Iguanas : Biology and Conservation [1 ed.] 9780520930117, 9780520238541
In what is certain to be the key reference on iguanas for years to come, some of the world's leading experts offer
205 27 4MB
English Pages 374 Year 2004
Recommend Papers
![Population Genetics for Animal Conservation (Conservation Biology) [1 ed.]
0521866308, 9780521866309, 0521685370, 9780521685375](https://ebin.pub/img/200x200/population-genetics-for-animal-conservation-conservation-biology-1nbsped-0521866308-9780521866309-0521685370-9780521685375.jpg)
![Iguanas : Biology and Conservation [1 ed.]
9780520930117, 9780520238541](https://ebin.pub/img/200x200/iguanas-biology-and-conservation-1nbsped-9780520930117-9780520238541.jpg)
- Author / Uploaded
- Allison C. Alberts
- Ronald L. Carter
- William K. Hayes
- Emilia P. Martins
File loading please wait...
Citation preview
Iguanas : Biology and Conservation,
Copyright © 2004. University of California Press. All rights reserved.
Copyright © 2004. University of California Press. All rights reserved.
IGUANAS
Iguanas : Biology and Conservation, University of California Press, 2004. ProQuest Ebook Central,
Copyright © 2004. University of California Press. All rights reserved. Iguanas : Biology and Conservation, University of California Press, 2004. ProQuest Ebook Central,
IGUANAS Biology and Conservation
Copyright © 2004. University of California Press. All rights reserved.
Edited by Allison C. Alberts, Ronald L. Carter, William K. Hayes, and Emília P. Martins
UNIVERSITY OF CA LIF ORNIA PRESS Berkeley Los Angeles London
Iguanas : Biology and Conservation, University of California Press, 2004. ProQuest Ebook Central,
Plate credits Frontispiece: Bartsch’s iguana, Cyclura carinata bartschi. Part I opening: Cuban iguana, Cyclura nubila nubila. Part II opening: Green iguana, Iguana iguana, from Anguilla. Part III opening: Andros Island iguana, Cyclura cychlura cychlura. All © 1999 and 2000 by John Bendon for Lizardwizard. These are not generic drawings. Each one is a representation of a real iguana. Working photographs taken by the illustrator with the exception of the Anguillan green iguana (photo by Glenn Gerber). All animals photographed in the wild except C. n. nubila, “Chuck,” which is an iguana known to the illustrator.
Copyright © 2004. University of California Press. All rights reserved.
University of California Press Berkeley and Los Angeles, California University of California Press, Ltd. London, England © 2004 by The Regents of the University of California Library of Congress Cataloging-in-Publication Data Iguanas : biology and conservation / edited by Allison C. Alberts . . . [et al.] p. cm. Includes bibliographical references (p. ) and index. ISBN 0-520-23854-0 (cloth : alk. paper) 1. Iguanas. I. Alberts, Allison. QL666.L25 I368 2004 597.95′42—dc21 2003003876 Manufactured in the United States of America 13 12 11 10 09 08 07 06 10 9 8 7 6 5 4 3 2 1
05
04
The paper used in this publication is both acid-free and totally chlorine-free (TCF). It meets the minimum requirements of ANSI/NISO Z39.48-1992 (R 1997).
Iguanas : Biology and Conservation, University of California Press, 2004. ProQuest Ebook Central,
CONTENTS
List of Figures / vii List of Tables / xi Preface / xv 1 • IGUANA RESEARCH: LOOKING BACK AND LOOKING AHEAD / 1
Gordon M. Burghardt
Part I • Diversity INTRODUCTION / 15
Copyright © 2004. University of California Press. All rights reserved.
Ronald L. Carter and William K. Hayes 2 • THE EVOLUTION OF IGUANAS: AN OVERVIEW OF RELATIONSHIPS AND A CHECKLIST OF SPECIES / 19
Bradford D. Hollingsworth
5 • TRACING THE EVOLUTION OF THE GALÁPAGOS IGUANAS: A MOLECULAR APPROACH / 71
Kornelia Rassmann, Melanie Markmann, Fritz Trillmich, and Diethard Tautz 6 • SODIUM AND POTASSIUM SECRETION BY IGUANA SALT GLANDS: ACCLIMATION OR ADAPTATION? / 84
Lisa C. Hazard
Part II • Behavior and Ecology INTRODUCTION / 97
Emília P. Martins 7 • BEHAVIOR AND ECOLOGY OF ROCK IGUANAS, I: EVIDENCE FOR AN APPEASEMENT DISPLAY / 101
Emília P. Martins and Kathryn E. Lacy 3 • GENETIC CONTRIBUTIONS TO CARIBBEAN IGUANA CONSERVATION / 45
Catherine L. Malone and Scott K. Davis
8 • BEHAVIOR AND ECOLOGY OF ROCK IGUANAS, II: POPULATION DIFFERENCES / 109
Ahrash N. Bissell and Emília P. Martins 4 • GENETIC STRUCTURE OF THE TURKS AND CAICOS ROCK IGUANA AND ITS IMPLICATIONS FOR SPECIES CONSERVATION / 58
Mark E. Welch, Glenn P. Gerber, and Scott K. Davis
9 • SEXUALLY DIMORPHIC ANTIPREDATOR BEHAVIOR IN JUVENILE GREEN IGUANAS: KIN SELECTION IN THE FORM OF FRATERNAL CARE? / 119
Jesús A. Rivas and Luis E. Levín
Iguanas : Biology and Conservation, University of California Press, 2004. ProQuest Ebook Central,
10 • DETERMINANTS OF LEK MATING SUCCESS IN MALE GALÁPAGOS MARINE IGUANAS: BEHAVIOR, BODY SIZE, CONDITION, ORNAMENTATION, ECTOPARASITE LOAD, AND FEMALE CHOICE / 127
William K. Hayes, Ronald L. Carter, Martin Wikelski, and Jeffrey A. Sonnentag 11 • ENVIRONMENTAL SCALING OF BODY SIZE IN ISLAND POPULATIONS OF GALÁPAGOS MARINE IGUANAS / 148
Martin Wikelski and Chris Carbone 12 • ENVIRONMENTAL INFLUENCES ON BODY SIZE OF TWO SPECIES OF HERBIVOROUS DESERT LIZARDS / 158
Christopher R. Tracy 13 • FACTORS AFFECTING LONG-TERM GROWTH OF THE ALLEN CAYS ROCK IGUANA IN THE BAHAMAS / 176
John B. Iverson, Geoffrey R. Smith, and Lynne Pieper
Part III • Conservation INTRODUCTION / 195
Allison C. Alberts 14 • TRANSLOCATION STRATEGIES AS A CONSERVATION TOOL FOR WEST INDIAN IGUANAS: EVALUATIONS AND RECOMMENDATIONS / 199
16 • SURVIVAL AND REPRODUCTION OF REPATRIATED JAMAICAN IGUANAS: HEADSTARTING AS A VIABLE CONSERVATION STRATEGY / 220
Byron S. Wilson, Allison C. Alberts, Karen S. Graham, Richard D. Hudson, Rhema Kerr Bjorkland, Delano S. Lewis, Nancy P. Lung, Richard Nelson, Nadin Thompson, John L. Kunna, and Peter Vogel 17 • CONSERVATION OF AN ENDANGERED BAHAMIAN ROCK IGUANA, I: POPULATION ASSESSMENTS, HABITAT RESTORATION, AND BEHAVIORAL ECOLOGY / 232
William K. Hayes, Ronald L. Carter, Samuel Cyril, Jr., and Benjamin Thornton 18 • CONSERVATION OF AN ENDANGERED BAHAMIAN ROCK IGUANA, II: MORPHOLOGICAL VARIATION AND CONSERVATION PRIORITIES / 258
Ronald L. Carter and William K. Hayes 19 • THE ROLE OF ZOOS IN THE CONSERVATION OF WEST INDIAN IGUANAS / 274
Richard D. Hudson and Allison C. Alberts 20 • ECOTOURISM AND ITS POTENTIAL IMPACT ON IGUANA CONSERVATION IN THE CARIBBEAN / 290
Charles R. Knapp
Charles R. Knapp and Richard D. Hudson
Copyright © 2004. University of California Press. All rights reserved.
Literature Cited / 303 15 • TESTING THE UTILITY OF HEADSTARTING AS A CONSERVATION STRATEGY FOR WEST INDIAN IGUANAS / 210
List of Contributors / 339 Index / 343
Allison C. Alberts, Jeffrey M. Lemm, Tandora D. Grant, and Lori A. Jackintell
Iguanas : Biology and Conservation, University of California Press, 2004. ProQuest Ebook Central,
Copyright © 2004. University of California Press. All rights reserved.
FIGURES
1.1.
Growth rates of hatchling iguanas in two populations on ranches in the Venezuelan llanos 7
1.2.
Nocturnal hopping behavior in a hatchling green iguana after emerging from a nest hole on moonlit nights 11
3.3.
Phylogenetic relationships of Cyclura cychlura 49
3.4.
Phylogenetic relationships between Iguana iguana lineages 50
3.5.
Relationship between island size and genetic diversity 54
2.1.
Generic-level relationships within Iguanidae 20
4.1.
Map of the Turks and Caicos Islands 59
2.2.
Generic-level relationships within Iguanidae 21
4.2.
Correlograms depicting results of Mantel’s tests performed on different distance classes 66
2.3.
Interspecific relationships of Sauromalus 23
4.3.
Scatterplot of FST estimates against geographic distances separating each pairwise combination of Cyclura carinata carinata populations from the Caicos Islands 66
5.1.
The 50% majority rule consensus tree obtained from maximum parsimony, neighbor joining, or maximum likelihood bootstrap analyses of data from the nine iguanid genera 72
2.4.
Interspecific relationships of Ctenosaura 24
2.5.
Interspecific relationships of Cyclura 25
3.1.
Biogeographic distribution of Cyclura 46
3.2.
Sequence divergence among various taxa 49
vii
Iguanas : Biology and Conservation, University of California Press, 2004. ProQuest Ebook Central,
5.2.
The Galápagos archipelago, the sampling locations of marine and land iguana populations, and the geographical distribution of iguana mitochondrial lineages 73
10.1.
Relationships between male body size and measures of relative mating success in male marine iguanas exhibiting territorial behavior 135
5.3.
Comparison of the level of mitochondrial and nuclear genetic differentiation among marine iguana populations from the three parts of the archipelago 81
11.1.
Maximum condition index for male marine iguanas on Santa Fé 151
11.2.
The temperature profile over twenty-four hours resulting from the model analysis 151
11.3.
The maximum bite rate of marine iguanas during daily foraging trips 154
11.4.
Percentage of subtidal foraging over the fourteen-day tidal cycle, plotted against operative temperatures on two islands 156
11.5.
Maximum body mass in marine iguanas in relation to two environmental parameters— average annual operative temperature and algae pasture height 156
12.1.
Species ranges for Sauromalus obesus and Dipsosaurus dorsalis
6.1.
Copyright © 2004. University of California Press. All rights reserved.
7.1.
Range of relative sodium and potassium secretion for iguanids and other lizards 90 Proportion of displays produced in each social context 105
7.2.
Examples of typical headbob displays given in the three different contexts 106
8.1.
Map of study area showing location of twelve islands in Chalk Sound and two islands to the north of Providenciales 111
8.2.
Average number of displays/hour produced by males on different islands and island clusters 113
159
8.3.
Scatterplot of island means showing iguana display frequencies and vegetative diversity 116
12.2.
Headless body length versus elevation of Sauromalus obesus and Dipsosaurus dorsalis 161
8.4.
Scatterplot of island means showing male iguana display frequencies with vegetation height 117
12.3.
Headless body length versus latitude of Sauromalus obesus and Dipsosaurus dorsalis 161
9.1.
Test arena for simulated predator presentations to juvenile green iguanas 121
12.4.
Size distributions of Sauromalus obesus 162
12.5. 9.2.
Frontal view of the hawk model presented to juvenile green iguanas 122
Snout-vent length, head length, and headless body length for the largest 20% each of males and females of Dipsosaurus dorsalis 169
viii
FIGURES
Iguanas : Biology and Conservation, University of California Press, 2004. ProQuest Ebook Central,
12.6.
12.7.
170
Scattergram of headless body length versus latitude for Dipsosaurus dorsalis specimens
170
12.8.
Size distributions of Dipsosaurus dorsalis 171
12.9.
Annual windows of potential activity for Sauromalus obesus and Dipsosaurus dorsalis at two elevations 172
13.1.
Map of the study islands in the Allen Cays, northern Exuma Islands, Bahamas 178
13.2.
Relationship between age and body size for U Cay and Leaf Cay iguanas 180
13.3.
Relationship between age and body size for female and male iguanas from Leaf Cay and U Cay 183
13.4.
Relationship between mean snoutvent length at first and second capture and growth rate for female and male iguanas with full tails from U Cay and Leaf Cay 184
13.5. Copyright © 2004. University of California Press. All rights reserved.
Scattergram of headless body length versus elevation for Dipsosaurus dorsalis specimens
13.6.
Comparisons of the relationship between mean snout-vent length at first and second capture and growth rate for female and male iguanas with full tails from U Cay and Leaf Cay for the 1980s versus the 1990s 190 Comparisons of the relationship between mean snout-vent length at first and second capture and growth rate for female and male iguanas with full tails from the 1980s and the 1990s from U Cay versus Leaf Cay 191
15.1.
Changes in antipredator behavior of forty-five captive juvenile Cuban iguanas and six captive juvenile Jamaican iguanas over time 214
15.2.
Snout-vent length of forty-two wild juvenile Cuban iguanas estimated to be between six and twenty-two months and of fortyfive captive juvenile Cuban iguanas from hatching through twenty months 216
15.3.
Postrelease changes in snout-vent length of four headstarted juvenile Cuban iguanas compared with snout-vent lengths of seventy-nine wild Cuban iguanas estimated to be of a similar age 216
16.1.
Schematic map of the core iguana area and mammal trapping trail, Hellshire Hills 223
16.2.
Growth in snout-vent length and body mass of male and female headstarted iguanas at the Hope Zoo in Kingston, Jamaica, from birth to nine years 225
17.1.
Distribution of Cyclura in the Bahamas, including the three subspecies of Cyclura cychlura and the three subspecies of C. rileyi 233
18.1.
Relationships between log body mass and log snout-vent length in adults of three subspecies of Cyclura rileyi, and in adults of C. r. rileyi captured in 1995 260
18.2.
Canonical plot of the discriminant function scores for each individual of the three subspecies of Cyclura rileyi 268
FIGURES
Iguanas : Biology and Conservation, University of California Press, 2004. ProQuest Ebook Central,
ix
18.3.
19.1.
Poster produced through the Fort Worth Zoo for the IUCN Iguana Specialist Group, highlighting the conservation status of West Indian iguanas 287 Sign warning against bringing domestic pets to an island and advertising the protected status of
an iguana population in the Exuma Islands, Bahamas 296 20.2. Collapsed iguana burrow caused by foot traffic on an iguana-inhabited island in the Exuma Islands, Bahamas 297 20.3.
Abnormally high-density iguana population of the Allen Cays iguana (Cyclura cychlura inornata), caused by tourists feeding the animals 299
Copyright © 2004. University of California Press. All rights reserved.
20.1.
Three-dimensional plot of the principal component scores for each individual of the three subspecies of Cyclura rileyi 268
x
FIGURES
Iguanas : Biology and Conservation, University of California Press, 2004. ProQuest Ebook Central,
TABLES
3.1.
Impact of taxa extinction on genetic diversity of genus 52
3.2.
Summary of microsatellite data
4.1.
PCR primer sequences used
Copyright © 2004. University of California Press. All rights reserved.
4.2.
55
6.2.
Role of salt gland in lizard electrolyte budgets 87
6.3.
Distribution of salt glands among lizards 88
7.1.
Behavior of recipient immediately after each display type 105
7.2.
Comparison of total number of headbobs produced by iguanas on different islands 106
7.3.
Comparison of mean display structure for the three display types 107
8.1.
Mean values and sample sizes of behavioral characteristics for the twelve Chalk Sound islands studied 113
8.2.
Mean values and sample sizes of morphological characteristics of each iguana population on the twelve Chalk Sound islands studied 114
8.3.
Mean values of island area and vegetation characteristics for the
61
Islands in the Turks and Caicos from which blood samples of Cyclura carinata carinata were collected 62
4.3.
Results from AMOVA
64
4.4.
Results of Mantel’s tests
5.1.
Variable positions observed in marine iguana cytochrome b sequences 78
65
5.2.
Variable positions observed in land iguana cytochrome b sequences 79
5.3.
Summary statistics of cytochrome b variation in the marine and land iguana 79
6.1.
Ion content of lizard plasma and energy, water, and ion contents of selected food items of lizards 86
xi
Iguanas : Biology and Conservation, University of California Press, 2004. ProQuest Ebook Central,
islands of Santa Fé and Genovesa, Galápagos 153
twelve Chalk Sound islands studied 115 8.4.
Correlation coefficients for each pairwise comparison of island habitat characteristics and iguana morphology and behavior 116
11.2.
Cumulative performance over one tidal cycle of marine iguanas of three size categories on Santa Fé and Genovesa 155
9.1.
Responses by male and female juvenile green iguanas to the forward passage of a simulated hawk model 122
12.1.
Latitude, elevation, and sample size for the sites used in statistical analyses 160
12.2.
Plant species list for the six sites from which Sauromalus obesus was collected 163
13.1.
Recapture information by year for Allen Cays iguanas 179
13.2.
Body size of Allen Cays iguanas at early ages 179
13.3.
Snout-vent lengths of Allen Cays iguanas at intermediate ages 181
13.4.
Body mass of Allen Cays iguanas for samples in table 13.3 182
13.5.
Effects of tail breaks on the relationship between body size and growth rate for Allen Cays iguanas on Leaf and U Cays 185
13.6.
Longevity estimates for Allen Cays iguanas 186
13.7.
Asymptotes based on von Bertalanffy growth models for various subpopulations of Allen Cays iguanas 187
13.8.
Tail break frequencies for rock iguanas of the genus Cyclura
9.2.
Copyright © 2004. University of California Press. All rights reserved.
10.1.
Number of juvenile iguanas of each sex that were predated naturally in outdoor experimental enclosures 124 Correlation matrix for lekking male marine iguanas on Caamaño, Galápagos 134
10.2.
Coefficients and their significance for independent variables in the final stepwise regression models 136
10.3.
Factor loadings of each trait for four principal components 137
10.4.
Coefficients and their significance for principal components used as independent variables in regression models 138
10.5.
Comparison of body size and ectoparasite infestations of lekking marine iguanas from Caamaño and Santa Cruz 139
10.6.
Comparison of body mass and ectoparasite infestations of male marine iguanas residing on Caamaño at the start of the mating season and several months afterward 140
13.9. 11.1.
xii
Comparison of mean environmental parameters on the
Effects of decade on the relationship between body size and growth rate for Allen Cays
TA B L E S
Iguanas : Biology and Conservation, University of California Press, 2004. ProQuest Ebook Central,
188
iguanas with full tails on Leaf and U Cays 189 15.1.
Feeding behavior of thirty juvenile Cuban iguanas 215
15.2.
Comparison of antipredator behavior, thermoregulatory behavior, and number of ectoparasites in wild and released headstarted juvenile Cuban iguanas 217
16.1.
17.1.
Copyright © 2004. University of California Press. All rights reserved.
17.2.
Data at release and most recent observation for headstarted Jamaican iguanas repatriated into the Hellshire Hills between 1996 and 2001 226 Summary of annual conservation research activities on the three subspecies of Cyclura rileyi 234 Summary of ownership, and geographical and ecological features of cays inhabited by Cyclura rileyi cristata, C. r. nuchalis, and C. r. rileyi 236
17.3.
Population data for all known populations of Cyclura rileyi cristata, C. r. nuchalis, and C. r. rileyi 238
17.4.
Identified threats to extant populations of Cyclura rileyi cristata, C. r. nuchalis, and C. r. rileyi 239
17.5.
Proportion of marked iguanas resighted during Lincoln-Petersen surveys of Cyclura rileyi 240
17.6.
Numbers of C. rileyi cristata of three size classes (and of undetermined size) noted during classical strip surveys on White Cay 247
18.1.
Body size and ecological variables for iguanas sampled from all known populations of Cyclura rileyi cristata, C. r. nuchalis, and C. r. rileyi 261
18.2.
Descriptive statistics for iguanas sampled showing injuries 263
18.3.
Comparisons of femoral pore counts and scalation differences for populations of Cyclura rileyi cristata, C. r. nuchalis, and C. r. rileyi 266
18.4.
Factor loadings of each character for the three principal components 268
19.1.
Conservation status of West Indian rock iguana populations 275
19.2.
History of support by zoos for the Jamaican iguana recovery program 286
19.3.
Conservation activities by zoos on behalf of West Indian iguanas 288
20.1.
Caribbean countries with corresponding iguana taxa and total annual visitors from 1990 to 1995 293
TA B L E S
Iguanas : Biology and Conservation, University of California Press, 2004. ProQuest Ebook Central,
xiii
Copyright © 2004. University of California Press. All rights reserved.
This page intentionally left blank
Iguanas : Biology and Conservation, University of California Press, 2004. ProQuest Ebook Central,
Copyright © 2004. University of California Press. All rights reserved.
PREFACE
Iguanas are distinctive among lizards in their large body size and herbivorous diet. Most species live for several decades and may take years to reach sexual maturity. Because their social behavior is so varied and complex, ranging from systems in which adult males are strongly territorial to large groups that coexist peacefully, behavioral ecologists regard iguanas as model organisms for study. Indeed, their size, prehistoric appearance, and distinctive headbob displays ensure that they generate human interest wherever they are seen. For the most part, iguanas are found in the New World, with the majority of taxa occurring in North, Central, and South America, the Galápagos Islands, and the Antilles. However, there are notable exceptions: a single genus found on Fiji and Tonga, and two genera found on Madagascar. The South Pacific iguanas (genus Brachylophus), which have clear affinities to other iguanids, are thought to have arrived from the Americas by natural rafting on floating vegetation. The Malagasy forms Chalarodon and Oplurus together form a natural group, but their relationship to other iguanas is ancient and ambiguous. Evidence from plate tectonics theory suggests that this group may have descended from early stock differentiating in South America that reached Madagascar via Antarctica dur-
ing the breakup of Gondwanaland. The complex and intriguing biogeographic history of iguanas has long interested evolutionary ecologists and systematists. A large proportion of extant iguanas inhabit islands, with every genus represented by at least one insular form. Several genera are restricted entirely to islands (Amblyrhynchus, Brachylophus, Conolophus, Cyclura, Chalarodon, Oplurus). Because of their limited distribution and the vulnerability of the habitats in which they occur, most iguanids on islands are threatened or endangered, some critically. Together with habitat loss, predation by introduced mammals undoubtedly constitutes the greatest threat, although competition with livestock for food and trampling of nest sites are also significant problems. For mainland populations, habitat fragmentation and hunting pose the most serious dangers. This volume concentrates on three aspects of iguana biology: evolutionary diversity, behavior and ecology, and conservation. The chapters that follow not only represent a sampling of the exciting and innovative work that is currently being accomplished with iguanas today but also provide new ideas and inspiration for future study. This book originally grew out of a 1997 Herpetologists’ League symposium, “Biosystematics, Behavioral Ecology, and Conservation of
xv
Iguanas : Biology and Conservation, University of California Press, 2004. ProQuest Ebook Central,
Davis, Kevin de Queiroz, Ken Dodd, David Duvall, Leo Fleishman, Glenn Gerber, Rich Glor, Lee Greer, Lee Grismer, Kathy Hanley, Hank Harlow, Brad Hollingsworth, John Iverson, Tom Jenssen, Vaishali Katju, Chuck Knapp, Rosemary Knapp, Harvey Lillywhite, Matt Lovern, James Malcolm, Catherine Malone, Numi Mitchell, John Phillips, Bob Powell, Steve Reichling, Jesús Rivas, Jack Sites, Ron Swaisgood, Richard Tokarz, Bob Wiese, Tom Wiewandt, and Byron Wilson. Finally, thanks are due to Gordon Burghardt, who has conducted and inspired so much valuable iguana research over the years, and who kindly agreed to introduce this book, twenty years after he and Stan Rand first published their seminal volume on iguana biology. This book is dedicated to them. allison c. alberts, ronald l. carter, william k. hayes, and emília p. martins March, 2002
Copyright © 2004. University of California Press. All rights reserved.
Iguanas,” held at the University of Washington as part of the 77th Annual Meeting of the American Society of Ichthyologists and Herpetologists. Many of the participants in that symposium are contributors to this volume. The original idea for the book came from Bill Hayes and Ron Carter, who organized and chaired the symposium; Allison Alberts and Emília Martins were primarily responsible for the editing and preparation of text and graphics, respectively. The order of editorship is alphabetical, recognizing the equally important contributions made by all involved. We are grateful to Doris Kretschmer and the editorial team at the University of California Press for making this book a reality. The many colleagues who kindly agreed to review chapters and made invaluable suggestions for improvement also deserve special acknowledgment: Robin Andrews, Ahrash Bissell, Fred Burton, David Chiszar, Bill Cooper, David Cowles, Scott
xvi
PREFACE
Iguanas : Biology and Conservation, University of California Press, 2004. ProQuest Ebook Central,
1
Iguana Research LOOKING BACK AND LOOKING AHEAD
Gordon M. Burghardt
Copyright © 2004. University of California Press. All rights reserved.
The 1997 symposium
in Seattle on which the present volume is based was held exactly fifteen years after the publication of Iguanas of the World: Their Behavior, Ecology, and Conservation, which A. Stanley Rand and I edited (Burghardt and Rand, 1982). It was based on a symposium we organized that took place in 1979 at the combined Society for the Study of Amphibians and Reptiles/Herpetologists League (SSAR/ HL) meetings in Knoxville, Tennessee. Of the people attending and presenting at that conference, I am the only one who also presented in Seattle. Most of the other attendees have moved on to other topics, retired, or died. My current work has largely shifted away from iguanas as well, although not because of a lack of continuing interest in them. Nonetheless, I am honored to give the introductory presentation to this book largely devoted to the work of a new generation of iguana researchers. I am especially proud to be able dedicate this introduction to Stan Rand, who pioneered and facilitated the modern study of iguana behavior and contributed enormously to many areas of herpetology and tropical biology in general.
I was first asked to write a chapter introducing behavioral research in iguanas, and my original title was more specific than the one used here: “Sociality in Iguanas: Past, Present, and Future.” This title, representing Erda’s three daughters, was a poor choice, which I recognized as soon as I began to prepare my paper. The “present” is represented by the work in this volume, where it is amply reviewed. My own emphasis gravitated to the ends of the continuum: the “past” and the “future.” Even so I must be selective and have chosen to be somewhat personal as well. My own interest in iguanas originated in their remarkable social behavior, which became more astonishing to me as I came to know it. Thus, although this introductory chapter addresses a few other important topics in iguana biology, social behavior is clearly emphasized.
LOOKING BACK My fascination with the history of the study of animal behavior is long-standing (Burghardt, 1973, 1985a,b). Even when writing term papers as a graduate student I found that, too often,
1
Iguanas : Biology and Conservation, University of California Press, 2004. ProQuest Ebook Central,
Copyright © 2004. University of California Press. All rights reserved.
novel findings and claims were not original, and that the antecedents of present day knowledge were often unacknowledged, even when known! Thus, my historical foray here should not be a surprise. Interestingly, as my career has progressed, I am now part of that history in some small way. Shortly after receiving my Ph.D., I labored hard on an invited chapter titled “Chemical Perception in Reptiles” (Burghardt, 1970). I tried to review the entire area accurately, generously, and critically, paying homage to past research and researchers as objectively as possible from the published record, knowing few of the participants personally. It did turn out that I missed some papers, but not many. Published in 1970, that review was perhaps the most cited work of mine for more than twenty years. I tried to be thorough again in a review of learning in reptiles (Burghardt, 1977a); such critical reviews are hard work, especially when there is a substantial literature in a foreign language. I have benefited from similar critical reviews, and they serve an important function in the scientific enterprise. The danger is that a history lesson from a participant can be a chance to set the record straight on some issues and be somewhat self-serving. Conservation, a small part of our 1982 book, is now a major theme, and indeed now is a prime justification for behavioral research—or at least it should be (Sutherland, 1998). In this chapter, I briefly revisit some of the most important early contributions, place empirical and conceptual contributions on iguana behavior into the context of what was happening in ethology generally, and highlight some new themes I see developing as remarkable new tools become available for studying both new topics and revisiting old ones. Iguanas have been viewed as impressive tropical reptiles for many years. Relatively easy to maintain in captivity, they have impassively looked out of zoo enclosures at people for decades (Burghardt and Milostan, 1995). As little was known about their behavior in the field, the size and physiognomy of iguanas justified their presence. They were known to be vegetarians as
2
adults, and adults were what were primarily exhibited. We knew that Iguana and Brachylophus were arboreal dwellers in wet forest, Ctenosaura lived in drier woods and was less arboreal, Amblyrhynchus was a coastal marine forager, Dipsosaurus and Sauromalus were desert dwellers, and Cyclura and Conolophus lived on dry rocky islands. In the laboratory, Iguana iguana was a common subject, for a lizard, in physiological and behavioral experiments. Nonetheless, even for the most common iguanas, how they actually lived in the field, particularly their social behavior and life history, was quite unknown outside of opportunistic observations and shortterm studies. Perhaps the first careful study of the social behavior of an iguana was that of L. T. Evans (Evans, 1951) on Ctenosaura pectinata. It was one of the first demonstrations of social plasticity in squamate reptiles. Both dominance hierarchies and territoriality could be found. Evans was a pioneer in reptile ethology with a checkered career marked by innovative preliminary studies that were often published as abstracts in The Anatomical Record. Working out of the American Museum of Natural History, he was overshadowed by the prolific and highly visible experimental herpetologist G. K. Noble. In the early 1950s, however, Evans was often the person called on by comparative psychologists and ethologists to review reptile behavior. His paper, late in his career, documenting maternal behavior in Eumeces on motion picture film was prescient in anticipating the complexity of squamate reptile behavior (Evans, 1959). Reading this paper as a senior in high school convinced me that I needed to become a student of reptile behavior. Unfortunately, when I later discovered that most life history field work in herpetology was based on collecting large samples of animals, killing them, and weighing gonads, I was greatly disappointed. My switch from a college chemistry major to a focus on ethology was delayed three years. Evans was, in his seventies, a towering, stern, and somewhat unappreciated patriarch in the field of reptile ecology and behavior. At least that
GORDON M. BURGHARDT
Iguanas : Biology and Conservation, University of California Press, 2004. ProQuest Ebook Central,
Copyright © 2004. University of California Press. All rights reserved.
is how I remember him as a graduate student attending the first lizard ecology symposium in Missouri in 1965 (Milstead, 1967). At that meeting, I also first heard Stan Rand speak about his work on territoriality and ecology in Anolis lizards (Rand, 1967). I can clearly recall the content, his delivery, and his response to pointed questions—although this was before his iguana work and our collaboration—indeed, before I ever met him. Beginning in the 1950s, I. Eibl-Eibesfeldt, a student of Konrad Lorenz, wrote many of the first descriptive accounts by a traditionally trained ethologist of the behavior of amphibians, reptiles, and mammals. The early ethologists, who were more attracted to insects, fishes, and, especially, birds, had largely ignored these taxa. Eibl observed territorial defense behavior by marine iguanas on the Galápagos Islands (EiblEibesfeldt, 1955) and interpreted them with the then pioneering theories of Lorenz and other ethologists on ritualized combat. His book on the natural history of the Galápagos also contained considerable material on avian and nonavian reptiles (Eibl-Eibesfeldt, 1961). When I was a student first getting professionally interested in reptile ethology in the early 1960s, his work was an inspiration for those of us convinced that reptiles were underutilized in field and laboratory ethological work, and that iguanas could be particularly useful in studying important issues in behavior. When I spent a month at the Max Planck Institute at Seewiesen, near Munich, in West Germany in 1963, he was most encouraging. However, by then he was already beginning to move to the study of human ethology, to which he devoted most of the rest of his long and still ongoing career. About the time Eibl was at work on marine iguanas, Charles C. Carpenter began his long series of pioneering studies on lizard push-up displays and associated behavior involved in territorial defense and courtship. One of his first papers was on desert iguanas, Dipsosaurus dorsalis (Carpenter, 1961). Carpenter took an explicitly comparative approach inspired by the classic work of Tinbergen, Baerends, and Lorenz. He
filmed and quantitatively compared displays of many lizards, mostly iguanids and agamids. Although studying many groups of lizards, at the 1979 symposium, he produced a comparative picture of the iguanas (Carpenter, 1982), though not attached to a phylogeny. It was augmented there by quantitative descriptions of displays in banded (Greenberg and Jenssen, 1982) and green iguanas (Distel and Veazey, 1982). Like Eibl-Eibesfeldt, Carpenter visited the Galápagos and studied the various land and marine iguanas (Carpenter, 1966). I still remember my excitement when I saw Carpenter’s huge orange land iguanas chomping down prickly pear cactus in the outdoor enclosures he had constructed at the University of Oklahoma Biological Station on the shores of Lake Texoma, Oklahoma, where he invited me to visit in the early 1960s. At this time I was keeping and observing a green iguana in my lab, but my focus was on garter snake feeding behavior, largely inspired by Carpenter’s outstanding dissertation on comparative ecology, and duly acknowledged elsewhere (Burghardt, 1970; Lyman-Henley and Burghardt, 1995). Chuck Carpenter inspired my career in multiple areas. Before the mid-1960s, Carpenter, Eibl, and Evans were about the only researchers working on squamate reptiles to incorporate ethological concepts in their work, and also to attend the International Ethological Conferences in Europe. Although their work has been superceded in many respects, the more recent innovative work of Emília Martins, Martin Wikelski, Allison Alberts, and other researchers, some of which is in this volume or cited below, must be read in conjunction with that of the early workers to both appreciate the growth in methodological and theoretical sophistication since the early days of 16-mm footage gathered at great expense, and to see the continuity of research efforts with modern comparative behavioral analyses (Martins, 1996; Martins and Lamont, 1998). As Bissell and Martins (this volume) point out, lizard displays may provide essential information of relevance to conservation. Beginning in the 1960s, green iguanas occupied center stage in field behavior studies of
IGUANA RESEARCH: LOOKING BACK AND LOOKING AHEAD
Iguanas : Biology and Conservation, University of California Press, 2004. ProQuest Ebook Central,
3
Copyright © 2004. University of California Press. All rights reserved.
iguanas for many years. Stan Rand took a research position at the Smithsonian Tropical Research Institute in Panama. Already a wellpublished scientist on diverse herpetological subjects (Rand, 1954, 1961, 1967) and a highly trained evolutionary biologist and ecologist, he was well poised to enthusiastically study the diverse and poorly understood neotropical herpetofauna. He was an early participant in the pioneering E. E. Williams initiative on anoline lizard ecology and behavior. However, even while collecting and observing dozens of species of Anolis, Stan began to observe the communal nesting behavior of female green iguanas on an islet off Barro Colorado Island called Slothia. His dramatic close-up filmed presentation at a herpetological meeting of the sequence of activities involved in nesting, including the competition among females, seemed to give a glimpse of what the behavior of dinosaurs must have looked like. I return to green iguanas later in this chapter. In the 1970s, field studies of diverse species of iguanas became more common. Here I just mention a few, emphasizing taxonomic diversity and authors included in the 1979 symposium. Neil Krekorian (Krekorian, 1977) studied homing in Dipsosaurus. Kristin Berry (Berry, 1974) carried out a comprehensive study on social behavior in chuckwallas (Sauromalus obesus) in the American Southwest. Ted Case (Case, 1982) subsequently studied the gigantic insular species in Baja California, and documented that, in contrast to mainland forms, these iguanas were nonterritorial and nonaggressive, had much smaller clutch sizes, grew more slowly, and probably lived much longer and formed longterm monogamous bonds. Dagmar Werner (Werner, 1982) performed a heroic study of Galápagos land iguanas (Conolophus subcristatus) on Fernandina, documenting long-distance migrations and many other social phenomena. Dee Boersma (Boersma, 1982) supported the hypothesis that marine iguanas often sleep in piles to facilitate food digestion in an environment where burrows are scarce or absent. Walter Auffenberg (Auffenberg, 1982a) carried
4
out detailed long-term fieldwork on the foraging behavior of Cyclura. He documented that these lizards would eat fruits highly toxic to virtually all other land vertebrates. Tom Wiewandt’s dissertation (Wiewandt, 1977) on social systems and ecology of Cyclura cornuta stejnegeri was a pioneering attempt to apply current socioecology theory to iguana social systems; this was extended in the synthesis provided by Dugan and Wiewandt (1982). John Gibbons, soon to be killed in a tragic boating accident, not only reported the exciting discovery of a new and larger species of Brachylophus (B. vitiensis), but also documented its behavioral differences from the banded iguana, B. fasciatus (Gibbons and Watkins, 1982). These and many other accomplishments from the fertile period of excitement in the mid-1970s to mid-1980s could be cited, but enough research has been mentioned to show the diverse work accomplished on the entire group. To say more would risk slighting much important work and workers; Iguanas of the World still provides a useful review and bibliography of this period.
GREEN IGUANAS After a visit to Panama in 1973 to look at snake feeding behavior in taxa I had not previously observed, I became entranced by the much more common hatchling green iguanas all around the laboratory clearing on Barro Colorado Island (BCI). Encouraged and supported by Stan Rand, this led to many years of intensive fieldwork on green iguana behavior in Panama and Venezuela by undergraduate, graduate, and postdoctoral students from the United States, primarily from the University of Tennessee. Among the student and research assistants who contributed to this project from 1974 to 1990 were Carlos Avila, Brian Bock, Douglas Brust, Janis Carter, Erick Castillo, Vania da Silva, Hugh Drummond, Beverly Dugan, Douglas Eifler, Patricia Gutiérrez, Enrique Font, Alejandro Grajal, Harry Greene, Harold Herzog, Jr., Jose Him, Roberto Ibanez, Matthew Kramer, Maria Elena Leon, Laurie McHargue, Hebe Monteza, Vivian Paez,
GORDON M. BURGHARDT
Iguanas : Biology and Conservation, University of California Press, 2004. ProQuest Ebook Central,
Luis Paz, Diniz Ramos, Gordon Rodda, Sylvia Rojas-Drummond, Renee Rondeau, Argelis Ruiz, Barbara Allen Savitsky, James Schwartz, Frank Solis, Kathleen Troyer, and Dalixa Vianda. Eventually many other Central and South American students became involved as well. Kathleen Troyer from the University of California at Davis did her elegant dissertation work on iguana foraging on BCI. Dagmar Werner joined the effort in the early 1980s and, working with Tracy Barker, developed improved methods of incubating iguana eggs and rearing neonates in Panama before she moved to Costa Rica and established a foundation to promote iguana ranching. Incubating hundreds of eggs under varying conditions showed that sex ratios in iguana nests were not influenced by temperature or humidity, although aspects of hatchling composition, such as amount of lipids, were (see, e.g., Werner, 1988). Not altogether apparent to me at the time, this intensive research effort in Panama was both remarkable and diverse in the quality and enthusiasm of the participants. Much of the collected data still remains unpublished. In providing a short overview of the major findings on green iguana sociality and related topics, I emphasize the earlier work while also mentioning some of the subsequent studies that break new ground.
Copyright © 2004. University of California Press. All rights reserved.
NESTING DYNAMICS
Female iguanas nest once a year and lay a single clutch of eggs during a synchronized nesting period. The earliest detailed work was by Stan Rand, who described the highly seasonal nesting behavior of female iguanas and the nesting competition among them (Rand, 1968). Soils in the area are often very hard, and thus digging the initial burrow entrance is both hard work and worth defending. This setting was ideal for a subsequent study by Stan and his brother, Will, on the energetic costs of escalating agonistic communication displays during nesting, one of the first such studies in animal behavior (Rand and Rand, 1976). Upwards of one hundred females migrated to the small (0.3 ha) islet of Slothia off BCI and competed for nesting space
in an area less than 8 m × 6 m. Subsequent observations in Panama and elsewhere showed that such traditional communal nesting was common, perhaps fostered by limited open areas with well-worked soil in which digging was relatively easy compared with soil never excavated previously. Excavation of a number of nests at several sites established that the nest burrows can be quite complex, with numerous chambers, especially when the same entrance is used in successive years (Rand and Dugan, 1983). Nest guarding after egg deposition is somewhat controversial, although on Slothia, females often vigorously defended their filled burrows for a day or two before leaving the islet. Slothia and other small islands may be particularly attractive to iguanas because nest predation by mammalian terrestrial predators is absent, although crocodiles can be a threat (Dugan et al., 1981). Iguana females arriving at nest sites are extremely wary and prone to flight and departure from the area. Thus we developed a way to noose the iguanas from a blind for measuring, marking, and sometimes forced swallowing of radio transmitters. The timing of this was critical and only took place when iguanas were well into burrow construction. Individual animals had individual personalities it seemed, and these were consistent from year to year. Our data have not yet been systematically quantified to confirm these impressions, however. Nesting takes place during the dry season, with hatching generally timed to occur at the beginning of the wet season when young vegetation is plentiful (Harris, 1982; Rand and Greene, 1982), as is generally true of all iguanas (Wiewandt, 1982; Alberts, 2000). Nest sites have certain features, such as adequate sunlight to provide the heat necessary for successful incubation, as well as protection from flooding. The number of hatchlings emerging from Slothia was also monitored through direct observation and use of fencing around the entire clearing to enable capture and marking of hatchlings (Drummond and Burghardt, 1983). Tracking the number of iguanas nesting on Slothia for several years, along with estimates of average clutch
IGUANA RESEARCH: LOOKING BACK AND LOOKING AHEAD
Iguanas : Biology and Conservation, University of California Press, 2004. ProQuest Ebook Central,
5
size, also allowed estimates of productivity and mortality in the nest (Rand and Dugan, 1980). In one year, a very wet dry season reduced productivity from hundreds of hatchlings to twenty-five! Mark and recapture studies established that females would repeatedly return to Slothia from at least 1.4 km around BCI, although most came from shorter distances (Bock et al., 1985, 1989). Studies of nesting behavior, nest site fidelity, nest site requirements, and the roles of communication, competition, and energetics are needed in all other species to effectively tease apart the evolutionary and ecological processes involved in a most critical and conservation-salient phase in iguana life history.
Copyright © 2004. University of California Press. All rights reserved.
HATCHLING AND JUVENILE BEHAVIOR
From the blind established to observe the nesting females on Slothia, it was also possible to monitor the nest sites nearly continuously as hatching time approached at the onset of the wet season. Hatching turned out to be quite complex, in that animals emerged in groups, often from separate nest holes, interacted socially, and then departed the clearing, and eventually the islet, in groups (Burghardt, 1977b; Burghardt et al., 1977). Although initially our observations were of emergence during the day, we later discovered that much nest emergence took place at night (Drummond and Burghardt, 1983). Dispersal from the nest site was often rapid, especially as the hatching season progressed and predators were attracted to the area. Hatchlings would stay on the island for a few days and often seemed to form social groups that interacted with each other and then would swim rapidly across the water to the main land mass 10–100 m away, where both they and the adults lived (Burghardt et al., 1977; Drummond and Burghardt, 1982; Bock, 1984). Hatchlings dispersed about as far as did adult females. Green iguanas are herbivorous all their lives. It is also known that a microbial gut flora is essential for proper hindgut digestion of the animals’ low quality, hard-to-process diet (McBee and McBee, 1982), although nematodes have also
6
been suggested to be involved in digestion (Iverson, 1982). Troyer (1984a) showed that hatchling iguanas are attracted to eating feces from adults and this may be an adaptation to acquiring the essential microflora. The transmission of flora among neonates might also partially explain the tendency of the animals to group closely. Kin associations among neonates were demonstrated in captive animals (Werner et al., 1987). Iguanas in the field in both Panama and Venezuela were often found in groups for many months, and faster growth rates of iguanas found in groups on BCI were documented (Burghardt and Rand, 1985). Such neonatal sociality might be related to predator avoidance (Greene et al., 1978), as well as foraging advantages due to social facilitation or other processes facilitating feeding. Marked geographic differences in growth rates between animals from two ranches in the Venezuelan llanos during the same year (figure 1.1) were also found (G. Burghardt and G. Rodda, unpubl. data). Although about 100 km farther south, El Frio animals essentially ceased growth during late summer and early autumn. Regardless of whether temperature, food availability, or presence of parasites underlies the lower growth rates, the possible role of sociality in survival may be considerable. These data also show that appropriate plant diets may not be as ubiquitous in the wet tropics as might be supposed. Laboratory studies have established that the presence of adult males leads to stress and lower growth in hatchlings (Alberts et al., 1994) and this may be related to the size segregation found in field populations. Rodda (1991) and especially Rivas and Ávila (1996) developed means of reliably sexing neonate iguanas, and this led to the discovery that altruistic behavior of male hatchlings toward female hatchlings might be occurring (Rivas and Levín, this volume). The complexity of neonate iguana behavior continues to astound, and more field studies are needed. It is important, as the studies on hatchling behavior suggest, that mechanisms of behavior and adaptive outcomes both be considered when complex behavior is analyzed.
GORDON M. BURGHARDT
Iguanas : Biology and Conservation, University of California Press, 2004. ProQuest Ebook Central,
FIGURE 1.1. Growth rates of hatchling iguanas in two populations on ranches in the Venezuelan llanos.
Copyright © 2004. University of California Press. All rights reserved.
COURTSHIP AND MATING
Mating behavior in green iguanas was observed intensively by Dugan (1982a) on the drier, more open island of Flamenco on the Pacific Ocean side of Panama and later by Rodda (1992) on ranches in the llanos of Venezuela. Dugan (1982a) established that there were three classes of males. Large orange males establish and defend small central territories into which females moved and largely remained. Male headbob display rates peak during the territorial establishment and courtship stages. Males within a population have stable, individually distinct display patterns that might aid in individual recognition (Dugan, 1982b). A given male’s territory usually attracts several females and operational sex ratios can average more than six during the peak of the three-to-four-week breeding season (Rodda, 1992). They not only mate with the resident male but also are protected by him from harassment by other males. Medium-sized males— the second class of males—are on the periphery of these territories and do much of the harassing. In Venezuela, the size difference between territorial and peripheral males was not evident (Rodda, 1992). In both populations, however, as shown especially clearly in figure 1 in Rodda (1992), this system resembles a lek mating sys-
tem and thus is similar, but in three dimensions, to that subsequently described for marine iguanas (Wikelski et al., 1996; Hayes et al., this volume). An important feature of reproduction discovered in both Panamanian and Venezuelan populations by Beverly Dugan and Gordon Rodda is forced copulation by small males that look like females, the third class of males. Such pseudofemales remain inconspicuous and lurk close to dominant male territories and take advantage of the territorial male’s preoccupation elsewhere. The role of intraspecific sexual mimicry may be an unexplored factor in sexual selection (Weldon and Burghardt, 1984). The more sensational “rape” aspects of this behavior in natural populations have become rather controversial as sociobiological analyses extend to our own species (Thornhill and Palmer, 2000). Rodda was able to document, from observing 250 copulations, that females resisted 95% of copulation attempts by pseudofemale males, but only 56% of those by dominant males. Microsatellite DNA markers should now be used to determine the success of this fairly common mating tactic in green iguanas, as well as for systematic studies (Malone and Davis, this volume). Genetic markers are also important for another reason. Unlike Dugan’s study, Rodda was
IGUANA RESEARCH: LOOKING BACK AND LOOKING AHEAD
Iguanas : Biology and Conservation, University of California Press, 2004. ProQuest Ebook Central,
7
able to identify individual females by crest scale patterns and other markings. Doing so showed that females often moved from one dominant male’s territory to another and often mated with two or more males. One female was observed to copulate fifteen times in a season and another switched territories between two males twelve times (Rodda, 1992). Although these are extreme figures, they document that female choice is taking place in this species. Females also often compete among themselves for “preferred” sleeping positions in trees and seem to maneuver to be either close to or more distant from the territorial male. The three-dimensional topography often creates rather complex paths from one point to another in a tree.
Copyright © 2004. University of California Press. All rights reserved.
MIGRATION, DISPERSAL, AND GENETICS
Green iguanas migrate considerable distances in several contexts. After nesting, radiotracked females returned rapidly and directly to home areas. Females may return to the same nest site several years in a row; after they begin to reproduce, growth almost ceases (Bock et al., 1985, 1989), so that age and size are not closely related. Hatchlings may move long distances as well. Some of this was noted by Drummond and Burghardt (1982), and longer movements were documented by Brian Bock in his dissertation (Bock, 1984). The method developed by Bock took advantage of the fact that young iguanas slept on exposed branches of shrubs and small trees. By marking them with a reflective paint that was dull by day but bright when spotlighted at night, movements of many individuals could be accurately followed for some weeks. Bock also established, using allozymes, a genetic differences among females at different nest sites (Bock and McCracken, 1988), as well as the existence of multiple paternity. The wealth of information on green iguanas, only touched on above, is limited to a few populations studied in detail, but is supported by observations of many other scientists. This volume recounts some of this work, but it is notable that
8
hatchling and juvenile behavior has not received the attention that it should. It is in the development and ontogeny of behavior that many important insights will be reached about the social organization and cognitive sophistication of large, long-lived reptiles adapted to environments changing seasonally and yearly in climate, food availability and its often patchy distribution, nest site availability, demography, and human interference. Behavioral development may also be central to understanding the phylogeny of iguanas. As noted below, concerted efforts are needed to move ahead on many fronts, applying the latest methodological and conceptual tools. Regardless, studying populations of iguanas for long periods of time is valuable and other species and populations should be studied behaviorally as well as monitored demographically.
LOOKING AHEAD The green iguana studies touch on only a few of the many issues still unresolved about the ecology, behavior, evolution, and conservation of all iguanas. Much work, especially laboratory research, has not been cited. Nevertheless, several themes in the green iguana story, those derived from work on other species and populations, and more recent studies need to be explored, replicated, and extended. New or improved techniques involving small electronically readable PIT tags, radiotracking, GIS layering, sexing of hatchlings, captive breeding, computer-based observation recording, remote video, temperature and activity loggers, field energetics, and application of molecular genetic DNA analysis from minute tissue samples, shed skin, and feces allow for more rapid and thorough data collection, as well as formulating and answering questions we thought could never be answered definitively only a few decades ago. Some aspects of the application of standard and new methods to conservation related research are usefully discussed in Alberts (2000). Here I list some topics that I think are interesting, important, and needed:
GORDON M. BURGHARDT
Iguanas : Biology and Conservation, University of California Press, 2004. ProQuest Ebook Central,
Copyright © 2004. University of California Press. All rights reserved.
Phylogeny Molecular and quantitative genetics Physiology (e.g., energetics, thermoregulation) Endocrinology (field and lab) Ecology and social structure Comparative development Growth and nutrition Application of comparative methods Nesting dynamics Role of adolescence Ontogeny and sexual differentiation Diseases in field and captivity Social organization Variation in sexual dimorphism Behavioral consequences of headstarting Unusual (weird) behaviors Social learning, social facilitation, and imitation Brain organization and processing (e.g., using magnetic resonance imaging [MRI]) Effects of field methods (trapping, marking, observing, tissue sampling, radioimplantation) Geographic variation and speciation Sensory abilities Functional and comparative morphology Dispersal Mating systems and multiple paternity Foraging and diet selection Antipredator responses Sexual selection Neonatal behavior and dispersal Communication and ritualization Gregariousness and altruism Behavioral ontogeny (genetics and plasticity) Kin recognition Role as companion animals Stress and the immune system Emotional expression and experience Motivational processes Cognition and problem solving Behavioral consequences of reintroduction (diet, predators, crowding, dispersal, growth rates, nesting, human interference) They do not involve just fieldwork, but laboratory, physiological, and developmental experiments
as well. Zoo and captive studies are needed not only to isolate and evaluate important factors, but also to provide needed information to those involved in captive breeding and conservation management. The immense interest in captive iguanas as pets is something from which we should not remain aloof. Although at present the pet trade is primarily a phenomenon of green iguanas, this may change. Other species, such as ground iguanas, may actually be better pets than arboreal species. The list includes topics on cognition, motivation, learning, and other areas usually deemed psychological and thus avoided by biologists, especially those studying reptiles, where the common view of reptilian stupidity is too often unchallenged (Burghardt, 1977a, 1991). Individual differences in the information conveyed by visual and chemical displays is great (Dugan, 1982b; Alberts et al., 1993). Reptiles, especially long-lived and large species, are much more adept at processing and using acquired information than we realize. Surely, iguanas recognize individual humans just as they distinguish among conspecifics. Surely, they learn details of their environment and can integrate visual, chemical, and other information. Although the developmental analysis of cognition and intelligence has focused on mammals, especially primates, the time may be ready for exploring similar phenomena in diverse radiations (Parker and McKinney, 1999). Besides studies in the field and captivity, we should apply the newly developed methods of brain imaging to iguanas. We have recently shown that MRI brain images can be acquired noninvasively in living reptiles such as small garter snakes (Anderson et al., 2000) and monitor lizards (Varanus; unpubl. data). Iguanas, being large, having a brain more equally divided among the sensory systems, and with complex social behavior, would be ideal animals with which to explore the way in which sensory, cognitive, motivational, and emotional processes are integrated. This could be of general significance in our understanding of the evolution of vertebrate cognition, a currently
IGUANA RESEARCH: LOOKING BACK AND LOOKING AHEAD
Iguanas : Biology and Conservation, University of California Press, 2004. ProQuest Ebook Central,
9
Copyright © 2004. University of California Press. All rights reserved.
exciting field with, unfortunately, an overwhelmingly mammalocentric bias. Without including reptiles and birds, we will never be able to answer the most pertinent phylogenetic questions. The topic of neglected (weird) behavior merits brief comment, as it is not at all facetious. Often observers of animals in field and captivity see behaviors that appear not just unusual, but downright aberrant. Although perhaps documented in a note, their potential significance is often ignored, because they do not fit the questions, methods, mindset, or concepts that we bring to the observational setting. For example, the distinctive titillation courtship seen in young emydid turtles was noted for years, but its behavioral significance neglected. Recently, we revisited the phenomenon and recognized it as sharing many features with social play in rodents (Kramer and Burghardt, 1998). Years ago, I noticed that one hatchling iguana would often be sleeping on top of another in shrubs (Burghardt, 1977b). If the hypothesis of fraternal altruism of Rivas and Levín (this volume) is correct, then the prediction would be that this represents a male on top of a sibling female. Again, molecular techniques are now available to test this. I have concentrated on green iguanas because it is my iguana story as well as the story of much of the early research on iguanas. As this chapter began, so it shall end—people going out to work on a new species or population of iguana should spend some time immersing themselves in the early work: Who did it? Why? What were the methods and conceptual framework? What worked and what did not? People becoming involved in the conservation of rare and endangered species must be particularly efficient in gathering information and carrying out critical studies. I end with a few suggestions that are meant to be positive: 1. Read the old literature on iguanas, good, bad, and indifferent. It is important to be critical and careful, however. For example, a study on displays in a Ctenosaura entered the literature as data on Iguana.
10
2. Field workers should not ignore studies on captive animals, as such studies can often isolate or test phenomena more rigorously than field studies (Pratt et al., 1992; Phillips et al., 1993). 3. Laboratory workers, on the other hand, should pay attention to the behavior of their species in the field and reference studies based on wild populations. Studies combining both lab and field approaches might be especially useful for some problems (Burghardt et al., 1986; Alberts et al., 1992a,b; Alberts, 1994). 4. Read studies on species or subspecies other than your own. Again, this is a practical necessity if you are working on a little-studied taxon, but is generally important to develop a feel for the group as a whole, and to serve as a resource for methods, ideas, and comparative analysis. 5. Contact earlier contributors who are still around and often willing to give good advice and suggestions. I did not do enough of this myself in earlier years, partly out of shyness. Do not assume that someone who did a study twenty, thirty, or even forty or fifty years ago is now scientifically stodgy, uninterested in new developments, has advanced Alzheimer’s, or is dead. Take the initiative; it may be fun as well as informative. After meeting, for the first time, Ernst Mayr at age ninety-two, I can assure you that he talked about both his bird collections from more than sixty years previously and current theoretical controversies with remarkable insight. Just as not using the most modern methods does not preclude deep understanding, neither does applying them guarantee it. When there are so many fascinating phenomena to study, as is generally true in behavior and ecology, faddishness often sets in as to what are the currently hot topics to study. As E. O. Wilson has pointed out repeatedly, the secret to genuine scientific success is to see the
GORDON M. BURGHARDT
Iguanas : Biology and Conservation, University of California Press, 2004. ProQuest Ebook Central,
Copyright © 2004. University of California Press. All rights reserved.
potential in a neglected area and make it your own. There are great opportunities ahead for iguana research and the in-progress list given above should inspire, not overwhelm, iguana researchers. Students of iguanas in the future should be able to appreciate the relevance of each of the topics listed to obtaining a fuller understanding of iguanas and gain the skills needed to help investigate them. We need more studies along the lines of those on pheromonal (femoral gland) communication (Alberts, 1989, 1990, 1993a; Alberts et al., 1993), hormones and behavioral development (Phillips et al., 1993; Alberts et al., 1994), food recognition (Cooper and Alberts, 1990), and predator recognition (Burger and Gochfeld, 1991; Burger et al., 1991). Beyond the detailed studies of specific populations and mechanisms, however, comparative integration is needed. In addition to theoretical syntheses, we need far more extensive comparative databases on the details, for all species (and many subspecies and populations), of communication, demography, diet, dispersion, ecological requirements, growth, life history, neonatal behavior, physiology, reproduction, social organization, and other areas as well. This is useful not only for conservation and ecological work, however. Historical phylogenetic factors need to be considered, not just recent ecology, in the reconstruction of evolution of behavior. An impressive start is available in the study of headbob displays in Cyclura (Martins and Lamont, 1998). Rather rapid evolution and putative ancestral states were identified. Comparable studies might be possible with pheromones (Alberts, 1991). Predictive modeling of responses to changes in many of the factors listed above, especially changes induced by direct or indirect human influence and natural events (El Niño, hurricanes, and floods) will also eventually be needed (Wikelski and Thom, 2000). Individual-based modeling (DeAngelis and Gross, 1992) may prove to be particularly useful in such integration, and has already been explored in rattlesnake popula-
FIGURE 1.2. Nocturnal hopping behavior in a hatchling green iguana after emerging from a nest hole on moonlit nights on Slothia islet off of Barro Colorado Island, Panama. Drawing by Tim Winkler from a still from a night vision video recording.
tions as a means to integrate proximate factors and evolutionary processes in the field (Duvall and Beaupre, 1998). In short, iguanas as a group could be a most useful model for both evolutionary and conservation biology research, since they are distinctive among lizards in many ways (e.g., size, diet, sociality) and comprise a limited number of genera and species, with a mix of widespread, geographically distinct forms and many small relict or endangered populations of charismatic creatures. It is these latter, especially in the Caribbean, that are rightfully the focus of much attention. Nonetheless, we need to more effectively convey to the public the remarkable features of these animals and create more international interest in their survival in natural settings. Several years ago Jim Schwartz and I observed a most remarkable hopping “towards the sky” behavior in hatchling iguanas emerging from nest holes on moonlit or bright starry nights (figure 1.2). We are not yet sure what this “weird” behavior means, but it may be a memorable metaphor for the urgency with which iguana researchers should be attempting to reach increasingly higher levels of understanding and knowledge.
SUMMARY Over the past 25 years, our knowledge of iguana biology has grown remarkably. Although green
IGUANA RESEARCH: LOOKING BACK AND LOOKING AHEAD
Iguanas : Biology and Conservation, University of California Press, 2004. ProQuest Ebook Central,
11
ACKNOWLEDGMENTS
The work summarized here was supported by the efforts of the many people listed in the section “Green Iguanas” in this chapter, the National Science Foundation, the Smithsonian Tropical Research Institute (including the administrators, support staff, staff scientists, and numerous visiting researchers), the Smithsonian Scholarly Studies Program, the University of Tennessee, and the owners of ranches in Venezuela (especially Tomás Blohm and the Maldonado family). Stan Rand and Gordon Rodda provided many useful comments and suggestions.
Copyright © 2004. University of California Press. All rights reserved.
iguanas (I. iguana) were most intensively studied initially, other species in the family are now becoming better known. Such reports have greatly altered our appreciation for the complexity and importance of reptilian behavior and ecology. Iguanas are an excellent group to study the phylogeny, ontogeny, ecology, and mechanisms of sociality and cognition in a long-lived squamate reptile. They may prove particularly useful in evaluating the role of selection at multiple levels. Furthermore, comparative research on iguanas throughout the lifespan, in both captive and free-living populations, will be critical in developing viable conservation and management schemes.
12
GORDON M. BURGHARDT
Iguanas : Biology and Conservation, University of California Press, 2004. ProQuest Ebook Central,
PART ONE
Copyright © 2004. University of California Press. All rights reserved.
Diversity
Iguanas : Biology and Conservation, University of California Press, 2004. ProQuest Ebook Central,
Copyright © 2004. University of California Press. All rights reserved.
This page intentionally left blank
Iguanas : Biology and Conservation, University of California Press, 2004. ProQuest Ebook Central,
Introduction Ronald L. Carter and William K. Hayes
and adaptive relationships between structure and function are traditional themes in biology that have been rejuvenated recently by developments in molecular biology, morphometric analysis, and bioinformatics. Using methods of comparative biology, the study of unique and shared features proves to be heuristic and provides predictive tools in evolutionary biology. Understanding diversity at its various levels is a major challenge because we must identify it, measure it, catalog it, and name it, if taxonomically relevant. We must also seek to understand its underlying causes, limitations, and evolutionary history. Diversity is a dominant feature of life, whose extent we are just beginning to comprehend as modern science reveals prodigious variation at all levels (i.e., DNA, protein, cell, individual, deme, metapopulation, species, higher taxonomic levels, and ecosystems). With approximately 1.5 million species described, and estimates of tens of millions of additional species to be described, the task of understanding biological diversity is daunting. The task becomes alarming as we attempt to mitigate anthropogenic forces that are rapidly exterminating vast
Copyright © 2004. University of California Press. All rights reserved.
The study of diversity
amounts of biodiversity. We must find ways to preserve diversity, allowing for its natural perpetuation into the future. In this section, five chapters view biodiversity at different levels. Four of the five focus on iguana systematics, including an overview of the family Iguanidae (Hollingsworth), species and subspecies relationships within Cyclura and Iguana (Malone and Davis) and subspecific populations of Cyclura carinata carinata (Welch et al.), and intergeneric and population relationships of marine (Amblyrhynchus) and land (Conolophus) iguanas (Rassmann et al.). The fifth chapter deals with possible adaptive morphological and physiological diversity in salt glands among lizards (Hazard). In his chapter, Hollingsworth reviews key morphological and molecular studies that have shaped our understanding of the taxonomic diversity within the monophyletic “iguanines” (Savage, 1958; Etheridge, 1964). He looks at intergeneric relationships as well as interspecific relationships within Sauromalus, Ctenosaura, and Cyclura. Hollingsworth reviews the continued debate regarding recognition of various groups within the taxa as families or subfamilies. He identifies features of rapid speciation rates at the
15
Iguanas : Biology and Conservation, University of California Press, 2004. ProQuest Ebook Central,
Copyright © 2004. University of California Press. All rights reserved.
base of clades followed by long periods of stasis in diversity (long-branch attraction problems), which may have contributed to ongoing incongruities among various basal branches in proposed phylogenies. He also provides an updated species checklist that demonstrates the extensive evolutionary diversity within, and relationships among, this family, and serves as an essential tool for comparative studies and formulation of management plans. This chapter ends with Hollingsworth’s prediction that our knowledge of iguanid diversity will likely increase as different philosophical approaches to species are applied and further insights into relationships are revealed. He believes there remain a number of competing hypotheses to be tested, and appeals for more studies that combine various morphological and DNA (genomic and cytoplasmic) data sets. Malone and Davis, in their chapter on Caribbean iguana genetics and conservation, argue convincingly for the use of DNA data to examine taxonomies to see if they are consistent with evolutionary history. They also use phylogenetics to assist in setting priorities for conservation management plans and scientific research. These authors review various molecular techniques appropriate to answer questions of genetic diversity at population and taxonomic levels. They state that nuclear and mitochondrial DNA (mtDNA) data in combination enable characterization of populations in terms of historical relationships, current boundaries, and the distribution of genetic diversity. Based on their ND4 gene within mtDNA phylogeny and calibrated molecular clock, they estimate the genus Cyclura to be between fifteen and thirty-five million years old, with C. pinguis on the Puerto Rican Bank as its most basal taxon. Subsequent speciation moved in a northwest radiation through the Greater Antilles and into the Bahamas archipelago (Malone et al., 2000). From their DNA analysis, Malone and Davis reveal a distinct mtDNA lineage for the Grand Cayman iguana, C. nubila lewisi, and likewise suggest that the existing subspecific designations of C. cychlura from the Bahamas might require revision.
16
Using evolutionary significant units (ESU) criteria, Malone and Davis use their DNA data to identify iguana species that warrant the highest priority conservation attention. They extend their reasoning to such species as C. rileyi, which show no genetic differentiation among subspecies, and therefore question the level of conservation effort that has been focused on managing these populations as separate entities (see Carter and Hayes, this volume; Hayes et al., this volume). This chapter ends with strong recommendations on how to best preserve diversity. Welch et al. evaluate patterns of diversity among populations of the Turks and Caicos subspecies, Cyclura carinata carinata, a taxon fragmented into numerous isolated populations. Using highly variable microsatellite markers, Welch et al. evaluate FST and RST among populations to address two hypotheses: (1) that overland dispersal, as well as water depth between islands, does not limit gene flow; and (2) that natural selection has played a role in shaping the current structure of this species. Their results provide insights into questions regarding the relationship of genetic distance to geographic distance, and how this relationship may have been affected by vicariance or dispersal. In addition, they discuss the possible impact of hurricanes on current population genetic structure, and evaluate the potential contributions of genetic drift and selection to these populations. In conclusion, Welch et al. provide a cogent discussion of the potential conservation genetic implications of ongoing translocation projects for endangered iguanas. They remind us that locally adapted gene complexes can be disrupted by translocation, which may lead to outbreeding depression. They also stress that such problems can be avoided by careful attention to maintaining the integrity of ESUs by translocating iguanas only for the purpose of reestablishing populations on extirpated islands, or to colonize new islands that have no iguana populations. They argue that translocation for the purpose of genetic diversity supplementation should be avoided unless populations are known to have
PART I
Iguanas : Biology and Conservation, University of California Press, 2004. ProQuest Ebook Central,
Copyright © 2004. University of California Press. All rights reserved.
evolved under identical conditions, such as in closely adjacent insular populations. The chapter by Rassmann et al. traces the evolution of the Galápagos iguanas and provides a powerful example of how measuring diversity accumulated in different regions of the genome (nuclear and mitochondrial) can be used to answer questions of evolutionary rates and patterns of relationships between genera, within populations, and between sexes. The relationship between the Galápagos land (Conolophus) and marine (Amblyrhynchus) iguanas has long been debated. When and where they diverged, and their modern-day population relationships, have been some of the unresolved questions. In their chapter, Rassmann et al., using mt ribosomal DNA (rDNA) (12S and 16S RNA genes), reevaluate iguana phylogeny primarily to estimate the probable time of separation between these two genera. Radiometric dates for the volcanic islands in the Galápagos archipelago were used to calibrate their mt rDNA molecular clock. Suggested divergence dates between land and marine iguanas appear to predate existing islands in the Galápagos. The authors provide convincing arguments for a common ancestor of the land and marine iguanas to have colonized an ancient, but now below sea level, volcanic island(s). Thus, the two sister taxa are likely to have diverged on a pre-Galápagos island. Using rapidly evolving dinucleotide-motif microsatellites and cytochrome b, Rassmann et al. describe the genetic structure of current land and marine iguana populations. Interestingly, apparent inconsistencies between genetic distances revealed by nuclear markers and mtDNA proved to be most informative regarding sex differences in migration patterns and philopatry. Such studies demonstrate the value of interpreting measures of genetic diversity with data sets from behavior, ecology, and biogeography. The last chapter in this section deals with the special problem of electrolyte regulation in herbivorous reptiles, especially those living in marine and intertidal habitats. This chapter by Haz-
ard summarizes the distribution of salt glands among the lizard taxa and reviews aspects of salt secretion important for marine lizard evolution. Within lizards, salt glands have arisen independently several times. This ability to modify the composition of secreted fluid may give animals flexibility (diversity) in acclimating or adapting to changes in dietary salinity. Species vary in their ability to modify the composition of secreted fluids, and the transition from species that primarily secrete potassium to species that primarily secrete sodium could involve natural selection on gland capacity to secrete sodium. However, Hazard suggests that selection for this ability may not have been necessary for the ancestors of these marine species to switch from a more typical terrestrial diet to a marine diet, and further suggests that sodium secretion by these species may merely reflect acclimation of the glands to a sodium-rich diet. Hazard reports on the three major descriptive characteristics of salt secretion: ion composition, rate, and concentration. Her review of the evolution of salt glands in lizards raises important questions about the roles of selection, adaptation, and acclimation that may account for the apparent diversity in salt-secretion performance in lizards. She concludes that, regardless of the current level of marine species specialization, the flexibility of the related terrestrial species served as a pre-adaptation, allowing the animals to invade marine habitats and specialize on marine foods. Our understanding of diversity and adaptation as fundamental forces in nature has a promising future. Advances in the new fields of genomics and bioinformatics promise to integrate our knowledge of genetic diversity with knowledge of the relationship between structure and function. Insights from these approaches will facilitate evaluation of gene products that help organisms adapt to their unique habitats. With these insights, real progress will be made toward understanding the genes of speciation, the genetics of behavior and ecology, and the phenotypes that need to be protected and managed.
DIVERSITY
Iguanas : Biology and Conservation, University of California Press, 2004. ProQuest Ebook Central,
17
Copyright © 2004. University of California Press. All rights reserved.
This page intentionally left blank
Iguanas : Biology and Conservation, University of California Press, 2004. ProQuest Ebook Central,
2
The Evolution of Iguanas AN OVERVIEW OF RELATIONSHIPS AND A CHECKLIST OF SPECIES
Bradford D. Hollingsworth
I provide an overview of the evolutionary diversity of iguanas to help synthesize the large volume of currently available knowledge and review the controversies that still exist. The family Iguanidae, as constituted by Frost and Etheridge (1989), was first formed as an informal taxonomic group of iguanian lizards referred to as “iguanines” (Savage, 1958; Etheridge, 1964). The current constitution of the family is based on the work of Etheridge (1964), who diagnosed the group by their unique caudal vertebrae. Since this early work, “iguanines” have been shown to be a natural group through characteristics of their skeletal morphology, behavior, digestive tract, and mitochondrial DNA (mtDNA) sequence (de Queiroz, 1987a; Etheridge and de Queiroz, 1988; Frost and Etheridge, 1989; Schulte et al., 1998). Although the evidence for this taxonomic constitution is strong, there is still debate over the recognition of the various iguanian groups as families or subfamilies (Frost and Etheridge, 1989, 1993; Lazell, 1992; Schwenk, 1994; Macey et al., 1997; Schulte et al., 1998; Frost et al., 2001). Until the philosophical and data conflicts are resolved, I prefer to adopt the taxonomy of Frost and Etheridge
Copyright © 2004. University of California Press. All rights reserved.
In this chapter,
(1989). No matter which taxonomic rank is eventually decided upon, iguanas represent a diverse monophyletic group. Iguanid lizards are distributed over much of North and Central America; northern South America; and numerous islands, including the West Indies, the Galápagos, and the Fiji-Tonga Archipelago (Etheridge, 1982). The last checklist of the family was presented by Etheridge (1982), who recognized eight genera and thirtyone species. Today, eleven genera are recognized, containing forty-four species. The large increase in the number of species is attributable to the description of three extinct monotypic genera, the elevation of subspecies to species, and ongoing work within Ctenosaura. Our knowledge of iguanid diversity will likely increase as different philosophical approaches to species are applied and further insights into relationships revealed. Still, the increase in the number of taxa is somewhat astonishing, considering that these lizards are relatively large terrestrial vertebrates with conspicuous behaviors. The addition of known species over the past decade underscores the need for further taxonomic work throughout the family.
19
Iguanas : Biology and Conservation, University of California Press, 2004. ProQuest Ebook Central,
At the time Etheridge (1982) presented his overview of evolutionary diversity in iguanid lizards, almost nothing was known of their interrelationships. Furthermore, the studies up until that time were difficult to evaluate, with many lacking clear indications of how relationships were formulated (see historical reviews in Etheridge [1982] and de Queiroz [1987a]). The first modern phylogenetic analysis of the family was presented by de Queiroz (1987a). This study has served as the reference point for all subsequent analyses and made contemporary phylogenetic studies approachable. A number of phylogenetic analyses have been completed over the past decade and relationships between iguanid taxa are becoming clearer. However, there remain a number of competing hypotheses to consider.
EVOLUTIONARY RELATIONSHIPS
Copyright © 2004. University of California Press. All rights reserved.
INTERGENERIC RELATIONSHIPS
The generic-level relationships presented by de Queiroz (1987a) were based on a morphological data set consisting of ninety-five characters evaluated across all of the recognized species known at that time. His preferred hypothesis (figure 2.1A) placed both Dipsosaurus and Brachylophus in a polytomy at the base of the tree with the remainder of the genera (i.e., Amblyrhynchus, Conolophus, Ctenosaura, Sauromalus, Iguana, and Cyclura) forming a monophyletic group designated as the Iguanini. Amblyrhynchina (Amblyrhynchus + Conolophus) and Iguanina (Iguana + Cyclura) were also recognized as suprageneric taxa. Norell and de Queiroz (1991) incorporated the fossil taxa Armandisaurus explorator† Norell and de Queiroz 1991 and Pumilia novackei† Norell 1989 into a slightly modified data set. The results clarified the uncertain relationships at the base of the tree, placing Dipsosaurus + Armandisaurus† as the sister group to other iguanids, and Brachylophus as the sister taxon to the Iguanini (figure 2.1B). Pumilia† was confirmed to be a diminutive species closely related to Iguana (see also Norell, 1989). In both
20
FIGURE 2.1. Generic-level relationships within Iguanidae. (A) de Queiroz (1987a); (B) Norell and de Queiroz (1991); (C) Hollingsworth (1998).
analyses, the placements of Sauromalus and Ctenosaura were considered dubious, although the most parsimonious tree of Norell and de Queiroz (1991) resulted in the relationships Sauromalus + Amblyrhynchina and Ctenosaura + Iguanina. Later, Hollingsworth (1998) presented results from a phylogenetic analysis of Iguanini using 142 morphological characters, ninety-three of which originated from de Queiroz (1987a) and Norell and de Queiroz (1991). His results were similar to theirs, but generally with more sup-
BRADFORD D. HOLLINGSWORTH
Iguanas : Biology and Conservation, University of California Press, 2004. ProQuest Ebook Central,
Copyright © 2004. University of California Press. All rights reserved.
port, the only difference being the unresolved position of Ctenosaura (figure 2.1C). All three morphological studies are highly congruent; the only apparent difference is the level of resolution achieved. Three molecular-based studies addressing intergeneric relationships have been completed recently (Sites et al., 1996; Petren and Case, 1997; Rassmann, 1997). The results from the mitochondrial ribosomal DNA (rDNA) sequence data of Rassmann (1997) are in agreement with the outcome of the morphological analysis, although weakly supported. However, the results from the two studies using mtDNA sequence data from the protein coding ND4 (Sites et al., 1996) and cytochrome b (Petren and Case, 1997) genes are in some ways in conflict with the hypotheses produced from the morphological studies, although there are many points of agreement. These two studies produced strongly supported hypotheses placing Cyclura as the sister taxon to the remaining Iguanini and Sauromalus + Iguana as sister taxa. Ctenosaura was found to be allied to the Amblyrhynchina (figure 2.2A). Sites et al. (1996) also combined their sequence data with the existing morphological data and found no difference from the results based on the molecular data alone. The dramatically different placements of Cyclura based on the morphological and proteincoding molecular data sets were analyzed further by Wiens and Hollingsworth (2000). In this study, the various data sets were standardized and reanalyzed. A comparison was made between the results analyzed using maximum parsimony and maximum likelihood methods. The molecular topologies based on the two proteincoding genes (ND4 and cytochrome b) and the morphological topology were significantly different. The Cyclura branch was 6.2 times longer than the average branch length when estimated by likelihood. When analyzed using parametric bootstrapping (see Huelsenbeck et al., 1996), the Cyclura branch was found to be susceptible to long-branch attraction, especially when analyzed with parsimony methods (Felsenstein,
FIGURE 2.2. Generic-level relationships within Iguanidae. (A) Sites et al. (1996) and Petren and Case (1997), pruned to nominal genera; (B) Wiens and Hollingsworth (2000) preferred tree with Sauromalus in a tentative position (dashed line) and nearly identical to the 50% majority rule consensus tree of Rassmann (1997), with the exception of the unresolved basal node.
1978). Likewise, the Sauromalus branch in the morphological analysis was susceptible to the same problems. As a result, Wiens and Hollingsworth (2000) constructed a preferred hypothesis not represented by either the molecular or morphological studies (figure 2.2B; but see Malone et al., 2000; Malone and Davis, this volume). The Wiens and Hollingsworth (2000) tree is nearly identical to the hypothesis of Rassmann (1997). Each of the extant genera in the family Iguanidae is well supported with numerous character state transformations (de Queiroz, 1987a). However, the recovery of their intergeneric relationships has been hampered by the disparate rates of transformations in the different data sets, as in the case for the Cyclura and Sauromalus branches. In addition, there is also relatively lower phylogenetic signal between taxa than there is in support of their individual
EVOLUTION OF IGUANAS
Iguanas : Biology and Conservation, University of California Press, 2004. ProQuest Ebook Central,
21
monophyly. The pattern of weak support for some parts of the topology while others are strongly supported has been associated with the process of rapid speciation at the base of the Iguanini (de Queiroz, 1987a; Sites et al., 1996; Rassmann, 1997; Hollingsworth, 1998). To recover the intergeneric relationships of iguana taxa further, researchers will have to sample a greater number of characters and further develop analytical methods that are not compromised by data with disparate rates of evolution.
Copyright © 2004. University of California Press. All rights reserved.
INTERSPECIFIC RELATIONSHIPS WITHIN SAUROMALUS
Progress has also been achieved in recovering the interspecific relationships within the more species-rich genera. Petren and Case (1997) completed the first modern phylogenetic analysis within Sauromalus using mtDNA sequence data from the cytochrome b gene (figure 2.3A). Petren and Case (2002) repeated the analysis with six additional samples with similar results. The two large chuckwalla species, S. varius and S. hispidus, are hypothesized to be sister taxa deeply nested within the tree containing the remaining smaller-bodied species and populations. The arrangement of this topology infers that the ancestral body size was small and the evolution of a larger body occurred in the common ancestor of S. varius and S. hispidus. The internal nodes within the molecular tree are weakly supported by bootstrap values of 60% or less, with the exception of S. varius + S. hispidus, which is supported by a 99% bootstrap value. This topology supports the insular gigantic hypothesis of body size evolution first put forward by Case (1982). The hypothesis postulates that a large body is not selected against in an arid insular environment lacking large predators and containing an erratic food supply (Case, 1982; Petren and Case, 1997). Based on the results of the molecular analysis, the two large-bodied species evolved from a smaller ancestral form in response to insular selection pressures. A morphological analysis of Sauromalus was completed by Hollingsworth (1998) using scalation, body proportions, color pattern, osteology,
22
and some soft anatomy. In contrast to the molecular tree, the morphological topology has the two large species, S. varius and S. hispidus, positioned sequentially at the base of the tree, with the smaller forms nested higher within the topology (figure 2.3B). The morphological tree is less resolved than the molecular topology, but has higher bootstrap values for the resolved basal nodes. The arrangement of this topology infers that the ancestral body size was large, and thus does not support the evolution of a large body size for two insular species, S. varius and S. hispidus. An alternative evolutionary hypothesis is that their large size is maintained by their insular environment, whereas smaller size was selected for in the ancestor of the remaining species, which likely lived on the adjacent continental areas (Grismer et al., 1995; Hollingsworth, 1998). The differences between the molecular and morphological hypotheses have yet to be explained. Each topology suffers from poor support, and the disagreement between the trees appears to reflect conflicts between the data sets. The poor support is likely attributed to the undersampling of phylogenetically informative characters. Further analysis of morphological variation and continued DNA sequencing will eventually determine if the undersampling of characters is a source of error between the trees. However, if each tree is a preliminary insight into the structure of their respective trees, then other sources of error should be investigated to explain the conflict in the data. At this time, direct comparison between the two analyses is difficult because the taxonomic sampling in the molecular study is sparse for some geographic regions and different terminal lineages were designated in the morphological analysis (Hollingsworth, 1998). INTERSPECIFIC RELATIONSHIPS WITHIN CTENOSAURA
As currently constituted, Ctenosaura contains seventeen species. Over the past two decades, five new species have been described (de Queiroz, 1987b; Köhler and Klemmer, 1994; Köhler, 1995;
BRADFORD D. HOLLINGSWORTH
Iguanas : Biology and Conservation, University of California Press, 2004. ProQuest Ebook Central,
Copyright © 2004. University of California Press. All rights reserved.
FIGURE 2.3. Interspecific relationships of Sauromalus. (A) Molecular topology after Petren and Case (1997), with S. obesus and S. australis terminal branches as originally presented (later synonymized with S. ater following Hollingsworth [1998], but see checklist remarks); (B) morphological topology modified from Hollingsworth (1998) with multiple terminal branches of S. ater representing the many isolated populations previously recognized under S. ater, S. australis, and S. obesus. Percentages are bootstrap values as reported in the different studies.
Buckley and Axtell, 1997; Köhler and Hasbun, 2001) and three subspecies of C. hemilopha elevated to species (Grismer, 1999a). None of the four most recent phylogenetic studies contain representatives of all the species. This is not likely a significant shortcoming in any of the analyses because each newly described species is clearly closely related to those included in the different studies. Three of the studies are based on morphological data (de Queiroz, 1987a,b; Hollingsworth, 1998), and one analyzes both morphological data and molecular randomly amplified polymorphic DNA (RAPD) markers (Köhler et al., 2000). The two morphological analyses of de Queiroz (1987a,b) differ little, with the primary modifi-
cation between the two being the inclusion of Ctenosaura oedirhina (figure 2.4A). In these analyses, C. hemilopha was found to be closely related to the species formerly recognized as Enyaliosaurus, lending support to its recognition as a subgenus of Ctenosaura (de Queiroz, 1995). However, in Hollingsworth (1998; figure 2.4B) and Köhler et al. (2000; figure 2.4C), C. hemilopha was positioned, respectively, at the base of the tree or closely allied with C. similis, C. acanthura, and C. pectinata. Unfortunately, the topologies are not well supported at these basal nodes. It remains a possibility that Enyaliosaurus will be recognized as a genus again, as the sister taxon to Ctenosaura. Among the remaining relationships, there is a strong congruence between the
EVOLUTION OF IGUANAS
Iguanas : Biology and Conservation, University of California Press, 2004. ProQuest Ebook Central,
23
Copyright © 2004. University of California Press. All rights reserved.
FIGURE 2.4. Interspecific relationships of Ctenosaura. (A) de Queiroz (1987b); (B) Hollingsworth (1998); (C) Köhler et al. (2000). Percentages are bootstrap values as reported in the different studies.
different studies in the remaining nodes of the tree. INTERSPECIFIC RELATIONSHIPS WITHIN CYCLURA
A recent monographic revision of Cyclura is lacking, although two recent studies have proposed
24
phylogenetic relationships among its species (Hollingsworth, 1998; Malone et al., 2000). The morphological analysis of Hollingsworth (1998) proposed relationships at the species level (figure 2.5A), resulting in a topology that is not strongly supported. In comparison, Malone et al. (2000) used mtDNA sequence data from the
BRADFORD D. HOLLINGSWORTH
Iguanas : Biology and Conservation, University of California Press, 2004. ProQuest Ebook Central,
Copyright © 2004. University of California Press. All rights reserved.
FIGURE 2.5. Interspecific relationships of Cyclura. (A) Hollingsworth (1998); (B) Malone et al. (2000), pruned to nominal species. Percentages are bootstrap values as reported in the different studies.
ND4 gene and adjacent transfer RNAs (tRNA) and incorporated samples from all described species and subspecies. The more thorough analysis of Malone et al. (2000) resulted in a topology strongly supported at nearly every node (figure 2.5B). When the Malone et al. (2000) topology is pruned to include the species used in the morphological study, only two nodes are shared between the different analyses. These are the placement of C. pinguis as the sister taxon to the remaining species and the sister taxa relationship between C. carinata + C. ricordii. The difference between the two studies is likely attributable to the undersampling of phylogenetically informative characters in the morphological analysis. However, a combined analysis using both morphological and molecular data has yet to be completed. The need for a monographic revision is further emphasized by the placement of C. nubila lewisi as a distant relative to C. n. nubila and C. n. caymanensis (figure 2.5B). In the
future, the former is likely to be recognized as a separate species, given that the subspecies of C. nubila apparently do not form a monophyletic clade (see Malone et al., 2000; Malone and Davis, this volume).
CHECKLIST The following checklist includes a listing of synonyms that chronicle the use of names for each species. This checklist is derived from the last comprehensive checklist for the family compiled by Etheridge (1982) and a more recent checklist of the Mexican species by de Queiroz (1995). It includes all taxa described subsequent to Etheridge (1982) and is intended to update both of these works. It also includes the numerous corrections identified by de Queiroz (1995) and makes further corrections when errors were found or new information became available. I have chosen to follow the general format of de
EVOLUTION OF IGUANAS
Iguanas : Biology and Conservation, University of California Press, 2004. ProQuest Ebook Central,
25
Queiroz (1995) for the inclusion of synonymous names. As such, this checklist does not represent a complete history of the use of names, but instead attempts to chronicle the different names formerly applied to each currently recognized species. To save space, I have chosen to abbreviate referenced works and exclude references to the collector of type specimens. Institutions were abbreviated following the standard acronyms recommended by Leviton et al. (1985). A general description of the distribution of each species is provided. Finally, it is clear that more investigative work is needed to clarify the taxonomy of these lizards. In many instances, type specimens have not been located and the identification of type localities needs further research. Use of different criteria for the recognition of species and subspecies is a prevalent problem, and remarks are included to highlight current debates over their use. I consider subspecific taxa without a specific reference to a synonymy as valid names until further systematic work is completed. AMBLYRHYNCHUS BELL
Amblyrhynchus Bell 1825, Zool. Jr., London 2:206. — Type species (by monotypy): Amblyrhynchus cristatus Bell 1825. Iguana (A. [mblyrhynchus]) – Gray 1831, in Cuvier, Anim. Kingd., London 9:37.
Copyright © 2004. University of California Press. All rights reserved.
Amblyrhincus (part.) – Duméril and Bibron 1837, Erpét. Gén., Paris 4:193 (invalid emendation). Hypsilophus (Amblyrhynchus) – Fitzinger 1843, Syst. Rept., Wien 1:55. Oreocephalus Gray 1845, Cat. Spec. Liz. Coll. Brit. Mus., London 189. — Type species (by monotypy): Amblyrhynchus cristatus Bell 1825. Amblyrhynchus cristatus Bell
Amblyrhynchus cristatus Bell 1825, Zool. Jr., London 2:206. — Holotype: OUM 6176 (Etheridge, 1982). — Type locality: “Mexico.” — Corrected type locality: Narborough (Fernandina) (Eibl-Eibesfeldt, 1956).
26
Iguana (A. [mblyrhynchus]) Cristatus – Gray 1831, in Cuvier, Anim. Kingd., London 9:37. Iguana (A. [mblyrhynchus]) Ater Gray 1831 (syn. fide Gray, 1845), in Cuvier, Anim. Kingd., London 9:37. — Type: not located (Etheridge, 1982). — Type locality: “Galápagos.” Amblyrhincus cristatus Duméril and Bibron 1837, Erpét. Gén., Paris 4:195. Amblyrhincus ater Duméril and Bibron 1837, Erpét. Gén., Paris 4:196. Hypsilophus (Amblyrhynchus) cristatus – Fitzinger 1843, Syst. Rept., Wien 1:55. Hypsilophus (Amblyrhynchus) ater – Fitzinger 1843, Syst. Rept., Wien 1:55. Oreocephalus cristatus – Gray 1845, Cat. Spec. Liz. Coll. Brit. Mus., London 189. Amblyrhynchus nanus Garman 1892, Bull. Essex Inst., Salem, 24:8. — Holotype: BMNH 99.5.4 = BMNH RR 1946.8.30.20 (Etheridge, 1982). — Type locality: “Tower Island.” Amblyrhynchus cristatus cristatus Eibl-Eibesfeldt 1956, Senckenberg. Biol., Frankfurt a. M., 37:88; pl. 9, fig. 1, 2a–b, fig. 1a, 2. Amblyrhynchus cristatus venustissimus EiblEibesfeldt 1956, Senckenberg. Biol., Frankfurt a. M., 37:90; fig. 3a–b. — Holotype: SMF 49851. — Type locality: “Nordküste der Insel Hood (Española).” Amblyrhynchus cristatus hassi Eibl-Eibesfeldt 1962, Senckenberg. Biol., Frankfurt a. M., 43(3):181; pl. 15 (fig. 4); fig. 2e, 3b. — Holotype: SMF 57407. — Type locality: “Indefatigable Südküste, westliche Akademiebucht . . . Indefatigable (Santa Cruz), GalápagosInseln.” Amblyrhynchus cristatus albermarlensis EiblEibesfeldt 1962, Senckenberg. Biol., Frankfurt a. M., 43(3):184; pl. 14 (fig. 2); fig. 2f. — Holotype: Eibl-Eibesfeldt private coll. (Etheridge 1982). — Type locality: “Insel Albemarle (Isabella).”
BRADFORD D. HOLLINGSWORTH
Iguanas : Biology and Conservation, University of California Press, 2004. ProQuest Ebook Central,
Amblyrhynchus cristatus mertensi EiblEibesfeldt 1962, Senckenberg. Biol., Frankfurt a. M., 43(3):185; fig. 2c–d, 3d–e. — Holotype: SMF 57430. — Type locality: “etwa 3 km südwestlich der Wrack-Bucht der Insel Chatham (S. Cristobal) . . . Chatman (Chatham [S. Cristobal]), Galápagos-Inseln.” Amblyrhynchus cristatus sielmanni EiblEibesfeldt 1962, Senckenberg. Biol., Frankfurt a. M., 43(3):188; fig. 2h, 3f. — Holotype: SMF 57417. — Type locality: “Westküste der Insel Abingdon.” Amblyrhynchus cristatus nanus Eibl-Eibesfeldt 1962, Senckenberg. Biol., Frankfurt a. M., 43(3):189; pl. 15, (fig. 6); fig. 2b, 3g. REMARKS
Few authors have adopted the use of the subspecies decribed by Eibl-Eibesfeldt, yet no formal synonymy has been purposed. Rassmann et al. (1997a) showed the close genetic relationship between various insular populations and discussed the plasticity of the morphological characters used to distinguish subspecies. They found that some of the subspecies are genetically indistinguishable from one another, a finding supported by the earlier immunological work (see Higgins and Rand, 1974, 1975; Higgins et al., 1974; Higgins, 1977; Wyles and Sarich, 1983). Until a formal synonymy is established, the seven subspecies are currently valid names.
Copyright © 2004. University of California Press. All rights reserved.
DISTRIBUTION
Galápagos Archipelago: Fernandina (= Narborough), Isabela (= Albemarle), Santa Cruz (= Indefatigable), San Cristóbal (= Chatham), Santiago (= James), Genovesa (= Tower), Pinta (= Abingdon), Española (= Hood), and Gardner Islands. Also reported on the islands of Floreana (= Charles), Pinzón (= Duncan), Wenman, and Culpepper (Heller, 1903). ARMANDISAURUS† NORELL AND DE QUEIROZ
Armandisaurus† Norell and de Queiroz 1991, Amer. Mus. Novitates, New York, 2997:2;
fig. 1–5. — Type species (by monotypy): Armandisaurus explorator† Norell and de Queiroz 1991. Armandisaurus explorator† Norell and de Queiroz
Armandisaurus explorator† Norell and de Queiroz 1991, Amer. Mus. Novitates, New York, 2997:2; fig. 1–5. — Holotype: AMNHFAM 8799. — Type locality: “White Operation Ridge, Sante Fe County, New Mexico, USA.” GEOLOGIC AGE
The type locality is in the Tesuque Formation, Skull Ridge Member, and is estimated to be between 11.6 and 16.5 million years old (Norell and de Queiroz, 1991). DISTRIBUTION
This species is only known from the holotype specimen, collected from White Operation Ridge, Sante Fe County, New Mexico, U.S.A. (Norell and de Queiroz, 1991). BRACHYLOPHUS CUVIER
Iguana (part.) Brongniart 1800, Bull. Soc. Philom., Paris 2:90. Agama (part.) – Daudin 1802, Hist. Nat. Rept., Paris 3:352. Brachylophus Cuvier 1829, in Guérin-Ménville, Icon. Règ. Anim., Paris 1:9; pl. 9, fig. 1. — Type species (by monotypy): Iguana fasciata Brongniart 1800. Iguana (Brachylophus) – Gray 1831, in Cuvier, Anim. Kingd., London 9:37. Hypsilophus (Brachylophus) – Fitzinger 1843, Syst. Rept., Wien 1:55. Chloroscrates Günther 1862, Proc. Zool. Soc. Lond., 189. — Type species (by monotypy): Chloroscrates fasciatus Günther 1862 (non Brongniart, 1800). Brachylophus fasciatus (Brongniart)
Iguana fasciata Brongniart 1800, Bull. Soc. Philom., Paris 2:90; pl. 6, fig. 1. — Type: none designated. — Type locality: none given. —
EVOLUTION OF IGUANAS
Iguanas : Biology and Conservation, University of California Press, 2004. ProQuest Ebook Central,
27
Comments on type locality: probably Tongatapu in the Tonga Islands (Gibbons, 1981). Agama fasciata – Daudin 1802, Hist. Nat. Rept., Paris 3:352. Brachylophus fasciatus – Cuvier 1829, in Guérin-Ménville, Icon. Règ. Anim., Paris 1:9; pl. 9, fig. 1, 1a–c. Iguana (Brachylophus) Fasciatus – Gray 1831, in Cuvier, Anim. Kingd., London 9:37. Hypsilophus fasciatus – Fitzinger 1843, Syst. Rept., Wien 1:55. Chloroscrates fasciatus Günther 1862, Proc. Zool. Soc. London, 189; pl. 25. — Syntypes: BMNH 55.8.12.1–2 = BMNH RR 1946.8.3.83–84 (Etheridge, 1982). — Type locality: “Feegee Islands.” Brachylophus brevicephalus Avery and Tanner 1970 (syn. fide Gibbons, 1981), Great Basin Nat., Provo, 30 3:167. — Holotype: BYU 32662. — Type locality: “Nukalofa, Tongatabu Island, Friendly Islands.”
DISTRIBUTION
Fiji Island Group, found on the island of Yadua Taba and the northern islands of the Yasawa group (Zug, 1991). Zug (1991) noted that specimens from the northern coast of Viti and Vanua Levu represent this species as well. CONOLOPHUS FITZINGER
Amb. [lyrhynchus] (part.) Gray 1831, Zool. Misc., London 1831:6. — Type species (by monotypy): Amb. [lyrhynchus] subcristatus Gray 1831. Amblyrhincus (part.) Duméril and Bibron 1837, (syn. fide Gray, 1845), Erpét. Gén., Paris 4:197. — Type species: Amblyrhincus Demarlii Duméril and Bibron 1837. Hypsilophus (Conolophus) – Fitzinger 1843, Syst. Rept., Wien 1:55. Trachycephalus Gray 1845, Cat. Spec. Liz. Coll. Brit. Mus., London 188. — Type (by monotypy): Amblyrhynchus subcristatus Gray 1831. Conolophus pallidus Heller
Conolophus subcristatus (part.) Garman 1892, Bull. Essex Inst. 24:5.
Copyright © 2004. University of California Press. All rights reserved.
DISTRIBUTION
Fiji Island Group, including the islands of Aiwa, Avea, Balavu, Beqa, Dravuni, Fulaga, Gau, Kabara, Kandavu Ono, Lakeba, Moturiki, Nggamea, Oneata, Ovalau, Taveuni, Vanua, Vanua Levu, Vanua Vatu, Vatu Vara, Vatuele, Viti Levu, and Wakaya (Etheridge, 1982). Etheridge (1982) noted that specimens from Cikobia, Koro, Naviti, and Yasawa were likely this species as well. Tonga Island Group, from Tongatapu, Ha’apai, Vava’u, and ‘Eua (Gibbons and Watkins, 1982; Zug, 1991). Also on Iles Wallis, northeast of Fiji (Etheridge, 1982). Recently introduced in the Tonga Island Group on Vanuatu (Bauer, 1988; Zug, 1991) and in the New Hebrides on Efate Island (Etheridge, 1982). Brachylophus vitiensis Gibbons
Brachylophus vitiensis Gibbons 1981, J. Herpet., 15(3):257; pl. I, IIa, c–d; fig. 2, 4a, 5a. — Holotype: MCZ 157192. — Type locality: “Yaduataba island (16°50′ S; 178°20′ E), Fiji.”
28
Conolophus pallidus Heller 1903, Proc. Wash. Acad. Sci., Washington, D.C. 5:87. — Holotype: CAS-SU 4749. — Type locality: “Barrington Island, Galápagos Archipelago.” DISTRIBUTION
Galápagos Archipelago, found only on the island of Santa Fé (= Barrington) (Heller, 1903). Conolophus subcristatus (Gray)
Amb. [lyrhynchus] subcristatus Gray 1831, Zool. Misc., London 1831:6. — Type: not located (Etheridge, 1982). — Type locality: “Galápagos?” Amblyrhincus Demarlii Duméril and Bibron 1837, (syn. fide Gray, 1845), Erpét. Gén., Paris 4:197. — Type: not located (Etheridge, 1982). — Type locality: not given. Hypsilophus (Conolophus) Demarlii – Fitzinger 1843, Syst. Rept., Wien 1:55. Trachycephalus subcristatus – Gray 1845, Cat. Spec. Liz. Coll. Brit. Mus., London 188.
BRADFORD D. HOLLINGSWORTH
Iguanas : Biology and Conservation, University of California Press, 2004. ProQuest Ebook Central,
Conolophus subcristatus – Steindachner 1876, Festschr. Zool.-Bot. Ges., Wien p. 322; pl. 4–7.
1928), inappropriate restriction (de Queiroz, 1995).
Conolophus subcristatus pictus Rothschild and Hartert 1899 (syn. fide Van Denburgh and Slevin, 1913) Novit. Zool., London 6:102. — Syntypes: BMNH 99.5.6.41–44. — Type locality: “Narborough.”
Uromastyx acanthura – Merrem 1820, Tent. Syst. Amphib., Marburg 56.
DISTRIBUTION
Galápagos Archipelago, including the islands of Santiago (= James), Santa Cruz (= Indefatigable), Isabela (= Albemarle), Fernandina (= Narborough), Baltra (= South Seymour), and Rábida (= Jervis) (Heller, 1903; Etheridge, 1982; Steadman and Zousmer, 1988). CTENOSAURA WIEGMANN
Lacerta (part.) – Shaw 1802, Gen. Zool., London 3(1):216. — Type species: Lacerta Acanthura Shaw 1802. Uromastyx (part.) – Merrem 1820, Tent. Syst. Amphib., Marburg p. 56. Cyclura (part.) – Harlan 1825 (syn. fide Gray, 1845), J. Acad. Nat. Sci. Philadelphia 4:250. — Type species: Cyclura teres Harlan 1825. Ctenosaura Wiegmann 1828, Isis von Oken, Leipzig 21:371. — Type (subsequent designation by Fitzinger, 1843): Ctenosaura cycluroides Wiegmann 1828 = Lacerta acanthura Shaw 1802.
Copyright © 2004. University of California Press. All rights reserved.
Enyaliosaurus Gray 1845, Cat. Spec. Liz. Coll. Brit. Mus., London p. 192. — Type (by monotypy): Cyclura quinquecarinata Gray 1842. Cachryx Cope 1866, Proc. Acad. Nat. Sci. Philadelphia 18:124. — Type species (by monotypy): Cachryx defensor Cope 1866. Ctenosaura acanthura (Shaw)
Lacerta Acanthura Shaw 1802, Gen. Zool., London 3(1):216. — Holotype: BMNH XXII.20.a = BMNH RR 1946.8.30.19 (Etheridge, 1982). — Type locality: not given. — Designated type localities: California (Boulenger, 1885), in error (Smith and Taylor, 1950); Mexico (Bailey, 1928); Tampico, Tamaulipas, Mexico (Bailey,
Cyclura teres Harlan 1825 (syn. fide Gray, 1845), J. Acad. Nat. Sci. Philadelphia 4:250. — Holotype: ANSP, number not given; lost (Smith and Taylor, 1950; Malnate, 1971). — Type locality: “Tampico.” Cyclura acanthura – Gray 1827, Phil. Mag., ser. 2 2:57. Ct. [enosaura] cycluroides Wiegmann 1828 (syn. fide Gray, 1845), Isis von Oken, Leipzig 21:371. — Syntypes: ZMB 576–578 (Bailey, 1928); ZMB 577 = MCZ 22453 (Bailey, 1928). — Type locality: Mexico, by implication (de Queiroz, 1995). — Designated type localities: Mexico (Bailey, 1928); Veracruz (Smith and Taylor, 1950), without justification (de Queiroz, 1995); Tampico (Etheridge, 1982), in error (de Queiroz, 1995). Iguana (Ctenosaura) Cycluroides – Gray 1831, in Cuvier, Anim. Kingd., London 9:37. Iguana (Ctenosaura) Acanthura – Gray 1831, in Cuvier, Anim. Kingd., London 9:38. Cyclura Shawii Gray 1831 (replacement name for Lacerta acanthura Shaw 1802), in Cuvier, Anim. Kingd., London 9:38. Iguana (Ctenosaura) Armata Gray 1831 (syn. fide Gray, 1845) in Cuvier, Anim. Kingd., London 9:38. — Type: Mus. [of Mr.] Bell [number not given] (de Queiroz, 1995); lost (Smith and Taylor, 1950). — Type locality: not given. — Designated type locality: Tampico, Tamaulipas (Smith and Taylor, 1950), without justification (de Queiroz, 1995). Iguana (Ctenosaura) Lanceolata Gray 1831 (syn. fide Gray, 1845) in Griffith (ed.) Cuvier’s Anim. Kingd., London 9:38. — Type: Mus. [of Mr.] Bell [number not given] (de Queiroz, 1995); lost (Smith and Taylor, 1950). — Type locality: not given. — Designated type locality: Tampico, Tamaulipas (Smith and Taylor, 1950), without justification (de Queiroz, 1995).
EVOLUTION OF IGUANAS
Iguanas : Biology and Conservation, University of California Press, 2004. ProQuest Ebook Central,
29
Iguana (Ctenosaura) Bellii Gray 1831 (syn. fide Bailey, 1928) in Cuvier, Anim. Kingd., London 9:38. — Type: Mus. [of Mr.] Bell [number not given] (de Queiroz, 1995); lost (Smith and Taylor, 1950). — Type locality: not given. — Designated type locality: Tampico, Tamaulipas (Smith and Taylor, 1950), without justification (de Queiroz, 1995). Iguana (Cyclura) Teres – Gray 1831 in Cuvier, Anim. Kingd., London 9:39. C. [yclura] articulata Wiegmann 1834 (syn. fide Gray, 1845) Herp. Mex., Saur. Spec., Berlin, 1:42. — Type: unknown (Smith and Taylor, 1950). — Type locality: “Mexico.” C. [yclura] denticulata Wiegmann 1834 (replacement name for Ctenosaura cycluroides; Wiegmann, 1828) Herp. Mex., Saur. Spec., Berlin 1:42; pl. 3. Cyclura (Ctenosaura) denticulata – Fitzinger 1843, Syst. Rept., Wien 1:56. Cyclura (Ctenosaura) semicrista – Fitzinger 1843 1834 (replacement name for Cyclura denticulata Wiegmann 1834, Syst. Rept., Wien 1:56.
DISTRIBUTION
The lowlands of eastern Mexico, from Llera and Tepehuaje de Arriba in Tamaulipas southward to the Isthmus of Tehuantepec in southeastern Veracruz and eastern Oaxaca (Bailey, 1928; Etheridge, 1982; de Queiroz, 1995; Köhler and Streit, 1996). Ctenosaura alfredschmidti Köhler
Ctenosaura alfredschmidti Köhler 1995, Salamandra, Rheinbach 31(1):5; fig. 4–8, 10. — Holotype: SMF 69019. — Type locality: “70 km östl. von Escarcega auf der Straβe nach Chetumal, Campeche, Mexico.” DISTRIBUTION
Known only from the type locality on the Yucatán peninsula, in the Mexican state of Campeche (Köhler, 1995). Ctenosaura bakeri Stejneger
Cyclura (Ctenosaura) articulata – Fitzinger 1843, Syst. Rept., Wien 1:56.
Ctenosaura bakeri Stejneger 1901, Proc. U.S. Natl. Mus., Washington, D.C. 23:467. — Holotype: USNM 26317. — Type locality: “Utilla Island, Honduras.”
Cyclura (Ctenosaura) Shawii – Fitzinger 1843, Syst. Rept., Wien 1:56.
Enyaliosaurus bakeri – Cochran 1961, Bull. U.S. Natl. Mus., Washington, D.C. 220:105.
Cyclura (Ctenosaura) Bellii – Fitzinger 1843, Syst. Rept., Wien 1:56.
Copyright © 2004. University of California Press. All rights reserved.
Type locality: “Dondomingvillo, in the State Oaxaca.” — Corrected type locality: Dondominguillo (Smith and Taylor, 1950).
Ctenosaura acanthura – Gray 1845, Cat. Spec. Liz. Coll. Brit. Mus., London 191. Cyclura (Ctenosaura) acanthura – Cope 1870, Proc. Am. Philos. Soc., Philadelphia (1869) 11:161. Ctenosaura teres – Bocourt 1874, in Duméril, Bocourt and Mocquard, Miss. Sci. Mex., Paris 3:142. Ctenosaura multispinis (part. de Queiroz, 1995) Cope 1886 (syn. fide Bailey, 1928), Proc. Am. Philos. Soc., Philadelphia 23:267. — Holotype: Sumichrast collection No. 201; = USNM 72737 (Smith and Taylor, 1950; Cochran, 1961). —
30
DISTRIBUTION
Isla de Utila, Departamento de Islas de la Bahía, Honduras (de Queiroz, 1990a; Köhler, 1998). Ctenosaura clarki Bailey
Enyaliosaurus quinquecarinatus (part.) – Dugès 1897, La Naturaleza, ser. 2 2:523; pl. 34. Ctenosaura clarki Bailey 1928, Proc. U.S. Natl. Mus., Washington, D.C. 73(12):44; pl. 27. — Holotype: MCZ 22454. — Type locality: “Ovopeo, Michoacan, Mexico.” — Corrected type locality: “Oropeo . . . at an elevation of about 1000 feet in the lower Tepalcatepec Valley about 8 miles south of La Huacana” (Duellman and Duellman, 1959).
BRADFORD D. HOLLINGSWORTH
Iguanas : Biology and Conservation, University of California Press, 2004. ProQuest Ebook Central,
Enyaliosaurus clarki – Smith and Taylor 1950, Bull. U.S. Natl. Mus., Washington, D.C. 199:76. Ctenosaura (Enyaliosaurus) clarki – de Queiroz 1995, Publicaciones Especiales del Museo de Zoología, Mexico City 9:13. DISTRIBUTION
Western Mexico, in the Balsas-Tepalcatepec Basin in Michoacán, between 200 and 510 meters in elevation (Duellman and Duellman, 1959; Duellman, 1961; Etheridge, 1982; Gicca, 1982; de Queiroz, 1995). Ctenosaura conspicuosa Dickerson
Ctenosaura conspicuosa Dickerson 1919, Bull. Am. Mus. Nat. Hist., New York 41(10):461. — Holotype: AMNH 5027; = USNM 64440 (Bailey, 1928; Cochran, 1961; de Queiroz, 1995). — Type locality: “San Esteban Island, Gulf of California, Mexico.” Ctenosaura hemilopha conspicuosa Lowe and Norris 1955, Herpetologica 11:89.
Copyright © 2004. University of California Press. All rights reserved.
REMARKS
Recently, Ctenosaura conspicuosa was elevated from its subspecific inclusion within C. hemilopha (Grismer, 1999a,b). Lowe and Norris (1955:90) relegated this taxon to a subspecies, choosing to recognize C. hemilopha as “a polytypic species with four subspecies,” but commenting that C. h. conspicuosa was the most distinctive among them. Lowe and Norris (1955) found it distinctive in both color and pattern. Following the evolutionary species concept and recognizing its distinctiveness, Grismer (1999a,b) elevated it to species rank. DISTRIBUTION
Isla San Esteban, Sonora, Mexico (Lowe and Norris, 1955; Smith, 1972; de Queiroz, 1995; Grismer, 1999a,b). Introduced onto Isla Cholludo, Sonora, Mexico (Grismer, 1999a,b). Ctenosaura defensor (Cope)
Cachryx defensor Cope 1866, Proc. Acad. Nat. Sci. Philadelphia 18:124. — Syntypes: USNM 12282 [3 specimens]; Exped. Coll. 585 (de Queiroz, 1995). — Type locality: not given;
Yucatán, by implication (de Queiroz, 1995) — Restricted type locality: Chichén Itzá, Yucatán, Mexico (Bailey, 1928); inappropriate restriction (de Queiroz, 1995). Ctenosaura erythromeles Boulenger 1886 (syn. fide Duellman, 1965), Proc. Zool. Soc. London 1886:241; pl. 23. — Holotype: BMNH 86.8.9.1 = BMNH RR 1946.8.30.18 (Etheridge, 1982). — Type locality: “not known.” — Designated type locality: Mexico (Bailey, 1928); Balchacaj, Campeche (Smith and Taylor, 1950); latter inappropriate restriction (de Queiroz, 1995). Cachryx erythromeles – Cope 1887, Bull. U.S. Natl. Mus., Washington, D.C. 32:43. Ctenosaura defensor – Günther 1890, Biol. Cent. Amer., Rept. and Batr. p. 58. Ctenosaura (Cachryx) annectens Werner 1911 (syn. fide Bailey, 1928), Jahrb. Hamb. Wiss. Anst. 27(2):25. — Holotype: ZMH 3420; destroyed (Etheridge, 1982). — Type locality: not given. — Designated type locality: Mexico (Bailey, 1928). Enyaliosaurus erythromeles – Smith and Taylor 1950, Bull. U.S. Natl. Mus., Washington, D.C. 199:77. Enyaliosaurus defensor – Smith and Taylor 1950, Bull. U.S. Natl. Mus., Washington, D.C. 199:77. Ctenosaura (Enyaliosaurus) defensor – de Queiroz 1995, Publicaciones Especiales del Museo de Zoología, Mexico City 9:13. DISTRIBUTION
Southern Mexico on the Yucatán Peninsula, from Balchacaj, Campeche to Telchac, Yucátan (Duellman, 1965; Lee, 1980; Etheridge, 1982; Köhler, 1996). Ctenosaura flavidorsalis Köhler and Klemmer
Enyaliosaurus quinquecarinata (part.) Meyer and Wilson 1973, Contrib. Sci. Nat. Hist. Mus. Los Angeles Co. 244:25. Ctenosaura flavidorsalis Köhler and Klemmer 1994, Salamandra, Rheinbach, 30(3):197; fig. 2–8. — Holotype: SMF 75845. — Type
EVOLUTION OF IGUANAS
Iguanas : Biology and Conservation, University of California Press, 2004. ProQuest Ebook Central,
31
locality: “1 km südl. La Paz (750 m ü. N.N.; 14°16′, 87°40′; Dpto. La Paz, Honduras).” DISTRIBUTION
Eastern Guatemala, from the Departamento de Jutiapa, through northern El Salvador, from Departamentos de Santa Ana, Cabañas, San Vincinte, Morazán, and La Unión, and southern Honduras, from the Departamentos de Intibucá and La Paz (Hasbun et al., 2001). Ctenosaura hemilopha Cope
Iguana (Cyclura) acanthura (non Shaw 1802) Blainville 1835 (homonym of Lacerta acanthura Shaw), Nouv. Ann. Mus. Hist. Nat., Paris 4:288; pl. 24; fig. 1. — Lectotype: MNHN 2245 (Brygoo, 1989; de Queiroz, 1995). — Type locality: “Californie.”
Ctenosaura insulana Dickerson 1919, Bull. Am. Mus. Nat. Hist., New York 41(10):462. — Holotype: AMNH 2694; = USNM 64439 (Bailey, 1928; Cochran, 1961; de Queiroz, 1995). — Type locality: “Cerralvo Island, Gulf of California, Mexico.” Ctenosaura hemilopha interrupta – Lowe and Norris 1955 (syn. fide Hardy and McDiarmid, 1969), Herpetologica 11:90. Ctenosaura hemilopha insulana – Lowe and Norris 1955 (syn. fide Grismer, 1999a), Herpetologica 11:90. Ctenosaura hemilopha hemilopha – Smith 1972 (syn. fide Grismer, 1999a), Great Basin Nat., Provo 32(2):104.
Cyclura acanthura (part.) – Duméril and Bibron 1837, Erpét. Gén., Paris 4:222.
DISTRIBUTION
Cyclura (Ctenosaura) hemilopha Cope 1863, Proc. Acad. Nat. Sci. Philadelphia 15:105. — Syntypes: USNM 5295 [4 specimens]; Xantus collection No. 789; one recataloged as USNM 69489 (de Queiroz, 1995). — Type locality: “Cape St. Lucas”; “near Soria Ranch, Cape San Lucas, Baja California, Mexico” [USNM 5295] and “San Nicolás, between Cape San Lucas and La Paz, Baja California, Mexico” [USNM 69489] (Cochran, 1961; de Queiroz, 1995).
Ctenosaura macrolopha Smith
Ctenosaura hemilopha – Cope 1866, Proc. Acad. Nat. Sci. Philadelphia 18:312. Copyright © 2004. University of California Press. All rights reserved.
Cyclura teres (part.) – Yarrow 1882, Bull. U.S. Natl. Mus., Washington, D.C. 24:71.
Ctenosaura acanthura (part.) – Bocourt 1874, in Duméril, Bocourt and Mocquard, Miss. Sci. Mex., Paris 3:138. Ctenosaura interrupta Bocourt 1882 (syn. fide Boulenger, 1885), Le Naturaliste, Paris 2(6):47. — Syntypes: MNHN 2243, 2245, 2843; BMNH 85.11.2.1 = BMNH RR 1946.8.3.85 (Etheridge, 1982). — Type locality: “Californie.” — Restricted type locality: “Cape San Lucas” (Smith and Taylor, 1950), without justification (de Queiroz, 1995). Cyclura hemilopha – Yarrow 1882, Bull. U.S. Natl. Mus., Washington, D.C. 24:71.
32
Baja California Sur, Mexico, from the vicinity of Loreto southward through the Cape Region, and Isla Cerralvo (de Queiroz, 1995; Grismer, 1999a,b).
?Ctenosaura multispinis (part., see de Queiroz, 1995) Cope 1886, Proc. Am. Philos. Soc. Philadelphia 23:267. Ctenosaura hemilopha hemilopha (part.) – Lowe and Norris 1955 (syn. fide Hardy and McDiarmid, 1969), Herpetologica 11:90. Ctenosaura hemilopha macrolopha Smith 1972, Great Basin Nat., Provo 32(2):104. — Holotype: FMNH 108705. — Type locality: “La Posa, San Carlos Bay, 10 mi NW Guaymas, Sonora.” Ctenosaura macrolopha – Grismer 1999, Herpetologica 55(4):450. REMARKS
Recently, this species was elevated from a subspecific rank from within Ctenosaura hemilopha by Grismer (1999a). It was found to be a separate evolutionary lineage and is diagnosible with morphological characters (see Grismer, 1999a: table 2).
BRADFORD D. HOLLINGSWORTH
Iguanas : Biology and Conservation, University of California Press, 2004. ProQuest Ebook Central,
DISTRIBUTION
Northwestern Mexico, from the vicinity of Hermosillo, Sonora, southward through the northern third of Sinaloa, and extreme western Chihuahua (Hardy and McDiarmid, 1969; Smith, 1972; de Queiroz, 1995). Ctenosaura melanosterna Buckley and Axtell
Enyaliosaurus palearis (part.) Echternacht 1968, Herpetologica 24(2):151. Ctenosaura palearis (part.) Etheridge 1982, in Burghardt and Rand (eds.), Iguanas of the World, New Jersey, p. 19. Ctenosaura melanosterna Buckley and Axtell 1997, Copeia, 1997(1):139. — Holotype: KU 101441. — Type locality: “2 km south of Coyoles Central, Departmento of Yoro, Honduras.” DISTRIBUTION
North-central Honduras in the Río Aguan Valley, Deparmento Yoro and Cayos Cochinos (= Hog Islands), 10–12 km due north of Nueva Armenia Yoro (Buckley and Axtell, 1997). Ctenosaura nolascensis Smith
Ctenosaura hemilopha hemilopha (part.) – Lowe and Norris 1955, Herpetologica 11:90. Ctenosaura hemilopha nolascensis – Smith 1972, Great Basin Nat., Provo 32(2):107. — Holotype: UCM 26391. — Type locality: “Isla San Pedro Nolasco, Sonora.”
Copyright © 2004. University of California Press. All rights reserved.
Ctenosaura nolascensis – Grismer 1999, Herpetologica 55(4):450. REMARKS
This species was elevated from a subspecific rank from within Ctenosaura hemilopha by Grismer (1999a,b), who applied the evolutionary species concept and found it diagnosable. DISTRIBUTION
Isla San Pedro Nolasco, Sonora, Mexico (Smith, 1972, Grismer, 1999a,b).
Ctenosaura (Enyaliosaurus) quinquecarianata (part.) – de Queiroz 1995, Publicaciones Especiales del Museo de Zoología, Mexico City 9:20. Ctenosaura oaxacana Köhler and Hasbun 2001, Senckenberg. Biol., Frankfurt 81(1/2):260. — Holotype: SMF 43259. — Type locality: “Tehuatepec, Estado de Oaxaca, Mexico.” DISTRIBUTION
Pacific versant of the Isthmus of Tehuantepec, Estado de Oaxaca, Mexico (Köhler and Hasbun, 2001). Ctenosaura oedirhina de Queiroz
Ctenosaura bakeri (part.) Barbour 1928, Proc. New England Zool. Club 10:56. Enyaliosaurus bakeri (part.) Cochran 1961, Bull. U.S. Natl. Mus., Washington, D.C. 220:105. Ctenosaura oedirhina de Queiroz 1987, Copeia 1987(4):892. — Holotype: UF 28532. — Type locality: “approx. 4.8 km (converted from 3 miles) west of Roatán on the path to Flowers Bay, Isla de Roatán, Departamento de las Islas de la Bahía, Honduras.” DISTRIBUTION
Isla de Roatán, and its satellite Isla de Santa Elena, Departamento de Islas de la Bahía, Honduras (de Queiroz, 1987b, 1990b). Ctenosaura palearis Stejneger
Ctenosaura palearis Stejneger 1899, Proc. U.S. Natl. Mus., Washington, D.C. 21:381. — Holotype: USNM 22703. — Type locality: “Gualan, Guatemala.” Enyaliosaurus palearis – Stuart 1963, Misc. Publ. Mus. Zool. Univ. Mich., Ann Arbor 122:68. DISTRIBUTION
Southeastern Guatemala in the Río Montgua Valley (Buckley and Axtell, 1997). Ctenosaura pectinata (Wiegmann)
Ctenosaura oaxacana Köhler and Hasbun
Ctenosaura quinquecarianata (part.) – Duellman 1966, Copeia 1966(4):700–719.
Cyclura pectinata Wiegmann 1834, Herp. Mex., Berlin, 42; pl. 2. — Syntypes: ZMB 574–575 (Taylor, 1969; de Queiroz, 1995). — Type
EVOLUTION OF IGUANAS
Iguanas : Biology and Conservation, University of California Press, 2004. ProQuest Ebook Central,
33
locality: “Mexico” (de Queiroz, 1995). — Restricted type locality: Colima, Colima, Mexico (Bailey, 1928), inappropriate restriction (de Queiroz, 1995). Cyclura (Cyclura) pectinata – Fitzinger 1843, Syst. Rep., Wien 1:56. Ctenosaura pectinata – Gray 1845, Cat. Spec. Liz. Coll. Brit. Mus., London 191. Ctenosaura acanthura (part.) Boulenger 1885, Cat. Liz. Brit. Mus. (Nat. Hist.), London 2:195. Ctenosaura brevirostris Cope 1886 (syn. fide Smith, 1949), Proc. Am. Philos. Soc., Philadelphia [1885] 23:268. — Syntypes: USNM 24708–24709 (Cochran, 1961; de Queiroz, 1995). — Type locality: “Colima, in Western Mexico.” Ctenosaura teres brachylopha Cope 1886 (syn. fide Smith, 1935), Proc. Am. Philos. Soc., Philadelphia, [1885] 23:269. — Syntypes: USNM 7180–7183. — Type locality: “Mazatlan.” — Restricted type locality: Mazatlan, Sinaloa, Mexico (Bailey, 1928). Ctenosaura brachylopha – Bailey 1928, Proc. U.S. Natl. Mus., Washington, D.C. 73(12):22; pl. 6.
Copyright © 2004. University of California Press. All rights reserved.
Ctenosaura parkeri Bailey 1928 (syn. fide Smith, 1949), Proc. U.S. Natl. Mus., Washington, D.C. 73(12):29; pl. 14, 15. — Holotype: USNM 18967. — Type locality: “Barranca Ibarra, Jalisco, Mexico.”
(de Queiroz 1995); “South America”; in error (BMNH Catalogue; de Queiroz, 1995). — Restricted type locality: “Tehuantepec, Oaxaca, Mexico” (Bailey, 1928), inappropriate restriction (de Queiroz, 1995); “to the southern portion of the distribution of C. quinquecarinata in Costa Rica and Nicaragua and consider Bailey’s (1928) restriction of the type locality . . . to Oaxaca, Mexico as invalid” (Hasbun and Köhler, 2001). Enyaliosaurus quinquecarinatus – Gray 1845, Cat. Spec. Liz. Coll. Brit. Mus., London 192. Cyclura (Ctenosaura) quinquecarinata – Cope 1870, Proc. Am. Philos. Soc., Philadelphia [1869] 11:161. Ctenosaura (Enyaliosaurus) quinquecarinata – Bocourt 1874, in Duméril, Bocourt and Mocquard, Miss. Sci. Mex., Paris 3:138. Ctenosaura quinquecarianata – Sumichrast 1880, Bull. Soc. Zool. Fr. 5:175. Ctenosaura (Enyaliosaurus) quinquecarianata (part.) – de Queiroz 1995, Publicaciones Especiales del Museo de Zoología, Mexico City 9:20. DISTRIBUTION
From Nicaragua in Departamentos Boaca, Chontales, Jinotega, and Matagalpa, and from Costa Rica in Provencia de Guanacaste (Villa and Scott, 1967; de Queiroz, 1995; Hasbun and Köhler, 2001).
DISTRIBUTION
Ctenosaura similis (Gray)
Western Mexico from the vicinity of Pericos, Sinaloa (Hardy and McDiarmid, 1969) southward to the Isthmus of Techuantepec in southeastern Oaxaca (Smith, 1949; Smith and Taylor, 1950; Köhler, 1996), including Isla Isabela and Islas de las Tres Marías, Nayarit (McDiarmid et al., 1976).
Iguana (Ctenosaura) Similis Gray 1831, in Cuvier, Anim. Kingd., London 9:38. — Type: Mus. [of Mr.] Bell [number not given] (de Queiroz 1995); not located (Bailey 1928). — Type locality: not given. — Designated type locality: Tela, Honduras, Central America (Bailey, 1928), inappropriate restriction (de Queiroz, 1995).
Ctenosaura quinquecarinata (Gray)
Cyclura quinquecarinata Gray 1842, Zool. Misc., London 1842:59. — Holotype: BMNH 41.3.5.61 = BMNH RR 1946.8.30.48 (Etheridge, 1982). — Type locality: “Demerara?”; in error
34
Cyclura (Ctenosaura) similis – Wiegmann 1834, Herp. Mex., Berlin p. 42. Ctenosaura completa Bocourt 1874 (syn. fide Bailey, 1928), in Duméril, Bocourt and
BRADFORD D. HOLLINGSWORTH
Iguanas : Biology and Conservation, University of California Press, 2004. ProQuest Ebook Central,
Mocquard, Miss. Sci. Mex., Paris 3:145. — Syntypes: MNHN 2252, 2256, 6499, 6500 (Guibe, 1954; Brygoo, 1989; de Queiroz, 1995). — Type locality: “Guatemala [and] . . . la Union.” — Restricted type locality: La Unión [El Salvador] (Smith and Taylor, 1950), without justification (de Queiroz, 1995). Ctenosaura acanthura (part.) – Boulenger 1885, Cat. Liz. Brit. Mus. (Nat. Hist.), London 2:195. Ctenosaura similis – Bailey 1928, Proc. U.S. Natl. Mus., Washington, D.C. 73(12):32; pl. 16–20. Ctenosaura similis similis – Barbour and Shreve 1934, Occas. Pap. Boston Soc. Nat. Hist. 8:197. Ctenosaura similis multipunctata Barbour and Shreve 1934, Occas. Pap. Boston Soc. Nat. Hist. 8:197. — Holotype: MCZ 36830. — Type locality: “Old Providence Island.” DISTRIBUTION
From the Isthmus de Tehuantepec southward through Central America on both versants to Ciudad de Panamá and Colón, Panama (de Queiroz, 1995; Köhler, 1996), including the following islands: Cozumel, Mujeres, del Carmen, Mexico; Isla de Utila and Guanaja, Honduras; Maiz Grande, Nicaragua; and El Rey, Panamá, Povidencia, and San Andrés, Colombia (de Queiroz, 1995).
Aloponotus Duméril and Bibron 1837, Erpét. Gén., Paris 4:189. — Type species (by monotypy): Aloponotus ricordi Duméril and Bibron 1837. Hypsilophus (Alopontus) – Fitzinger 1843, Syst. Rept., Wien 1:54. Hypsilophus (Metapoceros) – Fitzinger 1843, Syst. Rept., Wien 1:54. Cyclura (Cyclura) – Fitzinger 1843, Syst. Rept., Wien 1:54. Cyclura carinata Harlan
Cyclura carinata Harlan 1824, J. Acad. Nat. Sci. Philadelphia, 4:250. — Type: not located (Etheridge, 1982). — Type locality: “Turk’s Island.” Iguana (Cyclura) Carinata – Gray 1831, in Cuvier, Anim. Kingd., London 9:39. Cyclura (Cyclura) carinata – Fitzinger 1843 (partim), Syst. Rept., Wien 1:48. Cyclura carinata carinata – Barbour 1935, Zoologica, New York 19(3):118. Cyclura carinata bartschi Cochran 1931, J. Wash. Acad. Sci., Washington, D.C. 21(3):39. — Holotype: USNM 81212. — Type locality: “Booby Cay, east of Mariguana Island, Bahamas.” REMARKS
CYCLURA HARLAN
Copyright © 2004. University of California Press. All rights reserved.
Iguana (part.) – Lacépède 1789, Hist. Nat. Quad. Ovip. et Serp., Paris 2:493. Lacerta (part.) – Bonnaterre 1789, Tab. Encycl. Méth. Règ. Nat. , Erpét., Paris p. 40.
A thorough taxonomic assessment is lacking and the most recent molecular study was unable to evaluate the phylogenetic position of Cyclura carinata bartschi due to the scarcity of samples. The two subspecies are currently valid names. DISTRIBUTION
Cyclura Harlan 1824, J. Acad. Nat. Sci. Philadelphia 4:250. — Type species (subsequent designation by Fitzinger, 1843): Cyclura carinata Harlan 1824. Metapoceros Wagler 1830, Natür. Syst. Amphib., München 147. — Type (by monotypy): Iguana cornuta Bonnaterre 1789. Iguana (Cyclura) – Gray 1831, in Cuvier, Anim. Kingd., London 9:39.
Bahamian Archipelago, Turks and Caicos Islands, including Salt, Joe Grant’s, Major Hill, Dellis, Pine, Big Ambergris, Little Ambergris, East Bay, and Booby Cays (Gerber and Iverson, 2000; Buckner and Blair, 2000a). Cyclura collei Gray
Cyclura Collei Gray 1845, Cat. Spec. Liz. Coll. Brit. Mus., London 190. — Holotype: BMNH 1936.12.3.108. — Type locality: “Jamaica.”
EVOLUTION OF IGUANAS
Iguanas : Biology and Conservation, University of California Press, 2004. ProQuest Ebook Central,
35
Cyclura lophoma Gosse 1848 (syn. fide Grant, 1940), Proc. Zool. Soc. London 1848:99. — Holotype: BMNH 47.12.27.101. — Type locality: “Jamaica.”
likely be in debate. Here, I recognize their elevation to specific status because their character differentiation appears warranted (see Glor et al., 2000; R. Powell, 2000; Powell and Glor, 2000).
DISTRIBUTION
DISTRIBUTION
Jamaica, currently restricted to the Hellshire Hills (Vogel, 2000).
Hispaniola, including Isla Beata, Isla Saona, Ile de la Gonâve, Ile de la Petite Gonâve, Ile Grande Cayemite, and Ile de la Tortue (Glor et al., 2000; Ottenwalder, 2000a).
Cyclura cornuta (Bonnaterre)
Lacerta Cornuta Bonnaterre 1789, Tab. Encycl. Méth. Règ. Nat., Erpét., Paris 40; pl. 4, fig. 4. — Type: not located (Etheridge, 1982). — Type locality: “Sainte-Domingue . . . dans les mornes de l’Hôpital, entre l’Artibonite and les Gonaves.” Iguana cornuta – Lacépède 1789, Hist. Nat. Quad. Ovip. et Serp., Paris 2:493. Metopoceros cornutus – Wagler 1830, Natür. Syst. Amphib., München p. 147. Metapoceros cornutus – Gray 1845, Cat. Spec. Liz. Coll. Brit. Mus., London 188 (invalid emendation). Hypsilophus (Metapoceros) cornutus – Fitzinger 1843, Syst. Rept., Wien 1:54. Cyclura cornuta (part.)– Cope 1886, Proc. Amer. Philos. Soc., Philadelphia 23:263. Aloponotus cornutus – Perrier 1928, Traite Zool., Fasc. VIII:3095.
Copyright © 2004. University of California Press. All rights reserved.
Cyclura cornuta cornuta – Barbour 1937, Bull. Mus. Comp. Zool., Cambridge 82(2):132. Cyclura cychlura cornuta – Warner 1997, Iguana Times 6:59 (lapsus). REMARKS
In prior taxonomic treatments of Cyclura cornuta, the species C. stejnegeri and C. onchiopsis were included as subspecies (see a review in Glor et al. [2000]). Recently, Powell (1999) and Glor et al. (2000) recognized the specific status of all three, although it is uncertain if this will be accepted by other researchers. Until further taxonomic treatments are completed, the specific and subspecific status of these three taxa will
36
Cyclura cychlura (Cuvier)
Iguana cychlura Cuvier 1829, Règ. Anim., Ed. 2, Paris 2:45. — Holotype: MHNH 2367. — Type locality: “Carolina.” — Corrected type locality: Andros Island, Bahama Islands (Schwartz and Thomas, 1975). Cyclura baelopha Cope 1862 (syn. fide Schwartz and Thomas, 1975), Proc. Acad. Nat. Sci. Philadelphia (1861) 13:123. — Holotype: ANSP 8120. — Type locality: “Andros island, one of the Bahamas.” Cyclura inornata Barbour and Noble 1916, Bull. Mus. Comp. Zool., Cambridge 60(4):151; pl. 14. — Holotype: MCZ 11602. — Type locality: “U Cay in Allan’s Harbor, near Highborn Cay, Bahamas.” Cyclura figginsi Barbour 1923, Proc. New England Zool. Club, Cambridge 8:108. — Holotype: MCZ 17745. — Type locality: “Bitter Guana Cay, near Great Guana Cay, Exuma Group, Bahama Islands.” Cyclura cychlura – Schwartz and Thomas 1975, Carnegie Mus. Nat. Hist. Spec. Publ., Pittsburgh 1:112. Cyclura cychlura cychlura – Schwartz and Thomas 1975, Carnegie Mus. Nat. Hist. Spec. Publ., Pittsburgh 1:112. Cyclura cychlura figginsi – Schwartz and Thomas 1975, Carnegie Mus. Nat. Hist. Spec. Publ., Pittsburgh 1:112. Cyclura cychlura inornata – Schwartz and Thomas 1975, Carnegie Mus. Nat. Hist. Spec. Publ., Pittsburgh 1:112.
BRADFORD D. HOLLINGSWORTH
Iguanas : Biology and Conservation, University of California Press, 2004. ProQuest Ebook Central,
REMARKS
Since Schwartz and Thomas (1975), Cyclura cychlura has been recognized to contain three subspecific forms. Malone et al. (2000) described C. c. cychlura as being phylogenetically distinct from C. c. figginsi and C. c. inornata, but did not formally treat the first as a separate species. With regards to the latter two, Malone et al. (2000) believed the recovered polytomous relationships were not in agreement with their current constitution. Until these taxa are evaluated further, the subspecific names are currently valid. DISTRIBUTION
Bahamian Archipelago, Great Bahama Bank on Andros Island, including North Andros, Mangrove Cay, and South Andros (Buckner and Blair, 2000b), central and southern Exumas including Guana, Bitter Guana, Gaulin, White Bay, Noddy, North Adderly, Leaf Cays (Knapp, 2000a), and northern Exumas, including Leaf and U Cays (Iverson, 2000). Cyclura nubila Gray
Copyright © 2004. University of California Press. All rights reserved.
Iguana (Cyclura) Nubila Gray 1831, in Cuvier, Anim. Kingd., London 9:39. — Holotype BMNH XXII.18.a = 1946.8.29.88 (Etheridge, 1982). — Type locality: “South America?” — Corrected type locality: Cuba (Schwartz and Thomas, 1975). Cyclura Harlani (part.) Duméril and Bibron 1837 (syn. fide Schwartz and Thomas, 1975), Erpét. Gén., Paris 4:218. — Syntypes: MNHN A661, 2367; Lectotype: MNHN A661. — Type locality: “Caroline.” Cyclura MacLeayii Gray 1845 (syn. fide Schwartz and Thomas, 1975), Cat. Spec. Liz. Coll. Brit. Mus., London 190. — Holotype: BMNH XX.17.a = BMNH RR 1946.8.4.28 (Etheridge, 1982). — Type locality: “Cuba.” Cyclura macleayi – Barbour and Noble 1916, Bull. Mus. Comp. Zool., Cambridge 60(4):145; pl. 1, 2; pl. 13, fig. 5, 6. Cyclura caymanensis Barbour and Noble 1916, Bull. Mus. Comp. Zool., Cambridge 60(4):148;
pl. 3. — Holotype: MCZ 10534. — Type locality: “Cayman Islands, probably Cayman Brac.” Cyclura macleayi caymanensis Grant 1940, Bull. Inst. Jamaica, Sci. Ser., Kingston 2:29. Cyclura macleayi lewisi Grant 1940, Bull. Inst. Jamaica, Sci. Ser., Kingston 2:35; pl. 2; fig. 3, 4. — Holotype: BMNH 1939.2.3.68 = BMNH RR 1946.8.9.321 (Etheridge 1982). — Type locality: “Battle Hill, east end of Grand Cayman.” Cyclura nubila nubila Schwartz and Thomas 1975, Carnegie Mus. Nat. Hist. Spec. Publ., Pittsburgh 1:113. Cyclura nubila caymanensis Schwartz and Thomas 1975, Carnegie Mus. Nat. Hist. Spec. Publ., Pittsburgh 1:113. Cyclura nubila lewisi Schwartz and Thomas 1975, Carnegie Mus. Nat. Hist. Spec. Publ., Pittsburgh 1:113. Cyclura nubila Schwartz and Carey 1977, Stud. Faun. Curaçao and Carib. Is., Utrecht 53(173):23. REMARKS
Since Schwartz and Thomas (1975), Cyclura nubila has been recognized to contain three subspecific forms. In a molecular phylogenetic study, Malone et al. (2000) found that C. n. nubila and C. n. caymanensis were more closely related to C. cychlura, to the exclusion of C. n. lewisi. Malone et al. (2000) found C. n. lewisi to be phylogenetically distinct, and future studies may find there is further justification to elevate it to specific status (see Malone and Davis, this volume). DISTRIBUTION
Cuba, including as many as four thousand islets surrounding the mainland (Perera, 2000), Lesser Caymans, including Cayman Brac and Little Cayman (Gerber, 2000a), and Grand Cayman (Burton, 2000). Cyclura onchiopsis† Cope
Metopoceros cornutus (part.) – Cope 1866, Proc. Acad. Nat. Sci. Philadelphia 18:124.
EVOLUTION OF IGUANAS
Iguanas : Biology and Conservation, University of California Press, 2004. ProQuest Ebook Central,
37
C. [yclura] nigerrima Cope 1885 (syn. fide Schwartz and Thomas, 1975), Am. Nat., Lancaster 19(10):1006. — Holotype: USNM 9974. — Type locality: “Navassa.” (Nomen nudum fide Schwartz and Carey, 1977) C. [yclura] onchiopsis Cope 1885, Am. Nat., Lancaster 19(10):1006. — Syntypes: USNM 9977, 12239, MCZ 4717. — Type locality: “from an unknown locality.” — Designated type locality: Navassa Island (Cope, 1886).
Puerto Rican Bank, Anegada Island (Carey, 1975; Etheridge, 1982). Cyclura ricordii Duméril and Bibron
Aloponotus Ricordii Duméril and Bibron 1837, Erpét. Gén., Paris 4:190; pl. 38. — Holotype: MNNH 8304. — Type locality: “SainteDomingue.” Hypsilophus (Aloponotus) Ricordii – Fitzinger, Syst. Rept., Wien 1:54.
Cyclura cornuta (part.) – Cope 1886, Proc. Amer. Philos. Soc., Philadelphia 23:263.
Cyclura ricordii – Cochran 1924, Proc. U.S. Natl. Mus., Washington, D.C. 66(6):5.
Cyclura cornuta nigerrima – Barbour 1937, Bull. Mus. Comp. Zool. Cambridge 82:132.
Cyclura ricordi – Schwartz and Carey 1977, Stud. Faun. Curaçao and Carib. Is., Utrecht 53(173):64.
Cyclura cornuta onchiopsis – Schwartz and Thomas 1975, Carnegie Mus. Nat. Hist. Spec. Publ., Pittsburgh 1:112. Cyclura cornuta onchioppsis – Blair 1993, California Herpetol. Soc. Spec. Publ., Davis, California 6:57 (invalid emendation). Cyclura onchiopsis – Powell 1999. Carib. J. Sci., Puerto Rico 35:1–13. REMARKS
Copyright © 2004. University of California Press. All rights reserved.
DISTRIBUTION
Cyclura onchiopsis is believed to be extinct due to human exploitation, habitat alteration, and predation from exotics (Powell and Henderson, 1999; R. Powell, 2000). Recent studies have treated C. onchiopsis as a subspecies of C. cornuta (see Malone et al. [2000]), following the prevailing taxonomic arrangement, and did not comment on the recommendations of Powell (1999) and Powell and Henderson (1999). DISTRIBUTION
Navassa Island, off the west coast of Hispaniola (R. Powell, 1999, 2000). Cyclura pinguis Barbour
Cyclura pinguis Barbour 1917, Proc. Biol. Soc. Wash., Washington, D.C. 30:100. — Holotype: MCZ 12082. — Type locality: “Anegada, British Virgin Islands.”
38
DISTRIBUTION
Southwestern Dominican Republic, where it is restricted to Valle de Neiba and the Peninsula de Barahona, and includes Isla Cabritos located within the inland Lago Enriquillo (Ottenwalder, 2000b). Cyclura rileyi Stejneger
Cyclura rileyi Stejneger 1903, Proc. Biol. Soc. Wash., Washington, D.C. 16:130. — Holotype: USNM 31969. — Type locality: “Watlings Island, Bahamas.” Cyclura nuchalis Barbour and Noble 1916, Bull. Mus. Comp. Zool., Cambridge 60(4):156; pl. 8, fig. 1, 2. — Holotype: ANSP 11985. — Type locality: “Fortune Island, Bahamas.” Cyclura cristata Schmidt 1920, Proc. Linn. Soc., New York 33:6. — Holotype: AMNH 7238. — Type locality: “White Cay, Bahama Islands”; corrected to White Cay, Exuma Cays, Bahamas (Schmidt, 1936). Cyclura rileyi rileyi – Schwartz and Thomas 1975, Carnegie Mus. Nat. Hist. Spec. Publ., Pittsburgh 1:114. Cyclura rileyi cristata – Schwartz and Thomas 1975, Carnegie Mus. Nat. Hist. Spec. Publ., Pittsburgh 1:114.
BRADFORD D. HOLLINGSWORTH
Iguanas : Biology and Conservation, University of California Press, 2004. ProQuest Ebook Central,
Cyclura rileyi nuchalis – Schwartz and Thomas 1975, Carnegie Mus. Nat. Hist. Spec. Publ., Pittsburgh 1:114. REMARKS
Since Schwartz and Thomas (1975), Cyclura rileyi has been recongizd to contain three subspecific forms. Until further taxonomic study, the subspecific names are currently valid. DISTRIBUTION
Bahamian Archipelago, San Salvador, including Gaulin, Goulding, Green, Low, and Manhead Cays (Hayes et al., 1995; Hayes, 2000a), in the southern Exumas on White (= Sandy) Cay (Hayes, 2000b), and in the Aclins on Fish and North Cays (Hayes and Montanucci, 2000). Cyclura stejnegeri Barbour and Noble
Metopoceros cornutus (part.) – Meerwarth 1901, Mitth. Naturg. Mus., Hamburg 18:26. Cyclura cornuta (part.) – Stejneger 1904, Rep. U.S. Natl. Mus., Washington, D.C. 1902:670. Cyclura stejnegeri Barbour and Noble 1916, Bull. Mus. Comp. Zool., Cambridge 60(4):163; pl. 12. — Holotype: USNM 29367. — Type locality: “Mona Island.” Cyclura cornuta stejnegeri – Barbour 1937, Bull. Mus. Comp. Zool. 82:132.
Copyright © 2004. University of California Press. All rights reserved.
REMARKS
Cyclura stejnegeri has been treated as a subspecies of C. cornuta (see Malone et al., 2000), following the prevailing taxonomic arrangement prior to the recommendations of Powell (1999) and Powell and Glor (2000) to treat this taxon as a species. DISTRIBUTION
Isla Mona, situated between Hispaniola and Puerto Rico (Powell and Glor, 2000; Wiewandt and Garcia, 2000). DIPSOSAURUS HALLOWELL
Crotaphytus dorsalis (part.) Baird and Girard 1852, Proc. Acad. Nat. Sci. Philadelphia 6:126. — Type species (by monotypy): Crotaphytyus dorsalis Baird and Girard 1852.
Dipso-saurus Hallowell 1854, Proc. Acad. Nat. Sci. Philadelphia 7:92. — Type species (by monotypy): Crotaphytyus dorsalis Baird and Girard 1852. Dipsosaurus catalinensis Van Denburgh
Dipsosaurus catalinensis – Van Denburgh 1922, Occas. Pap. Calif. Acad. Sci. 10(1):83. — Holotype: CAS 50505. — Type locality: “Santa Catalina Island, Gulf of California, Mexico.” Dipsosaurus dorsalis catalinensis – Soulé and Sloan 1966, Trans. San Diego Soc. Nat. Hist. 14(11):141. REMARKS
Dipsosaurus catalinenesis was relegated to subspecific status within D. dorsalis by Soulé and Sloan (1966) without comment. More recently, Grismer (1999a) provided justification to elevate it to specific rank. DISTRIBUTION
Isla Santa Catalina, Baja California Sur, Mexico (Van Denburgh, 1922; Grismer, 1999a,b). Dipsosaurus dorsalis (Baird and Girard)
Crotaphytus dorsalis Baird and Girard 1852, Proc. Acad. Nat. Sci. Philadelphia 6:126. — Holotype: USNM 2699 (Cochran, 1961). — Type locality: “Desert of Colorado, Cal.” — Restricted type locality: Winterhaven (= Fort Yuma), Imperial County” (Smith and Taylor, 1950), without justification (de Queiroz, 1995). Dipso-saurus dorsalis – Hallowell 1854, Proc. Acad. Nat. Sci. Philadelphia 7:92. Dipsosaurus dorsalis – Baird 1859 in U.S. Dept. of Interior, United States and Mexican Boundary Survey, Washington, D.C. 2(2):8. Dipsosaurus dorsalis dorsalis – Van Denburgh 1920, Proc. California Acad. Sci., fourth ser. 10(4):33. Dipsosaurus dorsalis lucasensis – Van Denburgh 1920 (syn. fide Grismer, 1999a), Proc. California Acad. Sci., fourth ser. 10(4):33. — Holotype: CAS 46090. — Type locality: “San Jose del Cabo, Lower California, Mexico.”
EVOLUTION OF IGUANAS
Iguanas : Biology and Conservation, University of California Press, 2004. ProQuest Ebook Central,
39
Dipsosaurus carmenensis Van Denburgh 1922, (syn. fide Soulé and Sloan, 1966), Occas. Pap. California Acad. Sci. 10(1):81. — Holotype: CAS 50504. — Type locality: “Near Puerto Bellandro, Carmen Island, Gulf of California, Mexico.” Dipso-saurus dorsalis sonoriensis Allen 1933, Occas. Pap. Mus. Zool. Univ. Michigan 259:4. — Type: UMMZ 72121. — Type locality: “Hermosillo, Sonora, Mexico.” REMARKS
Dipsosaurus dorsalis has contained as many as four subspecies. Grismer (1999a) elevated D. catalinensis (see above) and placed D. d. lucasensis in synonymy with the nominal species. Of the remaining subspecific names, D. d. dorsalis and D. d. sonoriensis remain valid. DISTRIBUTION
Southwestern United States (in southern Nevada, southwestern Utah, southeastern California, and western Arizona), southward to northwestern Mexico (in western Sonora and northwestern Sinaloa), the peninsula of Baja California, and islands in the Gulf of California (including Ángel de La Guarda, Carmen, Cerralvo, Coronados, Espíritu Santo, Monserrate, Partida Sur, Santiago, San José, San Luis, and San Marcos), and the islands Magdalena and Santa Margarita in the Pacific Ocean (Etheridge, 1982; de Queiroz, 1995; Grismer, 1999a,b).
Copyright © 2004. University of California Press. All rights reserved.
IGUANA LAURENTI
Iguana Laurenti, 1768. Spec. Med., Synop. Rept., Wien p. 47. — Type species (by tautonymy): Lacerta iguana Linnaeus 1758. Prionodus Wagler 1828, Isis von Oken, Leipzig 21(8/9):860. — Type species (by monotypy): Lacerta iguana Linneaus 1758. Hypsilophus Wagler 1830, Natür. Syst. Amphib., München 147. — Type species (by monotypy): Lacerta iguana Linnaeus 1758. Iguana (Iguana) – Gray 1831, in Cuvier edit. Griffith, Anim. Kingd., London 9:36.
40
Iguana (Hypsilophus) Wiegmann 1834, Herp. Mex., Saur. Spec., Berlin p. 44. — Type species: Lacerta iguana Linneaus 1758. Hypsilophus (Hypsilophus) – Fitzinger 1843, Syst. Rept., Wien 1:16. Iguana delicatissima Laurenti
Iguana delicatissima Laurenti 1768, Spec. Med., Synop. Rept., Wien p. 48. — Holotype: Zool. Mus. Torino, not located (Etheridge, 1982). — Type locality: “Indiis.” — Restricted type locality: Island of Terre de Bas, Les Lles de Saintes, Département de la Guadaloupe, French West Indies (Lazell, 1973). Iguana nudicollis Merrem 1820 (referenced to ?Iguana delicatissima Laurenti, 1768), Tent. Syst. Amphib., Marburg p. 48. Amblyrhynchus delicatissima – Wagler 1930, Natür. Syst. Amphib., Müchen p. 148. DISTRIBUTION
Lesser Antilles, from Anguilla, St. Martin, St. Eustatius, St. Barthélemy (including Ilet au Vent), Antigua, Guadeloupe (including Basse Terre, La Désirade, Iles de la Petite Terre, and Les Iles des Saintes), Dominica, and Martinique (including Ilet Chancel) (Day et al., 2000). Iguana iguana (Linnaeus)
Lacerta iguana Linnaeus, Syst. Nat., Ed. 10, Stockholm 1:206. Syntypes: NHRM [one specimen, no number given]; ZMUU [one specimen, no number given] (Lönnberg, 1896; Anderson, 1900; Hoogmoed, 1973; de Queiroz, 1995). — Type locality: “Indiis.” — Restricted type locality: “island of Terre de Haut, Les Iles des Saintes, Département de la Guadeloupe, French West Indies” (Lazell, 1973), inappropriate restriction (de Queiroz, 1995); “confluence of the Cottica River and Perica Creek, Surinam” (Hoogmoed, 1973). ?Iguana minima Laurenti 1768 (syn. fide Fitzinger, 1843), Spec. Med., Synop. Rept., Wien 48. — Holotype: Museo Illustrissimi Comitis Turriani [no number given]; not
BRADFORD D. HOLLINGSWORTH
Iguanas : Biology and Conservation, University of California Press, 2004. ProQuest Ebook Central,
located (Elter, 1981; Etheridge, 1982). — Type locality: not given. Iguana tuberculata Laurenti 1768 (syn. fide Lönnberg, 1896), Spec. Med., Synop. Rept., Wien 49. — Holotype: Museo Illustrissimi Comitis Turriani [no number given]; not located (Elter, 1981; Etheridge, 1982). — Type locality: not given. Iguana delicatissima (part.) – Latreille 1802, in Sonnini and Latreille, Hist. Nat. Rept., Paris 1:255. Iguana coerulea (part.) Daudin 1802 (syn. fide Fitzinger, 1843), Hist. Nat. Rept., Paris 3:286. — Syntypes: MNHN [two specimens], lost (Brygoo, 1989; de Queiroz, 1995). I. [guana] vulgaris Link 1806 (replacement name for Lacerta iguana Linnaeus 1758, fide Peters and Donoso-Barros, 1970), Beschr. Natural.-Sammllung Univ. Rostock 2:58. Iguana sapidissima Merrem 1820 (replacement name [in synonymy] for Lacerta iguana Linnaeus 1758), Tent. Syst. Amphib., Marburg 47.
Copyright © 2004. University of California Press. All rights reserved.
Iguana squamosa Spix 1825 (syn. fide Gray, 1831), Spec. Nov. Lacert. Brazil, Monachii, 1:5; pl. 5. — Lectotype: ZSM 537/0 (Hoogmoed and Gruber, 1983; de Queiroz, 1995). — Type locality: “Bahiae, Parae”; “Salvador and Belém” (Vanzolini, 1981). Iguana viridis Spix 1825 (syn. fide Gray, 1831), Spec. Nov. Lacert. Brazil, Monachii 1:6; pl. 6. — Lectotype: ZSM 540/0 (Hoogmoed and Gruber, 1983; de Queiroz, 1995). — Type locality: “Rio St. Francisci et Itapicuru.” Iguana coerulea Spix 1825 (non Daudin, 1802; syn. fide Fitzinger, 1843), Spec. Nov. Lacert. Brazil, Monachii 1:7; pl. 7. — Syntypes: ZSM 71/0 [two specimens]; destroyed (Etheridge, 1982; Hoogmoed and Gruber, 1983). — Type locality: “Rio St. Francisci.” Iguana emarginata Spix 1825 (syn. fide Gray, 1831), Spec. Nov. Lacert. Brazil, Monachii 1:7;
pl. 8. — Holotype: ZSM 535/0 (Hoogmoed and Gruber, 1983). — Type locality: “[Rio] St. Francisci.” Iguana lophyroides Spix 1825 (syn. fide Fitzinger, 1843), Spec. Nov. Lacert. Brazil, Monachii 1:8; pl. 9. — Lectotype: ZSM 546/0 A (Hoogmoed and Gruber, 1983; de Queiroz, 1995). — Type locality: “Rio de Janeiro, Bahiae”; “Rio de Janeiro and Salvador” (Vanzolini, 1981). Iguana Iguana – Gray 1827, Phil. Mag., ser. 2 2:57. Prionodus iguana – Wagler 1828, Isis von Oken, Leipzig 21: 860. Iguana tuberculosa Bory de Saint-Vincent 1828 (replacement name for Lacerta iguana Linnaeus 1758), Résumé d’erpétologie, Paris p. 120; pl. 21. Hypsilophus iguana – Wagler 1830, Natür. Syst. Amphib., Müchen p. 147. Iguana (Iguana) tuberculata – Gray 1831, in Cuvier, Anim. Kingd., London 9:36. Iguana (Hypsilophus) rhinolophus Wiegmann 1834 (syn. fide Lazell, 1973), Herp. Mex., Saur. Spec., Berlin 44. — Syntypes: ZMB 571 [two specimens] (Etheridge, 1982); one recatalogued as ZMB 36300, ZMB 572 lost (de Queiroz, 1995). — Type locality: not given; Mexico by implication (de Queiroz, 1995). — Restricted type locality: Córdoba, Veracruz (Smith and Taylor, 1950), without justification (de Queiroz, 1995). Iguana rhinolopha – Duméril and Bibron 1837, Erpét. Gén., Paris 4:207. Hypsilophus (Hypsilophus) Rhinolophus – Fitzinger 1843, Syst. Rept., Wien 1:55. Hypsilophus (Hypsilophus) tuberculatus – Fitzinger 1843, Syst. Rept., Wien 1:55. Iguana rhinlophus – Gray 1845, Cat. Spec. Liz. Coll. Brit. Mus., London p. 186. Metopoceros cornutus – Tyler 1850, Proc. Zool. Soc. London 1850:106; pl. 3.
EVOLUTION OF IGUANAS
Iguanas : Biology and Conservation, University of California Press, 2004. ProQuest Ebook Central,
41
?Iguana Hernandesii Jan 1857 (nomen nudum fide Smith and Taylor, 1950), Indice Sistem. Rett. E. Anfib. Medesimo, Milano p. 38. Iguana tuberculata Var. rhinolopha – Boulenger 1885, Cat. Liz. Brit. Mus., London 2:190. Iguana iguana rhinolopha – Van Denburgh 1898, Proc. Acad. Sci. Philadelphia (1897) 49:461. Iguana iguana iguana – Dunn 1934, Copeia 1934(1):1. DISTRIBUTION
Northern Mexico, from Sinaloa and Veracruz, southward through Central America and into northeastern South America to the Tropic of Capricorn in Paraguay and southeastern Brazil (Etheridge, 1982; de Queiroz, 1995). The species occurs on numerous islands, including Cozumel, Utila, Roatán, de Guanaja, Corn, Providencia, San Andres, Aruba, Trinidad, Tobago, and various localities in the Lesser Antilles (Etheridge, 1982). LAPITIGUANA† PREGILL AND WORTHY
Lapitiguana† Pregill and Worthy 2003, Herpetologica 59(1):60; figs. 2–3. — Type species (by monotypy): Lapitiguana impensa† Pregill and Worthy 2003.
Copyright © 2004. University of California Press. All rights reserved.
Lapitiguana impensa† Pregill and Worthy
Lapitiguana impensa† Pregill and Worthy 2003, Herpetologica 59(1):60; figs. 2–3. — Holotype: MNZ 37015. Type locality: “Voli Voli Cave (Qara-ni-vokai Site) near Sigatoka, Viti Levu, Fiji, Southwest Pacific.” GEOLOGIC AGE
The type locality is in the Late Quaternary. This now extinct species likely overlapped with the Lapita people approximately 3000 years ago (Pregill and Worthy, 2003). DISTRIBUTION
Known only from Viti Levu, Fiji. Fossil remains have been recovered from the type locality on the southwest side of Viti Levu, in addition to Qara-
42
ni-oso near the village of Tau and Bukusia Cave near Raiwaqa Village (Pregill and Worthy, 2003). PUMILIA† NORELL
Pumilia† Norell 1989, Contr. Sci. Nat. Hist. Mus. Los Angeles Co. 414:3; fig. 3. — Type species (by monotypy): Pumilia novaceki† Norell 1989. Pumilia novaceki† Norell
Pumilia novaceki† Norell 1989, Contr. Sci. Nat. Hist. Mus. Los Angeles Co. 414:3; fig. 3. — Holotype: LACM 64115/13739. Type locality: “Vellacito Badlands of Anza Borrego Desert State Park, San Diego County, California” by implication. GEOLOGIC AGE
The type locality is in the Late Neogene deposits of the Palm Springs Formation and is estimated to be between 2.0 and 3.4 million years old (Norell, 1989). DISTRIBUTION
Known only from the type locality in Anza Borrego Desert State Park, San Diego County, California (Norell, 1989). SAUROMALUS DUMÉRIL
Sauromalus Duméril 1856, Arch. Mus. Hist. Nat., Paris 8:535; pl. 23, fig. 3, 3a — Type species (by monotypy): Sauromalus ater Duméril 1856. Euphryne Baird 1858, Proc. Acad. Nat. Sci. Philadelphia 10:253. —Type species (by monotypy): Euphryne obesus Baird 1859. Sauromalus ater Duméril
Sauromalus ater Duméril 1856, Arch. Mus. Hist. Nat., Paris 8:535; pl. 23, fig. 3, 3a. — Holotype: MNHN 813. — Type locality: not given. — Designated type locality: “one of the following islands in the Gulf of California: Espíritu Santo, Isla Partida, San Marcos, San Diego, Santa Cruz, or San Francisco” (Shaw, 1945); “Espíritu Santo Island” (Smith and Taylor, 1950); “southern coastal Sonora” (Hollingsworth, 1998; but see Montanucci, 2000).
BRADFORD D. HOLLINGSWORTH
Iguanas : Biology and Conservation, University of California Press, 2004. ProQuest Ebook Central,
Euphryne obesus Baird 1858, Proc. Acad. Nat. Sci. Philadelphia 10:253. — Type: USNM 4172. — Type locality: “Fort Yuma.” (see Montanucci [2001] for further clarification). Euphryne obesa – Baird 1859, U.S. Mex. Bound. Surv., Washington, D.C. 2:6; pl. 27 (valid emendation). Sauromalus interbrachialis Dickerson 1919 (syn. fide Schmidt, 1922), Bull. Am. Mus. Nat. Hist., New York 41:463. — Holotype: USNM 64443. — Type locality: “La Paz, Lower California, Mexico,” in error (Schmidt, 1922). Sauromalus townsendi Dickerson 1919, Bull. Am. Mus. Nat. Hist., New York 41:464. — Holotype: AMNH 5643. — Type locality: “Tiburon Island, Gulf of California, Mexico.” Sauromalus obesus – Schmidt 1922 (syn. fide Hollingsworth, 1998), Bull. Am. Mus. Nat. Hist., New York 46:618. Sauromalus australis Shaw 1945 (syn. fide Hollingsworth, 1998), Trans. San Diego Soc. Nat. Hist. 10:286. — Holotype: SDSNH 30170. — Type locality: “San Francisquito Bay, Baja California, Mexico.”
Copyright © 2004. University of California Press. All rights reserved.
Sauromalus obesus townsendi – Shaw 1945 (syn. fide Hollingsworth, 1998), Trans. San Diego Soc. Nat. Hist. 10:290. Sauromalus obesus tumidus Shaw 1945 (syn. fide Hollingsworth, 1998), Trans. San Diego Soc. Nat. Hist. 10:292. — Holotype: SDSNH 27323. — Type locality: “Telegraph Pass, Gila Mountains, Yuma County, Arizona.” Sauromalus obesus obesus – Shaw 1945 (syn. fide Hollingsworth, 1998), Trans. San Diego Soc. Nat. Hist. 10:295. Sauromalus shawi Cliff 1958, Copeia, 4:259. — Holotype: CAS-SU 16120. — Type locality: “San Marcos Island.” Sauromalus obesus multiforaminatus Tanner and Avery 1964 (syn. fide Hollingsworth, 1998), Herpetologica 20:38; fig. 1a, 1b. — Holotype: BYU 11376. — Type locality: “North Wash, 11 miles northwest of Hite, Garfield County, Utah.”
Sauromalus ater ater – Soulé and Sloan 1966 (syn. fide Hollingsworth, 1998), Trans. San Diego Soc. Nat. Hist. 14:141. Sauromalus ater shawi – Soulé and Sloan 1966 (syn. fide Hollingsworth, 1998), Trans. San Diego Soc. Nat. Hist. 14:141. Sauromalus obesus australis – Case 1982 (syn. fide Hollingsworth, 1998), in Burghardt and Rand (eds.), Iguanas of the World, New Jersey, 185. REMARKS
In the most recent taxonomic review of Sauromalus, Hollingsworth (1998) treated the names Sauromalus ater, S. australis, and S. obesus as synonyms, and following the principle of priority, the name Sauromalus ater was applied to a single, more broadly distributed species. A petition to the International Commission on Zoological Nomenclature (ICZN) is pending (Montanucci et al., 2001), requesting the ICZN use its plenary powers and place the name Sauromalus ater on the list of unavailable names. Rebuttal opinions are currently being submitted recommending the ICZN uphold the principle of priority and retain the name S. ater. Because of the disagreements over the use of S. ater, many authors chose to follow the taxonomy prior to Hollingsworth (1998) and recognize S. obesus (see Tracy, this volume). DISTRIBUTION
Southwestern United States (in southern Nevada, southwestern Utah, southeastern California, and western Arizona), southward to northwestern Mexico (in western Sonora), the peninsula of Baja California, and the following islands in the Gulf of California: Willard, Tiburón, San Marcos, El Coyote, Danzante, San Cosme, Santa Cruz, San Diego, San José, San Francisco, Ballena, Gallo, Partida Sur, and Espíritu Santo (Shaw, 1945, Etheridge, 1982; de Queiroz, 1995; Hollingsworth, 1998; Grismer, 1999b). Sauromalus hispidus Stejneger
Sauromalus ater Streets 1877 (part.), Bull. U. S. Natl. Mus., Washington, D.C. 7:36.
EVOLUTION OF IGUANAS
Iguanas : Biology and Conservation, University of California Press, 2004. ProQuest Ebook Central,
43
Sauromalus hispidus Stejneger 1891, Proc. Nat. Mus., Washington, D.C. 14:409. — Holotype: USNM 8563. — Type locality: “Angel de la Guardia Island, Gulf of California.” DISTRIBUTION
Found on the islands of Ángel de La Guarda, Granito, Mejía, Pond, San Lorenzo Norte, San Lorenzo Sur, and numerous islands in Bahía de Los Ángeles, including Cabeza de Caballo, La Ventana, Piojo, Flecha, Mitlán, and Smith, Gulf of California, Mexico (Shaw, 1945; Etheridge, 1982; de Queiroz, 1995; Hollingsworth, 1998; Grismer, 1999b). Sauromalus klauberi Shaw
Sauromalus klauberi Shaw 1941, Trans. San Diego Soc. Nat. Hist. 9:285. — Holotype: SDSNH 6859. — Type locality: “Santa Catalina Island, Gulf of California, Mexico.” Sauromalus ater klauberi – Soulé and Sloan 1966 (syn. fide Hollingsworth, 1998), Trans. San Diego Soc. Nat. Hist. 14:141. DISTRIBUTION
Isla Santa Catalina, Baja California Sur, Mexico (Shaw, 1941, 1945). Sauromalus slevini Van Denburgh
Sauromalus ater slevini – Robinson 1974 (syn. fide Hollingsworth, 1998), Herpetologica 30(2):163. DISTRIBUTION
Islas Carmen, Los Coronados, and Monserrate, Baja California Sur, Mexico (Shaw, 1945; Etheridge, 1982; de Queiroz, 1995; Hollingsworth, 1998; Grismer, 1999b). Sauromalus varius Dickerson
Sauromalus varius Dickerson 1919, Bull. Am. Mus. Nat. Hist., New York 41:464. — Holotype: AMNH 5633. — Type locality: “San Esteban Island, Gulf of California, Mexico.” DISTRIBUTION
Islas San Esteban, Sonora and Roca Lobos, Baja California, Mexico (Hollingsworth et al., 1997; Hollingsworth, 1998). ACKNOWLEDGMENTS
Early drafts of this chapter were read by Kevin de Queiroz and two anonymous reviewers. Both greatly enhanced the chapter and improved on a number of shortcomings. I am grateful for their help. Any errors, of course, are solely my responsibility.
Copyright © 2004. University of California Press. All rights reserved.
Sauromalus slevini Van Denburgh 1922, Occ. Pap. Calif. Acad. Sci. 10(1):97. — Holotype:
CAS 50503. — Type locality: “South end of Monserrate Island, Gulf of California, Mexico.”
44
BRADFORD D. HOLLINGSWORTH
Iguanas : Biology and Conservation, University of California Press, 2004. ProQuest Ebook Central,
3
Genetic Contributions to Caribbean Iguana Conservation Catherine L. Malone and Scott K. Davis
Copyright © 2004. University of California Press. All rights reserved.
STATUS OF CARIBBEAN IGUANAS Iguanas of the genus Cyclura occur only on islands in the West Indies. Throughout its distribution, this genus exhibits a high degree of endemism, with a single species or subspecies restricted to individual or small groups of islands (figure 3.1). Traditionally, species and subspecies have been described on the basis of morphology, and in many cases, a limited number of specimens were examined to establish taxa. Currently, there are eight described species and thirteen extant subspecies (Schwartz and Carey, 1977). Populations of Cyclura are being directly impacted throughout their ranges as a result of predation by both humans and feral mammals, such as rats, cats, and mongooses (Lewis, 1944; Wiewandt, 1977; Iverson, 1978; Knapp et al., 1999; Mitchell, 1999; Wilson et al., this volume). In addition, iguana habitat is being degraded by overgrazing and development. As a result, several taxa of Cyclura are threatened with extinction. The 2000 IUCN Red List assessment ranks nine taxa as Critically Endangered, four as Endangered, and three as Vulnerable
(Hilton-Taylor, 2000). Successful conservation management of Cyclura populations depends on accurate determination of taxonomic units that can be used in the development of effective management plans for the region. The genus Iguana ranges from northern Mexico, through Central America, to the Tropic of Capricorn in southeastern Brazil and Paraguay, and across the Lesser Antilles (Burghardt and Rand, 1982). The two species that make up the genus are I. iguana, which is found throughout the range of the genus, and I. delicatissima, which is limited to the Lesser Antilles. There are many barriers to dispersal separating continental populations (e.g., the Andes, the Amazon), and extensive water barriers restrict gene flow between island and mainland populations, as well as among islands. Additionally, Lesser Antillean populations of I. iguana, such as those on St. Lucia and Saba, display morphologies distinct from those of mainland forms, suggesting restricted gene flow and possibly strong selective forces. As we discuss in more detail later in this chapter, based on geographic distribution and patterns of genetic variation, it is possible that
45
Iguanas : Biology and Conservation, University of California Press, 2004. ProQuest Ebook Central,
Copyright © 2004. University of California Press. All rights reserved.
FIGURE 3.1. Biogeographic distribution of Cyclura. Maximum likelihood generated hypothesis of phylogenetic relationships based on 903 bp of mtDNA sequence data. Phylogram superimposed on a map of the Greater Antilles. Reprinted from Molecular Phylogenetics and Evolution, vol. 17, C. L. Malone, T. Wheeler, J. F. Taylor, and S. K. Davis et al., “Phylogeography of the Caribbean rock iguana (Cyclura): Implications for conservation and insights on the biogeographic history of the West Indies,” pp. 269–79, copyright 2000, with permission from Elsevier.
I. iguana does not represent a single species (Malone, 2000). Throughout their ranges, both I. iguana and I. delicatissima are heavily exploited by humans and are experiencing habitat loss. As a result, both are listed on the Convention on International Trade in Endangered Species of Wild Fauna and Flora (CITES) appendix II. For I. iguana, sustainable ranching has been undertaken to divert hunting practices and, in some cases, restore wild populations (Werner, 1991). Ranches cooperatively exchange live iguanas and some distribute captive bred iguanas to restocking programs throughout Central America (Cohn, 1989). Such practices, although proceeding with the best of intentions, may do more harm than good to conservation efforts if they do not consider potential genetic distinctiveness among populations.
46
GENETIC TOOLS IN CONSERVATION Research in genetics depends on the availability of marker systems. In the past, such genetic markers have included allozymes (derived from protein electrophoresis), standard or differentially stained karyotypes, mitochondrial DNA (mtDNA) restriction fragment length polymorphisms, and DNA fingerprinting (Hillis et al., 1996). Two techniques, nucleotide sequencing of nuclear and mtDNA genes and nuclear DNA microsatellites, have emerged as ideal tools for genetic analyses of populations and have great potential for use in species conservation. Mitochondrial DNA sequencing and microsatellites have proven useful for addressing questions related to taxonomy and population dynamics in a wide range of taxa (e.g., gazelles: Arctander et
C AT H E R I N E L . M A L O N E A N D S C O T T K . D AV I S
Iguanas : Biology and Conservation, University of California Press, 2004. ProQuest Ebook Central,
Copyright © 2004. University of California Press. All rights reserved.
al., 1996; moose: Broders et al., 1999; oystercatchers: Van Treuren et al., 1999; whales: Brown Gladden et al., 1999; whitefish: Hansen et al., 1999). Information from these markers can be combined with other types of data (e.g., ecological, demographic) to help determine not only where conservation efforts should be concentrated, but also how they should proceed. Mitochondrial DNA is a haploid, maternally inherited marker, and microsatellites are nuclear, biparentally inherited markers. Because mtDNA is haploid and represents only one half of the population, an mtDNA haplotype will coalesce four times faster in a given population than an allele at a nuclear locus. This makes mtDNA loci very effective for identifying geographically distinct maternal lineages and reconstructing evolutionary relationships, both of which have implications for setting conservation management priorities (Vane-Wright et al., 1991; Moritz, 1994; Crozier, 1997). Microsatellites are similar to DNA fingerprints but are single locus, codominant, Mendelian markers, and are therefore more amenable to statistical analysis and easier to interpret in pedigrees. Both of these techniques provide highlevel resolution and are easily performed via the polymerase chain reaction (PCR). PCR technology offers the tremendous advantage of utilizing only minute amounts of samples and providing data even when available samples are of very poor quality (e.g., museum specimens, shed skins). This technology allows the collection of data in a noninvasive, expeditious, and cost-efficient manner. Nuclear microsatellites, because of their high mutation rate, are particularly useful for addressing intraspecific-level questions by characterizing the distribution of variation among and within populations (Bruford and Wayne, 1993; Paetkau and Strobeck, 1994). For instance, this information can be used to quantify genetic variation within a population; identify populations that have unique genetic compositions (Parker et al., 1999); reveal dispersal patterns (Paetkau et al., 1998; Van Treuren et al., 1999); and uncover historical events, such as bottlenecks or
recent range expansions (Beaumont, 1999). In addition, allelic data can address ecological questions related to the natural history of a population, such as social structure (Paxton et al., 1996), mating system (Wilmer et al., 2000), and dispersal among populations (Paetkau et al., 1998; Piertney et al., 1998). Over the past decade, microsatellite markers have been developed for use in several species of Cyclura and Iguana. In combination, nuclear and mitochondrial data enable the characterization of populations in terms of historical relationships, current boundaries, and the distribution of genetic diversity. Microsatellite markers are especially appropriate to aid in addressing some of the conservation issues facing Caribbean iguanas: genetic distinctiveness and taxonomic status of species, subspecies, and populations; and retention of genetic variation during long-term management of small populations.
MOLECULAR PHYLOGENETICS AND CURRENT TAXONOMY OF IGUANAS Evolutionarily meaningful and biologically based taxonomies are fundamental to the conservation of diversity because taxonomic categories help define focal points for conservation and scientific activities. These taxonomies are most useful if hierarchically comparable (i.e., applied consistently) within a family. For instance, species in peril rightly receive more attention than subspecies in peril, which, by definition, represent geographic variants in a polytypic species. Clearly, it is imperative that the taxonomy of any group provides biologically meaningful information regarding population boundaries, uniqueness of lineages, and evolutionary histories. Errors in taxonomy can sometimes have tragic consequences. For example, the tuatara of New Zealand (Sphenodon), the last remaining lineage of the order Rhynchocephalia, consisted of three species in the nineteenth century. One species has since gone extinct and, of the two remaining species, S. guentheri was initially relegated to subpecific status due to its morphological similarity
G E N E T I C C O N T R I B U T I O N S T O I G U A N A C O N S E R VAT I O N
Iguanas : Biology and Conservation, University of California Press, 2004. ProQuest Ebook Central,
47
Copyright © 2004. University of California Press. All rights reserved.
to the most abundant species, S. punctatus (Meffe and Carroll, 1997). The government of New Zealand failed to afford any protection to S. guentheri, and all but one population has subsequently gone extinct. Recently, genetic analysis revealed that S. guentheri is indeed highly divergent from S. punctatus (Daugherty et al., 1990). On a more positive note, conservation efforts were recently validated by genetic analysis that confirmed the highly contested species status of the Kemp’s ridley sea turtle, Lepidochelys kempi (Bowen et al., 1991). Situations such as these illustrate the ability of genetic data to contribute to conservation efforts through the diagnosis of phylogenetically and evolutionarily distinct lineages. Examination of a well-supported and objectively derived phylogeny reveals discrepancies between taxonomy and phylogeny. Branch lengths in a phylogeny provide information on the evolutionary age of particular divergences among lineages and past processes that may have affected the demographic and genetic characteristics of populations (Slatkin and Hudson, 1990; Hillis et al., 1996). It follows that a robust molecular phylogeny can identify situations warranting a closer look using traditional methods. Evolutionary relationships between and within Cyclura and Iguana are currently being addressed through molecular research. Several studies have established that these two Caribbean taxa are only distantly related (Sites et al., 1996; Petren and Case, 1997; Malone et al., 2000; but see Norell and de Quieroz, 1991; Rassman, 1997). Furthermore, although the sister taxon to Iguana is Sauromalus, Cyclura is not particularly closely related to any other genus. Morphologically based studies of phylogenetic relationships within Cyclura resulted in several unresolved questions (Schwartz and Carey, 1977). Recent molecular data from mtDNA sequences of the ND4 to transfer RNA (tRNA)Leu region have provided considerable resolution of relationships within Cyclura (Malone et al., 2000). Through calibration of a molecular clock, the genus was estimated to be between fifteen and thirty-five million years old, with C. pinguis on
48
the Puerto Rican bank as the most basal taxon to a northwest radiation through the Greater Antilles (Malone et al., 2000). Although specieslevel designations were congruent with the molecular phylogeny, the mitochondrial data raised questions concerning the taxonomic status of some subspecies. The Grand Cayman iguana, C. nubila lewisi, was found to have a distinct mtDNA lineage and was not the sister group to the other two subspecies of C. nubila (figure 3.1). The population of C. n. lewisi is at great risk, consisting of fewer than two hundred individuals (Burton, 2000). A comprehensive study of the species, using nuclear markers, is needed to determine whether the two types of genetic data are congruent and support a species level designation for C. n. lewisi. The mtDNA data also suggested that existing subspecific designations of C. cychlura from the Bahamas might require revision (figure 3.3). This work was followed by a comprehensive nuclear microsatellite study (Malone et al., 2003), which found two geographically defined units supported by genetic data: Andros Island and the Exumas. Moreover, these results are supported by preliminary analysis of morphological data (C. Knapp, pers. comm.). Finally, preliminary investigation found no genetic variation among the three subspecies of C. rileyi. From a conservation standpoint, this observation is significant because considerable effort has been focused on managing these populations as separate entities. It is possible that these populations have only recently separated, in which case this management approach may not be optimal. This situation warrants further study to clarify populationlevel relationships within C. rileyi and develop a clear management plan (see also Carter and Hayes, this volume). Because of its broad distribution in the neotropics and its ability to survive in human modified habitat, Iguana iguana has received little attention from systematists and conservation biologists. Unfortunately, this animal is not immune to excessive harvesting, which has decimated local populations (Burghardt and Rand, 1982). Recently, a phylogenetic study found
C AT H E R I N E L . M A L O N E A N D S C O T T K . D AV I S
Iguanas : Biology and Conservation, University of California Press, 2004. ProQuest Ebook Central,
Copyright © 2004. University of California Press. All rights reserved.
FIGURE 3.2. Sequence divergence among various taxa. Comparison of mtDNA sequence divergence at the partial ND4 to tRNALeu locus between several lineages within Cyclura, Iguana, and Sauromalus. Data from Malone et al. (2000) and Sites et al. (1996). Shaded areas highlight those comparisons that indicate a questionable taxonomy. Clades A–C are defined in figure 3.4.
FIGURE 3.3. Phylogenetic relationships of Cyclura cychlura. Results of phylogenetic analysis of mtNDA sequence data of the relationships between populations of C. cychlura (Malone, 2000). Numbers above each branch indicate the number of nucleotide substitutions and those below give the bootstrap support based on two thousand iterations. Numbers in parentheses represent the number of individuals sequenced for a given haplotype.
congruent patterns between mtDNA and microsatellite markers, revealing high levels of subdivision among populations of I. iguana that were roughly defined by geographic regions (figure 3.4; Malone, 2000). As previously mentioned,
branch lengths in a phylogeny roughly reflect relative ages of lineages (Hillis et al., 1996), and we can compare these results with those for other taxa at the same locus. For instance, figure 3.2 shows an average of 4.3% sequence divergence
G E N E T I C C O N T R I B U T I O N S T O I G U A N A C O N S E R VAT I O N
Iguanas : Biology and Conservation, University of California Press, 2004. ProQuest Ebook Central,
49
C A
Copyright © 2004. University of California Press. All rights reserved.
FIGURE 3.4. Phylogenetic relationships between Iguana iguana lineages. Maximum likelihood generated hypothesis of phylogenetic relationships based on 903 bp of mtDNA sequence data from Malone (2000). Numbers above each branch indicate the number of nucleotide substitutions and those below give the bootstrap support based on two thousand iterations. Clades A–C are referred to in figure 3.2.
between Central and South American I. iguana compared with 4.0% between Sauromalus obesus and S. varius. Comparison of vertebrates from other families yields similar results. For example, species of muntjac deer (Muntiacus gongshanensis and M. feae; Wang and Lan, 2000) and pit vipers (Agkistrodon piscivorous and A. bilineatus; Parkinson et al., 2000) show approximately 3.7% and 4% sequence divergence, respectively. These data suggest that the taxonomy of I. iguana is not hierarchically comparable with other genera and call for a more comprehensive study. Interestingly, several shallow lineages were identified within Central America, each separated by only a few nucleotide substitutions, suggesting a relatively recent radiation in this region. Finally, the molecular
50
B
phylogeny reveals that at least two I. iguana radiations in the Lesser Antilles have taken place, first onto St. Lucia and more recently onto Saba and Montserrat. Cryptic species with continental ranges similar to I. iguana (e.g., tungara frogs and pseudoscorpions [Wilcox et al., 1997], bushmasters [Zamudio and Greene, 1997]) have been characterized by extreme genetic differentiation in the absence of corresponding morphological differences. To examine the validity of the current taxonomy of I. iguana, more detailed genetic data are needed from populations within South America. Currently, the concordant, geographically defined divisions found in both the nuclear and mtDNA data imply that at least three cryptic species may exist under the evolutionary
C AT H E R I N E L . M A L O N E A N D S C O T T K . D AV I S
Iguanas : Biology and Conservation, University of California Press, 2004. ProQuest Ebook Central,
and phylogenetic species concepts (Central American, South American, South American [Caribbean] + Lesser Antillean). However, although data are being collected, distinct lineages must be afforded protection by the conservation community. For example, all translocation of iguanas between South America, Central America, and the Caribbean Islands should cease, as hybridization between disparate lineages may lead to the loss of unique genetic variation and disintegration of locally adaptive gene complexes (Ward et al., 1998). In recent years, Iguana delicatissima populations have been afforded desperately needed protection in the Lesser Antilles. Interestingly, although I. delicatissima was found to be extremely divergent from its sister taxon, no genetic variation was found among its sampled island populations (figure 3.4; Malone, 2000). As with the situation discussed above involving Cyclura rileyi, these data suggest that all of the I. delicatissima populations might have been established in the recent past from one remnant population.
Copyright © 2004. University of California Press. All rights reserved.
GENETIC DIVERSITY AND CONSERVATION PRIORITIES Although molecular phylogenies offer an excellent method for discerning evolutionary relationships, establishing conservation priorities based on taxonomy alone can be subjective. In addition, a species from a monospecific lineage is more phylogenetically unique, and therefore of higher priority in terms of conservation of genetic diversity, than a species from a speciose lineage. It is unrealistic to expect that every population of every threatened species will receive equal conservation attention—some form of triage is necessary in any conservation plan. Although factors such as public appeal, ecological significance, and economics are important (Legge et al., 1996; Metrick and Weitzman, 1998), from a biological standpoint, the phylogenetic uniqueness of a population should be among the primary considerations in a conservation plan (Avise, 1989; Moritz, 1994; Sites and Crandall, 1997).
Recently, researchers have developed methods to quantify the impact that a single (or set of) population(s) has on the total genetic diversity of a group (Vane-Wright et al., 1991; Faith, 1992; Krajewski, 1994; Crozier, 1997). In a topological approach, genetic diversity is calculated based solely on branching order. A second method utilizes total degree of character divergence (Krajewski, 1994). A third method (Crozier, 1992; Faith, 1992) combines the merits of the previous two approaches (phylogenetic relationships and character divergence) in calculating the proportion of genetic diversity contributed by each unit (single lineage or group of lineages) within a given group, resulting in a measure of uniqueness for each unit. These methods of prioritization require comprehensive representation of the populations within a group and thus are appropriate for Cyclura, but as of yet, not for Iguana. Finally, it is important to stress that we are not proposing that this (or any) prioritization scheme should be used alone to construct a management plan. It is one piece of information among many that are important to consider. Malone et al. (2000) used the above combined method (Conserve 3.2.1; http://www.bio.ic.ac.uk/ evolve/software/conserve; Crozier et al., 1999) to examine conservation priorities based on genetic data for species within Cyclura (table 3.1). Using this program, it was possible to calculate error bounds on the uniqueness of each unit by employing a resampling method (bootstraps; Felsenstein, 1985). Malone et al. (2000) found that the two species in most peril, C. pinguis and C. collei (Alberts, 2000) are also the most genetically unique. The extinction of C. pinguis would have a significant impact on the loss of genetic diversity within the genus (16% loss). Fortunately, intensive conservation efforts are currently under way, including headstarting and public education (Hudson, 1999a) and future control programs for invasive species, particularly feral cats, are planned (Hudson and Alberts, this volume). The plight of the Jamaican iguana, C. collei, believed extinct from the 1940s until 1990 (Vogel et al., 1996), is equally precarious. Its rediscovery catalyzed conservation
G E N E T I C C O N T R I B U T I O N S T O I G U A N A C O N S E R VAT I O N
Iguanas : Biology and Conservation, University of California Press, 2004. ProQuest Ebook Central,
51
TABLE 3.1 Impact of Taxa Extinction on Genetic Diversity of Genus
taxon
percent genetic diversity loss
iucn threat
Cyclura pinguis
16.612 ± 0.067
Critically Endangered
C. collei
12.420 ± 0.051
Critically Endangered
C. cornuta
12.189 ± 0.035
Vulnerable
C. carinata
6.835 ± 0.034
Critically Endangered
C. ricordii
4.757 ± 0.011
Critically Endangered
C. nubila
4.578 ± 0.015
Vulnerable
C. cychlura
4.521 ± 0.015
Vulnerable
C. rileyi
3.658 ± 0.011
Endangered
C. nubila lewisi
3.272 ± 0.007
Critically Endangered
C. nubila caymanensis
1.506 ± 0.009
Critically Endangered
C. cornuta cornuta
1.219 ± 0.005
Vulnerable
C. nubila nubila
0.997 ± 0.006
Vulnerable
C. cychlura figginsi
0.897 ± 0.003
Endangered
C. cychlura cychlura
0.876 ± 0.001
Vulnerable
C. cornuta stejnegeri
0.738 ± 0.003
Endangered
C. cychlura inornata
0.004 ± 0.001
Endangered
C. rileyi rileyi
0
Critically Endangered
C. rileyi cristata
0
Critically Endangered
C. rileyi nuchalis
0
Endangered
C. carinata bartschi
0
Critically Endangered
Copyright © 2004. University of California Press. All rights reserved.
Notes: Taxa are ranked by the degree of impact their extinction would have on the genetic diversity of the genus using Conserve 3.2.1. Confidence limits of P = 0.05 are based on 500 bootstrap replicates. The 2000 IUCN Red List threat assessment for each taxon is from Hilton-Taylor (2000).
efforts by a consortium of U.S. zoos and Kingston’s Hope Zoo, which include headstarting, reintroduction, mongoose control, and management of a captive population (Hudson, 1999b; Wilson et al., this volume). Although support for recovery of this species is strong, the protection of its habitat is tenuous (Vogel and Kerr, in press). In contrast, the rhinoceros iguana of Hispaniola and Mona Island, C. cornuta, contributes a substantial amount of genetic diversity to the genus (12%) and is not under imme-
52
diate threat of extinction (table 3.1). In fact, this species is a good candidate for preventive conservation efforts because it has multiple populations of various sizes, experiencing varying degrees of disturbance (Sherwin et al., 2000). Cyclura cornuta provides an opportunity to evaluate potential conservation strategies in a field setting before they are applied to other iguanid species. This type of information will be especially important to preservation efforts for C. ricordii, a highly endangered species that is
C AT H E R I N E L . M A L O N E A N D S C O T T K . D AV I S
Iguanas : Biology and Conservation, University of California Press, 2004. ProQuest Ebook Central,
sympatric with C. cornuta in part of the lattter species’ range and therefore faces similar external threats. There are two notable decreases in the relative contribution to genetic diversity when populations are ranked by order of their genetic uniqueness (table 3.1). The first decrease occurs at the boundary between those species with and without closely related sister species. The second decrease, with the exception of Cyclura n. lewisi, marks the boundary between species and subspecies. The minimal contribution of the subspecies of Cyclura to overall genetic diversity in the genus is clear when they are compared with higher-level taxa. These results in no way imply that conservation efforts at the subspecies level are trivial; rather, they indicate that accurately defined species should be the initial unit considered when establishing conservation priorities. Emphasis on species-level conservation is also compatible with current legislative efforts (e.g., U.S. Endangered Species Act and CITES) and serves as an effective focal point for public support (Meffe and Carroll, 1997).
Copyright © 2004. University of California Press. All rights reserved.
MAINTENANCE OF GENETIC DIVERSITY WITHIN SPECIES Continued loss of habitat results in population declines, thus increasing the probability of extinction through stochastic events (e.g., disease and/or other natural disaster) and the loss of genetic diversity. The long-term survival of a lineage can be threatened with the loss of genetic diversity by compromising its resilience to environmental change (Wright, 1977; Honeycutt, 2000). For instance, Frankham (1995a) has suggested that genetically depauperate populations show increased susceptibility to disease and parasites. The smaller a population is, the more likely it is to lose allelic diversity through random genetic drift and experience an increase in homozygosity through chance mating between close relatives (Kimura and Crow, 1964; Nei et al., 1975; Hartl and Clark, 1990). Reduced fitness has been associated with loss of genetic diversity and increased homozygosity in experimental,
captive, and natural populations. Recent examples include experimental studies of land snails (Chen, 1993) and mice (Jimenez et al., 1994), where inbred individuals display significantly reduced fitness. In studies of cheetah (O’Brien et al., 1985; O’Brien, 1994), Florida panther (Roelke et al., 1993), captive Speke’s gazelle (Templeton and Read, 1984), black bear (Paetkau and Strobeck, 1994), rock wallaby (Eldridge et al., 1999), and moose (Broders et al., 1999) populations, it has been shown that a sharp decrease in population size (through various factors such as fragmentation, translocation, or founder events) results in a significant loss of genetic variation. Whereas cheetahs, Speke’s gazelles, Florida panthers, and black-footed rock wallabies exhibit symptoms of inbreeding depression, moose and black bears have shown no adverse effects to loss of variation. In part, this differential impact may result from differences in the type of bottleneck, which may be demographic or genetic. Although a decrease from ten million to one thousand individuals is an extreme reduction in population size, 99% of the genetic variation may be retained. Such bottlenecks are demographic, but not genetic, and may explain examples of species known to have experienced significant decreases in population size, such as pronghorn antelope and American bison (Honeycutt, 2000), with little loss of genetic variation. Although more work needs to be done in this area, the severity of the effects of population declines appears to be directly correlated with the size and duration of the event in terms of the number of generations involved (Paetkau and Strobeck, 1994; Honeycutt, 2000). Currently, efforts to offset the decline of iguana populations include removal of feral animals on islands, habitat improvement, headstarting, and translocation (Alberts, 2000). In this chapter, we argue that knowledge of genetic structure within and between iguana populations is essential for the development of a viable recovery plan. The detailed picture of population organization made possible by genetic data can provide insight into proper management of individual populations. For example, this type
G E N E T I C C O N T R I B U T I O N S T O I G U A N A C O N S E R VAT I O N
Iguanas : Biology and Conservation, University of California Press, 2004. ProQuest Ebook Central,
53
Copyright © 2004. University of California Press. All rights reserved.
FIGURE 3.5. Relationship between island size and genetic diversity. Genetic diversity (D) is calculated using the ShannonWiener Index: D = Σpi using microsatellite allelic data from Malone (2000) and unpublished data.
of information can expose patterns of mating, dispersal ability, and social structure. A case in point is the occurrence of multiple paternity in the Jamaican iguana, Cyclura collei, revealed by genetic data (Davis, 1996; Hudson and Alberts, this volume). Information regarding the degree of variation within populations and genetic divergence between populations can help focus conservation efforts. For instance, genetic markers and gene trees can provide information on the uniqueness of and relationships between populations, as well as characterizing overall genetic diversity. Such information can be used to guide captive propagation efforts, as has been done for the breeding program for the Grand Cayman iguana, C. nubila lewisi (Davis, 2000). In addition, these data allow conservation managers to minimize potential risks from outbreeding depression as a consequence of mixing genetically distinct stocks through improper translocations (Templeton, 1997). The data also allow identification of individuals and populations most suitable for translocation efforts. Maintaining genetic diversity in a species must be addressed at the population level. It is in the local population that responses to environmental challenges occur, adaptations arise, and genetic diversity is maintained (Meffe and Carroll, 1997). In general, larger islands can support larger populations, which in turn maintain higher levels of genetic diversity. Genetically depauperate populations are often those that have been isolated and retain small effective population sizes for many generations (Wright, 1940), as is the case for most of the Exuma Cays populations in the Bahamas. This is illustrated quite clearly when microsatellite allele diversity, cal-
54
culated using the Shannon-Wiener Index, is plotted against island size (figure 3.5). As expected, there is a strong correlation between island size (reflecting population size) and genetic diversity (r 2 = 0.778). Of course, populations do not always conform perfectly to this relationship, because they have unique evolutionary histories. For instance, a historical bottleneck can cause a currently large population to have less diversity than a contemporary smaller population. As an example, the North Adderly Cay population of Cyclura cychlura has by far the lowest genetic diversity relative to its island size (figure 3.5, table 3.2), indicating a historically very small effective-population size, consistent with both a severe bottleneck in the recent past or a recent colonization by a few individuals. Yet there are populations that have recently decreased dramatically in numbers, such as C. n. lewisi on Grand Cayman and C. pinguis on Anegada, that still maintain genetic variation consistent with the size of their respective islands. Apparently these populations have not been reduced in number long enough for genetic drift to have had deleterious effects. The population of C. cychlura on Gaulin Cay exhibits more diversity than expected (figure 3.5), presumably the result of emigration from Bitter Guana Cay, which is located only a few meters away and shares an mtDNA haplotype (figure 3.3). These data demonstrate that although larger populations generally maintain more genetic diversity than smaller ones, historical events play an important role in shaping the current diversity. Data on the partitioning of genetic variation among populations and subpopulations are required to understand current dynamics among
C AT H E R I N E L . M A L O N E A N D S C O T T K . D AV I S
Iguanas : Biology and Conservation, University of California Press, 2004. ProQuest Ebook Central,
Iguanas : Biology and Conservation, University of California Press, 2004. ProQuest Ebook Central,
Copyright © 2004. University of California Press. All rights reserved.
TABLE 3.2 Summary of Microsatellite Data
Cyclura cychlura cychlura microsatellite data Average number of alleles Total number of unique alleles
C. c. figginsi
gaulin
guana
north adderly
5
2.75
1.75
1.625
14
2 / 10
0/1
andros
C. c. inornata white bay
leaf
2
1.75
1.875
1/1
0/1
0/0
2/6
noddy
Average heterozygosity
0.540
0.375
0.191
0.203
0.278
0.360
0.281
Average diversity
1.050
0.746
0.313
0.269
0.411
0.464
0.451
Source: Compiled from Malone (2000). Notes: Average values are based on microsatellite loci. Values to left of slash are total number of unique alleles with respect to all populations; values to right of slash are total number of unique alleles with respect to only those populations within the Exumas.
Copyright © 2004. University of California Press. All rights reserved.
populations, as well as historical relationships between populations (Brown Gladden et al., 1999; Hansen et al., 1999). Data of this type were collected using microsatellite markers to clarify relationships between populations of Cyclura cychlura (Malone et al., 2003), revealing that, although once a contiguous population during the last glacial maximum, very little migration between any of the populations has occurred since their isolation. This information has bearing on which population(s) merits the most conservation attention from a genetics perspective. For instance, one might decide to focus on either populations containing high levels of genetic diversity or populations with unique genetic variants. As found by researchers working with the highly endangered Gila topminnow (Parker et al., 1999), these measures will not always result in the same ranking order. Of the four remaining topminnow populations, they discovered that the one containing the highest proportion of unique alleles did not contain the most variation overall, as measured by heterozygosity. Using microsatellite data collected on C. cychlura, Malone et al. (2003) found that either criterion would result in directing conservation efforts primarily towards the Andros Island population and secondarily toward the Gaulin Cay population (figure 3.5, table 3.2). In this case, understanding the distribution of genetic variation within C. cychlura will allow management efforts to be directed such that genetic diversity of the species as a whole is maximized. Information regarding the relative levels of genetic variation and relatedness among populations facilitates decisions regarding conservation measures. Although the removal of introduced predators to rapidly increase target species population size might be sufficient for maintaining genetic variation in one case, the facilitation of gene flow between neighboring populations could be the most appropriate action in another situation. For example, although both Cyclura n. lewisi and C. pinguis currently have small populations, they continue to maintain a substantial level of genetic diversity and, therefore, removal of recruitment barriers should
56
be the foremost objective in conservation programs for these species. In addition, allelic data showed that the C. cychlura population on Gaulin Cay contributes the most genetic diversity to the Exuma Cays region (table 3.1), presumably a result of migration between Gaulin and Bitter Guana Cays before the near extermination of the latter cay’s population. Because of its small capacity (due to island size), the currently high genetic variability in the Gaulin Cay population will naturally erode. Thus restoration of the population on Bitter Guana Cay, a much larger land mass, is of high priority in terms of preserving genetic diversity. Solutions to the impending problems on other Exuma Cays are more complicated. Although North Adderly Cay does not face any known external threats, it is genetically depauperate and will continue to lose diversity due to drift. There is evidence that the White Bay, Noddy, and North Adderly populations have exchanged migrants in the recent past, and the ecology of these cays appears virtually identical (C. Knapp, pers. comm.). Given the above, Malone et al. (2003) suggested that translocation of iguanas to the larger North Adderly Cay from the other two cays could be an appropriate and effective action to protect a significant portion of the diversity of C. cychlura in the near future.
FUTURE APPLICATIONS We have demonstrated how the application of genetic data, both phylogenetic and allelic, can assist in the prioritization of conservation efforts. Much of the groundwork for genetic studies of Caribbean iguanas has been completed. Marker systems are available for many species, and the interspecific phylogenetic relationships of Cyclura have been resolved. In addition to those mentioned above, several other issues concerning the Caribbean iguana group will require direct conservation action in the near future, and these efforts will also benefit from the application of genetic analysis. For example, C. carinata exists on many small cays in the Turks and Caicos Islands, occupying a cumulative land mass of about 28 km2 (Gerber and Iverson,
C AT H E R I N E L . M A L O N E A N D S C O T T K . D AV I S
Iguanas : Biology and Conservation, University of California Press, 2004. ProQuest Ebook Central,
future. As with Cyclura, resolution of many of the long-term problems faced by I. iguana will benefit from population genetic analysis. In areas where I. iguana is relatively abundant, genetic monitoring can help guide farming efforts so that surrounding natural populations are not swamped with the genotypes of only a handful of intensively mated individuals. Monitoring can also prevent the well-intentioned introduction of foreign genetic material to populations decimated by overharvesting and habitat destruction. ACKNOWLEDGMENTS
Sincere thanks to Rodney L. Honeycutt, Allison Alberts, and two anonymous reviewers for editorial contributions to this chapter. We acknowledge the Institute of Museum and Library Services for funding awarded to the Fort Worth Zoo in 1993 (Conservation Project Support Grant Number IC-30232-93), which launched genetic analyses of Caribbean iguanas in Scott Davis’s lab. In addition, a great deal of support for genetic research of iguana populations in the Bahamas has come from the John G. Shedd Aquarium (Chicago, Illinois).
Copyright © 2004. University of California Press. All rights reserved.
2000). Introduced predators have decimated most historical populations, and one of the largest cays currently inhabited by C. carinata is under development. Clearly, a characterization of the genetic architecture of this species is desirable to help prioritize conservation efforts and guide activities such as translocation (see Welch et al., this volume). Similarly, the current conservation status of C. ricordii is not well documented, and genetic analysis could aid conservation efforts by quantifying the effective size and genetic diversity in the few remaining populations. Other situations, such as that of C. collei, will require longer-term conservation measures. This species has been reduced to near extinction, with only eight known nesting females remaining as of 2000 (Vogel, 2000). The population contains so little genetic variation that conservation efforts must ensure that all adults contribute equally to future generations to minimize inbreeding depression and further loss of genetic diversity. Baseline genetic data for the genus Iguana are beginning to accumulate, and a robust molecular phylogeny and panels of nuclear microsatellite markers should be available in the near
G E N E T I C C O N T R I B U T I O N S T O I G U A N A C O N S E R VAT I O N
Iguanas : Biology and Conservation, University of California Press, 2004. ProQuest Ebook Central,
57
4
Genetic Structure of the Turks and Caicos Rock Iguana and Its Implications for Species Conservation Mark E. Welch, Glenn P. Gerber, and Scott K. Davis
are composed of multiple isolated populations inhabiting islands or patchily distributed habitat (Burghardt and Rand, 1982). Species with this type of distribution often have genetic structures that reflect geographic relationships among populations (Avise, 2000). Broadly speaking, these structures may provide an indication of the degree of evolutionary independence among populations, and when combined with geohistorical information, the relative effects of vicariance and dispersal may be inferred. High rates of migration among isolated populations may serve to maintain genetic homogeneity across a species range. When isolation is complete, populations may diverge without restriction. If migration among populations is maintained at reduced levels, however, then genetic drift will be tempered and genetic divergence may reach equilibrium. In addition to migration, selection may also play a role in determining the degree to which populations may diverge genetically. If isolated populations are under similar selective regimes, then selection may counter the effects of drift at functional loci. However, if populations face different selective
Copyright © 2004. University of California Press. All rights reserved.
Many species of iguanas
pressures, then distinct genotypes are likely to be favored in different populations. A low rate of dispersal in combination with selection against migrants and their offspring may act synergistically to restrict gene flow. Even in continuous populations, selection may induce clinal variation in allele frequencies (Endler, 1977). Here we attempt to assess the relative importance of vicariance and dispersal in shaping the genetic structure of the Turks and Caicos iguana, Cyclura carinata carinata, using nuclear genetic variation. This iguana is found on numerous islands and cays throughout the Turks and Caicos Islands (figure 4.1) and reaches high density on many islands with low anthropogenic disturbance (Iverson, 1979; Gerber and Iverson, 2000). In general, the genus Cyclura is noted for a high level of endemism, with sixteen subspecies restricted to single islands or island groups in the Greater Antilles (Etheridge, 1982). For example, C. c. bartschi, the only other subspecies of C. carinata, is found on a single small island in the Bahamas just northwest of the Turks and Caicos Islands. A recent phylogeographic study of the genus, based on mitochondrial genetic variation, strongly supports an east-
58
Iguanas : Biology and Conservation, University of California Press, 2004. ProQuest Ebook Central,
Copyright © 2004. University of California Press. All rights reserved.
FIGURE 4.1. Map of the Turks and Caicos Islands. Gray areas depict the island banks; sampled islands are shown in black and non-sampled islands in white. See table 4.2 for abbreviations and details on sampled islands. Inset shows the location of the Turks and Caicos Islands within the Greater Antilles.
to-west pattern of colonization, as the most basal lineage of Cyclura is found in the east and the most derived lineages in the west (Malone et al., 2000; Malone and Davis, this volume). This study also suggests that C. ricordii, a resident of Hispaniola (see inset of figure 4.1), is the closest extant relative of C. carinata. The Turks and Caicos Islands are distributed across two shallow island banks, the Turks Bank and the Caicos Bank. Estimates of sea level change over recent geological time (Lighty et al., 1982; Fairbanks, 1989) suggest that all islands located on each bank were part of one large island within the past fifteen thousand years. Mitochondrial genetic variation within Cyclura suggests that C. c. carinata may be as old as five million years (C. Malone, pers. comm.), and the fossil record confirms that this species has been present in the Turks and Caicos for at least several thousand years (R. Franz, pers. comm.). The two island banks, however, were never joined by land, as they are separated by the Turks Pas-
sage, a deep-water channel (NOAA, 1995). These large islands must have been gradually and partially inundated, leaving the islands of the present day. This gradual rise of the Caribbean over much of the Turks Bank and the Caicos Bank, from the perspective of C. c. carinata, represents a major loss of habitat and an increase in habitat fragmentation. Further, because sea levels rose gradually, some islands have been isolated for greater lengths of time than others, depending on variation in water depths. Observations of C. c. carinata behavior, when combined with the hydrogeological history of these islands, suggest that vicariance—isolation of populations by rising sea levels—may have been more instrumental than current dispersal rates in shaping the genetic structure of this species. Although C. c. carinata adults of both sexes are at least seasonally territorial and maintain semi-rigid home ranges (Iverson, 1979), juveniles and subadults have been known to disperse several kilometers over land (Iverson,
GENETIC STRUCTURE OF TURKS AND CAICOS ROCK IGUANA
Iguanas : Biology and Conservation, University of California Press, 2004. ProQuest Ebook Central,
59
Copyright © 2004. University of California Press. All rights reserved.
1979). However, C. c. carinata is unwilling to enter water, and when placed in water more than a few meters from shore will float passively rather than swim (Iverson, 1979). Together, these observations suggest that C. c. carinata has a high rate of migration over land and a low rate over water. Thus, we should expect little genetic divergence to accrue among populations on a continuous landmass because dispersal rates are likely to be high. This suggests that little genetic structure existed among populations of C. c. carinata within island banks prior to isolation by rising sea levels. Relative to populations connected by land, populations separated by water should experience lower levels of migration, resulting in increased differentiation through drift and selection. This suggests that isolation by rising sea levels likely had a pronounced effect on the genetic structure of this species. These patterns of dispersal and the hydrogeological history of the Turks and Caicos Islands further suggest that island populations isolated by the deepest waters should be most genetically dissimilar, because these island populations have had a greater length of time to differentiate. In addition to testing these hypotheses directly, we test the assumption that dispersal over land does not limit gene flow among populations and attempt to determine if natural selection has played a role in shaping the current genetic structure of this species. In addition to assessing the relative effect that different biogeographic influences have had on the genetic structure of C. c. carinata, we consider the implications of the current genetic structure for future conservation initiatives.
MATERIALS AND METHODS As part of a survey performed in 1995, the majority of the Turks and Caicos Islands were visited in an effort to catalog all extant populations of C. c. carinata (G. Gerber and M. Welch, unpubl. data). With few exceptions, an attempt was made to collect tissue from all extant populations. Populations were omitted from this study for one of two reasons. First, in some cases, an-
60
imals were so scarce that few or no captures were accomplished. Second, Chalk Sound has approximately one hundred tiny islets, many with extant populations (see figure 4.1). One Chalk Sound population was sampled to represent these numerous tiny populations. Iguanas were captured by noosing, and a blood volume of 500–1000 µl was collected from the caudal vein by syringe. Blood samples were stored at ambient temperature in 1 ml of a preservative lysis buffer while in the field (Longmire et al., 1992). Whole genomic DNA was obtained through phenol-chloroform extraction (Hillis and Davis, 1986). Individuals were genotyped for two microsatellite loci, lewisi 420 and lewisi 115, using primers designed for C. nubila lewisi (E. Louis, unpubl. data; table 4.1). Forward primers were end-labeled with 32P (Dowling et al., 1996). Microsatellite loci were amplified by the polymerase chain reaction (PCR). Reactions consisted of 10 nM DNA template, 10 µM forward and reverse primer, 150 mM MgCl2, 200 µM dNTPs, 1.2× Taq polymerase buffer, and one unit of Taq polymerase in a total volume of 25 µl. Reactions were denatured at 95 °C for 5 minutes then subjected to 30 cycles of 95 °C for 30 seconds, 55 °C for 30 seconds, and 70 °C for 2 minutes. Reactions were then left at 70 °C for an additional 10 minutes. Five µl of each reaction were run on standard 6% polyacrylamide gels for approximately 3 hours at 45 watts (Dowling et al., 1996). Gels were dried and placed on autoradiography film for 24–48 hours. Genotypes were scored in terms of the relative sizes of alleles. Analysis of molecular variance (AMOVA) was used to estimate hierarchical F-statistics assuming equal allelic independence (FST; Weir, 1996) and assuming a stepwise mutation model (RST; Slatkin, 1995). Two specific questions concerning the genetic structure of C. c. carinata were addressed. First, we asked whether the proportion of genetic variation among banks is greater than the proportion of genetic variation among populations within banks. To do this, we nested populations within banks and compared the resulting FST and RST values with FST and RST values among populations within banks. Com-
MARK E. WELCH ET AL.
Iguanas : Biology and Conservation, University of California Press, 2004. ProQuest Ebook Central,
TABLE 4.1 PCR Primer Sequences Used
number of alleles in CYCLURA motif
primer sequences
Lewisi 115
GT
for 5′ CAGTCACCCACTTCTGGTTTACGAA rev 5′ AATGGAGCATACCGAGGTTTGGAAC
8
for 5′ ACATTGTTAATCTGGAAAGGTAGGTAGG rev 5′ GGTTTCTACAGCTGAGTGGACATTC
5
Lewisi 420
Copyright © 2004. University of California Press. All rights reserved.
CARINATA CARINATA
locus
GT
paring these values should allow us to infer the relative degree of isolation experienced by the two island banks. Second, we ask what relative effect isolation by water has had on the genetic structure of populations. Populations of the Caicos Bank were broken into two groups: those isolated by waters shallower than two meters (nonisolated) and those isolated by water deeper than two meters (isolated). Nonisolated populations are all located along the north rim of the Caicos Bank, where the bank is shallowest. Because this region of the bank is so shallow, sandbars between islands can form and dissipate; thus, we assume these populations have more recently been connected by land. Genetic variation attributable to variation among islands was calculated separately by means of AMOVA for nonisolated and isolated population groups to aid in making inferences regarding the water depth hypothesis (see below). All AMOVA calculations were conducted with ARLEQUIN 2.0 (Schneider et al., 1999). Further, ARLEQUIN 2.0 was used to calculate the probability of independence of alleles within and between loci. Genotypes in populations were tested for HardyWeinberg equilibrium at independent loci according to Guo and Thompson (1992) and linkage disequilibrium between loci according to Slatkin and Excoffier (1996). Mantel’s (1967) test was used to test the hypothesis that no significant association between geographic distance and genetic distance between island populations exists. Further, Mantel’s test
was used to test the water depth hypothesis that genetic distance between island populations is associated with water depth between islands. Geographic distances between islands was estimated using Universal Transverse Mercator (UTM) coordinates of sampling sites (DOS, 1969), water depths (the deepest point along the shallowest route between two islands) were taken from soundings charts (Gascoine and Minty, 1994; NOAA, 1995), and pairwise genetic distances (FST and RST) were computed using ARLEQUIN 2.0 (Schneider et al., 1999). Additionally, pairwise geographic distances between Caicos Islands populations were broken into equifrequent classes. A Mantel’s test was performed for each geographic distance class individually to determine if the relationship between geographic distance and genetic differentiation changes with the scale of geographic distance. The number of geographic distance classes generated was determined using Sturge’s rule (Legendre and Legendre, 1998). All Mantel’s tests were conducted using the R PACKAGE 4.0 (Casgrain and Legendre, 1998). The relationship between geographic distance and genetic differentiation (FST) was also investigated by means of linear regression (Hutchison and Templeton, 1999). Also in accordance with Hutchison and Templeton (1999), absolute values of residual FST were regressed against geographic distance to determine whether variance in FST is constant (homoscedastic) with regard to geographic distance.
GENETIC STRUCTURE OF TURKS AND CAICOS ROCK IGUANA
Iguanas : Biology and Conservation, University of California Press, 2004. ProQuest Ebook Central,
61
Iguanas : Biology and Conservation, University of California Press, 2004. ProQuest Ebook Central,
Copyright © 2004. University of California Press. All rights reserved.
TABLE 4.2 Islands in the Turks and Caicos from Which Blood Samples of Cyclura carinata carinata Were Collected
locus lewisi 115 (2n) island
code
group
n
Big Ambergris Cay, Caicos Islands
CIBA
ISO
Big Sand Cay, Turks Islands
TIBS
TUR
Bird Cay, Caicos Islands
CIBC
Burial Cay, Caicos Islands
+0
+4
+6
+8
locus lewisi 420 (2n)
+10
+16
23
6
40
10
20
—
4
5
CIBU
NON
6
Chalk Sound, Caicos Islands
CICS
NON
6
Dickish Cay, Caicos Islands
CIDK
NON
6
Donna Cay, Caicos Islands
CIDC
NON
6
East Bay Cay, Caicos Islands
CIEB
NON
17
34
Fish Cay, Caicos Islands
CIFC
ISO
13
2
Horse Cay, Caicos Islands
CIHS
NON
5
Iguana Cay, Caicos Islands
CIIC
NON
20
Little Ambergris Cay, Caicos Islands
CILA
ISO
24
“Little Hog” Cay, Caicos Islands
CILH
NON
4
Little Water Cay, Caicos Islands
CILW
NON
21
18
Lizard Cay, Caicos Islands
CILC
—
4
Long Cay, Turks Islands
TILC
TUR
18
Major Hill Cay, Caicos Islands
CIMH
—
2
Mangrove Cay, Caicos Islands
CIMG
NON
7
8
3
+18
+22
6
+0
+4
+8
20
3 1
2
1
1
11
4
4
7
14 4
6 6
2
4
15
15
3
13
2
4
4
8
11 6
6 12
1
11
19 6
38 1
20
5
9
1
4
19
9
29
42
24
4
5 4
20
5
47 5
38
8
4
8
36
19
38
2
4
8
2
4
7
2
1
5
19
4
+16
14
4
5 2
+12 40
9
12 1
n
11
1
Iguanas : Biology and Conservation, University of California Press, 2004. ProQuest Ebook Central,
Copyright © 2004. University of California Press. All rights reserved.
Middle Creek Cay, Caicos Islands
CIMI
NON
21
Middleton Cay, Caicos Islands
CIMT
NON
5
“Mosquito” Cay, Caicos Islands
CIMQ
NON
5
North Caicos, Caicos Islands
CINC
—
5
“North Sound” Cay, Caicos Islands
CINS
NON
6
Pine Cay, Caicos Islands
CIPI
—
1
Plandon Cay, Caicos Islands
CIPC
NON
6
6
Sail Rock Island, Caicos Islands
CISR
NON
5
3
Six Hills Cay, Caicos Islands
CISH
ISO
5
4
“South Sound” Cay, Caicos Islands
CISS
—
2
4
White Cay, Caicos Islands
CIWC
ISO
10
8
7
3
2
10
179
147
76
13
262
Totals
267
18
4
5
7
8
10 1
5
5
1
4
5
3 2
13
10
1
8
15
8
6
1
43
5
2
4
48
20
7
6
12
1
1
2
3
4
8
6
3
5
10
2
3
4 4
3
1
2
2
9
1 20
1
5
61
408
5
Notes: Four-letter codes are listed. “Group” denotes the group to which each population was assigned for AMOVA. Turks bank populations are denoted by “TUR,” Caicos bank populations are denoted by “NON” or “ISO,” depending on which subgroup they were assigned to (nonisolated or isolated). Populations that are not assigned to a group, noted by a dash, were omitted from all analyses because of low sample size, or in the case of CINC, the location from which the animals were captured was unknown. For each locus, n refers to the number of individuals scored in each population. Alleles are referred to by their size relative to the reference or fast allele, and the number of alleles occurring in each population (2n) is also listed
TABLE 4.3 Results from AMOVA
fst (p )
r st (p )
Among all populations
0.41 (