly grafted on the surface of Fe3O4@SiO2, which could have been overlapped with the bending vibration of Si-OH of substrate, and the result was consistent with the reported literature [36]. Although these bands could not be used to judge that quantitative speciation had occurred as expected, these results were consistent with the subsequent work.

A New Magnetic Determination of Lead Ions in Wastewater Samples | 1133

Fig. 1: The FT-IR spectra of Fe3O4@SiO2 (a), Fe3O4@SiO2-CHO (b), Pb (II)-IIP unleached (c).

3.2.2 XRD Analysis The structural properties of Fe3O4 and Pb (II)-IIP were analyzed by XRD. As shown in Fig. 2, the diffraction peaks at 2θ values of 30.08°, 35.44°, 43.07°, 53.46°, 56.99°, and 62.54° were observed in both Fe3O4 and Pb(II)-IIP in the 2θ from 10 to 80°. These peak positions can be indexed respectively to the (220), (311), (400), (422), (511), and (440) planes of the magnetite particles with a spinel structure (JCPDS card (190629)). The results indicated that the spinel structure of Fe3O4 did not change after a series of modification, which was further confirmed by the result of VSM.

Fig. 2: XRD patterns of Fe3O4 (a) and Pb (II)-IIP (b).

1134 | Lin Yang, Sheng-Fang Li, Wei-Jun Song and Chun-Yan Sun 3.2.3 Magnetism Analysis The magnetization property of the Fe3O4 and Pb (II)-IIP was investigated at room temperature with an applied magnetic field of 20 kOe (Fig. 3). The saturation magnetization values of the Fe3O4 and Pb (II)-IIP were found to be 72.94 and 30.96 emu·g-1, respectively. The saturation magnetization intensity gradually reduced along with the subsequent reaction. This was mainly because the existence of silica shells and polymeric coating. It was apparent that, both the samples show an almost immeasurable magnetic hysteresis loop at 298K (Hc= 72.38 Oe, Mr= 2.62 emu·g-1), suggesting that both samples are all good superparamagnetic. Furthermore, Pb (II)IIP possessed enough magnetic force to meet the needs of magnetic separation, as can be observed in Fig. 3c. In conclusion, the magnetic property of the prepared Pb (II)-IIP was satisfactory, and it was easily separated under the external magnetic field.

Fig. 3: Magnetization curves at room temperature of Fe3O4 (a), Pb (II)-IIP (b), and the photograph of the solutions containing Pb (II)-IIP before and after magnetic separation with the help of an external magnet (c). The inset shows the magnified hysteresis loop of the Fe3O4 (a) and Pb (II)-IIP (b) (top).

3.2.4 Characteristic of EDS EDS analysis was used to prove further the existence of Pb in the polymer. The EDS spectra of Pb(II)-IIP unleached and Pb(II)-IIP were carried out, and related results of element analysis were shown in Fig. 4. The signal of Fe, O and Si were attributed to the substrate Fe3O4@SiO2, and C was attributed to the functional monomer. The signal of Pb was observed clearly in the sample of Pb (II)-IIP unleached (Fig. 4a), and disappear after extraction by H2SO4 aqueous solution (Fig. 4b). The above results support that Pb (II) ion has been successfully incorporated into the polymer, and Pb (II) can be extracted by simply washing with an H2SO4 aqueous solution.

A New Magnetic Determination of Lead Ions in Wastewater Samples | 1135

Fig. 4: EDS spectra of Pb (II)-IIP unleached (a) and Pb (II)-IIP (b).

3.2.5 SEM Observation The SEM was employed to study the morphology of pure Fe3O4 and Pb (II)-IIP, respectively. The results of SEM were displayed in Fig. 5. Fe3O4 nanoparticles revealed a homogeneous nano-size distribution. In comparison with Fe3O4, the size of Pb (II)IIP particles were significantly increased, which can be concluded the Fe3O4 nanoparticles were coated successfully with SiO2 and the imprinted shell [37].

Fig. 5: Scanning electron micrographs of the Fe3O4 (a) and Pb(II)-IIP (b).

3.3 Adsorption Experiments 3.3.1 Adsorption Kinetics The results of adsorption kinetics experiments of Pb(II) onto 20.0 mg of Pb(II)-IIP at 25 °C from initial concentration 20.0 mg·L-1 was illustrated in Fig. 6. The amount of Pb II) ion adsorbed rapidly increases with time in the initial stage (0-10 min range),

1136 | Lin Yang, Sheng-Fang Li, Wei-Jun Song and Chun-Yan Sun and then reach an equilibrium value in approximately 25-50 min. A further increase in contact time had a negligible effect on the amount of ion sorption. The equilibrium time was found to be independent of the initial concentration. According to these results, the agitation time was fixed at 6 h for the subsequent adsorption experiments to ensure that equilibrium was achieved. The equations of pseudo-firstorder [38], pseudo-second-order [39] and Elovish model [40] shown as Eqs. (8) to (10) were employed to interpret the experimental data.

ln(Qe  Qt ) 1

t Qt

k 2 Qe

Qt

2



(8)

lnQe  k1t t

(9)

Qe

A  B ln t

(10)

Where k1 (min-1) and k2 (g·mg-1·min-1) are the rate constants of pseudo-first-order and pseudo-second-order model. The parameters A and B are kinetic constants of Elovich model. All parameters were calculated from the lines of Qt against t using linear regression analysis of the experimental data. The fitting results are given in Table 1. According to the determination coefficients, the pseudo-second-order kinetic model provided an impressive and comparable correlation for the adsorption of Pb (II) (Fig. 6 inset), suggesting chemical adsorption as the rate-limiting step of the adsorption mechanism and no involvement of a mass transfer in solution. Table 1: Kinetic paraments of pseudo-first-order, pseudo-second-order, and elovich model analyzed for Pb (II) adsorbention onto Pb (II)-IIP. Pseudo-first-order Qe (mg·g-1)

k1 (min1 )

R2

9.6365

0.31886 0.877 4

Pseudo-second-order

Elovich

Qe (mg·g-1) k2 (g·mg-1·min-1)

R2

A

B

R2

10.163

0.999 5

4.775 4

1.697 8

0.9646

0.01167

A New Magnetic Determination of Lead Ions in Wastewater Samples | 1137

Fig. 6: Effect of contact time on the amount adsorbed of Pb II) onto Pb(II)-IIP at 298 K andthe fitting data by Pseudo-second-order model (inset).

Fig. 7: The sorption isotherm of Pb (II) onto Pb(II)-IIP at 298 K and the fitting data by Freundlich (inset).

3.3.2 Adsorption Isotherms The effect of the initial ion concentration was performed at concentrations from 20.0 to 1000.0 mg·L-1 at 298 K, and the results were shown in Fig. 7. It is clear that the sorption amount of Pb (II) ions increases with the increasing of initial ions concentration. The maximum adsorption capacity of Pb (II)-IIP for Pb (II) was about 158.56 mg∙g-1 in our experimental conditions, which is higher than that of Pb(II)-imprinted polymer reported [25,41,42]. And the sorption data at 298 K can be successfully modeled using Freundlich isotherm model (Fig. 7 inset):

1138 | Lin Yang, Sheng-Fang Li, Wei-Jun Song and Chun-Yan Sun

lg Qe

1 n

(11)

lg C e  lg K F

where KF is adsorption equilibrium constant of the Freundlich isotherm model and 1/n is an empirical parameter related to the adsorption intensity.

3.3.3 Selectivity Study The selective binding character of Pb(II)-IIP was evaluated by measuring extraction amounts of both Pb(II) and other competitive ions from binary mixtures such as Co(II)/Pb(II), Cu(II)/Pb(II), Cd(II)/Pb(II), and Zn(II)/Pb(II). As shown in Table 2, the distribution ratio of Pb (II)-IIP for Pb (II) ion was higher than that of NIP. Furthermore, the relative selectivity coefficient of Pb(II)-IIP were 3.758, 2.366, 1.373 and 2.601 times to Co(II)/Pb(II), Cu(II)/Pb(II), Cd(II)/Pb(II) and Zn(II)/Pb(II) binary solutions, respectively. Pb (II) - IIP exhibited effective adsorption selectivity for Pb (II) in presence of competitive metal ions. Table 2: Distribution coefficient and selectivity coefficient data of Pb (II)-IIP and nip sorbent. Binary system

Distribution ratio Kd (mL·g-1)

Selectivity coefficient k

Relative selectivity coefficient k′ 3.758

Sorbent

Kd (Pb)

Kd (M)

Co(II)/ Pb(II)

Pb(II)-IIP

2786.528

524.596

5.3118

NIP

1246.363

881.659

1.4137

Cu(II)/ Pb(II)

Pb(II)-IIP

2198.720

117.557

18.703

NIP

1104.397

139.717

7.905

Cd(II)/ Pb(II)

Pb(II)-IIP

884.378

765.055

1.156

NIP

523.123

621.467

0.8418

Zn(II)/ Pb(II)

Pb(II)-IIP

8744.21

187.362

46.670

NIP

3132.08

174.568

17.9420

2.366 1.373 2.601

3.3.4 Reusability Regeneration of the adsorbent Pb (II)-IIP was achieved using 1 mol·L-1 H2SO4 as an eluting solvent at 298 K for 12 h. The desorption ratio was determined to be as high as 94%. The adsorption-desorption process repeated five cycles, and the adsorption capacity was about 89% in the 5th use. It indicated that Pb (II)-IIP can be reused many times without significantly decrease in the adsorption capacity.

A New Magnetic Determination of Lead Ions in Wastewater Samples | 1139

3.4 MSPE Study 3.4.1 Analytical Precision and Detection Limits Under the selected adsorption and desorption experimental conditions, the calibration curve was linear over the concentration range of 0.5-50 μg·L-1 Pb (II), with good coefficient of correlation (R2= 0.9978). The precision of the method was evaluated by repeated analysis of Pb (II) during the course of experimentation on the same day and on different days under the selected experimental conditions. The inter-day and intra-day relative standard deviations (RSD) of five replicates deter-minations (n= 5) of 40 μg·L-1 lead solution were 0.59% and 1.45%, respectively. The limit of detection (LOD) based on the 3Sb/m (where Sb is the standard deviation of the blank signals and m is the slop of the calibration curve after extraction) was calculated to be 3.18 ng·L-1.

3.4.2 Real Sample Analysis To evaluate the practical applicability of the MSPE method based on imprinted polymer for the Pb (II) analysis, the Pb (II)-IIP was applied in environmental water samples. The tap water, aluminum ingot cooling water and flue cooling water were collected. Preparation of the real samples was performed according to Section 2.3. Under the selected conditions, the Pb (II)-IIP was samples with various amounts of Pb (II). The analytical results are listed in Table 3. As shown in Table 3, high recoveries ranged from 94% to 106.1% in the all tested concentration of Pb (II) indicated that this sorbent showed a high affectivity for extracting Pb (II) from the wastewater containing aluminum, and the accuracy of the proposed strategy. ]

1140 | Lin Yang, Sheng-Fang Li, Wei-Jun Song and Chun-Yan Sun Table 3: Determination of lead in real samples. Sample

Add (μg·L-1)

Founda (μg·L-1)

Recovery (%)

Tap water

-

0.286±0.01

-

10

10.07±0.4

97.84

20

20.43±0.6

100.72

Aluminum ingot cooling water Flue cooling water

a

-

26.52±0.1

-

10

37.13±0.8

106.1

20

46.62±1.1

100.5

-

36.45±1.4

-

10

46.04±1.6

95.9

20

55.25±2.1

94

Mean ± standard deviation. (n=7)

4 Conclusions In the present work, a new magnetic Pb (II) ion-imprinted polymer was prepared in combination of surface ion-imprinted and magnetic separation, and characterized by FT-IR, XRD, EDS, SEM and VSM. The adsorption experiments showed that Pb-IIP had high affinity and selectivity for template lead ions. The pseudo-second-order kinetic model can be applied to predict the adsorption process of Pb (II) onto Pb (II)IIP, and the adsorption equilibrium of Pb (II)-IIP was fitted well to Freundlich isotherm models. After five cycles of the adsorption-desorption process, the adsorption rate still exceed 89%. As a conclusion, Pb (II)-IIP was used as MSPE agent can be considered to be reliable and feasible for preconcentration and determination of lead ions in wastewater system. Acknowledgement: The authors thank the support of the National Natural Science Foundation of China (No. 21266027 and No. U1507122).

References [1] [2] [3] [4] [5] [6] [7]

M.K. Aroua, S.P.P.L. Leong, Y. Teo, C.Y. Yin, and W.M.A.W. Daud, Bioresour. Technol., 99, 57865792, 2008. B.L. Martins, C.C.V. Cruz, A.S. Luna, and C.A. Henriques, Biochem. Eng., 27, 310-314, 2006. A. lslam, H. Ahmad, N. Zaidi, and S. Kumar, ACS Appl. Mater. Interfaces, 6, 13257 -13265, 2014. Z. Tu, Q. He, X. Chang, Z. Hu, R. Gao, L. Zhang, and Z. Li, Anal. Chim. Acta., 649, 252-257, 2009. N. Jalbani and M. Soylak, Ind. Eng. Chem., 29, 48-51, 2015. S. Chen, C. Liu, M. Yang, D. Lu, L. Zhu, and Z. Wang, Hazard. Mater, 170, 247-251, 2009. L.A. Portugal, H.S. Ferreira, W.N.L. Dos Santos, and S.L.C. Ferreira, Microchem, 87, 77-80, 2007.

A New Magnetic Determination of Lead Ions in Wastewater Samples | 1141 [8] [9] [10]

D. Karadeniz Korkmaz, N. Ertas, and O. Yavuz, Ataman, Spectrochim. Acta B, 57, 571-580, 2002. M. Savio, B. Parodi, L.D. Martinez, P. Smichowski, and R.A. Gil, Talanta, 85, 245-251, 2011. M. Fayazi, M.A. Taher, D. Afzali, A. Mostafavi, and M.G. Motlagh, Materials Science and Engineering C, 60, 365-373, 2016. [11] C. Duran, A. Gundogdua, V.N. Bulutb, M. Soylak, L. Elci, H.B. Sentürk, and M. Tüfekci, Journal of Hazardous Materials, 19, 347-355, 2007. [12] S. A. Piletsky, S. Alcock, and A.P.F. Turner, Trends Biotechnol, 19, 9-12, 2001. [13] H. Nishide, and E. Tsuchida, Makromol. Chem., 177, 2295-2230, 1976. [14] S. J. Ahmadi, O. Noori-Kalkhoran, and S. Shirvani-Arani, Journal of Hazardous Materials, 175, 193-197, 2010. [15] V. Vatanpour, S.S. Madaeni, S. Zinadini, and H.R. Rajabi, Membrane Sci., 373, 36-42, 2011. [16] M.J. Whitcombe, N. Kirsch, and I. A. Nicholls, Mol. Recognit, 27, 297-301, 2014. [17] M. Monier, and D.A. Abdel-Latif, Carbohyd. Polym., 97, 743-752, 2013. [18] A. L. Hillberg, and M. Tabrizian, IRBM, 29, 89-104, 2008. [19] M. Meng, X. Meng, L. Yan, M. Meng, X. Meng, Z. Hu, and Z. Song, Journal of Hazardous Materials, 278, 134-143, 2014. [20] L. Wang, M. Zhou, Z. Jing, and A. Zhong, Microchim. Acta, 165, 367-387, 2009. [21] X. Zhu, Y. Cui, X. Chang, X. Zou, and Z. Li, Microchim. Acta, 164, 125-132, 2009. [22] L. Uzun, R. Uzek, S. Senel, R. Say, and A. Deniali, Mat. Sci. Eng C., 33, 3432-3439, 2013. [23] W. Yang, L. Liu, W. Zhou, W. Xu, Z. Zhou, and W. Huang, Appl. Surf. Sci., 258, 6583-6589, 2012. [24] D. Kumar, and B.B. Prasad, Sensor. Actuat B., 171-172, 1141-1150, 2012. [25] H. Zhang, Q. Dou, X. Jin, D. Sun, D. Wang, and T. Yang, Separation Science and Technology, 50, 901-910, 2015. [26] N. Khoddami, and F. Shemirani, Talanta, 146, 244-252, 2016. [27] E. Kazemi, A.M.H. Shabani, and S. Dadfarnia, Microchim. Acta, 182, 1025-1033, 2015. [28] F. Aboufazeli, H.R.L.Z. Zhad, O. Sadeghi, M. Karimi, and E. Najafi, Food Chem., 141, 3459-3465, 2013. [29] Y. Hiratsuka, N. Funaya, H. Matsunaga, and J. Haginaka, Pharmaceut. Biomed. 75, 180-185, 2013. [30] A. Mehdinia, T.B. Kayyal, A. Jabbari, M.O. Aziz-Zanjani, and E. Ziaei, Chromatogra A, 1283, 8288, 2013. [31] F.L. Ding, Q. Cheng, L.J.F. Li, and F.E. Jiang, Chinese Journal of Analytical Chemistry, 10, 15141518, 2012. [32] H. Deng, X. Li, Q. Peng, X. Wang, J. Chen, and Y. Li, Angew Chem., 117, 2842-2845, 2005. [33] Q. Chang, L. Zhu, C. Yu, and H. Tang, Luminesceuce., 128, 1890-1895, 2008. [34] J. Wang, S. Zheng, Y. Shao, J. Liu, Z. Xu, and D. Zhu, Journal of Colloid and Interface Science, 349, 293-299, 2010. [35] B. Zhao, M. He, B. Chen, and B. Hu, Spectrochimica Acta Part B, 107, 115-124, 2015. [36] W. Guo, Y. Liu, M. Meng, X. Meng, Z. Hu, and Z. Song, Colloids and Surface A: Physicochem. Eng. Aspects, 436, 693-703, 2013. [37] S. Sadeghi, and E. Aboobakri, Microchim. Acta, 178, 89-97, 2012. [38] S. Lagergren, Handlingar, 24, 1-39, 1898. [39] Y. S. Ho, and G. McKay, Process Biochem, 34, 451-465, 1999. [40] R.S. Juang, and M.L. Chen, Ind Eng Chem Res., 36, 813-820, 1997. [41] Y. Liu, Z. Liu, J. Gao, J. Dai, J. Han, Y. Wang, J. Xie, and Y. Yan, Journal of Hazardous Materials, 186, 197-205, 2011. [42] C. Li, J. Gao, J. Pan, Z. Zhang, and Y. Yan, Journal of Environmental Sciences, 21, 1722,2009.

Xiao-Hong Peng1, Yong-Qing Lee2, Xiao-Dong Shen3 and Ru-Hai Chen4

Analysis on the Characteristics of Smog Pollution in the Urban Centre of Chongqing Municipal

Abstract: According to the characteristics of economic developments in Chongqing Municipal, the article is to discuss and analyze on the characteristics of Smog Pollution in the urban centre of Chongqing Municipal throughout the past 3 years from several perspectives, such as the change in sources of atmospheric pollution, and seasonal, geographical, climatic features of Smog Pollution, in order to provide technological support for the control of atmospheric pollution, as the next step, in the coming future. Keywords: Source of Atmospheric Pollution, Seasonal Features, Mountainous Terrain, Foggy Climate

1 Introduction In recent years, the Government of Chongqing Municipal has been propelling the Operation of Blue Sky quite vigorously, fully carrying out each and every tasks in The Operational Plan for Prevention and Administration of Atmospheric Pollution from the State Council, and it has obtained some achievements in terms of Administration in Atmospheric Pollution by enhancing the supervision and governance over several aspects, such as industries, dust, transportation, daily living, and so on so forth. However, the pollutant emission of PM10, PM2.5, NO2 has not reached The Quality Standard of Environmental Air (GB3095-2012) yet, and the NO2 emission even demonstrated a year-on-year rising tendency. The change in characteristics of atmospheric pollution had made the change of Smog Pollution more and more diversified.

|| 1 Logistical Engineering University of PLA, Chongqing, 401311, China 2 Logistical Engineering University of PLA, Chongqing, 401311, China 3 Logistical Engineering University of PLA, Chongqing, 401311, China 4 Logistical Engineering University of PLA, Chongqing, 401311, China 10.1515/9783110516623-112 DOI 10.1515/9783110303568-112

1144 | Xiao-Hong Peng, Yong-Qing Lee, Xiao-Dong Shen and Ru-Hai Chen

2 The Change of Pollution Source in the Urban Centre There are two standards of Atmospheric Air Quality that had been carried out in Chongqing Municipal. It carried out The Quality Standard of Environmental Air (GB3095-2012) in the urban centre, and The Quality Standard of Environmental Air (GB3095-1996) in the suburban areas and counties. Due to the difference between the urban centre and suburban areas in terms of principal sources of pollution, the article is to discuss on the analysis of the characteristics of Smog Pollution in the urban centre only. Throughout the past more than 10 years, the atmospheric air quality has obtained great improvements in the urban centre of Chongqing Municipal, after the continuous reconstruction, reallocation, and shut-down of heavy pollution enterprises in the urban centre by the Municipal Government. Currently, there are almost no heavy pollution enterprises or carbon-burning ones within the urban centre, and clean energy of natural gas has covered the whole urban centre. Along with the improvements of urbanization, the energy structure had been adjusted, yet with a bit slow tempos, and the quality of gasoline-products had not been improved fundamentally either. Furthermore, the year-on-year increasing volume of automobile ownership had led to the increasing vehicle exhaust in the urban centre. Table 1: 2013-2015 Volume of automobile ownership in Chongqing Year

Auto Ownership Volume (10,000)

Addition year-on-year (%)

2013

405.04

21.2

2014

438.05

8.15

2015

461.70

5.4

The rapid growth of automobile ownership will generate the auto exhaust definitely and increasingly. Figure 1 shows the annual average concentration of pollutant emission of PM10, PM2.5, SO2, NO2, O3, CO in the urban centre of Chongqing on a comparison basis.

Analysis on the Characteristics Chongqing Municipal | 1145

Fig. 1: Annual average concentration of atmosphericpollutant emission from 2013 to 2015 in Chongqing.

According to Figure 1, we can see that the annual average concentration of pollutant emission, to some extent, had decreased in the urban centre, but the emission of PM10, PM2.5, NO2 had not reached the national standard yet, with the surplus part of 0.24 times, 0.62 times, and 0.12 times respectively. The emission concentration increased year by year. Due to the above, we can conclude that the sources of atmospheric pollution had changed in the urban centre of Chongqing Municipal. In opinions of some experts, the source of nitrogen oxide in the air mainly consists of 3 types, namely, lightening byproducts as the first, and secondly, the auto exhaust, and thirdly, factories of nitric acid. Apparently, the year-on-year increasing concentration of NO2 emission in the urban centre of Chongqing can be categorized into the second circumstance. The source of PM2.5 consists of 3 types: Firstly, the burning process and dust, and secondly, organics(OM) and elements carbon(EC), which generated by auto exhaust, released in gas at very high heat, is to be diluted through rains, and then cool down to concretion, and thirdly, auto exhaust will generate gaseous precursor, such as evaporative organics(VOCs), nitrogen oxide(NOX), sulfur dioxide(SO2), ammonia(NH3), hydrocarbon, carbonic oxide(CO), and so on so forth, and then it will, through a serial of chemical reaction, generate Offspring[1]. Some relevant datum demonstrated that the Offspring constituted around 60%-70% of PM2.5 currently, and contributed greatly to the Smog Pollution [2]. Furthermore, many a pollutants generated by auto exhaust is to trigger photochemical reaction to the ultraviolet rays under the sunshine, and then will generate secondary pollutants, such as ozone (O3), pan (PAN), etc. When the first pollutants and secondary pollutants that had both participated in the photochemical reaction mixed with each other, they will together lead to the emergence of an excitive smog of blue or brown colour, called Photochemical Smog [3]. Sometimes, Photochemical Pollution and Smog Pollution will entangle with each other, and too, hard to distinguish from each other. Therefore, to decrease and control the pollutants emission

1146 | Xiao-Hong Peng, Yong-Qing Lee, Xiao-Dong Shen and Ru-Hai Chen from auto exhaust, especially the emission of nitrogen oxide(NOX), is the most direct measure to prevent Smog Pollution and Photochemical Pollution in the urban centre. The increasing concentration of NO2 emission in the urban centre of Chongqing Municipal is closely pertinent to the increasing emission of automobile exhaust. The major source of PM2.5 in the urban centre is not industrial production anymore, but gasoline-product burning and automobile exhaust.

3 Apparent Seasonal Features of Smog Pollution in the Urban Centre Through the statistical analysis on relevant datum of recent 3 years, we’ve found out that the Smog Pollution in the urban centre of Chongqing Municipal held some seasonal changes, namely, relatively slight pollution in spring and summer(almost no pollution), and heavy Smog Pollution in autumn and winter. The Figure below is a statistical show on different levels of Smog Pollution in the 2 cities of Chongqing and Beijing from 2013.11. To 2016.09. (Slight Pollution, Middle Pollution, and Severe Pollution):

Fig. 2: Chongqing 2013.11-2016.09 Monthly Statistics of Smog Pollution Days

Analysis on the Characteristics Chongqing Municipal | 1147

Fig. 3: Beijing 2013.11-2016.09 Monthly Statistics of Smog Pollution Days

According to the 2 Figures of Datum, we can see the Smog Pollution in the urban centre of Chongqing Municipal mainly focused in October, November, December, January, and February yearly, which are also the seasons of autumn and winter. During the spring and summer, there is rarely weather of Smog Pollution appeared. However, the seasonal law of Smog Pollution is not so obvious in Beijing. It had just demonstrated that the Smog Pollution in the urban centre of Chongqing Municipal is not only related to the degree of emission from pollution sources, but also pertinent to different seasons. During the seasons of autumn and winter in Chongqing, the wind speed is slow, and the wind power is weak, the frequency of no wind is high, and it’s very foggy. The urban centre is located within the small basin, surrounded by Zhongliangshan Mountain Range, Tongluoshan Mountain Range, and Zhenwushan Mountain Range [4]. The special river-side and mountainous terrain plus seasonal climate had led to the uneasy sedimentation and scatter for Smog in the urban centre during the seasons of autumn and winter.

4 The River-Side And Mountainous Terrain Plus Foggy Weather Made the Scatter of Smog Pretty Quiet Difficult Generally speaking, the degree of atmospheric pollution in a district depends on the types of pollutants and volume of emission in the district, and secondly, the terrain and weather conditions in the district. Terrain and weather determined the velocity of dilution and scatter, and channels of migration and transformation, by the at-

1148 | Xiao-Hong Peng, Yong-Qing Lee, Xiao-Dong Shen and Ru-Hai Chen mosphere, to the pollutants. Under the circumstance of pollutants of fewer types and smaller volume of emission, terrain and weather are the cardinal factors to affect the atmospheric pollution [5]. Located near the verge of Chuandong Basin, Chongqing is surrounded by mountains, with two rivers to cross across the urban centre. Due to the influence of High Altitude Ridge North Wind, during night hours, the weather is often clear and clean with little cloud, and radiation cooling is very obvious, and there is quite distinguishable line between inversion layer and isothermal layer down to the ground surface [6]. The inversion layer will refrain the vertical movements of the atmosphere that make many a dust and tiny water drops to rally on the ground, forming a radiation fog. Fog can be classified into 2 types. The one, which occurred near the frontal surface, generated several hours before or after rains is called Rain Fog. The one, which occurred when there is no rain, is calling Radiation Fog [7]. Relevant research demonstrated that Radiation Fog constituted around 73.7% in Chongqing, and Rain Fog, around 26.3% [8]. In Chongqing. Both Rain Fog and Radiation Fog mainly concentrated from October to the next February, and it is a period where fog often occurred between November and the January of the next year. Fog is a phenomenon where huge tiny water drops, existing in the air that makes the atmospheric visibility below 1000 meters. Haze is a phenomenon where huge tiny dusty pellets, floating evenly in the air, that make the atmospheric visibility below 10,000 meters. Smog means that there is fog in the haze, while haze in the fog, where fog and haze mixed with each other. Fog and haze entangled with each, and coordinated with each other, and indistinguishable from each other. This is because the tiny dusty pellets become the carrier of small water drops to form steady aerosol, distributing evenly at the air layer close to the ground surface. Under the steady conditions of atmosphere, it is quite difficult for them to scatter or migrate, and finally, lead to Smog Pollution. In Chongqing, the unique terrain and weather lead to foggy autumn and winter. Fog is also the hotbed to generate haze, while the two often coordinate that make Smog much easier to amass, and more difficult to scatter or migrate.

5 Conclusion and Measures A. Factors, such as evolution in terms of eco-growth mode and energy structure, promotion of urbanization, climate change, and change of population structure, and so on so forth, will all cast an impact on the types and volume of atmospheric pollutant emission. Currently, the atmospheric pollution in the urban centre of Chongqing Municipal has transformed from industrial pollution to comprehensive pollution. Though the atmospheric quality has obtained improvements quite well, the emission of PM10, PM2.5, and NO2 had not reached the national Quality Standard

Analysis on the Characteristics Chongqing Municipal | 1149

of Environmental Air (GB3095-2012), with a rising tendency of the emission concentration of NO2 year by year. It had created a new hotbed for Smog Pollution. Consequently, in accordance with the new pollution mode, the Municipal Government shall adjust policy guidance timely, and take control of the atmospheric pollution more powerfully in the leadership of assistance to each and every industries and enterprises to increase revenue and decrease emission of atmospheric pollutants. B. There is an apparently seasonal feature of Smog Pollution in the urban centre of Chongqing. Compared to Beijing City, the Smog Pollution in the urban centre of Chongqing Municipal demonstrated an obviously seasonal feature, namely, heavy pollution in autumn and winter, but almost no pollution in spring and summer. While we administer on Smog Pollution, we can fully utilize the seasonal factors, clinging measures and tactics to the specifically local circumstances, in order to cut investment. C. The mountainous terrain in Chongqing leads to the uneasy scatter of Smog. Furthermore, the foggy weather with little wind of autumn and winter even increased the difficulty for Smog to scatter. However, Professor Tianran Teung from Atmospheric Science Department in Nanking Info-engineering University thought, “It is much easier for tiny pellets, on its surface, to absorb gaseous pollutants, such as NH3, NOX, etc., in the air with relatively higher humidity. “During rainy or snowy time, tiny pellets floating in the air will fall together with rain drops or snow down to the earth and it is called Wet Sedimentation. How to utilize suitable weather and terrain to trigger artificial rain, in order to decrease Smog Pollution through partial enhancement of air humidity within a short time-span and a cut of PM2.5 by Wet Sedimentation, is also feasible, but still need to take the operational cost into account. Generally speaking, the control of Smog Pollution rested in serious efforts on its origins, such as the fundamental way to reform the energy structure, and elevate the quality of gasoline-product. We shall promote the utilization of ecological-friendly electric vehicles more vigorously, and improve the processing apparatus of automobile exhaust, and prevent, seriously and definitely, the self-discharge of auto exhaust without any processing. The Municipal Government shall direct those heavypollution enterprises to carry out Emission Policy very strictly, and promote lowcarbon and ecological-friendly mode of go-outing among the municipal citizens. Only had we motivated the participation of all people from all social classes to engage in the long-term hard fight, we together, could be able to create a beautiful blue sky!

References [1] [2]

Jian-fang FEI. Numerical simulation of PM2.5 inorganic particles in a heavy fog [J].Journal of atmospheric sciences, 2009, 32(3):360-366. Li-Hong REN. Source apportionment of atmospheric PM10 and PM2.5 in the main urban area of Chongqing [J]. Environmental science, 2014, 27(12):1387-1394.

1150 | Xiao-Hong Peng, Yong-Qing Lee, Xiao-Dong Shen and Ru-Hai Chen [3] [4]

[5] [6] [7] [8] [9] [10] [11]

Shuang-cheng TAO. Chemical kinetics simulation of photochemical smog formation [J]. Journal of safety and environment, 2011, 11 (4): 27-31. IV. Guobin Chou. Datum Analog Research and Analysis of Impact to Atmosphere-pollution from Weather Conditions in the Urban Centre of Chongqing Municipal [D], Lanchou City, Lanchou Univeristy, 2014-4-20. Yin-zhi HU. Numerical simulation of pollutant diffusion in atmosphere [D]. Baotou iron and Steel Institute, 2002, 1-77. Yu HAN. Analysis of climatic characteristics and causes of Chongqing fog [J]. Journal of Meteorology and environment, 2013.29(6):116-122. De LIU. Analysis of the causes of the formation of fog in Chongqing[C]. Chongqing meteorological station, 2000, 36-42. Han Yu,liu DE, WANG Huan,et al. CIimati characteristics of fog and its forming reason in Chongqing[J].Journal of Meteorology and Environment,2013,29(6):116-122. Weiqin Lee. The Chemical Rudiments of Atmospheric Aerosol Pollution. Yellow River Conservancy Press. 2010-1-1. 2013-2015 Chongqing Environment Gazette. Weather Review. http://www.tianqihoubao.com/.

Yang Gao1, Zhi-Feng Wu2, Quan-Sheng Lou3*, Ming-Jie Li4, Yin-Xia Wang5, Xue-Rui Li6 and Ling Tang7

Remote Sensing Monitoring Analysis of Typical Islands in Paracel Islands

Abstract: Yongxing Island and Shidao Island in the Paracel Islands were selected as the study area. Based on high-resolution remote sensing image data of different periods as the data source, the information of the reef shoreline and artificial coastline in the study area were extracted. We analyzed the area change of Yongxing Island and Shidao Island, and the distribution and variation of different types of artificial coastline under the influence of human activities. The results showed that the coastline and area change of Yongxing Island and Shidao Island in the Paracel Islands were influenced by national development strategies and policies. With the increase of the Paracel Islands development, the area growth rate of the Yongxing Island and Shidao Island increased too. The order of development away from the mainland islands has gradually developed from the solution of transportation problems to the construction of public infrastructures, such as starting with the construction of airports and harbors, and continuously solving the urban development space by means of reclamation to improve the urban infrastructure construction. Keywords: changes of island, the Paracel Islands, Yongxing Island and Shidao Island

1 Introduction In recent years, due to the influence of natural and human factors, the coastline of most sea areas changes greatly, resulting in the unbalanced natural ecology [1]. It is necessary to study the reason of the coastline change, which can guide the islands development and protection accordingly. The rapid development of remote sensing and geographic information system (GIS) technology has enabled many scholars to

|| 1 South China Sea Institute of Planning and Environmental Research, SOA, Guangzhou, China. Email: [email protected] 2 School of Geographical Sciences, Guangzhou University, Guangzhou, China 3 South China Sea Survey Technology Center, SOA, Guangzhou, China. Email: [email protected] 4 South China Sea Institute of Planning and Environmental Research, SOA, Guangzhou, China 5 South China Sea Institute of Planning and Environmental Research, SOA, Guangzhou, China 6 South China Sea Institute of Planning and Environmental Research, SOA, Guangzhou, China 7 South China Sea Institute of Planning and Environmental Research, SOA, Guangzhou, China 10.1515/9783110516623-113 DOI 10.1515/9783110303568-113

1152 | Yang Gao, Zhi-Feng Wu, Xue-Rui Li and Ling Tang obtain shoreline information rapidly through remote sensing image data, and then carry out analysis of shoreline changes such as bay, estuary and waterway [2-10]. Visual interpretation and multispectral classification, the commonly used methods of coastal zone extraction are edge detection algorithm [11-13], regional growth method [14], mathematical morphology [15] and wavelet analysis [16]. Feng found that coastal erosion, coastal expansion and human impact were the main reason for the coastline change [1]. However, Weng reported that artificial activities are the dominated contribution to the influence and change of the coastline shape, while the natural siltation and erosion have relatively less influence on the coastline [17]. With the strategy of building a marine power and the 21st Century Maritime Silk Road, the proposed strategy and the establishment of Sansha city, China's development of the South China Sea is growing strength. The Paracel Islands are far away from the mainland, with the development of marine economy in recent years by the impact of human activities gradually increased; the ecological protection situation is grim. At present, the research on the Paracel Islands mainly focuses on geological structure [18], coral reefs [19-23], tidal current [24-25] and so on; however, there is little research on the changes of typical reef shoreline in Paracel Islands. After the establishment of Sansha city, the demand for land use has increased year by year, and the resources space has been continuously obtained from the sea. Human activities have a great impact on the marine ecological environment. As typical islands of the Paracel Islands, Yongxing Island and Shidao Island are selected as the study area in this paper. We took the high resolution remote sensing image data of different periods as the data source, used the measured coastline data of the study area in 2013 as the reference, interpreted the remote sensing image data of the study area by man-machine interactive interpretation, and extracted the research area of the island reef shoreline information and artificial shoreline information. We analyzed the changes of shoreline and area of island, and the distribution and variation characteristics of artificial reef coastline in each period, to provide a scientific basis in island protection and development management of Sansha city.

2 Study Area The Paracel Islands, located in the central South China Sea, southeast of Hainan Island, is one of the four major islands in the South China Sea. According to the location, it is divided into eastern Xuande Islands and the western Yongle Islands. Yongxing Island and Shidao Island are located in the middle of Xuande Islands. In recent years, the coastline change of the Yongxing Island and Shidao Island have been greatly influenced by human activities, especially since the establishment of the Sansha city in 2012, which has greatly influenced the changes of island. Yongxing Island is the largest island of the Paracel Islands, while Shidao Island is

Remote Sensing Monitoring Analysis in Paracel Islands | 1153

located 0.7 kilometers northeast to Yongxing Island, and connected to Yongxing Island by an artificial dam. Yongxing Island is the political, military, economic and cultural center of the Sansha city. It has public buildings such as airport, port, administrative office building, hospital, hotel, library, and bank and grain station. We choosed Yongxing Island and Shidao Island as typical reefs of the Paracel Islands which influenced by human development activities, and analysed the changes of the reefs in the past 20 years.

3 Data and Methods Remote sensing image data, including satellite remote sensing data and aerial image data, is the main data source in this study. The TM image data of the typical reefs covering the study area was recorded on April 9, 1989 and October 30, 1999, with spatial resolution of 15 meters. Quick bird data imaging dated on January 19, 2005, owing spatial resolution of 0.61 meter. Worldview imaging data imaging dated on August 12, 2011 and May 9, 2014, with spatial resolution of 0.5 meter. The aerial imagery date for the study area was December 27, 2013, and the spatial resolution was 0.2 meter. In addition, the chart of the study area and the administrative division map of the Sansha city were collected as the auxiliary data of the study. We conducted shoreline survey of the Yongxing and Shidao Island from May 12 to May 26, 2013, and obtained the measured data of the coastline of the islands. We tested the measured coastline data and interpreted shoreline results of 2013, and obtained a coincidence rate over 90%. The results of the remote sensing image coastline extraction satisfied the research requirements. The high-resolution image data in the study area was geometric corrected firstly, using the control point RPC error compensation method. Thereafter, the corrected high-resolution image was used to correct the low-resolution image. The radiographic calibration, geometric correction, image fusion, image enhancement, and uniform color inlay were used to obtain the image data at different periods in the study area. Taking the coastline data of the study area in 2013 as the reference, we interpreted the remote sensing image data of the study area by means of humancomputer interaction interpretation. Through visual interpretation, the information of the shoreline of the islands in different periods was extracted. Based on this method, the artificial shoreline information of Yongxing Island and Shidao Island in different periods was further extracted. According to the purpose of the study, combined with the actual situation of the study area, the artificial coastline of the study area was divided into three categories: urban life and coastal tourism coastline, port and harbor industrial coastline and embankment coastline. Because there is no artificial beach, coastal beach and

1154 | Yang Gao, Zhi-Feng Wu, Xue-Rui Li and Ling Tang other tourist facilities, the coastline of urban life and coastal tourism was divided into two types of public building coastline and the airport coastline. There is no port industry in the study area, so port and harbor industrial coastline was divided into port coastline. The study area doesn’t have anti-storm surge dyke and breeding dam, so the embankment coastline was divided into connected island embankment coastline (Table 1). Table 1: Division of artificial shoreline types in study area First level Class

Second level Class

Definition

Urban life and coastal tourism coastline

11 public building coastline

For the house, roads and other public facilities construction, or through reclamation for public facilities construction occupied by the coastline.

12 airport coastline

For the airport runway, houses and other buildings occupied by the coastline.

21 port coastline

For the port, harbor, breakwater and other port facilities occupied by the coastline.

Port and harbor industrial coastline

Embankment coast- 31 connected island emline bankment coastline

The embankment coastline to connect the island and the island, or the island and the mainland.

4 Results 4.1 Analysis of Coastline and Area Change of Island The coastline length and area of Yongxing Island and Shidao Island in different periods were calculated by using the extracted coastline information. Naturally, Yongxing Island and Shidao Island were seperated with each other. However and later because the two islands in the construction of an embankment between the two islands as one, so the two islands were analyzed as a whole (Table 2). Between 1989 and 1999, Yongxing Island coastline increased by 1738 meters, an area of 22.66 hectares. Between 1999 and 2005, Yongxing Island and Shidao Island connected by an embankment. The coastline of Yongxing Island and Shidao Island coastline increased by 1723 meters, an area of 10.82 hectares. Between 2005 and 2011, Yongxing Island and Shidao Island coastline increased by 1230 meters, an area of 28.31 hectares. Between 2011 and 2013, Yongxing Island and Shidao coastline increased 424 meters, and the land reduced 1.97 hectares. In 2011, Yongxing Island and Shidao Island near the south part of the part of Yongxing Island, a part of the regional reclamation makes the coastline extraction to the offshore expansion. But in 2013, this part of the reclamation area was still submerged by water, which may

Remote Sensing Monitoring Analysis in Paracel Islands | 1155

be caused by seawater erosion and sediment removal, resulting in the total area of Yongxing Island and Shidao Island has decreased. Between 2013 and 2014, Yongxing Island and Shidao Island coastline reduced by 687 meters, an area increased by 32.33 hectares, mainly due to the expansion of Yongxing Island Airport. The airport at both ends of a large area around the fill caused by the increase in the island area, resulting in reduced shoreline twists and turns. The changes of Yongxing Island and Shidao Island were mainly caused by reclamation, port and airport construction. The changes were mainly in the southwestern part of Yongxing Island (port construction), the north (land reclamation) and the east (airport construction), and the island embankment reclaimed between Yongxing Island and Shidao Island. Table 2: The coastline and area statistics in different periods of Yongxing island and Shidao island year

length (m)

area (ha)

1989

7266

176.51

1999

9004

200.34

2005

10727

211.16

2011

11957

239.47

2013

12381

237.50

2014

11694

269.83

From 1989 to 2014, Yongxing Island and Shidao Island area in addition to 2011 to 2013 period, due to hydrodynamic reasons, a small amount of reduction, the basic showing a trend of increasing year by year. Among them, from 1989 to 2005, the area growth rate is relatively slow; an area of 34.65 hectares, the average area growth rate is about 2.17 hectares per year. In 2007, the State Council approved the establishment of Sansha County. As the establishment of government agencies, land demand continues to increase, and gradually expand the space to the ocean. From 2005 to 2011, Yongxing Island and Shidao Island area of growing speed, area increased 28.31 hectares, the average area growth rate of about 4.72 hectares per year. In 2012, the State Council approved the establishment of Sansha City, the administrative functions and institutions to further improve the urban development of land space for a sharp increase in demand continue to speed up the development of the ocean to the pace of space. From 2011 to 2014, Yongxing Island and Shidao Island area increased by 30.36 hectares, the average area growth rate of about 10.12 hectares per year.

1156 | Yang Gao, Zhi-Feng Wu, Xue-Rui Li and Ling Tang

4.2 Analysis of Coastline Change of Island Affected by Human Activities 4.2.1 Analysis of artificial coastline features On the basis of the extracted coastline of the study area, the artificial shoreline information is further extracted, and the artificial shoreline is divided into four types of artificial coastline, such as public building coastline, airport coastline, port coastline and connected island embankment coastline for statistical analysis (Table 3, Figure 1). Table 3: Different types of artificial shoreline statistics in different periods of Yongxing island and Shidao island year

public building coastline(m)

airport coastline(m)

port coastline(m)

connected island embankment coastline(m)

1989

0

1491

624

0

1999

0

3018

1030

0

2005

130

3269

1040

1282

2011

1767

3270

2793

1042

2013

2132

3284

2737

1207

2014

1602

3616

2703

737

Remote Sensing Monitoring Analysis in Paracel Islands | 1157

Fig. 1: Different types of artificial shoreline distribution maps in different periods of Yongxing Island and Shidao Island

In 1989, most Yongxing Island and Shidao Island artificial shoreline the airport coastline and port coastline. Port coastline is 624 meters long, accounting for 30% of artificial shoreline, located in the southwest side of Yongxing Island, and airport shoreline is 1491 meters long, accounting for 70% of artificial shoreline, located in the south and south-east Yongxing Island. In 1999, Yongxing Island and Shidao Island artificial shoreline is mainly the airport coastline and port shoreline. Port shoreline is 1030 meters long, accounting for 25% of artificial shoreline, located in the southwest side of Yongxing Island, and airport shoreline is 3018 meters long, accounting for 75% of artificial shoreline, located in the south and south-east Yongxing Island.

1158 | Yang Gao, Zhi-Feng Wu, Xue-Rui Li and Ling Tang In 2005, Yongxing Island and Shidao Island artificial shoreline is mainly for the airport shoreline, port shoreline and even the connected island embankment coastline, a small amount of public building coastline. Port shoreline is 1040 meters long, accounting for 18% of artificial shoreline Located in Yongxing Island on the west side, and airport coastline is 3269 meters long, accounting for 57% of artificial shoreline, located in the south and south-east Yongxing Island, and connected island embankment coastline is 1282 meters long, accounting for 23% of artificial shoreline, distributed in the Yongxing Island and between the island, and public building coastline is 130 meters long, accounting for 2% of the artificial shoreline, located in the airport and the island between the dams. In 2011, Yongxing Island and Shidao Island artificial shoreline is the airport shoreline, port shoreline, public building shoreline and connected island embankment coastline. The airport coastline is the longest, 3270 meters, accounts for the artificial shoreline 37% , located in Yongxing Island south and southeast side, and followed by the port coastline which is 2793 meters long, accounting for 31% of artificial shoreline, located in the west side of Yongxing Island, again for the public building coastline which is 1767 meters long, accounting for 20% of artificial shoreline, located in the east of Yongxing Island, and finally, connected island embankment coastline is 1042 meters long, accounting for 12% of artificial shoreline between two islands. In 2013, Yongxing Island and Shidao Island artificial shoreline is mainly for the airport coastline, port shoreline, public building coastline and connected island embankment coastline. The airport coastline is 3284 meters long which is the longest coastline, accounting for 35% of artificial shoreline, located in the south and south-east Yongxing Island, the second is port shoreline which is 2737 meters long, accounting for 29% of artificial shoreline, located in the west side of Yongxing Island, and again for the public building coastline, is 2132 meters long, accounting for 23% of artificial shoreline, mainly located in Yongxing Island on the eastern side, and finally, connected island embankment coastline is 1207 meters long, accounting for 13% of artificial shoreline between two islands. In 2014, Yongxing Island and Shidao Island artificial shoreline is mainly for the airport shoreline, port shoreline, public building coastline and connected island embankment coastline. The longest coastline of the airport, is 3616 meters long, accounting for 42% of artificial shoreline, located in the south and south-east Yongxing Island, and the second is port shoreline which is 2703 meters long, accounting for 31% of artificial shoreline, located in the west side of Yongxing Island, and again for the public building coastline, is 1602 meters long, accounting for 18% of the artificial shoreline, mainly in the east of Yongxing Island, and finally, connected island embankment coastline is 737 meters long, accounting for 9% of artificial shoreline between two islands.

Remote Sensing Monitoring Analysis in Paracel Islands | 1159

4.2.2 Analysis of Artificial Coastline Change From 1989 to 1999, Yongxing Island and Shidao Island airport shoreline increased about 1527 meters, mainly in the northeast side of Yongxing Island. As a result of the period the construction of the airport makes the airport shoreline increased dramatically. And port coastline increased 406 meters, mainly in the west side of Yongxing Island, the time to expand the west side of the terminal Yongxing Island (Figure 2).

Fig. 2: Different types of artificial shoreline changing distribution maps of Yongxing Island and Shidao Island

1160 | Yang Gao, Zhi-Feng Wu, Xue-Rui Li and Ling Tang From 1999 to 2005, the shoreline of the airport increased by 251 meters, mainly in the east part of the airport in the northern region, may be due to the further expansion of the airport project, the completion of the project caused by changes. The port coastline barely changed, and the linked island embankment coastline has increased 1282 meters, mainly due to the connection of the two islands between the Yongxing Island and the Shidao Island. The public building shoreline increased by 130 meters, mainly distributed in the airport and the island between the dams, reclamation tends to occur in the region. From 2005 to 2011, the airport coastline has not changed, and the port coastline increased 1753 meters, located in the northwest side of Yongxing Island, the time in Yongxing Island original pool northwest side of a new port terminal to make a substantial increase in the port coastline, and connected island embankment coastline reduce 240 meters, mainly due to the east side of Yongxing Island, the island reefs caused by the reclamation of the dam to reduce the coastline, and public building coastline increased 1637 meters, mainly in the Yongxing Island on the eastern side of the period of Yongxing Island reclamation scale continues to increase. From 2011 to 2013, the coastline of Yongxing Island and Shidao Island airport coastline has changed little, and the coastline of port has been reduced appropriately, which may be caused by the reduction of shoreline and the increase of the shoreline of public buildings due to the reclamation of some ports along the coastline. The connected island embankment coastline increased by 165 meters. In 2011, the reclamation of part of the island near the Yongxing Island between the Yongxing Island and the Shidao Island caused the coastline to expand to the open sea. In 2013, this part of the reclamation is still flooded, the specific reason may be due to seawater erosion away caused by sediment, so that the shoreline of the island dam has increased. The public buildings coastline increased by 365 meters, mainly due to the northwest side of the dock near the Yongxing Island began to reclamation. From 2013 to 2014, Yongxing Island and Shidao airport coastline increased by 332 meters. The Sansha city was established, the population is increasing, the government staff exchanges and frequent business in Hainan Island, as well as national strategic needs, the airport carrying capacity requirements continue to increase, resulting in the airport continued to increase the size of the airport in the northeast and southwest side of a certain degree of expansion. And port coastline as a result of the airport expansion slightly reduced. Connected island embankment coastline reduce 470 meters, the main reason is due to airport northeast side expansion. Public building coastline increased by 530 meters, the city's development needs from the sea to obtain space resources, reclamation activities around the increasing, leading to public building coastline increased year by year.

Remote Sensing Monitoring Analysis in Paracel Islands | 1161

5 Conclusion In this paper, the changes of coastline and area of Yongxing Island and Shidao Island, and the distribution and variation of artificial shoreline of island are analyzed. The conclusions are as follows: The coastline and area changes of Yongxing Island and Shidao Island in the Paracel Islands are influenced by national development strategies and policies. With the increase of the Paracel Islands development, the area growth rate of the Yongxing Island and Shidao Island are also increasing. From 1989 to 2005, the development and utilization intensity of Xisha was relatively small, and the human development activities in Yongxing Island and Shidao Island were less. The area growth rate was about 2.17 hectares per year. From 2005 to 2011, the State Council approved the establishment of Sansha County, the establishment of the various administrative departments and institutions, acreage of Yongxing Island couldn’t match with the increasing economy, through reclamation to expand the land area, Yongxing Island and Shidao Island area of growing speed, the average area growth rate of about 4.72 hectares per year. From 2011 to 2014, the State Council approved the establishment of Sansha City, the administrative functions and institutions to further improve the urban development for the rapid increase in land demand, and constantly accelerate the development of space to the ocean speed, and the average area growth rate of Yongxing Island and Shidao Island is about 10.12 hectares per year. The order of development away from the mainland islands has gradually developed from the solution of transportation problems to the construction of public infrastructures, such as starting with the construction of airports and harbors, and continuously solving the urban development space by means of reclamation to improve the urban infrastructure construction. Acknowledgement: This study was supported by the Public Science and Technology Research Funds Projects of Ocean (No. 201205040-8), National Natural Science Foundation of China (Grant No. 41406113) and Director Fund of Marine Science and Technology, South China Sea Branch, SOA (No. 1671).

References [1] [2]

[3]

Feng Shouzhen, Yu Jia, LI Jie. Coastline Displacements and Dynamical Variabilities of Some Islands in Guangxi and Their Effects [J]. Coastal Engineering, 2010, 29(3):37-42. Ma Xiaofeng, Zhao Dongzhi, Zhang Fengshou, etc. An Overview of Means of Withdrawing Coastline by Remote Sensing [J]. Remote Sensing Technology and Application, 2007, 22(4):575-579. Yang Jinzhong, Li Zhizhong, Zhao Yuling. The Remote Sensing Dynamic Monitoring of Hangzhouwan Banks [J]. Remote Sensing for Land and Resources, 2002(1):23-28.

1162 | Yang Gao, Zhi-Feng Wu, Xue-Rui Li and Ling Tang [4]

[5] [6]

[7]

[8]

[9]

[10]

[11] [12]

[13]

[14] [15] [16] [17] [18]

[19] [20]

[21]

Yu Jie, Du Feiyan, Chen Guobao, etc. Study on the Change of Daya Bay Coastline Based on Remote Sensing Technology [J]. Remote Sensing Technology and Application, 2009, 24(4):512516. Liu Xu, Ma Yanyan, Li Guangxue, etc. Evolution of Yangtze River Estuary Coastline Based on Satellite Remote Sensing [J]. Marine Geology and Quaternary Geology, 2013, 33(2):17-23. Liu Rongjie, Zhang jie, Yan qiushuang, etc. Remote Sensing Monitoring and Analysis of Shoreline Evolution in Estuaries of Fujian Province From 1982 to 2012[J]. Journal of Applied Oceanography, 2014, 33(3): 425-433. Ma Hongwei, Feng Yulin, Cui Jian, etc. An Analysis of Shoreline Changes in Liaohe River Delta Based on Remote Sensing and GIS Technology [J]. Geological Bulletin of China, 2014, 33(10):1578-1581. Huang Hu, Hu Zining, Chen Xingeng, etc. Analyses on Spatial and Temporal Changes of Guangxi Shoreline Based on Remote Sensing and GIS [J]. Journal of Tropical Oceanography, 2006, 25(1):66-70. Feng Yongjiu, Liu Dan, Han Zhen. Study on The Extraction and Transition of The Jiuduansha Coastline Based on Remote Sensing and GIS [J]. Remote Sensing for Land and Resources, 2012(1):65-69. Wang Lin, Xu Hanqiu, Li Sheng. Remote Sensing Dynamic Monitoring of Coastline Changes in Xiamen Island and Its Neighborhood [J]. Remote Sensing Technology and Application, 2005, 20(4):404-410. Boak E H, Turner I L.Shoreline Definition and Detection: A Review [J]. Journal of Coastal Research, 2005, 21(4): 688-703. Zhang Chaoyang, Feng Wufa, Zhang Junhua. Remote Sensing Image Coastline Extraction Based on Chromatic Aberration [J]. Journal of Institute of Surveying and Mapping, 2005, 22(4):61-64. Dellepiane S, De Laurentiis R, Giordano F. Coastline Extraction from SAR Images and a Method for the Evaluation of the Coastline Precision [J]. Pattern Recognition Letters, 2004, 25(13):1461-1470. Yan Haibin, Li Bingbo, Chen Mingdong. Research Progress of Remote Sensing Technology for Extracting Coastline [J]. Areal Research and Development, 2009, 28(1):101-105. Li Wei. Research on Edge Detection Algorithm Based on Mathematical Morphology [J]. Computer and Digital Engineering, 2008, 36(11):20 -22. Du Tao, Zhang bin. Research on Wavelet Analysis of Remote Sensing Image to Determine Coastline Location [J]. Marine Sciences, 1999(4):19-21. Weng Yubin, Luo Meixue, Ren Yuesen. The Measurement and Its Significance of the Island Coast of Fujian Province [J]. Ocean Development and Management, 2011, 28(5):45-50. Zhang Chongyuan, Wang Zhengfeng, Fan Taoyuan, etc. Stress Measurement of Basal Crust of Shidao Island in Xisha Island and Its Geodynamic Significance [J]. Chinese Journal of Geophysics, 2015, 58(3):904-918. Zhu Zhixiong, Zhou Yongcan, Ke Shaowen, etc. Investigation and Primary Study on Main Diseases of Reef Formation in Xisha Islands [J]. Acta Oceanologica Sinica, 2012, 34(6):195-204. Shen Jianwei, Yang Hongqiang, Wang Yue, etc. Community dynamics and shallow-water carbonate sediments of coral reef flat in Yongxing Island [J]. Science China Earth Sciences, 2014, 44(3):472-487. Peng Jiaxi, Liu Jinling, Xu Xiangrong, etc. Concentrations of Heavy Metals and Enrichment in Corals of Yongxing Island in Xisha Island [J]. Marine Environmental Science, 2014, 33(6):848853.

Remote Sensing Monitoring Analysis in Paracel Islands | 1163 [22]

[23] [24]

[25]

Li Yuanchao, Lan Jianxin, Zheng Xinqing, etc. Preliminary Evaluation on the Effect of Coral Reef Ecological Rehabilitation in Zhaoshu Island [J]. Journal of Applied Oceanography, 2014, 33(3):348-353. Yang Hongqiang, Shen Jianwei, Fu Feixue, etc. Black Belt Disease May Lead to the North of Yongxing Island Reef Flat Coral Decline [J]. Science China Earth Sciences, 2014, 44(4):642-653. Deng Xiaodong, Liu Junliang, Cai Shuqun. Analysis of Tidal Current Characteristics in the Continental Shelf Area of the Xisha Islands in the South China Sea [J]. Marine Hydrology, 2013, 32(4):8-12. Wang Daoru, Shi Maochong, Nan Feng. Study on Characteristics of Tide and Residual Current in Xisha Islands [J]. Journal of Ocean University of China, 2012, 42(10):1-9.

Tie-Cheng Li1, Yan-Li Gao2, Shang-Wu Yang3 and Yong Ye4*

The Structural Character and Optimal Design of Canal Aqueduct Abstract: Canal aqueduct is aerial construction to transport water flow to cross river channels, ways, plains and the entrance of valley. And truss canal aqueduct has light structure, strong integrity and smaller counter force; it is actively generalized in engineering for its ideal pattern and is widely applied in port and traffic. Better structural design is made through analysis of the formation and combination with specific engineering. The results show that different truss canal aqueducts have different advantages in different stressing conditions. Deck type can not only transport big discharge but ship, half through type have better adaptive capacity, through type can suit soft foundation and have less engineering quantities of abutment pier. In view of different aqueduct structure has different advantages, calculation and analysis have been done in the structure, stability, strength, and crack control. In addition, an engineering example has been used to verify the correct calculation. Keywords: Constructions of transporting water, Truss canal aqueduct, Structural design, and Structural optimization.

1 Structural Form Braced arch or arched truss is the supporting structure of tank body in braced flume. [1] In arched canal aqueduct, main arch ring and supporting structure above arch are combined by braced arch and single or multiple trussed arch sheets is linked to massive structure by lateral associated component. Braced canal aqueduct is divided into deck, half through, through and more arch type based on structural features and place of tank body. [2] 1) Deck typed braced and arched flume: trussed arch sheet is consist of top boom, bottom boom and middle boom. Top boom is straight, bottom boom is arched. Tank body is on top of top boom. Though the effect of arch increases as the increase of stiffness ratio about top and bottom boom, the effect of arch increases

|| 1 College of Hydraulic & Environmental Engineering, Three Gorges University, Yichang, China 2 College of Hydraulic & Environmental Engineering, Three Gorges University, Yichang, China 3 College of Hydraulic & Environmental Engineering, Three Gorges University, Yichang, China 4 College of Hydraulic & Environmental Engineering, Three Gorges University, Yichang, China. Email: [email protected] 10.1515/9783110516623-114 DOI 10.1515/9783110303568-114

1166 | Tie-Cheng Li, Yan-Li Gao, Shang-Wu Yang and Yong Ye so sunk abutment in construction and arch abutment in operation are all in bad condition. It can only be applied in lower abutment and rock foundation. 2) Half through typed braced and arched flume: the one between deck type and bottom type has complex structure and better adaptive capacity. When the stiffness ratio of top and bottom boom increases, the effect of arch increases and 3) Through typed braced and arched flume: top boom is arched, bottom boom is straight and tank body is on top of top boom. When the stiffness ratio of top and bottom boom is large, the effect of arch outstands and larger horizontal thrust in arch springing is delivered to bottom boom to let it in pulling. In opposite condition, the effect of beam outstands, it actually is arched truss. The stressing of chase abutment and chase pier is associated with layout of arch springing. 4) More trusses typed braced and arched flume: quadrature booms are all arched and are pulled under vertical load, as the effect of arch outstands. It can only have single arch in two sides of tank body, so flow and span should not be too large.

2 Establishment of Elementary Size 2.1 Size of Span The election of span affects stressing of total flume structure, art of construction, treatment of foundation and construction. When span is small, construction is easier and top structure is well stressed, but supporting pier is more. [3] It can lead twoway effect to other constructions and can also affect navigation, flood and others. If the span is large, construction is harder and the stressing of top structure is complex, so demand of foundation is high. But arrangement of the whole pivot is flexible and has less two-way effect. The election of flume span should be based on comprehensive technology of top and bottom structure, analysis and compare of economy and possibility of construction. [4] Trying best to increase span to reflect the development level of modern technology.

2.2 The Size of Rise-Span Ratio Rise-span ratio affects the distribution of internal force of the whole component and holistic concerted working performance. General condition is that the larger of the rise-span ratio of arched boom, the greater of structural stressing condition. But if the rise-span ratio is too large, the quantity of demanded materials will increase because of the increase of total length of bar, and it will be bad to structural stabilization and construction. [5]

The Structural Character and Optimal Design of Canal Aqueduct | 1167

2.3 The Curve Form of Arched Boom The curve form of arched boom well affects trussed internal force, so it is a good way to use curve of the second degree. [6] 1) The division of nodal spacing of trussed arch sheet: size of nodal spacing also affects distribution of internal force between booms. Smaller nodal spacing is good to structural stressing, but it limits the play of curved bar (arched boom) and is bad to the endogenous force of total structure. The above situation should be considered about the election of nodal spacing. Compressive character of curved bar should be played, it can decline the size of section based on greater compression strength of concrete and simply calculation and construction based on uniform stressing of each middle bar. 2) Sectional size of member: trussed arch is statically indeterminate structure, and the linear hardness ratio between each member is different, so it not only affect internal distribution between each member, but also affect internal character and space working nature in the whole structure. Elementary internal force analysis shows that stressing of every member is more complex and more is two-way eccentric stressing component, and each of them also has shear force and torque, it is completely complex for reinforce design. The effect from some internal force to reinforce can be declined by adjusting the sectional size of each member. Or only considering build-up, it greatly simplifies member’s design and calculation and promotes calculation accuracy, security and economy. 3) Transverse connection of truss arch sheet: In order to strengthen structural integrity and concordant working nature and promote transverse stabilization of truss arch sheet, it is necessary to lay out transverse connected component between two sheets. 4) Structure of channel body: The structure mainly consider construction convenience, so handing stepped precast reinforced concrete tank body of rectangular section to presupposed place and pouring concrete once again to make it compose a massive structure, at the last, laying it at truss. Size of tank body is ensured by carrying demand. And thickness of base and curb plate is ensured by demand of strength, hardness and breaking resistance.

3 Internal Analysis and Calculation Combined contortion and bending of tank body is a main way to deliver structural load of trussed aqueduct to truss, then it is delivered to abutment, then it is delivered step by step. The stressing component of base and curb plate is constant plate supporting boom; its internal force can be calculated directly according to structural mechanics and look-up methods. Load of tank body mainly is self-gravity and water

1168 | Tie-Cheng Li, Yan-Li Gao, Shang-Wu Yang and Yong Ye compression, and wind load greatly affects empty channel, but wind compression is not very large, so it does not control design and calculation. Truss structure is statically indeterminate structure relying on abutments; it bears the load from tank body. Traditional calculation method about internal force is structural mechanics and bar system finite element method based on single plane truss, but the calculation is not full consider nodal hardness and structural space working nature, so it can’t completely reflect actual stressing condition and has larger inaccuracy and may lead to insecurity and waste in design. In order to promote calculative justification, it is necessary to choose space steel frame finite element model which fully consider structural space stressing and transformation to calculate internal force. Truss structure aqueduct is consisting of bar system. Compared with others, its analysis and calculation don’t need simplify if it is space steel frame. Internal calculation and actual stressing are nearly equal, so the accuracy is high.

3.1 Structural Calculation Structural calculation are calculation of limiting state of bearing capacity and check computation of using correctly limiting state, so it can ensure security, adaptability and durability. For this large prestressed concrete aqueduct structure, the choice of concrete material should combine construction level in our country, so high intensity scaled concrete should be chose as possible. In one hand, it can decline size of section, reduce self-gravity and remit compression to foundation. In other hand, it can exert greater prestress to satisfy the demand of crack control.

3.2 Calculation of Stability For the structural character of trussed aqueduct, the stability should be checked. (1) Massive stability. Truss with smaller shape factor and lateral associated structure is bar system structure, and wind load bring less effect to it Boom stability. If the section between two booms is hinge point, length of each boom is its geometric length. At the same time, if ratio of slenderness [L0/b] less than the limit of unbalance: [L0/b] =30, there is no problem for boom stability.

3.3 Calculation of Intensity Deck and curb plate of tank body are component in flexure, and its reinforced design is based on general constant plate. Truss booms are stressed intricately; most of them are two-way eccentric stressing components and have shear force and torque. In order to promote calculation accuracy and simplify calculation method: firstly, adjusting properly size of section of each boom to reduce the influence from some

The Structural Character and Optimal Design of Canal Aqueduct | 1169

internal force as torque to sectional intensity and make reinforce only depend on demand of construction; secondly, after elementary reinforce about intensity in main strain, check and adjust in two-way stressing and apply properly simple superposition method; at last, using uniform and symmetric reinforced manner as possible to suit normative calculation demand to decline inaccuracy.

3.4 Check Computation of Crack Control The choice of control standard should rely on reliability and economy of component. Control standard of breaking check computation: for prestressed concrete component, check computation should be used in both short-term and long-term combination of load influence, and marginal stress is admitted to take place in the side of tensile component, but tensile stress should not over the magnitude of stressed controlled by limit coefficient of concrete bon tensile stress; for reinforced concrete component, its relevant internal force can’t over magnitude of control. Control standards of crack width: for reinforced concrete component, it should be calculated in two conditions, one is short-term combination of influence, the other is longterm combination, and the largest width can’t over magnitude of sion .Though water through tank body directly, crack can’t appear, or flooding will be affected, so check computation should be based on breaking control standards. Once main stressed booms have cracks, trussed massive hardness and the whole structural internal distribution will be badly affect, so it bring disadvantage to the whole structure. For this booms, such as bottom boom, bottom bridging beam, montant and so on, check computation should be based on breaking control standards. For minor booms, as top bridging beam, cracks are admitted, and check computation of crack width control is ok. The acted influence of prestressed anchor bar is similar to external load under check computation of truss structural crack control, that is to say, prestress is equivalent to load action.

4 Engineering Illustration One aqueduct’s engineering location has well geologic condition, belonging to the second site. The inlet base height is 106.56 meter and the outlet is 105.93 meter. Rectangular section singular channel without drag bars is used through hydraulic computation, its channel width of flow section is 4.7 meter, design water lever is 1.32 meats and check water lever is 1.61 meter. The whole truss length is 142 meter, and deck circular board arch aqueduct is adopted in order to escape erecting abutments in arterial canal efficient flow section. According to traditional hydraulic computation, it is consist of 9 circular arches including main arch with 3/8 circular arch and

1170 | Tie-Cheng Li, Yan-Li Gao, Shang-Wu Yang and Yong Ye other arches with 1/2 circular arch in order to decline footing horizontal thrust. Main arch span is 49.6 meters and thickness is 1.2 meters, and the others is 13 meters and 1 meter. Expansion joints are at tank body crown section, and arch crown is connected with lengthways, also, it has no brackets. After optimal design, lateral section size of I-shape rib beam is 700*400 millimeters and spacing is 2 meters. The material is C40 concrete, and normal breaking control stress in limiting state is 3.23MPa and 2.66MPa. After calculation, lower surface axial tensile stress of arch crown is 0.86MPa; lower surface axial tensile stress of section which is 14 meters far away from arch crown arc length is 0.5MPa,and higher surface axial compressive stress is 3.15MPa; lower surface axial compressive stress of section which is 22 meters far away from arch crown arc length is 4.1MPa,and higher surface axial tensile stress is 1.24MPa; footing lower surface axial tensile stress is 1.1MPa,and higher surface axial compressive stress is 4.7MPa. Lengthways section at 1/2 beam width is lengthways stress control of the beam. Because stress at two sides of control section greatly changes, so control sectional lower surface at top of main arch has 4.9MPa the largest lengthways compressive stress under vertical load, otherwise local area of lower surface of small arch has 0.77MPa, the largest lengthways tensile stress. For lengthways beam, there is 1.42MPa the largest lengthways tensile stress at the middle span of lower surface. Its higher surface tensile stress is quite small and its range ability in total span range is small, both of this satisfies demand of normative design.

5 Summary Although the traditional aqueduct style has its own advantages, we are still committed to using these methods to design a more perfect aqueduct model, and through the production of aqueduct model to verify the idea. Acknowledgement: The program is greatly supported by College scientific and technological progest of Water Resources and Environment Academy of China Three Gorges University, and thanks the help of Jia-le GUO, Jie YANG and Xiao-li TIAN.

References [1] [2] [3]

Wen-hua ZHAO. Canal aqueduct. Water Resources and Electric Power Press. 2001, p.2-30. (in Chinese) Northwest Investigation, Designed Research Institute. Design Specifications for Hydraulic Concrete Structure SL/T 191-96.Beijing: China Water Power Press, 1997. (in Chinese) The water conservancy department. Unified design standard of structural reliability in cascade hydropower projects GB 50199-94.Beijing: China Plan Press, 1994. (in Chinese)

The Structural Character and Optimal Design of Canal Aqueduct | 1171 [4]

[5] [6]

Environment Protection department 0f 0riginal Rural-urban Construction. Design Specifications for Concrete Structure GBT 10-89.Beijing: China Building Industry Press, 1990. (in Chinese) Chinese agriculture water conservancy encyclopedia editing committee (Chinese agriculture encyclopedia on water resources): China Agriculture Press, 1986:276. (in Chinese) Qian-qing XU. Encyclopedia of China’s Water Conservancy: China Water Power Press, 2006: 549. (In Chinese)

Shuang-Shuang Li1, Gao-Ya Sang2, Ming-Yang Xu3 and Yong Ye 4

Different Aqueduct Structure Make and Design Abstract: Aqueduct is a construction that crosses under the rivers, roads, mountains and other obstacles, through which the water can be conveyed from one place to another. Aqueduct is a popular engineering structure. There are two common kinds which are Cable-stayed and Beam in all structures of aqueduct we have compared their structural features and the mechanical behavior, finally knowing their advantages in the engineering. And we gain two kinds of optional structures of aqueduct by calculating and analysis. Then the two kinds of aqueducts’ model are made and designed by using plastic materials. These experiences can improve student's cognitive and operational competences. Keywords: Cable-stayed aqueduct, Beam aqueduct, structure design, fabricated model.

1 Introduction Aqueduct is a construction that crosses under the rivers, roads, mountains and other obstacles, through which the water can be conveyed from the one place to another. Aqueduct is the most widely used structure not only for water conservancy but for flood diversion, desilting, as well as river diversion. Since the establishment of China, our country has gradually built a large number of aqueducts in order to solve the problem of industrial and agricultural water. In the early 1950s, due to the impact of factors such as economy and technology, aqueduct mostly belongs to stone arch, or wood girder structure, and construction technology of aqueduct is simple. After the early 1960s, reinforced concrete aqueduct gradually increases. Moreover, the construction method gives priority to use cast-in-situ monolithic. Before the 1970s, the flow of constructed aqueduct was relatively small, and structural features mostly had medium or small spans [1]. In the 1970s, in China, the

|| 1 College of Hydraulic & Environmental Engineering, Three Gorges University, CTGU, Yichang, China. E-mail: [email protected] 2 College of Hydraulic & Environmental Engineering, Three Gorges University, CTGU, Yichang, China. E-mail: [email protected] 3 College of Hydraulic & Environmental Engineering, Three Gorges University, CTGU, Yichang, China. E-mail: [email protected] 4 College of Hydraulic & Environmental Engineering, Three Gorges University, CTGU, Yichang, China. E-mail: [email protected] 10.1515/9783110516623-115 DOI 10.1515/9783110303568-115

1174 | Shuang-Shuang Li, Gao-Ya Sang, Ming-Yang Xu and Yong Ye flow through aqueducts developed from several cubic meters per second to a few cubic meters per second. Structure feature also developed tremendously; the span of single span reached up to hundreds of meters. Supporting structures had different types, such as hyperbolic arch and three hinged arch. In the 1980s, aqueduct structures gradually developed. According to support structure, aqueduct can be divided into several types, such as beam aqueduct, arch aqueduct, truss aqueduct, cable-stayed aqueduct. According to the shape of the fracture surface, aqueducts can be divided into rectangular, U-shaped, trapezoidal, parabolic aqueduct, etc.; According to the construction methods, aqueducts can be divided into cast-in-situ monolithic, prefabricated, pre-stressed etc.

2 Cable-Stayed Aqueduct 2.1 Specialty of Construction Cable-stayed [2] aqueduct is composed of stay cables, tower, pylon and aqueduct body and it is a structure feature taking advantages of disparate materials legitimately .Concrete pylon is mainly crushed component, and reinforced concrete tower and aqueduct body are eccentric compressive structures .And high-strength wire cables are the components of sustaining tension .What we have said above has proved that materials are given full play to each character. The same as cable-stayed bridge, cable-stayed aqueduct [3] enjoys strong span ability ,which can scratch hundreds of meters in general ,and the horizontal forces of stay cable are in favor of longitudinal stress of aqueduct body sufficiently. Theoretically, the longitudinal forces concentrate upon the mid-span so that it has no gravity pull by and large if we have adjusted the internal force of cable by the square .Aqueduct body belongs to the buildings being bend ,which is quite beneficial for the longitudinal reinforcing steel bar and crack resistance .Because of the support of cable ,the girder of aqueduct is not out of shape at the bearing when the cable has infinite rigidity ,which make it become small-span rigid supported continuous free beam ,decreasing the bending moment of girder .Therefore ,the height of aqueduct body can be decreased to save materials while horizontal thrust makes leaks ,having solved the difficulty to prevent leaks ,having solved the difficulty to deal with the partings of aqueduct. Therefore, in the various kinds of concrete aqueducts, which makes the concrete tower and pylon the stressed frame member, the reinforced concrete become the eccentric compressive buildings, the high-strength wire cables be the component of sustaining tension, is the most reasonable structure to use materials adequately at present .Component richly bring each function into play reduces the need of materials and increases the economic benefit widely.

Different Aqueduct Structure Make and Design | 1175

2.2 The Make of Cable-Stayed Aqueduct We make the scale of each section close to “golden ratio” in appearance while thinking length, angle, bending moment and connection type and so on in the aspect of stability .The upper and lower proportion of the main sticks of aqueduct body verges on “golden ratio”. The drop-point of cable, span equal distance and locating among the main sticks, should approach the midpoint of aqueduct accordingly. The structure calculation [4] cable-stayed aqueduct can be divided into two parts ,one is the calculation in regard to internal force of cross section ,another is the calculation in regard to vertical structure .The first part apply moment distribution method to receive the computational formula of internal force with typical section ,making the absolute value of bending moment locating two sides of main sticks equal and the length is twice the width with the aqueduct body .The second part apply direct stiffness method and finite element program to calculate. Using pong–sized girder can decrease self-weight and enhance the ability of spanning when we calculate the structure of aqueduct .As a result, this article apply pre-stressed technique to improve the bearing capacity of section, reduce the size of section when we design the cross section while cable-stayed aqueduct rely on cable and the longitudinal pressure of girder to bear dead load with the time to calculate longitudinal structure. By calculating and analyzing structure to optimize cable- stayed aqueduct, we have made a model exhibited as shown in (Fig.1).

Fig. 1: Model of cable-stayed aqueduct.

1176 | Shuang-Shuang Li, Gao-Ya Sang, Ming-Yang Xu and Yong Ye

3 Beam Aqueduct 3.1 Structural Characteristics Beam aqueduct [5] structure includes aqueduct body, supporting structure, structure of import and export, etc. Beam aqueduct body commonly used cross-sectional type has rectangle and U shape, as well as round tube. Rectangle is applicable to all flow, but U shape and round tube are applicable to small and medium flow. If aqueduct does not have navigation requirement, straining pole needs to be set every 1 ~ 2 meters on the top of the aqueduct, to increase longitudinal stability of the side wall and improve lateral loading of the body. If aqueduct has navigation requirement, we can appropriately increase thickness of the side wall or the stability of the side wall. When the flow is very enough, we can make full use of the model which belongs to multi-longitudinal beams at the bottom, to make the bottom of the aqueduct a platebeam structure. Beam aqueduct can be divided into four types, such as simply supported beam, double cantilever beam, single cantilever beam and continuous beam, according to the number and position of supporting points. Simply supported beam aqueduct possesses simple structure, convenient construction, as well as easy joint seal. Both ends of the aqueduct body are supported on the framed bent or piers, and aqueduct body under vertical load will has larger sagging moment that has tension at the bottom. Span commonly varying from 8 to 12 meters is generally equivalent to or slightly less than the height of piers or framed bent. Double cantilever beam aqueduct is divided into identical span beam aqueduct which belongs to double cantilever and identical bending-torque beam aqueduct which belongs to double cantilever, according to the position of supporting framed bent. The span of the former is equal to the sum of both sides of the cantilever length. The former just produce negative bending torque that has upper tension, and does not have bending torque in mid-span. The span of the latter is more than the sum of both sides of the cantilever length, which makes bending torque in mid-span equal to negative bending torque of bracing point. The upper and lower layer needs to configure the longitudinal tensile reinforcement and structural reinforcement. So the total amount of reinforcement of the latter may be bigger than the former. Single cantilever beam is suitable for the transition between double cantilever beam and simply supported beam and the connection between the import building and the export building. Cantilever’s length cannot be too long, and pulling force does not appear in the Single cantilever beam. Compared with Single cantilever beam, the body Continuous beam aqueduct has better stressing condition. And in the condition of the same span and load, continuous beam has smaller bending torque in mid-span, so continuous beam can increase the span.

Different Aqueduct Structure Make and Design | 1177

The lower supporting structure of the beam aqueduct has many kinds, for example, single framed bent, double framed bent, A-line framed bent and etc. Single framed bent has small volume, convenient construction, less construction materials and better flexible. It can be adapted to the telescopic deformation. When supporting weight is very heavy, and framed bent is high, A-line framed bent which have better stability can be used, but its drawback is that this structure would spending more. Vertical load of the framed bent mainly comes from the weight of the tank body and inland waters, and horizontal load is mainly wind load. Simple structure, convenient construction and installation are the biggest advantages of beam aqueduct, and these advantages are the reason that Beam aqueduct has still been used largely over many years. The body of Beam aqueduct plays a role of bearing weight, so the weight is heavier and the mid-span bending moment is bigger. These reasons make the beam aqueduct’s span small. The common span is between 8 and 15 meters. The rest beam aqueduct’s stress condition is better, but the applied span of the beam aqueduct generally within 20 meters. Even pre-stressed technology used, span is still confined to the 50 meters. Beam aqueduct body directly slot on the piers or framed bent, so temperature changing and foundation uneven settling will cause deformation of the aqueduct body, sometimes may leading to water leakage. When it comes to continuous beam aqueduct, there are some situations bad for the strained condition of the continuous beam, for example, every fulcrum has uneven settlement. And aqueduct body will produce larger additional bending torque, also producing torsional stress. Therefore, beam aqueduct should have good foundation conditions.

3.2 Model-Making of Beam Aqueduct The model is designed by making use of "the golden ratio". When it comes to the stability, the main factors that should be considered are the soundness of the platform of the aqueduct, the advantages and disadvantages of combined connection and the stability of piers, and so on. Model (Fig.2). Is mainly made by pole structure. And the key of the combination is how to make the section taking the least amount of force as well as the most stable structure.

1178 | Shuang-Shuang Li, Gao-Ya Sang, Ming-Yang Xu and Yong Ye

Fig. 2: Model of beam aqueduct.

4 Conclusion Through the model’s making and experiment, we realize that the stability of Beam aqueduct is poorer. The connection of beam aqueduct is complicated. And Cablestayed aqueduct‘s inlaid connection is convenient, whose stability is relatively good. When producing Beam aqueduct, making the body of Beam aqueduct is the key part. When we produce a Cable-stayed aqueduct, the location of rope and the height of the main support are very important in the stability of whole structure. After comparison, we can see that inlaid connection is more stable than the combined. Students' science and technology project gives us chances to touch scientific research activities, strengthening the consciousness of operational ability and learning. Those things are indispensable to college students' activities. Through this topic research, big enhancements are made by us. That many heads are better than one is learned because of. Increasing awareness of teamwork Acknowledgement: The authors wish to thank College of Hydraulic & Environmental Engineering, Three Gorges University for supporting our project. And the authors want to thank Zhang Yu and Zhang Jiajia for their help and the collaboration between us.

References [1]

ZHOU Hougui, MA Jiming, MA Jingang. Development of Domestic and Overseas Aqueducts and Caohe Aqueduct on Mid-Route of South-to-North Water Transfer Project[J], South to North Water Transfer and water conservancy science and technology, 2007.5(3): 14-17.

Different Aqueduct Structure Make and Design | 1179 [2] [3]

[4]

[5]

Fu Zhimin. Big Cable-stayed Aqueduct’s Optimizing and Design;Hohai university[D].2003. “in chinese” Zhang Junzhi. The Study on Optimization Algorithm of cable-stayed structure deliverying water [J]; Journal of Nanchang College of Water Conservancy and Hydroelectric Power.1994. “in chinese” Hao Wenxiu,Xu Xiao,Du Shoujun,Xu Zengming. Large flow cable-stayed aqueduct’s structure selection. Proceedings of the Tenth National Conference on Structural Engineering [A]; 2001. “in chinese” Ji Richen.The Study on Several Key Problems of Large Rectangular Beam Aqueduct’s Structure Features [D]; Xian science and engineering university. 2008. “in chinese”

Shuang Chen1, Ying-Lu Gu2, Qiang Zhong3 and Zhi-Liang Zhang4

Liquefaction Technology of Rice Husk in Polyhydric Alcohols

Abstract: Rice husk was liquefied in the mixture of polyethylene glycol (PEG400) and ethylene glycol as liquefying reagents in the presence of sulfuric acid as catalyst. In such a process of rice husk liquefaction, the amount of sulfuric acid and catalyst, liquid to solid mass ratio, the reaction temperature and time were investigated. Scanning electron microscope analysis shows clearly that the rice hull fiber is constantly being corroded, degraded and cracked, and hydroxyl value of liquefied product also decreases gradually from 154 to 50 mg/g. Acid value first increases, then decreases from 11 to 18mg/g; The molecular weight (Mw) is 8603 to 32880. Keywords: rice husk; polyhydric alcohols; liquefaction Plant fiber material is the only green renewable resource which is extremely rich in nature. With the consumption of the petrochemical resources and the problem of environmental pollution, the researches of its rational utilization are becoming more and more. The main component of plant fiber is refractory natural composite material, including cellulose, hemicellulose and lignin. These elements are difficult to process by dissolving, heating, and elevating pressure, so the utilization of the plant fiber is influenced [1]. The study showed that liquefaction technology could convert low grade solid plant fibers into high grade liquid fuel or chemicals, which is one of the main ways to use plant fibers efficiently. At the present stage, the most study is to degrade polyalcohol of plant fibers to prepare liquid plant polyalcohol which has reaction activity, and then it is converted into high polymer material with biodegradability [2]. This paper mainly investigates liquefaction technology of rice husk in polyhydric alcohols, the residues are analyzed and characterized to provide theoretical basis for the high value-added utilization of the rice husk.

|| 1 State Key Laboratory of Heavy Oil Processing, China University of Petroleum (East China), and Qingdao, China. Email: [email protected] 2 State Key Laboratory of Heavy Oil Processing, China University of Petroleum (East China), Qingdao, China 3 State Key Laboratory of Heavy Oil Processing, China University of Petroleum (East China), Qingdao, China 4 State Key Laboratory of Heavy Oil Processing, China University of Petroleum (East China), Qingdao, China 10.1515/9783110516623-116 DOI 10.1515/9783110303568-116

1182 |Shuang Chen, Ying-Lu Gu, Qiang Zhong and Zhi-Liang Zhang

1 Experiment 1.1 Experimental Materials 1.1.1 Raw materials Raw materials: Rice husk (60-80 mesh numbers), produced in Dongying, Shandong, dried in drier for 24h under the condition of 105°C and put into the dryer for use. Reagents: polyethylene glycol (PEG400), ethylene glycol and concentrated sulfuric acid are all analytic reagents.

1.1.2 Experimental apparatus Electronic balance, oil bath pan, stirrer, dryer, vacuum pump, muffle furnace, ultrasonicator, PH meter, conventional glass apparatus.

1.2 Methods 1.2.1 Determination of chemical compositions of rice husk The water, cellulose, hemicellulose, lignin, ash and benzene alcohol extract of the material are determined according to GB/T2677-1994. The results of the test are shown in Table 1: Table 1: Chemical compositions of rice husk component

water

cellulose

hemicellulose

lignin

ash

benzene alcohol extract

value

9.95%

33.01%

28.62%

20.31%

14.54%

3.39%

1.2.2 Liquefaction of rice husk in polyhydric alcohols Take a certain amount of polyethylene glycol (PEG400), liquefied promoter and concentrated sulfuric acid into a three mouth flask with a condensing tube, a thermometer and a stirrer to heat. When the temperature is close to the setting temperature, put 4.0g rice husks into the flask quickly and begin to time. When the reaction

Liquefaction Technology of Rice Husk in Polyhydric Alcohols | 1183

to the expected time, reactants are taken out and quickly cooled to room temperature in the cold water.

1.2.3 Determination of residue rate of liquefied products A certain amount of liquefied products are weighed accurately and completely dissolved in ultrasonicator with 100ml acetone for 10min. Then, the products are filtrated in vacuum and washed with acetone until the filtrate is colorless. Putting the residues into the dryer with the condition of 105°C until the weight is constant, then weighing and calculating the rate of residue. Adding anhydrous sodium sulfate to the filtrate to dehydrate. Then the black sticky liquefied liquid is reserved by vacuum distillation recovery solvent acetone. Residue rate (R) and liquefaction rate (S) can be calculated as follows: ௐ

 ൌ ቀ భ ቁ ൈ ͳͲͲΨǢ ௐ బ

 ൌ ሺͳ െ ሻ ൈ ͳͲŠ—••

(1) (2)

W0- the amount of dry rice (g); W1-the amount of dry residues.

1.3 Scanning Electron Microscope Analysis of Liquefaction Residues The liquefaction residue was analyzed with the SU3500 scanning electron microscope. The specific operating parameters: the electron microscope acceleration voltage is 20kV; the electron microscope amplification factor is 800 times.

1.4 Determination of Acid Value and Hydroxyl Value of Liquefied Oil Hydroxyl value is determined according to GB/T 12008.3-2009. Take an appropriate amount of liquefaction (accurate to 0.0001g) in the conical flask, adding 25mL two phthalic anhydride acylation reagent, shake flask to sample dissolved and connect the reflux pipe. Refluxing at 115°C after 30min, terminating the reaction and cooling to room temperature. The condenser tube is flushed with 30mL pyridine, and the final products are taken into a beaker of 250mL and titrated with NaOH standard solution of 0.5mol/L. The final titration point is determined by PH indicator. Using the same method to do a blank test. The calculation formula of hydroxyl value X1 is:

1184 |Shuang Chen, Ying-Lu Gu, Qiang Zhong and Zhi-Liang Zhang ܺଵ ൌ ሺܸଵ െ ܸଶ ሻ ൈ ܿ ൈ

ହ଺Ǥଵ ௠

൅ ܺଶǤ

(3)

X1-hydroxyl value of sample,mg/g;V1-the amount of NaOH standard solution in the blank titration,mL;V2-the amount of NaOH standard solution in the sample titration,mL;c-concentration of NaOH standard solution,mol/L;m-quality of sample,mg;56.1-Molar mass of NaOH,g/mol;X2-acid value of sample,mg/g. Reference of the Method in reference documentation [3] to determine the acid value. 1g liquid solution was dissolved in 100mL two oxygen six ring water solution, and titrated with 1mol/LNaOH standard solution, using pH meter to indicate the final point of titration. Utilize the same method to do a blank test. The calculation formula of acid value X2 is: ܺଶ ൌ ሺܸଵᇱ െ ܸଶᇱ ሻ ൈ … ൈ

ହ଺Ǥଵ ୫

Ǥ

(4)

X2-acid value of sample, mg/g;V1’-he amount of NaOH standard solution in the blank titration,mL;V2’-the amount of NaOH standard solution in the sample titration, mL; c-concentration of NaOH standard solution,mol/L; m-quality of sample, mg.

1.5 Analysis of the Molecular Weight Distribution of Liquefied Oil Liquefied liquid is diluted by tetrahydrofuran (THF) until the concentration (mass fraction) is 0.3%, the injection volume is 25μL, and flow rate of mobile phase THF is 1mL/min. The GPC we used is the Wyatt DAWN HELEOSII modular GPC of America.

2 Results and Discussions 2.1 Effect of Different Ethylene Glycol Content on Liquefaction Rate When liquefaction temperature is 150°C, liquid to solid mass ratio is 7:1, the amount of catalyst is 6%, liquefaction time is 120min, and the effect of different ethylene glycol content on the liquefaction of rice husk powder is shown in Figure 1 (a). In Figure 1 (a), when the rice husk powder is liquefied by polyethylene glycol (PEG 400) alone, the liquefaction rate is 61.25%. The molecular volume of ethylene glycol is small, so it is easy to overcome steric hindrance and happened the alcoholysis reaction with fiber bundle. As a result, the liquefaction rate increases with the increase of ethylene glycol content. So the content of ethylene glycol is 30% of the mass of the liquefaction agent polyethylene glycol (PEG400).

Liquefaction Technology of Rice Husk in Polyhydric Alcohols | 1185

2.2 Effect of Different Catalyst Content on Liquefaction Rate When liquefaction temperature is 150°C, liquid to solid mass ratio is 7:1, the amount of ethylene glycol is 6%, liquefaction time is 120min, concentrated sulfuric acid as catalyst, the effect of different catalyst content is shown in Figure 1 (b). In Figure 1 (b), when the reaction system is not consists of concentrated sulfuric acid, rice husk powder cannot be liquefied. The liquefaction rate increases rapidly with the increase of the concentration of sulfuric acid. When the concentration of sulfuric acid reaches 6%, the liquefaction rate reaches the maximum value, which is 80%. Continue to increase the amount of concentrated sulfuric acid, the excessive concentrated sulfuric acid makes the oxidation reactions and condensation polymerizations of liquefying reagents and degradation products intense than the alcoholysis reactions of fibers, results in the decrease of liquefaction yield. Therefore, when the amount of concentrated sulfuric acid is 6% of the total mass of the solid and liquid is more suitable.

2.3 Effect of Different Liquid to Solid Mass Ratio on Liquefaction Rate Liquid to solid mass ratio refers to the mass ratio of liquefying reagents and solid rice husk powders. When liquefaction temperature is 150°C, the amount of catalyst is 6%, liquefaction time is 120min, the amount of ethylene glycol is 30%, and the effect of different liquid to solid mass ratio on the liquefaction of rice husk powder is shown in Figure 1 (c). In Figure 1 (c), when the liquid to solid ratio is 3, the liquefaction rate is lower, which is 38.74%. With the increase of the liquid to solid ratio, the mixture is formed in the reaction system, which is more uniform in the suspension, and the solvent has a more and more intense effect on the osmotic dissolution and decomposition of rice husk powder. Re-condensation of the liquefied intermediate product is limited, and the liquefaction yield increases gradually. When the liquid to solid ratio is 7, the liquefaction rate reaches the maximum. Therefore, the selection of liquid solid ratio of 7 is more appropriate.

2.4 Effect of Different Reaction Temperature on Liquefaction Rate When the amount of catalyst is 6%, liquid to solid mass ratio is 7:1, the amount of ethylene glycol is 30%, liquefaction time is 120min, and the effect of different reaction temperature on the liquefaction of rice husk powder is shown in Figure 1 (d). In Figure 1 (d), the effect of temperature on the liquefaction of rice husk powder is great. When the temperature is from 110°C to 130°C, the liquefaction rate is in-

1186 |Shuang Chen, Ying-Lu Gu, Qiang Zhong and Zhi-Liang Zhang creased by only 13%. When the temperature is from 130°C to 150°C, the liquefaction rate is increased by 32%. Continue to increase the reaction temperature, due to the high temperature reaction system in the condensation reaction, the liquefaction rate begins to reduce. Therefore, the most suitable reaction temperature is150°C.

2.5 Effect of Different Reaction Time on Liquefaction Rate When the reaction temperature is 150°C, the amount of catalyst is 6%, liquid to solid mass ratio is 7:1, the amount of ethylene glycol is 30%, and the effect of different reaction time on the liquefaction of rice husk powder is shown in Figure 1 (e). In Figure 1 (e), it can be known that the liquefaction rate of rice husk powder in the former 30min is the fastest, reaching 62.88%. With the increasing of reaction time, the liquefaction rate is increasing, however the rate of liquefaction increases gradually. When the reaction time reaches 120min, the liquefaction rate reaches the maximum. Continue to increase the reaction time, liquefaction rate begins to decrease. This may be because of the reaction time is prolonged; the concentration of small and medium molecules in the reaction system is improved continuously. In the presence of sulfuric acid as catalyst, the condensation reaction between the liquid agent and the small molecule and the small molecule is reduced, which leads to the reduction of the liquefaction rate [4].Therefore, the most suitable reaction time is12min.

Liquefaction Technology of Rice Husk in Polyhydric Alcohols | 1187 (a)

(b)

90

OLTXHIDFWLRQUDWH

80 70 60 50 40 30 20 10 0

0

2

4

6

8

10

WKHDPRXQWRIFDWDO\VW

(c)

OLTXHIDFWLRQUDWH/%

80 70 60 50 40 30

2

3

4

5

6

7

8

9

10

11

12

OLTXLGWRVROLGPDVVUDWLR

(d)

(e)

90

80

OLTXHIDFWLRQUDWH/%

liquefaction rate/%

80 70 60 50 40 30

130

140

150

160

170

180 R

reaction tempeture/ C

190

70

60

 50

40 20

40

60

80

100

120

140

160

UHDFWLRQWLPH /min

Fig. 1: SEM images of (1) rice husk and residues at different liquefaction times of (2) 10min, (3) 0.5h, (4) 1h, (5) 1.5h and (6) 2h.

1188 |Shuang Chen, Ying-Lu Gu, Qiang Zhong and Zhi-Liang Zhang

2.6 SEM Analysis of Rice Husk Powder and Liquefaction Residues Electron microscope scanning analysis of the liquefaction residues of rice husk under different reaction time is shown in Figure 2. From Figure 2, we can see that the surface structure of the rice husk powder changes greatly, and the shape of the rice husk powder distorts greatly. A large number of holes exist in the liquefaction residues. With the extension of reaction time, the surface corrosion and degradation degree of rice hull powder has been continuously deepened, and the fiber surface has become loose. It is possible to play a leading role in the corrosion of concentrated sulfuric acid in the reaction, so that the smooth surface of the rice husk powder is corroded with cracks. The cracks appear to strengthen the penetration and dissolution of the solvent in the interior of the rice hull powder, and the heat is brought into the interior of the rice husk powder so as to contribute to the fracture of the molecular bond.

Fig. 2: SEM images of (1) rice husk and residues at different liquefaction times of (2) 10min, (3) 0.5h, (4) 1h, (5) 1.5h and (6) 2h.

2.7 Analysis of the Acid Value and Hydroxyl Value of Liquefied Oil When the reaction temperature is 150°C, liquid to solid mass ratio is 7:1, the amount of catalyst is 6%, the amount of ethylene glycol is 30%, the acid vale and hydroxyl value of liquefied oil under different reaction times is shown in Figure 3. The liquefaction of rice husk powder mainly includes the alcohol degradation reaction of big molecule, the oxidation reaction of the solvent and the small molecule, the condensation reaction of the small liquefied molecule and the solvent.

Liquefaction Technology of Rice Husk in Polyhydric Alcohols | 1189

260

22

240

20

220

18

200

16

180

14

160

12

140

DFLGYDOXHPJJ

K\GUR[\OYDOXH/mg.g-1

Figure 7 shows that with the reaction, the hydroxyl value of liquefaction products showed a gradually decreasing trend. It might because the main occurrence of the first half hour is the oxidation reaction of the solvent and the re-polymerization reaction between the solvents; from 0.5h to 2h, the degree of alcoholysis reaction of rice hull powder increase. With the polymerization reaction, oxidation reaction and esterification reaction between small molecules, the hydroxyl value of the liquefaction system is gradually reduced; after 2h, all kinds of reactions tend to be balanced, so the hydroxyl value in the liquefaction system remains stable. From Figure 3 we can see, with the reaction, the acid value of liquefaction system increases gradually and then decreases. It might due to the alcohol in the system is constantly being oxidized to acid, which corresponds to the change of hydroxyl value. The organic acids are produced in the alcoholysis liquefaction process of rice husk powder, resulting in the increase of acidity. With the increase of acidity in the reaction system and the reaction of alcohols in addition to acids to produce esters increased, resulting in the decrease of acidity.

10 30

60

90

120

150

UHDFWLRQWLPH/min

Fig. 3: Hydroxyl and acid values of liquefied product under different reaction times

2.8 Analysis of the Molecular Weight of Liquefied Oil When the reaction temperature is 150°C, liquid to solid mass ratio is 7:1, the amount of catalyst is 6%, the amount of ethylene glycol is 30%, and the molecular weight of liquefied oil under different reaction times is shown in Table 2. From the Table 2, it can be known that the rice husk powder is degraded into large molecules in the presence of concentrated sulfuric acid and the liquefaction agent. With the increasing of reaction time, large molecules are degraded into small molecules. The degradation rate is the fast firstly and then tends to be gentle, and Mw, Mn and D of liquefied liquid decreases gradually; In the later period of the liquefaction reaction, the condensation reactions between liquefaction products and between the liquefaction

1190 |Shuang Chen, Ying-Lu Gu, Qiang Zhong and Zhi-Liang Zhang products and the liquefaction agents are increased, which led to the increase of Mw and Mn, but the multi dispersion coefficient d changes little. Table 2: Relative molecular mass distribution of liquefied product under different reaction times Reaction time

Mn

Mw

d

0.5h

5394

32880

6.096

1h

3382

11330

3.352

2h

2963

8603

2.903

3h

3593

9698

2.699

3 Conclusions (1)With polyethylene glycol 400-ethylene glycol as liquid agent, through the investigation of 5 kinds of single factors, the optimum reaction conditions were concluded: sulfonic acid was 6%, liquid to solid mass ratio was 7:1, the amount of ethylene glycol was 30%, and liquefaction yield was 83% at 150°C after 120min. (2)Scanning electron microscope analysis showed clearly that the rice hull fiber was constantly being corroded, degraded and cracked. (3)With the extension of reaction time, hydroxyl value of liquefied product decreased gradually from 154 to 50 mg/g, its acid value firstly increased and then decreased from 11 to 18mg/g, and its molecular weight was 8603 to 32880. Notes: The paper is funded by a Project of Shandong Province Higher Educational Science and Technology Program (J12LD52).

References [1] [2] [3]

[4]

Yan-an SONG, Shao-zhuang CHEN, Li-hua HOU, Yue-zhen BIN. Study on the biodegradable composites of plant fiber reinforced poly lactic acid [J]. Polymer Bulletin, 2011, 09:111-120. Ting-ting LU, Gui-gan FANG, Kui-zhong SHEN, Yong-jun DENG, Fang-min LIANG. Study on the process of bamboo waste liquefaction [J]. New chemical materials, 2014, 10:97-101. Hai-rong ZHANG, Hong-guo JI, Jin-zhi SHI, Tie-zhu FU, Hao PANG, Bing LIAO. Eucalyptus wood powder organic sulfonic acid catalytic Thermochemical Liquefaction of [J]. Chemistry and industry of forest products, 2010, 06:35-39. Yao Y, Yoshioka M, Shiraishi N. Combined liquefaction of wood and starch in a polyethylene glycol/glycerin blended solvent [J]. Journal of the Japan Wood Research Society (Japan), 1993, 39(8): 930-938.

Zhou Fang1*, De-Yu Liu2, Guang-Hai Li3 and Zhe Wang4

Study on Engineering Example of Risk Based Inspection and Verification of Acoustic Emission Inspection for Storage Tank Group Abstract: The Risk Based Inspection for the large atmospheric storage tank group of a petrochemical plant in our country was done using the DNV risk assessment software AST RBI. The corresponding detection strategies were formulated according to the risk level of atmospheric tanks. The result of atmospheric storage tank’s Risk Based Inspection is verified by the Acoustic Emission Inspection method. The result shows that the risk evaluation technology on atmospheric storage tank is accurate and reliable. Keywords: Large atmospheric storage tank group, Risk Based Inspection, Risk level, Acoustic Emission inspection, Reliable

1 Introduction With the development of oil industry and the implementation of the strategic crude oil reserve project in China, in petrochemical industry the large-size crude oil storage tank has been an inevitable trend [1-3]. The safety problem gets more and more attention as the volume of the crude oil storage tank increasing. In the petrochemical companies, the periodic maintenance was adopted in the past to prevent tank accidents [4~7]. At present, nondestructive testing is carried out on the tank, and then evaluates the safety grade of tank with the related special equipment standard specification. The risk of storage tank was reduced effectively. The harm level of tank was controlled in the acceptable range. Risk assessment of the storage tank group is analyzed with instances and verified by acoustic emission inspection [8~10].

|| 1 China Special Equipment Inspection and Research Institute (CSEI), Beijing, P. R. China. Email: [email protected] 2 China Special Equipment Inspection and Research Institute (CSEI), Beijing, P. R. China. Email: 13911311796@ csei.org.cn 3 China Special Equipment Inspection and Research Institute (CSEI), Beijing, P. R. China. Email: [email protected] 4 Beijing Institute of Architectural Design (BIAD), Beijing, P.R. China. Email: wangzhe.com @163.com 10.1515/9783110516623-117 DOI 10.1515/9783110303568-117

1192 | Zhou Fang, De-Yu Liu, Guang-Hai Li and Zhe Wang

2 Risk Based Inspection The technique of RBI (Risk Based Inspection) is used for analyzing the data and calculating the risk level of atmospheric storage tank. According to the definition in API 580 [11] and API 581 [12], risk can be expressed as follow. Risk θ Failure probability × Failure consequences The object of the risk assessment was a large atmospheric storage tank group of a petrochemical plant in our country. This atmospheric storage tank group has not been carried out a large-scale maintenance, so the situation of serious corrosion may be existing [13, 14]. The 10 large atmospheric storage tanks were selected for risk assessment. The oil mediums were 4 sets of crude oil, 2 sets of diesel, 2 sets of naphtha and 2 sets of gasoline. The volumes of tanks were over 10000 m3; the largest volume was 50000 m3. The putting-in-service time was 1973 to 1984. The structures of tanks were all external floating roof. The details are shown in table 1. Table 1: Basic data about the storage tank Number Oils

Volume (m3)

Date of Puttingin-service

Structures

Materials of tank shell

Materials of tank floor

TK-111

Crude oil

50000

1979

External floating roof

16MnR

A3F

TK-112

Crude oil

50000

1979

External floating roof

16MnR

A3F

TK-117

Diesel

20000

1978

External floating roof

A3F

A3F

TK130A

Crude oil

10000

1973

External floating roof

A3F

A3F

TK130B

Crude oil

10000

1973

External floating roof

A3F

A3F

TK-131

Naphtha 10000

1982

External floating roof

A3

A3

TK-143

Naphtha 10000

1982

External floating roof

A3

A3

TK-150

Diesel

20000

1984

External floating roof

A3

A3

TK-151

Gasoline 20000

1984

External floating roof

A3

A3

TK-152

Gasoline 10000

1980

External floating roof

A3

A3

Study on Engineering Example Inspection for Storage Tank Group | 1193

The risk level and the distribution of atmospheric storage tank were concluded by the software AST RBI (Atmospheric Storage Tank RBI), as shown in Fig 1, Fig 2 and table 2. The results of risk assessment with tank shell are shown in Fig 1. The risk level of 2 sets is medium risk level; the risk level of 8 sets is low risk level. The results of risk assessment with tank floor are shown in Fig 2. The risk level of 2 sets is high risk level, the risk level of 4 sets is medium-high risk level, and the risk level of 4 sets is medium risk level. From the risk level of all, the ratios of high risk level, medium-high risk level, medium risk level and low risk level are 10%, 20%, 30% and 40%. The ten atmospheric storage tanks have not been carried out a large-scale maintenance, so the risk level is high. And the petrochemical factory is located in the coastal; the serious corrosion situation of storage tank is influenced by marine climate.

Fig. 1: Risk matrix distribution of tank shell

Fig. 2: Risk matrix distribution of tank floor

1194 | Zhou Fang, De-Yu Liu, Guang-Hai Li and Zhe Wang Table 2: Results of the 10 storage tanks’ risk assessment Tank number

failure of tank shell

failure of tank floor

Failure probability level

Failure consequences level

Risk level

Failure probability level

Failure consequences level

Risk level

TK-111

4

B

medium

3

D

medium-high

TK-112

4

B

medium

3

D

medium-high

TK-117

1

A

low

3

D

medium-high

TK-130A

1

B

low

3

E

high

TK-130B

1

A

low

3

E

high

TK-131

3

A

low

2

D

medium

TK-143

2

B

low

2

D

medium

TK-150

3

B

low

2

D

medium

TK-151

2

A

low

2

D

medium

TK-152

1

B

low

3

D

medium-high

3 Acoustic Emission Testing Verification 3.1 Principle of Acoustic Emission Acoustic emission is the elastic wave formed quickly when the object detection releasing energy. On-line acoustic emission detection of atmospheric tank means to capture acoustic signals of deformation or fracture and determine the strength and location. The defects of tank bottom plate are evaluated by transformation analysis. [15]. Acoustic emission detection of atmospheric tank is based on the atmospheric storage tank’s volume. 8 to 20 probes are arranged on the wall to capture the acoustic signal of tank steel. The acoustical signal is transformed and analyzed by special software to infer the dynamic information of acoustic emission source and judge the corrosion of tank bottom plate. The principle and flow chart of storage tank acoustic emission are shown as Fig 3.

Study on Engineering Example Inspection for Storage Tank Group | 1195

Fig. 3: Principle and flow chart of storage tank acoustic emission

The verification instrument is the acoustic emission detector of SAEU2S - 1016 type which is shown in figure 4. The testing instrument has the advantages of digital interface, easy to understand, fast speed, strong anti-interference and reliable. The model of convert probe is SRI40. The detection range is 20 KHz~100KHz. the coupling agent of detection is used vacuum resin.

Fig. 4: Acoustic emission detector

According to the results of risk assessment, two atmospheric tanks were verified by acoustic emission detection. The one is TK143 having medium risk level in tank floor, another is TK130A having high risk level in tank floor, the two tanks were inspected by online acoustic emission detection. The results are shown as follows.

1196 | Zhou Fang, De-Yu Liu, Guang-Hai Li and Zhe Wang

3.2 Acoustic Emission Detection Results (1) The acoustic emission detection results of TK143 are shown as Fig.5. (a)Two-dimension orientation of floor

(b)Three-dimension orientation of floor

Study on Engineering Example Inspection for Storage Tank Group | 1197 (c) The relationship of time and energy

(d) The relationship of time and range

Fig. 5: AE source and other parameters of TK130A

The number of total orientation events is 1837 per hour of TK130A. Every minute happened 30.6 orientation events. In the area of 1.0 x 1.0 m2 concentrate 17 areas. The most concentrated area has 183 orientation events, shown as Fig.6. The corrosion of TK143’s tank floor is serious. The signal parameters of TK130A acoustic emission detection are shown as follow. (1) The acoustic signal amplitude of tank bottom plate is high, and the time is long. (2) The status of the overall performance is high energy. From the parameters of the test results, the energy and amplitude of acoustical signal are both at high level.

3.3 Analysis Result The average number of events and the average energy every minute are gathered statistical analysis with TK143 and TK130A. The location and intensity of the acoustic emission source were inferred by the activity of each event. The corrosion and defect of the two atmospheric tank floors were determined. The conclusions of the acoustic emission are combined with China's relevant acoustic emission detection standards JB/T10764-2007 and GB/T18182-2000.

1198 | Zhou Fang, De-Yu Liu, Guang-Hai Li and Zhe Wang The corrosion level of TK143 tank floor is judged level II, the position of floor has slight corrosion, and the condition of rest parts is good. The tank will not be opened to detect before 2017, but the latest time it should be detected by nondestructive testing in 2020. The corrosion level of TK130A tank floor is judged level III, the overall situations of corrosion in bottom plate are serious. The tank should be opened to detect immediately to rule out the risk of leakage.

4 Conclusion Through the test results of acoustic emission and the results of risk assessment with TK143 and TK130A, the results of risk assessment were coincided with the results of nondestructive testing. The results show that the Risk Based Inspection is a reliable assessment technology and the AST RBI assessment software is practicability. Acknowledgement: This work was supported in part by the financial from the Science and technology projects of General administration of quality supervision, inspection and quarantine of P. R. China (AQSIQ), (Project No.2013QK018), Science and technology projects of General administration of quality supervision, inspection and quarantine of P. R. China (AQSIQ), (Project No.2014QK244), Quality inspection of public welfare scientific research Foundation of China (Project No.201310156), PhDs Foundation (Project No.BSJJ-2013-08), and National key scientific instrument and equipment development project (Project No.2012YQ090175).

References [1]

[2]

[3] [4] [5] [6] [7]

FANG Z, WEIWEI H, DEYU L. Study on Metallography Test of the Steel SPV490 for Atmospheric Storage Tank after Fire[C]. Proceedings of the ASME 2016 Pressure Vessels & Piping Conference. 2016. FANG Z, CHEN Z. P, JIA G D. Dynamic Experimental Investigation on the Self-Vibration Characteristics of Liquid Storage Tanks under Seismic Excitations[C]. 2013 ASME Pressure Vessels and Piping Division Conference, July 14-18, Paris, France. ASME Pressure Vessels Piping, 2013. FANG Z, CHEN Z P, YAN S J, et al. Ф 2800 mm nonmetal storage tank is a large earthquake simulation test of anchorage in Chinese. [J]. Pressure Vessels. 2012, 29(6) :1-8. GUO B. Study on Large atmospheric tank group of risk assessment technology in Chinese. [D]. Hebei university, 2010. WANG Y Q, YANG J F, LIU W B, et al. Large atmospheric tank the RBI technology application is analyzed in Chinese. [J]. Chemical Engineer, 2015, 29(05):42-45 GUO B, SHEN G T, ZHANG W L, et al. Risk-based inspection application in large-scale atmospheric tank group in Chinese. [J]. Pressure Vessels. 2010, 27(04):55-60 WANG G, LI G H, JIA G D. The integrity of atmospheric tank group evaluation technology in Chinese. [J]. Pressure Vessels. 2009, 26(07):29-32

Study on Engineering Example Inspection for Storage Tank Group | 1199 [8] [9] [10]

[11] [12] [13] [14] [15]

CHEN X D, WANG B, YANG T C. Discuss the Risk-Based Inspection (RBI) in the practice of petrochemical enterprises and some issues in China. [J]. Pressure Vessels. 2004, 21(8):39-45. XIA L. Study on Pressure vessel and pipeline RBI technology interpretation and improving methods in Chinese. [D]. Zhejiang University of Technology, 2008. SUN H T, ZHANG X B. Improve the database management system in pipeline integrity management to obtain benefits in Chinese. [J]. Journal of foreign oil field engineering. 2008, 24 (2): 52-54. American Petroleum Institute. API RP580 Risk based inspection[S].2009. American Petroleum Institute. API 581 Risk based inspection[S].2008. LI L B, BI S Y, SUN Y Z, Based on the fault statistics data of engine risk prediction [J]. Journal of Nanjing University of Aeronautics and Astronautics. 2015(4). LI X, SHI J F, LI J, Mechanical Behavior of Plastic Pipe Reinforced by Cross-Winding Steel Wire Subject to Foundation Settlement et al. [J]. Transactions of NUAA. 2015(3), 348-354. YAN H. Study on Metal atmospheric tank bottom acoustic emission source characteristics in Chinese. [D]. Beijing: Beijing University of Technology, 2006:44-49.

Si Hyeong Sung1, Uk Jae Lee2, Jae Sung Min3 and Hee Reyoung Kim4

Experimental Setup for Boron Meter Accuracy Analysis in Nuclear Reactor Environment

Abstract: This study introduces an experimental setup for test of boron meter with improved accuracy. A boron meter is used to measure the concentration of boric acid but its improvement has been required due to the low accuracy. Multi-detector boron meter by combination of low and high sensitivity detectors was designed to improve accuracy. Monte-Carlos simulation showed the theoretical enhancement of accuracy by using multi-detector. For enhancement of nuclear safety, an experimental setup based on the simulation was established to analyze the accuracy of new concept boron meter in the real reactor environment. Keywords: component: Accuracy Improvement, Boron meter, Boron concentration, Multi-detector, experiment set up

1 Introduction In PWR (Pressurized-water reactor) operate in Korea, boric acid water is added to the coolant of the nuclear reactor to control the reactivity according to the burnup of nuclear fuel [1]. Therefore, the monitoring facilities which accurately measure the concentration of boric acid of the coolant of the nuclear reactor in real-time plays a very important role in safety of the nuclear power plants[2]. Two methods, boron meter and periodic chemical sampling, are used to measure the concentration of boric acid. Chemical sampling method has better accuracy (~0.2%) than boron meter. But the chemical sampling method generates radioactive waste and the sampling is implemented only once a day [3] [4]. On the other hand, boron meter with low accuracy (~2%) has advantage of real-time monitoring without sampling. Therefore, the enhancement of the accuracy of the boron meter can improve the operational stability of the nuclear power plants significantly [5]. Simulation result with

|| 1 School of Nuclear Engineering, Ulsan National Institute of Science and Technology Ulsan, Republic of Korea. Email: [email protected] 2 School of Nuclear Engineering, Ulsan National Institute of Science and Technology Ulsan, Republic of Korea. Email: [email protected] 3 School of Nuclear Engineering, Ulsan National Institute of Science and Technology Ulsan, Republic of Korea. Email: [email protected] 4 School of Nuclear Engineering, Ulsan National Institute of Science and Technology Ulsan, Republic of Korea. Email: [email protected] 10.1515/9783110516623-118 DOI 10.1515/9783110303568-118

1202 | Si Hyeong Sung, Uk Jae Lee, Jae Sung Min and Hee Reyoung Kim multi-detector improved accuracy compared to the general boron meter with one detection sensitivity [6]. But MCNP has limitation that it is impossible to set accurate detector’s sensitivity [7]. This study is focused on a preparation of experimental set up for verifying the enhancement of accuracy of multi detector boron meter with different sensitivities.

2 Simulation of MULTI-Detector Boron Meter The detectors with high sensitivity can effectively detect the low neutron flux where the boron concentration of the coolant is high. However, the life of BF3 detector, whose general life expectancy is 1012 counts, is rapidly reduced in the environment of the continuous neutron exposure because a high sensitivity detector generates larger counts than a low one for the same number of neutron. In addition, the number of counting pulses can be overlapped or saturated. On the contrary, the detectors with low sensitivity have difficulty in detecting low neutron fluxes. Therefore, the combination of the detector with high sensitivity and low sensitivity was proposed. As shown in Fig. 1, Am-Be neutron source are placed in the center of the cylindrical container made of stainless steel 304, and four detectors surrounding the source are equidistant from the center. As a result, the boron meter consists of combination of 4 pieces of low-sensitivity detectors (4 cps/nv) and 2 pieces of highsensitivity detectors (11 cps/nv). In the simulation setup, neutron source emits 2.4×106 neutrons per second. The count number is same as the number of (n, α) reaction. The reaction rate is calculated by using MCNP6 fm4 tally function. Equation (1) called Boronline equation which yields the quantitative relationship between the boron concentration of coolant and count rate of boron meter in the light-water reactor [8]. Count rate = 1/ (a×Cb2+b×Cb+c) where Cb is boron concentration, and a, b and c are coefficients.

(1)

Experimental Setup for Boron Reactor Environment | 1203

Fig. 1: Schematic of multi-detector boronmeter

By using low-sensitivity detector in the range of 0~1000ppm, combination-type detector in the range of 1000~2000ppm, and high-sensitivity detector in the range of 2000~5000ppm. Fig. 2 showed the count rate on the change of boron concentration of the combination-type detector. The average error was 3.30ppm(0.66%), 1.15ppm(0.076%) and 0.91ppm(0.026%) in the range of 0~1000ppm, 1000~2000ppm and 2000~5000ppm, respectively. The simulation showed the improvement of accuracy compared with the commercialized boron meter of which average error was 20 ppm(4%), 120 ppm(4.8%) in the range of 0~1000ppm and 0~5000ppm.

1204 | Si Hyeong Sung, Uk Jae Lee, Jae Sung Min and Hee Reyoung Kim

Fig. 2: Count rate of multi-detector in regions of three different boron concentration.

3 Experimental Design for the Combination-Type Detector In case of MCNP simulation, the sensitivity of the detector was decided calculating the gas density from the internal gas pressure because it could not be set directly by MCNP, where it should be verified by experiment. The experiment was designed by considering three factors, size and sensitivity of detector, distance between the source and detector affecting counting rate. A commercially available BF3 detector with the similar specifications was selected considering the size and sensitivity based on simulation as represented in Table 1. The boron water vessel was designed and manufactured in accordance with the selected detector, where the stainless steel 304 was used as the material based on the simulation. The distance from the center of the source to the detector was 81mm. The height of the hole for inserting the source was determined in order that the source could be located in the center of the boron meter container exactly. The hole for inserting the detector was manufactured to be long enough to insert the whole detector. The boron water container was designed and completed as shown in Figure 3 and in Figure 4, respectively.

Experimental Setup for Boron Reactor Environment | 1205 Table 1: detectors geometry BF3 Detector

Total length(mm)

Radius (mm)

Pressure (atm)

Sensitivity (cps/nv)

Voltage (volts)

LND 202119

350.0

25.4

0.789

4.00

1525-1775

LND 20292

390.5

25.4

0.921

11.3

1750-2000

Fig. 3: The designed boron water vessel

Fig. 4: Boron vessel upper part (left), front (right)

Am-Be neuron sources with three different neutron emission of 103,105and 107 n/s were prepared, respectively. The experimental system for measurement of neutron flux was represented in Fig. 5. As seen in Table II, it was composed of ORTEC products suitable for the gas proportional counters. The components of system were selected for ideal detection environment by considering operate voltage of detector and neuron energy spectrum. Dual analyzer was selected to analyze the signal from two type detectors with different sensitivities.

1206 | Si Hyeong Sung, Uk Jae Lee, Jae Sung Min and Hee Reyoung Kim

Fig. 5: Experimental system for measuring neutron flux Table 2: Specification about component of system Component

Model

Performance

H.V Supply

ORTEC 556

· Use with proportional counter · 0±3 kVbias · 0 to 10mA

Preamplifier ORTEC PC142

· Ideal for proportional counter · High sensitive for low energy radiatoin · 0±3 kVbias

Amplifier

ORTEC 575a

· Ideal for proportional counter · High sensitive for low energy radiatoin · 0±3 kVbias

Timer/Scaler ORTEC 551a

· Dynamic range for neutron-gamma discrimination · Adjustable delay 0.1 to 11μs

Analyzer

Picture

ORTEC ASPec-927 · Dual Analyzer · 16,384 channel ADCs · Optimal dead time correction with ZDT

The count rate is measured after filling boron container with boron water with various concentrations. It is compared with theoretical prediction of boron concentration from (1). The accuracy of the boron meter with the combination-type detector is evaluated from the comparative analysis of experiment and simulation on the concentration of the boron water.

Experimental Setup for Boron Reactor Environment | 1207

4 Conclusion Experimental set up for the analysis of neutron counting rate and accuracy of boron meter with combination of high and low sensitivity detector was carried out. The accuracy improvement of the developed boron meter would be confirmed from the comparison with existing one. The experimental system was designated to evaluate the accuracy of the boron meter on the change of actual boron concentration. The optimal neutron monitoring system is thought to be established by comparison and analysis between the simulated and experimented result.

References [1] [2]

[3] [4]

[5] [6]

[7]

[8]

J.M Wong, Boron control in power plant reclamied water for portable reuse, Environ Prog 3 (1) (1984) 5-11 H.Kim, S.H. Lee, J.S. Park, H.Kim, Y.S. Chang, G.Heo, Reliability data update using condition monitoring and prognostics in probabilistic safety assessment, Nucl Eng Tech 47 (2) (2015) 204-211 G.A. Coulman, Chemical sampling as a data filter, Can J Chem Eng 45 (1964) 262-265 I.H. Rhee, H.Jung, D.Cho, Evaluation of pH control agents influencing on corrosion of carbon steel in secondary water chemistry condition of pressurized water reactor, Nucl Eng Tech 46 (2014) 431-438 M.Zubair, R.Ahmed, G.Heo, Quantitative and qualitative analysis of safety parameters in nuclear power plants, Int J Energy Res 38 (6) (2014) 755-764 C.Kong, H.EE, S.H. Kim, S.Lyou, D.Lee,, Optimization of boron meter model. International Congress on Advances in Nuclear Power Plants (ICAPP2016) 2016; San Francisco, CA, USA, April 17-20, 2016. C.Kong, H.EE, S.H. Kim, S.Lyou, D.Lee, sensitivty evaluation of boron meter model. Transacations of Korean Nuclear Society Autumn Metting 2015; Gyeongju, Republic of Korea. October 29-30, 2015Y. Yorozu, M. Hirano, K. Oka, and Y. Tagawa, “Electron spectroscopy studies on magneto-optical media and plastic substrate interface,” IEEE Transl. J. Magn. Japan, vol. 2, pp. 740–741, August 1987 [Digests 9th Annual Conf. Magnetics Japan, p. 301, 1982]. C.Kong, H.Lee, T.Tak, S.H.Kim, S.Lyou, D.Lee, “Accuracy Improvement of Boron Meter Adopting New Fitting Function and Multi-detector”, Nuclear Engineering and Technology 48 (6) (2016) 1360

Wu-Chao Qi1 and Su-Mei Tian2

Effects of Material Dispersion on Heat Transfer Analysis of Integrated Thermal Protection Systems Abstract: This paper presents a method to obtain the upper and lower bounds of the temperatures in a heat transfer analysis of an integrated thermal protection system. When one can only get little sample information of uncertainties, it is reasonable to use interval variables to describe the materials’ dispersions in the thermodynamic properties. The interval analysis method based on Taylor expansion can be used to observe the propagation process of uncertainties in heat transfer analysis. The results show that the material dispersions have an important influence on the heat transfer analysis results. The safety of the integrated thermal protection system will be improved when considering uncertainties in a design process. Keywords: material dispersion; uncertainty; interval analysis method; integrated thermal protection system

1 Introduction Owing to the reentry process of hypersonic vehicle being in a severe Aerodynamic heating environment, strict requirements are required for the structural design of the Thermal Protection System (TPS). A TPS needs protect the internal structure from high temperature with a certain ability to transfer / bear aerodynamic loads. Up to now, there are several forms of TPS with the development of thermal protection technology for hypersonic vehicle, including the tiles[1], insulations[2], metallic[3] and various types of ablation and active cooling thermal protection systems[45]. In recent years, the concept of Integrated Thermal Protection System (ITPS) [6-8] provides new ideas for the direction of lightweight and integration of thermal protection system. In this respect, an ITPS based on the corrugated-core sandwich panel has advantages of simple structure types, strong design abilities, large area coverage and so on. It is considered as a kind of thermal protection form with great potential for development.

|| 1 Faculty of Aerospace Engineering, Shenyang Aerospace University, Shenyang, China. Email: [email protected] 2 Faculty of Aerospace Engineering, Shenyang Aerospace University, Shenyang, China. Email: [email protected] 10.1515/9783110516623-119 DOI 10.1515/9783110303568-119

1210 | Wu-Chao Qi and Su-Mei Tian An ITPS based on the corrugated core structure requires a variety of materials. In the service process, the upper panel is in a high temperature state. So it needs to be used with high fracture toughness materials, such as high temperature alloy material, C/C, SiC/SiC and so on. However, the lower panel services under a lower temperature which not exceeds 150°C. High-strength Al alloy material or resin matrix composite materials can be used. The web is an important component to transmit aerodynamic force and bear lateral load, and it is also the path of thermal short circuit. Therefore, it needs high using temperature and high rigidity and strength in the selection of materials. At the same time, it has low material density and thermal conductivity. Ti alloy, high temperature alloys, zirconia and so on can be used. The thermodynamic properties of the materials used on an ITPS are changed with the change of temperature during the reentry of hypersonic vehicle. It is difficult or very expensive to get the changes of material properties during the whole reentry process in the ground experiments. So it is reasonable to consider the thermodynamic properties of materials in the reentry process as uncertain parameters. On the other hand, Owing to composite material being used in an ITPS with corrugated core structure, the dispersions of material properties can’t be ignored in the process of production, preparation and processing. The high security requirements of hypersonic vehicles require the engineers deal with the influence of the dispersions of the material properties reasonably on an ITPS. When it is difficult to obtain the probability distribution of the material dispersions, it is advantageous to describe an uncertain parameter as an interval variable if the range of the uncertain parameter can be given by a small amount of sample information plus expert opinions [9-10]. By analyzing the propagation of uncertainties in an ITPS, interval boundary values of the responses are obtained. Then a more secure design scheme can be given according to the "worst case design" idea. In this paper, based on the Taylor expansion interval analysis method, the upper and lower bounds of the temperature field in an ITPS are given based on the heat transfer analysis with considering the dispersion of the material properties.

2 Heat Transfer Analysis of an Integrated Thermal Protection System Considering an ITPS corrugated sandwich structures as shown in Fig. 1, the corresponding dimensions of each component are listed in Table 1. The used heat flux density curve [11] is shown in Fig. 2. The material of upper panel is Incorel718 which has good impact performance in a high temperature environment. The web’s material is Ti which can bear transverse loads at a high temperature gradient. The material of lower panel is Al to have a large heat sink. And the thermal insulation material is Saffil. All the material properties are list in Table 2[12].

Effects of Material Dispersion on Heat Transfer Protection Systems | 1211

Fig. 1: Corrugated sandwich structure

Fig. 2: The used heat flux curve Table 1: the sizes of a cell of an itps variables

tO

tI

tW

d

p

l

T

size

2

3

1.9

78.4

160

22

73.3

Table 2: The thermal properties of used materials Material

Inconel718

Ti

Al2024

Saffil

density (kg/m3)

8225

4429

2750

50

conductivity(W/(m*k))

11.5

7.6

150

0.09

specific heat(J/kg)

432.5

564.3

963

1300

1212 | Wu-Chao Qi and Su-Mei Tian The finite element model of the cell of an ITPS is built based on 8-node linear heat transfer brick element using ABAQUS 6.12.1 system which contains 15120 nodes and 12393 elements as shown in Fig. 3. To observe temperature changes, four different feature points named Node 1, Node 2, Node 3 and Node 4 in the left web from top to bottom are set for history output requests.

Fig. 3: Finite element model

Fig. 4: Temperature distribution at 600s

Effects of Material Dispersion on Heat Transfer Protection Systems | 1213

Fig. 5: Temperature distribution at 3000s

Fig. 6: Temperature variation for different feature points

Fig. 4 shows the temperature distribution of the cell at the time being 600s when the heat flux input reaches the maximum values. We can clearly observe the occurrence of thermal short-circuit phenomenon owing to the different thermal conductivities between Ti and Saffil materials. Fig. 5 shows the temperature distribution of the cell at the time point being 3000s when the upper surface of the ITPS has cooled but the temperature of lower surface reaches maximum values. The history output requests for different nodes are listed in Fig. 6. Fig. 6 shows that the outer nodes have the higher maximum temperatures. And the inner nodes appear the maximum temperatures after the outer nodes. The temperature of inner nodes is lowest at the end of reentry process (1000s) but being highest after sufficient cooling process (3000s).

1214 | Wu-Chao Qi and Su-Mei Tian

3 Interval Analysis Method Based on Taylor Expansion The purpose of the heat transfer analysis of an ITPS is to determine the time histories of the temperature field distributions under the heat flux loads as shown in Fig. 2. Based on the finite element analysis, a deterministic heat transfer analysis can be described as

H (t ) o ITPS(t ) o T (t )

(1)

where H (t ) , ITPS(t ) , NT (t ) are heat flux loads, finite element model of an ITPS and time histories of node temperatures, respectively, and t is the time. However, the material parameters used in the finite element model of the ITPS are dispersive and need to be described as uncertain parameters. We assemble the uncertain mateI   I rial parameters in an interval vector h  h [h , h ] (hi ) . Each component I   hi  hi [hi , hi ], i 1, 2,, m. where m is the dimension of the vector h . Then, Eq. (1)can be rewritten as

H (t ) o ITPS(h, t ) o T (h, t )

(2)

To fully describe the temperature field in an uncertain environment, it is necessary to give the solution sets of the nodal temperatures over the convex domain formed by the uncertainty. In general, such a solution set is very complex. In the sense of interval mathematics, the aim is to seek the lower and upper bounds of the temperaI ture field of the back panel which can be represented as T (h, t ) [T (t ), T (t )] . c A nominal value vector h and a deviation amplitude vector 'h can be defined respectively. Then, we have

hI

[hc  'h, hc  'h] hc  'hI

hc  'h[1,1]

(3)

Using the Taylor series expansion to the first order at the nominal value vector, we get

T (h, t ) | TL (h, t ) T (hc , t ) 

wT (hc , t ) h  hc wh

(4)

where hc satisfies the relationship

H (t ) o ITPS(hc , t ) o T (hc , t )

(5)

Effects of Material Dispersion on Heat Transfer Protection Systems | 1215

To estimate the interval bounds of the temperature filed at any time according to Eq.(4), we still need to find the sensitivity of the system response vector with respect to the interval vector h at the nominal vector hc . However, the sensitivity is unknown during the heat transfer analysis. In engineering, the difference of a function is usually used to replace the differential. Therefore, an alternative method of calculating the sensitivity of the interval vector in the nominal vector is obtained wT (hc , t ) wh by using the difference method, as follow

wT (hc , t ) T (hc  G h, t )  T (hc , t ) | wh Gh

(6)

where G h is a perturbation of the vector h . According to the natural interval extension theorem, the boundary values of the temperature fields can expressed as

TLI (hc , t ) T (hc , t ) 

wT (hc , t ) I h  hc wh

(7)

Then, the boundary values of the first order approximate response function of the Temperature fields can be obtained by the interval number theory, as m

T  ( h I , t ) T ( hc , t )  ¦ i 1

m

T  ( h I , t ) T ( hc , t )  ¦ i 1



Owing to hic  hi

h

 i

 hic

wT (hic , t ) c hi  hi , whi

wT (hic , t )  hi  hic , whi

(8)

(9)

'hi , the Eqs (8)-(9) can be rewritten as m

T  ( h I , t ) T ( hc , t )  ¦ i 1

wT (hic , t ) 'hi , whi

(10) m

T  ( h I , t ) T ( hc , t )  ¦ i 1

wT (hic , t ) 'hi , whi

(11)

The interval analysis method based on Taylor expansion needs to calculate the sensitivities of the temperature field at each uncertain parameter. The computation efforts of this method are related to the number of uncertain variables. To obtain derivative values, it is necessary to conduct the same numbers of deterministic heat

1216 | Wu-Chao Qi and Su-Mei Tian transfer analysis. Therefore, when the number of uncertain variables in the system is m, we in total need conduct deterministic heat conduction analysis process m  1 times.

4 Heat Transfer Analysis under Uncertain environment In the deterministic calculation of a heat transfer analysis of an ITPS, the material property parameters are taken the nominal values from Table 2. In this section, we consider the material property parameters are varied in a certain range. That is, the material property parameters in Table 2 will be regarded as interval variables. These interval variables are assembled in the vector h . According to the interval analysis method based on Taylor expansion proposed in the previous section, the upper and lower bounds of the temperature response curves at different nodes can be obtained. Let the interval variables varied in the range of hc u 5% for heat transfer analysis, we can get the upper and lower bounds of histories of the output nodes’ temperature curves, as shown in Fig. 7. It can be seen form Fig. 7 that the dispersions of thermodynamics parameters have significant influence on the temperature field distribution. The temperature-time histories of different nodes change within certain bounds. And this effect is more obvious for the internal nodes, especially for the nodes of the inner panel. In the same form, considering the interval variables varied in the range of c h u10% for heat transfer analysis, we can get the upper and lower bounds of histories of the output nodes’ temperature curves, as shown in Fig. 8. It can be seen form Fig. 8 that with the increasing of the dispersions of the materials, the radiuses of the temperature fields at each node are also increasing. When the variation of the material parameters reaches 10%, the temperature of inner panel exceeds the limit temperature (150°C). This may cause damages to the internal structures.

Effects of Material Dispersion on Heat Transfer Protection Systems | 1217

Fig. 7: Temperature bounds of different nodes (variation: 5%)

Fig. 8: Temperature bounds of different nodes (variation: 10%)

1218 | Wu-Chao Qi and Su-Mei Tian

5 Conclusion The paper calculates temperature distributions in a cell of an ITPS with corrugated sandwich structures under transient temperature heat flux load. The materials property parameters are regarded as interval variables owing to the lack of sample data. An interval analysis method based on Taylor expansion is proposed to observe the propagation of uncertainties in Heat Transfer Analysis. The results show that with the increasing of the dispersions of the materials, the radiuses of the temperature fields at each node are also increasing. The concerned temperature in the inner panel may exceed the limit temperature and a more secure structural design advice can be given. Acknowledgement: The work was supported by the National Nature Science Foundation of the P. R. China Program (11502149, 11372025), the Defense Industrial Technology Development Program (JCKY2013601B001) and the Education Department Series Projects of Liaoning Provincial (L2015406).

References [1]

[2]

[3]

[4]

[5]

[6] [7] [8] [9] [10] [11]

Rodriguez, Alvaro C., Snapp and Cooper G, “Orbiter Thermal Protection System Lessons Learned”. AIAA SPACE 2011 Conference & Exposition, Long Beach, California, USA, 27-29 September 2011. Aiichiro Tsukahara, Hiroyuki Yamao and Kazuyuki Miho, “Advanced Thermal Protection Systems for Reusable Launch Vehicles”. 10th International Space Planes and Hypersonic Systems and Technologies Conference, Kyoto, Japan, April 24-27, 2001. M. L. Blosser, R. R. Chen, I. H. Schmidt, J. T Dorsey, C. C. Poteet and R. K.Bird, “Advanced metallic thermal protection system development”, AIAA 40th Aerospace Sciences Meeting and Exhibit. AIAA 2002-504. Paolo Baioccoa, Sylvain Guedrona, Patrice Plotardb and Jacques Moulinb, “The Pre-X atmospheric re-entry experimental lifting body Program status and system synthesis”. Acta Astronautica, 2007, 61 (1-6): 459-474. T.Pichona, R.Barreteaua, P.Soyrisa, A.Foucaulta, J.M.Parenteaua, Y.Prelb and S.Guedronb, “CMC thermal protection system for future reusable launch vehicles: Generic shingle technological maturation and tests”. Acta Astronautica, 2010, (06): 165–176. R. Bharani, H. Raphael and S. Bhavani, “Uncertainty Analysis of Integrated Thermal Protection System with Rigid Insulation Bars”, AIAA 2011-1767. V. Diane, H. Raphael and S. Bhavani, “Accounting for Future Redesign in the Optimization of an Integrated Thermal Protection System”, AIAA 2012-1933. C. Diane, L.R. Rodolphe and T.H. Raphael, “Dynamic Design Space Partitioning for Optimization of an Integrated Thermal Protection System”, AIAA 2013-1534. X.J. Wang and L. Wang, “Uncertainty quantification and propagation analysis of structures based on measurement data”, Mathematical and Computer Modelling, 54 (2011) 2725-2735. W.C. Qi, and Z.P. Qiu, “A collocation interval analysis method for interval structural parameters and stochastic excitation”, Sci China-Phys Mech Astron, 55 (2012) 66-77. David, E., Carl, J. and Max, L. “Parametric Weight Comparison of Advanced Metallic Ceramic Tile and Ceramic Blanket Thermal Protection System”, 2000, NASA/TM-2000-210289.

Effects of Material Dispersion on Heat Transfer Protection Systems | 1219 [12]

Satish K. Bapanapalli, Oscar M. Martinez, Christian Gogu, Bhavani V. Sankar and Raphael T. Haftka, “Analysis and Design of Corrugated-Core Sandwich Panels for Thermal Protection Systems of Space Vehicles”, The 47th AIAA/ASME/ASCE/ AHS/ASC Structures, Structural Dynamics, and Materials Conference. AIAA 2006-1942.

Yong-Hua Xue1, Jing-Feng Bai1, Ning-Ning Hong1 and Hui-Ying Gao2

Dust Pollution Emission Characteristics and Dust Suppression Effect of Porous Windbreak and Large Strip Warehouse Based on Wind Tunnel Experiments

Abstract: Particulate matter is the main pollution issue in China bulk ports. The rapid growth of port throughput leads to the aggravation of dust pollution. Porous windbreak and large strip warehouse are the most common dust pollution control measures. Size distribution and emission factors of typical coal and ore in China’s coastal ports were investigated. The wind shelter effect and dust suppression of porous windbreak and large strip warehouse, which were obtained by wind tunnel experiments, are collected and analyzed rigorously. The estimated comprehensive emission reduction rate of windbreak and large strip warehouse are up to 63% and 71% separately. Keywords: dust emission, wind tunnel experiment, porous windbreak, large strip warehouse

1 Introduction Wind erosion is a major cause of particulate pollution in the yard of ports [1]. Recently, atmospheric dispersion of wind-blown dust particles from coal piles in the open storage yards has brought about severe air pollution and environmental problems due to fugitive dust emission. Therefore, it is of great importance to analyze the motion of wind-blown particles in order to develop effective means for controlling the particulate pollution. Studies have been carried out to investigate the mechanisms of wind-blown particles. Bagnold (1941) investigated the wind-induced sand movement in a Libyan desert [2]. Finney (1934) investigates snowdrift phenomena with wind tunnel experiments [3]. Zingg (1952) investigated the movement of sedimentary materials and particle saltation by means of a wind tunnel test [4]. Wind-induced movement of small particles has been classified into three transport processes: saltation, suspension and surface creep [1]. Saltation is the primary wind erosion mechanism, refer|| 1 Wind Engineering Technology Research Center, Tianjin Research Institute for Water Transport Engineering of Ministry of Transport, Tianjin, China, e-mail: [email protected] 2 China Classification Society Industrial Corp. Tianjin branch, Tianjin, China,[email protected] 10.1515/9783110516623-120 DOI 10.1515/9783110303568-120

1222 | Yong-Hua Xue, Jing-Feng Bai, Ning-Ning Hong and Hui-Ying Gao ring to a bouncing motion of particles. In general, particles with diameters ranging from about 100 to 1000 μm are involved in the saltation process. These particles lift off the surface and travel in curved trajectories under the influence of wind and gravity. The particles engaged in saltation are sufficiently massive that air turbulence has little influence on their motion. The ballistic trajectory of particles undergoing this kind of motion is 5-10 times longer than the maximum height. Most mass transportation occurring near the ground surface is due to saltation [5]. Coal pile has been the research focus of windblown particles regularity. Due to the large quantity of ore transportation, the pollution of ore dust has also been paid attention to. There is considerable throughout of coal and ore in most ports, which continued to grow rapidly. Porous windbreak and large strip warehouse are the most common dust pollution control measures in China. Since dozens of Porous windbreak and large strip warehouse have been built to reduce dust emission in China's coastal ports, a review on wind shelter and dust suppression effect of porous windbreak and large strip warehouse is very urgent. In recent years, our research group has studied and designed more than 30 windbreak and large strip warehouse projects by using wind tunnel experiments. The basic information such as yard scale, bulk cargo type, operation mode was obtained by field investigation. According to the field condition and wind tunnel, related pile and building models were made and set up in the test section of the wind tunnel. Then, the wind tunnel experiment is arranged and carried out. The data obtained from wind tunnel experiments was analyzed in order to compare the changes of the airflow field in the yard area before and after the construction of dust control project. The dust suppression effect of the project was estimated by employing the dust emission coefficient, which is previous research conclusion of our group. The paper investigated size distribution of typical coal and ore and collected data from 10 typical porous windbreak and large strip warehouse projects, which investigated and designed by our research group in recent years. The wind shelter effect and estimated the comprehensive emission reduction rate of emission control project are summarized and concluded.

2 Experimental Apparatus and Methods Experiments were performed in an opened blow-out boundary wind tunnel with a test section size of 4.4m (W) × 2.5m (H) × 15.0m (L). Wind tunnel fan speed is controlled in direct mode and the maximum wind speed is 30 m/s. Wind tunnel turbulence intensity is less than 1% and axial static pressure gradient (dp/dx) is less than 0.01m. Spires and roughness elements were installed along the span wise direction to create a neutrally buoyant atmospheric boundary layer.

Dust Pollution Emission Characteristics Based on Wind Tunnel Experiments | 1223

Geometry similarity is the basic condition of flow similarity. For the wind tunnel test, model scale is the ratio of corresponding length of several similar objects. According to the yard of the actual situation and the wind tunnel size, the model scale of experiment is 1:100. A schematic diagram of the wind tunnel test section is shown in Fig. 1 and size description of standard ore pile tested in experiments is shown in Fig. 2.

Fig. 1: Schematic diagram of pile settings in the test section of wind tunnel

Fig. 2: Schematic diagram of standard single pile size.

Long side of ore pile was set facing the wind stream in the wind tunnel test section in the single pile experiment. Piles were placed in the middle of test section of the wind tunnel. Emission reduction rate of windbreak and large strip warehouse projects was investigated in wind tunnel experiments with yard and wind break models by employing Irwin Probe, which settled in piles’ surfaces in order to identify the difference of friction wind speed before and after the project (wind break and/or large warehouse). Artificial boundary layer was simulated by spires and roughness elements. Expression of the power functions of wind velocity profile deduced by near the ground and neutral stratification and underlying surface conditions as follows:

1224 | Yong-Hua Xue, Jing-Feng Bai, Ning-Ning Hong and Hui-Ying Gao u/u1=(z/z1)m where u is the mean wind velocity (m/s), u1 is the wind velocity (m/s) of height z1 and m is a function of surface roughness and temperature stratification, which values depending on different regions and atmosphere stability. In addition to similarity of geometry and atmospheric boundary layer, Renault similarity is also an important prerequisite for the wind tunnel experiments. This study experimental wind velocity range of 4.5~12 m/s meets the Renault similarity requirements. Ore size distributions were measured by sonic vibration of semi-automatic screening particle size analyzer. ESJ200-4A and YP 200K-1 electronic balance were employed to weight measurement.

3 Results and Discussion Four typical coals and three typical ore were collected in China's southeast coastal ports. All of samples were flattened and natural dried for 20 days in laboratory. Data of size distribution were acquired by particle size analyzer referred above. Fig. 3 shows size distribution of typical coal and ore in China ports.

Dust Pollution Emission Characteristics Based on Wind Tunnel Experiments | 1225

Fig. 3: Size distribution of typical samples.

Smaller particle sizes will lead to greater dust. The particle size distribution characteristics of the four coal samples are quite similar, while the difference between ore samples is relatively significant. Due to the less density, coal dust emission is greater than ore under the same airflow conditions. Method for the determination of the startup wind velocity as follows: coal or ore powder with natural moisture was spread evenly on a sheet as much as possible to avoid surface wrinkles. Digital camera was mounted above the tested ore pile to monitor particle status. Start the wind tunnel, gradually increasing wind velocity and observe the movement of particles at the same time. The wind velocity was recorded when obvious particles movement was observed. Repeat this test process 5 times to acquire the mean startup velocity for each type. The results of startup velocity are list in Tab. 1.

1226 | Yong-Hua Xue, Jing-Feng Bai, Ning-Ning Hong and Hui-Ying Gao Table 1: Startup wind velocity for tested samples type

Startup wind velocity (m/s)

Coal A

3.5

Coal B

3.3

Coal C

3.6

Coal D

3.7

Ore A

4.0

Ore B

4.6

Ore C

4.9

Due to the different density and other physical properties, the startup wind velocity of ore dust is generally larger than coal. Each of coal and ore pile put in the wind tunnel for experiment was placed on a thin enough sheet, which weighted together with the pile both before and after test. Each test lasted 15 minutes. The test wind velocity (U) includes 4.5, 6, 8, 10 and 12 m/s. weight of blown off could be calculated by weight difference. Fig. 3 shows the relationship between quantity of windblown dust and mean wind velocity, which obtained by regression analysis. With wind velocity increases, the quantity of windblown dust increases rapidly and then slowly. According to data collected in the wind tunnel experiments, quantity of windblown dust was deduced as follows: Q=A×(U-U0)3 Where Q is the quantity of windblown dust, A is species coefficient, U is mean wind velocity during an experiment and U0 is the startup wind velocity of corresponding species. The detailed values are shown in Tab. 2 and one of the regression curves is illustrated in the Fig. 4. Table 2: Coefficient of quantity of windblown dust on mean velocity Coefficient

Coal

Ore

A

B

C

D

A

B

C

A

0.0051

0.0045

0.0046

0.0048

0.0206

0.0263

0.0284

U0

3.5

3.3

3.6

3.7

4.0

4.6

4.9

Dust Pollution Emission Characteristics Based on Wind Tunnel Experiments | 1227

Fig. 4: Quantity of windblown dust at various wind velocities (Ore A)

Fig. 4 shows Irwin Probe and pile model with Irwin Probes settled which is employed in emission reduction rate wind tunnel experiments.

Fig. 5: Irwin Probe and pile model with with Irwin Probes settled.

Pile model, windbreak and large strip warehouse model were arranged in the wind tunnel test section. Fig. 2 shows a typical layout of the model. The friction velocity of the pile surface under different conditions was obtained. Combined with the quantity of windblown dust for different materials, dust emission reduction rate of the windbreak, large strip warehouse and other projects can be evaluated.

1228 | Yong-Hua Xue, Jing-Feng Bai, Ning-Ning Hong and Hui-Ying Gao

Fig. 6: A typical layout of the model in wind tunnel experiment.

Tab. 2 shows a typical project list with emission reduction rate that our group is responsible for. Table 2: Typical windbreak and large strip warehouse projects Location

Project Information Projection type

Type of dust

Emission reduction rate

Yingkou

windbreak

ore

46.6%

Yingkou

windbreak

coal

63.4%

Yingkou

windbreak

coal

59.5%

Maoming

windbreak and large strip warehouse

coal

64.3%

Yantai

windbreak

ore

43.7%

Huanghua

windbreak

ore and coal

38.4%

Tianjin

windbreak

coal

43.6%

Suizhong

windbreak

coal

35.5%

Rizhao

windbreak

ore

44.5%

Zhenjiang

large strip warehouse

coal

71.1%

4 Conclusion According to the emission reduction rate data, the large strip warehouse has a better effect in suppressing dust pollution (71.1%) than windbreak (46.9%, average), mainly due to its better wind shielding effect to the yard. It is indicated that the construction of the large strip warehouse can greatly reduce dust emissions and improve

Dust Pollution Emission Characteristics Based on Wind Tunnel Experiments | 1229

environmental air quality, taking into account the throughput of billions of tons of Chinese ports. Acknowledgement: Special fund for basic scientific research business of central public research institutes (No. TKS140215), the Natural Science Foundation of Tianjin (No. 16JCYBJC22300), the National Natural Science Fund (No, 51179078).

References [1] [2] [3] [4] [5]

S.J. Lee, K.C. Park and C.W. Park, Wind tunnel observations about the shelter effect of porous fences on the sand particle movements, Atmospheric Environment, 36(2002), p.1453-1463. R.A. Bagnold, The physics of blown sand and desert dunes. Mathuen, London, 1941. E.A. Finney, Snow control on the highway, Michigan Engineering Experiment Station (East Lansing), Bulletin No. 57, pp.62. A.W. Zingg, Wind tunnel studies of the movement of sedimentary material. Proceedings of the Fifth Hydraulics Conferences, Vol.34, University of Iowa, pp.111-135. R.J. Kind, Mechanics of Aeolian transport of snow and sand. Journal of Wind Engineering and Industrial Aero-dynamics 36, 855-866.

Ming-Liang Zhang1 and Hai-Xia Wang

Removal of Cadmium, Iron and Sulfate from Synthetic Acid Rock Drainage Using MetalTolerant Sulfate Reducing Bacterial Sludge Abstract: In the present study, sulfate reducing bacteria (SRB) granular sludge was made to remove cadmium, iron and sulfate from synthetic acid rock drainage (ARD) using upflow anaerobic bioreactor in the laboratory scale. The robustness of the process was tested by increasing stepwise metal and sulfate concentrations and decreasing influent pH. The result showed the bioreactor effectively treated synthetic ARD with high concentrations of cadmium, iron and sulfate. Sulfide precipitation was found to be the main mechanism of iron and cadmium removal. The dominate sulfate reducer in the bioreactor was Desulfovibrio which resulted in effective sulfate reduction and metals removal. The result suggested the SRB granular sludge could have a good potential for ARD treatment with high concentration of metals and low pH. Keywords: Acid rock drainage; heavy metal; sulfate reduction

1 Introduction Acid rock drainage (ARD), the outflow of acidic water from metal mines or coal mines, is derived from the oxidation of sulfide minerals from overburden, spoil, mine waste dumps and pit mining works when exposed to air and water [1]. The occurrence of ARD may continue several decades or even centuries after mine closure if the conditions remain appropriate. ARD usually contains elevated levels of toxic metals and sulfate and strong acidity, which has resulted in contamination to surface water, soil, plant and animal biota surrounding mining area. Therefore, the effective treatment of ARD has become a major concern in recent years [2]. Biological remediation of ARD is becoming a promising alternative to conventional chemical processes due to its high efficiency [3]. Sulfate reducing bacteria (SRB) can reduce sulfate to hydrogen sulfide under anaerobic conditions, and produced bicarbonate enhances the pH of ARD. The produced sulfide and heavy metals (such as iron, cadmium, copper, nickel and zinc) can form stable precipitates. Sulfate reducing process has been confirmed as an effective method for ARD treatment

|| 1 School of Resources and Environment University of Jinan, Jinan, China.email:[email protected] 10.1515/9783110516623-121 DOI 10.1515/9783110303568-121

1232 | Ming-Liang Zhang and Hai-Xia Wang by many studies [4]. However, many limiting factors associated with the treatment of ARD using SRB bioreactor have also been reported in literature. Many studies have shown the inhibitory effects of low pH and heavy metal can adversely affect the biological treatment efficiency [5]. When the influent with low pH and high levels of heavy metals is fed, SRB activity will be adversely affected and even the performance in ARD bioremediation can be reduced. In the present study, in order to treat effectively synthetic ARD containing high concentrations of heavy metals at low pH, a novel SRB granular sludge was prepared by immobilization mixtures of SRB sludge, cornstalk powder, zero valent iron and silicon sand, and its performance in synthetic ARD bioremediation with high levels of cadmium and iron was evaluated using upflow anaerobic bioreactor. The microbial community in the bioreactor was characterized to analyse the dominate sulfate reducer and co-existing bacteria.

2 Materials and Methods 2.1 SRB Granular Sludge SRB was isolated from excess sludge from sewage treatment plant of Everbright Water Co., Ltd, Jinan city, Shandong province, China. Excess sludge with SRB inoculums were put into a plastic bottle for anaerobic cultivation of enriched SRB sludge until the production of strong smell of hydrogen sulfide. SRB granular sludge was made by the mixture of enriched SRB sludge, zero valence iron (ZVI), cornstalk powder and silicon sand. Sewage sludge and cornstalk powder were used for the physical support for microbial growth, and protected SRB from the toxicity of heavy metals due to its adsorption capacity. ZVI powder can enhance sulfate reduction due to its reductive properties [6]. Silicon sand can increase density and compression strength of granular sludge. Polyvinyl alcohol (PVA) and sodium alginate were used as gel matrix for SRB immobilization. The immobilized SRB granular sludge can tolerate higher concentrations of heavy metals than freely suspended SRB, and can increase biomass retention time in bioreactor [7-9].

2.2 Sulfidogenic Bioreactor Test Glass columns (5 cm diameter and 40 cm length), which were filled with immobilized SRB granular sludge in the middle, were used as up-flow anaerobic fixed-bed bioreactors. Washed silicon sand (particle diameter 1.5-2 mm) was packed in both ends of the bioreactor as supplementary biomass support medium. The bioreactor was activated under anaerobic conditions for three days to promote SRB activity at

Removal of Cadmium, Iron and Sulfate Sulfate Reducing Bacterial Sludge | 1233

30±2oC before feeding with synthetic ARD by peristaltic pump at constant hydraulic retention time (HRT) of 24 h. COD/SO4 ratio is one of the most important parameters to affect sulfate reduction and it also affects the competition between methanogens and sulfate reducing bacteria for the available organic substrates. Organic carbon is used for sulfate reduction, biomass growth, fermentation and methanogenesis in the bioreactor. In the absence of complete oxidation, COD/SO4 ratio may need to be higher than stoichiometric value (0.67) for high efficiencies of sulfate reduction and metals removal [10]. Choi and Rim (1991) reported that methanogens were predominant when the COD/SO4 was above 2.7 and SRB was predominant when this ratio was less than 1.7 [11]. Only at low COD/SO4 ratios SRB species like Desulfovibrio played a key role in organic carbon degradation [12]. COD/SO4 ratios were kept at 0.99-1.18 in the bioreactor experiment for this study. The bioreactor operated for 71 days under eight operating periods with sodium lactate as carbon and electron donors. Synthetic ARD in different periods was prepared through dissolving analytical grade salts (FeSO4.7H2O, Cd (NO3)2.4H2O, NaSO4, MgSO4·7H2O, NH4Cl, KH2PO4) in deionised water. In order to determine the tolerance of the bioreactor to heavy metal and low pH, metals concentration and pH of influent changed stepwise during eight periods.

2.3 Analytical Methods The effluent samples were collected from the port of upper section every day or two days. The pH and Eh of samples were measured immediately after collection using a pH meter coupled with ORP electrodes from unfiltered samples. Prior to iron, cadmium, sulfate and COD measurements, effluent samples were centrifuged at 6000 rpm for 5 min and filtered through 0.45um membrane syringe filters. The concentration of sulfate was measured by the ion chromatography system (ICS-90, Dionex). CODcr was mesured bypotassium dichromate method after removal of sulfide in samples. For measurements of soluble iron and cadmium ions, samples were first filtered through 0.45 um membrane syringe filters and then acidified with concentrated HNO3 to pH around 1.0. Metal concentrations were determined by using flame atomic absorption spectrometer (AA-7000 Shimadzu).

2.4 Microbial Community Identification DNA was extracted from samples by using Power Soil DNA kit (MoBio). Extracted DNA was used as the template for PCR amplification and subsequent denaturing gradient gel electrophoresis (DGGE) analysis, as previously described [13]. Amplification of 16S rDNA gene fragments was performed using polymerase chain reaction (PCR) with the primer pair 338F:5’-ACTCCTACGGGAGGCAGCAG-3’ and 534R-GC: 5’-

1234 | Ming-Liang Zhang and Hai-Xia Wang CGCCCGCCGCGCGCGGCGGGCGGGGCGGGGGCACGGGGGG (ATTACCGCGGCT GCTGG)-3’. PCR products were placed on an 8% polyacrylamide gel (acrylamide: bisratio, 37.5:1) under denaturing conditions (urea, 7 M; 40% form amide with a denaturing gradient ranging from 30 to 60%. The gels were run in 1×tris acetateEDTA buffer at 150 V for 420 min. Gels were silver stained, according to previously published methods [13]. Prominent bands were excised from the DGGE gel and sequenced. Identification of bacteria from sequence data was via comparison with sequences held in the National Center for Biotechnology Information (NCBI) database.

3 Results and Discussion 3.1 Effluent pH and Sulfate Removal The variation of sulfate concentration of influent and effluent is shown in Fig. 1a. In the period of I-VII (day 1-64), the removal efficiency of sulfate increased on the whole and the maximum reached 81.6% in day 39. Sulfate removal exhibited obvious fluctuation and ranged from 11.3% to 81.6%, probably due to the influence by variation of ARD influent parameters (pH, metal concentration, sulfate concentration, COD/SO4 ratio, et al.). In period VIII (day 65-71), the removal efficiency of sulfate decreased to 4.4% due to the inhibition of biological sulfate reducing. The effluent Eh ranged from -160 to -250 mV which suggested the sulfate reducing activity existed in the period of I-VII (day 1-64). When influent pH decreased to 2.8 and the concentrations of metal ions increased (iron 400mg/L and cadmium 96mg/L) in the period VII (day 51-64), the efficiency in ARD bioremediation of the bioreactor was not obviously affected in terms of sulfate reduction (48-77%). The result showed the bioreactor treated effectively synthetic ARD (pH 2.8) with high concentrations of cadmium (96 mg/L), iron (400 mg/L) and sulfate (3760 mg/L). The highest sulfate reduction rate of 3.9 g/ (L.d) was observed during period VII, which was comparable with the result reported in literature. In another study, Sahinkaya and Yucesoy (2010) reported the maximum sulfate reduction rate of about 3 g/ (L.d) in an anaerobic baffled reactor treating synthetic ARD [9]. In the last period (VIII), the sulfate removal decreased dramatically to 4.4% and the Eh increased to about 20 mV, which indicated biological sulfate reducing process was severely inhibited. It was probably caused by inhibitory effect of the influent low pH (2.4) and high concentrations of cadmium (117 mg/L) and iron (443mg/L). The variation of influent and effluent pH is shown in Fig. 1b. In the period of IVII (day 1-64), even though the influent pH was low in the range of 2.8-4.5 and contained high concentrations of cadmium, iron and sulfate, the effluent pH always remained in slightly alkaline range of 7.3-8.2 due to alkalinity generation as a result

Removal of Cadmium, Iron and Sulfate Sulfate Reducing Bacterial Sludge | 1235

of biological sulfate reduction. In period VIII (day 65-71), the effluent pH decreased to 6.4 and sulfate removal decreased due to the inhibition of sulfate reduction process.

()

(

Fig. 1: Changes of sulfate concentration (a) and pH (b) of influent and effluent

3.2 Cadmium and Iron Removal Iron and cadmium concentration of influent and effluent is shown in Fig.2. In the period of I-VII (day 1-64), even though the influent concentrations increased to 96 mg/L (cadmium) and 400 mg/L (iron), the removal efficiencies of cadmium and iron

1236 | Ming-Liang Zhang and Hai-Xia Wang ions in effluent samples were over 99.9% and 98.5% as the effluents concentration was less than 0.04 mg/L and 1.2mg/L, respectively. The effluent concentrations of cadmium and iron during the whole experiment were below the discharge limits (cadmium 0.1 mg/L, iron 6.0 mg/L) required by wastewater discharge standard for pollutants from coal industry in China (GB20426-2006), which showed the sulfidogenic bioreactor filled with immobilized SRB granular sludge was efficient for the removal of cadmium and iron from ARD. The solubility products (Ksp) of metal sulfides are lower than their respective hydroxide, which suggests that iron and cadmium ions can be removed by sulfide precipitates in the bioreactor rather than hydroxide precipitates. It was worth noting that in period VIII (day 65-71) the sulfate reducing process was significantly inhibited. Although the concentration of iron increased to 0.62 mg/L in period VIII due to the inhibition of biological sulfate reducing, the removal of iron and cadmium ions in effluent samples was all over 99.9%. In addition to sulfide precipitation caused by faint sulfate reduction process, co-precipitation with produced metal sulfides and adsorption onto cornstalk and sludge could contribute to the removal of cadmium and iron in period VIII [14]. The bioreactor experiment was conducted for 71 days with eight operation periods. Sulfate, heavy metals concentrations and acidity of influent increased step by step during eight periods with an interval of 7 or 14 days. The result showed the bioreactor treated effectively the synthetic ARD (pH 2.8) with high concentrations of cadmium (96 mg/L), iron (400 mg/L) and sulfate (3760 mg/L). Meanwhile, it was worth noting that each operation period (7 or 14 days) could be too short to stabilize the system, a longer operation time may need to be conducted further in the next study.

Removal of Cadmium, Iron and Sulfate Sulfate Reducing Bacterial Sludge | 1237

Fig. 2: Variation of Fe (a) and Cd (b) concentration of influent and effluent

3.3 Microbial Community Analysis The SRB in this sulfidogenic bioreactor belongs to Desulfovibrio desulfiricans. The co-existing bacteria were similar to members of the genus Clostridium and the order Bacteriodales, mainly including Bacteroides sp., Petrimonas sulfuriphila, Proteiniclasticum sp., Clostridia bacterium, and Bacillus sp., which belong to fermentative bacteria or cellulose degraders. They were also reported in ARD treatment in literature [15]. SRB cannot degrade complex organic materials directly. SRB rely on the activity of anaerobic hydrolytic- and fermentative-bacteria when complex organic substrate was used as carbon source. Wakeman et al (2010) reported that silage supported sulfate reduction in the treatment of metals and sulfate containing

1238 | Ming-Liang Zhang and Hai-Xia Wang wastewater, and co-existing fermenting bacteria (genus Clostridium) played an important role in the treatment due to fermenting bacteria degrading silage into suitable electron donors for SRB[16]. In this study, cornstalk powder and sewage sludge could be degraded by fermentative bacteria and degraded products could be used for SRB as electron donor. Efforts to improve bioreactor performance need to consider the entire microbial community and the interaction of different partners in sulfidogenic bioreactor.

4 Conclusions Metal-tolerant SRB granular sludge was prepared for the removal of cadmium, iron and sulfate from synthetic acid rock drainage using upflow anaerobic bioreactor. High removal efficiencies were achieved when ARD influent with high concentrations of cadmium (96 mg/L), iron (400 mg/L) and sulfate (3760 mg/L) was fed into the bioreactor. It showed the immobilized SRB granular sludge could be used to effectively treat ARD. Microbial community detected in the bioreactor included the SRB species (Desulfovibrio) and fermentative bacteria. Acknowledgement: This work was supported by Shandong Provincial Key Research and Development Program (2015GSF117014).

References [1] [2] [3] [4] [5] [6] [7]

[8]

[9]

A. Akcil, S. Koldas. Acid rock drainage (AMD): causes, treatment and case studies. J. Clean. Prod.14 (2006), 1139-1145. A.L.Mackie, M. E.Walsh. Investigation into the Use of Cement Kiln Dust in High Density Sludge (HDS) Treatment of Acid Mine Water. Water Res. 85(2015), 443-450. A.S.Sheoran, V.Sheoran, R.P. Choudhary. Bioremediation of acid-rock drainage by sulphatereducing prokaryotes: A review. Miner.Eng. 23(2010), 1073-1100. K.R.Waybrant, C.J.Ptacek, D.W.Blowes. Treatment of mine drainage using permeable reactive barriers: column experiments. Environ. Sci. Technol. 36(2002), 1349-1356. T.W.Hao, P.Y.Xiang, H.R.Mackey, K.Chi, H.Lu, H.K.Chui, M.C.M, van Loosdrecht. Chen, G. H. A review of biological sulfate conversions in wastewater treatment. Water Res. 65(2014), 1-21. H. Bai, Y.Kang, H.Quan, Y.Han, J.Sun, Y.Feng. Treatment of acid rock drainage by sulfate reducing bacteria with iron in bench scale runs. Bioresour. Technol. 128(2013), 818-822. X.Min, L.Chai, C.Zhang, Y.Takasaki, T.Okura. Control of metal toxicity, effluent COD and regeneration of gel beads by immobilized sulfate-reducing bacteria. Chemosphere. 72(2008), 1086-1091. H.F.Hsu, Y.S.Jhuo, M.Kumar, Y.S.Ma, J.G.Lin. Simultaneous sulfate reduction and copper removal by a PVA-immobilized sulfate reducing bacterial culture. Bioresour.Technol. 101 (2010), 4354-4361. E.Sahinkaya, Z.Yucesoy. Biotreatment of acidic zinc-and copper-containing wastewater using ethanol-fed sulfidogenic anaerobic baffled reactor. Bioprocess Biosyst. Eng.33 (2010), 989-997.

Removal of Cadmium, Iron and Sulfate Sulfate Reducing Bacterial Sludge | 1239 [10] [11] [12] [13]

[14]

[15] [16] [17]

M.Altun, E.Sahinkaya, I.Durukan, S.Bektas, K.Komnitsas. Arsenic removal in a sulfidogenic fixed-bed column bioreactor. J.Hazard. Mater. 269(2014), 31-37. E.Choi, J.M.Rim. Competition and inhibition of sulfate reducers and methane producers in anaerobic treatment. Water Sci. Technol. 23(1991), 1259–1264. Y.Hu, Z.Jing, Y.Sudo, Q.Niu, J.Du, J.Wu, Y.Y. Li. Effect of influent COD/SO42− ratios on UASB treatment of a synthetic sulfate-containing wastewater. Chemosphere. 130(2015), 24-33. H.Auvinen, L.M.Nevatalo, A.H.Kaksonen, J.A.Puhakka. Low-temperature (9°C) AMD treatment in a sulfidogenic bioreactor dominated by a mesophilic Desulfomicrobium species. Biotechnol.Bioeng. 104(2009), 740-751. A.H.Kaksonen, P.D.Franzmann, J. A.Puhakka. Effects of hydraulic retention time and sulfide toxicity on ethanol and acetate oxidation in sulphate-reducing metal-precipitating fluidizedbed reactor. Biotechnol. Bioeng.86 (2004), 332-343. T.Jong, D.L.Parry. Removal of sulfate and heavy metals by sulfate reducing bacteria in shortterm bench scale upflow anaerobic packed bed reactor runs. Water Res. 37(2003), 3379-3389. K.R.Waybrant, C.J. Ptacek, D.W.Blowes. Treatment of mine drainage using permeable reactive barriers: column experiments. Environ. Sci. Technol. 36(2002), 1349-1356. K.D.Wakeman, L.Erving, M.L.Riekkola-Vanhanen, J.A.Puhakka. Silage supports sulfate reduction in the treatment of metals-and sulfate-containing waste waters. Water Res. 44(2010), 4932-4939.

Kan-Hua Su1, Ji-Lin Liu2, Li-Fu Wan3 and Meng Li4

Measures to Prevent Subsea Wellhead Instability for Deepwater Drilling Abstract: Subsea wellhead connects a drilling riser and casing and plays a pivotal role in deepwater drilling system. The wellhead vertical or horizontal bearing capacity directly determines its stability and the safety of deepwater drilling system. Therefore, the bearing stability of subsea wellhead has become one of the most important issues in deepwater drilling operation. According to the influence of marine environmental loads, drilling operation conditions, and shallow seafloor soil parameters, the theoretical models to analyze the wellhead stability under the dangerous conditions are conducted. Then the evaluation indexes of the bearing capacity of the subsea wellhead were determined. The fuzzy comprehensive evaluation method, analytic hierarchy process method can be used to analyze the wellhead stability. Several improved measures can be used to maintain wellhead stability, such as select a reasonable riser tension, control the drilling platform drift, reduce the riser weight, improve the conductor bending stiffness, get the seafloor soil sample, control mud line scouring and install an anti-instability device. Keywords: deepwater drilling; subsea wellhead; bearing capacity; stability; improved measure

1 Introduction Deepwater drilling process is different from the drilling in land or shallow water area. The conventional equipment of deepwater drilling are composed of drilling platform, riser system, blowout preventer (BOP) system, subsea wellhead and casing strings. And the subsea wellhead plays a pivotal role in connecting the riser and the casing [1-5]. It supports the BOP stacks, suspends and supports the casing strings when cementing, and closes the annulus between casing strings during

|| 1 College of Petroleum Engineering Chongqing University of Science and Technology Chongqing, China. E-mail: [email protected] 2 College of Petroleum Engineering Chongqing University of Science and Technology, Chongqing, China. E-mail: [email protected] 3 College of Petroleum Engineering Chongqing University of Science and Technology, Chongqing, China. E-mail: [email protected] 4 College of Petroleum Engineering Chongqing University of Science and Technology, Chongqing, China .E-mail: [email protected] 10.1515/9783110516623-122 DOI 10.1515/9783110303568-122

1242 | Kan-Hua Su, Ji-Lin Liu, Li-Fu Wan and Meng Li drilling and production operations. The bearing capacity of the subsea wellhead directly determines the stability and safety of the deepwater drilling system. Therefore, it is necessary to study the bearing capacity of the subsea wellhead for deepwater drilling, to determine its safety risk, to find the measures to prevent subsea wellhead instability and to provide technical support for the safe operation of deepwater drilling.

2 Subsea Wellhead Introduction Generally, there are two wellheads called low-pressure wellhead and high-pressure wellhead for deepwater drilling. The low-pressure wellhead sits in 914.4mm or 762.0mm size casing to provide support for the high-pressure wellhead, and the high-pressure wellhead has 476.3mm to hang multi-layer casing strings. Subsea wellhead is connected to the BOP stacks by a connector, and the BOP stacks joints in the riser which is tensioned and suspended by the riser tension system to the drilling platform, as shown in Figure 1.

Fig. 1: Conventional deepwater drilling system.

It can be seen from the Figure 1 that the deepwater drilling operation is affected by many marine environmental factors such as the wind, current and wave, which will act on the riser, and cause the subsea wellhead bearing great bending moment. Furthermore, as the volume and weight of subsea BOP stack are much larger than

Measures to Prevent Subsea Wellhead Instability for Deepwater Drilling | 1243

that used on land, they will have a great weight on the subsea wellhead. Therefore, the wellhead has to have sufficient anti-bending capability, reliable sealing performance, and effective connection ability.

3 Theoretical Model of subsea wellhead stability To analyze the stability subsea wellhead, the vertical and lateral stability models were developed.

3.1 Vertical Stability Models The shallow strata below mud line are generally seabed silt, clay, and sand mixed layers, with the soil and sand mainly. After conductor jetted, the subsea wellhead bears vertical force caused by the riser and BOP, and its own weight. If the wellhead vertical bearing capacity is insufficient, there will be the risk of wellhead instability. When the conductor is jetted into place, it will bear surface casings and its own weights. At this time, the vertical stability of the subsea wellhead is the worst. The vertical force of the subsea wellhead, in this case, is shown in Figure 2.

Fig. 2: Vertical force diagram of subsea wellhead at the most dangerous condition.

Then, the vertical stability equation of the subsea wellhead is obtained [6]. 4 Z  1 W

4 I  4 S

(1)

1244 | Kan-Hua Su, Ji-Lin Liu, Li-Fu Wan and Meng Li Where, Qw1 is the weight of conductor and surface casing in drilling mud, kN; Ntl is the weight of wellhead in seawater, kN; Qf1 is the frictional resistance of the conductor, kN; Qp1 is the end bearing resistance of the conductor, kN. The results show that the frictional resistance of the conductor can play a decisive role [7]. According to the theory of soil mechanics and pile foundation, based on the conservative principle and ignoring the time effect, a conservative calculation can be obtained which satisfies the subsidence of the subsea wellhead. The equation is as follows: O

4Z

4 Z  1 W

¦ S ' VL OLT

L

VX L

(2)



Where, Qw is the total weight of conductor bearing, kN; qsui is the unit area frictional resistance of the string in the i layer soil, kPa; li is the thickness of the i layer soil, m; Dsi is the string diameter, m; l is the string length into the soil, m. After the installation of the riser pipe and BOP stacks, the vertical bearing capacity of the subsea wellhead in this case can meet the design requirements as the depth of the surface casing is long.

3.2 Lateral Stability Models The forces acting on the subsea wellhead during deepwater drilling are mainly due to the reaction forces at the riser bottom joint, the weight of the BOP stacks and suspension string, the current forces acting on the BOP stacks and the wellhead, the vertical and horizontal soil resistance, etc. These forces may cause the wellhead to sink or tilt, and make the collapse risk of the wellhead when exceeds its design limit. When the surface casing into and cementing is completed, and then land the riser and BOP stacks, the lateral stability of the subsea wellhead is the worst, as shown in Figure 3.

Measures to Prevent Subsea Wellhead Instability for Deepwater Drilling | 1245

Fig. 3: Schematic diagram of lateral force of subsea wellhead.

Considering drilling platform drift, mechanical properties of riser, and nonlinear response between casing string and formation [8-11], the dynamic analysis model of the lateral stability of the subsea wellhead is obtained as follows: ­ w \ [ W w\ [ W w ª w \ [ W º °P U [  FU [  «( U, U [ »  wW ° wW  w[  «¬ w[  »¼ ǂǂǂǂ ° w ° 7 [ w\ [ W  : [ w\ [ W )GF [ W U °° w[ w[ w[ ®   ª  ° w w \ [ W º w \ [ W w ª w\ [ W º  «( F, F [ »  « 1 [ »  °P F [ w[ ¬ w[ ¼ w[  ¬« w[  ¼» wW  ° ° °N [ \ [ W  FF [ w\ [ W S [ W wW ¯°

(3)

Where, y is the lateral displacement of string, m; x is the direction along the depth, m; mr is the riser mass per unit length, kg; cr is the riser damping coefficient; Erlr is the riser bending rigidity, kN • m2; T is the riser effective tension, kN; Wr is weight per unit length of riser, kN; Fdc is unit currents force on the riser, kN; EcIc is the equivalent casing string bending rigidity, kN • m2; mc is unit mass of the equivalent casing string, kg. Dc is the equivalent casing string outer diameter, m; N is the axial force that changes along the direction of casing string, kN; p is the ground reaction force on unit area of equivalent casing string which can be described by p-y curve, kPa; k is the string stiffness coefficient; cc is the string damping coefficient; and t is the time, s.

1246 | Kan-Hua Su, Ji-Lin Liu, Li-Fu Wan and Meng Li Finite difference method can be adapted to in the numerical simulation. Newmark method can be adapted to solving the model by time step. Then the model can be solved by the iterative method in the time domain, and the lateral loading capacity of the subsea wellhead can be obtained.

3.3 Evaluation Indexes of Subsea Wellhead Stabiltiy In the process of deepwater drilling, the subsea wellhead is subjected to complicated loads. Its bearing capacity is divided into two aspects: vertical and horizontal, and mainly affected by many factors [4, 6, 12]. So the subsea wellhead stability capacity evaluation indexes are obtained such as Table 1. According to the above evaluation indexes, fuzzy comprehensive evaluation and analytic hierarchy process can be used to quantitatively evaluate the subsea wellhead stability in deepwater drilling operation [13]. Table 1: evaluation indexes of subsea wellhead stability First-class index Vertical stability

Second-class index

Third-class index

Influences (third-class index)

Casing program design

Conductor diameter and thickness

Affect the vertical stability of the wellhead each other

Conductor depth Surface casing diameter and thickness

Affect the vertical stability of the wellhead each other

Surface casing depth

Formation properties

Horizontal stability

Marine environment

Wellhead weight

The larger the index, the worse the vertical stability

Soil undrained shear strength

The larger the index, the worse the vertical stability

Soil adhesion coefficient

The larger the index, the worse the vertical stability

Sand internal friction angle

The larger the index, the worse the vertical stability

Sand submerged unit weight

The larger the index, the worse the vertical stability

Seawater depth

The larger the index, the worse the horizontal stability

Wind

The larger the index, the worse the horizontal stability

Measures to Prevent Subsea Wellhead Instability for Deepwater Drilling | 1247

First-class index

Second-class index

Third-class index

Influences (third-class index)

Wave

The larger the index, the worse the horizontal stability

Current

The larger the index, the worse the horizontal stability

Operation parame- Riser top tension ters Drilling mud

Submarine formation properties

Affect the vertical stability of the wellhead each other

Platform drift

The larger the index, the worse the horizontal stability

Cementing level

The larger the index, the better the horizontal stability

Wellhead height to mud line

The larger the index, the worse the horizontal stability

Conductor diameter

The larger the index, the better the horizontal stability

Conductor thickness

The larger the index, the better the horizontal stability

Soil undrained shear strength

The effect of the shear strength on the lateral stability is the most

Soil adhesion coefficient Sand internal friction angle

The effect of the internal friction angle on the lateral stability is the most

4 Safety Measures to Prevent Instability of Subsea Wellhead The bearing capacity of the subsea wellhead determines its stability. The main consideration of the subsea wellhead vertical stability is the vertical bearing capacity of the conductor. The wellhead lateral displacement and the bending moment are main indicators for wellhead stability evaluation. According to the above analysis, the safety measures to effectively prevent the instability of the wellhead can be obtained.

1248 | Kan-Hua Su, Ji-Lin Liu, Li-Fu Wan and Meng Li

4.1 Select a Reasonable Riser Tension In order to control the deformation of the riser and improve its stress, it is necessary to improve the top tension of the riser. When the tension of the riser increases, the load on the subsea wellhead tends to increase. If the increase is large, it will not meet the requirements of the wellhead and will cause the subsea wellhead instability. Therefore, a reasonable tension interval needs to be found to meet the riser and subsea wellhead force permission. Meanwhile, in order to control the increase of the total weight of the riser caused by the increase of drilling mud density, a larger top tension is needed. However, if the larger top tension is used when the drilling mud density is low, it will bring subsea wellhead displacement and bending moment increasing sharply. Therefore, the top tension of the riser should be adjusted if the drilling mud density changed. And the appropriate riser tension should be selected based on the actual situation.

4.2 Control the Drilling Platform Drift The drilling platform drift has great influence on the lateral bearing capacity of the subsea wellhead. The larger the drift distance is, the larger the lateral load and bending moment of the wellhead. It will lead to the instability of the wellhead to a certain extent. In the deepwater area, harsh conditions, hurricanes, waves, currents and so on will cause the drift too large, and cause the wellhead has large lateral displacement and bending moment. Because the limited ability of the wellhead to bear the bending moment, when the drilling platform drifting excessively, it may cause the wellhead instability, then need to disconnect the BOP stacks from the lower part of the riser.

4.3 Reduce the Riser Weight and Improving the Riser Buoyancy As the depth of the water increases and the density of the drilling mud increases, the total weight of the riser increases and the top tension required is increased. This situation poses a threat to the stability of the subsea wellhead. In order to solve this problem caused by the increase of water depth, it is necessary to increase the number of buoyancy blocks. However, the increase of the buoyancy will cause the increase of the riser outer diameter, leading to the increase of the wave force on the riser. Thus, the horizontal force and bending moment of the wellhead will increase, which will also endanger the stability of the wellhead. Therefore, in order to prevent the instability of the subsea wellhead in deepwater drilling, the length, diameter

Measures to Prevent Subsea Wellhead Instability for Deepwater Drilling | 1249

and position of the buoyancy block should be selected according to the actual operation conditions. At the same time, a new type of aluminum alloy can also be adopted to reduce the weight of the riser, so as to improve the stress condition of the subsea wellhead.

4.4 Improve the Conductor Bending Stiffness Under the condition of the shallow stratum, the casing string size, especially the conductor, play an important role in the subsea wellhead stability. It is found that increasing the diameter and wall thickness of the conductor can significantly reduce the lateral displacement of the wellhead. Therefore, larger size, high steel grade, and thick wall thickness should be selected for the actual operating conditions and the soil property. For example, higher steel grades (X50 or X56) or larger wall thickness (38.1mm, 44.5mm or 50.8mm) of the conductor can be chosen, especially increase its upper section. And, the depth of the conductor should also consider the evaluation of shallow strata, at least more than the depth of the shallow soft soil. Therefore, in order to prevent the instability of the subsea wellhead, it is necessary to select the parameters of the conductor, especially the diameter, wall thickness, grade, and depth.

4.5 Data Sampling and Mud Line Scouring Control The vertical and lateral bearing capacity of the subsea wellhead is affected by the shallower soil. To improve the stability of the subsea wellhead, it is necessary to select a seabed location with high strength for drilling operation. Because the undrained shear strength of the soil and the friction angle of the sand are important to the stability of the wellhead, it is very important to sample before a new block is drilled. In addition, the higher the distance from the wellhead to the mud line and the seabed scored, the greater the lateral displacement and the bending moment of the wellhead. In order to improve the stability of the subsea wellhead, need to choose a reasonable wellhead height and take measures to control the seabed scouring around the conductor.

4.6 Use an Anti-Instability Device According to the principle of wellhead anti-instability, a series of anti-instability devices can be installed and used. Sometimes mud mat was used to control the conductor sink and tilt, then to improve the wellhead stability.

1250 | Kan-Hua Su, Ji-Lin Liu, Li-Fu Wan and Meng Li However, due to the soil around the conductor at the mud line is washed; it will lead to the side of the mud mat hollowing and then cause the conductor and wellhead instability. Focus on this problem, an especially wellhead anti-settling device with anti-scouring grids is designed. And a certain number of ribs are arranged under the bottom plate to play the role of sharing the bending moment of the conductor upper part and effectively to prevent the conductor rotating during the subsequent drilling process. A innovate barrel anti-instability device connected with the conductor can be injected into the seabed in accordance with conventional deepwater drilling procedures. The device has a large diameter drum structure to increase the contact area between the pipe wall and the shallow seabed soil, thus increase the vertical carrying capacity of the conductor and improve the vertical stability of the wellhead; Meanwhile, the bending moment of the conductor upper part can be shared, thereby the lateral stability of the subsea wellhead is improved.

5 Summary The subsea wellhead is particularly important equipment in the deepwater drilling system. In the event of the instability of the wellhead, it will cause serious safety problems. Therefore, the bearing stability of the subsea wellhead has become one of the most important issues in deepwater drilling. In the process of deepwater drilling, the subsea wellhead is bearing complicated loads. Its carrying capacity is divided into vertical and horizontal aspects. So it is feasible to establish the theoretical model and analyze the stability under the dangerous conditions. According to the influence of the marine environmental loads, operation conditions, and shallow seabed strata, the wellhead stability evaluation indexes can be obtained. Fuzzy comprehensive evaluation method, AHP method and so on can be used to analyses wellhead stability and safety. From the deepwater engineering and technical aspects, to select a reasonable riser tension, control the drilling platform drift, reduce the riser weight, improve the riser buoyancy, improve the conductor bending stiffness, sample shallow strata data and control mud line scouring are good measures to keep wellhead stability, whether used alone or in combination. Although the technical measures can increase the wellhead stability, but in some harsh conditions, installing the anti-instability device can improve the stability of the subsea wellhead better.

Measures to Prevent Subsea Wellhead Instability for Deepwater Drilling | 1251

Acknowledgement: This research is funded by Chongqing Research Program of Basic Research and Frontier Technology (No. CSTC 2015jcyjA90021) and Scientific and Technological Research Program of Chongqing Municipal Education Commission (Grant no. KJ1501302).

References [1] [2] [3] [4] [5] [6]

[7] [8] [9] [10] [11] [12] [13]

Rocha L A S, Junqueira P, Roque J L. Overcoming deep and ultra deepwater drilling challenges. OTC 15233, 2003. Shaughnessy J, Daugherty W, Graff R., et al. More ultradeepwater drilling problems. SPE 105792, 2007. Rohleder S A, Sanders W W, Williamson R N, et al. Challenges of drilling an ultra-deep well in deepwater-spa prospect. SPE/IADC 79810, 2003. Guan Z, Su K, Su Y. Numerical simulation of subsea wellhead stability for deepwater drilling. SPE 130823, 2009. Chang Y, Chen G. Theoretical investigation and numerical simulat ion of dynamic analysis for ultra-deepwater drilling risers. Journal of Ship Mechanics, 2010, 14(6):596-605. Su K, Guan Z. Analysis on vertical bearing capacity of conductor and surface casing for deepwater drilling. Journal of Chongqing University of Science and Technology: Edition of Natural Science, 2010,12(2):22-24. Akers T J. Jetting of structural casing in deepwater environments: job design and operational practices. SPE 102378, 2006. Wang T, Zhang X, Zhu W. Vessel motion effects on nonlinear dynamics of deepwater drilling Riser. Journal of Ship Mechanics, 2010, 14(6):606-618. Guan Z, Su K, Su Y. Analysis on lateral load bearing capacity of conductor and surface casing for deepwater drilling. Acta Petrolei Sinica, 2009, 30(2):285-290. Ju S, Chang Y, Chen G, et al. Determination of the hang off window for deepwater drilling riser. Acta Petrolei Sinica, 2012, 33(1):133-136. American Petroleum Institute. Recommended practice for design selection operation and maintenance of marine drilling riser system. API RP 16Q, 2001. King G W. Drilling engineering for subsea development wells. SPE 18687, 1990. He S, Ji A, Chen D. Application of fuzzy comprehensive evaluation in of security management assessment oil drilling group. Journal of Safety Science and Technology, 2011, 7(6):156-161.

Yu-Hong Chen1, Si-Qian Hu2*, Xing Qi3, Tian-Rong Zhu4, Hou-Tun Fu5 and Fang Tan6

Simultaneous Analysis of Methanol, Ethyl Acetate and Fusel Oil in Wine

Abstract: a method for determination and separation of methanol, ethyl acetate and fuel oils using capillary gas chromatography were developed by changing the kinetic parameter. The optimal separation condition and temperature program were studied. The results showed that methanol, ethyl acetate and fuel oils were well separated, and the GC peak shape was effectively improved. This method is simple, sensitive and accurate. It can be used in the investigation of methanol, ethyl acetate and fuel oils in wine. Keywords: methanol; ethyl acetate; fuel oils; capillary gas chromatography; kinetic parameter

1 Introduction In recent years, simultaneous analysis of the methanol, ethyl acetate and fuel oil of in wine using capillary gas chromatography has generated much interest among the chromatographic workers [1-3], but there are many problems [4-8]: (1) the methanol peak shape is very poor ; (2) in order to improve the seperation degree of methanol and ethanol, the column temperature should below 30 °C, which is lower than summer temperature in china; (3) the methanol and ethanol cannot completely

|| 1 Key Laboratory of Optoelectronic Chemical Materials and Devices, Ministry of Education, School of Chemical and Environmental Engineering, Jianghan University Wuhan, China. E-mail: 463077474 @qq.com 2 Institute of WuHan Studies, Jianghan University 2.Key Laboratory of Optoelectronic Chemical Materials and Devices, Ministry of Education, School of Chemical and Environmental Engineering, Jianghan University 3. School of Chemistry and Environmental Engineering, Jiang Han University, Wuhan, China. *E-mail: [email protected]* 3 Key Laboratory of Optoelectronic Chemical Materials and Devices, Ministry of Education, School of Chemical and Environmental Engineering, Jianghan University 2 School of Chemistry and Environmental Engineering, Jiang Han University Wuhan China. 4 Key Laboratory of Optoelectronic Chemical Materials and Devices, Ministry of Education, School of Chemical and Environmental Engineering, Jianghan University 2. School of Chemistry and Environmental Engineering, Jiang Han University, Wuhan, China 5 School of Chemistry and Environmental Engineering, Jiang Han University, Wuhan, China. 6 School of Chemistry and Environmental Engineering, Jiang Han University, Wuhan, China 10.1515/9783110516623-123 DOI 10.1515/9783110303568-123

1254 | Yu-Hong Chen, Si-Qian Hu, Xing Qi, Tian-Rong Zhu, Hou-Tun Fu and Fang Tan separated. To solve the above problems, we study a new method, under the condition of the column temperature (60 °C), through changing the separation process of kinetic parameters .It can be used in the investigation of methanol, ethyl acetate and fuel oils in wine.

2 Materials and Methods 2.1 Materials and Reagents Methanol; Ethyl acetate; Sec-butyl alcohol; Propyl alcohol; Isobutyl alcohol; N-butyl alcohol; Isoamyl alcohol; Ethanol and Acetone were analytical reagent, such as the purity 99.5% : National medicine group chemical reagent co., LTD.

2.2 Instruments and Equipment Gas Chromatograph (Clarus500): American Perkin Elmer Instrument (Shanghai) co., LTD.; GCD-300A Hydrogen Generator: Beijing HP Analysis Technology Institute.

2.3 Methods 2.3.1 Gas Chromatographic Conditions Gas chromatographic simulation separation use the software which developed by our research group [9]. The type of chromatographic column is HP-INOWAX (100% polyethylene glycol, strong polar stationary phase). The size of quartz capillary column is 30 m× 0.25 mmI.D. × 0.25 u m). The temperature of T injection port A is 250 °C. The temperature of hydrogen flame ionization detector is 250 °C. Air flow velocity is 450ml: min-1. Hydrogen flow rate is 45ml: min-1. Column temperature program: the initial temperature is 60°C, keeping 5 min, than up to 180°C at the speed of 10°Cmin-1. The carrier gas is nitrogen at a velocity of 15 ml.min-1, keeping 5 min, up to 40 ml min-1 at the speed of 6 mlmin-1. The injection mode is distributaries mode with the ratio of 1:4. The injection sample quantity is 1.0 ul.

2.3.2 GC Qualitative Analysis The GC qualitative is confirmed by the determination of retention time. Under the appropriate condition of chromatography, the mixed standard sample containing methanol, ethyl acetate and fuel oil had well been separated and determined. As the

Simultaneous Analysis of Methanol, Ethyl Acetate and Fusel Oil in Wine | 1255

figure 1 shows that the retention time of ethyl acetate, methanol, sec-butyl alcohol, normal propyl alcohol, isobutanol, n-butyl alcohol, isoamyl alcohol are 4.61, 4.78, 6.433, 6.634, 7.269, 7.912, and 8.625, respectively.

3 Results and Analysis 3.1 The Selection of Chromatography Column The column packing of GDXˉ102 had been used refer to GB/T5009.48-1996[10].GDX should be activated after using period of time, because it easily absorb water in the storing and using. As a result of the GDX has hydrophobic, water flows out chromatographic column before most of the organic compounds, which caused baseline drift, and affect the accuracy of the determination of methanol. Capillary column has the characteristics of fast separation, high column efficiency and good thermal stability. The separation effect of the methanol, ethyl acetate and fuel oil in ethanol solution is good, and other impurities cannot interference the results, because the stationary phase Elite-Wax is polarity.

3.2 The Optimum Velocity under Low Column Temperature According to the chemical thermodynamics, in chromatographic separation, the logarithmic of relative retention value between A and B is: ln(α)=a2-a1+(b2-b1)/T

(1)

The a1, b1 and a2, b2 is related to the quality of the components. T is the absolute temperature. It can be seen from formula (1) that the column temperature is lower, the relative retention value is higher, and the degree of separation is greater. But dynamic factors also have a great influence on the degree of separation except thermodynamic factors. Thermodynamic factors affect retention value of adjacent peak, and dynamics factors affect chromatographic peak shape. If peak shape is poor under low column temperature, the low column temperature can't improve the degree of separation. According to the chemical kinetics, the chromato- graphic column plate height [11] is:

H H

2Od p  2JD g / u 

A  B /u  C ˜u

2 d 2f k 0.01k 2 d p 2 u ˜ u ˜ ˜ 2 2 3 (1  k ) Dl (1  k ) D g

(2)

1256 | Yu-Hong Chen, Si-Qian Hu, Xing Qi, Tian-Rong Zhu, Hou-Tun Fu and Fang Tan This is the Fan's equation, which u is the velocity of carrier gas. It can be seen from the formula (2), increasing carrier gas flow rate cause high transfer mass resistance, and decreasing carrier gas flow rate cause high longitudinal diffusion, which lead to low column efficiency. Usually, the optimum velocity of capillary column (0.25μm) is about 1ml·min-1 (linear velocity is 40cm·s-1). However, the column temperature must be low when we separate weak component. Under the condition of low temperature, the diffusion coefficien of component in the carrier gas and the stationary phase (Dg, Dl) are small, which makes the transfer mass resistance is very big. If we still use velocity of 1ml·min-1, column efficiency will be very low. It can be seen from the figure 2, chromatographic shape of methanol is too poor to be quantitative analysis. It can be seen from the figure 3, that keeping reducing the column temperature maked the relative retention value of ethanol and methanol increasing, at the same time, chromatographic peak become wider, and the peak shape is further deterioration as a result of increased transfer mass resistance. In a word, changing the parameters of thermodynamics had no effect on the separation of methanol and ethanol. We try to change the kinetic parameters to improve the chromatographic peak shape. Diffusion coefficient of components in the mobile phase and stationary phase is an important kinetic parameters influencing the plate height. There is relationship between diffusion coefficient and column tenderness [12]:

D

D0 ˜ exp(

E ) RT

(3)

D0 is the diffusion coefficient of column temperature approaching infinity. E is diffusion activation energy. R is gas constant. It can be seen from the formula (3), with decreasing temperature, diffusion coefficient decreased sharply. At low column temperature, the diffusion coefficient of components in the stationary phase and mobile phase is very small, and the longitudinal diffusion have a little effect comparing to plate height. Transfer mass resistance is very large due to the diffusion coefficient is so small. The transfer mass resistance has become the most important factor affecting plate height. According to Fan’s equation, the transfer mass resistance and the velocity of carrier gas is proportional, in other words, only under the condition of low carrier gas velocity, can transfer mass process han enough time. Through reducing the carrier gas flow rate, the transfe mass resistance reduced, which greatly improved chromatographic peak shape, and increase the degree of adjacent peaks. Figure 4 is chromatogram peak of methanol and ethanol under the column temperature of 60 °C and carrier gas velocity of 15 cm·s-1. It can be seen from the figure 4 that methanol peak shape is improved greatly, and the separation of methanol, ethyl acetate and a large number of ethanol is well too.

Simultaneous Analysis of Methanol, Ethyl Acetate and Fusel Oil in Wine | 1257

3.3 GC Quantitative Analysis External standard peak method is used to GC Quantitative analysis. The concentration of methanol, ethyl acetate, sec-butyl alcohol, normal propyl alcohol, isobutanol, n-butyl alcohol, isoamyl alcohol in the standard solution is 1μg, 2μg, 4μg, 8μg, 10μg,15μg, 20μg·ml-1 respectively. Calculates the linear regression of the peak height Y the sample concentration X. The regression curve are shown in table 1. It shows that the correlation coefficients of regression equation are above 0.97. Add a certain amount of the standard solution into wine samples, then calculate recovery rate. The recovery rate is over 95%.

3.4 The Actual Samples According to the methodhe established above, with the acetone as internal standard substances, we measured the content of methanol, ethyl acetate and fuel oil in the wine that commercially available. The content shows in table 2. The detection samples I and II had been shown that the content of alcohol and fusel oil is less than the national standard limit.

Fig. 1: Methyl, ethyl acetate and fuel oil chromatogram

1258 | Yu-Hong Chen, Si-Qian Hu, Xing Qi, Tian-Rong Zhu, Hou-Tun Fu and Fang Tan

Fig. 2: Methanol and ethanol chromatograms under column temperature 60°C, carrier gas velocity 42cm.s-1

Fig. 3: Methanol and ethanol chromatograms under column temperature 30°C, carrier gas velocity 42cm.s-1

Simultaneous Analysis of Methanol, Ethyl Acetate and Fusel Oil in Wine | 1259

Fig. 4: Methanol and ethanol chromatograms under column temperature 60°C, carrier gas velocity 15cm.s-1 Table 1: The regression equation and linear range of methanol, ethyl acetate and fusel oil standard solution sample

regression equation

R2

the linear range of regression equation (μg·ml1 )

ethyl acetate

Y =1.2329 + 15.217X

0.9974

1 - 20.0

methyl alcohol

Y =117.81+ 10.218X

0.9977

1 - 20.0

sec-butyl alcohol

Y =187.97 + 50.9X

0.9797

1 - 20.0

normal propyl

Y =936.14+ 48.163X

0.9782

1 - 20.0

isobutyl alcohol

Y =310.82 +79.573X

0.9831

1 - 20.0

normal butanol

Y =165.89 + 66.866X

0.9731

1 - 20.0

isoamyl alcohol

Y =266.71 + 23.88X

0.9811

1 - 20.0

Table 2: The content of methanol and fusel oil in alcoholic liquor sample

ethyl acetate

methyl alcohol

secbutyl alcohol

normal propyl alcohol

isobutyl alcohol

normal butanol

isoamyl alcohol

I

0.058

0.0066

0.0040

0.018

0.009

0.0050

0.019

II

0.074

0.0070

0.0016

0.088

0.013

0.0016

0.033

1260 | Yu-Hong Chen, Si-Qian Hu, Xing Qi, Tian-Rong Zhu, Hou-Tun Fu and Fang Tan

4 Conclusion The experimental results shows that this method are high sensitivity, precision and accuracy, and easy to be operated, suitable to be used for determination content for methanol, ethyl acetate and fuel oil in liquor. Acknowledgement: This work was financially supported by open projects funded by Institute of WuHan Studies (IWHS 2016216) and Science and technology project of WuHan City Technology Bureau (No. 2014022905011274).

Reference [1] [2] [3] [4] [5] [6] [7] [8] [9] [10] [11] [12]

Chen Fa-he, Wu Guang-bin. Food science, 2007, 28(1): 232-233 lu Zhen-hua, Yang Qiu-ming, Peng Ying. Food research and development, 2006, 127(6).123-124 Peng Qing-tao, Wang li. Chemical analysis measurement, 2007, 16(1):33-34 Xu Qing-qin, Du Li-ming, Li Lin-gxin. Journal of shanxi normal university (natural science edition), 1998, 12(2):43-45 Zhang Qing-sheng. Chinese journal of health inspection, 2005, 15 (10): 12361 Hu Hong-mei, Xie Hong-bin, Zhou Ling. Practical preventive medicine, 2004, 1 1(4):825 -826. Liu Xiao-yue. China health inspection, 2002, 11 (3):363-364. Xu Guo-wang, Lou Pei-zhang, chromatography, 1991, 9(4):217. Fu Hou-tun, Feng Yu-qi, Zhao Li-min, Liu Li... Analytical instruments, 2000, 3:12-14. GB/T5009.48-1996. Lu Pei-zhang, Dai Chao-zheng, Zhang Xiang-min. Chromatographic theory [M]. Shanghai: science press, 1998. Fang Jun-xin, Liu Dong. Solid state physics [M]. Shanghai: Shanghai science and technology press, 2005:201.

Zhi-Yuan Wu1, Shu-Hui Wang2, Xin-Li Tian3, Xiu-Jian Tang4 and JunWei Yang5

Influence on Wetting Performance by Polarity Difference between Organic Acid and Organic Alcohol

Abstract: Wettability is one of the greatest characteristics of solid surface, and has important effect in industrial and agricultural production and daily life of people. In this paper, wetting characteristics of normal acid and alcohol with different carbon number on surfaces of monocrystal silicon, platinum sheet and stainless steel are inspected. Experiment result shows that organic acid with high polarity can obtain wetting effect better than that organic alcohol on surfaces of three types of solid in the condition of the same carbon number. By performing qualitative analysis on liquid polarity and solid polarity, it can be found that the decisive factor of wetting effect difference is the difference between liquid polarity and polarity of surface of wet solid. Increasing the polarity difference within certain range can obtain good wetting effect. Keywords: Polarity Difference; Wetting; Organic Acid; Organic Alcohol; Monocrystal Silicon

1 Introduction Wetting is an important surface phenomenon, has great significance on industries of lubrication, coating and washing, and is one of important directions for academic studies [1-2]. Generally, the explanation for wetting phenomenon is young's equation, and wetting phenomenon is reduced to the result of comprehensive effect of three interface force—liquid-solid, liquid-gas and solid-gas force [3]. However, as

|| 1 National Key Laboratory for Equipment Remanufacturing, Academy of Armored Force Engineering, Beijing, 100072, China. e-mail:[email protected] 2 Department of Scientific Research, Academy of Armored Force Engineering, Beijing, 100072, China. e-mail:[email protected] 3 National Key Laboratory for Equipment Remanufacturing, Academy of Armored Force Engineering, Beijing, 100072, China. e-mail:[email protected] 4 National Key Laboratory for Equipment Remanufacturing, Academy of Armored Force Engineering .Beijing, 100072, China. E-mail: [email protected] 5 National Key Laboratory for Equipment Remanufacturing, Academy of Armored Force Engineering, Beijing, 100072, China 10.1515/9783110516623-124 DOI 10.1515/9783110303568-124

1262 | Zhi-Yuan Wu, Shu-Hui Wang, Xin-Li Tian, Xiu-Jian Tang and Jun-Wei Yang liquid-gas and interface tension is difficult to directly measure, in-depth study of the field is affected. In this paper, polarity quoted is a specific property of matter, and has great significance for adsorption and wetting phenomena. In this paper, by respectively performing wetting experiments of normal acid and alcohol with different carbon chain lengths on surfaces of monocrystal silicon, platinum sheet and stainless steel, the variation rule of wetting angles is inspected, and analysis is performed on the mechanism of producing error through polarity property.

2 Influence on Wetting Performance by Polarity Difference between Organic Acid and Organic Alcohol 2.1 Contrastive Analysis on Polarity of Organic Acid and Organic Alcohol HLB value is an equilibrium value of matter hydrophily and lipophilicity, and is the balance of size and power of lipophilic group and hydrophilic group which are opposite to each other. The polarity and HLB value of organic matter have obvious relativity, the more the HLB value is, the better the polarity and hydrophily of soild are, so that it can be believed that the higher the HLB value is, the higher the polarity of organic matter is. HLB values of organic acid and organic alcohol used for experiments can be computed through a structure factor method [7], and specific algorithm is as shown in the following formula: HLB=7+∑ (cardinal number of hydrophilic group) + ∑ (cardinal number of lipophilic group) (1) Carboxyl-COOH is a hydrophilic group of organic acid, and the cardinal number is 2.1. The hydrophilic group of organic alcohol is carboxyl-OH, and the cardinal number is 1.9. According to the formula 1, we can see that the HLB value of organic acid is always greater than that of organic alcohol in the condition of the same carbon number, so that it can be concluded that the polarity of organic acid is greater than that of organic alcohol in the condition of the same carbon number. From the formula 1, we can deduce that the polarity of molecule with high carbon number is small in the condition of the same functional group, namely organic acid or organic alcohol with small carbon value has higher polarity.

Influence on Wetting Performance Organic Acid and Organic Alcohol | 1263

2.2 Contrast of Wetting Characteristics of Acid and Alcohol on Surfaces of Monocrystal Silicon Monocrystal silicon is a monocrystal of silicon, a crystal with a basically complete lattice structure, and a typical nonpolar material. Select normal organic acid and organic alcohol with the carbon number being 4-9 to perform wetting experiments on the surface of monocrystal silicon, and inspect the variation rule of wetting angles. Experiment result is as shown in Fig.1:

Fig. 1: Contrast of wetting conditions of alcohol and acid on surfaces of monocrystal silicon

From Table 1 it can be seen that wetting curves of all alcohol on the surface of monocrystal silicon are above that of acid. It can be believed that wetting of alcohol is poorer than that of acid in the condition of the same carbon number, namely acid wettability with high polarity on the surface of nonpolar monocrystal silicon is better than that of organic alcohol with low polarity. However, for the two types of reagents, the optimum wetting points exist. Organic acid adopts enanthic acid, and organic alcohol adopts capryl alcohol.

2.3 Contrast of Wetting Characteristics of Acid and Alcohol on Surface of Platinum Sheet Platinum is a type of transition metal, very stable in chemical property, not dissolved in strong acid and strong alkaline solution, and not oxidized in the air, so that platinum sheet is selected in this section to be taken as wet material to be experimented. Organic matter is consistent with wetting agent for surface of monocrystal silicon.

1264 | Zhi-Yuan Wu, Shu-Hui Wang, Xin-Li Tian, Xiu-Jian Tang and Jun-Wei Yang

Fig. 2: Contrast of wetting conditions of alcohol and acid on surface of platinum sheet

From Fig.2 it can be seen that the wetting condition on the surface of platinum sheet and the wetting condition on the surface of monocrystal silicon have certain similarity, the wetting curves of all alcohol on the surface of monocrystal silicon are above that of acid. Wetting of alcohol is still poorer than that of acid in the condition of the same carbon number. But the difference is that organic alcohol has convex inflection points, and the mechanism of the inflection points awaits further research.

2.4 Contrast of Wetting Characteristics of Acid and Alcohol on Surface of Stainless steel. From Fig.3 it can be seen that the wetting rule on the surface of stainless steel is similar to the wetting characteristic on the surface of platinum sheet which is metal material too, and the difference is only that the wetting angles of the two are different. The experiment phenomena shall be analyzed through three solid polarities as follows.

Influence on Wetting Performance Organic Acid and Organic Alcohol | 1265

Fig. 3: Contrast of wetting conditions of alcohol and acid on surface of stainless steel

3 Analysis on Influence on Wetting Property by Solid Surface Polarity Electronegativity of bonding atoms of monocrystal silicon is completely the same, and the bonding atoms adopt nonpolar solid. Similarly, forming valence bonds in platinum atoms in platinum sheet are completely the same, and polarity does not exist. However, as the electron cloud on the surface of the platinum metal bond is different and shifted, platinum sheet has certain polarity. Similarly, the electron cloud on the surface of stainless steel which is also metal is different and shifted, certain polarity is produced. In addition, stainless steel comprises multiple elements which can form polar bonds, so that the polarity of the stainless steel, platinum sheet and monocrystal silicon is reduced in sequence. By averaging experiment results of organic acid and organic alcohol with different carbon chain lengths, it can be seen that the variation rule of the wetting angles of of three solid surfaces is as shown in Fig. 4.

1266 | Zhi-Yuan Wu, Shu-Hui Wang, Xin-Li Tian, Xiu-Jian Tang and Jun-Wei Yang

Fig. 4: Wetting of alcohol on different solid surfaces

Fig. 5: Wetting of acid on different solid surfaces

From Fig.4 and Fig.5, it can be easily seen that alcohol and acid obtain the optimum wetting effect on the surface of monocrystal silicon with the smallest polarity, and are poor in wetting effect on the surface of stainless steel with the largest polarity. Author thinks that the polarity difference between liquid interface and solid interface cause the phenomenon. Acid and alcohol with certain polarity can obtain the largest polarity difference on monocrystal silicon, so that the wetting effect is enhanced. The polarity difference between acid and alcohol is weakened on stainless steel with large polarity, so that the wetting effect is relatively poor.

4 Summary When solid is fixed, the wetting effect of organic acid with large polarity is better than that or organic alcohol in the condition of the same carbon number.

Influence on Wetting Performance Organic Acid and Organic Alcohol | 1267

Organic acid can have different wetting rules on the surface of nonpolar monocrystal silicon and the surface of polar metal. The decisive factor of wetting effect difference is the difference between liquid polarities of the polarity of wet solid surface. Large difference with in experiment range can obtain good wetting effect. Acknowledgement: The research supported by National Natural Science Foundation of China (Project number: 51275527).

References [1]

[2] [3]

Jianjun Jiang, Qiang Guo, Bailing Wang, Research on variation of static contact angle in incomplete wetting system and modeling method.Colloids and Surfaces A: Physicochemical and Engineering Aspects. 504 ( 2016) 400-406 Zhangxin Wang, Jian Jin, Deyin Hou,Tailoring surface charge and wetting property for robust oil-fouling mitigation in membrane distillation. Journal of Membrane Science.(2016)113-122 Dimitra Aslanidou, Ioannis Karapanagiotis, Costas Panayiotou. Tuning the wetting properties of siloxane-nanoparticle coatings to induce superhydrophobicity and superoleophobicity for stone protection. Materials & Design. 108 ( 2016) 736-744

A-Ling Song1, Yi-Xuan Wang2, Hui-Lin Su and Hai-Feng Liu

Evaluation and Application of Poverty Index Water Based on Principal Component Analysis Abstract: The water poverty index (WPI) is a holistic and objective reflection of the relationship between degree of water shortage and development of social economy. Based on the analysis of the classical WPI evaluation model, the model is optimized by the principal component analysis method. Then, an optimized WPI evaluation model based on PCA is proposed, and the experimental results verify the validity of the proposed model. When the optimization model is applied to the water resources data of Beijing region, the efficiency of WPI evaluation is improved by about 4%.On the other hand, the optimization model is used to evaluate the WPI values of different urban and rural areas, and the results are satisfactory. On this basis, this paper designs the water environment prediction model and the Shan-gan-ning district was tested for the local future water resources situation and provides theoretical support. Keywords: water scarcity, entropy weight, principal component analysis, sensitivity analysis

1 Introduction The water poverty index (WPI) is an interdisciplinary approach to assess water stress, in such a way as to link physical estimates of water availability with the socio-economic drivers of poverty. Accurate assessment of water resources has an important realistic demand for social development. At present, there are some scholars in this area. In the work by LI Jing-zhi et al. [1], they built the supply and demand model of water resources by using system dynamic software STELLA to simulate the supply and demand situation of water resources in Anhui from 2012 to 2030.Then they put forward some measures to deal with the problem of water resources. Based on the improved ecological footprint model of water resources. In the work by Zhang Yi et al. [2], they calculates the ecological footprint of Guangxi water resources from 2003-2010 which makes the calculation results in line with the local water resources environment. Based on the principle of nonlincar multi-objective programming a model for optimal allocation of regional water resources with multiconsumers was developed in Sun Zhi-linet a [3]. Work and more the validity and || 1

Institute of Sciences, PLA University of Science and Technology, Nanjing, 210007, China School of software, Yunnan University, Kunming, 650500 China. e-mail:[email protected]

2

10.1515/9783110516623-125 DOI 10.1515/9783110303568-125

1270 | A-Ling Song, Yi-Xuan Wang, Hui-Lin Su and Hai-Feng Liu adaptability of the model are verified by experiments. Based on water footprint theories, K Huanget al. [4] used the calculation methods of water footprint were compared, and their applications progress were summarized. In this paper, three methods were used to evaluate the water resources, and the suggestions for optimizing water resources were given. Based on the fuzzy entropy weight model comprehensive evaluation method, Han Yun-hong et al [5]. Evaluated the water resources carrying capacity of Fuyang City, Anhui Province in 2009-2013, and more obtained the conclusion that the water resources carrying capacity is close to saturation. But the related research in data mining is more or less the existence of defects, in particular, the corresponding mathematical model of the corresponding information content is relatively small. In this paper, based on the above related research, with the aid of the principal component analysis method, the optimization of the classical water resources model makes the data processing more close to the reality.

2 Analysis on the Basic Factors of WPI Evaluation System Generally speaking, WPI is composed of 5 key issues, which are essential to the assessment of water provision. Key components of the WPI have been identified as: Resource(R) - Physical availability of surface and ground water; Access (A) - The extent of access to this water for human use; Capacity(C) - The effectiveness of people’s ability to manage water; Use (U) - The ways in which water is used for different purposes; Environment (E) - The need to allocate water for ecological services. Through the inclusion of these dimensions, we are able to capture some measure of the complexity of water management. The WPI is primarily designed to provide a tool by which water managers can evaluate the water situation in different locations in a holistic way. Such a tool will allow comparisons to be made between communities, and this will enable decisions to be made in a transparent and consultative way. In addition, if implemented in such a way as to generate time series data, the tool can be used to monitor progress over time. According to the authority data, taking the current social and economic development level into account, water safety can be divided into five classes by the WPI value [6]:

Evaluation and Application Principal Component Analysis | 1271 Table1: Wpi Value, Corresponding Class and Description WPI value

Class

Description

WPI>62

Very safe

Water resources and water environment system is in harmony with the social and economy system and operate efficiently. The degree of satisfaction is the highest.

56