Goldfish Development and Evolution 9811608490, 9789811608490

Citation preview

Kinya G. Ota

Goldfish Development and Evolution

Goldfish Development and Evolution

Kinya G. Ota

Goldfish Development and Evolution

Kinya G. Ota Yilan Marine Research Station Institute of Cellular and Organismic Biology, Academia Sinica Yilan, Taiwan

ISBN 978-981-16-0849-0 ISBN 978-981-16-0850-6 https://doi.org/10.1007/978-981-16-0850-6

(eBook)

© The Editor(s) (if applicable) and The Author(s), under exclusive license to Springer Nature Singapore Pte Ltd. 2021 This work is subject to copyright. All rights are solely and exclusively licensed by the Publisher, whether the whole or part of the material is concerned, specifically the rights of translation, reprinting, reuse of illustrations, recitation, broadcasting, reproduction on microfilms or in any other physical way, and transmission or information storage and retrieval, electronic adaptation, computer software, or by similar or dissimilar methodology now known or hereafter developed. The use of general descriptive names, registered names, trademarks, service marks, etc. in this publication does not imply, even in the absence of a specific statement, that such names are exempt from the relevant protective laws and regulations and therefore free for general use. The publisher, the authors, and the editors are safe to assume that the advice and information in this book are believed to be true and accurate at the date of publication. Neither the publisher nor the authors or the editors give a warranty, expressed or implied, with respect to the material contained herein or for any errors or omissions that may have been made. The publisher remains neutral with regard to jurisdictional claims in published maps and institutional affiliations. This Springer imprint is published by the registered company Springer Nature Singapore Pte Ltd. The registered company address is: 152 Beach Road, #21-01/04 Gateway East, Singapore 189721, Singapore

Svetlana, Yunona, Enzo, Oton, and Okan. Thank you.

Preface

Goldfish are a popular ornamental domesticated fish species, and their highly divergent morphological features and color variations have attracted innumerable breeders and fanciers. The history of this species is unique in that it has been spread all over the world by breeders, and it has also been employed as an experimental organism by researchers in the field of life science. However, so far, no available scientific books provide a detailed description of the embryogenesis and morphogenesis of this animal. In fact, compared with the number of published books for fanciers, there are very few books on goldfish biology. This book is written with the intention of explaining how the beautiful goldfish body develops from a single fertilized egg and how this developmental process was changed during the process of domestication. In Chap. 1, the history of goldfish domestication and research is briefly introduced, taking into account the literature surveys written by early researchers and recently updated zooarchaeological studies. The aim of this chapter is to provide basic background of how goldfish have been utilized since their establishment by early Chinese breeders and how they have been investigated by scientists. In this chapter, readers may grasp the time scale of goldfish domestication for ornamental purposes. Chapter 2 then explains the biological characteristics of goldfish, including how this teleost species has been used in research, providing reasons for why evolution and development should be investigated in this ornamental species. In Chap. 3, phenotypic features of ornamental goldfish are introduced taking into account vertebrate anatomy. There are differences in systems for categorizing and designating ornamental goldfish strains among breeders, fanciers, and researchers, causing confusion about nomenclature. This confusion has impeded a systematic explanation of phenotypic characters of goldfish morphology. Thus, in this chapter, the “wild-type goldfish” is carefully defined, and subsequently, the characteristics of mutated ornamental goldfish strains are described by comparison with the wild-type goldfish. Although several books have attempted to exhaustively describe all ornamental goldfish strains and provide details about as many varieties of goldfish as possible, I do not have such aspirations. Rather than enumerative descriptions, this vii

viii

Preface

book describes the vast range of variations in ornamental goldfish strains systematically, incorporating an approach from vertebrate comparative anatomy. Chapters 4 and 5 cover the developmental process of the wild-type and mutant ornamental goldfish strains based on our previous publications and newly acquired data. In these chapters, the details of embryonic and post-embryonic development are fully described in the wild-type and twin-tail goldfish, including images of live goldfish, fluorescent dyes, and histological stains. Moreover, the developmental processes of some other ornamental goldfish strains are also described. Based on these above chapters, I raise several questions related to the establishment of ornamental goldfish strains in the context of evolutionary developmental biology (evodevo) in Chaps. 6 and 7. Recent progress in whole-genome sequencing has allowed us to identify loci and candidate genes, which are responsible for the mutated morphologies in several domesticated ornamental animals, including dogs and pigeons. In fact, the results derived from advanced sequencing technology have increased our knowledge of how genotypes evolved during the domestication process, but they also pose additional problems, especially with regard to evolution of phenotypes that require embryological knowledge; this is the reason why the title of this book is Goldfish Development and Evolution. In these two chapters, I aim to explain how the developmental process is related to the genetic fixation of ornamental phenotypes during domestication, taking into account evodevo-related concepts, such as developmental robustness, constraints, modularity, and others. In the final chapter, I added experimental notes on goldfish evodevo. Since I was appointed to my current affiliation (Yilan Marine Research Station, Institute of Cellular and Organismic Biology, Academia Sinica, Taiwan) in 2011, I have performed artificial insemination and observations of embryos and larvae in goldfish with members of my laboratory every year. I designed this chapter specifically to share the skills that I have accumulated in the course of making research observations in our laboratory. I hope that the descriptions in this chapter will be useful not only to researchers but also to enthusiastic breeders and fanciers who want to see first-hand more about embryonic and larval development of goldfish. Unlike mutant laboratory animals which must be kept under strictly controlled conditions, goldfish are ornamental fish that can be accessed by almost anyone anywhere. This ease of access allows one to feel close to evolutionary biology, developmental biology, and evolutionary developmental biology. I believe that if readers have the opportunity to encounter real, live models used in evolutionary developmental biology studies, they will better understand the technical terms of evolutionary developmental biology. I hope that this book provides an opportunity for all of us to think about the influences of anthropogenic activities on evolution and development of other organisms living today, and to consider how we will interact with other organisms in the near future, through the scientific lens of goldfish development and evolution. Yilan Marine Research Station Institute of Cellular and Organismic Biology Academia Sinica, Yilan, Taiwan

Kinya G. Ota

Acknowledgments

Thanks to the help of many people, I was able to finish writing this book successfully. I am grateful to Wen‐Hui Su (SHUEN‐SHIN Breeding Farm), You Syu Huang (former member of the Aquaculture Breeding Institute, Hualian), An-Pin Lin (Lan yang koi center), Chuang Wei Chen (Guppy Palace, Aquarium Design), Teng Yu-Feng (Big Wind technology), Ba-Jia Leisure Fishfarm, Shen Keng Ri Ji Guanli Chi, and other local fish farmers for technical advice on fish breeding and aquarium maintenance in Taiwan. I also thank the following current and former members of the Yilan Marine Research Station, Institute of Cellular and Organismic Biology, and Academia Sinica: the late Hung-Tsai Lee, Jhih-Hao Wei, Chia-Chun Lee, ChihiChiang Lee, Han-Chuan Tsai, the security staff, the water and electrical facilities maintenance staff, and other part-time staff for the maintenance of aquarium systems; Chi-Fu Hung, Fei Chu Chen, CF Hui, other ICOB members, and Life Science Library of Academia Sinica staff for administrative support; Shu-Hua Lee, Mariann Chang, Shi-Chieh Liu, Hsin-Yuan Tsai, Chen-Yi Wang, Hsiao-Chian Chen, Zu-Chin Chi, Jo-Hsin Chen, and Ing-Jia Li for experimental works and image acquisition; Takao K. Suzuki, Daichi G. Suzuki, Naoki Irie, Yuki Ishikawa, Asano Ishikawa, Kenta Sumiyama, Yi-Hsien Su, Jr-Kai Yu, John Wang, Duncan Wright, Koji Tamura, Yoshiiro Omori, Hiroki Higashiyama, Daisuke Koyabu, Akira R. Kinjo, Yasuhiro Oisi, Tatsuya Hirasawa, and Gembu Abe for their valuable scientific suggestion. Finally, I thank Marcus Calkins for his critical reading of my manuscript. This book is supported by Ministry of Science and Technology, Taiwan, and a Career Development Award from Academia Sinica.

ix

Contents

Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1.1 Goldfish Developmental Biology According to Early Researchers of Evolution . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1.2 Early Research on Goldfish Domestication . . . . . . . . . . . . . . . . . 1.3 Pre-domestication to Domestication . . . . . . . . . . . . . . . . . . . . . . 1.4 Domestication for Ornamental Purposes . . . . . . . . . . . . . . . . . . . 1.5 Selection of Peculiar Morphologies . . . . . . . . . . . . . . . . . . . . . . References . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

.

1

. . . . . .

2 4 7 9 11 14

2

Goldfish as an Experimental Model . . . . . . . . . . . . . . . . . . . . . . . . 2.1 Phylogenic Position Among Vertebrates . . . . . . . . . . . . . . . . . . . 2.2 Problems with Nomenclature, Phylogeny, and Biogeography . . . . 2.3 Duplicated Goldfish Genome . . . . . . . . . . . . . . . . . . . . . . . . . . . 2.4 Low Oxygen Tolerance, Physiology, and Neuroscience . . . . . . . . 2.5 Rise and Fade of Goldfish Embryology . . . . . . . . . . . . . . . . . . . 2.6 Contrast Between Zebrafish Mutants and Goldfish Strains . . . . . . 2.7 Comparison with Other Domesticated Animals . . . . . . . . . . . . . . References . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

. . . . . . . . .

17 18 20 24 26 28 30 33 36

3

Varieties of Goldfish Morphology . . . . . . . . . . . . . . . . . . . . . . . . . . . 3.1 The Single-Tail Common Goldfish as the “Wild-Type” Goldfish . . 3.2 Overview of the Wild-Type Goldfish Morphology . . . . . . . . . . . . 3.3 Mutated Morphological Features . . . . . . . . . . . . . . . . . . . . . . . . . 3.3.1 Nomenclature of Ornamental Goldfish Strains . . . . . . . . . . 3.3.2 Cranial Level . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 3.3.3 Trunk Level . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 3.3.4 Pectoral Fin . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 3.3.5 Pelvic Fin . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 3.3.6 Dorsal Fin . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 3.3.7 Anal Fin . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 3.3.8 Caudal Fin . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

45 46 48 50 52 54 55 56 57 57 57 59

1

xi

xii

Contents

3.3.9 Integuments . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Responsible Loci . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Three Representative Morphotypes . . . . . . . . . . . . . . . . . . . . . . 3.5.1 Single-Tail Morphotype . . . . . . . . . . . . . . . . . . . . . . . . . 3.5.2 Twin-Tail Morphotype . . . . . . . . . . . . . . . . . . . . . . . . . . 3.5.3 Dorsal-Finless Morphotype . . . . . . . . . . . . . . . . . . . . . . 3.6 Descriptions of Intermediated Morphotypes . . . . . . . . . . . . . . . . 3.6.1 Variations of Caudal and Anal Fin Mutations . . . . . . . . . 3.6.2 Variations in Dorsal-Finless Mutants . . . . . . . . . . . . . . . . 3.7 Cataloging of Goldfish Morphological Variations . . . . . . . . . . . . References . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

. . . . . . . . . . .

59 60 62 64 65 66 66 67 67 68 71

Development of the Wild-Type Goldfish . . . . . . . . . . . . . . . . . . . . . . 4.1 Normal Developmental Staging Table for Goldfish . . . . . . . . . . . . 4.2 Embryonic Development of the Single-Tail Common Goldfish . . . . 4.2.1 Zygote to Blastula Periods . . . . . . . . . . . . . . . . . . . . . . . . 4.2.2 Gastrula Period (50% Epiboly to Bud Stages) . . . . . . . . . . 4.2.3 Segmentation Period (6–22 Somite Stages) . . . . . . . . . . . . 4.2.4 Pharyngula Period (25–65% OVC) . . . . . . . . . . . . . . . . . . 4.2.5 Hatching Period (Long-Pec to Protruding-Mouth) . . . . . . . 4.3 Post-embryonic Developmental Process . . . . . . . . . . . . . . . . . . . . 4.3.1 Larval Period . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 4.3.2 Juvenile . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 4.3.3 Adult . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 4.4 Development of the Skeletal System . . . . . . . . . . . . . . . . . . . . . . 4.4.1 Cranial Region . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 4.4.2 Mid-Trunk Skeleton . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 4.4.3 Pectoral Fin Skeleton . . . . . . . . . . . . . . . . . . . . . . . . . . . . 4.4.4 Pelvic Fin Skeleton . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 4.4.5 Dorsal Fin Skeleton . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 4.4.6 Anal Fin Skeletons . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 4.4.7 Caudal Fin Skeleton . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 4.5 Notable Similarities/Differences Between Goldfish and Zebrafish . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . References . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

75 76 78 78 85 89 91 96 101 103 115 119 119 119 121 124 127 128 128 128

Development of Mutant Goldfish Strains . . . . . . . . . . . . . . . . . . . . . . 5.1 Twin-Tail Morphotypes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 5.1.1 Staging Indexes and Rates of Embryo Development . . . . . . 5.1.2 Early Embryogenesis of the Twin-Tail Morphotype . . . . . . 5.1.3 Modified Dorsal-Ventral Patterning . . . . . . . . . . . . . . . . . . 5.1.4 Twin-Tail Morphotype-Specific Features at Late Embryonic and Early Larval Stages . . . . . . . . . . . . . . . . . . . . . . . . . . 5.1.5 Skeletal Development During Larval Periods . . . . . . . . . . . 5.1.6 Histology of Larvae at the Trunk Level . . . . . . . . . . . . . . . 5.1.7 Comparison of Axial Skeletal Development in Larvae . . . .

137 139 139 140 141

3.4 3.5

4

5

132 133

144 146 159 163

Contents

xiii

5.1.8 5.1.9

Juvenile and Adult Stages . . . . . . . . . . . . . . . . . . . . . . . Inter- and Intra-strain Variations of the Developmental Process . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 5.2 Dorsal-Finless Morphotype . . . . . . . . . . . . . . . . . . . . . . . . . . . . 5.2.1 Pharyngula Stage Embryos and Hatching Stage Larvae . . 5.2.2 5–9 dpf Larval Progenies . . . . . . . . . . . . . . . . . . . . . . . . 5.2.3 Limitations of Staging Indexes for the Dorsal-Finless Morphotype . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 5.2.4 Molecular Interpretation of the Developmental Process . . 5.3 Notes on the Cranial Level, Body Shape, and Integument Ornamental Phenotypes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 5.3.1 Telescope Eyes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 5.3.2 Warty Growth . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 5.3.3 General Ornamental Mutant Phenotypes at the Cranial Level . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 5.3.4 Globular Body Shape . . . . . . . . . . . . . . . . . . . . . . . . . . . 5.4 Genes and Development . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . References . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 6

7

. 167 . . . .

168 173 175 176

. 179 . 180 . 182 . 182 . 184 . . . .

185 186 187 188

Evodevo Questions Related to Ornamental Morphology . . . . . . . . . . 6.1 Bifurcated Median Fin Mutations of Twin-Tail Morphotype Goldfish . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 6.1.1 Chordin Paralogs and Their Expression Patterns . . . . . . . . 6.1.2 Absence of the “Twin-Tail Common Carp” . . . . . . . . . . . . 6.1.3 Implications for Required Conditions for Large-Scale Morphological Evolution . . . . . . . . . . . . . . . . . . . . . . . . . 6.1.4 Independent Development of Paired Fins and Bifurcated Median Fins . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 6.1.5 Divergence of the chdL Paralog . . . . . . . . . . . . . . . . . . . . 6.1.6 Bifurcated Caudal Fin Resulting from Other Mutations . . . 6.1.7 Other Dorsal-Ventral Patterning-Related Genes . . . . . . . . . 6.2 Dorsal-Finless Morphotype and Its Deviated Morphology . . . . . . . 6.2.1 Dorsal-Finless Phenotype with Different Gene Mutations . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 6.2.2 Relationship with the Twin-Tail Morphology . . . . . . . . . . . 6.3 Absence of “Mirror Scale Goldfish” . . . . . . . . . . . . . . . . . . . . . . . 6.4 Different Ways to the Globular Body Shape . . . . . . . . . . . . . . . . . 6.5 Differences in Developmental Timings Between Mutated Phenotypes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . References . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

191

200 202 203 206 208

Problems, Challenges, and Perspectives . . . . . . . . . . . . . . . . . . . . . 7.1 Fixable Mutations Through Developmental Process . . . . . . . . . . 7.2 Genotype and Phenotype . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 7.3 Homozygosity, Development, Environment, and Polymorphisms .

225 226 228 232

. . . .

192 192 194 196

209 211 214 215 216 219

xiv

Contents

7.4 Perturbations, Development, and Evolution . . . . . . . . . . . . . . . . 7.5 Novel Phenotype and Developmental Process . . . . . . . . . . . . . . . 7.6 Genome Editing-Derived Domestication . . . . . . . . . . . . . . . . . . . References . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 8

. . . .

235 236 239 242

Experimental Notes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 8.1 Parents . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 8.1.1 Obtaining Parental Goldfish . . . . . . . . . . . . . . . . . . . . . . . 8.1.2 Size of Adult Goldfish . . . . . . . . . . . . . . . . . . . . . . . . . . . 8.1.3 Identification of Individual Live Goldfish . . . . . . . . . . . . . 8.1.4 Sexing in Spawning Season . . . . . . . . . . . . . . . . . . . . . . . 8.2 Live Feed . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 8.3 Artificial Fertilization . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 8.3.1 Preparation of Parent Fish . . . . . . . . . . . . . . . . . . . . . . . . 8.3.2 Hormone Stimulation . . . . . . . . . . . . . . . . . . . . . . . . . . . . 8.3.3 Preservation of Sperm . . . . . . . . . . . . . . . . . . . . . . . . . . . 8.3.4 A Note on Over-matured Eggs . . . . . . . . . . . . . . . . . . . . . 8.3.5 Dry Method of Insemination . . . . . . . . . . . . . . . . . . . . . . . 8.3.6 Blocking of the Bottom of the Polystyrene Plastic Dish (Optional) . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 8.3.7 Washing Fertilized Eggs . . . . . . . . . . . . . . . . . . . . . . . . . 8.4 Embryo and Juvenile Nursery . . . . . . . . . . . . . . . . . . . . . . . . . . . 8.4.1 Incubation Condition . . . . . . . . . . . . . . . . . . . . . . . . . . . . 8.4.2 Counting Live and Dead Eggs . . . . . . . . . . . . . . . . . . . . . 8.4.3 Maintenance of Larvae . . . . . . . . . . . . . . . . . . . . . . . . . . . 8.4.4 Growth of Goldfish as Next Generation Parents . . . . . . . . . 8.5 Conventional Stereomicroscopic Observations . . . . . . . . . . . . . . . 8.5.1 Detaching Eggs from the Dish and Dechorinoization . . . . . 8.5.2 Light Microscopic Observation of Live Embryos, Larvae, and Juveniles . . . . . . . . . . . . . . . . . . . . . . . . . . . . 8.5.3 Observation of Skeletons . . . . . . . . . . . . . . . . . . . . . . . . . 8.6 Conventional Histological Observation . . . . . . . . . . . . . . . . . . . . 8.6.1 Fixation Process . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 8.6.2 Paraffin Embedding and Sectioning . . . . . . . . . . . . . . . . . . 8.6.3 Staining and Identification of Sectioned Level . . . . . . . . . . 8.7 Genotyping Analysis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 8.7.1 DNA Extraction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 8.7.2 PCR-Based Genotyping of the Twin-Tail Gene (chdSE127X) . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 8.8 Analysis of Gene Expression Patterns . . . . . . . . . . . . . . . . . . . . . 8.8.1 Complementary DNA (cDNA) Cloning and Sequence . . . . 8.8.2 Digoxigenin (DIG)-Labeled Antisense RNA Probe Synthetize . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 8.8.3 Harvesting and Fixation of Samples . . . . . . . . . . . . . . . . .

249 249 249 251 252 252 254 255 255 256 257 259 259 261 262 263 263 264 265 267 268 268 270 270 272 272 272 272 273 273 274 274 274 275 275

Contents

xv

8.8.4

Hybridization, Detection of Signals, and Image Acquisition . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 8.9 Functional Assays of Genes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 8.9.1 General Methods for Microinjection . . . . . . . . . . . . . . . . . 8.9.2 Morpholinos . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 8.9.3 Synthesized mRNA . . . . . . . . . . . . . . . . . . . . . . . . . . . . . References . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

275 276 276 278 278 279

Index . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 281

Abbreviations

aart af af0 afr afrad ao art asb bahy bar bc bli br bsr bt c.fb c.hb ce cf cff cfr chy cl cle crt dent df df0 dff dfr dfrad

Anguloarticular Anal fin Anal fin primordia Anal fin ray Anal fin radials Dorsal aorta Atrium Anterior swim bladder Basihyal Larval barbel Blastpore Blood island Branchial arch Branchiostegal rays Breeding tubercles Cavity of forebrain Cavity of hindbrain Cerebellum Caudal fin Caudal fin fold Caudal fin ray Ceratohyal Cloaca Cleithrum Ceratobranchial Dentary Dorsal fin Dorsal fin primordia Dorsal fin fold Dorsal fin ray Dorsal fin radials xvii

xviii

dien dm.ff dsfs ecptr epu fcf forked cf fro fr-s gcl gr ha hb hem hhyv hk hm hmsp hr hs hy hyc hyo ie inl int iop ipl ki kv len li ll lpm mes mhb mptr mx myo n.pi ne no ns nspu

Abbreviations

Diencephalon Dorsal median fin fold Dorsal segmented fin spine Ectopterygoid Epural Forked fin robes Forked caudal fin Frontal Segment of fin ray Ganglion cell layer Germ ring Hyoid arch Hindbrain Hemal arch Hyophyal ventral Head kidney Hyomandibula Horizontal myoseptum Heart Hemal spine Hypural Hypural complex Hyoid Inner ear Inner nuclear layer Intestine Interopercular Inner plexiform layer Kinethmoid Kupffer’s vesicle Lens Liver Lateral line Lateral plate mesoderm Mesencephalon Midbrain hindbrain boundary Metapterygoid Maxilla Myotome Nasal pit Neural tube Notochord Neural spine Neural spine of preural

Abbreviations

ob onl opl opr opt os otic pa.c pal par pcc pcle pe.sac pecf pecfb pecfr pfr phy plvf plvfb plvfr pm pnd pop post-aff pre-af pre-aff psb psb0 ptm pto pu px qd rad rart re ri rpe sb scl sfs sh sne

xix

Oblong Outer nuclear layer Outer plexiform layer Opercular Optic vesicle os suspensorium Otic vesicle Parachordal cartilage Palatine Parietal Pericardial cavity Post-cleithrum Pericardial sac Pectoral fin Pectoral fin bud Pectoral fin rays Pelvic fin ray Parhypural Pelvic fin Pelvic fin bud Pelvic fin ray Premaxilla Pronephric duct Preopercular Post-anal fin fold Pre-anal fin Pre-anal fin fold Posterior swim bladder Primordia of posterior swim bladder Post-temporal Pterotic Preural Pharynx Quadrate Radial Retroarticular Retinal primordia Rib Retinal pigment epithelium Swim bladder Scales cover entire body Segmented fin spine Shield Supraneuralis

xx

som sop tel tra trg tri uhy ve ventr vm.ff y y.b y.ext ysl

Abbreviations

Somite Subopercular Telencephalon Trabecula Trigeminal ganglia Tripus Urohyal Axial vein Ventricle Ventral median fin fold Yolk Yolk ball Yolk extension Yolk syncytial layer

Chapter 1

Introduction

Abstract The historical background of domesticated goldfish has been examined by several previous researchers, who aimed to investigate how various phenotypic variations became genetically fixed in populations. Here, I introduce the contributions of the researchers using goldfish for evolution and developmental biology. Taking the studies of early researchers and recent historical and zooarchaeological studies into consideration, I summarize the domestication history of goldfish to update our knowledge about this species. From the well-established fish cultivation technologies used in China during the Neolithic age, it appears that breeding of the ancestral goldfish species for extensive fish farming might not have been difficult for people in that time and place. It is also presumed that the establishment of highly morphologically diverged ornamental goldfish strain was only possible in the Ming dynasty, when sophisticated genetic crosses became possible. This historical evidence and its implications provide an opportunity to consider the rationality and motivation for using goldfish as a model system in evolutionary developmental biology studies.

Goldfish (Carassius auratus) is a well-known species of domesticated animal, which has several ornamental strains distinguished by genetically fixed phenotypic mutations. Because of their attractive phenotypes, ornamental goldfish have been spread all over the world by breeders and fanciers, but the original strains were established several centuries ago in China. This book, as the title indicates, explains how the morphological variations of ornamental goldfish have become a valuable tool in the study of evolutionary developmental biology (evodevo). Thus, the majority of content in later chapters concerns the anatomy, histology, developmental biology, molecular genetics, and evolutionary biology of the goldfish; detailed descriptions of these topics are provided in Chaps. 2–7. To understand the biological background of ornamental goldfish, it is informative to consider the domestication process. Thus, we will begin by briefly explaining the work of early and contemporary researchers, who detailed goldfish development, evolution, and domestication history (Darwin 1868; Bateson 1894; Watase 1887; Chen 1925, 1934, 1956; Matsui 1934; Hervey and Hems 1948; Smartt 2001; Roos 2019). On the basis of these descriptions, several important aspects of goldfish © The Author(s), under exclusive license to Springer Nature Singapore Pte Ltd. 2021 K. G. Ota, Goldfish Development and Evolution, https://doi.org/10.1007/978-981-16-0850-6_1

1

2

1 Introduction

domestication are revealed and a deepened understanding of its evolutionary history can be gained.

1.1

Goldfish Developmental Biology According to Early Researchers of Evolution

The peculiar morphologies of various goldfish strains have intrigued both early and recent biologists in the fields of evolution and developmental biology. In fact, morphological mutant goldfish strains gave two of the most influential nineteenthcentury biologists insights into how animal body shapes may change over time in nature (Darwin 1868; Bateson 1894). Darwin (1868) first used ornamental goldfish variations to argue for gradual change of phenotypic features in The Variation of Animals and Plants Under Domestication (Darwin 1868). In this work, he introduced almost all of the mutated goldfish morphologies (including twin-tail, dorsal fin less, globular body shape, and pop eye mutants). He also knew that these morphologically diverged goldfish are kept as ornaments or curiosities by breeders in China and provided his thoughts, as follows: “... we may feel nearly confident that selection has been largely practised in the formation of new breeds. . . .” Then, Bateson (1894) also used twin-tail goldfish as a representative example in his monograph Materials for the Study of Variation. However, Bateson used the variations to exemplify discontinuous variation in his protest against Darwin’s gradual evolution hypothesis. Despite their references to adult goldfish morphologies, the embryonic and larval development of goldfish seems to have been beyond the focus of these two biologists, who worked in the early days of evolutionary biology. In fact, to my knowledge, no references or descriptions of goldfish development are contained within Darwin’s book (1868). However, shortly after Darwin’s publication, a detailed characterization of goldfish embryonic development was reported by a scientist named Shozaburo Watase (渡瀬 庄三郎). Watase’s influential work was performed prior to Bateson’s 1894 publication (Fig. 1.1), when he was in the Sapporo Agricultural College and of the Imperial University. Subsequently, he moved to Johns Hopkins, Clark University, and the University of Chicago (he also lectured at Woods Hole during several summers), before returning to Japan as Chair of Zoology at the Imperial University of Tokyo (Geison 1987; see also http://woodsholemuseum.org/ JapaneseWH/pages/watase.html). The descriptions of goldfish variations in caudal and anal fins first described by Watase (1887) were featured prominently as evidence in arguments made by Bateson (1894) (Fig. 1.1); thus, it is quite likely that Bateson was also aware of the developmental studies by Watase (1887). However, these studies on embryonic and larval development were not highlighted by Bateson, suggesting that it might not have been clear to him how to incorporate detailed descriptions of time-dependent morphological changes of goldfish embryos into his arguments about fundamental aspects of evolution.

1.1 Goldfish Developmental Biology According to Early Researchers of Evolution

3

Fig. 1.1 Illustrations of goldfish anatomy and embryology. (a–c) Drawing of a goldfish in Watase (1887). (a) Adult morphology of twin-tail goldfish. (b) Skeletal anatomy of goldfish. (c) Developmental process of goldfish. (d) Skeletal anatomy provided by Bateson (1894) based on Watase (1887). The red numbers in (b, d) indicate corresponding panels in the figures by Watase (b) and Bateson (d)

4

1 Introduction

Although Darwin, Watase, and Bateson had major differences in their research topics and conclusions, all of these scientists knew the value of observing goldfish phenotypes that had been selected and genetically fixed by breeders to gain useful insights into natural processes. Despite their utility to early evolutionary biologists, the details of how ornamental goldfish strains were selected and established were unknown to scientists until Chinese archives were examined by researchers familiar with Chinese history and literature (please see below).

1.2

Early Research on Goldfish Domestication

To date, there have been several reports in different languages about the domestication of goldfish by authors in many different counties (Chen 1925, 1954; Matsui 1935; Hervey and Hems 1948; Matsui 1934; Smartt 2001; Balon 2004; Teichfischer 1994; Roos 2019). Among these articles, Roos (2019) provides the most updated and detailed information about the cultural issues and historical episodes related to ornamental goldfish; her book also contains fascinating and informative reproductions of pictures, ceramic paintings and craftworks related to goldfish. Moreover, Goldfish Varieties and Genetics by Joseph Smartt covers a wide range of literature on goldfish and provides biologically suggestive descriptions. Although Smartt focuses on the genetics of goldfish morphological variations (he also mentions in his book that he does not have the ability to read and decipher Chinese archives himself), he performed a quite careful and informative survey, examination, and summarization of representative articles about the process of goldfish domestication. For biologists wishing to grasp the history of the goldfish domestication, his book might be one of the most useful. Among several key articles examined by Smartt (2001), those written by Shisan C. Chen (陳禎) and G. F. Hervey were frequently cited in his book. In fact, Smartt’s descriptions of the early period of goldfish domestication are highly dependent on descriptions provided first by Chen (1956) and Hervey and Hems (1948), which contain overlapping and unique details about goldfish domestication. The former publication is a careful examination of the history of goldfish in China, while the descriptions in latter contain historical developments not only in China and Japan, but also in Europe and America. Notably, it seems that Smartt might have been familiar with the background of Hervey, as the Smartt book includes notes about Hervey, such as “Hervey was very fortunate in securing the advice of Dr. A. C. Moule, the eminent Cambridge sinologist, whose contribution he gracefully acknowledges”. On the other hand, there are no equivalent descriptions of Chen (1954) in the Smartt publication (2001), presumably due to a paucity of available information about Shisan C. Chen’s background when Smartt published his book. Thus, in order to advance our understanding of how goldfish domestication was investigated by Chen, several compensatory descriptions of Shisan C. Chen are provided here. A biography of S. C. Chen was published by Fu (2016), and

1.2 Early Research on Goldfish Domestication

5

according to this source, Chen graduated from China College in 1914 and was later admitted to the University of Nanking (南京), Jiangsu Province (江蘇省), where he majored in agriculture and forestry. He passed an examination for overseas postgraduate studies at Tsinghua (清華) University in 1919 and started his postgraduate education at Cornell University. He then received a master’s degree from the Department of Zoology at Columbia University in 1921. It is also known that he learned genetics in Thomas Hunt Morgan’s laboratory before returning to China in 1922. After he came back to China, he worked as a professor at Southeastern University (國立東南大學) in Nanjing; for more detailed information about Chen’s career, see Fu (2016). Based on this historical record, Chen’s goldfish research was conducted in Nanjing. Chen’s work published in 1925 mainly focuses on the external phenotypes of goldfish, but it also contains an examination of historical documentation (Fig. 1.2) (Chen 1925). Moreover, he published an intensive study on the history of goldfish domestication first in Chinese (1954) and then in English shortly thereafter (1956). These works reference arguments made by early biologists, including Darwin and Mendel, and he cites more than 50 original Chinese literature sources published from 1036 CE to the modern age. Interestingly, Chen (1956) and Hervey and Hems (1948) provide highly similar descriptions in their articles; for example, both publications reference the same Chinese poems written by Song (宋) dynasty poets [including Sū Shùnqīn 蘇舜欽 (courtesy name, Sū Ziměi蘇子美; 1008–1048) and Sū Shì蘇軾 (courtesy name, Sū Dōngpō 蘇東坡; 1037–1101)]. The overlapping descriptions might suggest that the major available Chinese archives were comprehensively surveyed by these two authors (one had a collaborator who was a British Anglican sinologist; the other is a native Chinese language speaker), independently. In fact, Smartt (2001) and other subsequent researchers tend to cite Chen’s articles heavily (for example, Balon 2004; Roos 2019), suggesting that his survey of Chinese literature archives related to goldfish domestication history in China might have been exhaustive (1925, 1954, 1956). At this point, it is worth introducing the work of Yoshiichi Matsui (松井佳一), which was also featured in Smartt’s book (Matsui 1933a, b, c, 1934, 1935, Matsui et al. 1972). Yoshiichi Matsui was a technical expert at the Fisheries Experimental Station, under the Ministry of Agriculture and Forestry in Japan. He obtained a doctorate in Agriculture from Tokyo Imperial University on August 7, 1934, based on the results of his study on the genetics of Japanese goldfish. In this article, he provided a diagram of the genealogical relationship of goldfish strains (Matsui 1934). This diagram, the so-called Matsui’s diagram (Fig. 1.3), is quite wellknown and frequently cited in popular goldfish fancier books, although this type of diagram for goldfish genealogy was not firstly invented by him (according to Roos 2019, a diagram showing the relationship between different strains had been previously published as “Japanese Goldfish: Their Varieties and Cultivation” by Smith in 1909). After his highly impactful thesis study, Matsui also published a review book consisting of over 400 pages in Japanese (Matsui 1935). In this review, he provides several descriptions of how goldfish are incorporated in art and culture, based on his own collection of Japanese traditional paintings and textual archives. Since Matsui

6

1 Introduction

Fig. 1.2 PLATE IX from Chen (1925). This picture is derived from PLATE IX from Chen (1925), originally from the “Imperial Encyclopedia” or “欽定古今圖書集成” published in 1726

(1935) and Chen (1954) both provided the titles of Chinese language references in Chinese characters (漢字: Hanzi or Kanji), their citations allow us to directly survey the original archives, which have been made accessible on publicly available databases, such as Scripta Sinica (漢籍全文資料庫計畫: http://hanchi.ihp.sinica.

1.3 Pre-domestication to Domestication

7

Fig. 1.3 Illustration of Matsui’s genealogical diagram. The name of each strain comes from Matsui (1933a, b, c). Solid and dotted lines indicate spontaneous mutations and hybridization of different strains, respectively. (The image is modified from Ota and Abe 2016)

edu.tw/ihp/hanji.htm), the Chinese Text Project (中國哲學書電子化計劃: https:// ctext.org/guodian/zh), and the Kanseki Repository (漢リポ: http://www.kanripo. org/).

1.3

Pre-domestication to Domestication

The early researchers mentioned above generally described the origin of goldfish breeding in terms of its association with paddy rice cultivation, which requires water storage and thus provides an appropriate habitat for the fish (Chen 1925; Hervey and Hems 1948; Smartt 2001). However, there is still uncertainty about the origins of goldfish aquaculture. In fact, it is still unknown whether and how goldfish were maintained in ponds during ancient times. A recent zooarchaeological study has provided further clues about the origin of goldfish domestication in ancient China. Nakajima et al. (2019) examined the fossil record in the Early Neolithic Jiahu (賈湖) site in Henan province (河南省), China, which is known for its early cultural and agricultural activity (including rice cultivation, fermentation of beverages, creation of bone flutes, and perhaps early writing), estimated to date back 8000 years. This study showed that a highly biased ratio of common carp to Carassius species exists at the Jiahu site. Although Carassius species are easy to catch compared to common carp and thus tended to be consumed as food, the Neolithic Jiahu people culturally preferred the common carp and established functional aquaculture systems for

8

1 Introduction

common carp during the final cultural period represented at the Jiahu site (6200–5700 BCE, called Period III in Nakajima et al. 2019). While the study by Nakajima et al. (2019) focuses on common carp aquaculture, the publication also provides significant evidence that the carp and Carassius species were clearly distinguished by Neolithic Jiahu people. This article also examined how cultural preferences of the Neolithic people were related to differences in seasonal behavior between the common carp and Carassius species. In contrast to the Carassius species, which tends to stay close to river banks or lakeshores in all seasons, the adult common carp leaves the lakeshore immediately after spawning season. Thus, the Neolithic Jiahu people established aquaculture techniques to obtain the common carp (a “hard to catch fish”) even in non-spawning season. Viewing the evidence from another perspective, the Carassius species may have also been cultivated as a food resource; however, the Jiahu people preferred to eat common carp. Moreover, this zooarchaeological study describes how Neolithic aquaculture of the Jiahu people can be classified according to early historical records of aquaculture systems. The authors state that the development of common carp aquaculture can be categorized into three stages: Stage 1 is defined by fishing in the marshy area in which carp gather during the spawning season; Stage 2 then involves management of the marshy area by digging channels and controlling water levels and circulation; Finally, Stage 3 requires constant anthropogenic inputs, such as control of reproduction with spawning beds and fishponds or paddy fields, as well as feeding. Given that Neolithic Jiahu aquaculture was Stage 2, one may assume that genetic crosses would not have been difficult at that time. On the other hand, Stage 3 aquaculture was described in historical records like the Yǎngyú jīng (養魚経), which is known as one of the oldest books on aquaculture and was written by Fàn Lǐ (范蠡: 536–448 BCE) also known as Táo Zhū Gōng (陶朱公). The description of this archive is later cited in the written book, Qí mín yào shù (齊民要術) (533–544 CE), as Táo zhū gōng Yǎngyú jīng (陶朱公養魚經). Given that the Yǎngyú jīng states that 20 matured females and 4 males should be put in the same pond, it is presumed that the people in these area could have inadvertently performed genetic crosses with specific male and female individuals. Even though the natural fertilization process for common carp is utilized, the genetic backgrounds could be homogenized by repeatedly selecting breeding males and females with preferred characteristics. This ancient origin of common carp cultivation also provides evidence that the goldfish has been present in socio-ecological systems in paddy-dominated landscapes, which tend to be found in the monsoon-affected areas of Asia (see Saito and Ichikawa 2014 for further information about the socio-ecological systems in paddydominated landscapes). Even though the common carp was the major aquaculture product of Neolithic people, it is reasonable to assume that a certain population of Carassius was also incorporated into man-made structures for common carp aquaculture (including channel systems, spawning bed, and ponds). In fact, fossil records of Carassius species have been found in the above-mentioned common carp cultivation sites, suggesting that several populations of Carassius might have been intendedly or unintendedly kept under artificial conditions. Although there are still

1.4 Domestication for Ornamental Purposes

9

several remaining points of uncertainty, goldfish domestication appears to have coexisted and coevolved with the paddy fields and associated irrigation systems in pre-historic ages. From the descriptions stating that Carassius skeletons were contained in ritual vessels (for example, ding (鼎)) found in tombs from the Warring States periods (戦国時代: fifth century BCE) at Liulige (琉璃閣) site in Huixian (輝 县), Henan (河南) province (Wǔ and Ráo 1966), one may suppose that the Carassius species was already culturally significant in this area and time. These new findings are helpful when reconsidering the arguments of early researchers about spontaneous color-mutant fish. A description of the “red-scale fish” is found in archives from the 晉 (Jìn) dynasty period (265–420 CE), and whether this red-scale fish is a precursor to the goldfish was the subject of disagreement among early researchers (Chen 1956; Hervey and Hems 1948; Smartt 2001), who sought to identify the earliest descriptions of color-mutant goldfish. I do not give this controversy any in-depth treatment, since there is no sufficient information to make a firm conclusion. However, the few mentions of the red-scale fish may indicate that such color variations are not common and might not have been intensively maintained by breeders in this era. In fact, it is assumed that such a red-scaled fish (whether it be a common carp or Carassius species) could have been intensively maintained using the early techniques described in Yangyu Jing. However, the scant number of descriptions for this color-mutant fish species leads us to presume that such a red-color fish might not have been of interest to breeders at that time. Thus, the breeders in this era lacked motivation to isolate and maintain the red-color mutant common carp (and/or goldfish), even though the pursuit was technically possible. The cultural motivation to intensively maintain such color mutations increased beginning from the Tang (唐) dynasty period (618–907 CE). This period was a highly significant time in the history of goldfish domestication. Due to the influence the Buddhism, living creatures were released into ponds (so-called ponds of mercy: 放生池, Fàngshēng chí) (Smartt 2001; Chen 1954), as a symbolic gesture. The color-mutant Carassius species might have also been recognized as a special creature with mysterious significance. Nevertheless, it is certain that by the end of the Tang dynasty, goldfish were maintained under semi-domesticated conditions, and this time marks the beginning of documented selection for color variations (Smartt 2001).

1.4

Domestication for Ornamental Purposes

The Song dynasty (960–1279 CE) is recognized as a turning point for goldfish domestication, with reliable archives describing how goldfish were intensively reared and maintained for ornamental purposes (Smartt 2001; Chen 1925). Chen (1954) suggested that the Southern Song Dynasty (1127–1279) might have been culturally different from the preceding age, as the people in this era began to artificially breed goldfish and placed a high value on curious variations. These

10

1 Introduction

people unconsciously practiced the methods of artificial selection based on the differences in the aquatic community maintained between the early pond of mercy times and the private ponds of the Southern Song Dynasty (Chen 1954). In the ponds of mercy, which were made for religious purposes, believers of Buddhism would release many different types of aquatic organisms, demonstrating mercy to all living things without careful attention to whether the aquarium communities and pond ecosystems could be maintained. On the other hand, private ponds maintained by breeders in the later period were devoid of potential goldfish predators (including predatory fish and turtles). Moreover, the influence of the imperial favor toward goldfish is also explored in previous works (Smartt 2001; Roos 2019). Smartt indicated that the Emperor Gaozong of the Song dynasty (宋高宗; Sòng Gāo Zōng) or Emperor Chao Gou [趙構: Zhào Gòu; called “Chao Kou” in Smartt (2001)] was apparently a goldfish enthusiast and ordered a collection of gold and silver fish to stock his pond (Smartt 2001; see also Roos 2019); the pond in question was the goldfish pond of Te Shou palace (徳壽宮: Dé shòu gong) in the city of Hangzhou (杭州), according to the descriptions from Chen (1954) and Roos (2019), and the archive of Wulin jiushi (武 林舊事: Wǔlín jiùshì) by Zhou Mi (周密: Zhōu Mì; 1232–1298 CE). From these documents, it is certain that pond-keepers maintained a single-species goldfish for ornamental purposes (Chen 1954). Moreover, Zhou Mi described several methods for carrying fish larvae with bamboo containers in Guixin zashi (癸辛雜識: Miscellaneous Records at Guizin) (see Zhang 2012; so-called Miscellaneous Records in this era). He also prepared a section of his book that included descriptions of fish larvae. In this part, it is explained how the death rate of the fish larvae may be reduced by exchanging the water in the container and keeping the container clear of predatory fish, suggesting that fish farmers had skills to increase the survival rate of cultivated fish, using available tools of the time. After the Song dynasty collapsed in 1279 CE and was succeeded by the Mongolian Yuan (元) dynasty, new documents pertaining to goldfish were not as frequently published. However, the new dynasty did publish an official agriculture book (農桑 輯要Nóng sāng jí yào) in 1273 CE, indicating that agricultural activities were officially supported in this era (see also Miya 2006, 2008 for information about the contribution of Mongolian Yuan to agricultural activities). Moreover, this book also references the above-mentioned Táo zhū gōng Yǎngyú jīng aquaculture book, suggesting that the basic aquaculture techniques were inherited from the previous dynasty. However, the lack of material makes it difficult to infer how the goldfish were maintained during this period, except for the move of breeding to Beijing (Chen 1925; Roos 2019). The second set of significant events occurred during the Ming (明) dynasty (1368–1598), especially the late Ming dynasty. Chen (1954) reported that goldfish were maintained in basins or aquariums after 1547. He also mentioned that the change from outside ponds to aquarium culture systems caused significant differences in goldfish domestication. In fact, given that the aquarium cultures have more restricted water volumes and require more diligent human inputs than outside ponds, the selective pressures on goldfish were changed as a result of the rearing

1.5 Selection of Peculiar Morphologies

11

environment. More significantly, quite sophisticated breeding methods are described in a book entitled Treatises on Natural Beauties (二如亭群芳譜: Èr rú tíng qúnfāng pǔ) written by Wang Hsiang-ching (王象晉, Wáng Xiàng Jìn: 1561–1653) in 1630. The sentences provided by Chen (1954) in Chinese and translated by Chen (1956) into English are as follows; 雨後, 将種魚連草撈入新清水缸内。視雄魚 縁缸趕咬雌魚, 卽其候也. 咬罷, 将魚撈入 舊缸。取草映日, 看其上有子如粟米大, 色如水晶者卽是。将草撈於残 瓦盆内, ⋯。 After raining put the breeding fish with the water-grass into a new vessel of clear water. When you see the male fish chasing after and biting the female along the wall of the vessel, you know that it is time. When the biting is over, put the fish back into the old vessel. Examine the water-grass in the light of the sun; if you find little crystalline granules about the size of millet, they are the eggs. Then put the water-grass in a shallow earthen pot. . .

These descriptions allow us to infer that the breeders in the late Ming dynasty could perform one-to-one genetic crosses in the aquarium systems. In the context of population genetics, the one-to-one genetic cross is significantly different from the cross between multiple males and females described in Yangyu Jing. Moreover, the relatively small body size of the goldfish in comparison with common carp might have been a crucial factor allowing these mating conditions. Based on the available documents, one may presume that goldfish experienced artificial selection for ornamental purposes from the Song dynasty to present time. Moreover, from the late Ming dynasty, the domesticated ornamental goldfish experienced strong artificial selective pressures for morphological features. Although the possibility still exists that novel evidence could indicate the origin of ornamental goldfish domestication is much earlier than currently thought, it is unlikely that the domestication history of the goldfish began before the Neolithic period. Thus, we can estimate that diverse morphological changes in goldfish were introduced by humans over quite short periods (ranging from one thousand to several thousand years at maximum). These periods stand in stark contrast to time periods presumed to be required for large-scale morphological changes to occur in nature (Janvier 1996; Liem et al., 2001; Kardong 2012). In addition, it is known that internal axial skeletal structures are substantially modified in twin-tail and dorsal fin less strains (Ota and Abe 2016; Abe and Ota 2016). Given that the evolution of such internal skeletal structures required long time periods in nature (Janvier 1996; Liem et al., 2001; Kardong 2012), the drastic evolutionary changes can be expected to have occurred in morphogenic developmental mechanisms; this topic will be elaborated in Chaps. 2–4.

1.5

Selection of Peculiar Morphologies

As previously stated, goldfish have undergone two different types of domestication processes: the conventional domestication process as a resource for human life, and then domestication ornamental purposes. During these two different processes, goldfish might have been subjected to the same types of selective pressures. For

12

1 Introduction

example, phenotypes related to physical viability (e.g., resistance to low oxygen conditions, disease, and temperature changes) were selected in both processes. However, the major difference in selection pressures is with regard to morphological features. Moreover, the available methods for goldfish breeding were different in different eras. Thus, the motivations of the breeders and available methods are likely to have heavily influenced the selection of goldfish during domestication. For domestication of an animal as a resource, it is presumed that the size and weight of edible tissues and organs might be selected by breeders. However, it is unlikely that the color variety (red or orange color) would be selected, since the genetic determinants of these phenotypes are not related to the breeders’ motive to maintain the animal as food. Even though color varieties are preferred by humans, these color variant goldfish were under purifying selection in an era during which goldfish were mainly cultivated in outside ponds. Although predatory aquatic animals could be removed from goldfish ponds, the breeders of the Song dynasty might not have been able to completely eliminate predation by birds (for example, herons). Since red or orange goldfish tend to be attacked by herons (Katz et al. 2015; Roos 2019), preferred color variations might have been exceedingly difficult to fix due to loss of survivability in nature. Because of the rearing environment, morphological features that significantly reduce the fitness of goldfish in nature could not be genetically fixed in domesticated goldfish populations at that time. In fact, the red-color variant and dark-color goldfish, which are drawn in the hand scroll, “Fish Swimming Amid Falling Flowers” (落花遊魚圖) by Liú Cǎi (劉寀: 1080–1120) from the Song dynasty, are quite similar in body shape; both the dark-color and reddish color goldfish have slender bodies (see the reproduction of this scroll in Roos 2019 or view it at other publicly available sources). However, the situation drastically changed beginning from the late Ming dynasty, as mentioned by Chen (1954). Once breeders succeeded in mating and maintaining goldfish in isolated containers (e.g., porcelain vessels), rather than the outside ponds, they could apply totally different selective pressures to the populations. Although careful conditioning is required to maintain goldfish in the isolated aquarium systems, aquarium-based breeding and maintenance provided the significant advantage of being able to isolate and fix phenotypic mutants for ornamental purposes. The breeders could move vessels to safer locations, away from predators; perhaps the vessels could be placed in indoor spaces to avoid the attack of birds. Moreover, breeders might have been able to identify and isolate preferred phenotypes at early developmental stages. In fact, given that several morphological features can be recognized before juvenile stages (Smartt and Bundell 1996; Li et al. 2019), these features could be used as criteria for culling at early developmental stages. Thus, the aquarium systems allow for secure placement of the goldfish and application of early-stage screening techniques, which would both plausibly increase the efficiency of genetically fixing human-preferred phenotypes. Although a certain number of goldfish populations were still maintained in outside ponds after the late Ming dynasty, breeders utilized additional and more sophisticated methods of goldfish breeding for ornamental purposes. The appearance of these methods seems to be consistent with the appearance of the morphological

1.5 Selection of Peculiar Morphologies

13

mutations of the goldfish. In fact, it is estimated that most of the peculiar morphological mutant strains were generated during the Ming and Qing (清: 1644–1912) dynasties (Smartt 2001; Chen 1954). For example, the twin-tail goldfish was first described in the late 1500s, and illustrations containing dorsal-finless goldfish date to around the 1700s (Smartt 2001). Taking into account that these ornamental goldfish strains with fin mutations have reduced swimming abilities (including swimming speed and maneuverability; Blake et al. 2009), aquarium-based goldfish breeding must have been utilized in their generation. In fact, it is empirically understood that these goldfish strains cannot survive in environments with strong competition from wild-type goldfish. Moreover, random mating is not preferred by goldfish breeders when maintaining individuals with the same mutated morphology. For the genetic fixation of the peculiar morphological mutant strains, selective mating should be conducted by breeders. Taken together, records indicate that from the late Ming dynasty, humans succeeded in establishing methods to isolate preferred mutated phenotypes of goldfish, even though the mutated phenotypes significantly reduce the fitness of goldfish in nature. The process of the goldfish domestication can be generalized into two major steps. First, the animal species was maintained due to its utility for human life. Subsequently, its phenotypic variations were genetically fixed as ornamental strains. A similar two-step processes can be seen in some other ornamental vertebrate species. In fact, color variations of common carp were also genetically fixed in ornamental populations, following the pre-historic and historical aquaculture as a food source (Nakajima et al. 2019; Balon 2004). Pigeons were also originally used for food, after which feather color and shape variety were became the subject of artificial selection by fanciers (Shapiro and Domyan 2013). Although the domestication process of dogs is slightly different from these examples (most were utilized as watchdogs, hounds, sled dogs, and so on, in the early periods of domestication), some dogs have been kept for ornamental purposes (vonHoldt et al. 2010). This high prevalence of ornamental species leads us to a question; why should we choose to investigate goldfish in our studies? As I mentioned at the beginning of this chapter, the major purpose of this book is to explain why the ornamental goldfish have been so significant in evodevo studies. Each animal species has advantages and disadvantages as a research material. In this text, I examine the exclusive biological and historical features of goldfish that have contributed to its use as a laboratory model. We reveal the advantageous characteristics of this teleost species, which have allowed scientists to expand our understanding of the relationship between evolution and development. In Chap. 2, I explain how goldfish have been investigated by researchers in several different biological fields, revealing specific issues that have been made clear from goldfish evodevo studies. Subsequently, in Chap. 3, morphological variations of ornamental goldfish are described, and in Chaps. 4 and 5, the details of embryonic and postembryonic goldfish development are provided as a reference for developmental biology. Furthermore, I also provide future research perspectives of goldfish evodevo in Chaps. 6 and 7, and some experimental techniques are detailed in the Experimental Notes (Chap. 8). Chapters 4 and 5, along with the Experimental Notes,

14

1 Introduction

are intended to be useful references not only for researchers but also for enthusiastic breeders and fanciers. On the other hand, my core research questions relating to goldfish evodevo are detailed in Chaps. 6 and 7. I hope that all readers will be interested in how humans have succeeded (and will continue to succeed) in making changes to sophisticated developmental mechanisms through domestication of goldfish.

References Abe G, Ota KG (2016) Evolutionary developmental transition from median to paired morphology of vertebrate fins: perspectives from twin-tail goldfish. Dev Biol 427(2):251–257. https://doi. org/10.1016/j.ydbio.2016.11.022 Balon EK (2004) About the oldest domesticates among fishes. J Fish Biol 65(s1):1–27. https://doi. org/10.1111/j.0022-1112.2004.00563.x Bateson W (1894) Materials for the study of variation treated with especial regard to discontinuity in the origin of species. Macmillan, New York Blake RW, Li J, Chan KH (2009) Swimming in four goldfish Carassius auratus morphotypes: understanding functional design and performance employing artificially selected forms. J Fish Biol 75(3):591–617. https://doi.org/10.1111/j.1095-8649.2009.02309.x Chen SC (1925) Variation in external characters of goldfish, Carassius auratus, vol 1. In: Contributions from the biological laboratory of the Science Society of China. Science Society of China, Shanghai Chen SC (1934) The inheritance of blue and brown colours in the goldfish, Carassius auratus. J Genet 29(1):61–74 Chen SC (1954) A historty of the domestication and the factors of the varietal formation of the common goldfish, Carassius auratus (金魚家化史舆品種類形成的因素). Act Zool Sin 6 (2):89–116. (in Chinese) Chen SC (1956) A history of the domestication and the factors of the varietal formation of the common goldfish, Carassius auratus. Sci Sin 5:287–321 Darwin C (1868) The variation of animals and plants under domestication by Charles Darwin: 1, vol 2. J. Murray, London Fu L (2016) Shisan C. Chen and his research on goldfish genetics. Protein Cell 7(2):79–80. https:// doi.org/10.1007/s13238-015-0236-3 Geison GL (1987) Physiology in the American context, 1850-1940. American Physiological Society; Baltimore Distributed by Williams & Wilkins, Bethesda, MD Hervey GF, Hems J (1948) The goldfish. Batchworth Press, London Janvier P (1996) Early vertebrates, vol QE851 J36. Oxford University Press, Oxford Kardong KV (2012) Vertebrates: comparative anatomy, function, evolution, 6th edn. McGraw-Hill Higher Education, Boston Katz MW, Abramsky Z, Kotler BP, Rosenzweig ML, Alteshtein O (2015) All that glitters is not gold: different anti-predatory behavior of two color morphs of goldfish (Carassius auratus). Environ Biol Fishes 98(1):377–383. https://doi.org/10.1007/s10641-014-0268-1 Li I-J, Lee S-H, Abe G, Ota KG (2019) Embryonic and post-embryonic development of the ornamental twin-tail goldfish. Dev Dyn 248(4):251-283:doi:https://doi.org/10.1002/dvdy.15 Liem KF, Bemis WE, Walker WF, Grande L (2001) Functional anatomy of the vertebrates: an evolutionary perspective. Harcourt College, New York Matsui Y (1933a) Preliminary note on the inheritance of caudal and anal fins in gold-fish of Japan. Proc Imp Acad 9(10):655–658

References

15

Matsui Y (1933b) Preliminary note on the inheritance of scale transparecy in gold-fish of Japan. Proc Imp Acad 9(8):424–427 Matsui Y (1933c) Preliminary note on the Mendelian inheritance of the telescope eyes in the goldfish of Japan. Proc Imp Acad 9(9):544–547 Matsui Y (1934) Genetical studies on gold-fish of Japan. J Imp Fish Inst 30:1–98 Matsui Y (1935) Kagaku to shumikara mita Kingyo no kenkyuu (科学と趣味から見た金魚の研 究). Seizando-Shoten Publishing Co., Ltd, vol 90(12). https://ci.nii.ac.jp/ncid/BA79565196 [in Japanese] Matsui Y, Kumagai T, Betts LC (1972) Pet library goldfish guide. Pet Library Limited, London Miya N (2006) The various policies to promote agriculture in the Dai on yeke Mongyol Ulus: as seen from the publication of the Nongsangjiyao (Pt.1) (『農桑輯要』からみた大元ウルスの 勧農政策(上)) [in Japanese]. Zinbun Gakuhō J Hum 93:57–84. https://doi.org/10.14989/48679 Miya N (2008) The various policies to promote agriculture in the Dai on yeke Monγol Ulus: an seen from the publication of the Nongsangjiyao (pt. 3) (『農桑輯要』からみた大元ウルスの勧農 政策(下)) [in Japanese]. Zinbun Gakuhō J Hum 96:101–125. https://doi.org/10.14989/71075 Nakajima T, Hudson MJ, Uchiyama J, Makibayashi K, Zhang J (2019) Common carp aquaculture in Neolithic China dates back 8000 years. Nat Ecol Evol 3(10):1415–1418. https://doi.org/10. 1038/s41559-019-0974-3 Ota KG, Abe G (2016) Goldfish morphology as a model for evolutionary developmental biology. Wiley Interdiscip Rev Dev Biol 5(3):272–295. https://doi.org/10.1002/wdev.224 Roos AM (2019) Goldfish. Reaktion Books, London Saito O, Ichikawa K (2014) Socio-ecological systems in paddy-dominated landscapes in Asian Monsoon. In: Usio N, Miyashita T (eds) Social-ecological restoration in paddy-dominated landscapes. Springer Japan, Tokyo, pp 17–37. https://doi.org/10.1007/978-4-431-55330-4_2 Shapiro MD, Domyan ET (2013) Domestic pigeons. Curr Biol 23(8):R302–R303. https://doi.org/ 10.1016/j.cub.2013.01.063 Smartt J (2001) Goldfish varieties and genetics: handbook for breeders. Blackwell Science, Malden Smartt J, Bundell JH (1996) Goldfish breeding and genetics. TFH Publications Inc, Neptune, NJ Teichfischer B (1994) Goldfische in aller Welt: Haltung, Zuchtformen und Geschichte der ältesten Aquarienfische der Welt. Tetra, Melle Vonholdt BM, Pollinger JP, Lohmueller KE, Han E, Parker HG, Quignon P, Degenhardt JD, Boyko AR, Da E, Auton A, Reynolds A, Bryc K, Brisbin A, Knowles JC, Mosher DS, Spady TC, Elkahloun A, Geffen E, Pilot M, Jedrzejewski W, Greco C, Randi E, Bannasch D, Wilton A, Shearman J, Musiani M, Cargill M, Jones PG, Qian Z, Huang W, Ding Z-L, Zhang Y-P, Bustamante CD, Ostrander EA, Novembre J, Wayne RK (2010) Genome-wide SNP and haplotype analyses reveal a rich history underlying dog domestication. Nature 464 (7290):898–902. https://doi.org/10.1038/nature08837 Watase S (1887) On the caudal and anal fins of gold-fishes. J Coll Sci Imp Univ Tokyo 1:247–267 Wǔ X, Ráo Q (1966) Wǒguó de dànshuǐ yú de lìshǐ (我国的淡水鱼的历史). In: Zhōngguó dànshuǐ yú lèi yǎngzhí xué (ed) Kēxué chūbǎn shè, Beijing, pp 10–55 [originally Chinese; translated in Japanese] Zhang CE (2012) To be “Erudite in Miscellaneous Knowledge”: a study of song (960-1279) “Biji” writing. Asia Major 25(2):43–77

Chapter 2

Goldfish as an Experimental Model

Abstract Goldfish have been used as experimental animals in various biological fields due to ease of handling and breeding, which derives from physiological and developmental characteristics. This chapter introduces goldfish characteristic features, focusing on genomic background, in addition to physiological and embryological characteristics. It is known that the phylogenetic relationship between goldfish and related species is ambiguous since interspecies hybrids can easily occur. Moreover, allotetraploidization (genome duplication with species hybridization) occurred in the common ancestor of goldfish and common carp, according to whole-genome sequencing analyses. This genome duplication event seems to be significant for allowing goldfish to become animals with “easy handling and breeding,” which contributes to their use as ornamental and research animals. On the other hand, the rise of zebrafish molecular developmental genetics might have caused goldfish developmental biology to fade, partially due to the complicated genomic background of goldfish. Although several physiologists and neuroscientists still prefer to use goldfish as their experimental animals, fewer developmental biologists currently choose goldfish over zebrafish as a research model. Taking into account the above goldfish characteristics and current status of research, significant points related to the use of goldfish as a model system for evolutionary developmental biology are summarized, as follows. First, unlike the random mutagenesis-derived zebrafish, domestication-derived goldfish were subject to artificial selection. Second, in comparison with some other domesticated vertebrate species, the observation of embryonic goldfish is quite easy. These two exclusive characteristics of goldfish allow us to investigate how artificial selection and the developmental process are related. This chapter introduces several significant aspects of goldfish biology. The first three sections (Sects. 2.1, 2.2, and 2.3) describe the phylogeny, biogeography, and genomic backgrounds of goldfish, raising problems and issues that have been uncovered by recent studies. The fourth section includes a brief summary of goldfish physiological characteristics and aims to explain why the goldfish has been so often utilized by researchers, especially those in the fields of physiology and neuroscience. Finally, in the last part of the chapter, the goldfish is compared to other model © The Author(s), under exclusive license to Springer Nature Singapore Pte Ltd. 2021 K. G. Ota, Goldfish Development and Evolution, https://doi.org/10.1007/978-981-16-0850-6_2

17

18

2 Goldfish as an Experimental Model

organisms, emphasizing several unique, advantageous, and disadvantageous points of using goldfish in evodevo studies.

2.1

Phylogenic Position Among Vertebrates

Goldfish belong to the jawed vertebrates (gnathostomes), which consist of lobefinned fish (sarcopterygians) and ray-finned fish (actinopterigians). Most domesticated animals (e.g., cow, horse, pig, dog, cat, chicken, and pigeon) belong to the former group, while the goldfish is categorized in the latter (Kardong 2012; Liem et al. 2001; Janvier 1996) (Fig. 2.1). It is also known that the ray-finned fish further diverged into several different lineages comprising many species. In particular, the number of species in the teleost lineage has dramatically increased, as teleosts have adapted and spread into almost every region of surface and underground waters on Earth. The highly diverged teleost species are categorized into several taxa by taxonomists, and goldfish belong to one such taxon, i.e., the group of Otophysi (Nelson et al. 2016; Greenwood 1966; Saitoh et al. 2003). The phylogenetic relationship between the Otophysi group and its close relations is a matter of debate (Saitoh et al. 2003). According to early researchers (for example, Greenwood 1966; Johnson and Patterson 1996; see Saitoh et al. 2003 also), the groups of Otophysi and Anotophysi are clustered into the superorder of Ostariophysi. This superorder consists of around 8000 species, of which more than half are found in fresh water (Nelson et al. 2016). The monophyletic relationship of Ostariophysi is supported by the presence of the Weberian apparatus in all member species. This structure is formed by four bones derived from parts of the ribs and vertebrae, and it functions as an auditory organ, transmitting sounds from the swim bladder to the inner ear (Liem et al. 2001; Kardong 2012) (see Chap. 3). Moreover, the phylogenetic relationship between species in the Otophysi group is quite complex, according to a high-resolution phylogenetic analysis (Saitoh et al. 2003). Although the phylogenetic relationship between groups is complicated, there is a firm consensus that the goldfish is a part of the family Cypriniformes, which belongs to the group of Otophysi (Saitoh et al. 2003). This family contains three notable species that have been widely researched in several fields of experimental biology, including the goldfish, common carp, and zebrafish (Danio rerio). Goldfish and common carp are clustered into the same group, while the zebrafish is more distantly related (Saitoh et al. 2006) (Fig. 2.1). The goldfish and common carp also share quite similar historical backgrounds as domesticated teleost species (Fig. 2.2). Both have been cultivated by humans since ancient times, suggesting that they both exhibit breeder-selected biological characteristics that might also be preferred by researchers (see Chap. 1); presumably, the ease of maintenance and handling for these two fish species is desirable to breeders and researchers alike. Similarly, the zebrafish is used frequently as a model organism for experimental biology, largely because of the ease with which researchers can obtain successive generations in aquarium conditions. Its small body size and short life cycle (in comparison with common carp and goldfish)

2.1 Phylogenic Position Among Vertebrates

19

Fig. 2.1 Phylogenetic position of goldfish. Sarcopterygian and actinopterigian groups are indicated by green-filled area and triangular blue outline, respectively. Light and dark gray regions represent Otophysi and Cyprinidae groups. The lineage of the goldfish is indicated by the red-filled triangle. The white circle indicates the common carp and goldfish lineage-specific allotetraploidization. The phylogenetic relationship of Otophysi and related groups is based on Saitoh et al. (2003, 2006), and the relationships of the other lineages are derived from Liem et al. (2001) with minor modifications. For simplicity, multiple paraphyletic lineages of basal teleost groups and basal actinopterigian groups are represented by two lines (see Liem et al. 2001)

also allow researchers to conduct sophisticated molecular developmental genetic studies (Fig. 2.3). Consequently, the zebrafish has played an increasingly pivotal role in the study of many molecular developmental mechanisms (for examples, see Kimmel et al. 1995; Bradford et al. 2011), and the establishment of molecular developmental techniques in zebrafish has greatly impacted the prevalence and aims of goldfish studies (see Sects. 2.5 and 2.6).

20

2 Goldfish as an Experimental Model

Fig. 2.2 Lateral views of Carassius auratus and Cyprinus carpio. (a, b) Carassius auratus. (c, d) Cyprinus carpio. The specimens of (a, c) were collected at the river in Yilan prefecture, Taiwan. The ornamental domesticated strains of Carassius auratus and Cyprinus carpio (b, d). Scale bars ¼ 1 cm. (Panels b, c adapted from Abe et al. (2018) with permission from Scientific Reports)

2.2

Problems with Nomenclature, Phylogeny, and Biogeography

Most recent researchers use Carassius auratus or similar nomenclature to indicate goldfish (e.g., Carassius auratus auratus in Luo et al. 2007; Carassius auratus red var in Qin et al. 2014; Carassius auratus in Chen et al. 2019), but a consistent scientific nomenclature system has still not been established. Matsui (1935) and Smartt (2001) discuss the confusing history of nomenclature for the genera Cyprinus

2.2 Problems with Nomenclature, Phylogeny, and Biogeography

21

Fig. 2.3 Comparison of goldfish and zebrafish body sizes. Approximate body sizes (black color) and brain sizes (white color) of mature adult fish are represented in the illustration. (a) Goldfish. (b) Zebrafish. The approximations of the body size were based on Parichy et al. (2009) and Li et al. (2015). The fish images are illustrated by the author

and Carassius, beginning with the initial classification by Linnaeus. Interestingly, the goldfish specimen described by Linnaeus was an ornamental twin-tail individual that was designated as Cyprinus auratus. Thus, the confusion about goldfish nomenclature began with the first definitions of Cyprinus species by Linnaeus nearly 300 years ago (see Matsui 1935 and Smartt 2001 for details). Thankfully, reports from recent researchers have provided an opportunity to revisit and reconsider the definition of Carassius auratus (Takada et al. 2010; Rylková et al. 2013). To avoid confusion in further parts of this book, I will provide a definition of goldfish to be used throughout this work. Here, I define goldfish as domesticated Carassius auratus strains containing color and morphological variations that were established under artificial conditions by breeders and fanciers for ornamental purposes. This definition allows us to further divide goldfish populations into several different groups based on their historical background. These subdivided goldfish populations (and individuals, in some cases) are designated by a strain name and/or suitable adjectives. For example, well-established and commercially available ornamental strains are identified by their strain names (e.g., “Ranchu” and “Ryukin”). If there is an inconsistency between a strain name and its associated phenotype, the source article, in which the strain name was used, is written explicitly; for instance, “Ryukin by Matsui (1935).” For more information about the phenotypes and nomenclature of goldfish strains, see Chap. 3. Moreover, all of the strains together can be collectively called “ornamental goldfish,” and ornamental goldfish that escaped into nature are referred to as “feral goldfish,” consistent with terminology used by several researchers (Morgan and Beatty 2007; Kalous et al. 2012; Rylková et al. 2013). These definitions of goldfish subtypes work well for most domesticated ornamental goldfish strains and are applicable to all of the goldfish mentioned in further chapters of this book. Moreover, for convenience, Carassius auratus is defined as the group of Carassius species forming a clade with goldfish that are simultaneously excluded from other Carassius species. These other Carassius species are referred to as “nonCarassius auratus species.”

22

2 Goldfish as an Experimental Model

Fig. 2.4 Representative patterns of goldfish importation. (a–d) Goldfish habitats and spread are schematically represented. (a) A natural water system with Carassius auratus species. (b) An aquarium for domesticated ornamental goldfish. (c) A natural water system with wild endogenous Carassius species (non-Carassius auratus). (d) A natural water system without any Carassius species. The Arabic numbers indicate four different cases of Carassius auratus transfer. The black arrow (the case 1) represents the transfer of goldfish during early domestication. The red arrows (cases 2–4) show the importation of domesticated ornamental goldfish into natural habitats

However, it should be noted that there is no consensus about the nature of the phylogenetic relationship between goldfish, non-goldfish Carassius auratus, and non-Carassius auratus species, even though recent researchers have utilized molecular phylogenetic methods to study the question (Komiyama et al. 2009; Takada et al. 2010; Podlesnykh et al. 2012, 2015). Recent reports on the phylogenetic relationship of Carassius species often use the term “Carassius auratus complex,” presumably due to the highly complicated results of molecular evolutionary analyses on Carassius auratus and related Carassius species (Takada et al. 2010; Rylková et al. 2013) (Fig. 2.1). One possible reason why the phylogenetic relationship is so complicated may be human influences on the range of habitats occupied by goldfish. After the establishment of domesticated ornamental goldfish, the strains were carried from their original habitat range (eastern regions of the Eurasian continent) to Europe (Portugal, France, and Great Britain) in the seventeenth century. Across Europe, goldfish readily took up residence in natural freshwater habitats due to their high tolerance for temperature changes and hypoxic/anoxic conditions (Ford and Beitinger 2005; Fagernes et al. 2017; Hervey and Hems 1948; Rylková et al. 2013) (Fig. 2.4a–c). According to Copp et al. (2010), who reported a detailed history of how imported goldfish spread into freshwater areas of Britain, domesticated goldfish were often illegally released as “unwanted pets” into British streams and ponds, where the brown variety of goldfish showed relatively high fitness and reproduced to create new generations of feral fish. Subsequently, these brown feral goldfish were mistaken as endogenous crucian carp (Carassius carassius) and failed to be recognized as an invasive species, allowing the goldfish to successfully expand their habitat in Britain (Fig. 2.4c). Similar events were also reported in other areas where endogenous Carassius species are not naturally distributed, such as America, Australia, and Africa (Morgan and Beatty 2007; Takada et al. 2010; Haynes et al. 2012; Rylková et al. 2013; Weyl et al. 2020; Halas et al. 2018) (Fig. 2.4d). Such anthropogenic influences on the habitat of Carassius auratus led to unexpected inter-species hybridizations of imported goldfish and endogenous Carassius carassius (Hanfling et al. 2005). Notably, Tetsugyo is considered to be a hybrid of imported domesticated goldfish and an endogenous species. It is reported that the population of Tetsugyo—

2.2 Problems with Nomenclature, Phylogeny, and Biogeography

23

whose habitat of Yutori-numa Pond in Miyagi Prefecture is designated as a National Natural Monument in Japan (https://kunishitei.bunka.go.jp/heritage/detail/401/ 186)—was derived from the hybridization of goldfish and an unidentified endogenous Carassius species (Matsui 1934; Komiyama et al. 2009; Tomizawa et al. 2015) (Fig. 2.4a, b). Unlike most hybrids of goldfish and Carassius species, Shubunkin is known to be a hybrid strain that was intentionally generated by breeders (Matsui 1934; Komiyama et al. 2009; Tomizawa et al. 2015) (Fig. 2.4a, b). It is reported that the Shubunkin strain is derived from the hybrid of goldfish and the red-color mutation of a wild Carassius species called “Hibuna” in Japanese; details of the establishment of these fish can be seen in the article by Matsui (1934). Hibuna is not located within the group containing goldfish in the phylogenetic tree on the basis of its quite long mitochondrial DNA sequence (approximately 11,180 bp) (Komiyama et al. 2009); thus, the Shubunkin strain is recognized as an inter-species hybrid goldfish strain. The relatively frequent inter-species hybridizations and resulting complicated phylogenetic relationships are also reflected by the diversity of ploidy in Carassius auratus strains. Polyploid (triploid and tetraploid) Carassius species are known to be distributed across Eurasia (Takada et al. 2010; Rylková et al. 2013), and the reproductive system of triploid Carassius species is known to be gynogenesis. The ginbuna triploid crucian carp (Carassius auratus langsdorfii in the works of Kobayashi 1970; Kobayasi et al. 1973; Ojima 1983; Murakami et al. 2001) has been well investigated with regard to its genetics and immune system. Interestingly, researchers aimed to make this species a model organism for immunology because it is known to reproduce by gynogenesis, allowing easy access to clonal populations (Somamoto et al. 2005, 2009, 2014). Previous karyotyping analyses and recent genome sequencing research (Makino 1939; Ojima and Takai 1979; Ojima et al. 1979; Chen et al. 2019) suggest that the goldfish chromosome number in a diploid cell is 100. In fact, the goldfish is used as the diploid gonochoristic reference species for phylogenetic analyses (Kalous et al. 2012). This strong diploid gonochoristic character is consistent with evidence that breeders produced various ornamental goldfish strains by crossing males and females with phenotypic features that were favorable for ornamental purposes. Thus, a gonochoristic diploid species may be preferred by breeders and fanciers to produce goldfish strains for ornamental purposes, causing the gonochoristic diploid trait to be retained and reinforced in the ornamental goldfish population. However, given that polyploid crucian carp are found in phylogenetically distinct lineages (Takada et al. 2010; Rylková et al. 2013), one may expect that strains with different ploidies have occurred in parallel and independently multiple times. These phylogenetic analyses also illustrate the difficulty and limitations of using ploidy for identification of Carassius species and lineages (Takada et al. 2010; Rylková et al. 2013). Since goldfish and polyploid non-Carassius auratus species are categorized in the same group of the molecular phylogenetic tree (Takada et al. 2010), it is likely that the common ancestor of the goldfish underwent changes in ploidy. This observation may therefore be taken as evidence that the original cytogenetic features of the lineage included unstable ploidy.

24

2 Goldfish as an Experimental Model

The complexities of phylogeny, taxonomy, and evolution of ploidy described above are largely due to the ambiguous reproductive isolation of the Carassius species (Ojima 1983; Takada et al. 2010; Rylková et al. 2013). In fact, goldfish and common carp can make hybrids (Delomas et al. 2017; Warner et al. 2018; Liu et al. 2016; Liu 2010), although the progeny are not stably viable. Therefore, one may presume that inter-genus hybrids of Carassius can occur relatively easily and have influenced the evolution of Carassius species. This high frequency of intra- and inter-species hybridization is consistent with expectations for polyploids (Liu 2010), suggesting a cautious approach is required when utilizing the nuclear genome sequences of polyploids and hybrids. When analyzing nucleotide sequences from nuclear genomes, the existence of polyploidy leads us ask the question whether isolated homologous sequences represent orthologous or paralogous genes. Moreover, the ambiguous reproductive isolation between goldfish and common carp has also led to further puzzling observations, as detailed below.

2.3

Duplicated Goldfish Genome

Polyploidization is not specific to the Carassius lineage. In addition to goldfish, common carp also have a diploid chromosome number of 100, while zebrafish have 50 (Ojima 1983; Xu et al. 2014; Chen et al. 2019). The chromosome numbers of goldfish and common carp compared to zebrafish suggest that tetraploidization occurred in the common ancestor of these two teleost species. Moreover, recently published whole genome sequencing data revealed that the type of tetraploidization as allotetraploidization (Xu et al. 2014; Chen et al. 2019; see also Gregory 2021, http://www.genomesize.com). Allotetraploidization and autotetraploidization both produce tetraploid genomes; however, these two processes are distinguished from one another by the origin of the chromosomes (Griffiths et al. 2012). The term autopolyploidization indicates a genome doubling in one species. On the other hand, allotetraploidization refers to a duplication of the genome with species hybridization. The latter type of genome duplication has been reported in a number of plant species and in a limited number of animal species (especially amphibian species) (Flagel and Wendel 2010; Doyle et al. 2008; Okuyama et al. 2012; Buggs et al. 2014; Adams et al. 2003; Adams and Wendel 2005; Uno et al. 2013; Session et al. 2016). The reason why whole-genome sequence data of the common carp and goldfish suggest the occurrence of allotetraploidization is that there is a clear one-to-one orthologous relationship between most of the duplicated genes in each genome (Fig. 2.5). The clear orthologous relationship of duplicated genes in the goldfish might be utilized in molecular phylogenetic analyses to understand the complicated interCarassius relationships. At least, the problem of deciding whether isolated nucleotide sequences from different species and/or individuals are orthologs or paralogs can be relatively easily resolved. Given that the allotetraploidization occurred in the common ancestor of goldfish and common carp, the phylogenetic tree of isolated

2.3 Duplicated Goldfish Genome

25

Fig. 2.5 Allotetraploidization and paralogous genes in goldfish and common carp. (a) Schematic representation of the relationship between genes and species. The genes are represented in italics (e.g., sp1A). Gray area shows the species tree. (b) Schematic representation of the expected phylogenetic relationship of paralogs genes derived from goldfish and common carp. In this tree, zebrafish gene A (Zebrafish A) was used as an outgroup. Light and dark green lines represent the lineage of the gene A paralogs derived from species 1 (sp1A) and species 2 (sp2A), respectively

paralogs is expected to show three representative features: (a) the orthologous genes derived from goldfish and common carp form one cluster, (b) the paralogous sequences are excluded from the cluster to form another cluster, and (c) the zebrafish homologous gene is separate from these two clusters (Fig. 2.5) (Abe et al. 2014, 2016; Xu et al. 2014; Chen et al. 2019). Thus, in comparison with duplicated genes from autotetraploidization, those arising from allotetraploidization might be relatively easy to assign orthology and paralogy; although there are still remaining problems in the experimental procedures (see below). These duplicated gene sets in the genome of goldfish also endow the goldfish lineage with the capacity to present species-specific phenotypes. It is known that the duplicated genes tended to evolve independently, and their functions have diverged (Abe et al. 2014, 2016). Such an evolutionary process is called sub/neo-functionalization, and this process might have contributed to the acquisition of characteristics like high tolerance to novel environments and extreme ornamental phenotypes.

26

2.4

2 Goldfish as an Experimental Model

Low Oxygen Tolerance, Physiology, and Neuroscience

The genome duplication in goldfish has apparently led it is tolerance for extremely low oxygen conditions. Biochemical and molecular studies suggested that duplicated and neofunctionalized components of the pyruvate dehydrogenase complex (PDHc) provide low-oxygen tolerance and allow the goldfish to survive in aquariums and other conditions that are uninhabitable for other fish (Fagernes et al. 2017). This low-oxygen tolerance may allow us to understand how people succeeded in maintaining their ornamental goldfish in aquariums during the Ming dynasty (see Chap. 1). Presumably, study of this unique goldfish-specific feature has also indirectly and directly contributed to increasing the knowledge about general fish respiratory physiology. In addition to allowing people of the Ming dynasty to keep goldfish in aquariums, tolerance for low-oxygen conditions provided an opportunity for the goldfish to spread from its original habitat to other regions (see Chap. 1). Consequently, the goldfish became a readily and commercially available experimental animal for researchers all over the world. Since the tolerance for low-oxygen conditions facilitates long-term monitoring of respiratory physiological features, a number of studies have utilized goldfish to measure oxygen consumption and metabolism under the different experimental environmental conditions (e.g., different temperatures and chemical conditions) from early to recent times (Crozier and Stier 1925; Allee et al. 1940; Kanungo and Prosser 1959; Tsukuda et al. 1985; Lushchak et al. 2001; Lisser et al. 2017). The relationship between low-oxygen tolerance and progress in the study of respiratory physiology in the goldfish seems to be very close; since goldfish can endure and survive under the challenging conditions prepared by researchers, the researchers prefer to use this teleost species. Consequently, the understanding of goldfish respiratory physiology has been advanced. The tolerance of goldfish to extremely low oxygen might also provide significant advantages for studying neuroscience. Since several common experimental procedures for neuroscience studies (e.g., placing of electrodes for electrophysiology and dye injections for retrograde and anterograde tracing) must be conducted outside the aquarium, the ability of goldfish to tolerate low-oxygen conditions increases the success rate for these experiments. Moreover, the relatively large body and brain sizes of the goldfish have been traditionally preferred by neuroscientists (Fig. 2.3). As such, a number of basic neuroanatomical descriptions, neuronal tracer experiments, and electrophysiology studies have been conducted in goldfish (CronlyDillon 1964; Northcutt 2008; Masai et al. 1982; Eaton et al. 1981; Schmidt et al. 1978; Gestrin and Sterling 1977; Pastor et al. 2019; Torres et al. 1992; Von Bartheld et al. 1984; Puzdrowski 1988; Meek 1983; Levine and Dethier 1985; Zottoli and Van Horne 1983; Rahmat and Gilland 2019; Kyle and Peter 1982; Takeda et al. 2018). While similar experiments have been conducted on the common carp (Negishi et al. 1978; Harper et al. 1990; Luiten 1981; Luiten and van Der Pers 1977; Echteler 1984; Fujita 1987), the goldfish seems to be more frequently used in recent neuroscience studies (Pastor et al. 2019; Rahmat and Gilland 2019; Takeda et al. 2018); it is

2.4 Low Oxygen Tolerance, Physiology, and Neuroscience

27

possible that the goldfish is more suited than the common carp to rearing and experimental platforms in a research laboratory, since the common carp body size is larger than that of goldfish. The suitable body size, high tolerance to severe environmental conditions, and ease of experimental handling have allowed the goldfish to become a widely used tool in physiological and neuroscience studies (Fig. 2.3). For example, the technique of wireless electrophysiology was developed in the goldfish to acquire electrophysiological data from free-swimming animals (Vinepinsky et al. 2017, 2020). Moreover, tolerance to a wide range of oxygen concentrations, temperatures, and chemical conditions allowed researchers to use the goldfish for toxicological studies, sometimes in combination with neuroscience (Powers 1918; Martyniuk et al. 2005; Sun et al. 2007; Wang et al. 2009). Given that Carassius auratus and its related species are now distributed throughout natural waters all over the world (even though this wide distribution does not reflect their original habitat), experimentally acquired data from goldfish can be compared with real-world data derived from Carassius auratus within environmental water systems (including feral goldfish and endogenous Carassius auratus). Indeed, these research endeavors can be considered typical examples of situations where researchers have made use of advantageous goldfish characteristics. However, recent progress studying neuroscience and physiology in zebrafish should be taken into account. Highly sophisticated and advanced optophysiology and genetic visualization techniques have been developed in zebrafish and have provided unparalleled opportunities to visualize neuronal circuits and probe how these circuits work at a molecular level in live intact specimens (Friedrich et al. 2010; Portugues et al. 2013; Kimura et al. 2013; Miyasaka et al. 2009; Okamoto et al. 2012). Due to the relatively long life cycle of the goldfish in comparison with zebrafish (Ota and Abe 2016; Parichy 2015), it is not reasonable to expect that equivalent optophysiology and genetic visualization methods will be easily established in the goldfish experimental system. Moreover, even though the suitable body size and high tolerance of the goldfish are advantageous for the development of micro-devices for physiological monitoring (Vinepinsky et al. 2017, 2020), it is also possible that even smaller devices will be developed in the near future, allowing their application in zebrafish (Cao et al. 2014). Thus, the current trend of developing highly advanced techniques in zebrafish will provide an opportunity for goldfish researchers to seriously reflect on and consider the most beneficial characteristics of goldfish for new research projects (see Blanco et al. 2018). This type of serious consideration will be required of researchers in all fields, without exception, if goldfish are to be used as a model organism.

28

2.5

2 Goldfish as an Experimental Model

Rise and Fade of Goldfish Embryology

To delineate the truly advantageous points of using goldfish in developmental studies, I consider the historical rise and fade of goldfish embryology here. Although the study of early embryogenesis was intensively investigated in goldfish at a molecular level by Yamaha and colleagues near the turn of the century in Japan (Yamaha et al. 1998, 1999, 2001, 2003; Yamaha and Yamazaki 1993; Tanaka et al. 2004; Mizuno et al. 1997; Otani et al. 2002), such molecular embryological studies have gradually become less common. This fade of goldfish developmental biology seems to be correlated with the rise of zebrafish developmental biology. Even though goldfish embryos are larger than zebrafish embryos, the latter have been more frequently used in recent developmental biology studies (Fig. 2.6). The decline in goldfish developmental biology research is partly due to technical problems. First, goldfish require long periods of time for maintenance and spawning. It is known that the goldfish female can spawn its eggs at 1–2 years after fertilization. On the other hand, zebrafish become adults at around 3–4 months after fertilization. This difference in the life cycle duration is crucial for researchers who want to employ genetic approaches. Second, while the large size of goldfish embryos was previously advantageous, this advantage became almost insignificant after manipulation techniques were established in zebrafish (Mizuno et al. 1997; Bradford et al. 2011) (Fig. 2.6). Third, the goldfish provides no obvious benefits to researchers who want to investigate molecular developmental systems, partly due to the phylogenetic closeness with zebrafish. The phylogenetic closeness of goldfish and zebrafish might lead researchers to conclude that the study of goldfish would only yield discoveries of molecular phenomena that are quite similar to those revealed by zebrafish studies. Furthermore, goldfish might not attract researchers interested in the ancestral state of the fish linage, because alternative teleost species, such as medaka (Oryzias latipis), seem more suitable for this purpose. Medaka and its relatives are also well-known ornamental and experimental teleosts, which are naturally distributed in areas within Fig. 2.6 Comparison of goldfish and zebrafish egg sizes. Egg membrane and yolk are represented by white-filled and gray-filled circles, respectively. The approximations of egg sizes were based on Kimmel et al. (1995) and Tsai et al. (2013)

2.5 Rise and Fade of Goldfish Embryology

29

Asia. Since medaka is distantly related to zebrafish, comparisons between these species have provided important insights into a wide range of common ancestral traits for the teleost linage (Wittbrodt et al. 2002; Kasahara et al. 2007). By the same logic, the comparison of zebrafish to other model vertebrate animals is more information rich than the comparison of closely related goldfish and zebrafish. The complicated genomic background has also estranged molecular biologists from goldfish. Given that the duplicated genome of goldfish increases the complexity of molecular networks, molecular biologists who simply want to know the function of genes would not be inclined to use the goldfish. In fact, the multiple number of paralogous genes has been an annoyance to many researchers performing molecular cloning, analyses of gene expression patterns, and functional analyses (Fig. 2.5). In terms of experimental practicalities, there are two major interrelated problems with the goldfish genome. First, additional paralogous genes must always be isolated to perform thorough and accurate molecular studies. Second, even when all the paralogous genes are isolated, it can be difficult to interpret gene expression patterns and functions because there is a distinct possibility that the paralogs exhibit different expression patterns and diverged functions. The second problem can be especially vexing to researchers trying to interpret the results of experiments in which a target gene product is depleted, as there is always a possibility that the paralogous genes will influence the outcome. To solve such problems with interference by duplicate paralogs genes, researchers need to examine both the orthologs and paralogs of the target gene in their functional analyses. In other words, a major disadvantage of goldfish as an experimental model is that researchers have to be concerned about the existence of additional paralogs and the function of such paralogs. Despite recent progress with sophisticated molecular techniques, the problems resulting from gene paralogs cannot be completely solved. For example, nextgeneration sequencing techniques have allowed whole genome sequencing of the goldfish and its relatives (Xu et al. 2014; Chen et al. 2019), and comparison with reference genome sequences has allowed researchers to identify the genes responsible for various different ornamental goldfish phenotypes (Kon et al. 2020); these genotype–phenotype relationships will be examined in Chap. 3. However, researchers working with goldfish have to conduct more complicated molecular experimental studies than those using other model teleost species (e.g., zebrafish and medaka) (Figs. 2.1 and 2.5). Interestingly, researchers largely depend on knowledge gained from zebrafish studies when investigating the function of goldfish genes (Kon et al. 2020). Moreover, even though genome editing techniques are extensively used in zebrafish (examples include Hwang et al. 2013; Jao et al. 2013; Hruscha et al. 2013) and similar techniques may be available for goldfish, the duplicated paralogs in goldfish still necessitate additional analyses. For example, even though the whole genome sequences of goldfish provide sufficient information to design guide RNAs for CRISPR/Cas9-mediated genome editing and knockout experiments, the interpretation of results from goldfish knockouts is not as simple as it is for zebrafish, since the duplicated paralogs in the goldfish genome must be taken into account.

30

2 Goldfish as an Experimental Model

For these reasons, goldfish are generally not considered to be a good model organism for researchers interested in common molecular developmental mechanisms or for those interested in making comparisons between well-established model organisms for molecular biology. Even though the embryos of goldfish are slightly larger than those of zebrafish, Xenopus and chick models might be more suitable for researchers concerned with ease of embryological manipulation (Hamburger and Hamilton 1992; Nieuwkoop and Faber 1994). Similarly, even though the goldfish are highly suitable for use as a model system to study the relationship between genome duplication (allotetraploidization) and development, the researcher must clarify the unique rationale for using goldfish in a genomic study. It is known that Xenopus laevis and zebrafish have also experienced genome duplication and given that these animals are probably easier to use for the molecular developmental biology experiments, it seems more suitable to use these well-established model organisms to investigate the relationship between genome duplication and molecular developmental mechanisms (Inomata et al. 2008; De Robertis 2009; Session et al. 2016). Thus, a precise rationale of why it is advantageous to study a certain developmental process, its underlying molecular mechanisms and its evolution must be provided to justify investigations in goldfish.

2.6

Contrast Between Zebrafish Mutants and Goldfish Strains

For the reasons outlined above, goldfish seem to have become a generally unattractive model for developmental biologists after zebrafish were established as a standard representative vertebrate animal for molecular developmental biology. Unlike zebrafish, the goldfish requires relatively large aquarium facilities, and the female does not constantly spawn eggs (Mullins et al. 1994; Tsai et al. 2013; Li et al. 2015, 2019; see also Chap. 8, Experimental Notes). Moreover, the proximate phylogenetic relationship between goldfish and zebrafish reduces the significance of goldfish in evolutionary studies. However, there are still valid reasons and opportunities to use goldfish as a developmental model. In order to understand the benefits of goldfish as a developmental model, it is important to consider that zebrafish mutants and ornamental goldfish have significant differences in how they are established and maintained (Fig. 2.7). Mutant strains of goldfish and zebrafish were both established under artificial conditions, suggesting that both models are under selective pressures by humans. Thus, regardless of the species, if an individual cannot survive in the respective artificial conditions, it will be eliminated from the population. Presumably, mutant individuals (either goldfish or zebrafish) that cannot physiologically adapt to the artificial aquarium conditions (i.e., goldfish breeder ponds or aquarium systems in zebrafish laboratories) are not likely to reproduce and pass the mutation to the next generation. However, anthropogenic selective pressure to exhibit visually recognizable

2.6 Contrast Between Zebrafish Mutants and Goldfish Strains

31

Fig. 2.7 Contrast between zebrafish mutagenesis and goldfish breeding. Screening, maintenance, and establishment of zebrafish mutant strains (a–e) and ornamental goldfish strains are shown (f–j). The numbers and phenotypes of individuals within the populations are indicated by the vertical and horizontal axis of each graph. This scheme is based on the assumptions that the + allele is dominant to the  allele, (+/+) and (+/) populations show identical distributions, and the population consisting of / individuals shows a polymorphic phenotype. Arrowheads indicate mutated phenotypes. Black arrowheads indicate the mutated phenotypes most preferred by breeders. Horizontal arrows indicate selective pressures in the goldfish population. The screening of homozygous mutants with morphological features tends to remove individuals with low penetrance from the zebrafish population (asterisks in b, c). The distribution patterns of zebrafish mutant populations tend to show the same distribution patterns with previous generations (c–e). (f) During goldfish breeding (f–j), the most preferred mutated traits in each generation (black arrowheads in g, h) tend to be selected and become fixed in the population. (Reprinted with permission from Ota and Abe 2016)

phenotypes has been applied in both species to create phenotypic mutants. An important difference is that the visually recognizable phenotypes of zebrafish mutant strains have been selected for research purposes, while visually recognizable

32

2 Goldfish as an Experimental Model

phenotypes in goldfish mutant strains were selected for ornamental purposes by breeders and fanciers (Fig. 2.7). Most conventional zebrafish mutant strains were not subjected to strong directional selective pressures based on morphological features (Fig. 2.7a–e). Large-scale random mutagenesis experiments have been performed for the purpose of identifying genes that regulate morphogenesis and development, and a wide range of mutant phenotypes have been described by researchers (Mullins et al. 1994; Haffter et al. 1996; Driever et al. 1996; Amsterdam et al. 1999; Golling et al. 2002; Wienholds et al. 2003; Sivasubbu et al. 2006; Nagayoshi et al. 2008) (Fig. 2.7a–d). In the initial step of these experiments, zebrafish researchers carefully screened for any detectable mutant phenotypes, even selecting phenotypic differences that are quite subtle in comparison with wild-type fish (Haffter et al. 1996; Driever et al. 1996; Amsterdam et al. 1999). In the second step, mutated loci were subjected to genetic identification, isolation, and/or purification. More specifically, the mutated fish were backcrossed with wild-type zebrafish in order to segregate any mutated loci that may have co-occurred. Consequently, mutant zebrafish with multiple mutated loci are likely to have been removed from the zebrafish mutant populations. This step increases the ease of analysis for researchers who want to identify the locus or allele responsible for a mutant phenotype of interest. Moreover, it is evident that specific morphological features were not positively selected by researchers (Fig. 2.7a–d). Rather than selecting a specific phenotypic feature, researchers put effort into retaining randomly generated phenotypes in order to learn more about the functions of the responsible loci. After the responsible locus and/or allele (as well as its function) is identified, the established zebrafish mutant strains are typically kept for further detailed analysis over several generations, without application of further selective pressures on morphological features (Fig. 2.7d, e). For example, a mutated allele that causes a severe phenotype in homozygous individuals tends to be maintained in a heterozygous population if the research purpose is to identify the locus and analyze the function of the allele. If the heterozygous fish does not exhibit any phenotype, then the allele and its related loci could not reasonably be subject to positive selection for phenotypic features. Instead, the mutated allele is selected and retained by checking the genotype with polymerase chain reaction or sequencing techniques, and/or some milder phenotype may be used as an index to identify individuals with heterozygous loci. In such cases, the distribution patterns of phenotypes should not be substantially modified, although mutant individuals with low penetrance and expressivity of the phenotypes may be eliminated from the population by researchers (Fig. 2.7e, Ota and Abe 2016). More specifically, if a morphological mutation (e.g., a twin-tail or short body, as seen in ornamental goldfish) is exhibited by a mutant zebrafish strain, researchers would tend not to preferentially select “champion” individuals with the most extreme phenotypes (i.e., the progeny with the most beautifully bifurcated twin-tail or shortest body). Instead, a certain range of polymorphisms would be permitted for classical genetics studies, as zebrafish researchers are unlikely to impose strong directional selective pressures during random mutagenesis

2.7 Comparison with Other Domesticated Animals

33

experiments. Thus, the process of random mutagenesis for zebrafish and other teleost model systems lacks repeated selection or reinforcement of mutations. For this reason, the creation and maintenance of mutant zebrafish strains differs greatly from the goldfish breeding process. Unlike the mutant phenotypes of zebrafish strains isolated for research purposes, the ornamental phenotypes of goldfish were subject to strong directional selection toward characteristics considered to be more attractive and valuable for fanciers and breeders (Fig. 2.7f–j). If one goldfish individual were to exhibit an exemplary and highly valuable morphological feature in the goldfish market (e.g., more symmetric and well-spread bifurcated caudal fins), breeders would certainly use this “champion” as a parental fish to produce the next generation. Even though breeders often use less exemplary individuals to generate subsequent generations, it is expected that breeders will actively exclude polymorphic individuals that exhibit phenotypes with little or no value from their goldfish population for economic reasons. In the context of evolutionary biology, the breeding process of morphologically differentiated goldfish mutant strains can be rephrased as follows. (1) A goldfish individual showing a mutated morphological phenotype is selected (Fig. 2.7g). (2) The individuals that exhibit the preferred morphological phenotypes are used as parents of the next generation (Fig. 2.7g–i). (3) The same process may be performed repeatedly. (4) Finally, the most preferred mutated morphological phenotype is genetically fixed as the established ornamental morphology in the population, and simultaneously, non-preferred phenotypes are eliminated. This process is highly similar to that which occurs under natural conditions (Fig. 2.7j). These differences in breeding strategy and purpose between zebrafish and goldfish reveal some unique and advantageous aspects of the goldfish model. The presence of directional selection on goldfish ornamental phenotypic features may allow researchers to investigate the evolutionary consequences of continuous and directional artificial selection on adult morphological features. Furthermore, it is expected that such artificial selective pressures for visible phenotypes will be reflected in evolution of the genome. Although we highlighted several disadvantages of using a model with a duplicated genome derived from the allotetraploidization, this genomic feature and historical background of ornamental domesticated animals provide an opportunity to consider how duplicated genomes may evolve under domesticated conditions.

2.7

Comparison with Other Domesticated Animals

To close this chapter, we consider how the goldfish differs from other domesticated vertebrates in the context of its use as a model for developmental biology, aiming to answer the question posed at the end of Chap. 1: why should we choose to investigate goldfish in our studies? Recent researchers have utilized several different domesticated mammals and birds, with dogs and pigeons representative of typical classic and modern species (Darwin 1868; Lindblad-Toh et al. 2005; Wayne and

34

2 Goldfish as an Experimental Model

Ostrander 2007; Akey et al. 2010; VonHoldt et al. 2010; Stringham et al. 2012; Shapiro et al. 2013). Interestingly, these domesticated animals often exhibit some quite unnatural phenotypic features and encompass an extensive variety of morphologically diverged strains. Moreover, the genomic backgrounds of diverged phenotypes have been intensively and extensively investigated in recent studies (Lindblad-Toh et al. 2005; Wayne and Ostrander 2007; Akey et al. 2010; VonHoldt et al. 2010; Stringham et al. 2012; Shapiro et al. 2013). These studies have increased our understanding of the relationship between human activity and evolution of genotypes, genes, and genomes. However, mammals and birds have not been used to make significant contributions to our understanding of how artificial selection is related to the developmental process. One reason why developmental studies are rare in domesticated mammal and bird species is the general difficulty of harvesting and observing embryos in amniote species; embryos of mammals and birds develop in a uterus or an egg with an opaque hard shell. In comparison with domesticated amniotes, the embryos of goldfish are much easier to observe, which is a major advantage for developmental biology experiments. While breeding and spawning of goldfish may be somewhat difficult, these difficulties are overshadowed by the ease with which embryos may be observed (Fig. 2.8) compared to ornamental amniotes. In addition, the relatively well-recorded historical background of goldfish domestication provides a reliable reference to gauge the time periods required for changing macroscopic phenotypic features and related developmental processes (see Chap. 1). Another notable difference between goldfish and other ornamental species is their habitat. Unlike the domesticated mammals and birds, a goldfish resides in aquatic conditions during its entire lifespan. Taking into account that terrestrial and aquatic animals are under different constraints in terms of functional anatomy and mechanics (Liem et al. 2001), it is easy to understand why goldfish might exhibit mutated phenotypes that are not found in terrestrial species. In fact, some ornamental domesticated goldfish varieties have been bred to exhibit drastic alterations in morphology of the axial skeleton, which are probably not feasible to generate in terrestrial vertebrate species (see Chap. 3). Thus, the relatively minor influence of gravity on goldfish movement might be a crucial factor facilitating the efforts of breeders to establish extreme modifications in the skeletal morphologies that have not appeared in conventional terrestrial vertebrate species. The fact that ornamental goldfish strains have such extreme ornamental morphological features might provide an opportunity for researchers to simultaneously apply genetics and developmental biology to investigate large-scale morphological evolution (Fig. 2.8). Previously, a few evodevo studies have been conducted to investigate large-scale morphological evolution by employing comparative analyses of phylogenetically highly diverged animals; see, for example, Gilbert and Epel (2009), Kuratani (2004), and Carroll et al. (2013). However, due to the difficulty of conducting genetic crosses between animals of different lineages, genetic approaches are not directly applicable for distantly related animals. On the other hand, the progenies derived from nearly any of combination of goldfish parents can survive and reproduce, even though the parents may be highly diverged in their

2.7 Comparison with Other Domesticated Animals

35

Fig. 2.8 Simultaneous application of genetic and developmental approaches. Domestication-derived ornamental phenotypes can be examined with combined genetic and developmental approaches (especially during embryogenesis) in the goldfish

morphology. This ease of crossing individuals allows us to investigate the drastic evolutionary process of modifying skeletal morphologies and other related features using genetic approaches. Thus, goldfish have major advantages compared to other domesticated species in terms of amenability to both genetic and embryological approaches (Fig. 2.8). Based on the information presented in this chapter, we conclude that goldfish may be the vertebrate animal model that is best suited to simultaneous application of genetics and embryology to investigate how strong artificial selective pressures can modify the developmental process, presenting unparalleled novel opportunities in the study of evodevo.

36

2 Goldfish as an Experimental Model

References Abe G, Lee S-H, Chang M, Liu S-C, Tsai H-Y, Ota KG (2014) The origin of the bifurcated axial skeletal system in the twin-tail goldfish. Nat Commun 5:3360. https://doi.org/10.1038/ ncomms4360 Abe G, Lee S-H, Li I-J, Chang C-J, Tamura K, Ota KG (2016) Open and closed evolutionary paths for drastic morphological changes, involving serial gene duplication, sub-functionalization, and selection. Sci Rep 6:26838. https://doi.org/10.1038/srep26838 Abe G, Li I-J, Lee S-H, Ota KG (2018) A novel allele of the goldfish chdB gene: functional evaluation and evolutionary considerations. J Exp Zool B Mol Dev Evol 330(6–7):372–383. https://doi.org/10.1002/jez.b.22831 Adams KL, Wendel JF (2005) Polyploidy and genome evolution in plants. Curr Opin Plant Biol 8 (2):135–141. https://doi.org/10.1016/j.pbi.2005.01.001 Adams KL, Cronn R, Percifield R, Wendel JF (2003) Genes duplicated by polyploidy show unequal contributions to the transcriptome and organ-specific reciprocal silencing. Proc Natl Acad Sci U S A 100(8):4649–4654. https://doi.org/10.1073/pnas.0630618100 Akey JM, Ruhe AL, Akey DT, Wong AK, Connelly CF, Madeoy J, Nicholas TJ, Neff MW (2010) Tracking footprints of artificial selection in the dog genome. Proc Natl Acad Sci U S A 107 (3):1160–1165. https://doi.org/10.1073/pnas.0909918107 Allee WC, Finkel AJ, Hoskins WH (1940) The growth of goldfish in homotypically conditioned water; a population study in mass physiology. J Exp Zool 84(3):417–443. https://doi.org/10. 1002/jez.1400840306 Amsterdam A, Burgess S, Golling G, Chen W, Sun Z, Townsend K, Farrington S, Haldi M, Hopkins N (1999) A large-scale insertional mutagenesis screen in zebrafish. Genes Dev 13 (20):2713–2724. https://doi.org/10.1101/gad.13.20.2713 Blanco AM, Sundarrajan L, Bertucci JI, Unniappan S (2018) Why goldfish? Merits and challenges in employing goldfish as a model organism in comparative endocrinology research. Gen Comp Endocrinol 257:13–28. https://doi.org/10.1016/j.ygcen.2017.02.001 Bradford Y, Conlin T, Dunn N, Fashena D, Frazer K, Howe DG, Knight J, Mani P, Martin R, Moxon ST, Paddock H, Pich C, Ramachandran S, Ruef BJ, Ruzicka L, Schaper HB, Schaper K, Shao X, Singer A, Sprague J, Sprunger B, Van Slyke C, Westerfield M (2011) ZFIN: enhancements and updates to the zebrafish model organism database. Nucleic Acids Res 39(Suppl 1):822–829. https://doi.org/10.1093/nar/gkq1077 Buggs RJA, Wendel JF, Doyle JJ, Soltis DE, Soltis PS, Coate JE (2014) The legacy of diploid progenitors in allopolyploid gene expression patterns. Philos Trans R Soc B Biol Sci 369 (1648):20130354. https://doi.org/10.1098/rstb.2013.0354 Cao H, Yu F, Zhao Y, Zhang X, Tai J, Lee J, Darehzereshki A, Bersohn M, Lien C-L, Chi NC, Tai Y-C, Hsiai TK (2014) Wearable multi-channel microelectrode membranes for elucidating electrophysiological phenotypes of injured myocardium. Integr Biol 6(8):789. https://doi.org/ 10.1039/C4IB00052H Carroll SB, Grenier JK, Weatherbee SD (2013) From DNA to diversity: molecular genetics and the evolution of animal design. Wiley, Hoboken, NJ Chen Z, Omori Y, Koren S, Shirokiya T, Kuroda T, Miyamoto A, Wada H, Fujiyama A, Toyoda A, Zhang S (2019) De novo assembly of the goldfish (Carassius auratus) genome and the evolution of genes after whole-genome duplication. Sci Adv 5(6):eaav0547. https://doi.org/ 10.1126/sciadv.aav0547 Copp G, Tarkan S, Godard M, Edmonds N, Wesley K (2010) Preliminary assessment of feral goldfish impacts on ponds, with particular reference to native crucian carp. Aquat Invasions 5 (4):413–422. https://doi.org/10.3391/ai.2010.5.4.11 Cronly-Dillon JR (1964) Units sensitive to direction of movement in goldfish optic tectum. Nature 203(4941):214–215. https://doi.org/10.1038/203214a0 Crozier WJ, Stier TB (1925) Critical increment for opercular breathing rhythm of the goldfish. J Gen Physiol 7(6):699

References

37

Darwin C (1868) The variation of animals and plants under domestication by Charles Darwin: 1, vol 2. J. Murray, London De Robertis EM (2009) Spemann’s organizer and the self-regulation of embryonic fields. Mech Dev 126(11–12):925–941. https://doi.org/10.1016/j.mod.2009.08.004 Delomas TA, Gomelsky B, Anil A, Schneider KJ, Warner JL (2017) Spontaneous polyploidy, gynogenesis and androgenesis in second generation (F2) koi Cyprinus carpio  goldfish Carassius auratus hybrids. J Fish Biol 90(1):80–92. https://doi.org/10.1111/jfb.13157 Doyle JJ, Flagel LE, Paterson AH, Rapp RA, Soltis DE, Soltis PS, Wendel JF (2008) Evolutionary genetics of genome merger and doubling in plants. Annu Rev Genet 42:443–461. https://doi. org/10.1146/annurev.genet.42.110807.091524 Driever W, Solnica-Krezel L, Schier AF, Neuhauss SC, Malicki J, Stemple DL, Stainier DY, Zwartkruis F, Abdelilah S, Rangini Z, Belak J, Boggs C (1996) A genetic screen for mutations affecting embryogenesis in zebrafish. Development (Cambridge, England) 123:37–46. PMID: 9007227 Eaton RC, Lavender WA, Wieland CM (1981) Identification of Mauthner-initiated response patterns in goldfish: evidence from simultaneous cinematography and electrophysiology. J Comp Physiol 144(4):521–531. https://doi.org/10.1007/BF01326837 Echteler SM (1984) Connections of the auditory midbrain in a teleost fish,Cyprinus carpio. J Comp Neurol 230(4):536–551. https://doi.org/10.1002/cne.902300405 Fagernes CE, Stensløkken K-O, Røhr ÅK, Berenbrink M, Ellefsen S, Nilsson GE (2017) Extreme anoxia tolerance in crucian carp and goldfish through neofunctionalization of duplicated genes creating a new ethanol-producing pyruvate decarboxylase pathway. Sci Rep 7(1):7884. https:// doi.org/10.1038/s41598-017-07385-4 Flagel LE, Wendel JF (2010) Evolutionary rate variation, genomic dominance and duplicate gene expression evolution during allotetraploid cotton speciation. New Phytol 186(1):184–193. https://doi.org/10.1111/j.1469-8137.2009.03107.x Ford T, Beitinger TL (2005) Temperature tolerance in the goldfish, Carassius auratus. J Thermal Biol 30(2):147–152. https://doi.org/10.1016/j.jtherbio.2004.09.004 Friedrich RW, Jacobson GA, Zhu P (2010) Circuit neuroscience in zebrafish. Curr Biol 20(8): R371–R381. https://doi.org/10.1016/j.cub.2010.02.039 Fujita I (1987) Electrophysiology of the terminal nerve in cyprinids. Ann N Y Acad Sci 519:69–79. https://doi.org/10.1111/j.1749-6632.1987.tb36287.x Gestrin P, Sterling P (1977) Anatomy and physiology of goldfish oculomotor system. II. Firing patterns of neurons in abducens nucleus and surrounding medulla and their relation to eye movements. J Neurophysiol 40(3):573–588 Gilbert SF, Epel D (2009) Ecological developmental biology. Sinauer Associates, Sunderland Golling G, Amsterdam A, Sun Z, Antonelli M, Maldonado E, Chen W, Burgess S, Haldi M, Artzt K, Farrington S, Lin S-Y, Nissen RM, Hopkins N (2002) Insertional mutagenesis in zebrafish rapidly identifies genes essential for early vertebrate development. Nat Genet 31 (2):135–140. https://doi.org/10.1038/ng896 Greenwood PH (1966) Phyletic studies of teleostean fishes, with a provisional classification of living forms. Bull Am Mus Nat Hist 131:341–455 Gregory TR (2021) Animal genome size database. http://www.genomesize.com Griffiths AJF, Wessler SR, Carroll SB, Doebley J (2012) Introduction to genetic analysis, 10th edn. W.H. Freeman, New York Haffter P, Granato M, Brand M, Mullins MC, Hammerschmidt M, Kane DA, Odenthal J, van Eeden FJ, Jiang YJ, Heisenberg CP, Kelsh RN, Furutani-Seiki M, Vogelsang E, Beuchle D, Schach U, Fabian C, Nüsslein-Volhard C (1996) The identification of genes with unique and essential functions in the development of the zebrafish, Danio rerio. Development (Cambridge, England) 123:1–36. PMID: 9007226 Halas D, Lovejoy N, Mandrak NE (2018) Undetected diversity of goldfish (Carassius spp.) in North America. Aquat Invasions 13(2):211–219. https://doi.org/10.3391/ai.2018.13.2.03

38

2 Goldfish as an Experimental Model

Hamburger V, Hamilton HL (1992) A series of normal stages in the development of the chick embryo. Dev Dyn 195(4):231–272 Hanfling B, Bolton P, Harley M, Carvalho GR (2005) A molecular approach to detect hybridisation between crucian carp (Carassius carassius) and non-indigenous carp species (Carassius spp. and Cyprinus carpio). Freshwater Biol 50(3):403–417. https://doi.org/10.1111/j.1365-2427. 2004.01330.x Harper AA, Watt PW, Hancock NA, Macdonald AG (1990) Temperature acclimation effects on carp nerve: a comparison of nerve conduction, membrane fluidity and lipid composition. J Exp Biol 154(1):305–320 Haynes GD, Gongora J, Gilligan DM, Grewe P, Moran C, Nicholas FW (2012) Cryptic hybridization and introgression between invasive Cyprinid species Cyprinus carpio and Carassius auratus in Australia: implications for invasive species management. Anim Conserv 15 (1):83–94. https://doi.org/10.1111/j.1469-1795.2011.00490.x Hervey GF, Hems J (1948) The goldfish. Batchworth Press, London Hruscha A, Krawitz P, Rechenberg A, Heinrich V, Hecht J, Haass C, Schmid B (2013) Efficient CRISPR/Cas9 genome editing with low off-target effects in zebrafish. Development 140 (24):4982–4987. https://doi.org/10.1242/dev.099085 Hwang WY, Fu Y, Reyon D, Maeder ML, Tsai SQ, Sander JD, Peterson RT, Yeh JJ, Joung JK (2013) Efficient genome editing in zebrafish using a CRISPR-Cas system. Nat Biotechnol 31 (3):227–229. https://doi.org/10.1038/nbt.2501 Inomata H, Haraguchi T, Sasai Y (2008) Robust stability of the embryonic axial pattern requires a secreted scaffold for chordin degradation. Cell 134(5):854–865. https://doi.org/10.1016/j.cell. 2008.07.008 Janvier P (1996) Early vertebrates, vol QE851 J36. Oxford University Press, Oxford Jao L-E, Wente SR, Chen W (2013) Efficient multiplex biallelic zebrafish genome editing using a CRISPR nuclease system. Proc Natl Acad Sci 110(34):13904–13909. https://doi.org/10.1073/ pnas.1308335110 Johnson GD, Patterson C (1996) Relationships of lower euteleostean fishes. In: Stiasney MLJ, Parenti LR, Johnson GD (eds) Interrelationships of fishes. Academic Press, London, pp 251–332 Kalous L, Bohlen J, Rylková K, Petrtỳl M (2012) Hidden diversity within the Prussian carp and designation of a neotype for Carassius gibelio (Teleostei: Cyprinidae). Ichthyolog Explor Freshw 23(1):11 Kanungo MS, Prosser CL (1959) Physiological and biochemical adaptation of goldfish to cold and warm temperatures. I. Standard and active oxygen consumptions of cold- and warm-acclimated goldfish at various temperatures. J Cell Comp Physiol 54(3):259–263. https://doi.org/10.1002/ jcp.1030540308 Kardong KV (2012) Vertebrates: comparative anatomy, function, evolution, 6th edn. McGraw-Hill Higher Education, Boston, MA Kasahara M, Naruse K, Sasaki S, Nakatani Y, Qu W, Ahsan B, Yamada T, Nagayasu Y, Doi K, Kasai Y, Jindo T, Kobayashi D, Shimada A, Toyoda A, Kuroki Y, Fujiyama A, Sasaki T, Shimizu A, Asakawa S, Shimizu N, Hashimoto S-I, Yang J, Lee Y, Matsushima K, Sugano S, Sakaizumi M, Narita T, Ohishi K, Haga S, Ohta F, Nomoto H, Nogata K, Morishita T, Endo T, Shin-I T, Takeda H, Morishita S, Kohara Y (2007) The medaka draft genome and insights into vertebrate genome evolution. Nature 447(7145):714–719. https://doi.org/10.1038/nature05846 Kimmel CB, Ballard WW, Kimmel SR, Ullmann B, Schilling TF (1995) Stages of embryonic development of the zebrafish. Dev Dyn 203(3):253–310. https://doi.org/10.1002/aja. 1002030302 Kimura Y, Satou C, Fujioka S, Shoji W, Umeda K, Ishizuka T, Yawo H, Higashijima S-I (2013) Hindbrain V2a neurons in the excitation of spinal locomotor circuits during zebrafish swimming. Curr Biol 23(10):843–849. https://doi.org/10.1016/j.cub.2013.03.066 Kobayashi H (1970) Comparative chromosome studies in the genus Carassius, especially with a finding of polyploidy in the Ginbuna (C. auratus langsdorfii). Jpn J Ichthyol 17:153–160

References

39

Kobayasi H, Ochi H, Takeuchi N (1973) Chromosome studies in the genus Carassius: comparison of C. auratus grandoculis, C. auratus buergeri, and C. auratus langsdorfii. Jpn J Ichthyol 20:7– 12. https://doi.org/10.11369/jji1950.20.7. [in Japanese] Komiyama T, Kobayashi H, Tateno Y, Inoko H, Gojobori T, Ikeo K (2009) An evolutionary origin and selection process of goldfish. Gene 430(1–2):5–11. https://doi.org/10.1016/j.gene.2008.10. 019 Kon T, Omori Y, Fukuta K, Wada H, Watanabe M, Chen Z, Iwasaki M, Mishina T, Shin-ichiro SM, Yoshihara D (2020) The genetic basis of morphological diversity in domesticated goldfish. Curr Biol 30:1–15. https://doi.org/10.1016/j.cub.2020.04.034 Kuratani S (2004) Evolutionary morphology (動物進化形態学), 1st edn. University of Tokyo Press, Tokyo. [in Japanese] Kyle AL, Peter RE (1982) Effects of forebrain lesions on spawning behaviour in the male goldfish. Physiol Behav 28(6):1103–1109. https://doi.org/10.1016/0031-9384(82)90183-4 Levine RL, Dethier S (1985) The connections between the olfactory bulb and the brain in the goldfish. J Comp Neurol 237(4):427–444. https://doi.org/10.1002/cne.902370402 Li IJ, Chang CJ, Liu SC, Abe G, Ota KG (2015) Postembryonic staging of wild-type goldfish, with brief reference to skeletal systems. Dev Dyn. https://doi.org/10.1002/dvdy.24340 Li IJ, Lee SH, Abe G, Ota KG (2019) Embryonic and postembryonic development of the ornamental twin-tail goldfish. Dev Dyn 248(4):251–283. https://doi.org/10.1002/dvdy.15 Liem KF, Bemis WE, Walker WF, Kabce G (2001) Functional anatomy of the vertebrates: an evolutionary perspective. 3rd revised ed. Brooks Cole, Pacific Grove Lindblad-Toh K, Wade CM, Mikkelsen TS, Karlsson EK, Jaffe DB, Kamal M, Clamp M, Chang JL, Kulbokas EJ, Zody MC, Mauceli E, Xie X, Breen M, Wayne RK, Ostrander EA, Ponting CP, Galibert F, Smith DR, DeJong PJ, Kirkness E, Alvarez P, Biagi T, Brockman W, Butler J, Chin C-W, Cook A, Cuff J, Daly MJ, DeCaprio D, Gnerre S, Grabherr M, Kellis M, Kleber M, Bardeleben C, Goodstadt L, Heger A, Hitte C, Kim L, Koepfli K-P, Parker HG, Pollinger JP, Searle SMJ, Sutter NB, Thomas R, Webber C, Baldwin J, Abebe A, Abouelleil A, Aftuck L, Ait-Zahra M, Aldredge T, Allen N, An P, Anderson S, Antoine C, Arachchi H, Aslam A, Ayotte L, Bachantsang P, Barry A, Bayul T, Benamara M, Berlin A, Bessette D, Blitshteyn B, Bloom T, Blye J, Boguslavskiy L, Bonnet C, Boukhgalter B, Brown A, Cahill P, Calixte N, Camarata J, Cheshatsang Y, Chu J, Citroen M, Collymore A, Cooke P, Dawoe T, Daza R, Decktor K, DeGray S, Dhargay N, Dooley K, Dooley K, Dorje P, Dorjee K, Dorris L, Duffey N, Dupes A, Egbiremolen O, Elong R, Falk J, Farina A, Faro S, Ferguson D, Ferreira P, Fisher S, FitzGerald M, Foley K, Foley C, Franke A, Friedrich D, Gage D, Garber M, Gearin G, Giannoukos G, Goode T, Goyette A, Graham J, Grandbois E, Gyaltsen K, Hafez N, Hagopian D, Hagos B, Hall J, Healy C, Hegarty R, Honan T, Horn A, Houde N, Hughes L, Hunnicutt L, Husby M, Jester B, Jones C, Kamat A, Kanga B, Kells C, Khazanovich D, Kieu AC, Kisner P, Kumar M, Lance K, Landers T, Lara M, Lee W, Leger J-P, Lennon N, Leuper L, LeVine S, Liu J, Liu X, Lokyitsang Y, Lokyitsang T, Lui A, Macdonald J, Major J, Marabella R, Maru K, Matthews C, McDonough S, Mehta T, Meldrim J, Melnikov A, Meneus L, Mihalev A, Mihova T, Miller K, Mittelman R, Mlenga V, Mulrain L, Munson G, Navidi A, Naylor J, Nguyen T, Nguyen N, Nguyen C, Nguyen T, Nicol R, Norbu N, Norbu C, Novod N, Nyima T, Olandt P, O’Neill B, O’Neill K, Osman S, Oyono L, Patti C, Perrin D, Phunkhang P, Pierre F, Priest M, Rachupka A, Raghuraman S, Rameau R, Ray V, Raymond C, Rege F, Rise C, Rogers J, Rogov P, Sahalie J, Settipalli S, Sharpe T, Shea T, Sheehan M, Sherpa N, Shi J, Shih D, Sloan J, Smith C, Sparrow T, Stalker J, Stange-Thomann N, Stavropoulos S, Stone C, Stone S, Sykes S, Tchuinga P, Tenzing P, Tesfaye S, Thoulutsang D, Thoulutsang Y, Topham K, Topping I, Tsamla T, Vassiliev H, Venkataraman V, Vo A, Wangchuk T, Wangdi T, Weiand M, Wilkinson J, Wilson A, Yadav S, Yang S, Yang X, Young G, Yu Q, Zainoun J, Zembek L, Zimmer A, Lander ES (2005) Genome sequence, comparative analysis and haplotype structure of the domestic dog. Nature 438(7069):803–819. https://doi.org/10. 1038/nature04338

40

2 Goldfish as an Experimental Model

Lisser DFJ, Lister ZM, Pham-Ho PQH, Scott GR, Wilkie MP (2017) Relationship between oxidative stress and brain swelling in goldfish (Carassius auratus) exposed to high environmental ammonia. Am J Physiol Regul Integr Comp Physiol 312(1):R114–R124. https://doi.org/ 10.1152/ajpregu.00208.2016 Liu S (2010) Distant hybridization leads to different ploidy fishes. Sci China Life Sci 53 (4):416–425. https://doi.org/10.1007/s11427-010-0057-9 Liu SJ, Luo J, Chai J, Ren L, Zhou Y, Huang F, Liu XC, Chen YB, Zhang C, Tao M, Lu B, Zhou W, Lin GL, Mai C, Yuan S, Wang J, Li T, Qin QB, Feng H, Luo KK, Xiao J, Zhong H, Zhao RR, Duan W, Song ZY, Wang YQ, Wang J, Zhong L, Wang L, Ding ZL, Du ZL, Lu XM, Gao Y, Murphy RW, Liu Y, Meyer A, Zhang YP (2016) Genomic incompatibilities in the diploid and tetraploid offspring of the goldfish x common carp cross. Proc Natl Acad Sci U S A 113 (5):1327–1332. https://doi.org/10.1073/pnas.1512955113 Luiten PGM (1981) Afferent and efferent connections of the optic tectum in the carp (Cyprinus carpio L.). Brain Res 220(1):51–65. https://doi.org/10.1016/0006-8993(81)90210-9 Luiten PGM, van der Pers JNC (1977) The connections of the trigeminal and facial motor nuclei in the brain of the carp (cyprinus carpio L.) as revealed by anterograde and retrograde transport of horseradish peroxidase. J Comp Neurol 174(4):575–590. https://doi.org/10.1002/cne. 901740403 Luo J, Stadler PF, He S, Meyer A (2007) PCR survey of hox genes in the goldfish Carassius auratus auratus. J Exp Zool B Mol Dev Evol 308B(3):250–258. https://doi.org/10.1002/jez.b. 21144 Lushchak VI, Lushchak LP, Mota AA, Hermes-Lima M (2001) Oxidative stress and antioxidant defenses in goldfish Carassius auratus during anoxia and reoxygenation. Am J Physiol Regul Integr Comp Physiol 280(1):R100–R107. https://doi.org/10.1152/ajpregu.2001.280.1.R100 Makino S (1939) The chromosomes of the carp, Cyprinus carpio, including those of some related species of Cyprinidae for comparison. Cytologia 9(4):430–440. https://doi.org/10.1508/ cytologia.9.430 Martyniuk CJ, Crawford AB, Hogan NS, Trudeau VL (2005) GABAergic modulation of the expression of genes involved in GABA synaptic transmission and stress in the hypothalamus and telencephalon of the female goldfish (Carassius auratus). J Neuroendocrinol 17 (5):269–275. https://doi.org/10.1111/j.1365-2826.2005.01311.x Masai H, Takatsuji K, Sato Y (1982) Morphological variability of the brains under domestication from the crucian carp to the goldfish. J Zool Syst Evol Res 20(2):112–118. https://doi.org/10. 1111/j.1439-0469.1983.tb00256.x Matsui Y (1934) Genetical studies on gold-fish of Japan. Imper Fish Inst XXX(1):1–96 Matsui Y (1935) Kagaku to shumikara mita Kingyo no kenkyuu (科学と趣味から見た金魚の研 究). Seizando-Shoten Publishing Co, Ltd, Tokyo, vol 90(12). https://ci.nii.ac.jp/ncid/ BA79565196 [in Japanese] Meek J (1983) Functional anatomy of the tectum mesencephali of the goldfish. An explorative analysis of the functional implications of the laminar structural organization of the tectum. Brain Res Rev 6(3):247–297 Miyasaka N, Morimoto K, Tsubokawa T, Higashijima S-I, Okamoto H, Yoshihara Y (2009) From the olfactory bulb to higher brain centers: genetic visualization of secondary olfactory pathways in zebrafish. J Neurosci 29(15):4756–4767. https://doi.org/10.1523/JNEUROSCI.0118-09. 2009 Mizuno T, Yamaha E, Yamazaki F (1997) Localized axis determinant in the early cleavage embryo of the goldfish, Carassius auratus. Dev Genes Evol 206(6):389–396. https://doi.org/10.1007/ s004270050068 Morgan DL, Beatty SJ (2007) Feral goldfish (Carassius auratus) in western Australia: a case study from the Vasse River. J R Soc Western Australia 90(3):151–156 Mullins MC, Hammerschmidt M, Haffter P, Nusslein-Volhard C (1994) Large-scale mutagenesis in the zebrafish: in search of genes controlling development in a vertebrate. Curr Biol 4 (3):189–202. https://doi.org/10.1016/S0960-9822(00)00048-8

References

41

Murakami M, Matsuba C, Fujitani H (2001) The maternal origins of the triploid ginbuna (Carassius auratus langsdorfi): phylogenetic relationships within the C. auratus taxa by partial mitochondrial D-loop sequencing. Genes Genet Syst 76(1):25–32. https://doi.org/10.1266/ggs.76.25 Nagayoshi S, Hayashi E, Abe G, Osato N, Asakawa K, Urasaki A, Horikawa K, Ikeo K, Takeda H, Kawakami K (2008) Insertional mutagenesis by the Tol2 transposon-mediated enhancer trap approach generated mutations in two developmental genes: tcf7 and synembryn-like. Development (Cambridge, England) 135(1):159–169. https://doi.org/10.1242/dev.009050 Negishi K, Kato S, Teranishi T, Laufer M (1978) An electrophysiological study on the cholinergic system in the carp retina. Brain Res 148(1):85–93. https://doi.org/10.1016/0006-8993(78) 90379-7 Nelson JS, Grande TC, Wilson MV (2016) Fishes of the World. Wiley, Hoboken, NJ Nieuwkoop PD, Faber J (1994) Normal table of Xenopus laevis (Daudin): a systematical and chronological survey of the development from the fertilized egg till the end of metamorphosis. Garland Publishing, New York Northcutt RG (2008) Forebrain evolution in bony fishes. Brain Res Bull 75(2–4):191–205. https:// doi.org/10.1016/j.brainresbull.2007.10.058 Ojima Y (1983) Fish cytogenetics (魚類細胞遺伝学). Suikoushya, Tokyo Ojima Y, Takai A (1979) Further cytogenetical studies on the origin of the gold-fish. Proc Jpn Acad Ser B 55(7):346–350. https://doi.org/10.2183/pjab.55.346 Ojima Y, Ueda T, Narikawa T (1979) A cytogenetic assessment on the origin of the gold-fish. Proc Jpn Acad Ser B 55(2):58–63. https://doi.org/10.2183/pjab.55.58 Okamoto H, Agetsuma M, Aizawa H (2012) Genetic dissection of the zebrafish habenula, a possible switching board for selection of behavioral strategy to cope with fear and anxiety. Dev Neurobiol 72(3):386–394. https://doi.org/10.1002/dneu.20913 Okuyama Y, Tanabe AS, Kato M (2012) Entangling ancient allotetraploidization in Asian mitella: an integrated approach for multilocus combinations. Mol Biol Evol 29(1):429–439. https://doi. org/10.1093/molbev/msr236 Ota KG, Abe G (2016) Goldfish morphology as a model for evolutionary developmental biology. Wiley Interdiscip Rev Dev Biol 5(3):272–295. https://doi.org/10.1002/wdev.224 Otani S, Maegawa S, Inoue K, Arai K, Yamaha E (2002) The germ cell lineage identified by vas-mRNA during the embryogenesis in goldfish. Zool Sci 19(5):519–526. https://doi.org/10. 2108/zsj.19.519 Parichy DM (2015) The natural history of model organisms: advancing biology through a deeper understanding of zebrafish ecology and evolution. Elife e05635:4. https://doi.org/10.7554/ eLife.05635 Parichy DM, Elizondo MR, Mills MG, Gordon TN, Engeszer RE (2009) Normal table of postembryonic zebrafish development: staging by externally visible anatomy of the living fish. Dev Dyn 238(12):2975–3015. https://doi.org/10.1002/dvdy.22113 Pastor AM, Calvo PM, de la Cruz RR, Baker R, Straka H (2019) Discharge properties of morphologically identified vestibular neurons recorded during horizontal eye movements in the goldfish. J Neurophysiol 121(5):1865–1878. https://doi.org/10.1152/jn.00772.2018 Podlesnykh AV, Apalikova OV, Brykov VA (2012) Phylogenetic relationships of silver crucian carp in Carassius auratus complex based on mtDNA analysis. Russ J Genet 48(12):1207–1217. https://doi.org/10.1134/S1022795412120113 Podlesnykh AV, Brykov VA, Skurikhina LA (2015) Polyphyletic origin of ornamental goldfish. Food Nutr Sci 6(11):9. https://doi.org/10.4236/fns.2015.611104 Portugues R, Severi KE, Wyart C, Ahrens MB (2013) Optogenetics in a transparent animal: circuit function in the larval zebrafish. Curr Opin Neurobiol 23(1):119–126. https://doi.org/10.1016/j. conb.2012.11.001 Powers EB (1918) The goldfish (Carassius carassius) as a test animal in the study of toxicity. Auspices of the Graduate School by The University of Illinois Puzdrowski RL (1988) Afferent projections of the trigeminal nerve in the goldfish, Carassius auratus. J Morphol 198(2):131–147. https://doi.org/10.1002/jmor.1051980202

42

2 Goldfish as an Experimental Model

Qin Q, Wang Y, Wang J, Dai J, Xiao J, Hu F, Luo K, Tao M, Zhang C, Liu Y (2014) The autotetraploid fish derived from hybridization of Carassius auratus red var. (female)  Megalobrama amblycephala (male). Biol Reprod 91(4):93–91 Rahmat S, Gilland E (2019) Hindbrain neurovascular anatomy of adult goldfish (Carassius auratus). J Anat 235(4):783–793. https://doi.org/10.1111/joa.13026 Rylková K, Kalous L, Bohlen J, Lamatsch DK, Petrtỳl M (2013) Phylogeny and biogeographic history of the cyprinid fish genus Carassius (Teleostei: Cyprinidae) with focus on natural and anthropogenic arrivals in Europe. Aquaculture 380:13–20 Saitoh K, Miya M, Inoue JG, Ishiguro NB, Nishida M (2003) Mitochondrial genomics of ostariophysan fishes: perspectives on phylogeny and biogeography. J Mol Evol 56 (4):464–472. https://doi.org/10.1007/s00239-002-2417-y Saitoh K, Sado T, Mayden RL, Hanzawa N, Nakamura K, Nishida M, Miya M (2006) Mitogenomic evolution and interrelationships of the cypriniformes (Actinopterygii: Ostariophysi): the first evidence toward resolution of higher-level relationships of the world’s largest freshwater fish clade based on 59 whole mitogenome sequences. J Mol Evol 63(6):826–841. https://doi.org/10. 1007/s00239-005-0293-y Schmidt JT, Cicerone CM, Easter SS (1978) Expansion of the half retinal projection to the tectum in goldfish: an electrophysiological and anatomical study. J Comp Neurol 177(2):257–277 Session AM, Uno Y, Kwon T, Chapman JA, Toyoda A, Takahashi S, Fukui A, Hikosaka A, Suzuki A, Kondo M, van Heeringen SJ, Quigley I, Heinz S, Ogino H, Ochi H, Hellsten U, Lyons JB, Simakov O, Putnam N, Stites J, Kuroki Y, Tanaka T, Michiue T, Watanabe M, Bogdanovic O, Lister R, Georgiou G, Paranjpe SS, van Kruijsbergen I, Shu S, Carlson J, Kinoshita T, Ohta Y, Mawaribuchi S, Jenkins J, Grimwood J, Schmutz J, Mitros T, Mozaffari SV, Suzuki Y, Haramoto Y, Yamamoto TS, Takagi C, Heald R, Miller K, Haudenschild C, Kitzman J, Nakayama T, Izutsu Y, Robert J, Fortriede J, Burns K, Lotay V, Karimi K, Yasuoka Y, Dichmann DS, Flajnik MF, Houston DW, Shendure J, DuPasquier L, Vize PD, Zorn AM, Ito M, Marcotte EM, Wallingford JB, Ito Y, Asashima M, Ueno N, Matsuda Y, Veenstra GJC, Fujiyama A, Harland RM, Taira M, Rokhsar DS (2016) Genome evolution in the allotetraploid frog Xenopus laevis. Nature 538(7625):336–343. https://doi.org/10.1038/ nature19840 Shapiro MD, Kronenberg Z, Li C, Domyan ET, Pan H, Campbell M, Tan H, Huff CD, Hu H, Vickrey AI (2013) Genomic diversity and evolution of the head crest in the rock pigeon. Science 339(6123):1063–1067 Sivasubbu S, Balciunas D, Davidson AE, Ma P, Hermanson SB, Wangensteen KJ, Wolbrink DC, Ekker SC (2006) Gene-breaking transposon mutagenesis reveals an essential role for histone H2afza in zebrafish larval development. Mech Dev 123(7):513–529. https://doi.org/10.1016/j. mod.2006.06.002 Smartt J (2001) Goldfish varieties and genetics: a handbook for breeders. Blackwell Science, Oxford Somamoto T, Yoshiura Y, Nakanishi T, Ototake M (2005) Molecular cloning and characterization of two types of CD8α from ginbuna crucian carp, Carassius auratus langsdorfii. Dev Comp Immunol 29(8):693–702 Somamoto T, Okamoto N, Nakanishi T, Ototake M, Nakao M (2009) In vitro generation of viralantigen dependent cytotoxic T-cells from ginbuna crucian carp, Carassius auratus langsdorfii. Virology 389(1–2):26–33 Somamoto T, Kondo M, Nakanishi T, Nakao M (2014) Helper function of CD4+ lymphocytes in antiviral immunity in ginbuna crucian carp, Carassius auratus langsdorfii. Dev Comp Immunol 44(1):111–115 Stringham SA, Mulroy EE, Xing J, Record D, Guernsey MW, Aldenhoven JT, Osborne EJ, Shapiro MD (2012) Divergence, convergence, and the ancestry of feral populations in the domestic rock pigeon. Curr Biol 22(4):302–308

References

43

Sun Y, Yin Y, Zhang J, Yu H, Wang X (2007) Bioaccumulation and ROS generation in liver of freshwater fish, goldfish Carassius auratus under HC Orange No. 1 exposure. Environ Toxicol 22(3):256–263. https://doi.org/10.1002/tox.20262 Takada M, Tachihara K, Kon T, Yamamoto G, Iguchi K, Miya M, Nishida M (2010) Biogeography and evolution of the Carassius auratus-complex in East Asia. BMC Evol Biol 10:7. https://doi. org/10.1186/1471-2148-10-7 Takeda A, Shuto M, Funakoshi K (2018) Chondroitin sulfate expression in perineuronal nets after goldfish spinal cord lesion. Front Cell Neurosci 12:63 Tanaka M, Yamaha E, Arai K (2004) Survival capacity of haploid-diploid goldfish chimeras. J Exp Zool Part A Comp Exp Biol 301(6):491–501. https://doi.org/10.1002/jez.a.48 Tomizawa T, Kijima T, Futami K, Takahashi K, Okamoto N (2015) Mitochonroria DNA oyobi kaku DNA no kaisekiniyoru Uonuma Tetsugyo no kigen (ミトコンドリアDNA および核 DNA の解析による魚取沼テツギョの起源). Ichiolog Res 62(1):51–57. https://doi.org/10. 11369/jji.62.51 Torres B, Pastor AM, Cabrera B, Salas C, Delgado-García JM (1992) Afferents to the oculomotor nucleus in the goldfish (Carassius auratus) as revealed by retrograde labeling with horseradish peroxidase. J Comp Neurol 324(3):449–461. https://doi.org/10.1002/cne.903240311 Tsai H-Y, Chang M, Liu S-C, Abe G, Ota KG (2013) Embryonic development of goldfish (Carassius auratus): a model for the study of evolutionary change in developmental mechanisms by artificial selection. Dev Dyn 242(11):1262–1283. https://doi.org/10.1002/dvdy.24022 Tsukuda H, Bunshin L, Ken-Ichi F (1985) Pulsation rate and oxygen consumption of isolated hearts of the goldfish, Carassius auratus, acclimated to different temperatures. Comp Biochem Physiol A Physiol 82(2):281–283 Uno Y, Nishida C, Takagi C, Ueno N, Matsuda Y (2013) Homoeologous chromosomes of Xenopus laevis are highly conserved after whole-genome duplication. Heredity 111(5):430–436. https:// doi.org/10.1038/hdy.2013.65 Vinepinsky E, Donchin O, Segev R (2017) Wireless electrophysiology of the brain of freely swimming goldfish. J Neurosci Methods 278:76–86. https://doi.org/10.1016/j.jneumeth.2017. 01.001 Vinepinsky E, Cohen L, Perchik S, Ben-Shahar O, Donchin O, Segev R (2020) Representation of edges, head direction, and swimming kinematics in the brain of freely-navigating fish. Sci Rep 10(1):14762. https://doi.org/10.1038/s41598-020-71,217-1 Von Bartheld CS, Meyer DL, Fiebig E, Ebbesson SOE (1984) Central connections of the olfactory bulb in the goldfish, Carassius auratus. Cell Tissue Res 238(3):475–487 Vonholdt BM, Pollinger JP, Lohmueller KE, Han E, Parker HG, Quignon P, Degenhardt JD, Boyko AR, Earl DA, Auton A, Reynolds A, Bryc K, Brisbin A, Knowles JC, Mosher DS, Spady TC, Elkahloun A, Geffen E, Pilot M, Jedrzejewski W, Greco C, Randi E, Bannasch D, Wilton A, Shearman J, Musiani M, Cargill M, Jones PG, Qian Z, Huang W, Ding Z-L, Zhang Y-P, Bustamante CD, Ostrander EA, Novembre J, Wayne RK (2010) Genome-wide SNP and haplotype analyses reveal a rich history underlying dog domestication. Nature 464 (7290):898–902. https://doi.org/10.1038/nature08837 Wang S-H, Huang P-P, Li X-Y, Wang C-Y, Zhang W-H, Wang J-J (2009) Embryonic and developmental toxicity of the ionic liquid 1-methyl-3-octylimidazolium bromide on goldfish. Environ Toxicol 25(3):243–250. https://doi.org/10.1002/tox.20496 Warner JL, Gomelsky B, Delomas TA, Kramer AG, Novelo ND (2018) Reproductive ability of second generation ornamental (koi) carp (Cyprinus carpio L.)  goldfish (Carassius auratus L.) hybrids and characteristics of their offspring. Aquacult Res 49(6):2317–2321. https://doi.org/10. 1111/are.13694 Wayne RK, Ostrander EA (2007) Lessons learned from the dog genome. Trends Genet 23 (11):557–567. https://doi.org/10.1016/j.tig.2007.08.013 Weyl OLF, Ellender BR, Wassermann RJ, Truter M, Dalu T, Zengeya TA, Smit NJ (2020) Alien freshwater fauna in South Africa. In: van Wilgen BW, Measey J, Richardson DM, Wilson JR,

44

2 Goldfish as an Experimental Model

Zengeya TA (eds) Biological invasions in South Africa. Springer International Publishing, Cham, pp 153–183. https://doi.org/10.1007/978-3-030-32,394-3_6 Wienholds E, van Eeden F, Kosters M, Mudde J, Plasterk RHA, Cuppen E (2003) Efficient targetselected mutagenesis in zebrafish. Genome Res 13(12):2700–2707. https://doi.org/10.1101/gr. 1725103 Wittbrodt J, Shima A, Schartl M (2002) Medaka—a model organism from the far East. Nat Rev Genet 3(1):53–64. https://doi.org/10.1038/nrg704 Xu P, Zhang X, Wang X, Li J, Liu G, Kuang Y, Xu J, Zheng X, Ren L, Wang G, Zhang Y, Huo L, Zhao Z, Cao D, Lu C, Li C, Zhou Y, Liu Z, Fan Z, Shan G, Li X, Wu S, Song L, Hou G, Jiang Y, Jeney Z, Yu D, Wang L, Shao C, Song L, Sun J, Ji P, Wang J, Li Q, Xu L, Sun F, Feng J, Wang C, Wang S, Wang B, Li Y, Zhu Y, Xue W, Zhao L, Wang J, Gu Y, Lv W, Wu K, Xiao J, Wu J, Zhang Z, Yu J, Sun X (2014) Genome sequence and genetic diversity of the common carp, Cyprinus carpio. Nat Genet 46(11):1212–1219. https://doi.org/10.1038/ng.3098 Yamaha E, Yamazaki F (1993) Electrically fused-egg induction and its development in the goldfish, Carassius auratus. Int J Dev Biol 37(2):291–298 Yamaha E, Mizuno T, Hasebe Y, Takeda H, Yamazaki F (1998) Dorsal specification in blastoderm at the blastula stage in the goldfish, Carassius auratus. Dev Growth Differ 40(3):267–275. https://doi.org/10.1046/j.1440-169X.1998.t01-1-00002.x Yamaha E, Mizuno T, Matsushita K, Hasebe Y (1999) Developmental staging in goldfish during the pre-gastrula stage. Nippon Suisan Gakkaishi 65(4):709–717. https://doi.org/10.2331/suisan. 65.709 Yamaha E, Kazama-Wakabayashi M, Otani S, Fujimoto T, Arai K (2001) Germ-line chimera by lower-part blastoderm transplantation between diploid goldfish and triploid crucian carp. Genetica 111(1–3):227–236. https://doi.org/10.1023/A:1013780423986 Yamaha E, Murakami M, Hada K, Otani S, Fujimoto T, Tanaka M, Sakao S, Kimura S, Sato S, Arai K (2003) Recovery of fertility in male hybrids of a cross between goldfish and common carp by transplantation of PGC (primordial germ cell)-containing graft. Genetica 119(2):121–131. https://doi.org/10.1023/A:1026061828744 Zottoli SJ, Van Horne C (1983) Posterior lateral line afferent and efferent pathways within the central nervous system of the goldfish with special reference to the Mauthner cell. J Comp Neurol 219(1):100–111. https://doi.org/10.1002/cne.902190110

Chapter 3

Varieties of Goldfish Morphology

Abstract Various different types of goldfish strains have been established by breeders and fanciers. Although these phenotypically different goldfish strains were previously grouped into different categories by researchers, there is no consensus among the manner of categorization for ornamental goldfish strains. Moreover, there is no standard nomenclature system for ornamental goldfish strains, leading to confusion about how to use variations of ornamental goldfish strains as research models. To avoid confusion arising from uncertain categorization and nomenclature systems, I first define the standard wild-type goldfish and provide detailed descriptions about its phenotypic features, in accordance with textbooks of vertebrate anatomy that examine mutated morphological features. Moreover, based on the skeletal anatomical characteristics, I categorize currently known goldfish strains into three representative morphotypes: single-tail, twin-tail, and dorsalfinless. Furthermore, comprehensive methods to describe all varieties of ornamental goldfish strains and their polymorphic features are provided by applying a character matrix-based method.

This chapter introduces phenotypic variations of several representative ornamental goldfish strains, especially focusing on the morphological features of adults. Morphological variations of ornamental goldfish were selected and genetically fixed in the domesticated ornamental goldfish populations by breeders. Even though their ornamental phenotypes do not increase fitness under any natural conditions, various ornamental domesticated goldfish strains have been spread all over the world by the anthropogenic activities (see Chap. 1). Presumably due to this worldwide distribution, the unnatural morphologies of ornamental goldfish became a subject for evolutionary studies. Goldfish morphology especially intrigued early influential researchers, such as Darwin (1868) and Bateson (1894). In fact, the descriptions of ornamental goldfish in The Variation by Animals and Plants Under Domestication by Darwin (1868) inform us of the impression they made on his thinking; Many of the varieties, however, such as triple tail-fins, &c., ought to be called monstrosities; but it is difficult to draw any distinct line between a variation and a monstrosity. Indeed, several ornamental goldfish strains seem to

© The Author(s), under exclusive license to Springer Nature Singapore Pte Ltd. 2021 K. G. Ota, Goldfish Development and Evolution, https://doi.org/10.1007/978-981-16-0850-6_3

45

46

3 Varieties of Goldfish Morphology

have deviated substantially from conventional teleost species in terms of morphology. However, it should be noted that the morphological variations might not arise arbitrarily or randomly, given that morphological features are generated by commonly conserved developmental mechanisms. Although the detailed developmental process of ornamental goldfish will be examined in further chapters (Chaps. 4 and 5), morphological variations of ornamental goldfish will be more carefully examined from the view-point of anatomy and genetics in the first four sections of this chapter (Sects. 3.1, 3.2, 3.3, and 3.4). Subsequently, the comprehensive methods for categorization and descriptions of morphological variations of ornamental goldfish for evodevo studies will be considered in the fifth to seventh sections (Sects. 3.5, 3.6, and 3.7).

3.1

The Single-Tail Common Goldfish as the “Wild-Type” Goldfish

To start, the basic body architecture should be examined in the “wild-type” goldfish. Once the basic body architecture of the wild-type goldfish is clearly understood, the morphological variations of the ornamental domesticated goldfish can be relatively easily thought of as modifications of the wild-type morphology. However, to my knowledge, there are no articles that explicitly define the morphology of wild-type goldfish. Thus, this book defines a goldfish having a slender body and single caudal fin without any mutations in dorsal, anal, and caudal fins or other external tissues as the “single-tail common goldfish,” and the morphology of the single-tail common goldfish is considered to be the wild-type phenotype, unless otherwise noted (Figs. 3.1 and 3.2). At this point, it is worthwhile to make a note about the single-tail common goldfish nomenclature, since it is uncommon among researchers. Although the definition of the single-tail common goldfish is the same as that of “Common Goldfish” in Smartt (2001), the term single-tail common goldfish will be used in this text to minimize further confusion that may arise due to the inconsistent descriptions and usages of Common Goldfish between Smartt (2001) and Matsui (1934). Smartt (2001) introduced several early works wherein the term Common Goldfish is used, and he also gave his own definition of the Common Goldfish as one with a single tail and slender body. On the other hand, Matsui (1934) introduced the strains, “Hibuna” and “Wakin”; the former and latter were translated as Western Common Goldfish and Japanese Common Goldfish, respectively, by Smartt (2001). However, the latter is further subcategorized into Yotsuo-wo (four-lobed), Mitsu-wo (three-lobed), Sakura-wo (intermediate caudal fin morphology, between Yotsuo-wo and Mitsu-wo), and Funa-wo (single-tail, or more precisely, the “tail-like wild crucian carp” in Japanese). Thus, the caudal fin morphology of Common Goldfish is not consistently defined in the nomenclatures used by all authors. Other similar

3.1 The Single-Tail Common Goldfish as the “Wild-Type” Goldfish

47

Fig. 3.1 Dorsal view of single-tail common goldfish strains. (a) The single-tail common goldfish (single-tail Wakin). (b) The single-tail common goldfish of Taiwan. Scale bars ¼ 1 cm. (Reprinted with permission from Li et al. 2015)

inconsistencies in terminology between Smartt (2001) and the articles cited therein can be easily identified. This confusion might stem from the translation of Wakin, which is often called Common Goldfish, without appending an explicit description of caudal fin morphology. Thus, in order to avoid further confusion from ambiguous morphological descriptions, the name single-tail common goldfish is used in this text. As noted previously, this term clearly indicates the status of the caudal fin morphology, and it is equivalent to the terms Common Goldfish in Smartt (2001) and Funa-wo Wakin in Matsui (1933). Application of the term wild-type for domesticated goldfish would be peculiar for breeders, fanciers, and population genetics or ecology researchers using wild

48

3 Varieties of Goldfish Morphology

Fig. 3.2 Lateral view of the single-tail common goldfish. The male single-tail common goldfish (Japanese single-tail Wakin strain). Scale bar ¼ 1 cm. (Reprinted with permission from Li et al. 2015)

populations of Carassius auratus, because a domesticated strain would be recognized as the wild-type. This terminology would be especially problematic for the researchers who want to make comparisons between the domesticated goldfish and Carassius auratus derived from natural habitats, similar to zebrafish researchers who compare zebrafish from laboratory strains to those derived from natural habitats (Engeszer et al. 2007; Bradford et al. 2011). However, a certain set of criteria is required to distinguish between wild-type and mutants when conducting evodevo studies utilizing comparative morphology, genetics, genomics, and other related approaches. Even though most experimental animals have been maintained under artificial conditions (laboratory conditions), the cultivated animals are typically referred to as wild-type. Given that there are no significant differences between the single-tail common goldfish and the Carassius auratus with basic body architecture found in natural habitats (see Fig. 2.2 in Chap. 2), the above-mentioned criteria might be suitable for comparative analyses between ornamental goldfish. Thus, the single-tail common goldfish is defined as the wild-type, and the other ornamental goldfish strains with different morphologies are mutant strains. Using these definitions, the morphological differences (and similarities) are examined in the following two sections (Sects. 3.2 and 3.3).

3.2

Overview of the Wild-Type Goldfish Morphology

Body parts of the wild-type goldfish are segregated between the cranial and postcranial levels, according to the descriptions of the conventional teleost species in comparative vertebrate anatomy textbooks (Liem et al. 2001; Kardong 2012) (Fig. 3.2). The post-cranial level can be further subdivided into trunk and caudal

3.2 Overview of the Wild-Type Goldfish Morphology

49

Fig. 3.3 Representative characteristics of goldfish sexual maturation. Breeding tubercles on operculum (a) and pectoral fin (b). Ventral views of the male (c, c0 ) and female (d) cloaca regions. Squeezed sperm from a male goldfish (black arrowhead in c, c0 ). A prominent cloaca in a squeezed female (the white arrowhead d). (Reprinted with permission from Li et al. 2015)

levels based on the location of the cloaca (Liem et al. 2001). Two sets of paired fins (pectoral and pelvic fins) and three median fins (dorsal, anal, and caudal fins) are located at the post-cranial level. The pectoral and pelvic fins are located on the lateral and ventrolateral sides of the body, respectively. On the other hand, all of the median fins are located on the sagittal plane (Liem et al. 2001; Kardong 2012). Notably, all of the fins have fin rays (Fig. 3.2). Most regions of cranial level are covered by calcified cranial skeleton and regions of the post-cranial level are covered by scales. In the matured adult, sexual dimorphisms can be recognized by the presence/absence of breeding tubercles and shape of cloaca (Figs. 3.2 and 3.3). Moreover, in the spawning season, the shape and size of the cloaca are evidently different between males and females (Fig. 3.3). From the lateral view of a clear skeletal sample, the calcified cranial skeleton and segmentally arranged axial skeleton can be recognized (Fig. 3.4). At the most anterior part of cranial skeleton, the kinethmoid bone is found, similar to other Cypriniformes species (“ki” in Fig. 3.5) (Fink and Fink 1981; Li et al. 2015). Moreover, the conventional and modified ribs from the first to fourth vertebrae are observed (Fig. 3.6). These first to fourth vertebrae form the Weberian apparatus; tripus and fourth rib are indicated as “tr” and “ri4” in Fig. 3.6. In the photographed individual, there are 30 centrums from the most anterior vertebral element to the most posterior vertebral centrum (the compound centrum attaching to parhypural and hypurals) (Fig. 3.7). At the boundary between cranial and trunk levels, the pectoral fin extends, forming a sophisticated skeletal structure (Figs. 3.5 and 3.6). Pelvic fins are also found at the ventral side of the trunk level (Fig. 3.6). The skeletons of the dorsal and anal fins consist of fin rays and internal skeletal elements, i.e., fin rays attached to radials (Fig. 3.6). The second radial bone is

50

3 Varieties of Goldfish Morphology

Fig. 3.4 Lateral views of the single-tail common goldfish skeleton. The size of the specimen at the completely scaled juvenile (18.6 mm) stage. The same specimen was photographed under bright-field (a) and fluorescent light as a gray scale image (b). Scale bars ¼ 1 mm. (Reprinted with permission from Li et al. 2015)

attached to the thickest fin ray, which is highly calcified and segmented compared with the other fin rays. This fin ray is designated as the segmented fin spine [the “hard ray” in Smartt (2001)]. The relationship between the segmented fin spine of goldfish and true bone spines observed in Acanthopterygii (spiny finned) species is still uncertain (Mabee et al. 2002). Another notable feature of the fin skeleton is that the outline of the caudal fin from the lateral view is dorsoventrally symmetric (homocercal shape), as would be expected for conventional teleost species. The dorsoventrally symmetric caudal fin also has a cleft and diastema which allow one to distinguish the upper and lower fin lobes. The fin rays are attached to the caudal fin skeletons, and since the caudal fin skeleton is attached to the notochord, fin rays can be recognized as a part of the axial skeleton (Fig. 3.7).

3.3

Mutated Morphological Features

Given that the above morphological features of the wild-type goldfish are similarly represented in most relatives of Carassius species (including common carp and zebrafish), one may naturally presume that the morphology of wild-type goldfish represents the ancestral state, and the morphological variations in other strains result from modifications of wild-type morphology by artificial selection (Fig. 3.8; see Fig. 1.3 in Chap. 1). In other words, breeders and fanciers encountered

3.3 Mutated Morphological Features

51

Fig. 3.5 Skeletal anatomy of the juvenile single-tail common goldfish at the cranial level. The specimen is the same as shown in Fig. 3.4. The specimen was photographed under brightfield (a) and fluorecent light as a gray scale image (b). Scale bars ¼ 1 mm. (Reprinted with permission from Li et al. 2015)

morphological mutations in some goldfish individuals, and then, they consciously and/or unconsciously applied strong selective pressures for those morphological mutations. To examine how the wild-type morphology has been modified in each lineage of domesticated ornamental goldfish strains, morphological mutations at the different body parts will be described for several representative ornamental goldfish strains.

52

3 Varieties of Goldfish Morphology

Fig. 3.6 Skeletal anatomy of the single-tail common goldfish at the trunk level. The specimen is the same as shown in Fig. 3.4. Scale bars ¼ 1 mm. The numbers indicate the vertebral number. The panel (b) is the magnified view of the panel (a). The white asterisk in (b) indicates the radial located at the ninth vertebral level. Scale bars ¼ 1mm. (Represented with permission from Li et al. 2015)

Fig. 3.7 Skeletal anatomy of the single-tail common goldfish at the caudal level. The specimen is the same as shown in Fig. 3.4. The specimen was photographed under bright-field (a) and fluorecent light as a gray scale image (b). Scale bars ¼ 1 mm. (Represented with permission from Li et al. 2015)

3.3.1

Nomenclature of Ornamental Goldfish Strains

Due to the absence of a unified nomenclature system for ornamental goldfish among breeders, fanciers, and researchers (Ota and Abe 2016), the common names of ornamental goldfish are highly varied. Thus, the nomenclature for ornamental goldfish strains should be clarified before proceeding to a detailed examination of

3.3 Mutated Morphological Features

53

Fig. 3.8 Varieties of ornamental goldfish. (a, b) Dorsal view of nine different goldfish strains: (a) the single-tail Wakin; (b) the twin-tail Wakin; (c) Ryukin; (d) Oranda; (e) Red-cap Oranda; (f) Telescope (black butterfly); (g) Telescope (red butterfly tail); (h) Pearl scale; (i) Ranchu. Scale bars ¼ 1 cm. (Represented with permission from Abe et al. 2014)

morphological variations, as was done with the definition of wild-type in the above section. Perhaps the main reason why there is no systematic nomenclature and categorization system for goldfish varieties is that all goldfish strains can produce viable progenies, even when the mating fish are morphologically distinct. Consequently, new strains, which cannot be categorized by previous criteria, may be created in abundance. Such newly established strains are almost arbitrarily named by breeders and fanciers, often without detailed consideration of the coloration patterns and external appearance. Of course, there exist certain standards, criteria, and/or consensus among fanciers and breeders to distinguish one established ornamental goldfish strains from others. Otherwise, aquarium fish dealers would face major problems when setting the price of goldfish, and organizers of competitive goldfish exhibitions could not establish classes for competition (Smartt 2001; Teichfischer 1994). However, the common names and commercially derived definitions often used among breeders and fanciers are easily confused when applied in objective comparative analyses, due to the obscured phenotypic descriptions. Therefore, it is necessary that phenotypic

54

3 Varieties of Goldfish Morphology

variations of the domesticated ornamental goldfish are cataloged in an objective manner for evodevo studies, rather than naively applying common names without explicit morphological definitions. Thus, the approaches and terminologies for describing goldfish anatomy apply to all the mutated phenotypes of ornamental goldfish, as introduced for the single-tail common goldfish (Sect. 3.2). However, for the sake of simplicity, a limited number of common names for representative ornamental goldfish strains will be utilized; these names are taken from Smartt (2001) and Matsui (1934); for example, Comet, Shubunkin, Jikin, Fantail, Ryukin, Tosakin, Veiltail, Telescope, Celestial, Bubbleeye, Pompon, Perlscale, Oranda, and Ranch. The provided descriptions for these strains still contain points of confusion, but the detailed descriptions allow for crossliterature comparisons and identification of causes of confusion, as I previously did for the definitions of Common Goldfish and Wakin. It is certain that the breadth of commercially available domesticated ornamental goldfish is not limited to the above-mentioned 14 strains. In fact, several books have cataloged quite large numbers of domesticated ornamental goldfish strains. However, it should be noted once again that the focus of this book is not to provide narrative descriptions of all ornamental goldfish. For readers interested in learning about the wide spectrum of goldfish strains, I recommend books such as Smartt (2001) or Ye and Qu (2017). Rather than describing all ornamental goldfish strains and their morphological varieties, in this book, I aim to discuss how such morphological variations may arise as modifications of the wild-type goldfish. Thus, the phenotypes of different body parts will be introduced in the next sections (Sects. 3.3.2–3.3.9). Therein, the mutated phenotypes are italicized (for example, twin-tail, telescope-eye) in reference to the corresponding mutant strains, as mutated loci are typically represented with italic letters in mutagenesis work for other vertebrate species (for examples, see van Eeden et al. 1996).

3.3.2

Cranial Level

The epidermal tissues at the cranial level show mutated phenotypes in several ornamental goldfish. For example, Oranda, Ranchu, and some other strains are equipped a “hood” or warty growth (epidermal thickening in cranial and opercula regions) (Figs. 3.8, 3.9, and 3.10). Moreover, the epithelial tissue around the nostril is also affected in some strains; these abnormally developed epithelial tissues are called narial bouquets or pon-pons. Other mutations at the cranial level include abnormally enlarged infraorbital vesicles (water bubble eyes), telescope-eye (protuberant eyes), and upwardly directed protuberant eyes (Figs. 3.8, 3.9, and 3.10). Among these mutations, the hood, protuberant eyes, and upwardly directed protuberant eyes involve alterations of cranial skeletal morphology (Koh 1931; Matsui 1925).

3.3 Mutated Morphological Features

55

Fig. 3.9 Two representative twin-tail strains. (a) Dorsal view of Ryukin strain. (b) Lateral view of Ryukin strain. (c) Dorsal view of Oranda strain. (d) Lateral view of Oranda strain. All the pictured goldfish specimens are approximately 12 cm standard length. (Represented with permission from Li et al. 2019)

3.3.3

Trunk Level

A globular body shape is a quite commonly observed ornamental morphology. For example, Ryukin, Ranchu, and Oranda strains all exhibit such a morphology; these mutant strains can be clearly distinguished from the wild-type by their trunk morphology, as the trunk of these mutants is shorter than that of the wild-type (Figs. 3.8, 3.9, and 3.10). Moreover, the globular body shape mutations are further categorized into different types, including curved back, straighter back, short globular, and medium globular (Smartt 2001). Given that the internal skeletal morphology is mutated in these ornamental goldfish (Koh 1931, 1932), it is expected that the genetics underlying the process of axial skeletal development might be modified. Additionally, the ratio of anterior to posterior swim bladder size differs

56

3 Varieties of Goldfish Morphology

Fig. 3.10 Lateral view of pre-cloacal region of two representative dorsal fin less strains. (a) Ranchu strain (~8 cm standard length). (b) Celestial strain (~10 cm standard length). (Image courtesy of Ing-Jia Li)

between the single-tail common goldfish and globular body shape ornamental strains; specifically, the anterior swim bladder is smaller than the posterior swim bladder in globular body shape goldfish (Hervey and Hems 1948).

3.3.4

Pectoral Fin

The pectoral fin tends to be conserved among ornamental goldfish strains. These fins exhibit almost the same morphology in all wild-type and mutant strains, even though other body parts are highly diverged (Figs. 3.1, 3.2, 3.8, and 3.9). One exception to this consistent morphology is that the pectoral fin rays may exhibit different lengths; for example, Comet goldfish have long pectoral fins.

3.3 Mutated Morphological Features

3.3.5

57

Pelvic Fin

Similar to the pectoral fins, the internal skeleton of the pelvic fin and the attached muscles tend to be conserved among all ornamental goldfish strains (Figs. 3.2, 3.3, and 3.6). The fin length is extended in the long fin goldfish strains. Moreover, the location of the pelvic fin seems to be influenced by the shape of the trunk, presumably because the pelvic girdle of goldfish is separated from axial skeletal system, similar to most other teleost species; this separation is a significant difference between the pelvic fin and pectoral fin. The detailed developmental process of pelvic fin will be examined in Chaps. 4 and 5.

3.3.6

Dorsal Fin

Several goldfish strains completely lack a dorsal fin, such as the Ranchu and Celestial strains (Fig. 3.10). These dorsal-finless strains are thought to have been subjected to strong selective pressure by early Chinese breeders, since the dorsal fin is visible from a top view. Moreover, molecular phylogenetic analyses suggest that dorsal-finless mutant strains were established after the genetic fixation of mutant strains with a twin-tail morphology (Komiyama et al. 2009; Kon et al. 2020). Interestingly, the expressivity of dorsal-finless morphology was reported by Matsui (1934) to be unstable, as some individuals of the dorsal-finless strains partially retain the remnants of the dorsal fin or its internal skeleton.

3.3.7

Anal Fin

A bifurcated anal fin was reported in several twin-tail goldfish strains, such as Oranda and Ryukin (Watase 1887; Li et al. 2019) (Figs. 1.1 and 3.10). Moreover, there are several morphological variations in fish with this mutation; the bifurcated anal fin is well separated in some individuals but not in the others (Fig. 3.11) (Watase 1887; Li et al. 2019). It is also worthwhile to note that there are almost no ornamental domesticated goldfish strains that have been designated on the basis of anal fin morphology. At least, I could not find any classical ornamental goldfish strains that are exclusively categorized by the shape of the anal fin in articles of Matsui (1934), Smartt (2001), or other researchers.

58

3 Varieties of Goldfish Morphology

Fig. 3.11 Schematic drawings of anal and caudal fins in Watase (1887). The Arabic numbers indicate the caudal fin morphology: (1) completely bifurcated caudal fin (the “four-lobed tail” or the “Yotsu-wo”), (2) the dorsal edge-connected bifurcated caudal fin (the “three-lobed tail” or the “Mitsu-wo”), (3) the only ventral part bifurcated caudal fin, and (4) the single fin. The Roman numerals represent the anal fin morphology: (I) the completely bifurcated anal fin, (II) the posterior part bifurcated anal fin, (III) the anterior region bifurcated but posterior region fused anal fin, and (IV) the single anal fin

3.3 Mutated Morphological Features

3.3.8

59

Caudal Fin

One prominent mutation in ornamental goldfish is the twin-tail phenotype, in which the fin rays and internal skeleton are duplicated. There are several variations in the bifurcated caudal fin morphology, and on this basis, some goldfish strains are further categorized into different groups by breeders (Watase 1887; Matsui 1934; Li et al. 2019) (Fig. 3.11). In fact, the presence/absence of horizontally well-spread upper and lower lobes of the caudal fin mutations allows us to distinguish the Butterfly tail and Tosakin strains from other twin-tail goldfish strains (Smartt 2001). Moreover, variations in length and shape can also be seen in the caudal fin; For example, the cleft of the caudal fin is not evident in Butterfly tail, Tosakin, and Veiltail, while Comet exhibits elongated and pointed narrow fin lobes with a deep cleft in the caudal fin. In addition, three representative variations of caudal fin shapes are recognized in Shubunkin strain variations. Japanese-American Shubunkin, London Shubunkin, and Bristol Shubunkin, respectively, exhibit a long-tail, short-tail, and heart-shaped single caudal fin (see Smartt 2001 for details). Furthermore, it is worthwhile to note that the caudal-finless goldfish mutant (Meteor) was documented by Smartt (2001). The relationship between the development of the anal fin and caudal fin will be examined in Chap. 5.

3.3.9

Integuments

Variations of color and patterns are commonly observed mutant phenotypes in many goldfish, including the single-tail common goldfish and the other morphological variations (Figs. 3.1 and 3.8). These mutations were mentioned in the earliest historical times of goldfish domestication, and subsequently, large varieties were genetically fixed by fanciers and breeders (see Chap. 1). Several specific color patterns were genetically fixed in ornamental goldfish strains, and they have been given specific common names by breeders. For example, the red-cap Oranda is called “Tancho” (Fig. 3.8e), and the black-colored popped-eye mutant is called Kurodemekin or Moor (see Smartt 2001). These mutations are caused by differences in the production of pigments (iridophores, melanophores, and xanthophores) in the integuments, including the scales and attached tissues. The combinations of mutated chromatophores, their locations, and morphological mutations dramatically increase inter-strain variation. Interestingly, the intensity of color and contrast of color patterns exhibit some plasticity in comparison with morphological features. For example, it was reported that feeding with algae and background color of the aquarium affects the intensity of red color, suggesting that these environmental factors can influence the physiological process of pigment production in the goldfish (Gouveia et al. 2003; Eslamloo et al. 2015). Similarly, it is empirically known that goldfish progenies maintained in

60

3 Varieties of Goldfish Morphology

an aquarium with or without the sunlight will cause significant differences in the concentrations of red and black pigments, even in the same individual. These observations indicate that color patterns may be influenced by environmental factors in addition to genetics. Besides color patterns, the shape of scales has also been modified during domestication. The domed scale mutation is recognized in some goldfish strains, such as the Pearl scale strain (Fig. 3.8h). Although different colors can appear on specific body parts, the domed scale mutation seems to affect the scales on the entire body, according to Smartt (2001). More specifically, the boundaries of red color and different color areas can be found at any part of the body, but such boundaries are not found in fish with the domed scale mutation. Thus, the domed scale mutation and pigmentation mutations exhibit some fundamental differences. As an exceptional case, the mirror scale mutation was reported by Smartt (2001). However, he suggested that this mutation might be derived from hybridization of goldfish and mirror carp. In fact, it is empirically known that this type of mutation is uncommon in ornamental goldfish (Smartt 2001; Rohner et al. 2009). The reason why such a mutation may be present in the common carp linage but not in the goldfish lineage will be discussed in further chapters (Chaps. 6 and 7).

3.4

Responsible Loci

Thanks to recent advances in molecular techniques, the loci responsible for almost all of the representative mutated phenotypes mentioned above have been identified at the molecular genetic and genomic levels (Chen et al. 2019; Abe et al. 2014; Kon et al. 2020). For example, the gene that is responsible for the twin-tail goldfish phenotype was identified by genetic approaches and direct functional analyses in the goldfish (Abe et al. 2014). Moreover, several chromosomal regions and genes were recently associated with dorsal-finless, long fin, heart-shaped tail, telescope eyes, and albino mutations by whole-genome sequencing approaches (Table 3.1). The allele for twin-tail goldfish was first identified as a stop codon mutation in one of two duplicated chordin genes; it is designated as chdSE127X (originally chdAE127X) (Abe et al. 2014; Kon et al. 2020). This stop codon-containing allele Table 3.1 Responsible and candidate loci for the goldfish mutations Phenotypes Twin-tail Dorsal-fin-less Long-fin Heart-shaped tail Telescope-eye Albinism

Genes (synonym) chdS (chdA) Lrp6S Kcnk5bS rpzS and rpz4S Lrp2aL oca2L oca2S

Linkage group (sub-genome) LG40 (S-chromosome) LG29 (S-chromosome) LG45 (S-chromosome) LG41 (S-chromosome) LG9 (L-chromosome) LG6 (L-chromosome) LG31 (S-chromosome)

Reference Abe et al. (2014) Kon et al. (2020) Kon et al. (2020) Kon et al. (2020) Kon et al. (2020) Kon et al. (2020) Kon et al. (2020)

3.4 Responsible Loci

61

for the chordin gene was found to be homozygous in different types of ornamental goldfish strains with twin-tail morphology (Fig. 3.8), suggesting that the common ancestor of all twin-tail strains also had the same genotype at this locus. The question of whether this allele is indeed genetically linked with the twin-tail phenotype was addressed by genotyping F2 populations derived from backcrossing twin-tail (chdSE127X/E127X) and wild-type (chdSwt/wt) goldfish. Furthermore, microinjection of wild-type mRNA was found to rescue the mutated phenotype (eliminate twin-tail morphology) in twin-tail ornamental goldfish embryos. These experiments demonstrating that the chordin gene is responsible for the twin-tail phenotype—the relationship between the gene function, expression pattern and influence on developmental processes—will be detailed in Chap. 5. In contrast to this more traditional approach, wherein the responsible gene was identified by genetic approaches and its function was confirmed by mRNA rescue experiments, the responsible genes for dorsal-finless, long fin, heart-shaped tail, and telescope eyes were identified by genomic approaches (genome-wide association study; GWAS) (Kon et al. 2020). The functions of the identified candidate genes were further examined mainly utilizing a zebrafish molecular developmental experimental system. This study revealed that the responsible genes for dorsal-finless, heart-shaped tail, long fin, and telescope eyes phenotypes are the lrp6S, Kcnk5bS, rpz, and lrp2aL genes, respectively (Table 3.1). The long fin (kcnk5bS) and heartshaped tail (rpz genes) mutants are dominant, while the other mutations are recessive with regard to phenotype expression. The GWAS in goldfish (and common carp) also provided significant information about their evolution and structure of their genomes (Kon et al. 2020; Xu et al. 2019). According to these genomic studies, the chromosomes in goldfish or common carp genomes can be subdivided into two types, which have different evolutionary characteristics and expression levels. In the goldfish GWAS report, the two chromosome types are designated S- and L-chromosomes (Kon et al. 2020). Notably, the authors also suggested that the S-chromosomes have higher mutation frequencies than L-chromosomes. At this juncture, it is worthwhile to consider the nomenclature for goldfish genes. The genes identified in the GWAS study were designated according to the chromosome in which they are found; genes were identified as residing on S- or L-chromosomes by adding a suffix of L or S, as in oca2S and oca2L. This nomenclature allows one to clearly distinguish whether the identified paralogue belongs to the set of S- or L-chromosomes. The gene responsible for twin-tail morphology was originally designated as chdA, since it was isolated before reports of asymmetrical genome evolution (Abe et al. 2014; Kon et al. 2020); thus, the chdA gene is re-designated as chdS in this book. Color was also examined with classical genetic approaches by early researchers (Yamamoto 1973; Kajishima 1977; Chen 1934), and more recently, with transcriptome analyses (Zhang et al. 2017) and GWAS (Kon et al. 2020). Among these studies, the GWAS provided clear evidence that oca2S and oca2L genes are plausible candidates for the genetic basis of albino (with pink pupil) goldfish (Kon et al. 2020). In contrast to the genes responsible for morphological mutations, the

62

3 Varieties of Goldfish Morphology

GWAS data indicated that the expression of the albino trait requires mutations in both paralogs (oca2S and oca2L), although the function of these genes is still unknown. This finding provides a poignant illustration of how different morphological and color mutations may be similar or dissimilar at the molecular level. The functions of the genes identified in the goldfish GWAS have not yet been directly examined in goldfish (Kon et al. 2020), presumably due to a lack of shared techniques for functional analyses among researchers. Thus, further studies may be required to confirm that these genes are indeed responsible for the morphological and color mutations in goldfish. However, it is certain that the GWAS performed by Kon et al. (2020) will pave the way for further goldfish evodevo studies. This study not only provided candidate genes for mutant morphologies, but it also revealed the genetic population structure of several ornamental goldfish strains (Fig. 3.12). The GWAS data show how polymorphic sites in the genomic nucleotide sequences correspond to established ornamental goldfish strains, providing material for discussion of how these highly diverged ornamental goldfish might be categorized into a small set of groups (see below).

3.5

Three Representative Morphotypes

A systematic method to categorize variations in ornamental goldish strains will be required to facilitate further discussion of goldfish evodevo. However, it seems that there is no consensus among researchers, fanciers, and breeders about how such highly diverged goldfish strains should be categorized. For example, Smartt (2001) categorized modern goldfish into 16 groups based on morphology, while a recently published book by Ye and Qu (2017) first divided modern Chinese goldfish strains into two groups (fan-tail and egg-fish-shaped goldfish), then further subcategorized these two groups into 40 subgroups (fan-tail comprised 22 subgroups, and egg-fishshaped covered 18 subgroups). These two systems represent hierarchical categorizations of goldfish strains. On the other hand, Matsui (1934) introduced 19 representative Japanese goldfish strains and examined the genealogical and geological relationships among them. Notably, the recent goldfish GWAS study provides an opportunity to take an entirely different approach to categorization of strains, one based on the genetic population structure (Kon et al. 2020). In this study, the authors divided ornamental goldfish into three groups, the “Edo group,” “China group,” and “Ranchu group,” based on an admixture analysis of genome-wide sequence data (Fig. 3.12). These different systems of categorization directly reflect the academic purposes and goals of the authors who proposed them. Thus, the best method to categorize varieties of ornamental goldfish for evodevo studies should be carefully considered, rather than naively applying the categorization methods of others. In order to provide a system of categorization suitable for evodevo studies, ornamental goldfish strains may be categorized by the structures of their internal skeletons, in accordance with textbooks of comparative vertebrate anatomy (Liem et al. 2001; Kardong 2012). Indeed, the major reason why this text uses comparative

3.5 Three Representative Morphotypes

63

Fig. 3.12 Phylogenetic tree for ornamental goldfish strains. The simplified neighbor-joining tree was reconstructed based on the pairwise distance matrix based on Kon et al. (2020). The branches containing the same strains (forming a monophyletic group) were unified into one operational taxonomic unit (OTU); e.g., two wild goldfish branches (wild-type goldfish 1 and wild goldfish 2) are represented as a single OTU (wild goldfish) in the phylogenetic tree. Blue, green, and red colors represent the China, Ranchu, and Edo groups, respectively. These groups are defined by the genetic population structure based on GWAS. Bubble-eye and Pompon are placed in the China group based on their ancestral sequences, but simultaneously clustered with the Ranchu group. (The image is modified from Kon et al. 2020)

anatomy of vertebrate textbooks as a guide to describe morphological features of goldfish is because this approach results in a more suitable categorization for evodevo studies. A number of previous evodevo studies have used the internal skeletal anatomy to describe morphological characteristics and categorize major groups of vertebrates. This approach allows investigations into skeletal anatomy in both extant and extinct animals, providing a means for researchers (especially paleontologists) to identify homologies and to investigate evolutionary changes in homologous skeletal features (for example, see Kuratani 2004; Kardong 2012, Liem

64

3 Varieties of Goldfish Morphology

et al. 2001; Janvier 1996). Moreover, the skeletal features provide articulated indexes and landmarks to identify homologous body parts, making systematic comparisons between various different strains possible. The early appearance of the basic internal skeletal architecture during development allows for comparative analyses across different developmental stages. In fact, once goldfish skeletal tissues are developed at embryonic or larval stages, the morphologies tend to be preserved for relatively long time periods and are not as influenced by environmental conditions as many other tissues (Li et al. 2015, 2019). For example, coloration patterns may change depending on the habitat or other environmental characteristics, even in the same specimen. In contrast, the topological relationships of skeletal elements are highly conserved throughout the developmental process, and these conserved features exist not only within the same species but also among different species (Liem et al. 2001; Kardong 2012; see also Parichy et al. 2009 and Li et al. 2015 for similarities between zebrafish and goldfish skeletal systems; Koyabu et al. 2011, Koyabu and Son 2014 also provide several comparisons of internal skeletal development in various mammals). Thus, by focusing on morphological mutations in the skeletons of caudal fin and dorsal fin, modern ornamental goldfish may be categorized into three representative morphotypes: the “Single-tail,” “Twin-tail,” and “Dorsal-finless” morphotypes (Fig. 3.13). To my knowledge, the term morphotypes has only been explicitly applied to a study on the biomechanical effects of goldfish morphological variations (Blake et al. 2009). The authors of this biomechanics study originally defined four morphotypes based on the length of fins, number of dorsal and caudal fins, and globularity of the trunk region, i.e., the “common,” “comet,” “fantail,” and “eggfish.” However, only the caudal and dorsal fin morphologies are used to define the three morphotypes in this text because these fins (a) are easily recognized by external appearance, (b) reflect internal skeletal morphology, and (c) provide articulated and objective criteria. On the other hand, the slenderness/globularity and length of the fin are not used, due to the relative inconvenience of measurement and lack of clear criteria for assessment. Although it is possible to define a criterion to distinguish globular and slender body shapes, the use of a continuous variable for categorization might be difficult because researchers would need to quantify large amounts of morphological data, a more constructive use of these morphological data will be discussed later (Sect. 3.7). Here, I provide brief descriptions of the three morphotypes to be used in this work.

3.5.1

Single-Tail Morphotype

Compared to undomesticated Carassius species, fish in this morphotype are less modified than those in the other two morphotypes. All goldfish strains having a single caudal fin without mutations in the dorsal fin are categorized into this group. Thus, the group comprises not only the single-tail common goldfish, but the Comet and Shubunkin as well (Figs. 3.1 and 3.13a).

3.5 Three Representative Morphotypes

65

Fig. 3.13 Comparison of three representative skeletal morphotypes. Lateral views of alizarin red and cleaned juvenile individuals of the single tail morphotype (a), the twin-tail morphotype (b), and the dorsal-finless morphotype (c). The single-tail (a), twin-tail (b), and dorsal-finless morphotype specimens (c) are the single-tail common goldfish (specimen is the same as shown in Fig. 3.4), Oranda, and Ranchu strains, respectively. Scale bars ¼ 1 mm. (Panel a adapted with permission from Li et al. 2015)

3.5.2

Twin-Tail Morphotype

Most goldfish varieties having a bifurcated caudal fin are categorized into this morphotype, as follows: twin-tail Wakin, Jikin, Fantail, Ryukin, Tosakin, Veiltail, Telescope, Oranda, and Pearlscale (Figs. 3.8 and 3.13b).

66

3.5.3

3 Varieties of Goldfish Morphology

Dorsal-Finless Morphotype

Goldfish of this morphotype exhibit a minimized (but not completely missing) dorsal fin and are equipped with a twin tail. In other words, this morphotype also includes the mutated post-cranial skeletal morphology that defines the twin-tail morphotype. The strains of Celestial and Ranchu groups are categorized in this morphotype (Figs. 3.8 and 3.13c).

3.6

Descriptions of Intermediated Morphotypes

Most well-established goldfish strains can be categorized into the aforementioned three morphotypes (at least those goldfish strains appearing in major publications, such as Smartt 2001; Matsui 1934; Kon et al. 2020). Although goldfish belonging to traditionally defined ornamental goldfish strains (for example, Wakin) may show polymorphisms in dorsal or anal fin morphology, every individual can be categorized into one of the three morphotypes mentioned above. For example, the singletail Wakin and twin-tail Wakin can be, respectively, categorized into the single-tail morphotype and the twin-tail morphotype. In the same manner, even though Pompon and Bubble eyes strains exhibit polymorphisms in the presence/absence of the dorsal fin, the dorsal fin positive/negative individuals can be categorized into the twin-tail/dorsal-finless morphotypes. The results of genetic population structure analysis based on GWAS data are almost entirely consistent with the above categorization scheme. In this analysis, most of the dorsal-finless strains, including Ranchu and Celestial, were categorized into the same group (the Ranchu group). Moreover, the molecular phylogenetic analyses based on mitochondrial DNA sequences are also largely consistent with the above morphotypes (Komiyama et al. 2009). Although there are inconsistencies between molecular evolutionary analyses and the morphotypes proposed here, the inconsistencies will be helpful to establish testable working hypotheses for evodevo studies; given defined morphotypes based on elements of body architecture, one can further examine how such elements tend to occur in the context of morphological and molecular evolution, rather than simply noting perceived inconsistencies between morphological evolution and molecular phylogenetic analyses. In other words, even if the three morphotypes do not reflect genealogy, genome evolution, and phylogeny, we can use this conceptual framework to study how such extremely differentiated morphological features were established during domestication; the relationships between molecular and morphological evolution will be thoroughly examined in Chap. 5. Thus, the application of these three morphotypes would not cause serious experimental problems, but instead, it would be useful in the design of comprehensive analyses using molecular developmental genetics, comparative anatomy, and other approaches.

3.6 Descriptions of Intermediated Morphotypes

67

Several intermediate morphotypes have been described for the twin-tail and dorsal-finless morphologies by early and recent researchers (Watase 1887; Matsui 1934; Li et al. 2015). Thus, in the following sections, I introduce some polymorphic features and intermediate morphotypes that cannot be completely accounted for by the morphotypes in the above section (Sect. 3.5) as well as methods to describe these exceptional morphologies.

3.6.1

Variations of Caudal and Anal Fin Mutations

As explained in the above sections (Sects. 3.1 and 3.3.8), the caudal and anal fin morphologies exhibit both inter- and intra-strain differences. To describe these differences, a figure compiling 16 combinations of goldfish caudal and anal fin morphology was prepared by Watase (1887) (Fig. 3.11). This figure covers a wide range of morphological variations in anal and caudal fins and provides a method of notation for these variations. For example, if the caudal fin of a Ryukin individual is bifurcated, but it possesses a single anal fin, this morphotype can be represented as “I4 type”. Moreover, the system introduced by Watase (1887) allows us to describe uncommon morphotypes in modern ornamental goldfish strains. For example, a goldfish with a single caudal fin and completely bifurcated anal fin can be identified as the “IV4”-type goldfish; this type of goldfish is not commonly found in the modern goldfish population and was neither listed in Smartt’s book (2001) nor Matui’s genealogical diagram. Thus, the comprehensive classification system seems to cover the entire morphospace of bifurcated anal fin and caudal fin variations. However, other complex exceptional cases also exist. For instance, a certain percentage of twin-tail goldfish progenies exhibit asymmetry in their bifurcated caudal fin morphology (Li et al. 2019; see also Chap. 5), even though breeders spent considerable efforts to remove such low-value individuals from the population. Moreover, asymmetric caudal and anal fin morphologies also occur with regard to the numbers of fin rays in the left and right caudal and anal fins.

3.6.2

Variations in Dorsal-Finless Mutants

Variations in the dorsal fin and surface of dorsal parts have been reported among the dorsal-finless strains by Matsui (1935). Moreover, he produced several hybrids of Ranchu with other single-tail or twin-tail goldfish strains, subsequently obtaining F1 and F2 progenies that exhibited four reported phenotypes: dorsal-finless, non-flat dorsal side, incomplete loss of dorsal fin, and normal dorsal fin. So far, no detailed analyses of the variations in dorsal fin morphology have been performed. However, one may assume that the number of fin rays could be used as index to describe the morphological variations of the dorsal-finless morphotypes, as ichthyologists often

68

3 Varieties of Goldfish Morphology

use the numbers of the spines and rays in fins as indexes for taxonomical descriptions (Nelson et al. 2016; Nakabo 1993).

3.7

Cataloging of Goldfish Morphological Variations

In the above sections, morphological variations of ornamental goldfish were described as three morphotypes. It was also explained how intermediate morphologies of the twin-tail and dorsal-finless morphologies can be denoted. However, several problems still remain. In fact, it is certain that the methods described above do not allow us to encode all goldfish morphological variations. Moreover, new morphological varieties can be genetically fixed by fanciers and breeders, so novel goldfish strains that cannot be categorized with the above criteria could easily appear. Thus, a more comprehensive method to describe morphological variations should be considered. To my knowledge, there is no commonly utilized comprehensive method to describe all reported morphological variations. In fact, most researchers describe morphological features of interest in their own ways. As shown in Fig. 3.11, Watase (1887) provided a matrix to describe the combinations of the different types of the anal and caudal fin morphologies. However, Matsui (1934) measured and counted several morphological features and listed their variations in a table. Moreover, interand intra-strain comparative research has been performed for some selected goldfish morphologies; examples include vertebral numbers (Asano and Kubo 1972), the number of fin rays (Li et al. 2015), and relative weight of eyes (Kon et al. 2020). Furthermore, Smartt (2001) provided tables with descriptions of the characteristic phenotypic features for each ornamental species. It is certain that there is poor compatibility between these descriptions by different researchers; this situation not only impedes the production of a complete goldfish morphological variation catalog, but it also makes recoding the variations in a structured data format difficult. As such, the utility and ease of sharing the morphological data compiled by each researcher is highly limited. Since several loci responsible for mutated phenotypes of domesticated ornamental goldfish strains were already identified, the disrupted gene names may be used to identify some goldfish strains (Abe et al. 2014); for example, twin-tail goldfish can be called the chdSE127X/E127X strain. However, it is uncertain whether all identified mutated loci express identical phenotypes; as mentioned above, there are morphological variations in the twin-tail goldfish due to differences in penetrance and/or expressivity of the uniformly inherited chdSE127X/E127X allele (Li et al. 2019). Moreover, the genes responsible for a number of morphological features are totally unknown, indicating that the strains cannot be identified by the name of the corresponding loci. Thus, to describe all of the morphological variations of the ornamental goldish, a different systematic coding system based on morphological features is required.

3.7 Cataloging of Goldfish Morphological Variations

69

Table 3.2 Characters and their states of 16 representative goldfish strains by Smartt (2001) Strains The single-tail common goldfish Comet Shubunkin Wakin (twin-tail) Jikin Fantail Ryukin Tosakin Veiltail Telescope Celestial Bubble-eye Pompon Pearlscale Oranda Ranchu

EpiNos wt wt wt wt wt wt wt wt wt wt wt wt Nb wt wt wt

Eye wt wt wt wt wt wt wt wt wt pop up bubble wt wt wt wt

Epi.fron.pari wt wt wt wt wt wt wt wt wt wt wt wt wt wt hood wt/hood

Df 1 1 1 1 1 1 1 1 1 1 0 0 0 1 1 0

Af 1 1 1 1/2 1/2 1/2 1/2 1/2 1/2 1/2 1/2 1/2 1/2 1/2 1/2 1/2

Cf 1 1 1 2 2 2 2 2 2 2 2 2 2 2 2 2

Sca wt wt wt wt wt wt wt wt wt wt wt wt wt domed-s wt wt

Based on data Smartt (2001)

Unlike most researchers, Teichfischer (1994) presented a systematic coding method to describe the goldfish mutant morphology, although his article has not been frequently cited. He divided the goldfish body into five domains [head (Kopf), eyes (Augen), body and squamation (Köper u. Beschuppung), dorsal fin (Rückenflosse), and caudal fin (Schwanzeflosse)] and noted the phenotypic states of each domain; for example, three phenotypic states were used to describe the dorsal fin [“normal,” “without” (ohne), and “high” (hoch)]. As mentioned in his report, this coding system allows researchers to represent phenotypic features of goldfish without long descriptions and potentially confusing nomenclature. More significantly, this method is quite analogous to the coding method utilized in the character matrix for cladistic or phylogenetic analyses (Scotland and Pennington 2000). Although this coding system does not seem to have been widely adopted by researchers, it seems to be a good fit for evodevo studies. Thus, Teichfischer (1994) and character coding methods used in the field of cladistics and phylogenetics (Scotland and Pennington 2000) provide a basis for characterizing mutated phenotypes of ornamental goldfish strains. The phenotypic characters and states of ornamental goldfish are shown in Table 3.2, which is equivalent to a character matrix. Representative anatomical features used to identify mutated phenotypes are listed in the first row of the table, under the heading “character.” Subsequently, the phenotypic variants (including wild-type and mutated phenotypes) for each character are coded as the “character state” as follows: 1. Epidermis in Nostril (EpiNos): wild-type (wt); Narial bouquet (Nb) 2. Eyes: wt; Protuberant or pop eye (pop) enlarged, protuberant, upwardly directed (up); “water bubble-eye” (bubble)

70

3 Varieties of Goldfish Morphology

3. Epidermis on frontal and parietal regions (Epi.fron.pari): wt; warty growth or hood (hood) 4. Dorsal fin (Df): wt (1); absence (0) 5. Anal fin ray (Af): absence (0); wt (1); bifurcated (2) 6. Caudal fin (Cf): absence (0); wt (1); bifurcated (2) 7. Scales (Sca): wt; domed scale (domed-ss) Based on the above characters (1–7), the phenotypic features of the modern goldfish strains listed by Smartt (2001) are summarized (Table 3.2). In addition to constructing a character matrix, we can also apply this coding system to describe the characteristic features of strains and individuals, as Teichfischer (1994) intended. For example, variations in the number of anal fins in Ryukin strains can be described as follows: a Ryukin individual with bifurcated anal fin would be “Ryukin (2Af)”; a Ryukin individual with a single anal fin would be “Ryukin (1Af).” In the same manner, the phenotypes of the hybrid progenies derived from parents with different morphotypes can be described, even when hybrid progenies exhibit phenotypes that do not correspond with currently known goldfish strains. For example, Matsui (1934, 1935) produced hybrids of the Telescope strain and a wild crucial carp; the progeny had a single caudal fin and protuberant eyes. Although progeny with this appearance might not be categorized as either Telescope or wild crucial carp by breeders, fanciers, or researchers (Smartt 2001), the phenotype of this progeny can be represented by the code “pop-1Cf.” This system may therefore provide a clear and succinct description of the hybrid phenotype. Moreover, this method also allows one to categorize previously unreported or uncommon goldfish variations. For example, Meteor and single-tail dorsal-finless goldfish strains can be represented as “1Df1Af0Cf” and “0Df1Af1Cf”, respectively. Although the dataset in Table 3.2 does not exhaustively categorize all modern goldfish strains, a more thorough examination of anatomical features would allow us to establish a more sophisticated character matrix. In fact, the data matrix in Table 3.2 does not allow one to distinguish between the twin-tail Wakin, Jikin, Fantail, Ryukin, Tosakin, and Veiltail, even though there are obvious differences among these strains in the outline of caudal fin morphology and shape of the trunk. To describe these variations, several approaches could be taken. One would be to use the traditional nomenclature system for phenotypes as a part of the coding system; for example, the “caudal fin with straight-cut trailing edge” or “short and globular body,” as described by Smartt (2001). Another would be to convert the traditional nomenclature into objective data. For example, the outline shape of the caudal fin lobes can be represented by the relative length of caudal fin rays, or the number and length of fin ray segments, as these indexes have been measured in zebrafish long fin, another long fin/kcnk5b, and rpz mutants as well as the heart-shaped caudal fin and long fin ornamental goldfish mutants (Iovine and Johnson 2000; Perathoner et al. 2014; Green et al. 2009; Kon et al. 2020). The utilization of these parameters may allow us to describe subtle morphological differences in the caudal fins of Fantail, Tosakin, and Veiltail. Moreover, the body shape can also be quantified and qualified by measuring the number and length of the axial skeleton, and by applying

References

71

morphometric methods (Asano and Kubo 1972; Zelditch et al. 2012). Although it seems difficult to objectively define slenderness and globularity, there is a possibility that application of the morphometrics might separate these strains in higher resolution, once a highly quantified dataset is obtained. These methods may also allow us to describe newly generated strains, as Teichfischer (1994) intended. This character matrix not only allows us to simply describe morphological variations but also clarifies the homologous relationships between organs, tissues, and other morphological features of different goldfish strains, producing a systematic catalog of variants. Once homologous morphological features are identified between different goldfish strains at the adult stage, it becomes possible to examine the developmental origin of these homologous features using different goldfish strains. Even though one goldfish may be clearly distinct from another at the adult stage, both began as single fertilized eggs, which were morphologically quite similar. Thus, we are presented with an opportunity to consider when and how differences in homologous morphological features arise during the developmental process, and in answering this question we may also consider the next problem; how did these developmental processes diverge in an evolutionary sense? In the next chapters (Chaps. 4 and 5), we will examine the developmental processes underlying several of the morphotypes mentioned above.

References Abe G, Lee S-H, Chang M, Liu S-C, Tsai H-Y, Ota KG (2014) The origin of the bifurcated axial skeletal system in the twin-tail goldfish. Nat Commun 5:3360. https://doi.org/10.1038/ ncomms4360 Asano H, Kubo Y (1972) Variations of spinal curvature and vertebral number in goldfish. Jpn J Ichthyol 19(4):223–231 Bateson W (1894) Materials for the study of variation treated with especial regard to discontinuity in the origin of species. Macmillan, New York Blake RW, Li J, Chan KHS (2009) Swimming in four goldfish Carassius auratus morphotypes: understanding functional design and performance employing artificially selected forms. J Fish Biol 75(3):591–617 Bradford Y, Conlin T, Dunn N, Fashena D, Frazer K, Howe DG, Knight J, Mani P, Martin R, Moxon ST, Paddock H, Pich C, Ramachandran S, Ruef BJ, Ruzicka L, Schaper HB, Schaper K, Shao X, Singer A, Sprague J, Sprunger B, Van Slyke C, Westerfield M (2011) ZFIN: enhancements and updates to the zebrafish model organism database. Nucleic Acids Res 39(Suppl 1):822–829. https://doi.org/10.1093/nar/gkq1077 Chen SC (1934) The inheritance of blue and brown colours in the goldfish, Carassius auratus. J Genet 29(1):61–74 Chen Z, Omori Y, Koren S, Shirokiya T, Kuroda T, Miyamoto A, Wada H, Fujiyama A, Toyoda A, Zhang S (2019) De novo assembly of the goldfish (Carassius auratus) genome and the evolution of genes after whole-genome duplication. Sci Adv 5(6):eaav0547. https://doi.org/ 10.1126/sciadv.aav0547 Darwin C (1868) The variation of animals and plants under domestication by Charles Darwin: 1, vol 2. J. Murray, London

72

3 Varieties of Goldfish Morphology

Engeszer RE, Patterson LB, Rao AA, Parichy DM (2007) Zebrafish in the wild: a review of natural history and new notes from the field. Zebrafish 4(1):21–40. https://doi.org/10.1089/zeb.2006. 9997 Eslamloo K, Akhavan SR, Eslamifar A, Henry MA (2015) Effects of background colour on growth performance, skin pigmentation, physiological condition and innate immune responses of goldfish, Carassius auratus. Aquacult Res 46(1):202–215. https://doi.org/10.1111/are.12177 Fink SV, Fink WL (1981) Interrelationships of the ostariophysan fishes (Teleostei). Zool J Linn Soc 72(4):297–353. https://doi.org/10.1111/j.1096-3642.1981.tb01575.x Gouveia L, Rema P, Pereira O, Empis J (2003) Colouring ornamental fish (Cyprinus carpio and Carassius auratus) with microalgal biomass. Aquacult Nutr 9(2):123–129. https://doi.org/10. 1046/j.1365-2095.2003.00233.x Green J, Taylor JJ, Hindes A, Johnson SL, Goldsmith MI (2009) A gain of function mutation causing skeletal overgrowth in the rapunzel mutant. Dev Biol 334(1):224–234. https://doi.org/ 10.1016/j.ydbio.2009.07.025 Hervey GF, Hems J (1948) The goldfish. Batchworth Press, London Iovine MK, Johnson SL (2000) Genetic analysis of isometric growth control mechanisms in the zebrafish caudal Fin. Genetics 155(3):1321–1329. https://doi.org/10.1093/genetics/155.3.1321 Janvier P (1996) Early vertebrates, vol QE851 J36. Oxford University Press, Oxford Kajishima T (1977) Genetic and developmental analysis of some new color mutants in the goldfish, CARASSIUS AURATUS. Genetics 86(1):161–174 Kardong KV (2012) Vertebrates: comparative anatomy, function, evolution, 6th edn. McGraw-Hill Higher Education, Boston, MA Koh T-P (1931) Osteology of Carassius auratus. Sci Rep Natl Tsing Hua Univ Peiping China 1:61–81 Koh T-P (1932) Osteological variations in the axial skeleton of goldfish (Carassius auratus). Sci Rep Natl Tsing Hua Univ 2:109–121 Komiyama T, Kobayashi H, Tateno Y, Inoko H, Gojobori T, Ikeo K (2009) An evolutionary origin and selection process of goldfish. Gene 430(1–2):5–11. https://doi.org/10.1016/j.gene.2008.10. 019 Kon T, Omori Y, Fukuta K, Wada H, Watanabe M, Chen Z, Iwasaki M, Mishina T, Shin-ichiro SM, Yoshihara D (2020) The genetic basis of morphological diversity in domesticated goldfish. Curr Biol 30:1–15. https://doi.org/10.1016/j.cub.2020.04.034 Koyabu D, Son NT (2014) Patterns of postcranial ossification and sequence heterochrony in bats: life histories and developmental trade-offs. J Exp Zool B Mol Dev Evol 322(8):607–618. https:// doi.org/10.1002/jez.b.22581 Koyabu D, Endo H, Mitgutsch C, Suwa G, Catania KC, Zollikofer CP, Oda S-i, Koyasu K, Ando M, Sánchez-Villagra MR (2011) Heterochrony and developmental modularity of cranial osteogenesis in lipotyphlan mammals. EvoDevo 2(1):21. https://doi.org/10.1186/2041-91392-21 Kuratani S (2004) Evolutionary morphology. University of Tokyo Press, Tokyo Li IJ, Chang CJ, Liu SC, Abe G, Ota KG (2015) Postembryonic staging of wild-type goldfish, with brief reference to skeletal systems. Dev Dyn 244(12):1485–1518. https://doi.org/10.1002/dvdy. 24340 Li I-J, Lee S-H, Abe G, Ota KG (2019) Embryonic and post-embryonic development of the ornamental twin-tail goldfish. Dev Dyn 248(4):251–283. https://doi.org/10.1002/dvdy.15 Liem KF, Bemis WE, Walker WF, Grande L (2001) Functional anatomy of the vertebrates: an evolutionary perspective. Harcourt College, New York Mabee PM, Crotwell PL, Bird NC, Burke AC (2002) Evolution of median fin modules in the axial skeleton of fishes. J Exp Zool 294(2):77–90. https://doi.org/10.1002/jez.10076 Matsui Y (1933) Preliminary note on the inheritance of caudal and anal fins in gold-fish of Japan. Proc Imp Acad 9(10):655–658 Matsui Y (1925) On the warty growths of Japanese lionhead goldfish. Annotationes Zoologicae Japonenses 10(7):355–362

References

73

Matsui Y (1934) Genetical studies on gold-fish of Japan. J Imp Fish Inst 30:1–98 Matsui Y (1935) Kagaku to shumikara mita Kingyo no kenkyuu (科学と趣味から見た金魚の研 究). Seizando-Shoten Publishing Co., Ltd, vol 90(12). https://ci.nii.ac.jp/ncid/BA79565196. [in Japanese] Nakabo (1993) Fishes of Japan with pictorial keys to the species (日本産魚類検索). Tokai University Press, Tokyo. [in Japanse] Nelson JS, Grande TC, Wilson MV (2016) Fishes of the world. Wiley, Hoboken, NJ Ota KG, Abe G (2016) Goldfish morphology as a model for evolutionary developmental biology. Wiley Interdiscip Rev Dev Biol 5(3):272–295. https://doi.org/10.1002/wdev.224 Parichy DM, Elizondo MR, Mills MG, Gordon TN, Engeszer RE (2009) Normal table of postembryonic zebrafish development: staging by externally visible anatomy of the living fish. Dev Dyn 238(12):2975–3015. https://doi.org/10.1002/dvdy.22113 Perathoner S, Daane JM, Henrion U, Seebohm G, Higdon CW, Johnson SL, Nusslein-Volhard C, Harris MP (2014) Bioelectric signaling regulates size in zebrafish fins. PLoS Genet 10(1): e1004080. https://doi.org/10.1371/journal.pgen.1004080 Rohner N, Bercsényi M, Orbán L, Kolanczyk ME, Linke D, Brand M, Nüsslein-Volhard C, Harris MP (2009) Duplication of fgfr1 permits Fgf signaling to serve as a target for selection during domestication. Curr Biol 19(19):1642–1647. https://doi.org/10.1016/j.cub.2009.07.065 Scotland R, Pennington RT (2000) Homology and systematics: coding characters for phylogenetic analysis. Taylor & Francis, London Smartt J (2001) Goldfish varieties and genetics: handbook for breeders. Blackwell Science, Malden, MA Teichfischer B (1994) Goldfische in aller Welt: Haltung, Zuchtformen und Geschichte der ältesten Aquarienfische der Welt. Tetra, Melle van Eeden FJ, Granato M, Schach U, Brand M, Furutani-Seiki M, Haffter P, Hammerschmidt M, Heisenberg CP, Jiang YJ, Kane DA, Kelsh RN, Mullins MC, Odenthal J, Warga RM, NüssleinVolhard C (1996) Genetic analysis of fin formation in the zebrafish, Danio rerio. Development (Cambridge, England) 123:255–262 Watase S (1887) On the caudal and anal fins of gold-fishes. J College Sci 1:247–267 Xu P, Xu J, Liu G, Chen L, Zhou Z, Peng W, Jiang Y, Zhao Z, Jia Z, Sun Y (2019) The allotetraploid origin and asymmetrical genome evolution of the common carp Cyprinus carpio. Nat Commun 10(1):1–11 Yamamoto T (1973) Inheritance of albinism in the goldfish, Carassius auratus. Jpn J Genet 48 (1):53–64 Ye Q, Qu L (2017) Goldfish of China: descriptions and illustrations of diversed goldfish in China (中国金鱼图鉴). The Straits Publishing & Distribution Group, Fujian. [in Chinese] Zelditch ML, Swiderski DL, Sheets HD (2012) Geometric morphometrics for biologists: a primer, 2nd edn. Elsevier Academic, Amsterdam Zhang Y, Liu J, Peng L, Ren L, Zhang H, Zou L, Liu W, Xiao Y (2017) Comparative transcriptome analysis of molecular mechanism underlying gray-to-red body color formation in red crucian carp (Carassius auratus, red var.). Fish Physiol Biochem 43(5):1387–1398. https://doi.org/10. 1007/s10695-017-0379-7

Chapter 4

Development of the Wild-Type Goldfish

Abstract Embryonic and post-embryonic development of goldfish was described by early researchers. However, there were no reliable staging tables for normal goldfish development included in the early reports. To address the paucity of descriptions of the developmental process, embryonic and post-embryonic development was profiled in the single-tail common goldfish by our laboratory, and the normal embryonic and post-embryonic staging tables were reported in two articles: Tsai et al. (Dev Dyn 242(11):1262–1283, 2013) and Li et al. (Dev Dyn 244 (12):1485–1518, 2015). Based on these articles, the developmental process of wild-type goldfish is introduced in this chapter. Comparisons between goldfish and zebrafish revealed that the developmental process of these two species are closely related, but there are differences in terms of yolk size, the epiboly process, pigmentation patterns, scales, and median fin skeletons. These staging system can facilitate comparative ontogenetic analyses between wild-type and mutant goldfish strains, allowing us to investigate the relationship between artificial selection and molecular developmental mechanisms in vertebrates.

The development of ornamental goldfish intrigued early researchers, leading to the publication of a number of early reports about the embryonic and post-embryonic developmental process for this species (Watase 1887; Khan 1929; Battle 1940; Hervey and Hems 1948; Li et al. 1959; Kajishima 1960; Sharma and Ungar 1980; Yamaha et al. 1999; Otani et al. 2002; see also Smartt 2001). Among these reports, three major articles described the details of embryonic development and provided staging tables (Li et al. 1959; Kajishima 1960; Yamaha et al. 1999). In particular, the staging table by Li et al. (1959) is the most detailed, covering early embryonic to late post-embryonic stages. Moreover, this report examined the developmental process in five different strains. Despite its thorough descriptions, only a few researchers have cited the staging table by Li et al. (1959); this dearth of citations is presumably due to several reasons. (a) The report was written completely in Chinese (with the exception of its Abstract). (b) There were no annotations indicating equivalent embryological and anatomical terminologies in any other language (for example, Latin, English, or German), which necessitates a certain level of reading skill for Chinese characters to understand the © The Author(s), under exclusive license to Springer Nature Singapore Pte Ltd. 2021 K. G. Ota, Goldfish Development and Evolution, https://doi.org/10.1007/978-981-16-0850-6_4

75

76

4 Development of the Wild-Type Goldfish

descriptions. (c) No figures or photographs were presented to show characteristics of post-embryonic stages, precluding evaluation of the accuracy, adequacy and suitability of the provided information for research. (d) No standard lengths were reported in this staging table, at either hatching or post-hatching stages. The fourth point (the absence of standard length in the staging table) is a crucial omission for the study of post-embryonic stages, since the growth rate of the goldfish larvae described in this paper is uncertain; it was however reported the larvae were reared at a constant temperature (25
C), and it is known that the growth rate of post-embryonic and freefeeding teleost larvae is influenced by environmental factors (Kilambi and Robison 1979; Shelton et al. 1981; Schram et al. 2006; Merino et al. 2007; Parichy et al. 2009). In short, there was no reliable staging table of normal goldfish development produced by early researchers, and none existed before 2013, when our group at Yilan Marine Research Station, Academia Sinica, Taiwan produced one based on intensive developmental studies. The staging table produced by our lab comprehensively details the developmental process of the single-tail common goldfish from early embryonic to late postembryonic stages and includes comparisons with zebrafish development (Tsai et al. 2013; Li et al. 2015; Kimmel et al. 1995; Parichy et al. 2009). In this chapter, the embryonic and post-embryonic development of goldfish is described on the basis of these previous reports (Tsai et al. 2013; Li et al. 2015, 2019). We will carefully examine the developmental process of the single-tail common goldfish, aiming to understand how basic body architecture of the single-tail morphotype of the goldfish is formed.

4.1

Normal Developmental Staging Table for Goldfish

A developmental staging table is a handy device for designing experiments and description of ontogenesis. Although there are polymorphisms in developmental timing even within the same species, researchers divide the developmental process into subcategories (called stages, periods, etc.) on the basis of their criteria. Similarly, we also divided the goldfish developmental process into several stages. However, rather than making arbitrary divisions, zebrafish embryonic and postembryonic staging tables were used as a reference, with the aim of comparing these two different species and employing zebrafish molecular techniques and knowledge to goldfish evodevo studies. Presumably due to their phylogenetic proximity, goldfish and zebrafish exhibit highly similar embryonic and post-embryonic morphologies (Kimmel et al. 1995; Parichy et al. 2009). This proximity also allows direct comparisons in staging tables, although there are some differences in the texture of early embryos, and developmental processes of caudal, dorsal, anal, and pelvic fins. Thus, we categorized embryonic stages into seven periods (Zygote, Cleavage, Blastula, Gastrula, Segmentation, Pharyngula, and Hatching stages) and post-embryonic stages were

4.1 Normal Developmental Staging Table for Goldfish Fig. 4.1 Overview of the developmental process for the single-tail common goldfish. The panel of adult specimen is identical with Fig. 3.2 in Chap. 3. (Modified from Tsai et al. 2013 and Li et al. 2015; Reprinted with permission from Tsai et al. 2013 and Li et al. 2015)

77

78

4 Development of the Wild-Type Goldfish

divided into three periods (larval, juvenile, and adult periods) as shown in Fig. 4.1 and Tables 4.1 and 4.2 (Tsai et al. 2013). Similar to the format of Chap. 3, we first examine the developmental process of the single-tail common goldfish since this stain shows the most ancestral morphological features. The stages of the single-tail common goldfish thus become the “reference” or “standard” developmental process for the wild-type goldfish. In other words, we consider how the process of single-tail common goldfish (the single-tail morphotype) development may have been modified during domestication and changed into that of other ornamental goldfish (twin-tail and dorsal-finless morphotypes).

4.2

Embryonic Development of the Single-Tail Common Goldfish

During embryonic development, dorsal–ventral and anterior–posterior body axes are formed. Moreover, the basic structure of pectoral fin and trunk muscle systems is also established during the embryonic development. These developmental processes are highly dependent on incubation temperature. Moreover, presumably due to the concentration of oxygen in the water, the density of the embryos also influences to the growth rate during development. According to our previous analysis, the rate of development of embryos is represented in the graph shown in Figs. 4.2 and 4.3. Under the constant water temperature (24
C), almost all singe-tail common goldfish embryos tend to show similar growth rates.

4.2.1

Zygote to Blastula Periods

The early embryonic periods from zygote to blastula were examined in three independent studies, which yielded similar descriptions of morphological features and developmental rates (Li et al. 1959; Kajishima 1960; Yamaha et al. 1999). Moreover, Yamaha and colleagues intensively investigated the early embryonic developmental process of the goldfish (Yamaha and Yamazaki 1993; Yamaha et al. 1998, 1999, 2001, 2003; Mizuno et al. 1997, 1999; Nagai et al. 2001; Otani et al. 2002; Tanaka et al. 2004). This consistency of the three independent reports covering the zygote to blastula period embryos might be due to the ease of stage identification. During these periods, the stages are defined by the number of the blastodermal cells. Because there is little ambiguity as to the number of cells, especially at the cleavage periods (2- to 64-cell stages), all researchers agreed to use this parameter as the staging index. Furthermore, although the number of the cells is hard to count at the blastula stage, the shape of the boundary between the blastoderm and yolk of the goldfish embryos is comparable to that of zebrafish

4.2 Embryonic Development of the Single-Tail Common Goldfish

79

Table 4.1 Stages of embryonic development Period Zygote period

Stage

hpf (24
C)a

1-cell

0

Perivitelline space appears; cytoplasm move to animal pole to form the blastodisc

2-cell 4-cell 8-cell 16-cell 32-cell 64-cell

0.4 0.85 1.3 1.75 2.2 2.65

Partial cleavage 2  2 array of blastomeres 2  4 array of blastomeres 4  4 array of blastomeres 1–2 blastomeres layer(s) 3 blastomeres layers

128-cell 256-cell 512-cell 1k-cell High

3.1 3.55 4 4.45 4.9

Oblong

5.35

Sphere Dome 30% epiboly

5.8 6.25 6.7

5 blastomere layers 7–8 blastomere layers 9–10 blastomere layers 11 blastomere layers >11 blastomere layers; beginning of blastodisc flattening and smoothing; an elliptical shape Smooth border between blastodisc and yolk; shape remains elliptical Spherical or highly compressed pear shape Yolk cell doming toward animal pole as epiboly begins Blastoderm shows an inverted cup shape; edge of the cup is thinner than the other; margin reaches 30% of distance between the animal and vegetal poles

50% epiboly

8

Germ ring Shield 60% epiboly 90% epiboly 95% epiboly Bud

8.5 8.6 9

11.5

Blastoderm shows uniform thickness; margin of blastomere reaches 50% of distance between the animal and vegetal poles Germ ring visible from animal pole; 50% epiboly Embryonic shield visible, showing thicker dorsal side Dorsal side distinctly thicker; 25–30% blastopore closure Brain rudiment thickened; tail bud prominent; 70–80% blastopore closure Early polster; 85–90% blastopore closure

12

Distinctly larger polster and tail bud; 100% epiboly

6-somite 10-somite

14 16

Optic primordium begins to show Neuromeres appearance

Descriptions

Cleavage period

Blastula period

Gastrula period

11

Segmentation

(continued)

80

4 Development of the Wild-Type Goldfish

Table 4.1 (continued) Period

Stage 14-somite 18-somite 22-somite

hpf (24
C)a 18 20 22

30-somite

26

Prim-yolk extension

35

Prim-\ caudal

44

Long pec

58

Pec fin

64

Protruding mouth

72

Descriptions Distinct Kupffer’s vesicles; v-shaped trunk somites Distinctive yolk extension in the caudal region Muscular twitches; lens and otic vesicles; tail well extended, sculptured brain

Pharyngula period Early pigmentation in retina and skin; red blood cells on yolk; median fin fold; heart beat; pectoral fin bud appearance; OVL, 3 Retina pigmented strongly; strong heat beat; actinotrichia extension at median fin fold; OVL, 1.5; equivalent with prim >12 stages Broad median fin fold with well-extended actinotrichia; strongly pigmented ventral side of tail; asymmetric pectoral fin bud; yolk extension beginning to taper; OVL, 0.5; prim >24 stage

Hatching period Distinct yellow colored head; distinctive pre-cloacal fin fold; pectoral fin pointed; head lifting up to dorsal; HTA, 40
C Pectoral fin flattened fin shape; dorsal body as yellow as head; HTA, 30
C Wide open mouth protruding anterior; well-developed pre-cloacal median fin fold; slender yolk; distinctly broader caudal fin fold; HTA, 20
C

Reprinted with permission from Tsai et al. (2013) hpf of gastrula, pharyngula, and hatching period is approximate

a

(Kimmel et al. 1995). Thus, from the zygote to blastula period, we provide a brief description of the developmental process and goldfish-specific features.

4.2.1.1

One-Cell Stage

Goldfish eggs exposed to water exhibit a perivitelline space. The chorion develops strong adhesiveness to the substrate (Fig. 4.4a). The surface of the goldfish chorion shows a whitish color under the microscope, and its transparency is lower than zebrafish eggs (Fig. 4.4b).

4.2 Embryonic Development of the Single-Tail Common Goldfish

81

Table 4.2 Postembryonic stages of the goldfish Stage name (Abb) Protruding mouth (prot) Posterior swim bladder (Psb) Caudal fin ray (Cr) Forked caudal fin (Fcf) Anterior swim bladder (Asb) Dorsal fin ray (Dr) Anal fin ray (Ar) Pelvic fin bud (Pb) Pelvic fin ray (Pr)

Juvenile

Adult

Descriptions (SL and dpf onset) Extended mouth, yolk, all fin folds remain; straight notochord at the caudal fin level (5 mm and 3 dpf) (Tsai et al. 2013) Inflation of the posterior swim bladder; lower jaw extension (5.6–5.7 mm and 5.7–5.8 dpf) More than four visible caudal fin rays, snout length longer than Psb, slightly bended caudal fin; this stage can be divided into sub-stages based on the number of fin rays (6.1–6.3 mm and 7.5–7.8 dpf) Appearance of a largely concaved point in the caudal fin, evident anal and dorsal fin condensation; slightly reduced dorsal and post-anal fin rays (6.8–7.0 mm and 13.6–13.8 dpf) Inflation of anterior swim bladder; enlarged anal and dorsal fin condensation (7.0–7.3 mm and 12.8–14.8 dpf) Dorsal fin ray appearance; larger anterior swim bladder lobe than Asb stage (7.5–7.8 mm and 18.0–20.0 dpf) Anal fin ray appearance; lack of the dorsal fin fold at the anal fin level, anterior swim bladder is larger than posterior swim bladder; curved triangle shape-like dorsal fin (8.2–8.4 mm and 22.3–24.0 dpf) Pelvic fin bud being visible from lateral side and equipping AER (8.7–9.0 mm and 26.0–27.0 dpf) Pelvic fin ray appearance; elongated most posterior dorsal and anal fin rays; trapezium shape dorsal and anal fins (11.0–11.2 mm and 31.0–31.1 dpf) Complete loss of the fin fold; incomplete squamation; posterior serrations at the anterior dorsal and anal fin ray; this stage can be divided into two sub-stages based on squamation patterns (17.0–17.6 mm and 45.2–49.2 dpf) Produce matured eggs and sperms; SL onset, 5 cm

Reprinted with permission from Li et al. (2015)

4.2.1.2

Cleavage Period (2-Cell to 64-Cell Stages)

Similar to other teleost fish species, the cleavage of the fertilized egg of goldfish is meroblastic and directly comparable to that of zebrafish (Kimmel et al. 1995). The first cleavage of the blastodisc cytoplasm begins around 40 min post-fertilization at 24
C and forms two blastoderms; subsequently, cleavage occurs every 25–30 min during this period (Fig. 4.5). The cleavage pattern is also the same with zebrafish. The vertically oriented cleavage furrow is apparent up to the 32-cell stage. The size and shape of the blastoderm cells are almost the same at the four-cell stage. The cells gradually differentiate from the eight-cell stage. From the 32-cell stage, the cells begin to assemble into a three-dimensional array with vertically elongated shapes (Fig. 4.5). After the generation of 64 cells, the blastoderm exhibits three layers when viewed from the lateral side (Fig. 4.5).

82

4 Development of the Wild-Type Goldfish

Fig. 4.2 Rates of development for embryos from the pharyngeal to the hatching period. Black circles show the developmental stage according to hours post fertilization. Red open circles indicate the rate of development for zebrafish at 28.5
C. The vertical green line indicates the hatching time of goldfish incubated at 25
C (Li et al. 1959). The dashed line indicates the linear regression for goldfish plots of embryonic periods. (Reprinted with permission from Tsai et al. 2013)

4.2.1.3

Blastula Period (128-Cell to Early Epiboly Stages)

Similar to that of zebrafish, the blastula period of goldfish is divided into nine stages; 128-cell, 256-cell, 512-cell, 1k, high, oblong, sphere, dome, and 30% epiboly stages (Fig. 4.6). Although 128-cell blastomeres are also arranged into a three-dimensional high mound of cells, the surface of the blastoderm is smoother than it is at previous stages (Fig. 4.6); this surface texture allow us to distinguish between 64-cell and 128-cell stages. From the 128-cell to the 1k stages, the boundary between the blastodisc and the yolk has similar morphological features. But the number of blastodermal cell layers may be used as a staging index (Table 3.1 and Fig. 4.6). Presumably due to its soft texture, the yolk of goldfish embryos tends to change shape. This flexible shape of the yolk makes it challenging to identify the stages in early embryos. However, the entire shape of the embryo of the goldfish tends to be elliptical, and the boundary between blastoderm and yolk tends to be smoother at the high stage (Fig. 4.6e). At the oblong stage, the boundary is almost unrecognizable. While the outline of embryos at high and oblong stages tends to exhibit slight elongation along the animal–vegetal axis, the outline of sphere stage tends to be a “compressed pear shape,” unlike the more spherical shape of zebrafish embryos at the equivalent stage (Fig. 4.6g) (Kimmel et al. 1995).

Fig. 4.3 Rates of development for embryos from the zygote to the segmentation periods. Black open circles indicate the ratio plot between embryonic stages and hours post fertilization (hpf). Red, green, and blue open circles indicate the rate of development for zebrafish embryos incubated at 28.5
C (Kimmel et al. 1995), and goldfish embryos incubated at 25
C (Li et al. 1959) or 20
C (Yamaha et al. 1999). The dashed lines indicate linear regression of goldfish staging during blastula and segmentation periods. The developmental rate in the gastrula periods is represented by the line plots; data points derived from the same embryos are connected by solid lines. (Reprinted with permission from Tsai et al. 2013)

4.2 Embryonic Development of the Single-Tail Common Goldfish 83

84

4 Development of the Wild-Type Goldfish

Fig. 4.4 One-cell stage of goldfish embryos. (a) Goldfish embryos spread on a plastic dish. (b) Side view of a fertilized egg. (Reprinted with permission from Tsai et al. 2013)

Fig. 4.5 Cleavage stages of embryos. Panels of (a-c, e, g, and h), and (d and f) show side and animal pole views, respectively. The stages are given in the upper right corners of each panel. Scale bar ¼ 0.5 mm. (Reprinted with permission from Tsai et al. 2013)

4.2 Embryonic Development of the Single-Tail Common Goldfish

85

Fig. 4.6 Side views of embryos at the blastula stage. The black arrows indicate the boundary between blastoderm and the yolk on the surface of embryos. White arrowheads and arrows indicate the internal margin between the blastoderm and the yolk. Scale bar ¼ 0.5 mm. (Reprinted with permission from Tsai et al. 2013)

A dome-like structure is visible in both goldfish embryos and zebrafish embryos (Fig. 4.6h) (Kimmel et al. 1995). Although a dome-like structure can be observed in some goldfish embryos at the oblong stage, the goldfish dome and oblong stages can be distinguished by the shape of the internal blastoderm margin; the outline of internal blastoderm margin of the dome stage is more evidently concave than that of oblong stage (Fig. 4.6h).

4.2.2

Gastrula Period (50% Epiboly to Bud Stages)

Following the zebrafish staging table, early gastrula period goldfish embryos can be categorized as 50% epiboly, germ ring, or shield based on the shape of the blastoderm (Kimmel et al. 1995) (Figs. 4.7 and 4.8). However, after the shield stage, zebrafish embryos are staged by percent-epiboly, which is difficult to apply to goldfish due to the soft texture of the yolk. To overcome this difficulty, the “percentage of blastopore closure (bc)” is defined as an additional index (Fig. 4.7).

86

4 Development of the Wild-Type Goldfish

Fig. 4.7 Indexes for staging of gastrula period embryos. (a, b) Schematic representation of early (a) and late (b) gastrula embryos. The percentage of epiboly and blastopore closure are defined as a Þ I:bd:AV and ðdia:DVdia:bp , respectively. dia.bp diameter of blastopore, dia.DV diameter percentage of I:ent:AV dia:DV of embryo along dorsal-ventral axis, l.bd.AV length of blastoderm along the animal–vegetal pole axis, l.ent.AV length of entire embryo along the animal–vegetal pole axis. (Reprinted with permission from Tsai et al. 2013)

This index is equivalent to “yolk plug closure” which were used in early studies of zebrafish, as well as other teleost species (Kimmel et al. 1989; le Pabic et al. 2009; Latimer and Jessen 2010). Our previous study indicated that the 60%, 90%, and 95% epiboly stages are nearly equivalent with 25%, 80%, and 85% bc. We provide descriptions of the developmental events occurring at these three early gastrula stages and the late gastrula stage (25%, 80%, and 85% bc).

4.2.2.1

50% Epiboly

The thickness of the blastoderm begins to be almost equal across the region at 40–45% epiboly and is almost fully uniform by 50% epiboly (Fig. 4.8a, b). At this stage, most embryos exhibit a slightly oval or roundish pear shape.

4.2.2.2

Germ Ring

There are no significant differences between 50% epiboly and germ ring stages according to percent-epiboly. The germ ring, the characteristic feature of this stage, can be observed as a stripe at the most vegetal-pole side of the blastoderm margin (Fig. 4.8c).

4.2 Embryonic Development of the Single-Tail Common Goldfish

87

Fig. 4.8 Gastrula stage embryos. Stages based on the index of “epiboly” are indicated in the upper right corner of panels of (a–o). Panels of (a, b), (c–j), and (o, k–m, and n) show side, left-side, rightside, and ventral views, respectively. The stages based on the blastopore closure are indicated in the lower left corner of panels of (f–n). The evidently thicker part of the blastoderm is indicated by black arrowheads in panels (d, f, g, h, i, j, k). White arrowhead in (e–k, m, o) indicate the dorsal side of the blastoderm margin. The white arrows indicate the concave parts of the yolk in panels (f, g). A well-developed polster and large yolk plug are indicated by black and white arrows, respectively, on the panels of (j–o). Scale bar ¼ 0.5 mm. (Reprinted with permission from Tsai et al. 2013)

4.2.2.3

Shield

The embryonic shield can be observed as a prominence on one side of the inner-face of the blastoderm margin. From the 50% epiboly stage to the shield stage, the shape of the yolk near the blastoderm margin tends to show significant changes, presumably due to the involution of the blastoderm (Fig. 4.8d, e).

4.2.2.4

25% bc

After the shield stage, more than half the yolk begins to be covered by the blastoderm. At this stage, the dorsal side of the blastoderm, including the embryonic shield, is obviously thicker than at the shield stage (see Fig. 4.8f).

4.2.2.5

80% bc

At the dorsal side of the blastopore, the tail bud prominence tends to become evident from this stage. The yolk around blastoderm margin exhibits a yolk plug shape.

88

4 Development of the Wild-Type Goldfish

From the lateral view, the most prominent part of the dorsal epiblast is observed at the anterior dorsal part of embryos at the 45% bc stage and subsequently moves anteriorly. The most thickened part of dorsal epiblast at the 70% bc stage represents the brain primordial region (Fig. 4.8g–k).

4.2.2.6

85% bc

From the lateral view, early polster can be recognized in most of embryos. Even as the blastopore is almost closed, the yolk tends to be exposed in some embryos. From the ventral view, the developing neural plate can be observed (Fig. 4.8l–n).

4.2.2.7

Bud

Distinctly prominent tail bud and polster can be recognized. The blastopore is completely closed, but a small amount of yolk is not covered by the blastoderm and is excluded from embryo, even throughout the somite stages (Fig. 4.8n, o).

4.2.2.8

Note on the Active Movement of Yolk and Staging of the Late Gastrula Stage

Although the bc works as a staging index for late gastrula stage goldfish embryos, the limitation of this staging index should also be noted. It is certain that the blastopore tends to become narrower and narrower over time. However, unlike the zebrafish epiboly process, during the closing process of blastopore, the size of the blastopore seems to oscillate (Fig. 4.9). Therefore, even though identically timed goldfish embryos may be photographed, the blastopore closure will show a certain level of variation (Fig. 4.9). This tendency is especially observable at early bc stages.

Fig. 4.9 Time-lapse images of a developing single-tail common goldfish embryo. Individual timelapse images from a representative gastrula-period embryo incubated at 24
C. Lapsed times are indicated at the upper left corner of each panel. Scale bar ¼ 0.1 mm. (Ota, unpublished data)

4.2 Embryonic Development of the Single-Tail Common Goldfish

4.2.3

89

Segmentation Period (6–22 Somite Stages)

Since the number of somites is easy to recognize under the microscope and shows little ambiguity, this characteristic may also be employed as a staging index for the segmentation period, as was done in zebrafish embryos (Kimmel et al. 1995). As goldfish embryos at the late gastrula stage exhibit one to five somites, this period overlaps slightly with last period (Fig. 4.10). Actually, in the embryos shown in Fig. 4.10a, b, the exposed yolk can be seen. With this exceptional developmental feature, goldfish embryos exhibit morphological similarity to zebrafish during the segmentation period (Kimmel et al. 1995). The rate of somite appearance is approximately two somites per hour in goldfish, which is consistent with that observation by Li et al. (1959). Five representative segmentation stages (6-, 10-, 14-, 18-, and 22-somite stages) are listed on the embryonic staging table (Table 4.1) and explained more in detail as follows.

4.2.3.1

6-Somite Stage

Cube-shaped developing somites are recognizable. Optic primordia exhibit horizontally elongated shape (Fig. 4.10a). The subdivision of rudimentary brain begins.

4.2.3.2

10-Somite Stage

The outline of the rudiment of the brain is recognized as a prominence at the dorsalanterior region (Fig. 4.10b). Subdivision of the rudiment of the brain allows one to recognize telencephalon, diencephalon, mesencephalon, and rhombomeric regions. Anterior somites exhibit rounded rectangular shape. Kupffer’s vesicles are recognized in a posterior view of 10–12 somite embryos (Fig. 4.10e).

4.2.3.3

14-Somite Stage

Somites exhibit a V-shape (Fig. 4.10c). The prominent tail bud region is clear. The distance between tail bud and the most anterior side of the head becomes narrower than at the 10-somite stage. Subdivision of the mesencephalon, cerebellum, and rhombomeric regions are evident, as also observed in 18-somite stage zebrafish embryos (Fig. 4.10c, f) (Kimmel et al. 1995). The posterior part of yolk is slightly contracted and extended posteriorly, as it begins to develop a yolk extension (Fig. 4.10c). Kupffer’s vesicles can be recognized from the lateral and posterior view to the protruded tail bud (Fig. 4.10c, f).

Fig. 4.10 Segmentation stage of goldfish embryos. (a–d) Left lateral view of the early segmentation stage embryo. (e–g) Dechorionated somite stage embryos. The optic primodium is indicated by the black arrowhead. Exposed yolk is indicated by white arrows in (a, b). Divisions of the brain rudiment are indicated by black arrowheads in panels (b, c). Construction of yolk and Kupffer’s vesicles are indicated by white asterisks and arrowhead in the panels (c, d, e, f). Scale bar ¼ 0.5 mm. (Reprinted with permission from Tsai et al. 2013)

90 4 Development of the Wild-Type Goldfish

4.2 Embryonic Development of the Single-Tail Common Goldfish

4.2.3.4

91

18-Somite Stage

The tail bud region is more protruded than it was at earlier stages (Fig. 4.10d).

4.2.3.5

22-Somite Stage

Highly sculptured brain primordia are formed. Lens primordia and otic vesicles can be recognized from the lateral view in live embryos and in histological sections of embryos at approximately the equivalent stage (Fig. 4.10a,b, g ). The floor plate is also visible at the dorsal side of the notochord in the live embryo (Fig. 4.10g). The yolk extension is elongated as a rod-like shape at approximately this stage. The median fin fold is recognized at the most posterior level (Fig. 4.10g). The trunk muscle begins to twitch at this stage. Horizontal histological sections show the notochord is not vacuolated, and certain somite cells attaching to the lateral side of notochord exhibit elongated shape in an anteroposterior direction; these elongated cells are presumably adaxial cells (Fig. 4.11).

4.2.4

Pharyngula Period (25–65% OVC)

After the number of the somites is more than 20, the yolk extension and post-cloacal region begin to elongate posteriorly, and subsequently, pigmentation and budding of the pectoral fin primordia may be observed (Fig. 4.12). Although it is possible to continue to count the somite number embryos beyond the 22-somite stage (Fig. 4.12g), it is unrealistic to employ the somite number as a staging index for such a late segmentation stage embryo. Moreover, after the completed set of somites is formed at the end of the caudal region, the number of the somites is unobservable. Thus, we identify the stage of goldfish embryos with somites at the caudal level using “otic vesicle closure” (OVC) (Fig. 4.13). According to early researchers (von Baer 1828; Gould 1977), the pharyngula period is a highly comparable stage among most of vertebrates, and the similarity of this mid-embryonic period has been explored using recent molecular techniques (Irie and Kuratani 2011). However, the staging indexes used to subdivide this embryonic period are highly divergent among researchers, presumably due to the divergent ontogenetic sequence of tissues and organs in this lineage and/or available technology. As such, the degree of the lateral line primordia (prim) was used as a staging index for zebrafish, but no other reports have used the prim index for stage identification of teleost embryos following the zebrafish staging table (Kimmel et al. 1995; Martinez and Bolker 2003; Iwamatsu 2004; Hall et al. 2004; Fujimoto et al. 2004; Fujimura and Okada 2007; Hinaux et al. 2011). The reason prim stages have not used by other researchers is probably due to the difficulty and effort required to optimize protocols for observing the lateral line

92

4 Development of the Wild-Type Goldfish

Fig. 4.11 Histological section of 20- to 22-somite stage embryos. (a) Transverse section at the optic level. (b) Horizontal section at the otic level (the upside is posterior). (c) Horizontal section at the trunk level (the upside is anterior). Scale bars ¼ 0.1 mm (a, b), 0.05 mm (c). (Reprinted with permission from Tsai et al. 2013)

primordia, as indicated in Kimmel et al. (1995). In our previous research, we were also unable to apply the prim staging index for goldfish embryos (Tsai et al. 2013) because of low transparency, whitish color, and thicker size of goldfish embryos in comparison with zebrafish embryos. These goldfish embryonic features made it exceedingly difficult to optimize the conditions for differential interference contrast (DIC) microscopic observation of the prim.

4.2 Embryonic Development of the Single-Tail Common Goldfish Fig. 4.12 Pharyngula stage embryos. The left column shows the left side view of the entire body of pharyngula stage embryos (a, b, c, d). Middle and right columns show magnified views of the anterior and posterior regions in the same embryos (a0 , b0 , c0 , d0 , a00 , b00 , c00 , and d00 ). The stages based on OVC are indicated in the right upper corner of the first column panels (a– c). Pectoral fin buds and otic vesicles are indicated by black arrowheads and arrows, respectively. The white arrowhead indicates a gap in the melanocyte pattern at the caudal level in the ventral aspect (d00 ). Scale bar ¼ 1 mm in (a–d), 0.1 mm in (a0 d0 ). (Reprinted with permission from Tsai et al. 2013)

93

94

4 Development of the Wild-Type Goldfish

Fig. 4.13 Schematic drawing of pharyngula embryos. Left side view of early (a) and late pharyngula stage embryos (b). Blue arrows indicate the shortest distance between the posterior end of the eye and the anterior end of the otic vesicles (dist.e.ot). Red arrows indicate the length of the major axis of the otic vesicle (l.ot). The percentage of otic vesicle closure (OVC) is defined as l:ot ðl:otþdist:e:otÞ. (Reprinted with permission from Tsai et al. 2013)

On the other hand, the measurement of OVC does not require DIC microscopic observation. A stereomicroscope with oblique light allows us to examine the OVC. This index is derived from the “otic vesicle length” (OVL) in the zebrafish embryonic staging table (Kimmel et al. 1995) (Fig. 4.13). OVC increases from approximately 20% to more than 60% and is inversely proportional to OVL, allowing the categorization of goldfish embryos in the pharyngeal period into three different stages (25% OVC, 35% OVC, and 65% OVC).

4.2.4.1

25% OVC

When embryos are equipped more than 30 somites, pigmentation can be recognized in the retina and skin (Fig. 4.12a–a00 ). Ellipse-shaped otic vesicles, blood flow in the common cardinal vein (duct of Cuvier), a heartbeat, and pectoral fin buds are recognized as characteristic features of this period at the anterior body level (Reib 1973; Zhong 2005) (Fig. 4.12a0 ). Median fin folds appear at the dorsal and ventral sides at the posterior body level (Fig. 4.12a00 ). From these embryonic characteristics, this stage of goldfish seems to be equivalent to the prim-5 stage of zebrafish embryos.

4.2.4.2

35% OVC

In comparison with the 25% OVC stage, pigmentation of retina, heartbeat, and prominent pectoral fin bud are more evident (Fig. 4.12bb0 ). In addition, melanocytes tend to appear at the entire body level, the median fin fold at the caudal part is dorsoventrally enlarged (Fig. 4.12b00 ) and the otic vesicles change into a more roundish shape (Fig. 4.12b0 ).

4.2 Embryonic Development of the Single-Tail Common Goldfish

95

Fig. 4.14 Histological section of embryos during the pharyngula period. (a) Horizontal section at the nasal pit level. (b, c) Transverse sections at the optic (b) and otic (c) levels, respectively. (d) Transverse section at the level of the pectoral fin bud. (e–i) Transverse sections at the level of the anterior yolk extension. (j) Horizontal section of the trunk region. Scale bars ¼ 0.1 mm. (Reprinted with permission from Tsai et al. 2013)

Examination of transverse histological sections at a more developed stage (60% OVC) demonstrates that the teleoncephalon, nasal pit, liver, and heart ventricle and atrium, pronephric duct, and vacuolated notochord are already formed by this stage (Fig. 4.12c–c0 and Fig. 4.14a–h). Median fin folds mainly consist of ectodermal epithelial cells but also contain some mesenchymal cells (Figs. 4.12c00 and 4.14hi). In a horizontal histological section of the trunk region, anteroposteriorly elongated myotomes consisting of several multinucleated muscle fibers can be observed

96

4 Development of the Wild-Type Goldfish

(Fig. 4.14j). At this stage, the EL is around 3.4–3.5. These characteristics of goldfish embryos are similar to the prim-10 to -20 stages in zebrafish embryos.

4.2.4.3

65% OVC

The contrast between pigmented and non-pigmented areas all over the body is more evident at this stage (Fig. 4.12dd0 ). Most of the embryos show a gap in the melanocyte patterns at the caudal level in the ventral aspect (Fig. 4.12d00 ). The shape of the pectoral fin bud from the lateral view also changes to become asymmetric; the anterior face is smoother than the posterior face in the outline of pectoral fin (from lateral view), and the ratio of height and width of the pectoral fin bud is greater than 0.5 (Fig. 4.12d0 ).

4.2.5

Hatching Period (Long-Pec to Protruding-Mouth)

Around 3 days post-fertilization, goldfish progeny tend to hatch. However, their hatching time and stages are not always synchronized among individuals, even within the same clutch of embryos (Yamaha et al. 1999). This difference in hatching timing is partly controlled by several different environmental factors (e.g., temperature, egg density, and oxygen concentration) (Kimmel et al. 1995; Yamaha et al. 1999). More significantly, this unsynchronized hatching time suggests that this occurrence cannot directly be used as a staging index of goldfish. Unsynchronized hatching time seems to be a common tendency in both goldfish and zebrafish embryos. Fortunately, the shape of the pectoral fin bud, the head-trunk angle (HTA), and xanthopore pigmentation patterns have been employed for stage identification of zebrafish and are similarly available for goldfish stage identification.

4.2.5.1

Long Pec

A pale yellow color (xanthophores) appears on the dorsal side, from the head to the anterior half of the trunk. The pectoral fin bud elongates posteriorly and extends the height-to-width ratio to approximately 1.5 (Figs. 4.15 and 4.16). The median fin fold at the caudal end enlarges and expands in dorsoventral direction. The HTA is approximately 40
, although it varies between individuals. In some embryos, the mouth opening can be recognized on the ventral aspect of the head (Fig. 4.17).

4.2.5.2

Pec Fin

Almost all embryos have hatched by this stage. The xanthophore-positive area extends to the caudal region. The head tilts slightly upward in comparison with the

4.2 Embryonic Development of the Single-Tail Common Goldfish Fig. 4.15 Hatching stage larvae. Panels (a, b, c) show left side views of larvae. Panels (a0 , b0 , c0 ) are magnified views of the anterior region of the same larvae. White arrowheads, black arrowheads, black arrows, black asterisks, white asterisks, and red arrowheads indicate mouth, cloacae, heart, otic vesicles, common cardinal vein, and anterior horn, respectively. Scale bars ¼ 1 mm in (a, c, e), 0.1 mm in (a', b', c'). (Reprinted with permission from Tsai et al. 2013)

97

98

4 Development of the Wild-Type Goldfish

Fig. 4.16 Pectoral fin of hatching stage larvae. (a, b) Left lateral views of the pectoral fin in long pec and pec fin stage larvae. (c, d) Dorsal views of early pec fin and late pec fin stage larvae. The distal end of the pectoral fin is indicated by a white arrowhead. The apical fold of the pectoral fins in (c, d) are indicated by brackets. Otic vesicles and pigmented common cardinal veins are indicated by black and white asterisks, respectively. Scale bars ¼ 0.1 mm. (Reprinted with permission from Tsai et al. 2013)

long pec fin stage; the HTA is approximately 30
. The pectoral fin bud elongates further and develops actinotrichia. From the early to late pec fin stage, an approximate twofold increase in the size of apical fin fold of pectoral fin can be observed, similar to zebrafish (Fig. 4.15) (Yano and Tamura 2013). In transverse sections of the head region of hatching stage larva (pec fin stage), staining with hematoxylin and eosin reveals the eyes have six different layers (ganglion cell layer, inner plexiform layer, inner nuclear layer, outer plexiform layer, outer nuclear layer, and retinal pigment epithelium; Fig. 4.18a) (Gross et al.

4.2 Embryonic Development of the Single-Tail Common Goldfish

99

Fig. 4.17 Mouth opening of early hatching stage larvae. (a) Ventral view of the head of a long pec fin stage embryo. (b) oblique ventral view of the head of a pec fin stage embryo fixed with Bouin’s fixative. White arrowheads indicate mouth opening. Scale bars ¼ 0.1 mm. (Reprinted with permission from Tsai et al. 2013)

2005). Chondrogenesis of parachordal and trabecula cartilage can also be observed at the otic vesicle level in the transverse section (Schilling and Kimmel 1997) (Fig. 4.18b).

4.2.5.3

Protruding Mouth (Prot)

The dorsal side of the entire body is pigmented by xanthophore. The HTA is approximately 20
. The position of the heart moves toward the dorsal direction; the head approaches the ventral cranial region (Fig. 4.15c). Mouth opening is more anterior compared with the pec fin stage (Fig. 4.15c0 ). In live specimens, cartilaginous structures can be observed at the cranial level. Moreover, in horizontal sections, cartilaginous tissues of otic vesicles, branchial arches, and pectoral fins are also present (Fig. 4.18c, d). The swim bladder primordia can be recognized in transverse and horizontal sections (Fig. 4.18c, e). The ventral median fin appears more concave at the level of the cloaca in comparison with pec fin stage (Fig. 4.15c). As such, the pre- and post-cloacal fin folds become defined. In transverse histological sections, alcian blue-positive tissues can be observed in median fin folds (Fig. 4.18f–k). The height of the caudal median fin fold is larger than in previous stages. A number of eosin-positive muscle fibers and myoseptums are observed in horizontal sections at the mid-trunk level (Fig. 4.18l). Since almost all healthy embryos have hatched by this stage, the prot stage can be considered an intermediate stage between embryo and larva.

Fig. 4.18 Histological section of hatching stage larva. (a, b) Transverse sections at the eye and otic levels, respectively. (c, d) Horizontal sections at the otic vesicle and eye levels, respectively. (e–k) Transverse sections at the levels of the posterior end of the pectoral fin. (l) Horizontal section of trunk. Arrows indicate myoseptum. Scale bars ¼ 0.1 mm. (e–k) are shown at the same magnification. (Reprinted with permission from Tsai et al. 2013)

100 4 Development of the Wild-Type Goldfish

4.3 Post-embryonic Developmental Process

101

Fig. 4.19 Relationship between total length and days post-fertilization. The growth rates of individually and collectively maintained goldfish progenies are represented by scatter plots with black- and white-filled points, respectively. Regression lines of individually and collectively maintained goldfish are shown as dashed and dotted lines, respectively. Different point shapes indicate different clutches. The 95% confidence intervals are indicated as gray areas. (Reprinted with permission from Li et al. 2015)

4.3

Post-embryonic Developmental Process

Since almost all goldfish progeny have hatched and started to actively swim and feed at the prot stage, this stage can be set as the starting point of larval stages (Li et al. 2015). It is known that the growth rate of individual larvae is influenced by the maintenance conditions: for example, individually and collectively maintained goldfish exhibit significant differences in growth rate (Fig. 4.19). Larvae of the single-tail common goldfish were carefully evaluated for the following ten traits: (1) inflation of the posterior lobe of the swim bladder; (2) appearance of caudal fin rays; (3) appearance of the forked caudal fin; (4) inflation of the anterior lobe of the swim bladder; (5) appearance of the dorsal fin ray; (6) appearance of the anal fin ray; (7) appearance of apical ectodermal ridge on the pelvic fin bud; (8) appearance of the pelvic fin ray; (9) disappearance of the fin fold; and (10) appearance of scales. These traits are

102

4 Development of the Wild-Type Goldfish

Fig. 4.20 Relationship between median fin ray numbers and standard length (SL) (a) and dpf (b). The relationships between caudal (top), dorsal (middle), and anal (bottom) fin ray number and standard length in individually maintained juveniles are plotted. The juveniles from different clutches are indicated by differently shaped points. (Reprinted with permission from Li et al. 2015)

easily visible under a stereomicroscope from the lateral view, not only in live specimens but also in fixed samples. In fact, the number of caudal, dorsal, and anal fin rays can be counted from the lateral view, and these quantifiable traits provide objective indexes for stage identification (Fig. 4.20). Importantly, it was demonstrated that the appearance order for these traits is correlated with both standard length and days post fertilization in two different lineages of the single-tail common goldfish strains: one derived from the Japanese single-tail Wakin strain, with the other being the single-tail common goldfish population found in Taiwan (Fig. 3.1) (Li et al. 2015, 2019). Based on the appearance order and timing of these anatomical traits, hatched goldfish larvae proceed through protruding mouth (prot), Posterior swim bladder lobe (Psb), Caudal fin ray (Cr), Forked caudal fin (Fcf), Anterior swim bladder (Asb), Dorsal fin ray (Dr), Anal fin ray (Ar), Pelvic fin bud (Pb), and Pelvic fin ray (Pr) stages. Moreover, the goldfish progeny exhibiting scales covering the entire surface of the body are categorized as juvenile stage, and sexually mature individuals are called adult (Fig. 3.1). Here, we review the characteristic features of each postembryonic stage.

4.3 Post-embryonic Developmental Process

4.3.1

103

Larval Period

Although nine larval periods are defined, some morphological changes can be seen in the same larval stage. To describe these intra-stage differences, we provide more detailed descriptions by dividing some stages into sub-stages. The sub-stages are Fig. 4.21 Late protruding mouth stage larva. Lateral views of the whole body (a), anterior (b), mid-trunk (c), and caudal (d) regions of protruding mouth stage larva. The arrowhead indicates caudal fin condensation (d). Scale bars ¼ 1 mm in (a); 0.1 mm in (b–d). (Reprinted with permission from Li et al. 2015)

104

4 Development of the Wild-Type Goldfish

designated by adding a prefix representing a time-point (for example, “early” or “late”) or a suffix indicating the number of a countable staging index (for example, “Cr4” represents the Cr stage with four caudal fin rays). Fig. 4.22 Psb stage larvae. Lateral views of the whole body (a), anterior (b), mid-trunk (c) and caudal (d) regions. The arrowhead indicates caudal fin condensation (d). Scale bars ¼ 1 mm in (a); 0.1 mm in (b–d). (Reprinted with permission from Li et al. 2015)

4.3 Post-embryonic Developmental Process

105

Fig. 4.23 Late Psb stage larvae. Lateral views of the whole body (a), anterior (b), mid-trunk (c) and caudal (d) regions. The arrowhead indicates the caudal fin condensation area (d). Asterisks indicate undigested brine shrimp eggs. Scale bars ¼ 1 mm in (a); 0.1 mm in (b–d). (Reprinted with permission from Li et al. 2015)

4.3.1.1

Prot Stage

Although the swim bladder has not yet developed completely, its primordia is evident in the late prot stage. At the same time, the lower jaw is also well developed in the late prot stage larvae (compare Figs. 4.16cc0 and 4.21). Due to this underdevelopment of the swim bladder, larvae at this stage tend to stay near the bottom of the aquarium. This stage is quite similar to the zebrafish prot stage (Tsai et al. 2013).

106 Fig. 4.24 Cr4 sub-stage larvae. Lateral views of the whole body (a), anterior (b), mid-trunk (c), and caudal (d, e) regions. The black arrowhead indicates flection of the notochord. Four caudal fin rays are visible (indicated by black arrows in e). Developing fin rays are indicated by white arrowhead. Scale bars ¼ 1 mm in (a); 0.1 mm in (b–e). (Reprinted with permission from Li et al. 2015)

4 Development of the Wild-Type Goldfish

4.3 Post-embryonic Developmental Process

4.3.1.2

107

Psb

The larvae at this stage are equipped with a posterior swim bladder and tend to stay at the surface or middle of the tank (Fig. 4.22). Although some yolk still remains, the larvae show active feeding behavior and undigested feed can be observed in the gut of late Psb stage larvae (Fig. 4.23). Condensation of the caudal fin primordial mesenchymal cell population can be recognized as an opaque region at the ventral side of the notochord (at the caudal level). This stage is similar to the swim bladder posterior lobe (pSB) in zebrafish (Parichy et al. 2009). The lower jaws and mouth opening extend more toward the anterior from Prot stage to late Psb stages (Figs. 4.22b and 4.23b). Moreover, the sizes of the yolk and swim bladder are changed greatly between early and late Psb stages (Figs. 4.22b, c and 4.23b, c).

4.3.1.3

Cr

Based on the number of fin rays, the larvae at this stage can be further categorized into sub-stages. Here we explain the phenotypic features of larvae having four caudal fin rays (Cr4) and 17 caudal fin rays (Cr17). By the Cr4 sub-stage, the residual yolk has been completely consumed (Fig. 4.24). The notochord exhibits slight flection and caudal fin rays can be recognized at the caudal level (Fig. 4.24). Under the light microscope, these caudal fin rays are first visible in larvae with a standard length of 6.4–6.6 mm, and subsequently their number is increased in larvae from 6.5 to 7.5 mm. The increase in number of caudal fin rays is coincident with the developmental of the notochord at the caudal level. The notochord at the caudal level of Cr17 sub-stage larvae is more upward oriented than that of Cr4 sub-stage larvae (Fig. 4.25). Moreover, caudal fin skeletons are visible under the light microscope in Cr17 sub-stage larvae (Fig. 4.25). Although the dorsal and anal fin folds are quite transparent throughout the Cr stages, slightly opaque regions may be observed at the anal and dorsal fin primordial regions (Fig. 4.25).

4.3.1.4

Fcf

The outline of the caudal fin starts to change when the tissue contains more than 20 caudal fin rays. Larvae exhibiting a homocercal-shaped caudal fin can be distinguished from Cr stage larvae, allowing the fish to be categorized as Fcf stage larvae. Fcf stage larvae show two concaved points in the caudal fin (Fig. 4.26). One concaved point divides the upper and lower caudal fin lobe, designated as the cleft (Rolland-Lagan et al. 2012; Goldsmith et al. 2003), and precedes a diastema at later stages. The other concaved point on the upper lobe of the caudal fin disappears at later stages (Fig. 4.26). At this stage, the caudal skeleton, the opaque regions of anal and caudal fin primordia are more evident (Fig. 4.26).

108

4 Development of the Wild-Type Goldfish

Fig. 4.25 Cr17 sub-stage larvae. Lateral views of the whole body (a), head (b), swim bladder (c), dorsal fin (d), cloaca (e), and caudal fin (f) regions. Black and white arrows indicate condensation of cells in the dorsal and anal fins, respectively. Black and white arrowheads indicate the bending point of the notochord and caudal fin skeletons, respectively. Scale bars ¼ 1 mm in (a); 0.1 mm in (e, f). (b–e) are the same magnification. (Reprinted with permission from Li et al. 2015)

Fig. 4.26 Fcf stage larvae. Lateral views of the whole body (a), head (b), swim bladder (c), dorsal fin (d), cloaca (e), and caudal fin (f) regions. The whole arrowhead indicates the concave point of the fin fold (f). The black arrowhead indicates a large concave point that divides the upper and lower caudal fin lobes (f). Asterisks indicate the narrowest level of the fin fold at the caudal peduncle region (e, f). Twenty caudal fin rays can be observed (f). Scale bars ¼ 1 mm in (a); 0.1 mm in (c, e). Panels (b, c) are at the same magnification, as are (d, e). (Reprinted with permission from Li et al. 2015)

110

4 Development of the Wild-Type Goldfish

Fig. 4.27 Asb stage larvae. Lateral views of the whole body (a), head (b), swim bladder (c), dorsal fin (d), and caudal fin (e) regions. Black and white arrows indicate condensation of the dorsal and anal fins, respectively (d). Scale bars ¼ 1 mm in (a); 0.1 mm in (b–e). (Reprinted with permission from Li et al. 2015)

4.3.1.5

Asb

The appearance of the anterior lobe of the swim bladder clearly distinguishes this stage from previous stages (Fig. 4.27). This swim bladder is clearly visible from the lateral view, with round shape and smaller size compared to the posterior swim bladder. Notably, the posterior swim bladder is oval in shape (Fig. 4.27). On the dorsal and post-anal fin fold, opaque anal and dorsal fin primordia are more apparent

4.3 Post-embryonic Developmental Process

111

Fig. 4.28 Dr stage larvae. Lateral views of the whole body (a), head (b), swim bladder (c), mid-trunk (d), dorsal fin (e), anal fin (f), caudal fin (g), and dorsal side of the caudal fin (h) regions. Panel (h) is a magnified view of the boxed area (dashed lines) in (g). Black and white arrows indicate condensation of the dorsal and anal fins, respectively (e, f). Several caudal fin rays have three segments (h). Scale bars ¼ 1 cm in (a); 0.1 cm in (b–h). (Reprinted with permission from Li et al. 2015)

than at previous stages (Fig. 4.27). Caudal fin rays are elongated, and joints are recognized in some (Fig. 4.27).

4.3.1.6

Dr

Whether dorsal fin rays are visible or not allows one to distinguish this stage from the previous stage. The anterior swim bladder at this stage is enlarged compared to the previous stage. The dorsal and post-anal fin folds are reduced in size. The reduction in size of the post-anal fin fold at the level proximate to anal fin primordia is especially evident (Fig. 4.28). The notochord at the caudal level highly reflects, and the caudal fin exhibits almost symmetrical homocercal shapes (Fig. 4.28).

112

4 Development of the Wild-Type Goldfish

Fig. 4.29 Ar stage larvae. Lateral views of the whole body (a, b), anterior (c), posterior (d), swim bladder (e), dorsal fin (f), anal fin (g), and dorsal part of the caudal fin (h). Panels of (a, b) were photographed under different light conditions. The black arrowhead indicates the interior end of the pre-anal fin fold (c). The black asterisk indicates the narrowest region of the dorsal fin fold (d). White asterisks indicate iridophores in the intestine area (e). Scale bars ¼ 1 mm in (b, d); 0.1 mm in (g, h). Panels (a–g) are the same magnifications. (Reprinted with permission from Li et al. 2015)

4.3.1.7

Ar

Upon the appearance of more than approximately eight dorsal fin rays, anal fin rays become recognizable. The anterior lobe of the swim bladder is larger than the posterior lobe of the swim bladder (Fig. 4.29). The dorsal fin fold at the level of the anal fin is almost completely eliminated, and several dorsal fin rays are divided by one or two joints (Fig. 4.29). The numbers of joints in the caudal fin rays are also increased. Unlike zebrafish, in which anal fin rays appear first and are followed by dorsal fin rays, the anal fin rays of goldfish develop after the appearance of dorsal fin rays (Li et al. 1959).

4.3 Post-embryonic Developmental Process

113

Fig. 4.30 Pb stage larvae. Lateral views of the whole body (a, b), head (c), swim bladder (d), ventral side of the mid-trunk (e), pelvic fin bud (f), dorsal fin (g), anal fin (h), and caudal fin (i). Panels (a, b) were photographed under different light conditions. Panel (f) is a magnified view of the boxed area (dashed lines) in (e). Scale bars ¼ 1 mm in (b, c, i); 0.1 mm in (f). Panels (a–e, g, h), are at the same magnifications. (Reprinted with permission from Li et al. 2015)

4.3.1.8

Pb

The presence of a well-developed apical epithelial ridge at the ventral lateral side of body distinguishes this stage from previous stages (Fig. 4.30). Since budding of the pelvic fin bud is continuous and its time of appearance is influenced by genetic and environmental factors (Figs. 4.31 and 4.32), the presence of a well-developed apical epithelial ridge may be utilized as an index at this stage, providing an unambiguous criterion. Although the budding process of the pelvic fin bud began at an earlier stage (Asb) in some individuals and can be detected at the histological level (Fig. 4.32), the apical epithelial ridge (or blade-like pelvic fin bud) tends to appear in larvae which already exhibit both dorsal and anal fin rays (Fig. 4.32j, j0 ). More specifically stated, an individual with anal fin rays will exhibit a prominent pelvic fin bud with an apical epithelial ridge; the region of condensed mesenchymal cells (the budding region) can be easily detected from the lateral side (Figs. 4.31j and 4.32j0 ). While dorsal and post-anal fin folds are largely reduced in size, the pre-anal fin fold is still present at this stage (Figs. 4.30b and 4.31l).

4.3.1.9

Pr

According to the appearance of pelvic fin rays, this stage is distinguished from the Pb stage. It is difficult to observe pelvic fin rays compared to the fin rays of median fins because the angle of the surface of this fin differs from that of median fins in a lateral view. However, pelvic fin rays can be recognized clearly under high magnification. At this stage, there are almost no remaining signs of the dorsal and post-anal fin folds

114 Fig. 4.31 Pelvic fin bud development in single-tail common goldfish. (a–c) Lateral views of a three dorsal fin ray stage larva. (d–f) Lateral views of an eight dorsal fin ray stage larva. (g–j) Lateral views of a three anal fin ray stage larva. (k, l) Lateral views of a pelvic fin bud stage larva. Panels (b, e, h) show fluorescence. Panels (c, f, j, l) are magnified views of (a, d, g, k), respectively. Black and white arrowheads indicate dorsal and anal fins, respectively. Black arrows mark pelvic fin or its primordia. Scale bars in (a, b, d, e, g, k) ¼ 1 mm. Scale bars in (c, f, h, i, j, l) ¼ 0.1 mm. (Reprinted with permission from Li et al. 2015)

4 Development of the Wild-Type Goldfish

4.3 Post-embryonic Developmental Process

115

Fig. 4.32 Development and variation of pelvic fin bud in single-tail common goldfish. First-row and second-row panels show oblique lateral views of fixed larvae and corresponding magnified views (a, a', c, c', e, e', g, g', i, and i'). Third-row and fourth-row panels are hematoxylin, eosin, and alcian blue-stained sections of larvae and corresponding magnified views (b, b', d, d', f, f', h, h', j, and j'). Black asterisks indicate pelvic fin bud primordia. Arrows in panels indicate apical ectodermal ridges of pelvic fin bud. Scale bars first row ¼ 1 mm. Scale bars second and third rows ¼ 0.1 mm. Scale bars fourth row ¼ 0.01 mm. (Reprinted with permission from Li et al. 2015)

and the size of the pre-anal fin fold is also largely reduced in comparison with previous stages. The posterior regions of the dorsal and anal fins extend, and consequently these fins form a trapezoid shape (Fig. 4.33).

4.3.2

Juvenile

The complete loss of fin folds is defined as the start of the juvenile stage in goldfish. In our previous observations, there are two types of fin-fold-less juveniles. One is a completely scaled juvenile, and the other is not; the former is a late-stage juvenile, and latter is an early-stage juvenile. Thus, these two types of juveniles are divided into “Incompletely scaled juvenile (IsJ)” and “Completely scaled juvenile (CsJ).”

116

4 Development of the Wild-Type Goldfish

Fig. 4.33 Pr stage larvae. Lateral views of the whole body (a, b), anterior (c), trunk (d), pelvic fin (e), dorsal fin (f), anal fin (g), posterior (h), and caudal (i) regions. Panels (a, b) were photographed under different light conditions. Black asterisks indicate fin rays. Scale bars ¼ 1 mm in (b, d, h); 0.1 mm in (e, g, i). Panels (a–d, f, g) are at the same magnifications. (Reprinted with permission from Li et al. 2015)

4.3 Post-embryonic Developmental Process

117

Fig. 4.34 IsJ sub-stage specimen. Lateral views of the whole body (a), anterior (b), mid-trunk (c), dorsal (d), anal fin (e), and caudal fin (f) regions. Black asterisks indicate scale-missing region from the anterodorsal trunk. Back arrowhead indicates posterior serrations in the dorsal and anal fin rays (d, e). Scale bars ¼ 1 mm. Panels (d, e) are the same magnification. (Reprinted with permission from Li et al. 2015)

4.3.2.1

IsJ Sub-stage

Almost the entire lateral side of the trunk region is covered by scales (Fig. 4.34), but the anterior dorsal trunk region does not yet have scales. In both anal and dorsal fins, one fin ray is evidently thicker than the others and exhibits segmentally posterior serrations; this thick fin ray is designated as the “segmented fin spine” by Li et al. (2015) and “hard ray” by Smartt (2001).

118

4 Development of the Wild-Type Goldfish

Fig. 4.35 CsJ sub-stage specimen. Lateral views of the whole body (a), head (b), dorsal fin (c), pelvic fin (d), and anal fin (e). Scale bars ¼ 1 mm. (Reprinted with permission from Li et al. 2015)

4.3.2.2

CsJ Sub-stage

The anterior dorsal part of the trunk region is completely covered by scales at this sub-stage (Fig. 4.35). External skeletal morphology of this sub-stage is almost the same as that of the adult stage. The variation of pigmentation patterns between strains and individuals is often observable from this stage.

4.4 Development of the Skeletal System

4.3.3

119

Adult

Goldfish progenies of over 5 cm standard length exhibit external sexual traits (Figs. 3.1, 3.2, and 3.3). Males tend to show breeding tubercles on the opercular and pectoral fins, and mature sperm can be recognized during the breeding season. Mature females exhibit prominent cloaca, similar to zebrafish (Dranow et al. 2013).

4.4

Development of the Skeletal System

At relatively early larval stages, several calcified skeletal tissues are formed, and these hard skeletal tissues usually maintain their position into the adult stage. This property hard skeletal tissues allows us to monitor the basic body architecture and developmental trajectory of individual goldfish progenies. Thus, here we describe the developmental process of the calcified skeletal system at larval and juvenile stages, focusing on the different body levels, paired, and median fins.

4.4.1

Cranial Region

Changes of cranial morphology are evident in the mouth region (length of snout and jaw) under the light microscopic view. These morphological changes are consistent with the appearance of calcified tissues. First, the cleithrum, fifth ceratobranchial, opercular, and dentary can be observed as calcein-positive skeletal elements at the prot stage (Fig. 4.36a, a0 ). Subsequently, cranial skeletons, including hyoid, maxilla, branchiostegal, quadrate, and occipital bones and otic capsule are detected as calcified tissues at Psb stage (Fig. 4.36). From Cr4 to Cr16 sub-stages, the anguloarticular, retroarticular, interopercular, subopercle, premaxilla, metapterygoid, and first to fourth ceratobranchials may be identified by calcein staining methods (Fig. 4.36). The kinethmoid and palatine, which are related to suction feeding, are also recognized in the Pr stage (Fig. 4.37a, b). At the CsJ stage, the highly calcified frontal is observed (Fig. 4.37c, d). In alizarin red opaque samples at Fcf stage, most of the branchial and facial bones are visible on the surface of the cranial region from a lateral view (Fig. 4.38a). The skeletal elements located on the dorsal side (parietal, frontal, posttemporal, and pterotic) tend to become visible at later stages (Fig. 4.38b, c). The ventral views of alizarin red-stained opaque samples from the Pb to IsJ stages, skeletal elements of hyoid and branchial arches (basihyal, branchiostegal rays, ceratohyal, ventral hypohyal, urohyal) as well as facial bones (anguloarticular, retroarticular, dentally, quadrate, inter-opercular, sub-opercular) are observable (Fig. 4.39). The ceratohyal, ventral hypohyal, and urohyal at the Pr and IsJ stages are often obscured by developing hypobranchial muscles (Fig. 4.39).

120

4 Development of the Wild-Type Goldfish

Fig. 4.36 Development of cranial skeleton in early juveniles. Left and right columns show the light field (a–d) and fluorescence (a0 –d0 ) views. Stages (and sub-stages) and standard length are labeled in the upper right and lower left corners of panels (a–d). Scale bars ¼ 0.1 mm in (a–d). Panels in the same column are the same magnification. (Reprinted with permission from Li et al. 2015)

4.4 Development of the Skeletal System

121

Fig. 4.37 Alizarin red-stained cranial skeletons. Left and right columns show the light field (a, c) and fluorescence (b, d) views. Stage (and sub-stage) and standard length are labeled in the upper right and lower left corners of panels (a, c). Panels (c, b) are identical fish panels (a, d) in Fig. 3.4. Scale bars ¼ 1 mm. (Reprinted with permission from Li et al. 2015)

4.4.2

Mid-Trunk Skeleton

A segmented vertebral centrum can be detected in calcein-stained Psb stage larvae; at this stage, around 15 calcified vertebral centrums can be observed from a lateral view (Fig. 4.40a). The number of calcified centrums increases during development, and the number of the vertebral centrums at the Fcf stage reaches the same number as found in the adult (30 from first vertebral column to the most posterior vertebral centrum, which comprise the hermal spine—the second preural) (Fig. 4.40a–e). While the neural spines are visible on the dorsal side of the vertebral elements at the Cr16 stage, ventral axial skeletal elements (hermal spine and ribs) are not visible at the mid-trunk regions (Fig. 4.40d). These ventral axial skeletal elements can be observed at the Fcf stage (Fig. 4.40e). In comparison with these axial skeletal elements, superneuralis elements tend to appear at later stages (Fig. 4.41). These elements are recognizable at the dorsal aspect of the fourth vertebral body from Pr

122 Fig. 4.38 Lateral external surface of the cranial skeleton. Stage (and sub-stage) and standard length (mm) are labeled in the upper right corners of each panel (a–c). Scale bars ¼ 1 mm. (Reprinted with permission from Li et al. 2015)

Fig. 4.39 Ventral external surface of the cranial skeleton. Stages (and sub-stage) and standard length are labeled in the upper right and lower left corners of each panel (a–c). Scale bars ¼ 1 mm. (Reprinted with permission from Li et al. 2015)

4 Development of the Wild-Type Goldfish

4.4 Development of the Skeletal System

123

Fig. 4.40 Development of calcein-stained axial skeleton in early larval stage. Stage (and sub-stage) and standard length are labeled in the upper right and lower left corners of each panel (a–e). White arrowheads indicate the calcified vertebra at the most posterior end. The white arrow indicates the calcified region on the dorsal side of the notochord. Scale bars ¼ 1 mm. The image is modified from Li et al. (2015). (Reprinted with permission from Li et al. 2015)

124

4 Development of the Wild-Type Goldfish

Fig. 4.41 Axial skeleton in alizarin red-stained Pr stage and CsJ sub-stages. Stage (and sub-stage) and standard length are labeled in the upper right and lower left corners of each panel. First, second, and third row panels show entire body, magnified view of mid-trunk and Weberian apparatus, respectively. White asterisks in (b, d) indicate the radials located at the ninth vertebral level. Panels of (c, d) are identical with panels (a, b) in Fig. 3.4. Scale bars ¼ 1 mm. (Reprinted with permission from Li et al. 2015)

stage. The second and third vertebral columns are tightly abutted, and their joint is difficult to identify at the Pr stage (Fig. 4.41a). At the Pr and CsJ stages, the boundaries between the first, second, and third vertebral centrums are almost impossible to identify, and several ventral elements of axial skeletons at the same levels (tripus, os suspensorium, and the forth rib) form the complexed Weberian apparatus (Fig. 4.41b, d).

4.4.3

Pectoral Fin Skeleton

The pectoral fin skeleton consists of fin rays and radials, radial basements, and pectoral girdles (Grandel and Schulte-Merker 1998; Liem et al. 2001; Kardong

4.4 Development of the Skeletal System Fig. 4.42 Pectoral fin rays in alizarin red-stained larvae to juvenile. Stage (and sub-stage) and standard length are labeled in the upper right and lower left corners of panels (a–d). Panel (d0 ) shows a magnified view of pectoral fin ray in panel (d). Black asterisks indicate the most distal tip of calcified fin rays. Scale bars ¼ 0.1 mm in (a, b); 1 mm in (c, d, d0 ). (Reprinted with permission from Li et al. 2015)

125

126

4 Development of the Wild-Type Goldfish

Fig. 4.43 Pelvic fin ray in alizarin red-stained larvae to juvenile. Stage/sub-stage and standard length are labeled in the upper right corner of panels (a–d). Black asterisks indicate unbranched calcified fin rays. Black arrowheads indicate the branched fin rays. Scale bars ¼ 1 mm. (Reprinted with permission from Li et al. 2015)

2012). Among those pectoral fin skeletal components, the cleithrum is calcified at early stages (Psb stage) (Fig. 4.36). Subsequently, four to five calcified pectoral fin rays are visible from Pb stages with alizarin red staining. At this stage, the calcified region is restricted to the proximal side. The number of the calcified pectoral fin rays increases to around nine, and their calcified regions are extended to distal regions at the Pr stage. The postcleithrum is also visible at the same level with pelvic fin rays at this stage. At the IsJ sub-stage, around 14 calcified pectoral fin rays can be recognized from the lateral view in alizarin red-stained opaque samples. These calcified fin rays exhibit bifurcated patterns at the distal side during the CsJ sub-stage (Fig. 4.42).

4.4 Development of the Skeletal System

127

Fig. 4.44 Dorsal fin rays in alizarin red-stained larvae to juvenile. Stages are labeled in the upper right corner of panels. Black asterisks indicate calcified fin rays. Scale bars ¼ 1 mm. (Reprinted with permission from Li et al. 2015)

4.4.4

Pelvic Fin Skeleton

The calcification of the pelvic fin start is visible only after the calcification of all other goldfish fin starts (Fig. 4.43). At the early Pr stages, the pre-anal fin fold largely remains, but its area is reduced from a lateral view (Fig. 4.43a, b). As with the pectoral fin rays, the calcified region is restricted to the proximal side at the early Pr stage; the region extends toward the distal side during development, and finally these fin rays exhibit bifurcated patterns at the distal side during the CsJ sub-stage (Fig. 4.43d). Calcified skeleton components in the pelvic girdle tend to become visible after more than five pelvic fin rays appear.

128

4.4.5

4 Development of the Wild-Type Goldfish

Dorsal Fin Skeleton

Three calcified dorsal fin rays can be observed in the larva with forked caudal fins (Fig. 4.28b). Subsequently, eight calcified dorsal fin rays are visible at the stage with three anal fin rays and Pb stage (Fig. 4.28hi). At the Pr stage, specimens with 19 mineralized dorsal fin rays are visible (Fig. 4.29a); the third fin rays tend to show strong calcification (Fig. 4.44a, b), and subsequently, this fin ray exhibits segmental fin spine-specific characteristics (posterior serrations) at IsJ sub-stage (sfs in Fig. 4.44c). Simultaneously, the bifurcation of the fin ray begins at the IsJ sub-stage. At the CsJ sub-stage, all of the dorsal fin rays exhibit bifurcated morphology, except the first, second, and third (segmental fin spine) rays. At the early dorsal fin ray stages (from Dr3 to Dr8), calcified radials cannot be detected (Fig. 4.31b, e). On the other hand, Pr stage larvae with eight calcified dorsal fin rays exhibit eight radials at the ventral side of the calcified dorsal fin rays, and CsJ sub-stage specimens exhibit more than 15 radials (Fig. 4.44). Of these, the first and second radials exhibit relatively strong calcification patterns at Pr and juvenile stages. During development, the calcified part of the radials proximally extends and the proximal tip of radials is located at the space between neural spines (Fig. 4.44b, d). The observed topographic relationship between these radials, fin rays, and neural spines at the Pr stage and CsJ sub-stage suggests that the segmented fin spines are derived from the fin ray located at the ninth vertebral level (white asterisks in Fig. 4.41b, d).

4.4.6

Anal Fin Skeletons

The earliest timing at which the calcified anal fin rays can be observed is the seven dorsal fin ray (Dr7) stage (Fig. 4.45a). At this stage, two calcified anal fin rays are observed (Fig. 4.45a), and the number is increased until the total dorsal number reaches around 20 (Figs. 4.19 and 4.45b–e). During the developmental course from Pr to IsJ, the second fin ray changes into a segmental fin spine, and posterior fin rays exhibit bifurcated patterns. Moreover, the anal fin radials tend to be visible from the Pr stage, and the second radial (attached to the segmental fin spine and located at the 19th to 20th vertebral level) tends to show strong calcification patterns (Fig. 4.41a, c).

4.4.7

Caudal Fin Skeleton

Caudal fin rays are the earliest skeletal component to show calcified patterns. Although the caudal fin rays cannot be recognized under the light microscope at the Psb stage, one or two of fin rays undergo the calcification process during this

4.4 Development of the Skeletal System Fig. 4.45 Anal fin rays in larvae to juvenile. White asterisks, black asterisks, and arrowheads indicate the calcein-stained fin ray, un-bifurcated, and bifurcated fin rays, respectively. Scale bars ¼ 0.1 mm in (b, c); 1 mm in (a, d, e). (Panels b– e are adapted with permission from Li et al. 2015)

129

130

4 Development of the Wild-Type Goldfish

Fig. 4.46 Caudal skeleton in early larval stages. Lateral views of calcein-stained larva. Stages are labeled in the upper right corner of panels. White arrowheads indicate calcein-stained developing caudal fin rays in panel (a). Scale bars ¼ 0.1 mm in (a–f). (Reprinted with permission from Li et al. 2015)

period (Fig. 4.46a). While only fin rays are recognized at Cr4 stage, some other internal skeletal elements (hypural 1–3) at the ventral side of the caudal fin are recognized at the Cr9 stage (Fig. 4.46b, c). The number of these ventral internal skeletal elements increases from this stage to the Fcf stage. At the Fcf stage, all ventral internal skeletal elements (second hermal spine of second centrum from ural, parhypural, six hypural bones) show calcification (Fig. 4.46c–e). The neural spine tends to be calcified at the Asb stage in comparison with the Fcf stage (Fig. 4.46f). Although the caudal skeletal elements are recognized as a part of the post-cranial axial skeletal system and modified vertebral elements, the calcification patterns of the skeletal tissues in the most caudal region are significantly different from those in the mid-trunk region (Figs. 4.7 and 4.46). More specifically, while the calcification of the vertebral centrum begins from the anterior side at the mid-trunk level, ural tends to be calcified at earlier stages in comparison with the first and second pre-ural elements. Furthermore, a part of the dorsal side of the notochord are calcified at the

4.4 Development of the Skeletal System

131

Fig. 4.47 Caudal skeleton in later larvae and juveniles. Lateral fluorescent views of alizarin red-stained samples. Stage (and sub-stage) and standard length are labeled in the upper right and lower left corners of panels. Panels (c, d) are identical with panels (a, b) in Fig. 3.7. Scale bars ¼ 0.1 mm in (a, b); 1 mm in (c, d). (Reprinted with permission from Li et al. 2015)

caudal level at Cr16 stage, during which several vertebral centrums are not calcified (Figs. 4.40 and 4.46). The calcification process of the caudal fin rays seems to be consistent with that of hypural. First, the fin rays located at the cleft start to be calcified at the Cr4 stage, while the second and third hypural bones (locations are also consistent with diastema) exhibit calcification at the Cr9 stage (Fig. 4.46). In general, it can be said that the calcification of caudal fin rays and their attachment to the internal skeleton begins with the skeletal elements proximal to the diastema. The morphology and calcification patterns of the caudal fin rays change from the Pb to Juvenile stage (Fig. 4.47). While the posterior part of the lepidotracia tends to be uncalcified from Asb to Pb stages, all of the fin rays can be stained with alizarin red at the Juvenile stages (Fig. 4.47a, b). At the IsJ sub-stage, the total number of caudal fin rays is nearly equivalent to that of adult stage (around 30 fin rays)

132

4 Development of the Wild-Type Goldfish

Fig. 4.48 Caudal fin rays in juveniles. Lateral views of alizarin red-stained samples. Sub-stage is labeled in the upper right corner of panels (a, b). Black asterisks and arrowheads indicate branched fin rays and segmentations, respectively. Scale bars ¼ 1 mm. (Reprinted with permission from Li et al. 2015)

(Fig. 4.47c). Moreover, the number of the bifurcated fin rays are the same between IsJ and CsJ sub-stages (Fig. 4.48). Segments and joints of the caudal fin are increased from the Pr to IsJ stage; while 6–7 joints are observable at the Pr stage, 10 joints are found at the IsJ stage, with an equivalent number of fin rays (Figs. 4.33i and 4.48).

4.5

Notable Similarities/Differences Between Goldfish and Zebrafish

The embryonic and post-embryonic development of single-tail common goldfish is quite similar to that of zebrafish (Kimmel et al. 1995; Parichy et al. 2009). However, the texture of the yolk at the embryonic stages and the appearance order of the dorsal and anal fin rays of the single-tail common goldfish differ from zebrafish. The difference in yolk texture might influence the process of gastrulation, and blastopore closure should be used as a staging index for this developmental period. The difference in fin ray appearance order seems to be associated with the difference in sizes of anal and dorsal fins between zebrafish and goldish. While the dorsal fin is

References

133

smaller than the anal fin in the zebrafish, the size relationship is opposite in the single-tail common goldfish, with the dorsal fin being larger than the anal fin. Histological observations of the pelvic fin bud in the goldfish indicate that the budding timing of the pelvic fin bud is continuous and starts in Ar or Dr larvae. Thus, although the appearance of the pelvic fin buds as protuberances from the ventral body wall is used as the staging index for the pelvic fin bud stage in the postembryonic normal stages of zebrafish (Parichy et al. 2009), a more specific definition is required for the goldfish Pb stage. The timings for disappearance of the fin fold and squamation are also different between zebrafish and goldfish. While the residual fin fold is retained at the ventral side of the pre-anal region in the zebrafish larvae, our observations suggest that goldfish scales tend to be visible after the complete reduction of the pre-anal fin fold. Thus, contrary to the definition of two zebrafish larval stages by squamation (posterior squamation and anterior squamation), we defined two Juvenile sub-stages (IsJ and CsJ) in the goldfish staging table.

References Battle HI (1940) The embryology and larval development of the goldfish (Carassius Auratus L.) from Lake Erie. Ohio J Sci 40:82–93 Dranow DB, Tucker RP, Draper BW (2013) Germ cells are required to maintain a stable sexual phenotype in adult zebrafish. Dev Biol 376(1):43–50. https://doi.org/10.1016/j.ydbio.2013.01. 016 Fujimoto T, Kataoka T, Otani S, Saito T, Aita T, Yamaha E, Arai K (2004) Embryonic stages from cleavage to gastrula in the loach Misgurnus anguillicaudatus. Zool Sci 21(7):747–755. https:// doi.org/10.2108/zsj.21.747 Fujimura K, Okada N (2007) Development of the embryo, larva and early juvenile of Nile tilapia Oreochromis niloticus (Pisces: Cichlidae). Developmental staging system. Dev Growth Differ 49(4):301–324. https://doi.org/10.1111/j.1440-169X.2007.00926.x Goldsmith MI, Fisher S, Waterman R, Johnson SL (2003) Saltatory control of isometric growth in the zebrafish caudal fin is disrupted in long fin and rapunzel mutants. Dev Biol 259(2):303–317. https://doi.org/10.1016/S0012-1606(03)00186-6 Gould SJ (1977) Ontogeny and phylogeny. Belknap Press of Harvard University Press, Cambridge, MA Grandel H, Schulte-Merker S (1998) The development of the paired fins in the zebrafish (Danio rerio). Mech Dev 79(1–2):99–120. https://doi.org/10.1016/S0925-4773(98)00176-2 Gross JM, Perkins BD, Amsterdam A, Egaña A, Darland T, Matsui JI, Sciascia S, Hopkins N, Dowling JE (2005) Identification of zebrafish insertional mutants with defects in visual system development and function. Genetics 170(1):245–261. https://doi.org/10.1534/genetics.104. 039727 Hall TE, Smith P, Johnston IA (2004) Stages of embryonic development in the Atlantic Cod Gadus morhua. J Morphol 259(3):255–270. https://doi.org/10.1002/jmor.10222 Hervey GF, Hems J (1948) The goldfish. Batchworth Press, London Hinaux H, Pottin K, Chalhoub H, Père S, Elipot Y, Legendre L, Rétaux S (2011) A developmental staging table for Astyanax mexicanus surface fish and Pachón cavefish. Zebrafish 8(4):155–165. https://doi.org/10.1089/zeb.2011.0713 Irie N, Kuratani S (2011) Comparative transcriptome analysis reveals vertebrate phylotypic period during organogenesis. Nat Commun 2(1):246–248. https://doi.org/10.1038/ncomms1248

134

4 Development of the Wild-Type Goldfish

Iwamatsu T (2004) Stages of normal development in the medaka Oryzias latipes. Mech Dev 121 (7–8):605–618. https://doi.org/10.1016/j.mod.2004.03.012 Kajishima T (1960) The normal developmental stages of the goldfish, Carassius auratus. Jpn J Ichthyol 8(1–2):20–28. https://doi.org/10.11369/jji1950.8.20 Kardong KV (2012) Vertebrates: comparative anatomy, function, evolution, 6th edn. McGraw-Hill Higher Education, Boston Khan MH (1929) Early stages in the development of the goldfish (Carassius auratus). J Bombay Nat Hist Soc 33:614–617 Kilambi RV, Robison WR (1979) Effects of temperature and stocking density on food consumption and growth of grass carp Ctenopharyngodon idella, Val. J Fish Biol 15(3):337–342 Kimmel CB, Kane DA, Walker C, Warga RM, Rothman MB (1989) A mutation that changes cellmovement and cell fate in the zebrafish embryo. Nature 337(6205):358–362. https://doi.org/10. 1038/337358a0 Kimmel CB, Ballard WW, Kimmel SR, Ullmann B, Schilling TF (1995) Stages of embryonic development of the zebrafish. Dev Dyn 203(3):253–310. https://doi.org/10.1002/aja. 1002030302 Latimer A, Jessen JR (2010) Extracellular matrix assembly and organization during zebrafish gastrulation. Matrix Biol 29(2):89–96. https://doi.org/10.1016/j.matbio.2009.10.002 le Pabic P, Stellwag EJ, Scemama J-L (2009) Embryonic development and skeletogenesis of the pharyngeal jaw apparatus in the Cichlid Nile Tilapia (Oreochromis niloticus). Anat Rec 292 (11):1780–1800. https://doi.org/10.1002/ar.20960 Li P, Wang AQ, Cui DF, Mu JY, Wang CY, Zhang RQ, Ning YH, Zhang NC (1959) Normal stages in the development of wild and domesticated goldfish, Carassius auratus. Acta Zool Sin 11 (2):145–154 Li IJ, Chang CJ, Liu SC, Abe G, Ota KG (2015) Postembryonic staging of wild-type goldfish, with brief reference to skeletal systems. Dev Dyn 244(12):1485–1518. https://doi.org/10.1002/dvdy. 24340 Li IJ, Lee SH, Abe G, Ota KG (2019) Embryonic and postembryonic development of the ornamental twin-tail goldfish. Dev Dyn 248(4):251–283. https://doi.org/10.1002/dvdy.15 Liem KF, Bemis WE, Walker WF, Grande L (2001) Functional anatomy of the vertebrates: an evolutionary perspective. Harcourt College Publishers, New York Martinez GM, Bolker JA (2003) Embryonic and larval staging of summer flounder (Paralichthys dentatus). J Morphol 255(2):162–176. https://doi.org/10.1002/jmor.10053 Merino GE, Piedrahita RH, Conklin DE (2007) The effect of fish stocking density on the growth of California halibut (Paralichthys californicus) juveniles. Aquaculture 265(1–4):176–186. https:// doi.org/10.1016/j.aquaculture.2007.01.028 Mizuno T, Yamaha E, Yamazaki F (1997) Localized axis determinant in the early cleavage embryo of the goldfish, Carassius auratus. Dev Genes Evol 206(6):389–396. https://doi.org/10.1007/ s004270050068 Mizuno T, Yamaha E, Kuroiwa A, Takeda H (1999) Removal of vegetal yolk causes dorsal deficiencies and impairs dorsal-inducing ability of the yolk cell in zebrafish. Mech Dev 81 (1–2):51–63. https://doi.org/10.1016/S0925-4773(98)00202-0 Nagai T, Yamaha E, Arai K (2001) Histological differentiation of primordial germ cells in zebrafish. Zool Sci 18(2):215–223. https://doi.org/10.2108/zsj.18.215 Otani S, Maegawa S, Inoue K, Arai K, Yamaha E (2002) The germ cell lineage identified by vas-mRNA during the embryogenesis in goldfish. Zool Sci 19(5):519–526. https://doi.org/10. 2108/zsj.19.519 Parichy DM, Elizondo MR, Mills MG, Gordon TN, Engeszer RE (2009) Normal table of postembryonic zebrafish development: staging by externally visible anatomy of the living fish. Dev Dyn 238(12):2975–3015. https://doi.org/10.1002/dvdy.22113 Reib JP (1973) La circulation sanguine chez l’embryon de Brachydanio rerio. Ann Embryol Morphol 6:43–54 Rolland-Lagan AG, Paquette M, Tweedle V, Akimenko MA (2012) Morphogen-based simulation model of ray growth and joint patterning during fin development and regeneration. Development 139(6):1188–1197. https://doi.org/10.1242/dev.073452

References

135

Schilling TF, Kimmel CB (1997) Musculoskeletal patterning in the pharyngeal segments of the zebrafish embryo. Development (Cambridge, England) 124(15):2945–2960 Schram E, Van Der Heul JW, Kamstra A, Verdegem MCJ (2006) Stocking density-dependent growth of Dover sole (Solea solea). Aquaculture 252(2–4):339–347. https://doi.org/10.1016/j. aquaculture.2005.07.011 Sharma SC, Ungar F (1980) Histogenesis of the goldfish retina. J Comp Neurol 191(3):373–382. https://doi.org/10.1002/cne.901910305 Shelton WL, Smitherman RO, Jensen GL (1981) Density related growth of grass carp, Ctenopharyngodon idella (Val.) in managed small impoundments in Alabama. J Fish Biol 18 (1):45–51. https://doi.org/10.1111/j.1095-8649.1981.tb03758.x Smartt J (2001) Goldfish varieties and genetics: handbook for breeders. Wiley, New York Tanaka M, Yamaha E, Arai K (2004) Survival capacity of haploid-diploid goldfish chimeras. J Exp Zool A Comp Exp Biol 301(6):491–501. https://doi.org/10.1002/jez.a.48 Tsai H-Y, Chang M, Liu S-C, Abe G, Ota KG (2013) Embryonic development of goldfish (Carassius auratus): a model for the study of evolutionary change in developmental mechanisms by artificial selection. Dev Dyn 242(11):1262–1283. https://doi.org/10.1002/dvdy.24022 von Baer KE (1828) Entwicklungsgeschichte der Thiere: Beobachtung und Reflexion. Bornträger, Königsberg Watase S (1887) On the caudal and anal fins of gold-fishes. J Coll Sci Imp Univ 1:247–267 Yamaha E, Yamazaki F (1993) Electrically fused-egg induction and its development in the goldfish, Carassius auratus. Int J Dev Biol 37(2):291–298 Yamaha E, Mizuno T, Hasebe Y, Takeda H, Yamazaki F (1998) Dorsal specification in blastoderm at the blastula stage in the goldfish, Carassius auratus. Dev Growth Differ 40(3):267–275. https://doi.org/10.1046/j.1440-169X.1998.t01-1-00002.x Yamaha E, Mizuno T, Matsushita K, Hasebe Y (1999) Developmental staging in goldfish during the pre-gastrula stage. Nippon Suisan Gakkaishi 65(4):709–717. https://doi.org/10.2331/suisan. 65.709 Yamaha E, Kazama-Wakabayashi M, Otani S, Fujimoto T, Arai K (2001) Germ-line chimera by lower-part blastoderm transplantation between diploid goldfish and triploid crucian carp. Genetica 111(1–3):227–236. https://doi.org/10.1023/A:1013780423986 Yamaha E, Murakami M, Hada K, Otani S, Fujimoto T, Tanaka M, Sakao S, Kimura S, Sato S, Arai K (2003) Recovery of fertility in male hybrids of a cross between goldfish and common carp by transplantation of PGC (primordial germ cell)-containing graft. Genetica 119(2):121–131. https://doi.org/10.1023/A:1026061828744 Yano T, Tamura K (2013) The making of differences between fins and limbs. J Anat 222 (1):100–113. https://doi.org/10.1111/j.1469-7580.2012.01491.x Zhong TP (2005) Zebrafish genetics and formation of embryonic vasculature. Curr Top Dev Biol 71 (5):53–81. https://doi.org/10.1016/S0070-2153(05)71002-4

Chapter 5

Development of Mutant Goldfish Strains

Abstract The developmental process in ornamental goldfish is known to have been modified by breeders and fanciers during the domestication process. However, little is known about specifically how the developmental process was modified. Here, the embryonic and post-embryonic development of twin-tail morphotype goldfish strains is examined, based on previously published reports and comparison with the developmental process of wild-type goldfish strains. Moreover, the morphological characteristics of the dorsal-finless morphotype goldfish strains and their developmental process are reported. These observations suggest that the early embryonic developmental processes of wild-type and dorsal-finless goldfish are closely related at the microscopic levels, but the late embryonic and post-embryonic developmental processes are clearly different, in terms of morphogenesis of the post-cranial level. Furthermore, the developmental processes for ornamental morphologies at the cranial level (including telescope eye and warty growth) are also described. Based on these results, the relationship between the genetic mutations and development of mutated phenotypes are discussed.

Breeders and fanciers have applied selective pressures to goldfish morphology in order to establish attractive ornamental strains (described in Chap. 3). During this domestication process, the developmental mechanisms of wild-type goldfish were substantially modified. These modifications of developmental mechanisms have tended to be simply interpreted by recent researchers as the consequences of fixing mutated genotypes through artificial selection (for example, including Smartt 2001; Kon et al. 2020). In other words, it seems that modern researchers are largely interested in knowing what kinds of genetic and genomic events occurred during the establishment of ornamental morphologies, which can be seen at the adult stage, rather than how the ornamental morphologies develop from a single fertilized egg. Thus, little is known about the process of embryonic and post-embryonic development for ornamental phenotypes. Given that breeders and fanciers have applied selective pressures to goldfish morphology in order to establish attractive ornamental strains (described in Chap. 3), it is probable that the developmental process of wildtype goldfish was substantially modified during domestication. Because such artificial selection was performed at a certain developmental time-point, careful © The Author(s), under exclusive license to Springer Nature Singapore Pte Ltd. 2021 K. G. Ota, Goldfish Development and Evolution, https://doi.org/10.1007/978-981-16-0850-6_5

137

138

5 Development of Mutant Goldfish Strains

consideration of selection timing can yield several interesting observations about how developmental programs may change in response to artificial selection, suggesting the need for a more careful examination of how artificial selection influences the developmental process. Several centuries ago in China, breeders and fanciers would have been unable to conduct careful microscopic examinations of embryonic or early larval phenotypes, so one may naturally assume that these early developmental processes did not provide a basis for artificial selection when ornamental goldfish strains were first established (see Chap. 1). On the other hand, culling of larval and/or juvenile goldfish was performed by enthusiastic breeders and fanciers (Matsui et al. 1972; Smartt and Bundell 1996) at developmental time-points after the early larval and/or embryonic stages. Technically, it might now be possible for modern breeders and fanciers to perform microscopic screening for culling, but such complicated methods would probably not provide any appreciable economic benefits. To my knowledge, there are no reports of breeders and fanciers conducting such microscopic culling for goldfish breeding. Based on the standard practices for culling, it is presumed that phenotypes visible at the late larval, juvenile, and adult stages were consciously targeted for artificial selection by fanciers and breeders during the domestication process, but embryonic and early larval phenotypes were not directly assessed. Thus, there seems to be a difference between developmental modifications at embryonic/early larval stages and late larval/juvenile/adult periods, in terms of how morphologies were modified by artificial selection. While the late larval, juvenile, and adult morphologies were consciously selected by fanciers and breeders, any modifications of embryological and early larval development would have been unconscious byproducts of the anthropogenic selection process. We have already discussed the normal embryonic and post-embryonic developmental process of wild-type goldfish in Chap. 4. Although the development of nonwild-type single-tail goldfish strains has not been explicitly examined, it is expected that the features of this process should be closely aligned with those of wild-type goldfish due to the high similarity of body architectures. In addition, we also considered the representative phenotypic features of twin-tail and dorsal-finless morphotypes in Chap. 3. These two morphotypes are highly diverged from wildtype in terms of the internal and external skeletal anatomies of their median fins, and because the primordia of the median fins tend to appear at the early developmental stages, the developmental processes of these three morphotypes (single-tail, twintail, and dorsal-finless) are expected to have diverged at early developmental stages (Figs. 3.13, 4.8, and 4.10). In this chapter, we will cover several examples and materials that illustrate how conscious and unconscious selective pressures have led to modifications in the development of morphologically diverged ornamental goldfish strains. Using the developmental process and staging table for the wild-type goldfish given in Chap. 4 as a starting point, modifications for the twin-tail morphotype will be carefully described (based on our previous papers: Abe et al. 2014; Li et al. 2019) in the first section (Sect. 5.1). Then, the embryological and larval features of dorsal-finless

5.1 Twin-Tail Morphotypes

139

goldfish will be described in the second section (Sect. 5.2), followed by an introduction of other ornamental features according to our preliminary data (Sect. 5.3). Finally, the relationships between mutated genes and modifications to the developmental process will be discussed (Sect. 5.4).

5.1

Twin-Tail Morphotypes

Most descriptions of the developmental process for twin-tail morphotype goldfish depict the Oranda and Ryukin strains, due to their ease of obtainment and maintenance (Abe et al. 2014; Li et al. 2019) (Fig. 3.9). Based on these descriptions, the developmental process of the twin-tail morphotype of goldfish are introduced according to stereomicroscopic features, histology and gene expression patterns, with the aim of explaining how the twin-tail morphotype body architecture grows from early embryos to adults. In this section, the embryonic and post-embryonic stages of the twin-tail morphotype goldfish are described separately, in the same format as Chap. 4.

5.1.1

Staging Indexes and Rates of Embryo Development

The indexes that allow stage identification of the twin-tail morphotype goldfish are comparable to those of the single-tail morphotype, shown in Table 5.1. Furthermore, the timings of appearance for each of the commonly observed staging indexes are compared between the single-tail and twin-tail goldfish morphotypes, from zygote to Table 5.1 Embryonic staging indexes and specific features of twin-tail goldfish Periods Zygote Cleavage Blastula Gastrula Segmentation

Pharyngula

Hatching a

Representative staging indexesa Perivitelline space, cytoplasm moves to animal pole to form the blastodisc The number of cells The shape of blastodisc The shape of the blastoderm Somite number, appearance of Kupffer’s vesicles, yolk extension, lens and otic vesicles, extended tails, and sculpted brain OVC, pectoral fin appearance, pigmentation in retina and skin, shape of the median fin fold Pectoral fin morphology, xanthophore patterns, caudal fin fold shape

Specific features of twin-tail goldfish Under the light microscopic views, significant specific features are not detected from zygote to gastrula periods Enlarged tail bud, polymorphic appearance patterns of Kupffer’s vesicles Bifurcated median fin folds and enlarged blood island Bifurcated caudal fin fold and expansion of the posterior side of the yolk

Modified from Tsai et al. (2013) (Permission from Tsai et al. 2013)

140

5 Development of Mutant Goldfish Strains

Fig. 5.1 Rates of development for zygote to early gastrula embryos. The data for twin-tail morphotype goldfish consist of 17, 9, and 61 points from two Ryukin progenies (#2017-0307-RY and #2017-0320-RY) and one Oranda progeny (#20170425-OR). Black circles indicate data from wild-type goldfish (from Tsai et al. 2013). (Reprinted with permission from Li et al. 2019)

segmentation periods (Fig. 5.1, 5.2, and 5.3). From blastula to early gastrula periods, the appearance timing of the embryonic stages is quite similar between the wild-type and twin-tail goldfish (Fig. 5.1). On the other hand, the somite number and the relationship between hpf and blastopore for the twin-tail morphotype goldfish are slightly different than those of the single-tail goldfish (Figs. 5.2 and 5.3). These differences in the development between the wild-type and twin-tail morphotypes are important for their respective adult morphologies (see also Sect. 5.3.4). More detailed phenotypic features of embryos incubated at 24
C will be described below.

5.1.2

Early Embryogenesis of the Twin-Tail Morphotype

It is difficult to distinguish the live embryos of twin-tail morphotype goldfish from embryos of other morphotypes at the zygote to gastrula stages by simple stereomicroscopic observation (Fig. 5.4; see Sect. 4.2.1 in Chap. 4). However, from the segmentation to pharyngula stages, the differences between the single-tail and the twin-tail morphotype embryos tend to become more evident. At the 18 somite stage, the prominent tail bud of the twin-tail morphotype goldfish embryos is significantly larger than that of the single-tail morphotype. Moreover, Kupffer’s vesicle is more difficult to find in the twin-tail morphotype embryos in comparison with wild-type

5.1 Twin-Tail Morphotypes

141

Fig. 5.2 Rates of development for gastrula stage embryos. Relationship between the size of the blastopore and hours post-fertilization (hpf). The data consist of 15, 36, and 22 points from progenies of one Ryukin (#2017-0307RY), one Oranda (#2017-0425-OR), and wild-type (#20170420-Single). Points derived from each clutch are indicated by the same colors. The shaded areas with regression lines indicate the 95% confidence intervals. (Reprinted with permission from Li et al. 2019)

embryos (Fig. 5.5). Subsequently, the primordium of the fin fold becomes visible at the pharyngula stage in the live embryos (Fig. 5.5e, f).

5.1.3

Modified Dorsal-Ventral Patterning

As explained in Chaps. 2 and 3, allotetraploidization occurred in the common ancestor of the common carp and goldfish, resulting in the duplication of the chordin gene in both lineages. The chordin gene is known to contain four cysteine-rich (CR) domains, which are important for dorsal-ventral patterning in vertebrate embryos (Sasai et al. 1994; De Robertis 2006, 2008, 2009; Garcia Abreu et al. 2002; Inomata et al. 2008) (Fig. 5.6). Given that all of the investigated goldfish strains belonging to the twin-tail and dorsal-finless morphotypes carry a homozygous stop codon mutation, which disrupts the function of three out of the four CR domains in the chdS allele (chdSE127X/E127X), it is presumed that the function of the chdS is reduced in embryos of goldfish with bifurcated caudal fins. Furthermore, the dino/chordin

142

5 Development of Mutant Goldfish Strains

Fig. 5.3 Rates of development for segmentation stage embryos. The data consist of 8, 1, 33, and 28 points from two Ryukin (#2017-0307-RY, #2017-0320-RY), Oranda (#2017-0425-OR), and wild-type (#2017-0420-Single) progenies, respectively. The regression line for the developmental rate of Ryukin progenies was estimated from the data from #2017-0307-RY and #2017-0320-RY. Points derived from the same clutch are indicated by the same colors. The black circles are derived from the singe tail common goldfish in Tsai et al. (2013) (equivalent with the data from Fig. 4.3). (Reprinted with permission from Li et al. 2019)

mutant was also reported to exhibit a bifurcated caudal fin (Hammerschmidt et al. 1996; Fisher and Halpern 1999). It was also revealed that the expression pattern of chdS is differs from that of chdL, suggesting that the gene products are sub/neo-functionalized. The chdS gene exhibits wider expression patterns than the chdL gene at early bc stages in the wildtype goldfish embryos (Fig. 5.7a–f). Moreover, the expression patterns of chdL are different between the wild-type and twin-tail morphotype goldfish (Fig. 5.7a–c’) The differences between wild-type and twin-tail morphotype goldfish are more evident in the expression patterns of ventral marker genes (bmp4, szl and eve1) (Fig. 5.7j–o0 ). For example, eve1 and bmp4 exhibit quite significant differences in their ranges of gene expression on the ventral side and blastoderm margin at the shield stage; the twin-tail goldfish embryos have wider expression patterns than the wild-type goldfish (Fig. 5.7j–i0 , m–o0 ). At a later stage (40% bc stage), these two genes and szl are restricted to the narrow area of the ventral region in single-tail common goldfish embryos, but their expression is retained at the wider part of the ventral side of the embryos. These highly ventralized expression patterns of bmp4 and szl are retained at later stages (90% bc and szl). Bud stage embryos also strongly

5.1 Twin-Tail Morphotypes

143

Fig. 5.4 Representative goldfish embryos of the twin-tail morphotypes from fertilization to gastrula periods. (a) Zygote stage. (b–f) Cleavage stages. (g–l) Blastula stages. (m–p) Gastrula stages. Designations in the upper right corner of each panel represent stage. Panel (h) (labeled as 1280 cell) shows an intermediate stage between 128- and 256-cell stages. Panels (a, b, d–p) are Ryukin embryos. Panel (c) shows an embryo of the Oranda strain. Scale bar, 0.1 mm. All panels are shown at the same magnification. (Reprinted with permission from Li et al. 2015)

express szl and bmp4 genes (Fig. 5.7i, i0 , p, p0 ). In contrast to these evident differences of ventral markers, expression of the hindbrain marker (krox20) does not differ in these two morphotype embryos (Fig. 5.7t–u0 ). Taken together, these observations suggest that the ventral side of the twin-tail morphotype goldfish early embryos is highly ventralized, while the dorsal side maintains the same embryonic features as the single-tail morphotype embryos. The expression of bmp4 can be observed in fin fold primordial regions in the segmentation stage embryos. The wild-type goldfish exhibit bmp4 expression on the midline as a single stripe, but the stripe is bifurcated in the twin-tail morphotype goldfish embryos (Fig. 5.7q–s0 ). Meanwhile, in the twin-tail morphotype goldfish

144

5 Development of Mutant Goldfish Strains

Fig. 5.5 Representative goldfish embryos from segmentation to pharyngeal stages. Lateral view of 4- (a), 10- (b), 18-somite (c) stages. (d) Seventeen- to 19-somite stage embryos. Twenty-five-somite (e) and pharyngula stages (f) (34% OVC). Black and white arrowheads indicate bifurcated fin fold and division of the brain rudiment, respectively. Embryos in panels (a, e, f) are derived from Ryukin strain progenies, and embryos in the other panels are derived from Oranda-strain progenies. Scale bars, 0.1 mm (a–c, e, f), 1 mm (d). (Reprinted with permission from Li et al. 2015)

Fig. 5.6 Schematic representation of the Chordin amino acid sequences of wild-type and twin-tail morphotype goldfish. Colored boxes indicate CR domains. The arrowhead indicates the stop codon mutation site. (Modified from Ota and Abe 2016)

embryos, the bmp4-positive regions make a similar single line at the dorsal side, but the region is bilaterally separated on the ventral side. These results are consistent with the phenotypes of the median fin fold in the wild-type and twin-tail morphotype goldfish (Figs. 4.10g, 4.12, 5.5e, f).

5.1.4

Twin-Tail Morphotype-Specific Features at Late Embryonic and Early Larval Stages

The bifurcated fin fold is maintained at later stages. Moreover, at the late pharyngula to hatching stage, an enlarged blood island can be found at the ventral side at the

5.1 Twin-Tail Morphotypes

145

Fig. 5.7 Comparison of gene expression patterns between wild-type and twin-tail goldfish. Expression patterns of chdS (a–c0 ), chdL (d–f0 ), eve1 (g–i0 ), szl (j–l0 ), bmp4 (m–s0 ), and krox20 (t–u0 ). Unless otherwise noted, panels show lateral views of embryos. Black arrowheads indicate areas of gene expression. (s, s0 ) Magnified views of (r, r0 ), respectively. Panels [(a–r), (t–u0 ) and (s, s0 )] are the same magnification. Scale bars, 500μm (a, t), 100μm (s). (Reprinted with permission from Abe et al. 2014)

level of cloaca (Fig. 5.8). This enlarged blood island tends to be retained at a more posterior level (Fig. 5.8) and persists into the late hatching stage and even after hatching, before it gradually fades. The shape of the yolk extension of the twin-tail morphotype embryos is another evidently different feature found in single-tail morphotype embryos. The yolk extension in twin-tail morphotypes tend to be wide or “fat,” while in the latter embryos, it is thinner or “slim” in diameter. However, it should be noted that these phenotypic features were observed in the progenies of Ryukin or Oranda strains, and both of these strains have globular body shapes. Taking into account that the twintail Wakin strain is also equipped with a bifurcated caudal fin and is homozygous of the stop codon alleles in the chdS locus, one may expect that the widening of the ventral side in the embryonic and larval progenies could be influenced by not only the stop codon allele at the chdS locus but also some other mutated locus/loci related to the globular body shape.

146

5 Development of Mutant Goldfish Strains

Fig. 5.8 Hatching stage of twin-tail goldfish larvae. Lateral view of long pec (a), pec (b), protruding mouth (c) stages. Ventral view of protruding-mouth stage (d). All larvae were derived from Ryukin-strain parents. Black arrowheads and asterisks indicate bifurcated fin fold and malformed fin. White arrow indicates edema; white arrowheads indicate the edge of the bifurcated fin fold near the end of the yolk. Scale bars, 0.1 mm. (Reprinted with permission from Li et al. 2019)

The bifurcation patterns of the caudal fin fold are varied (Fig. 5.8), and in several hatching stage embryos, edema can be observed (Fig. 5.8c). Moreover, the angle and posterior end of bifurcated post-anal fin fold differs among individuals. While the pre-anal fin fold is easily recognized as a clear and fine membrane in the single-tail morphotype progenies at the hatching stage and protruding mouth stage, such a clear membrane-like morphology is not often observed in twin-tail morphotype embryos (Fig. 5.8).

5.1.5

Skeletal Development During Larval Periods

Throughout the larval developmental process, twin-tail morphotype progenies are quite similar to single-tail morphotype progenies (Sect. 4.4 in Chap. 4). However, in

5.1 Twin-Tail Morphotypes

147

the axial skeletons, pelvic, anal, and caudal fins, significant differences are observed. Thus, we will next cover the differences at each stage of larval development for the twin-tail morphotypes based on the staging table of the single-tail morphant progenies, and we will examine whether the staging indexes for single-tail morphotype progenies are directly applicable to the twin-tail goldfish; representative similarities and differences are summarized in Table 5.2.

5.1.5.1

Prot Stage

From a lateral view, the ventralized and enlarged posterior part of the yolk extension can be recognized. The beginning of the fin fold bifurcation at the most caudal level can be recognized as a whitish line (white arrow in Fig. 5.9). The calcified cleithlum and opercular are detected in calcein-stained larvae under fluorescence microscopy, similar to the single-tail morphotype larvae. Almost all three dpf larvae exhibit a Prot stage phenotype (approximately 4.2 mm standard length).

5.1.5.2

Psb Stage

The posterior swim bladder can be observed from 6 to 7 dpf (approximately 6.0 mm standard length) (Fig. 5.10). At the Psb stage, yolk is reduced in comparison with previous stages, similar to larvae of single-tail morphotype progenies. However, in the photographed progeny in Fig. 5.10, a relatively large yolk remains in the yolk extension, unlike with the single-tail morphotype progenies. Development of the cranial and pelvic girdle skeletons (including maxilla, anteroarticular, brachiostegal, ceratohyals, and cleithlum) of the twin-tail morphotype larvae is quite similar to that of the single-tail morphotype larvae. However, the calcified patterns of segmentally arranged vertebral centrum in the twin-tail morphotype larvae are easily differentiated from the single-tail morphotype Psb stage larvae. More specifically, the ventral side of the notochord has calcified tissues.

5.1.5.3

Cr Stage

At the early Cr sub-stage (more than 5 mm standard length), the yolk is completely consumed (Fig. 5.11), and most larvae display active feeding behavior. Calcified cranial elements and vertebral elements are increased. The calcified region at the ventral side of the notochord is extended toward the posterior. Calcified caudal fin rays can be observed from lateral and ventral views under the microscopic views. At the late Cr sub-stage, the calcified tissues at the ventral side of notochord tend to face out at the anterior trunk levels. In the bifurcated caudal fin, the calcified fin rays are visible, showing symmetric calcification patterns (Fig. 5.12).

148

5 Development of Mutant Goldfish Strains

Table 5.2 Post-embryonic staging indexes and twin-tail goldfish specific features Stage Protruding mouth Posterior swim bladder Caudal fin ray

Forked caudal fin

Anterior swim bladder Dorsal fin ray

Anal fin ray

Pelvic fin bud Pelvic fin ray Juvenile

Adult

Representative staging indexesa Extended mouth, yolk, all fin folds remain; straight notochord at the caudal fin level; heart location moves anteriorly Inflation of the posterior swim bladder; lower jaw extension Visible caudal fin rays; snout length longer than at Psb; this stage can be divided into sub-stages based on the number of fin rays Appearance of a largely concaved point in the caudal fin, evident anal and dorsal fin condensation; slightly reduced dorsal and post-anal fin fold Inflation of anterior swim bladder; enhanced anal and dorsal fin condensation Dorsal fin ray appearance; anterior swim bladder lobe is larger than that of Asb stage Anal fin ray appearance; lack of the dorsal fin fold at the anal fin level, anterior swim bladder is larger than posterior swim bladder Pelvic fin bud being visible from lateral side and equipping AERb Pelvic fin ray appearance; elongated most posterior dorsal and anal fin rays; trapezium shaped dorsal and anal fins Complete loss of the fin fold; posterior serrations at the anterior dorsal and anal fin ray; this stage can be divided into two sub-stages based on squamation completeness Produce mature eggs and sperm

Specific feature of twin-tail goldfish Bifurcated caudal, anal, and pre-anal fin folds Unsegmented calcified tissues at the ventral side of notochord beginning to be visible Bilaterally bifurcated caudal fin with fin rays; starting to form the globular body shape The large concaved points in bifurcated caudal fin

Due to the globular body shape, the proper comparison of the size between anterior and posterior swim bladder tends to be impeded Some progenies exhibit bifurcated anal fin and its rays Bilaterally shifted location of fin budc The globular body shape is more enhanced than the previous stages The strain difference in warty growth beginning to be visible

Globular body shape and bifurcated caudal fin

a

Modified from Li et al. (2019) (Permission from Li et al. 2019) The definition of the Pelvic fin bud stage is clarified based on the results of present study (see main text) c The bilaterally shifted location of pectoral fin bud impeded application of this stage to the twin-tail goldfish progenies (see Fig. 5.25c, d) b

5.1.5.4

Fcf Stage

At approximately 7.5 mm standard length, the twin-tail goldish larvae exhibit a cleft on the caudal fin (Fig. 5.13). Vertebral elements are observed throughout the entire

5.1 Twin-Tail Morphotypes

149

Fig. 5.9 Lateral view of protruding mouth-stage larva. The whole body of light (a) and calceinstained fluorescence (b) views. (c) Magnified views of panels (a, b) are shown in (c, d), respectively. Black arrowheads, black asterisks, black pound signs (#) indicate bifurcated fin fold, malformed fin fold, and enlarged blood island, respectively. The pictured larva was derived from Ryukin parents. Scale bars, 1 mm (a, b), 0.1 mm (c, d). (Reprinted with permission from Li et al. 2019)

150

5 Development of Mutant Goldfish Strains

Fig. 5.10 Lateral views of posterior swim bladder stage. Panels (a, b) show light and calceinstained fluorescence views of the entire body. Panels (c–e) are magnified views of the anterior region of (a, b) and caudal region of (a), respectively. White arrowheads mark the most posterior calcified vertebral body. Black arrowheads indicate bifurcated caudal fin. White arrow shows the

5.1 Twin-Tail Morphotypes

151

trunk that resemble neural spines. The segmentation patterns of the vertebral centrums of this stage larvae are more clear than that of previous stages (Fig. 5.13). Ribs and hemal arches are also visible in the anterior and posterior trunk, respectively. Bifurcated caudal fins at this stage contain more than 15 calcified fin rays.

5.1.5.5

Asb Stage

The dual appearance of cleft and anterior swim bladder is found in larvae of approximately 8 mm standard length. Since no individual with an anterior swim bladder and without a forked caudal fin was found in our previous studies, it is expected that appearance order of anterior swim bladder and forked caudal fin is consistent between the twin-tail and the single-tail morphotypes. A prominent region of the dorsal fin fold exhibits an opaque and whitish color under the light microscopy; this region is the dorsal fin ray developing region (Fig. 5.14). The intestine tends to exhibit a curved shape at this stage (Fig. 5.14). The calcified cranial skeleton of the twin-tail morphotype progeny exhibits a complex structure equivalent to that of the single-tail morphotype progenies at the same stages. The axial skeletons also have increased numbers of the ribs and hemal arches; however, the vertebral centrum shows heterogeneous calcified patterns in comparison with equivalently staged single-tail larvae.

5.1.5.6

Dr Stage

Calcified dorsal fin rays are visible before the appearance of the anal fin. The 9 mm standard length larvae exhibit calcified dorsal fin rays between the 11th and 14th vertebrae (Fig. 5.15). The calcification of cranial and post-cranial skeleton has progressed from previous stages. The definition of vertebral column segments is ambiguous at the cloacal level (Fig. 5.15).

5.1.5.7

Ar Stage

Those larvae with dorsal fin rays exhibit three pairs of anal fins at the 22nd or 23rd vertebrae level. In the anterior part of the dorsal side, supraneurals are observed (Fig. 5.16). When three anal fin rays have developed, six dorsal fin rays are visible.  ⁄ Fig. 5.10 (continued) posterior end of unsegmented calcein-positive tissues on the ventral side of the notochord. White asterisks indicate calcein-stained area between calcified vertebral elements. Black asterisks and pound signs (#) indicate pre-anal fin fold and enlarged blood vessels. Scale bar, 1 mm (b), 0.1 mm (e). Panels showing the entire larva (a, b) and panels showing magnified views (c–e) were photographed at the same magnification. (Reprinted with permission from Li et al. 2019)

152

5 Development of Mutant Goldfish Strains

Fig. 5.11 Early Cr stage. Lateral (a–h) and ventral (i–n) views of Ryukin strain larva. Left and right columns show light and calcein-stained fluorescence microscopic images. Second-, third-, and fourth-row panels are magnified views of first-row panels. Panels in the sixth and seventh rows are magnified views of panels in the fifth row. White arrows, arrowheads, and asterisks indicate the most posterior part of the calcified notochord, the most posterior calcified centrum, and calcified notochordal regions between centra, respectively. Black asterisks and arrowheads mark bifurcated caudal fin and malformed pre-anal fin fold. Scale bars, 1 mm (b, h, j), 0.1 mm (l, n). Panels in the

5.1 Twin-Tail Morphotypes

153

Fig. 5.12 Late Cr stage. Lateral (a–f) and ventral (g–l) views of Ryukin strain larva. Left and right columns show light and calcein-stained fluorescein microscopic images. Black asterisks and arrowheads indicate bifurcated caudal fin and malformed pre-anal fin fold. White asterisks and arrowheads mark ectopically calcified notochordal region and the most posterior calcified centrum. White arrow shows calcified tissue at the level of the flexed notochord. Scale bars, 1 mm (b, h), 0.1 mm (f, l). Panels in the first row (a, b), second and third rows (c–f), fourth row (g, h), and fifth and sixth rows (i–l) are shown at the same magnifications. (Reprinted with permission from Li et al. 2019)  ⁄ Fig. 5.11 (continued) first row (a, b), second to fourth rows (c–h), fifth row (i, j), and sixth and seventh rows (k–n) are shown at the same magnifications. (Reprinted with permission from Li et al. 2019)

154

5 Development of Mutant Goldfish Strains

Fig. 5.13 Fcf stage. Lateral (a–f) and ventral (g–l) views of a forked caudal fin-stage Ryukin progeny. Left and right columns show light and calcein-stained fluorescent microscopic images. Black arrows, arrowheads, and asterisk indicate the concave point that divides the upper and lower fin lobes, bifurcated caudal fin fold, and malformed pre-anal fin fold, respectively. White arrowheads show the most posterior calcified centrum. Scale bars, 1 mm (b, h), 0.1 mm (f, l). Panels in the first row (a, b), second and third rows (c–f), fourth row (g, h), and fifth and sixth rows (i–l) are shown at the same magnifications. (Reprinted with permission from Li et al. 2019)

5.1 Twin-Tail Morphotypes

155

Fig. 5.14 Lateral views of Asb stage larva. Whole body view of larva from Ryukin parents (a, b). Magnified views of the anterior (c, d), mid-trunk (e, f) and caudal (g, h) regions of (a, b). Black asterisk and arrowheads represent malformed pre-anal fin fold and bifurcated caudal fin, respectively. Scale bars, 1 mm (b, h). Panels showing the entire larva view (a, b) and panels showing the magnified views (c–h) were photographed at the same magnification. (Reprinted with permission from Li et al. 2019)

5.1.5.8

Pb Stage

Dorsal and anal fin-positive larvae are equipped with a blade-like pelvic find bud that has an apical epithelial ridge from the lateral view, as shown in Fig. 5.17. Due to the relatively bilaterally shifted position of the pelvic fin bud in the twin-tail morphotype progenies, in comparison with the single-tail morphotype progenies, the pelvic fin bud of the twin-tail morphotype progenies are relatively easily observed from ventral

156

5 Development of Mutant Goldfish Strains

Fig. 5.15 Lateral views of Dr stage larva. Whole body view of larva from Ryukin parents (a, b). (c– h) Magnified views of anterior (c, d), mid-trunk (e, f), and posterior regions (g, h). Black asterisks mark malformed pre-anal fin fold. Black arrowheads indicate bifurcated caudal fins. White asterisks indicate fused centrum. Scale bars, 1 mm (b, h). Panels showing the entire larva view (a, b) and panels showing the magnified views (c–h) were photographed at the same magnification. (Reprinted with permission from Li et al. 2019)

side (Fig. 5.18). This illustrates the difficulty of applying the Pb stage index of the single-tail morphotype larvae to the twin-tail morphotype larvae only by observation from lateral views (Figs. 4.31 and 5.17). Thus, the number of the dorsal and anal fin rays seems to be more precise staging index for comparative analyses between the single-tail morphotypes and twin-tail morphotypes. Cranial skeletons have

5.1 Twin-Tail Morphotypes

157

Fig. 5.16 Lateral views of Ar stage larva. The left column (a, c, e, g) and right column (b, d, f, h) show light and calcein-stained fluorescent microscopic images. Black arrowheads indicate caudal fins. Black asterisks mark mutated area of pre-anal fin fold. Scale bars, 1 mm (b, f), 0.1 mm (h). Panels in the first row (a, b), second and third rows (c–f), and fourth row (g, h) are shown at the same magnifications. (Reprinted with permission from Li et al. 2019)

developed ventral and dorsal regions; calcified parietal and frontal plates are recognized in the calcein-stained progenies under the fluorescence imaging (Fig. 5.17b, d, f).

5.1.5.9

Pr Stage

Calcified fin rays are visible in the pelvic fin on the lateral surface of the larval trunk (Fig. 5.19). In early Pb stage twin-tail morphotype progeny, four pelvic fin rays are

158

5 Development of Mutant Goldfish Strains

Fig. 5.17 Lateral views of Pb stage larva. Whole-body view of larva derived from Ryukin parents (a, b). Magnified views of anterior (c, d), and posterior (e, f) regions. Panel (g) shows a magnified view of the boxed area in (e). Black arrowheads, black asterisks, and white asterisks indicate bifurcated caudal fin, mutated pre-anal fin fold, and twisted part of ribs, respectively. Scale bars, 1 mm (b, d, f), 0.1 mm (g). Panels in the first row (a, b), second row (c, d), and third row (e, f) are shown at the same magnifications. (Reprinted with permission from Li et al. 2019)

visible. Similar to the single-tail morphotype Pr stage larvae, twin-tail larvae retain dorsal and anal fin folds at the caudal peduncle as well as pre-anal fin fold at the Pr stage (Fig. 5.19). In fact, although calcified scales are visible in the late Pr sub stage, the pre-anal fin fold is still clearly visible from the lateral side (Fig. 5.19). During development from early to late Pb stage, the location of the pelvic fin moves from a

5.1 Twin-Tail Morphotypes

159

Fig. 5.18 Ventral views of Pb stage larva. (a, d) Whole-body views of larva derived from Ryukin parents. Magnified views of anterior (b, e) and pelvic fin bud (c). Bifurcated caudal fin is indicated by black arrowheads. Scale bars, 1 mm (a, d, e), 0.1 mm (c). Panels (b, e) are shown at the same magnification. (Reprinted with permission from Li et al. 2019)

lateral to a ventral site of the body (Fig. 5.20). Similar to the single-tail morphotype progenies, dorsal and anal fin radials are visible. Cranial and axial skeletons are well developed. In some specimens, twisted ribs are observed. In contrast to the morphology and appearance timing of the pelvic fin bud, pelvic fin rays are directly comparable between the single-tail morphotype and the twin-tail morphotype progenies.

5.1.6

Histology of Larvae at the Trunk Level

Light and fluorescence microscopy of twin-tail morphotype goldfish larvae revealed that the development of ventral tissues at the caudal half body level is different from the single-tail morphotype goldfish. To investigate in more detail how the pelvic fin, fin folds on the ventral side, and caudal fin develop in the twin-tail morphotypes, histology of the twin-tail morphotype goldfish was examined at several representative stages (Figs. 5.21, 5.22, and 5.23). In fixed 3.8 mm standard length proto larvae, dorsal, caudal, and ventral fin folds (pre-anal fin fold) can be recognized (Fig. 5.21). In histological sections, an enlarged blood island and bifurcated pre-anal and post-anal fin folds are present. In these bifurcated fin folds, alcian blue-positive extracellular matrix is seen. Moreover, several mesenchymal cells can be observed in the ventral and caudal fin fold. In Fcf larvae (6.5 mm standard length), a well-developed pre-anal fin fold and alcian blue-positive extracellular matrix are observed (Fig. 5.22). In the photographed twin-tail morphotype progeny, the pre-anal fin fold is bifurcated at the posterior level but not at the anterior level. The post-anal fin fold is also bifurcated but significantly different from pre-anal fin folds due to the presence/

160

5 Development of Mutant Goldfish Strains

Fig. 5.19 Lateral views of early Pr stage. (a, b) Whole lateral views of larva derived from Ryukin strain parents. (c–h) Magnified views of anterior (c, d), pelvic fin (e, f), and posterior (g, h) regions of (a, b). Left column (a, c, e, g) and right column (b, d, f, h) are light and calcein stained fluorescent microscopic images. Black arrowheads indicate bifurcated caudal fin. This larva developed four pelvic fin rays. White asterisks mark twisted ribs. Scale bars, 1 mm (b, d, h), 0.1 mm (f). Panels in the first row (a, b), second row (c, d), third row (e, f), and fourth row (g, h) are shown at the same magnifications. (Reprinted with permission from Li et al. 2019)

absence of the mesenchymal cells. At the caudal level, laterally duplicated caudal skeletons and fin rays are recognized. In the 9.2 mm standard length larvae, a prominent pelvic fin bud equipped with at least four anal fin rays is clearly observed in the lateral oblique view (Fig. 5.23). At the same trunk level with pelvic fin bud, the reduced pre-anal fin fold is recognized. Moreover, the pre-anal fin fold, anal fin, and post-anal fin fold are visible from lateral

5.1 Twin-Tail Morphotypes

161

Fig. 5.20 Lateral views of late Pr stage. (a, b) Whole lateral views of larva derived from Ryukin parents. Magnified view of anterior (c, d) and posterior (e, f) regions of (a, b). Left column (a, c, e) and right column (b, d, f) are light and calcein-stained fluorescent microscopic images. Black arrowheads indicate bifurcated cauda fin. Scale bars, 1 mm (b, d, f). Panels in the first row (a, b), second row (c, d), and third row (e, f) are shown at the same magnifications. (Reprinted with permission from Li et al. 2019)

and ventral fin views (Fig. 5.23). In the histological sections, the pelvic fin bud and its condensed mesenchymal cells (Fig. 5.23) and bifurcated pre-anal fin fold with extracellular matrix are observed. Moreover, duplicated radials of the anal fin and their attached muscle tissues are found at the cloacal and anal fin level (Fig. 5.23). At the levels from anal fin to the posterior end of the post-anal fin fold, the epithelial tissue is thicker than the other regions (black arrowheads in Fig. 5.23). Similar to duplicated muscular tissues of the anal fin, the caudal fin muscular tissues are also duplicated. Moreover, the muscular tissues located in the intermediate region between the left and right second hypurals, connect these laterally duplicated caudal skeletal elements (Fig. 5.23). At the most posterior level, calcified fin rays are observed.

162

5 Development of Mutant Goldfish Strains

Fig. 5.21 Histological analysis at the pre/postcloacal levels in prot stage twin-tail goldfish larvae. (a, b) Lateral views of protruding mouth stage specimen from Oranda parents. (c–e) Lateral oblique views of the same larva shown in panel (a). (f–j) Hematoxylin and eosin- and alcian blue-stained transverse sections. (f) Precloacal region. (g) Cloacal region. (h–j) Postcloacal region. Locations of histological sections are indicated by white dashed lines in panels (b, d, e). Black arrowhead, white arrowheads, and black arrows indicate bifurcated pre-anal fin fold, post-anal fin fold, and migratory mesenchymal cells in the caudal fin, respectively. Scale bars, 1 mm (a, c), 0.1 mm (b, e, j). Panels (d–j) are shown at the same magnification. (Reprinted with permission from Li et al. 2019)

In this context, it is worthwhile to examine the developmental process through which the pelvic fin bud is formed. As mentioned above, there are differences between live samples of the single-tail and twin-tail morphotype goldfish with regard to the visibility of the pelvic fin bud (Figs. 5.17 and 5.18). The differences are quite evident at the level of the histology as well (Fig. 5.24). Comparative histological analyses between the wild-type and Ryukin goldfish larvae at Ar stage indicate that the former exhibits a well-developed apical ectodermal ridge of pelvic fin at the lateral ventral side, while the latter develops the apical ectodermal ridge of pelvic fin at the lateral side. These results suggest that in addition to the caudal and anal fins, the pelvic fin was also modified during the domestication process (Li et al. 2019).

5.1 Twin-Tail Morphotypes

163

Fig. 5.22 Histological analysis at the pre-/postcloacal levels in Fcf stage twin-tail goldfish larvae. (a) Whole-body lateral view of fixed larvae from Ryukin parents. (b–i) Hematoxylin and eosin- and alcian blue-stained transverse sections. Panels (c, e, g) are magnified views of (b, d, f), respectively. Locations of each sections are marked by white dashed lines in panel (a). Black asterisks indicate malformed areas of pre-anal fin fold. Black arrowheads indicate migratory mesenchymal cells in dorsal and anal fins. Scale bars, 1 mm (a), 0.1 mm (b, d, e, f), 0.01 mm (c, g, h, i). (Reprinted with permission from Li et al. 2019)

5.1.7

Comparison of Axial Skeletal Development in Larvae

As early research suggested (Koh 1931, 1932; Asano and Kubo 1972), most twintail progenies exhibit disrupted morphology of vertebral elements during development. In fact, a detailed comparison between the single-tail morphotype and twin-tail morphotype progenies revealed that the segmentation patterns of the calcified

Fig. 5.23 Histological analysis at the pre-/postcloacal levels in Pb stage twin-tail goldfish larvae. (a–f) Fixed larva derived from Ryukin parents. (a) Dorsal oblique view. (c) lateral view. (e) Ventral view. Panels (b, d, f) are magnified views of panels (a, c, e), respectively. (g–t) Hematoxylin and eosin- and alcian blue-stained transverse sections. Panels (h, j, n, p, r, t) are magnified views of (g, i, k, m, o, q, s), respectively. Black arrowheads and asterisks indicate thickened

164 5 Development of Mutant Goldfish Strains

 ⁄

Fig. 5.23 (continued) epithelial tissue and remaining pre-anal fin fold in proximity to the pelvic fin bud. Black arrows and white asterisks mark bifurcated skeletons of anal fin (radials) and duplicated muscle attached to skeleton of the anal fin (including depressors and erectors anales). White arrowheads indicate muscle fibers connecting left and right bifurcated second hypurals. White arrow indicates the condensed mesenchymal cells in the pelvic fin bud. Scale bars, 1 mm (e, f), 0.1 mm (d, g–t). Panels with the entire larva (a, c, e) and the magnified views (b, d) are shown at the same magnifications. (Reprinted with permission from Li et al. 2019)

5.1 Twin-Tail Morphotypes 165

166

5 Development of Mutant Goldfish Strains

Fig. 5.24 Histological comparison of pelvic fin bud in single- and twin-tail goldfish at Ar stage. Panels (a–d) and (e–h) show the wild-type and Ryukin progenies, respectively. Panels (a–d) are derived from panels (i, i0 , j, j0 ) in Fig. 4.32. Panels (a, e) show oblique lateral views of fixed goldfish larvae. Panels (b, f) are magnified views of first-row panels. Panels (c, g) are hematoxylin and eosin- and alcian bdluestained sections of larvae in first-row panels. Panels (d, h) show magnified views of left lateral side in the thirdrow panels. Locations of histological sections are marked by black arrowheads in the second row. Black arrows in panels (b, f) indicate the most posterior end of pelvic fin buds. Arrows in panels (c, d, g, h) indicate apical ectodermal ridge of the pelvic fin bud. Scale bars first row, 1 mm. Scale bars second and third rows, 0.1 mm. Scale bars fourth row, 0.01 mm. (Reprinted with permission from Li et al. 2019)

vertebral centrum are clearer in the former than the latter (Fig. 5.25). More specifically, in the twin-tail morphotype progenies observed in our previous research, irregular calcified tissues, which have not been observed in the single-tail morphotype progenies, were observed at the caudal site of the notochord at the level more posterior to the calcified centrum from Prot to early Cr stage. These irregular calcified tissues persist at the ventral side of the notochord at the mid-trunk region, where the calcified centrum is developed, at the late Cr stage larvae. Furthermore, the arrangements of vertebral elements in the twin-tail morphant larvae are largely disrupted at the Fcf stage, when the single-tail morphant larvae shows

5.1 Twin-Tail Morphotypes

167

Fig. 5.25 Comparison of vertebral columns of single- and twin-tail morphotype goldfish strains. First and second columns are single-tail common goldfish progenies shown in light and calceinstained fluorescence microscopic images. Third and fourth columns are twin-tail goldfish progenies from Ryukin parents shown in light and calcein-stained fluorescence microscopic images. First, second, and third rows show Cr1, Cr9, and Fcf stage larvae, respectively. White asterisks in (d) indicate calcein-positive notochordal area, in which centra are not developed. Scale bars, 1 mm (b, d, f, h, j, l). Panels showing the same larva [(a, b), (c, d), (e, f), (g, h), (i, j) and (k, l)] were photographed at the same magnifications. (Reprinted with permission from Li et al. 2019)

evident metameric segmental patterns (Fig. 5.25). Although it is still uncertain whether all twin-tail morphotype progenies exhibit the same type of the calcification patterns in the axial skeleton, it is reasonable to expect that this disrupted calcified patterns are derived from the mutation in chdS locus, as dino/chordin zebrafish also show similar disrupted segmental patterns of the axial skeletons (Fisher and Halpern 1999).

5.1.8

Juvenile and Adult Stages

Since reduction of the fin fold (especially the pre-anal fin fold) is quite similar between the single-tail and twin-tail morphotype progenies at the Pr stage, the same staging index for goldfish juvenile stage (complete loss of the fin fold) is directly applicable to both. Our previous study suggested that the transition from larva to juvenile tends to begin at approximately 12 mm standard length (Fig. 5.26). During the juvenile period, pigmented tissues containing xanthophore, melanophore, and iridophore are visible on the entire body. The warty growth and some other cranial ornamental tissues tend to become visible starting at this stage (Fig. 5.26; see below also; Sect. 5.3.2). After around 1 year from fertilization, the twin-tail morphotype goldfish progenies become sexually mature, as illustrated by the 384 dpf Oranda strain progeny in Fig. 5.27; males and females can be distinguished by inspecting cloaca in the spawning season, similar to the single-tail morphotype progeny (Fig. 3.3).

168

5 Development of Mutant Goldfish Strains

Fig. 5.26 Lateral views of twin-tail morphotype juvenile. (a) Whole lateral view of juvenile from Oranda parents. Magnified view of anterior (b) and posterior (c) regions of (a). Black arrowheads indicate bifurcated caudal fin. Scale bars, 1 mm. (Reprinted with permission from Li et al. 2019)

5.1.9

Inter- and Intra-strain Variations of the Developmental Process

Progenies of the single-tail and twin-tail morphotypes exhibit highly similar developmental processes from embryogenesis to juvenile stages. In fact, most of the embryonic staging indexes established in the single-tail morphotype progenies can be directly applied for stage identification of twin-tail morphotypes. However, we also found differences between the single-tail and the twin-tail morphotypes in the developmental process of anal, caudal, pelvic fins and axial skeletons, suggesting the presence of inter-strain variations (Figs. 5.9–5.25). Based on the anal and caudal fin morphologies, the twin-tail morphotype progenies can be divided into four different groups, including those that have (1) two anal and two caudal fins (2A2C) (Fig. 5.28), (2) two anal and one caudal fins (2A1C), (3) one anal and two caudal fins (1A2C) (Fig. 5.29), and (4) one anal and one caudal

5.1 Twin-Tail Morphotypes

169

Fig. 5.27 Twin-tail morphotype specimens. Photographed specimens were 384 dpf Oranda progenies. Panels (a, b) are lateral and dorsal views derived from the same specimen. (c) Right pectoral fin of male specimen with breeding tubercles (bt). (d, e) Ventral views of cloacal region of an adult male specimen. Black asterisk in panel (e) indicates sperm. (f) The cloaca of the female. The pictured male and female are approximately 8 cm standard length. (Reprinted with permission from Li et al. 2019)

fins (1A1C) (Fig. 5.30). Among these groups, 2A1C and 1A1C are uncommon among progenies derived from twin-tail morphotype parents, although these potential phenotypes are included in Watase (1887) (Fig. 3.11), and these phenotypes have been reported to occur with low frequency (Li et al. 2019). On the other hand, the 2A2C and 1A2C groups are commonly observed among progenies from the twin-tail morphotype parents. In fact, in our previous experiments, all 54 Ryukin strain progenies and 16 of 33 progenies obtained from Oranda parents were categorized into 2A2C phenotype. Notably, the ratios of appearance for these two phenotypes are significantly different between Ryukin and Oranda progenies (Table 5.3), suggesting that intra-strain variations exist in the expressivity of the bifurcated anal fin phenotype. Comparisons of morphologically varied progenies from Oranda parents suggested that some juvenile morphological traits are determined at relatively early larval stages. In particular, the presence or absence of a bifurcated caudal fin in adults is conditioned upon the presence or absence of a bifurcated caudal fin fold at the hatching stage or events at even earlier stages. On the other hand, making a

170 Fig. 5.28 The developmental progression of Oranda (2A2C) progeny. Whole-body lateral view of hatched larvae (3 dpf) (a) and a magnified view of its caudal region (b). Lateral view of the caudal region of Fcf larva (14 dpf) (c). Whole-body lateral view of a juvenile (51 dpf) (d) and a ventral view of its caudal region (e). Black arrowhead, black arrows, and black asterisks indicate bifurcated caudal fin, bifurcated anal fin, and malformed fin fold of pre-anal level, respectively. Scale bars, 0.1 mm (a, b), 1 mm (c–e). (Reprinted with permission from Li et al. 2019)

5 Development of Mutant Goldfish Strains

5.1 Twin-Tail Morphotypes Fig. 5.29 The developmental progression of Oranda (1A2C) progeny. Whole-body lateral view of hatched larva (3 dpf) (a) and a magnified view of its caudal region (b). (c) Magnified view of caudal portion of a Cr stage larva (11 dpf). Whole-body lateral view of a juvenile (51 dpf) (d) and a magnified view of its caudal region (e). Black arrows and asterisks indicate the anal fin and malformed region of pre-anal level. Scale bars, 0.1 mm (a, b), 1 mm (c–e). (Reprinted with permission from Li et al. 2019)

171

172

5 Development of Mutant Goldfish Strains

Fig. 5.30 The developmental progression of the single caudal fin Oranda (1A1C). (a) Hatched larvae (3 dpf). (b) Early Cr stage (9 dpf). (c) Late Cr stage (11 dpf). (d) Dr stage (14 dpf). (e) Pb stage (17 dpf). (f). Juvenile stage (51 dpf). Black asterisks indicate areas with malformed fin folds. Scale bar, 0.1 mm (a), 1 mm (b–f). (Reprinted with permission from Li et al. 2019)

Table 5.3 Caudal fin morphology of OR and RY progenies from 41 dpf to 57 dpf

Clutch number #2017-0307-RY #2017-0320-RY #2017-0425-OR #2017-0508-OR Total

Bifurcated 25 29 17 16 87

Single 0 0 1 1 2

Reduced 0 0 1 1 2

Total 25 29 19 18 91

Modified from Li et al. (2019) (Permission from Li et al. 2019)

5.2 Dorsal-Finless Morphotype

173

prediction of whether an individual progeny will form a bifurcated anal fin is made difficult by the relatively small size of the primordial region. In addition to differences in primordial fin folds, extreme morphological deviations can be found in surviving juvenile larvae; such deviations may lead to morphologies that are highly diverged morphology from most twin-tail morphotype juveniles (the larva exhibit reduced large parts of the caudal and anal fin; Fig. 5.31). During the early developmental process, such individuals might fail to develop the ventral dermal tissues, and subsequently, the development of the ventral region at the equivalent level is far different than the majority of twin-tail morphotype progenies (Fig. 5.31). Furthermore, one specimen exhibited a highly bifurcated caudal fin and ambiguous axial topology (Fig. 5.32); it seemed that the caudal region was highly twisted and the bifurcated area was located on the lateral side of the body. However, because this individual had such an extremely differentiated caudal fin morphology and developmental process, we decided the detailed morphology was too complex and ambiguous to be reported in our previous article (Li et al. 2019). On the other hand, some more mildly mutated larvae exhibit a lethal phenotype during the larval developmental process, even though all of the progenies were maintained under the same conditions (Fig. 5.33). In total, the breadth and frequencies of phenotypes provide a unique dataset, which may be used to gain further understanding of the crucial developmental time-points when survival or death will be determined for morphologically diverged progenies.

5.2

Dorsal-Finless Morphotype

In contrast to those of single-tail and twin-tail morphotype goldfish, the developmental process of the dorsal-finless morphotype has not been well investigated, and a paucity of data exists on its embryonic and post-embryonic features. Although we have acquired preliminary data on the development of the Ranchu strain, these data are not sufficient for a comprehensive analyses of the developmental process of the dorsal-finless morphotype (Figs. 5.34, 5.35, 5.36, and 5.37). In fact, our preliminary observations in progenies from the Ranchu strain did not include any significant Ranchu-specific embryonic features from zygote to somite stages (Fig. 5.34). However, late embryonic and larval Ranchu strain progenies exhibit both inter-strain and intra-clutch differences in morphology; some of these differences are highly deviated from any other morphotypes at the equivalent stage (Fig. 5.35). Here, the evident differences in embryonic and larval morphology between the Ranchu progenies and the other two morphotypes are described.

174 Fig. 5.31 The developmental progression of the bifurcated anal fin and reduced caudal fin in Oranda progeny. (a) Hatched larvae. (b) Lateral view of Dr stage (14 dpf) and a magnified view (c). (d) Lateral view of juvenile (51 dpf) and a magnified ventral view (e). Black arrowheads indicate caudal fin fold (and caudal fin); black arrows indicate anal fin; black asterisks indicate malformed region of preanal fin fold. White asterisks indicate enlarged ventral region in panels (c, d). A missing portion of the post anal fin is indicated by the black bracket in panels (a, b). A white arrowhead points to the rudimental ventral fin lobe in panel (e). Scale bars, 0.1 mm (a, b) 1 mm (c–e). (Reprinted with permission from Li et al. 2019)

5 Development of Mutant Goldfish Strains

5.2 Dorsal-Finless Morphotype

175

Fig. 5.32 The developmental progression of an Oranda progeny with extremely bifurcated caudal fin. (a) Hatched larva (3 dpf), (b–f, h) Caudal view of the progeny. (b) Early Cr stage (9 dpf). (c) Late Cr stage (11 dpf). (d) Dr stage (14 dpf). (e) Pb stage (17 dpf). (f) Juvenile stage (29 dpf), (g) Juvenile stage (51 dpf). (h) Magnified view of caudal region in panel (g). Scale bar, 1 mm

5.2.1

Pharyngula Stage Embryos and Hatching Stage Larvae

Ranchu progenies exhibit various yolk extension morphologies, including both enlarged and reduced yolk extensions (Fig. 5.35a). Variability is found not only in yolk extension morphology, but the fin folds also exhibit variations. One pharyngula larva may have a largely reduced dorsal fin fold, while another retains a part of the dorsal fin fold (Fig. 5.35b, c). These variations in the fin fold are consistent with

176

5 Development of Mutant Goldfish Strains

Fig. 5.33 The developmental progression of Oranda progeny with lethal phenotype. (a) Hatched larvae (3 dpf). (b) 9 dpf larva. (c) 11 dpf larva. Asterisks indicate yolk in panel (a) and abnormally developed ventral region in (b, c). Arrowheads indicate bifurcated caudal fin fold Scale bar, 0.1 mm (a, b), 1 mm (c). (Images courtesy of Ing-Jia Li)

variations in the adult dorsal fin morphology noted by Matsui (1934); he reported variations in the missing patterns of the dorsal fin. Based on the assumption that the dorsal fin fold development is required for the dorsal fin formation, it is reasonable to expect that the presence/absence of dorsal fin at the adult stage is dependent on whether the dorsal fin fold develops (or not) at the pharyngula stage (Fig. 5.35d–f). Some pharyngula larvae, which might not express severe phenotypes, can develop to hatching stage, and they also exhibit variation in the shape of notochord. The individual illustrated in Fig. 5.35d exhibits a relatively straight body shape, but the other individuals (Fig. 5.35e, f) have bent notochords at different body levels. However, it is still uncertain whether these malformations of the body axis (including bending of the notochord and its related tissues) reflect Ranchu-specific features or not (see below Sect. 5.2.4).

5.2.2

5–9 dpf Larval Progenies

A number of five dpf larvae of the Ranchu strain also exhibit highly deviated phenotypes (Fig. 5.36), and there is substantial variation among larvae in total length. Those larvae with more severe phenotypes are typically smaller than the

5.2 Dorsal-Finless Morphotype

177

Fig. 5.34 Representative Ranchu embryos at zygote, cleavage, blastula, gastrula, and segmentation stages. Side views of one-cell stage (a), two-cell stage (b), and the intermediate stage between fourand eight-cell stages (c). The animal pole views of the 16-cell stage (d) and the intermediate stage between 16- and 32-cell stages (e). Size view of dome stage (f). The animal pole view of germ ring stage (g). Late shield stage (h). Bud stage (i). Mid-somite stages (containing 16–19 somite stages) (j). Eighteen-somite stage (k). Scale bars, 0.1 mm (i, k), 1 mm (j). Panels (a–i) were photographed at the same magnification. (Photographed by the author)

other larvae. Moreover, the shapes of the yolk extension and notochord, in addition to caudal fin morphology, are also varied among individuals. Even though the Ranchu morphology is highly deviated from the twin-tail morphotype progenies, the fish can mostly survive at larval stages (5–9 dpf)

178 Fig. 5.35 Representative embryos of pharyngeal and hatching stage embryos of Ranchu progenies. (a) Variations of pharyngeal stage embryos. The lateral views show an embryo that is completely missing dorsal fin (b) and an embryo with a dorsal fin fold (c). (d–f) Variations of 3 dpf embryos. All embryos have absent dorsal fin folds. Embryos have notochords that are bent at different positions (e, f). Scale bars, 1 mm (a), 0.1 mm (c, f). Panels (b–f) were photographed at the same magnification. (Photographed by the author)

5 Development of Mutant Goldfish Strains

5.2 Dorsal-Finless Morphotype

179

Fig. 5.36 Representative Ranchu larvae. Variations of 5 dpf larvae (a). Whole lateral views of 5 dpf larvae (b, d) and their magnified views (c, e). The progenies in panel (d) and (e) exhibit bent notochord. Variations among 9 dpf larvae (f). Lateral view of short-body larva (g) and corresponding calcein-stained fluorescent view (i). Lateral view of the slightly curved larvae (h) and corresponding calcein-stained fluorescent view (j). Scale bars, 1 mm (a, b, d, e, g, i), 0.1 mm (c, e). Panels showing the 9 dpf lateral view of the same larva [(f, g) and (h, i)] were photographed at the same magnifications. (Photographed by the author)

(Fig. 5.36). At this stage, the contrast between the twin-tail morphotype and the dorsal-finless morphotype is evident not only in the dorsal fin fold but also in the swim bladder. An inflated swim bladder is present in both single-tail and twin-tail larvae at 5–7 dpf, but it is absent in the dorsal-finless morphotype larvae at 9 dpf. Moreover, one individual was found to exhibit a highly deviated morphology of the lower jaw, and due to this morphological feature, the individual seems unable to close its mouth (Fig. 5.36). The calcification patterns of axial skeletal tissues are also varied between individuals. As observed in the twin-tail morphotypes, unsegmented calcified tissues are observed in both progenies illustrated in Fig. 5.36g, i. However, the unsegmented patterns are significantly different between these two larvae. In the progeny shown in Fig. 5.36g, almost no segmental patterns are recognized, while relatively clear segmental patterns are observed in the other progeny (Fig. 5.36i).

5.2.3

Limitations of Staging Indexes for the Dorsal-Finless Morphotype

The staging indexes for the single-tail common goldfish may be readily applied to the twin-tail morphotypes, and the indexes can also be used for relatively early stage embryos of the dorsal-finless morphotypes. However, our observations of late stage

180

5 Development of Mutant Goldfish Strains

embryos and larvae of the Ranchu strain indicate that there are several limitations to applying these staging indexes to the dorsal-finless morphotypes. For example, the appearance of the dorsal fin ray is used as a staging index, but clearly, this index cannot apply to dorsal-finless morphotypes (Fig. 5.37). Moreover, the use of standard length to characterize larvae with bent notochords is very difficult (Fig. 5.35). In previous studies describing post-embryonic staging indexes for the single-tail common goldfish, the developmental process was traced to determine the appearance order of each staging index. However, a relatively large number of Ranchu progenies exhibit severe phenotypes that cause lethality, in contrast to the progenies of single-tail common goldfish and typical twin-tail strains (Oranda and Ryukin). This high rate of lethal phenotypes causes technical problems for the tracing of the staging index appearance order in individuals of the dorsal-finless morphotype (Figs. 5.35 and 5.36). In other words, comparing the phenotypes of embryonic, larval, and juvenile fish is quite difficult because the individuals are not identical, unlike the twin-tail morphotype progenies that are amenable to such comparisons (Figs. 5.28, 5.29, 5.30, 5.31, and 5.32). This technical problem may also present a major obstacle to investigating the polymorphic features of larval dorsal-finless phenotypes. As Fig. 5.35b, c indicates, dorsal-finless progenies exhibit major differences at the body level where the dorsal fin fold would normally be found. While the polymorphic features of the mutated dorsal fin fold at the larval stages might be related to the polymorphisms in adults, described by Matsui (1934), the larval status and juvenile/adult status cannot be compared directly. The extremely modified phenotypes of dorsal-finless progenies also impede the application of the wild-type index for the stage identification. For example, the shape of the snout and mouth cannot be compared between the progenies shown in Fig. 5.36f, h. Moreover, our preliminary data suggest that the appearance timing of the anterior swim bladder is not reliably observable (Fig. 5.37), as a substantial number of progenies exhibit malformed anterior swim bladders. Although the ambiguous appearance timings of the staging indexes are persistent problems for the establishment of a widely available and comprehensive staging table, the situation may provide us an opportunity to investigate how developmental processes and selective pressures are related to adult morphologies.

5.2.4

Molecular Interpretation of the Developmental Process

Several malformations and polymorphic features in Ranchu progenies were introduced in the above section; however, it is still uncertain whether these malformations are caused by the mutation responsible for the dorsal-finless phenotype. As mentioned in Chap. 3, lrp6S was recently identified as a candidate gene for the dorsalfinless phenotype (Table 3.1) (Kon et al. 2020). It is expected that the mutation in this gene would cause the dorsal-finless mutation because of the following reasons: (1) depletion of its Xenopus homolog causes the malformation of the dorsal fin fold (Hassler et al. 2007), (2) the lrp6 homolog is essential for Wnt signaling, and Wnt

5.2 Dorsal-Finless Morphotype

181

Fig. 5.37 Representative Cr, Fcf, Asb, and Ar stages of Ranchu progenies. Left column and right column show light and calcein-stained fluorescent views. Lateral views of early Cr (a, b), late Cr (c, d), Fcf (e, f), Asb (g, h), and Ar (i, j) stage larvae. Fused vertebral elements are indicated by white arrowheads. The white asterisks indicate abnormally developed swim bladder. Scale bars, 1 mm (h, j). Panels of the same larva [(a, b), (c, d), (e, f), (g, h), (i, j)] were photographed at the same magnification. (Photographed by the author)

signaling is related to the development of fins (including median and paired fins), and (3) ectopic expression of Dkk1 (a negative regulator of lrp6-mediated Wnt signaling) affects dorsal fin formation in zebrafish (Hassler et al. 2007; Mathew et al. 2008; Kagermeier-Schenk et al. 2011; Nagendran et al. 2015; Kon et al. 2020). However, it is still unknown how lrp6S might reduce the dorsal fin in dorsal-finless

182

5 Development of Mutant Goldfish Strains

goldfish morphotype goldfish at a molecular level, because the function of this gene has not been directly examined in goldfish. It was previously reported that depletion of the lrp6 homologue in zebrafish causes a lethal phenotype (Jiang et al. 2012). However, it is also known that the dorsal-finless morphotype might be caused by reduction of the heterozygosity in addition to a bottleneck effect (Kon et al. 2020). Moreover, all modern goldfish strains categorized as dorsal-finless morphotypes also have the twin-tail phenotype, suggesting that they are homozygous for the chdSE127X allele. In other words, not only one single mutation but multiple mutations should be taken into consideration when trying to understand why such a highly lethal and polymorphic phenotype is observed in Ranchu progenies. Furthermore, it is still uncertain whether all dorsalfinless morphotype goldfish clutches exhibit high lethality and polymorphic development, due to a paucity of research on the developmental process in this morphotype goldfish. The problems mentioned above seem to apply to not only Ranchu progenies but also to other dorsal-finless morphotype goldfish strains (e.g., Celestial).

5.3

Notes on the Cranial Level, Body Shape, and Integument Ornamental Phenotypes

The developmental processes of three representative morphotype goldfish were explained in Chap. 4 and the above sections (Sects.5.1 and 5.2). Although all modern goldfish strains can be categorized into these three morphotypes, some strains have additional ornamental phenotypic features at the cranial level, in the body shape, and/or in the integuments. These additional ornamental phenotypic features are examined in this section.

5.3.1

Telescope Eyes

The morphology of eyes in the black telescope eye strain is quite similar to that of single-tail morphotype goldfish at the larval stage (pec fin stage) from the dorsal view; in other words, the larvae of the black telescope eye does not yet exhibit its adult characteristic of extremely protruded eyes. Moreover, at the juvenile stage, it is still hard to detect any significant protrusion of the eyes. These observations in the larvae and juveniles suggest that the formation of the protruded eye morphology might begin at the late juvenile stage, with the size of the eyes increasing gradually during the late juvenile to adult stages (Fig. 5.38). Although it is uncertain how mutations in lrp2al (the candidate gene for telescope eye mutation) influence the developmental process of goldfish, mouse genetics studies suggest that the involvement of this gene implies the SHH pathway may be related to the phenotypes in

5.3 Notes on the Cranial Level, Body Shape, and Integument Ornamental Phenotypes Fig. 5.38 Developmental progress of protruding eyes phenotype. (a) Hatching stage embryo (3 dpf) of Heimutan (one of the telescope eye strain) progeny. (b) Early lava stage (13 dpf) of Heimutan progeny. (c) Juvenile stage (53 dpf) of Heimutan progeny. (d) Adult Heimutan strain individual. Scale bars, 0.1 mm (a, b), 1 mm (c, d). (Photographed by the author)

183

184

5 Development of Mutant Goldfish Strains

black telescope eye goldfish and other telescope eye mutants (including Celestial) (Kon et al. 2020; Christ et al. 2015).

5.3.2

Warty Growth

A comparison of the Ryukin and Oranga strain progenies revealed that the warty growth (or hood) becomes evident at the late post-embryonic stages (Li et al. 2019). The epithelial tissues on the dorsal and lateral sides of the cranial region are extremely enlarged in adult Oranda but not in Ryukin goldfish (Figs. 3.9 and 5.27). While we could not detect enlarged epithelial tissues on the cranial regions of larval Oranda under light microscopy, the dorsal cranial epithelial tissues do tend to be thickened in the Oranda juvenile compared with Ryukin juveniles (Fig. 5.39). It is worthwhile to mention that the warty growth phenotype involves alterations to the internal skeletal morphology. Taking into account that there are differences in the cranial skeletal morphologies of ornamental goldfish having the warty growth (for example, Ranchu and Oranda) (Koh 1931, 1932), it is expected that the molecular mechanisms controlling cell growth at the dorsal side of the cranial region might be modified in the developmental process. Moreover, it was reported that the brain morphology (the size of the vagal lobe, facial lobe, and corpus cerebelli) and histological features of the vagal lobe (Masai et al. 1982) are varied among different strains. Since these cranial tissues cannot be directly observed by breeders and fanciers, it is difficult to expect that modifications of these tissues were caused by the direct artificial selective pressures. Rather, it is reasonable to presume that these modifications occurred as a byproduct of the artificial selection for the ornamental morphology.

Fig. 5.39 Cranial region of Ryukin and Oranda goldfish progenies at juvenile stage. (a) Ryukin. (b) Oranda. Black asterisks indicate the warty growth. Scale bar, 1 mm. Both panels are shown at the same magnification. (Reprinted with permission from Li et al. 2019)

5.3 Notes on the Cranial Level, Body Shape, and Integument Ornamental Phenotypes

185

The molecular basis of the byproduct is still totally unknown. However, at this moment, we can make two alternative hypotheses: (1) the locus or allele responsible for the phenotype also causes modifications to these skeletal and neural tissues, or (2) the inbreeding process during domestication caused irregular morphologies in these tissues. The first hypothesis assumes that a single locus/allele influences both the ornamental phenotype, which appears on the surface of body and the internal skeletal and brain tissue phenotypes. Consequently, the mutated phenotype would always include these different anatomical/histological features. On the other hand, the second hypothesis suggests that the phenotypes are caused by different loci, and would therefore be separable. While the aforementioned two hypotheses are not mutually exclusive and further careful consideration is required, we will discuss their relationship in the rest of the chapter.

5.3.3

General Ornamental Mutant Phenotypes at the Cranial Level

In addition to the aforementioned mutated phenotypes, water bubble eyes and narial bouquets can be raised as further examples of ornamental mutations in the cranial region. Although the underlying developmental processes have not yet been carefully examined, it is expected that these phenotypes result from increasing the size of tissues differentiated from the late developmental stage, similar warty growth, given that the affected tissues are quite similar. As such, the development of these phenotypes might be explained as irregular growth of the integument tissues at the cranial level. Moreover, these cranial level mutations might not require topological changes to anatomical elements for their formation, in contrast to the requirement for skeletal alterations underlying the appearance of a bifurcated caudal fin or loss of dorsal fin. Thus, it seems reasonable to assume that most ornamental mutations at the cranial level might be caused by the modifications to molecular developmental mechanisms that control cell growth at a certain region. Furthermore, it is worthwhile to note that one may make arbitrary combinations of cranial mutations and basic internal skeletal architectures. The twin-tail and the twin-tail dorsal-finless morphotypes both contain warty growth and telescope-eye variations (Teichfischer 1994). This ability to make combinations implies that the genes responsible for cranial ornamental morphologies and axial skeletal morphotypes act independently of each other. Since the respective responsible loci for twin-tail, dorsal-finless, and the telescope-eye are already known to be chdS, lrp6S, and lrp2aL, it is expected that these mutated alleles can co-exist in one individual fish; otherwise, Celestial could not have been genetically fixed in the goldfish population. Moreover, these mutations can also co-exist with several different color pigment mutations.

186

5.3.4

5 Development of Mutant Goldfish Strains

Globular Body Shape

Although the adult Ryukin and Oranda goldfish exhibit highly shortened and roundish trunk morphologies in comparison with wild-type goldfish, there is no major difference in trunk morphology at the early larval stage (Figs. 3.1, 5.8, and 5.28). In other words, the inter-strain differences in trunk shape tend to be enhanced during the late post-embryonic developmental process. It is also known that the twintail and dorsal-finless morphotype strains exhibit fused and/or twisted morphologies in axial skeletal elements (including vertebral body, neural spine, and ribs) (Koh 1931, 1932; Li et al. 2019), consistent with the skeletal phenotypes of chordin mutant zebrafish (Fisher and Halpern 1999; Abe et al. 2014). However, it seems that the chordin mutation does not always produce a globular body shape. For example, the twin-tail Wakin has slender body (compare the MitsuoWakin and the other twin-tail goldfish; Fig. 3.8), suggesting that the chdS locus is not decisive locus for the globular body shape. Moreover, Tamasaba has a single fin but globular body shape; although Tamasaba (the so-called single-tail Ryukin strain) was not described in Smartt (2001) and Matsui (1934), this strain was used for genome analyses in Kon et al. (2020), suggesting that the globular body and twin-tail morphology can independently exist in a single goldfish. Although the developmental process of the Tamasaba strain has not been examined, its development is likely quite similar to the progeny of twin-tail morphotype parents, as shown in Fig. 5.31. This photographed individual (with chdSE127X/E127X locus) exhibited a mutated ventral fin fold at the larval stage, and a globular body with a single caudal fin at the juvenile stage. Thus, the chordin mutation and globular body shape (and twintail morphology) are not inseparable, suggesting the possibility that additional alleles are involved determining the globular body shape. In other words, the penetrance/ expressivity of chdSE127X/E127X at different developmental time points might be related to morphological variations, such as those mentioned above. It is also assumed that the developmental process of the somite might have been affected by artificial selection for the globular adult body shape. However, comparisons of somite segmentation in the different goldfish strains have not given clear answer to the question of how such a globular body shape arises in the Ryukin and Oranda strains (Fig. 5.3). Although these two twin-tail morphotype goldfish show timing delays in the first segmentation of the somite, the rates of segmentation per hour are quite similar among strains, suggesting that the molecular mechanisms for the somite segmentation have not been modified in these goldfish strains (Saga and Takeda 2001). Thus, the appearance of the globular body shape might be established by modifications to the molecular developmental process of somite derivatives, rather than somite genesis.

5.4 Genes and Development

5.4

187

Genes and Development

From observations on the developmental processes of single-tail, twin-tail, and dorsal-finless morphotype goldfish strains, it is clear that adult phenotypes are reflected in embryonic and larvae fin fold morphologies, as follows: (a) the singletail morphotype develops a complete median fin fold (Figs. 4.12 and 4.15), (b) the twin-tail morphotype forms a bifurcated ventral fin fold (Figs. 5.5 and 5.8), and (c) the dorsal-finless morphotype lacks a major part of the dorsal fin fold (Figs. 5.35 and 5.36). Since ornamental goldfish strains were established by artificial selection for adult morphologies, it is only the fin morphologies of late developmental stages (including late larva, juvenile, and adult) that have provided the basis for artificial selection, and the embryonic fin fold morphology has not. Moreover, ventralized expression patterns were observed in early embryos of the twin-tail morphotype, which were caused by the mutation in chdS (Fig. 5.7). These results suggest that artificial selection changed the early embryonic developmental process in goldfish strains with twin-tail morphology. Furthermore, it is also known that development of the median fin fold is related to the neural tube and non-neural tube ectoderm in somite stage zebrafish embryos (Abe et al. 2007). Although it is still unknown how the lrp6S mutation causes the dorsal-finless phenotype, it is highly possible that the genetic mutation influences the developmental process of the ectoderm in somite stage embryos. Taken together, these observations suggest that selective pressures on adult median fin morphologies led to genetic fixation of mutations in the responsible genes and consequently changed the early developmental process of the goldfish. One especially evident change is in the development of calcified skeletal elements in the caudal and dorsal fins. Such changes are easy to observe under stereomicroscopic observation. As such, single-tail morphotype goldfish display mid-line constrained calcified skeletons (including fin rays and attached anal, caudal, and dorsal fins); twin-tail morphotype goldfish show bifurcated caudal fin rays and attached axial skeletons; the dorsal-finless morphotype exhibits bifurcated caudal skeletal elements (like the twin-tail morphotype) and also lacks dorsal fin rays and attached internal skeletons (dorsal fin radials) (Figs. 5.10 and 5.20). Several different connective tissues (tendons, cartilages, and muscles) are also attached to the calcified skeletal tissues, and these connective tissues are also duplicated, as shown in histological sections (Figs. 5.22 and 5.23). Most of these skeletal and non-skeletal connective tissues are not developed from the fin fold directly. However, some are known to be derived from the neural crest and somite in zebrafish (Smith et al. 1994; Kague et al. 2012; Shimada et al. 2013), suggesting that the developmental programs of primordial cells were influenced by artificial selection. Therefore, the developmental processes in multiple tissues and cell populations with widely varied embryonic origins were changed by artificial selection during the establishment of the twin-tail and dorsal-finless morphotypes from the original wild-type population. In the context of genetics, the above-mentioned evolutionary changes in the development of skeletal structures can be explained and generalized as follows. A

188

5 Development of Mutant Goldfish Strains

genetic mutation changed goldfish development and formed an attractive morphology for breeders and fanciers. This mutation was then positively selected by artificial means, until it became genetically fixed in a population. Once an associated mutant locus and its nucleotide sequence is identified, many researchers, fanciers, and breeders might be convinced that the cause of the phenotype is known. However, each mutation in each gene may differently influence the developmental process. In fact, the single-tail, twin-tail, and dorsal-finless morphotypes display developmental differences at early embryonic stages, while other phenotypic mutations (including, protruding eyes, warty growth and mutations in integuments) affect later developmental processes. Thus, the genes responsible for twin-tail (chdS) and dorsal-finless (lrp6S) phenotypes seem to affect earlier processes than genes responsible for phenotypes, such as teleoscope-eye (lrp2aL), that are only observed in late developmental stages. In particular, these genes differ in how the phenotypes arise and how the gene is related to other genes during development. Furthermore, these processes are related to how the gene was selected during the domestication process. It is expected that careful comparisons between the three representative morphotypes and some other mutated morphologies, in terms of both genetics and development, will provide new opportunities to tackle problems of vertebrate evodevo.

References Abe G, Ide H, Tamura K (2007) Function of FGF signaling in the developmental process of the median fin fold in zebrafish. Dev Biol 304(1):355–366. https://doi.org/10.1016/j.ydbio.2006.12. 040 Abe G, Lee S-H, Chang M, Liu S-C, Tsai H-Y, Ota KG (2014) The origin of the bifurcated axial skeletal system in the twin-tail goldfish. Nat Commun 5:3360. https://doi.org/10.1038/ ncomms4360 Asano H, Kubo Y (1972) Variations of spinal curvature and vertebral number in goldfish. Jpn J Ichthyol 19(4):223–231 Christ A, Christa A, Klippert J, Eule JC, Bachmann S, Wallace VA, Hammes A, Willnow TE (2015) LRP2 acts as SHH clearance receptor to protect the retinal margin from mitogenic stimuli. Dev Cell 35(1):36–48 De Robertis EM (2006) Spemann’s organizer and self-regulation in amphibian embryos. Nat Rev Mol Cell Biol 7(4):296–302. http://www.nature.com/nrm/journal/v7/n4/suppinfo/nrm1855_S1. html De Robertis EM (2008) Evo-devo: variations on ancestral themes. Cell 132(2):185–195. https://doi. org/10.1016/j.cell.2008.01.003 De Robertis EM (2009) Spemann’s organizer and the self-regulation of embryonic fields. Mech Dev 126(11–12):925–941. https://doi.org/10.1016/j.mod.2009.08.004 Fisher S, Halpern ME (1999) Patterning the zebrafish axial skeleton requires early chordin function. Nat Genet 23(4):442–446. https://doi.org/10.1038/70557 Garcia Abreu J, Coffinier C, Larrain J, Oelgeschlager M, De Robertis EM (2002) Chordin-like CR domains and the regulation of evolutionarily conserved extracellular signaling systems. Gene 287(1-2):39–47. https://doi.org/10.1016/S0378-1119(01)00827-7 Hammerschmidt M, Pelegri F, Mullins MC, Kane DA, van Eeden FJ, Granato M, Brand M, Furutani-Seiki M, Haffter P, Heisenberg CP, Jiang YJ, Kelsh RN, Odenthal J, Warga RM,

References

189

Nüsslein-Volhard C (1996) Dino and Mercedes, two genes regulating dorsal development in the zebrafish embryo. Development (Cambridge, England) 123:95–102 Hassler C, Cruciat C-M, Huang Y-L, Kuriyama S, Mayor R, Niehrs C (2007) Kremen is required for neural crest induction in Xenopus and promotes LRP6-mediated Wnt signaling. Development 134(23):4255–4263. https://doi.org/10.1242/dev.005942 Inomata H, Haraguchi T, Sasai Y (2008) Robust stability of the embryonic axial pattern requires a secreted scaffold for chordin degradation. Cell 134(5):854–865. https://doi.org/10.1016/j.cell. 2008.07.008 Jiang Y, He X, Howe PH (2012) Disabled-2 (Dab2) inhibits Wnt/β-catenin signalling by binding LRP6 and promoting its internalization through clathrin. EMBO J 31(10):2336–2349. https:// doi.org/10.1038/emboj.2012.83 Kagermeier-Schenk B, Wehner D, Özhan-Kizil G, Yamamoto H, Li J, Kirchner K, Hoffmann C, Stern P, Kikuchi A, Schambony A (2011) Waif1/5T4 inhibits Wnt/β-catenin signaling and activates noncanonical Wnt pathways by modifying LRP6 subcellular localization. Dev Cell 21 (6):1129–1143. https://doi.org/10.1016/j.devcel.2011.10.015 Kague E, Gallagher M, Burke S, Parsons M, Franz-Odendaal T, Fisher S (2012) Skeletogenic fate of zebrafish cranial and trunk neural crest. PLoS One 7(11):1–13. https://doi.org/10.1371/ journal.pone.0047394 Koh T-P (1931) Osteology of Carassius auratus. Sci Rep Natl Tsing Hua Univ Peiping China 1:61–81 Koh T-P (1932) Osteological variations in the axial skeleton of goldfish (Carassius auratus). Sci Rep Natl Tsing Hua Univ 2:109–121 Kon T, Omori Y, Fukuta K, Wada H, Watanabe M, Chen Z, Iwasaki M, Mishina T, Shin-ichiro SM, Yoshihara D (2020) The genetic basis of morphological diversity in domesticated goldfish. Curr Biol 30:1–15. https://doi.org/10.1016/j.cub.2020.04.034 Li IJ, Chang CJ, Liu SC, Abe G, Ota KG (2015) Postembryonic staging of wild-type goldfish, with brief reference to skeletal systems. Dev Dyn 244(12):1485–1518. https://doi.org/10.1002/dvdy. 24340 Li I-J, Lee S-H, Abe G, Ota KG (2019) Embryonic and post-embryonic development of the ornamental twin-tail goldfish. Dev Dyn 248(4):251–283. https://doi.org/10.1002/dvdy.15 Matsui Y (1934) Genetical studies on gold-fish of Japan. Imp Fish Inst XXX:1 Masai H, Takatsuji K, Sato Y, Ojima Y (1982) Morphological variation in crucian brains, with special reference to the origin of the goldfish. J Zool Syst Evol Res 20(4):296–301. https://doi. org/10.1111/j.1439-0469.1983.tb00555.x Mathew LK, Sengupta SS, LaDu J, Andreasen EA, Tanguay RL (2008) Crosstalk between AHR and Wnt signaling through R-spondin1 impairs tissue regeneration in zebrafish. FASEB J 22 (8):3087–3096. https://doi.org/10.1096/fj.08-109009 Matsui Y, Kumagai T, Betts LC (1972) Pet library goldfish guide. Pet Library Limited, London Nagendran M, Arora P, Gori P, Mulay A, Ray S, Jacob T, Sonawane M (2015) Canonical Wnt signalling regulates epithelial patterning by modulating levels of laminins in zebrafish appendages. Development 142(2):320–330. https://doi.org/10.1242/dev.118703 Ota KG, Abe G (2016) Goldfish morphology as a model for evolutionary developmental biology. Wiley Interdiscip Rev Dev Biol 5(3):272–295. https://doi.org/10.1002/wdev.224 Saga Y, Takeda H (2001) The making of the somite: molecular events in vertebrate segmentation. Nat Rev Genet 2(11):835–845. https://doi.org/10.1038/35098552 Sasai Y, Lu B, Steinbeisser H, Geissert D, Gont LK, De Robertis EM (1994) Xenopus chordin: a novel dorsalizing factor activated by organizer-specific homeobox genes. Cell 79(5):779–790 Shimada A, Kawanishi T, Kaneko T, Yoshihara H, Yano T, Inohaya K, Kinoshita M, Kamei Y, Tamura K, Takeda H (2013) Trunk exoskeleton in teleosts is mesodermal in origin. Nat Commun 4:1639. https://doi.org/10.1038/ncomms2643 Smartt J (2001) Goldfish varieties and genetics: a handbook for breeders. Blackwell Science, Oxford Smartt J, Bundell JH (1996) Goldfish breeding and genetics. TFH Publications, Neptune, NJ

190

5 Development of Mutant Goldfish Strains

Smith M, Hickman A, Amanze D, Lumsden A, Thorogood P (1994) Trunk neural crest origin of caudal fin mesenchyme in the zebrafish Brachydanio rerio. Proc R Soc Lond Ser B Biol Sci 256 (1346):137–145 Teichfischer B (1994) Goldfische in aller Welt: Haltung, Zuchtformen und Geschichte der ältesten Aquarienfische der Welt. Tetra Verlag Tsai H-Y, Chang M, Liu S-C, Abe G, Ota KG (2013) Embryonic development of goldfish (Carassius auratus): a model for the study of evolutionary change in developmental mechanisms by artificial selection. Dev Dyn 242(11):1262–1283. https://doi.org/10.1002/dvdy.24022 Watase S (1887) On the Caudal and anal fins of gold-fishes. J Coll Sci Imp Univ Tokyo 1:247–267

Chapter 6

Evodevo Questions Related to Ornamental Morphology

Abstract Ornamental morphologies of domesticated goldfish strains have been established by breeders and fanciers. It is certain that spontaneous mutants in nucleotide sequences and selections played a significant role in the establishment of these various goldfish strains, but additional evolutionary events also seem to be required to explain the establishment of variants with ornamental morphologies. Here, the twin-tail morphotype goldfish strains are examined from the perspectives of genome evolution and developmental biology. Based on these examinations, I put forth a hypothesis that different types of evolutionary events should occur in a specific order for the occurrence of large-scale morphological changes. In this chapter, I also consider current problems relating to (a) the absence of twin-tail morphology in other teleost species, (b) polymorphisms of the dorsal-finless phenotypes, (c) the relationship between different types of ornamental phenotypes and their responsible genes, (d) the absence of a “scale-less goldfish.” By considering these problems, the differences between the “early embryonic stage-appearing mutated phenotypes” and the “late developmental stage-appearing mutated phenotypes” are illustrated in an attempt to define the relationships between mutation, selection, and development.

The developmental processes of wild-type and mutant goldfish strains were introduced in Chaps. 4 and 5. Comparing these different ornamental goldfish strains allows us to understand how the developmental process has been modified through artificial selection by breeders and fanciers. On the basis of these descriptions, we will use this chapter to discuss remaining research questions and problems that should be solved in further studies. In particular, we will consider how ornamental morphologies and the underlying developmental processes are related to the domestication history of the goldfish and other biological phenomena (for example, allotetraploidization and developmental robustness) and raise current questions related to the twin-tail, dorsal-finless, and the other ornamental morphologies (from Sects. 6.1 to 6.4). We also examine the relationships between different phenotypic mutations and their appearance timings in the context of evolution and developmental biology (Sect. 6.5).

© The Author(s), under exclusive license to Springer Nature Singapore Pte Ltd. 2021 K. G. Ota, Goldfish Development and Evolution, https://doi.org/10.1007/978-981-16-0850-6_6

191

192

6.1

6 Evodevo Questions Related to Ornamental Morphology

Bifurcated Median Fin Mutations of Twin-Tail Morphotype Goldfish

The rareness of the twin-tail morphology in nature should first be noted. Of all known vertebrate species, none have been found to exhibit a bifurcated caudal skeleton under natural conditions (Janvier 1996; Liem et al. 2001; Kardong 2012). The absence of such a peculiar skeletal morphology in nature is probably the result of strong selective pressures from environmental factors. For example, a twin-tail vertebrate species would likely be eliminated from natural populations due to a significant reduction in locomotor ability. On the other hand, the twin-tail morphology was positively fixed in domesticated populations of goldfish, despite its leading to reduced locomotion. When breeders and fanciers want to fix a mutant morphology for ornamental purposes, mutant individuals are carefully raised and maintained under human protection, reducing the risk of death associated with the mutation. However, such ornamental animals (for example, twin-tailed dogs and/or twin-tailed cats) have not been genetically fixed in conventional domesticated species (except for goldfish with bifurcated caudal fins), even though several reports of these mutations in the caudal region have been made in other species (Bateson 1894; Korschelt 1907). From its internal skeletal morphology, the twin-tail goldfish can be recognized as a vertebrate with a partially bifurcated axial skeletal system (Figs. 3.4, 3.6, and 3.7). The internal skeleton supporting the caudal fin consists of calcified bones, cartilages, and the notochord. Although the notochord is not bifurcated, a number of the calcified bones and cartilages are laterally bifurcated (see Chap. 5). Since an equivalent skeletal morphology cannot be found in any extant or extinct vertebrate species, the twin-tail morphology of the goldfish can be considered as a significant deviation in the basic body architecture of vertebrates. In other words, the basic axial skeletal morphology, which has been evolutionarily conserved for more than 400 million years, was changed within a short period of artificial selection by Chinese breeders during the early Middle Ages (Liem et al. 2001; Kardong 2012; Abe et al. 2014, 2016). Although the chdSE127X was revealed to be the gene responsible for this phenotype by molecular developmental genetics and functional analyses (Abe et al. 2014, 2016), it should be further considered how such a drastic and large-scale evolutionary change would only occur in the goldfish lineage.

6.1.1

Chordin Paralogs and Their Expression Patterns

Highly ventralized gene expression patterns of the twin-tail morphotype goldfish embryos were shown in the previous chapter (Fig. 5.7). Similarly, the same types of ventralized gene expression patterns and twin-tail morphology were also reported in the dino/chordin zebrafish and medaka chordin mutants, meaning these phenotypes

6.1 Bifurcated Median Fin Mutations of Twin-Tail Morphotype Goldfish

193

are common features of chordin gene-depleted teleost species (Abe et al. 2014; Ota and Abe 2016; Fisher and Halpern 1999; Takashima et al. 2007). However, unlike the zebrafish and medaka chordin gene mutants, which show severe phenotypes, the chdSE127X goldfish exhibit a high survival rate (Fisher and Halpern 1999; Takashima et al. 2007; Abe et al. 2014; Li et al. 2019). Thus, one may raise a question: why is the survival rate of goldfish different from those of other chordin mutant teleost species? It is known that dorsal-ventral patterning by chordin-related molecular networks is a highly robust and conserved molecular mechanism among different vertebrate species (Yabe et al. 2003; Muraoka et al. 2006; Inomata et al. 2008; De Robertis 2009; Langdon and Mullins 2011). To explain how such a highly conserved and robust developmental mechanism could be modified without causing a lethal phenotype only in the goldfish lineage, a deeper examination is required. One of the most significant factors determining whether the twin-tail phenotype is non-lethal/lethal is the presence/absence of chordin gene paralogs (Fig. 5.6). Two chordin paralogs (chdS and chdL) were isolated from goldfish, but paralogous genes are not found in zebrafish or medaka genomes (Abe et al. 2014; Ota and Abe 2016). This presence/absence of chordin gene paralogs is the primary cause of the significant differences in survival between twin-tail goldfish and the other two model teleost species. More specifically, in the goldfish, depletion of one of two chordin paralogs is permissible because the other chordin gene exhibits a compensatory function. It is hypothesized that the compatible functions of chdS and chdL led goldfish embryos to avoid a lethal phenotype when chdS function was reduced by the stop codon mutation. However, this hypothesis is still not sufficient to explain the highly ventralized gene expression patterns in the twin-tail goldfish early embryos; if chdL can completely compensate for the loss of chdS, then chdS-depleted embryos might be expected to develop as a wild-type embryo without ventralized gene expression patterns. Based on this reasoning, there should be differences between the chordin paralogs that allow expression of the twin-tail morphology without lethality. One such difference is that chdS and chdL show partially (but not completely) overlapping expression patterns (Fig. 5.7) (Abe et al. 2014). The relatively narrow expression pattern of the chdL gene suggests that the total amount of functional chordin proteins might be reduced in the chdS mutant, allowing ventral marker genes to be expressed more widely, but not to the point of over-ventralization (Fig. 5.7). Moreover, as the expression patterns of krox20 gene are similar between the single-tail and twin-tail morphotype embryos, the narrower expression patterns of chdS gene seems to prevent the over-reduction of neural tissues on the anterior dorsal side, including forebrain, midbrain, and hindbrain (Abe et al. 2014). Therefore, this partially overlapping expression pattern may allow goldfish with reduced chdL gene function to avoid lethal effects (Figs. 5.7 and 6.1). Based on these lines of evidence, we can draw a contrast between the chordin gene mutant zebrafish and medaka, and twin-tail goldfish (Abe et al. 2014; Fisher and Halpern 1999; Takashima et al. 2007). The absence of the chordin gene paralogs suggests that the reduced function of the single chordin gene mutation leads to malfunction of the dorsal-ventral patterning mechanisms and causes lethality in

194

6 Evodevo Questions Related to Ornamental Morphology

Fig. 6.1 Schematic view of gene expression patterns of zebrafish and goldfish. First, second, third, and fourth columns indicate wild-type zebrafish, dino zebrafish, wild-type goldfish, and twin-tail goldfish, respectively. Upper row shows gastrula and lower row shows bud stage embryos. Olive, light green, green, red, and blue colors indicate areas positive for zebrafish chd, chdSwt, chdL, ventral markers (eve1, szl, and bmp4), and krox20, respectively. Asterisks indicate areas of krox20 expression in twin-tail goldfish and dino zebrafish. The expression patterns are based on Fig. 5.7. (Reprinted with permission from Abe et al. 2016)

embryos and larvae, indicating that the chordin mutation cannot be genetically fixed in zebrafish and medaka, even under domestication. On the other hand, the presence of paralogous chdS and chdL genes and their partially overlapping gene expression patterns allow the chdS mutant goldfish to survive, permitting the genetic fixation of the ornamental goldfish population. Thus, the modified dorsal-ventral patterning in the early embryo of twin-tail morphotype goldfish suggests that highly conserved and robust developmental mechanisms, such as the dorsal-ventral patterning molecular networks, can be modified with duplicated genes; the sub-functionalized expression patterns of these genes allow for mutations that reduce the function of one paralog.

6.1.2

Absence of the “Twin-Tail Common Carp”

Similar to the goldfish, the common carp also underwent domestication for ornamental purposes (Matsui et al. 1972; Abe et al. 2014) (Fig. 6.2; also see Chap. 1). Since this teleost species shares a common ancestor with goldfish that experienced lineage-specific allotetraploidization, the chdS and chdL paralog genes are present in the common carp genome as well (Xu et al. 2014; Abe et al. 2016). Due to the genetic similarity of these two closely related teleost species, it is assumed that a bifurcated caudal fin phenotype could be genetically fixed in the ornamental common carp; however, no such common carp strain is known.

6.1 Bifurcated Median Fin Mutations of Twin-Tail Morphotype Goldfish

195

Fig. 6.2 Phylogeny and historical differences/similarities of goldfish and common carp. (a) Phylogenetic relationship and historical/evolutionary events in the lineage of goldfish and common carp. Red, black, and white squares indicate the first records of twin-tail goldfish, the approximate origin of goldfish domestication for ornamental purposes and the first records of ornamental common carp breeding in Japan. These historical events are based on Chen (1956) and Pietsch and Hirsch (2015). Black and white circles indicate the allotetraploidization event and divergence of zebrafish and other teleost lineages. The timing of these two evolutionary events are based on Luo et al. (2020). The red line indicates the twin-tail goldfish lineages. Photographs on right: (b) twintail goldfish (Mitsuo-wakin strain), white arrows indicate the bifurcated caudal fin. (c) The singletail common goldfish. (d) Ornamental common carp. (e) Wild-type common carp. Scale bar ¼ 1 cm. (Reprinted with permission from Abe et al. 2016)

To determine why the twin-tail morphology is absent in ornamental common carp, chordin genes were depleted using modern molecular biology techniques in embryos under the assumption that an equivalent morphology could be reproduced by experimental depletion of one of two chordin gene paralogs. In this experiment, the expression of major dorsal-ventral patterning marker genes were largely

196

6 Evodevo Questions Related to Ornamental Morphology

modified in common carp embryos upon depletion of the chordin gene (Fig. 6.3). Similar to the twin-tail goldfish, the examined genes (gata2a, foxb1a, and szl) exhibited ventralized gene expression patterns at early embryonic stages. Moreover, the goldfish and common carp morphants for chd genes showed ventralized phenotypes and bifurcated fin folds (Fig. 6.4). However, these ventralized phenotypes were not reflected in the post-embryonic stage common carp, unlike chdS morphant wild-type goldfish (Fig. 6.4). This difference in post-embryonic phenotype is presumably due to the completely overlapping expression patterns of chordin gene paralogs in common carp (Abe et al. 2016) (Fig. 6.5). A careful comparison of common carp chdS morphants and twin-tail goldfish at the late embryonic stage suggests that there are significant differences in the positions of the bifurcated fin fold (Figs. 5.28, 5.29, 5.30, and 6.3). The bifurcated fin fold of the chdS morphant common carp is restricted to the level around the yolk extension at the late embryonic stage (Fig. 6.3m, n), but that of the twin-tail goldfish is wider in individuals that exhibit a twin-tail fin at the post-embryonic stages (Figs. 5.28 and 5.29). This difference suggests that the expression of a bifurcated caudal fin in the common carp at the late embryonic period is not sufficient for the formation of a bifurcated caudal fin in adults. Moreover, it can be hypothesized that the effect of inducing chdS deficiency with morpholino injection at the early embryonic stage might be compensated for and buffered during the developmental process of common carp by the overlapping expression of chdL (Fig. 6.5). Although there still remains a possibility that some other factors suppress the expression of the twin-tail morphology, it is reasonable to assume that the presence/ absence of chordin gene paralogs and their expression patterns are the major determinants of whether the twin-tail morphology can be genetically fixed. In other words, it can be assumed that goldfish experienced a series of evolutionary events (i.e., duplication of the chordin gene, sub-functionalization of chordin gene expression patterns, and selection of morphological features) in an order which allowed for this drastic morphological change. On the other hand, common carp underwent chordin gene duplication but not sub-functionalization of paralogs, a situation which did not allow the emergence of twin-tail morphology (Fig. 6.6).

6.1.3

Implications for Required Conditions for Large-Scale Morphological Evolution

The contrast between twin-tail goldfish and other teleost species leads us to conclude that certain conditions are required for drastic changes of morphological features. As mentioned, it seems that sole duplication of chordin genes was not sufficient to allow the genetic fixation of a highly modified dorsal-ventral patterning process (Fig. 6.6) (Abe et al. 2014, 2016). Even though the dorsal-ventral patterning in embryonic development may be highly modified, embryos exhibiting a lethal phenotype cannot contribute to the genetic fixation of the modification and its underlying genes. For

6.1 Bifurcated Median Fin Mutations of Twin-Tail Morphotype Goldfish

197

Fig. 6.3 Depletion of the chordin gene in goldfish and common carp. (a–h) Late-stage goldfish embryos (a, b: control; c–f: chdS gene morphant embryos of the wild-type goldfish, e–h, chdL gene morphant embryo of the twin-tail morphotype goldfish (chdSE127X/E127X)). (i–l) Post-embryonic morphology of control (i, j) and chdS morphants from wild-type goldfish. (m–t) Morphologies of late- and post-embryonic stage common carp individuals (m, t) Morphologies of late- and postembryonic stage common carp individuals (m, n: chdS morphant; o, p: chdS and chdL double morphants). Panels of (d, d, f, h, n, p, r and t) are magnified views of panels (a, c, e, g, m, p, r and t), respectively. Panels (j, l) are ventral views of the alizarin red-stained specimen in (i, k). Black arrows, black arrowhead, white arrowheads, asterisks, and brackets indicate bifurcated in folds, ectopically accumulated blood, enlarged blood island, expanded yolk extension, and malformation of fin folds, respectively. Scale bars ¼ 0.5 mm (a–h), 1 cm (i–l), 1 mm (m, o, q, t). (Reprinted with permission from Abe et al. 2016)

198

6 Evodevo Questions Related to Ornamental Morphology

Fig. 6.4 Modified dorsal-ventral patterning in chdS and chdL gene-depleted embryos. Expression patterns of gata2a (a–d), foxb1a (e–h), and szl (i–l) genes in control (a, e, j), chdS- (b, f, j), chdL(c, g, k), and chdS/chdL double- (d, h, l) morphant embryos. Black arrowheads indicate areas of gene expression. Panels of (a–h) show dorsal view of embryos. Panels of (i–l) are lateral view of embryos. All panels are shown at the same magnification. Scale bar ¼ 0.1 mm. (Reprinted with permission from Abe et al. 2016)

this reason, the mutation in a sole chordin gene (which causes a lethal phenotype) can also not be retained in the population. In short, neither individuals with a twintail phenotype that experience lethality nor healthy individuals without twin-tail morphology can be subject to artificial selection by the breeders who seek to establish a twin-tail morphology (Fig. 6.6). The genetic fixation of the twin-tail morphology with modified dorsal-ventral patterning mechanisms required four different evolutionary events, gene duplication, sub-functionalization, loss of function in one paralog, and selection for the specific morphological feature. It should be emphasized that all four of these evolutionary events necessarily occurred in a specific order to allow for the genetic fixation of the twin-tail phenotype (Abe et al. 2014, 2016). Even if chordin gene paralogs were present and one lost its function, the phenotype might not appear without sub-functionalization, and consequently, the mutation could not be the subject of artificial selection by breeders. Moreover, if one of the sub-functionalized paralogs were mutated and a novel morphology appeared as a result, subsequent positive selection is likely to be required for genetic fixation to occur in a population over a relatively short period. More specifically, the allele responsible for the modified dorsal-ventral patterning molecular mechanisms and its resultant bifurcated caudal fin could not persist in a goldfish population without biased selective pressures, due to a relatively poor swimming performance with twin-tail morphology. It is evident that the twin-tail

6.1 Bifurcated Median Fin Mutations of Twin-Tail Morphotype Goldfish

199

Fig. 6.5 Comparison of expression patterns of chordin paralogs in common carp. Expression patterns of chdS (a–d) and chdL (e–h) in early blastopore stage embryos, using probes designed against different cDNA sequence regions: 50 UTR (a, b, e, f) and 30 UTR (c, d, g, h). Dorsal (a, c, e, g) and animal pole (b, d, f, h) views are shown. Black arrowheads indicate ranges of the gene expression areas. Scale bar ¼ 0.1 mm. All panels are shown at the same magnification. (Reprinted with permission from Abe et al. 2016)

morphology will increase the risk of predation under the natural conditions and reduce the competitiveness with single-tail morphotype goldfish under artificial aquarium conditions with restricted food resources and high population density (Katz et al. 2015; Roos 2019; Li et al. 2015, 2019). Thus, it seems reasonable to presume that twin-tail morphotype goldfish strains experienced the above four evolutionary events in the order given (Fig. 6.6). The rareness of such a mutation in nature can easily be explained by these requirements for a drastic change in morphological features and the underlying developmental process. Given that the probability each different type of independent evolutionary event would occur in a certain order is lower than if the events occurred randomly, it is natural to assume that a long period and/or a large number of trails and errors would be required before such a drastic change could realistically occur, suggesting that a similar morphology cannot easily appear during a short evolutionary period. Thus, although large-scale morphological evolutionary events may be attributed to any one of the aforementioned evolutionary steps, for the twin-tail goldfish, there does not appear to be a single key evolutionary event among them.

200

6 Evodevo Questions Related to Ornamental Morphology

Fig. 6.6 Schematic representation of the differences between goldfish, common carp, and zebrafish. The three large arrow-shaped boxes on the left represent a single generation. Drawings of early-, late-, and post-embryonic phenotypes are shown for each species. The narrow arrowshaped boxes represent multiple generations of goldfish and common carp. Black and white arrows within the arrow-shaped boxes indicate bifurcated fin folds and bifurcated caudal fins, respectively. Expression patterns of ventral markers and chdL genes are represented by red and dark green areas, respectively. The boundaries of the original expression patterns of goldfish chdS and the zebrafish chordin genes are indicated by green dashed lines. V ventral; D dorsal. (Reprinted with permission from Abe et al. 2016)

Instead, the order of evolutionary events seems to be centrally important for understanding this type of large-scale morphological change (Abe et al. 2016).

6.1.4

Independent Development of Paired Fins and Bifurcated Median Fins

To my knowledge, Watase (1887) was the first researcher to mention the relationship between bifurcated median fins (bifurcated anal and caudal fins) and paired fins in twin-tail morphotype goldfish. He postulated a homologous relationship exists between the bifurcated median fins and paired fins (Watase 1887), presumably due to the influence of fin fold theory on his thinking. During the late nineteenth century, two main hypotheses regarding fins were under active evaluation: the gill arch theory and the lateral fin fold theory (Thacher 1874, 1877; Balfour 1878, 1881; Gegenbaur 1878; Mivart 1879). The former hypothesis suggests that paired fins evolved from modified gill arches, based on the comparative anatomy of gills in the adult elasmobranch and of the pectoral fin in Australian lungfish (Gegenbaur 1878) (see also Abe and Ota 2016). On the other hand, the lateral fin fold theory claims that the ancestor of jawed vertebrates had a bilateral longitudinal fin fold that extended as a

6.1 Bifurcated Median Fin Mutations of Twin-Tail Morphotype Goldfish

201

continuation of its median fin (Thacher 1877; Balfour 1878). Thus, Watase might interpret the bilaterally located pre-anal fin fold of the twin-tail goldfish as a hypothetical ancestral form of jawed vertebrates (see also Abe and Ota 2016). Watase’s postulate was examined by Bateson (1894) and other researchers (Cori 1896; Braus 1906; Storch 1911; see also Chap. 1). According to C. J. Cori (1896), the twin-tail caudal fin morphology was found in at least one breeding population of trout; he occasionally found twin-tail trout in his own fish farm. Given that a genome duplication occurred in the trout lineage (Berthelot et al. 2014), it is possible that a trajectory of evolutionary events similar to that which occurred in the twin-tail goldfish also occurred in the trout of Cori’s fish farm (Abe et al. 2014; Kon et al. 2020). Based on his own experience, he concluded that the twin-tail condition in the goldish constitutes a simple malformation. Braus (1906) also claimed that Watase’s hypothesis was not supported by phylogenetic data. Furthermore, Storch (1911) conducted an examination of muscular and non-muscular connective tissues at the anal fin level and rejected Watase’s hypotheses, claiming that the bifurcated anal fin of the twin-tail goldfish simply represents a duplication of anal fin structure of the single tail common goldfish and that the bifurcated anal fin is morphologically unrelated with paired fins. Since there was no consensus about the criteria for homology among these early researchers, their work is hard to compare and cannot provide a clear cut answer to the question of whether bifurcated median fins are homologs of paired fins. However, it is certain that histological analysis of the twin-tail goldfish does not support Watase’s hypothesis (Fig. 5.23a, b). In fact, the locations of the pre-anal fin and pelvic fin bud are not closely related in the twin-tail goldfish larvae, and therefore, the ventrolateral locations of the AER for paired fins and bifurcated anal fins are not tightly linked in terms of developmental positioning mechanisms (Fig. 5.23a, b). This conclusion led us to pose a further question of why twin-tail goldfish exhibit bilaterally symmetric bifurcated anal and caudal fins, with an appearance and shape that are similar to paired fins, rather than highly polyfurcated anal and caudal fins. For example, while Korschelt (1907) described polyfurcated caudal regions of lamprey, this type of caudal fin phenotype has not been found in goldfish. The absence of the polyfurcated morphology and apparently similar morphologies of bifurcated median and paired fins led us to suspect there may be a common molecular developmental mechanism between the two fin types. To explain how such similar morphological features could be found in distantly related body parts and/or animals, one may hypothesize a cooption of cis-regulatory elements and/or gene expression circuits. In fact, this concept has been applied to explain the appearance of paired appendages in the jawed vertebrate lineage (Shubin et al. 1997; Freitas et al. 2006), and it was also used to justify the presence of a bifurcated anal fin in fossils of jawless vertebrates, Euphanerops (Sansom et al. 2013). However, the idea of cooption does not seem to be required to explain the relationship between paired fin and bifurcated median fin morphologies, since depletion of the chd gene ortholog alone can recapitulate the generation of bifurcated median fins in goldfish and some other model teleost species (Fisher and Halpern 1999; Takashima et al. 2007; Abe et al. 2014, 2016).

202

6 Evodevo Questions Related to Ornamental Morphology

Similar to the idea of cooption, “deep-homology” is often used as an explanation of how similar characteristics could have appeared in distantly related taxa and/or in different body parts. Deep-homology refers to a shared gene-regulatory apparatus that produces similar characteristics and provides a retrospective explanation for similar morphological effects (Shubin et al. 1997, 2009). In fact, Watase’s hypothesis seems to be justified by the concept of deep-homology. However, this concept may not be helpful to solve the above-mentioned problems in evodevo. Instead, it would probably just cause confusion with regard to how the ambiguous boundary between homology and deep-homology should be defined (Suzuki and Tanaka 2017). In other words, although bifurcated median fins and paired fins can be considered to be deeply homologous features, this assignment reduces the resolution of the evolutionary relationship between the analyzed traits. For example, it can be presumed that pectoral, pelvic, bifurcated anal, and bifurcated caudal fins all share the same molecular mechanisms of development to a certain degree; thus, it can be concluded that these fins are “deeply homologous characteristics,” but it is hard to imagine how this categorization could contribute to designing further experiments to reveal the evolutionary relationship between the structures. Thus, rather than an arbitrary designation of deep-homology, the identification of specifically affected modules in the developmental hierarchy would be more suitable to answer the question of why bifurcated median fins and paired fins exhibit apparent morphological similarities (Suzuki and Tanaka 2017; Abe and Ota 2016).

6.1.5

Divergence of the chdL Paralog

While it is evident that the chdS gene was influenced by artificial selection, it is uncertain how chdL evolved during the domestication process. The chdSE127X allele was almost certainly drastically increased in the ornamental goldfish population during domestication of the twin-tail morphotype. However, the chdL gene might not have been subject to such drastic evolutionary events, since the compensatory function of chdL is required for survival of the twin-tail morphotype goldfish (Sect. 6.1.3). Although the detailed functions of chdL are still unknown, an intensive molecular sequence analysis of the chdL gene implied that this chordin paralog is relatively conserved in terms of its evolution and functions (Abe et al. 2018). Molecular cloning of several different ornamental goldfish strains yielded two alleles at the chdS locus, designated as chdL1 and chdL2. These alleles differ in their encoding of amino acid sequences in the CR domains (at least four amino acid substitutions are predicted in the second CR domain). Moreover, the chdL2 is a rare allele in the goldfish population, with a frequency of 0.214 in the Oranda strain and 0.044 across all investigated strains. The microinjection of mRNAs derived from these two alleles into the twin-tail goldfish produced rescue phenotypes. Moreover, the influence of these two alleles on phenotypes of the twin-tail morphology was determined in progenies of the Oranda strain. However, clear differences were not found in the phenotypes of

6.1 Bifurcated Median Fin Mutations of Twin-Tail Morphotype Goldfish

203

mRNA-microinjected animals. Exceptionally, carriers of these two alleles exhibit differences in their viability at the juvenile stage; the viability of chdL1/1 is higher than chdL2/2 F2 segregants (Fig. 6.7). Although it is expected that such a rare allele might be easily eliminated from the goldfish population under a random mating model, based on the lower viability of the chdL2/2 carriers (Hartl and Clark 1997; Hedrick 2011), the allele persists in the goldfish population. It is uncertain how this rare and disadvantageous allele has successfully persisted in the goldfish population, but two hypotheses can be made as follows: (a) the chdL2 allele is stochastically retained in the goldfish population, or (b) this allele exhibits some phenotype that is beneficial to goldfish breeders. Although the latter hypothesis cannot be completely rejected due to a paucity of information, the former seems to be more plausible, given that no significant differences were found in the caudal fin morphology and the goldfish population is subdivided into small populations. At least, it is certain that even though the chdL2 allele differs from chdL1 in the encoded amino acid sequence, the allelic differences might not substantially contribute to modifications of the morphological features of the caudal fin, as would be expected from the significant role of the chordin gene.

6.1.6

Bifurcated Caudal Fin Resulting from Other Mutations

Although the chdSE127X allele is the sole allele responsible for the twin-tail morphology of the ornamental goldfish, depletion of the szl gene can also cause similar morphological features (Abe et al. 2018a). The szl gene mutant zebrafish (ogon/ sizzled) also exhibits the twin-tail morphology, and this gene is involved in the chordin gene-related dorsal-ventral patterning network (Hammerschmidt et al. 1996; van Eeden et al. 1996). Since it is reported that the Szl protein inhibits Bmp1a or Tll1 protein-mediated cleavage of Chordin protein in the zebrafish, reduced szl gene expression is likely to cause a reduction in active Chordin protein level that consequently leads to the development of a ventralized embryo and twin-tail goldfish. Intriguingly, the sizzled/ogon mutant zebrafish exhibits better survival than dino/ chordin mutants, raising an unexpected question (Abe et al. 2018). Since the ogon/sizzled mutant exhibits a higher survival rate than the dino/ chordin zebrafish mutant (Fisher and Halpern 1999; van Eeden et al. 1996), we wondered why no szl-type twin-tail goldfish has been found in any natural or domesticated population. In other words, the absence of the szl-type twin-tail goldfish led us to ask: is there any biological basis that could explain the lack of a szl-type twin-tail ornamental goldfish population? This question was addressed by producing szl gene morphant twin-tail goldfish and comparing them with chdSE127X/E127X mutants and chdS morphants in terms of morphology and viability (Abe et al. 2018) (Fig. 6.8). Because the twin-tail morphology could be produced by depletion of one of two duplicated szl gene paralogs, the paralogs (szlA and szlB) cannot completely compensate for each other, unlike chdL and chdS in the common carp (Fig. 6.5) (Abe et al. 2016). These results suggest

204

6 Evodevo Questions Related to Ornamental Morphology

Fig. 6.7 Viability and theoretical chdL2 allele frequency. (a) Genotype frequency and viability of segregants derived from chdL1/2 Oranda goldfish parents. Theoretical allele frequencies based on Mendelian predictions (chdL1/1: chdL1/2: chdL2/2) are indicated by light gray bars. Solid and open

6.1 Bifurcated Median Fin Mutations of Twin-Tail Morphotype Goldfish

205

Fig. 6.8 SzlA morphant goldfish with twin-tail phenotype. Pr stage goldfish larvae (a–h) and alizarin red-stained juveniles (i–l). Panels of first two and third columns are lateral oblique views and ventral views. Italicized descriptions, cont, szlA-MO, szlB-MO, chdS-MO, and chdS-MU indicate control, szlA morphant, szlB morpahnt, chdSE127X/E127X mutant, and chdS morphant individuals, respectively. Black and white arrows indicate bifurcated caudal fin. Scale bars ¼ 1 mm. (Reprinted with permission from Abe et al. 2018)

that the twin-tail goldfish with the szl gene mutation could be genetically fixed in the ornamental goldfish population, if such a mutation were to occur during evolution. Thus, the lack of observed twin-tail goldfish with szl gene is probably due to chance. It is possible that the szl-type twin-tail goldish actually does exist in domesticated and/or natural populations, but it was somehow absent from investigated populations. Otherwise, a more probable explanation would be that no phenotypeinducing mutations occurred in the szl genes of the goldfish lineage (Abe et al. 2018).  ⁄ Fig. 6.7 (continued) circles indicate the observed frequencies and the viabilities calculated from the observed genotype frequency, respectively. (b) The theoretical expectation of allele frequency across generations is based on the relative fitness. The frequencies calculated by the generationby-generation algorithm are represented by open circles with fine solid lines; Hartl and Clark (1997). The dotted line and the dashed line in panel (b) indicate the observed allele frequency in the Oranda goldfish strain and the average allele frequency among all investigated goldfish populations. (Reprinted with permission from Abe et al. 2018)

206

6 Evodevo Questions Related to Ornamental Morphology

In addition to potential stochastic processes, one may consider the hypothetical case where a nonsense mutation occurs in the szlA gene during ornamental goldfish domestication. Since the twin-tail morphology of szlA morphant and chdS-depleted goldfish are equivalent (Fig. 6.8), the szl-type twin-tail goldfish would likely be positively selected by breeders. However, it is still uncertain whether the szl-type twin-tail goldfish would be equivalent to the chdS-type twin-tail goldfish in terms of viability. Although there are still ambiguities, the szlA morphants seem to exhibit more severe phenotypes than chdS morphant, and consequently, the viability of szlAmutant twin-tail goldfish might be lower than that of chdSE127X twin-tail goldfish (Abe et al. 2018). From the comparison of twin-tail goldfish with chd and szl genes, we can conclude that even though multiple gene mutations may generate the same type of large-scale molecular developmental and morphological changes, only a limited subset of mutations can be genetically fixed in a population by selective pressures from breeders.

6.1.7

Other Dorsal-Ventral Patterning-Related Genes

Besides the above-mentioned genes (chordin and szl), other genes also should be taken into consideration when discussing genetic fixation and penetrance/expressivity of twin-tail morphology. At least 17 genes were reported to be involved in the chordin gene network in zebrafish (Langdon and Mullins 2011), suggesting that the goldfish network might have double that number of genes (Fig. 6.9). Absence of twin-tail zebrafish among mutants of these genes (except chordin and sizzled) led us to assume that the depletion of these genes in the goldfish might not produce the

Fig. 6.9 Dorsal-ventral patterning-related genes in zebrafish and goldfish. Molecular regulatory networks of chordin-related genes of zebrafish (a: Langdon and Mullins 2011) and goldfish (b: hypothetical). Hypothetical paralogs are indicated by single (0 ) and double (00 ) primes. (Reprinted with permission from Ota and Abe 2016)

6.1 Bifurcated Median Fin Mutations of Twin-Tail Morphotype Goldfish

207

twin-tail phenotype. However, it seems certain that these genes should influence the penetrance/expressivity of the twin-tail morphology, because the depletion of some (for example, bmp1a and tll1) are known to influence dorsal-ventral patterning in zebrafish embryos (Muraoka et al. 2006). Therefore, we posed the question: how do these dorsal-ventral patterning-related genes influence the evolution and development of twin-tail morphotype goldfish? As mentioned in Chap. 2, the ornamental goldfish strains have undergone repetitive artificial selection and may have accumulated mutations during the domestication process (Fig. 2.6). Given that so many genes are related to the expression patterns of the chordin gene, it is highly possible that the mutated alleles in these chordin-related genes (including bmp, tll1, and other genes) were genetically fixed in the ornamental goldfish populations. Although it has not been investigated whether those genes are truly related to the penetrance/expressivity of the twin-tail phenotype, the polymorphic feature of the caudal fin in the progenies of the twin-tail morphotype goldfish can be explained by the influence of genetic polymorphisms in chordin-network-related genes (Fig. 6.9). More specifically, the genes shown in Fig. 6.9 can possibly be responsible for the single caudal and anal fin morphologies of the twin-tail morphotype progenies with chdSE127X/E127X genotype (Fig. 5.6 and Table 5.3 in Chap. 5). Intensive and extensive analyses of molecular sequences in goldfish have not revealed any mutations that drastically reduce the original function of the protein (frame shift or stop codon mutations) for any gene in the chordin network, except the chdSE127X allele (Abe et al. 2014; Kon et al. 2020). One possible explanation for the absence of such mutations could be the tendency for pleiotropic genes to be evolutionary conserved. Owing to the fact that reduction or loss of function in pleiotropic genes will often cause malformations of multiple organs and lower fitness, those individuals carrying such mutations cannot be retained in the population. Another possible explanation for the lack of detected mutations is related to technical problems. It is possible that the inability to detect frameshift or stop codon mutations could be derived from insufficient coverage and resolution of genome sequence analyses, which are attributed to difficulties in analyzing a duplicated goldfish genome (Chen et al. 2019; Kon et al. 2020). In fact, the similarity of the paralogous genes impedes proper analyses of the genome sequence. Moreover, in light of the allotetraploid genome and compensatory function of paralogs, it is highly expected that unidentified mutations have occurred and been retained in the genes of chordin-related homologs (Fig. 6.9) and will be found in further analyses. Even though no mutations were found in the coding regions, there is also a possibility that mutations exist in cis-regulatory elements, which change the expression level of the genes. One significant difference between zebrafish mutants and ornamental goldfish strains should also be recalled (Fig. 2.7). Most zebrafish mutants used for the identification of responsible genes and their functions (Fig. 6.9) were reproduced by random mutagenesis and isolated by researchers using sophisticated microscopic inspection techniques over relatively short periods (Hammerschmidt et al. 1996; Yabe et al. 2003). During the isolation and maintenance of these strains, the mutated

208

6 Evodevo Questions Related to Ornamental Morphology

alleles, rather than a certain specific morphology, have been the focus of selection. On the other hand, the ornamental goldfish were maintained over a relatively long time period of artificial selection in comparison with random mutagenesis-derived zebrafish mutant strains (Chap. 2), suggesting that multiple mutations, which provide subtle changes to the protein functions and/or the expression levels of these genes, may have accumulated as SNP sites (Ota and Abe 2016). Simultaneously, the possibility should be considered that such subtle changes of protein functions cannot influence the dorsal-ventral patterning mechanisms due to the robust feedback systems in the chordin network (Fig. 6.9) (Yabe et al. 2003; Muraoka et al. 2006; Inomata et al. 2008). Taking the robustness of the developmental mechanisms as well as the limited resolution of visual inspection by breeders and fanciers into consideration, one may conclude that accumulated mutations and the SNP sites observed in current ornamental goldfish can be categorized as mutations, which (a) express detectable phenotypes for breeders and fanciers, (b) change only the protein function and/or expression levels but do not influence the morphological phenotype, and (c) do not have any significant influences on phenotypes at any level. If breeders and fanciers selected the morphology of the bifurcated caudal fins and viability of goldfish, only the first type of mutations could have reasonably contributed to the changes in twin-tail morphology. Moreover, there is a possibility that only a certain combination of multiple genetic mutations influences the penetrance/expressivity of phenotypic mutations. Thus, a proper evaluation of the influence of the mutations should include the relationships between mutations. Although experiments to evaluate the influence of multiple mutations would be difficult to design, this approach might provide a much deeper understanding of how the accumulated SNPs in the coding and non-coding regions of genes in goldfish influenced the evolutionary and developmentally conserved dorsal-ventral patterning systems during the domestication process.

6.2

Dorsal-Finless Morphotype and Its Deviated Morphology

Representative embryonic features of the dorsal-finless morphotype goldfish were described in Chap. 5 (Sect. 5.2) (Figs. 5.35 and 5.36), focusing on the developmental process of Ranchu progenies. The data suggest that the developmental process of Ranchu progenies is quite polymorphic, especially with regard to post-cranial skeletal morphology, and this polymorphic nature impedes the development of a reliable staging table. On the other hand, the polymorphic developmental process provides an opportunity to consider its underlying mechanism, taking into account recent reports on population genetics and GWAS (Wang et al. 2013; Kon et al. 2020). According to recent studies, three major conclusions can be reached regarding this morphotype: (1) lrp6S is the most likely candidate gene for the dorsal-finless phenotype, (2) the dorsal-finless morphotype exhibits reduced heterogeneity of

6.2 Dorsal-Finless Morphotype and Its Deviated Morphology

209

genetic background, and (3) the dorsal-finless morphotype appeared after the twintail morphotype (Komiyama et al. 2009; Kon et al. 2020). Here, the relationships between these developmental and molecular evolutionary phenomena are discussed.

6.2.1

Dorsal-Finless Phenotype with Different Gene Mutations

Due to the relative difficulty of performing molecular developmental experiments in goldfish, the function of lrp6S has not been examined in this species (Kon et al. 2020). Instead, transgenic zebrafish were used to examine the accuracy of the GWAS analyses in goldfish. In fact, the causal relationship between lrp6S and the dorsal-finless phenotype in goldfish is predicted from the results that ectopic expression of Dkk1 (a Wnt inhibitor) reduced the size of the dorsal fin in the transgenic zebrafish (Kon et al. 2020). These results consistently support the notion that the wnt signaling pathway is related to dorsal fin morphology, as the relationship between Dkk1 and Lrp6 and their influence on dorsal fin morphology were demonstrated in both zebrafish and Xenopus (Hashimoto et al. 2000; Kon et al. 2020; Semënov et al. 2001; Hassler et al. 2007). These observations further imply the possibility that in addition to lrp6S, some other genes interacting in the wnt signaling pathway could be related to the dorsalfinless mutation. Moreover, it was reported that the mutation in the coding region in eomesa (eomesa fh105) in zebrafish cause the dorsal-finless mutation (Du et al. 2012). Maternal eomesa influences the initiation of epiboly, implying the influence of the eomesa mutation on early stage migration and movement of cells causes a reduction in the number of the dorsal fin primodial cells. Although Yan et al. (2020) reported that there is no nonsense mutation in coding regions of eomesa of Ranchu, it is still uncertain whether there is a mutated allele which influence the penetrance/expressivity of the dorsal-finless phenotype in the locus. Furthermore, several szl genedepleted goldfish exhibit dorsal fin reductions, as well (Abe et al. 2018) (Fig. 6.10). Given that wnt-related, eomesodermin, and szl genes are all expressed during axis formation in zebrafish (Yabe et al. 2003; Muraoka et al. 2006; Langdon and Mullins 2011; Schier and Talbot 2005), one may expect that changes during the early developmental stages are significant for the formation of the dorsal-finless phenotype. Interestingly, expression of several genes at later developmental stages also influences the formation of the dorsal fin morphology. It was reported that the deletion of cis-regulatory elements in the lmbr1 gene can produce a dorsal-finless mutant in medaka (Letelier et al. 2018). In the dorsal-finless mutant medaka, a certain specific genomic region containing the zone of polarizing activity (ZPA)regulated sequence is ablated. This enhancer sequence is located on the fifth intron of the lmbr1 gene and controls shh transcription, implying that several shh-related genes also might have potential to mediate a dorsal-finless phenotype. In addition,

210

6 Evodevo Questions Related to Ornamental Morphology

Fig. 6.10 SzlA morphant goldfish with dorsal-finless phenotype. Left panels (a, c, e, g, and i) show wild-type, weakly ventralized, bifurcated caudal fin fold, dorsal fin fold less bifurcated caudal fin, and dorsal fin fold less ventralized fin fold hatching stage embryos. Right panels (b, d, f, h, and j) show magnified views of the caudal regions of the respective left panels. Italicized descriptions, cont and szlA-MO indicate control and szlA morphants, respectively. Black arrowheads, black brackets, and white bracket indicate bifurcated fin fold, reduced dorsal fin fold, and malformed regions at the ventral side malformed region. Scale bars ¼ 1 mm (a), 0.1 mm (b). Left panels and right panels are shown at the same magnifications. (Reprinted with permission from Abe et al. 2018)

careful research on median fin development in zebrafish indicated that the formation of the neural tube is related to the presence/absence of a fin fold during the segmentation stage; zebrafish treated with SU5402 (inhibitor of signaling through FGF receptors) reduced the median fin fold (Abe et al. 2007). The multiple candidate genes that could cause a dorsal-finless phenotype also provide clues to understand why the dorsal-finless morphotype goldfish tend to be

6.2 Dorsal-Finless Morphotype and Its Deviated Morphology

211

highly polymorphic in dorsal fin morphology (Matsui 1934) (Fig. 5.37). Some larvae from Ranchu parents exhibit highly bended notochord and significant malformation of the calcified vertebral elements, while others do not. Moreover, these polymorphic features of axial skeletal mutations at the larval stages seem to be derived from embryonic stages. Actually, the pharyngula stage embryos exhibit variations in the shape of the notochords; some pharyngula embryos exhibit bended notochord, and others do not (Fig. 5.35). Such extreme variations of the shape of the caudal notochord are uncommon in the embryos of twin-tail morphotype goldfish in our study. In fact, these highly polymorphic morphologies of the dorsal fin seem to be consistent with the number of potential candidate genes. Based on these lines of evidence, the potential candidate genes causing the dorsal-finless phenotype are not restricted to those expressed at early developmental stages, suggesting that more genes responsible for the dorsal-finless phenotype will likely be found in further analyses.

6.2.2

Relationship with the Twin-Tail Morphology

From a survey of the archives describing the domestication history of ornamental goldfish, phylogenetic analyses based on mitochondrial DNA sequences, and GWAS analyses (Chen 1956; Komiyama et al. 2009; Wang et al. 2013; Kon et al. 2020), it is likely that the twin-tail morphotype first appeared from a single-tail morphotype, and subsequently, the dorsal-finless morphotype strains were genetically fixed in the goldfish population. In fact, to my knowledge, the single-tail dorsal-finless strains are not commonly found among modern goldfish variations, nor were these individuals often described in the early Chinese archives. Thus, it is reasonable to assume that the mutation of chdS gene was fixed prior to the fixation of the mutation in the lrp6S locus that produced the dorsal-finless morphotype goldfish population (Fig. 6.11a). However, this retrospective explanation does not account for why the first genetic fixation happened to be the twin-tail morphotype. In other words, this explanation does not answer the question: why did the dorsal-finless morphotype appear after the twin-tail morphotype (Fig. 6.11a)? Although Matsui (1934) reported results from genetic hybrid experiments between single-tail, twin-tail, and dorsal-finless morphotype goldfish, it is hard to find the answer to this question in the data from his report. Because he did not originally design the genetic crosses to solve this specific problem, there were simply not enough genetic cross experiments in his study to make a clear conclusion. To find a causal relationship between the order of genetic fixations, several hypotheses can be evaluated. The first hypothesis is that such a mutant strain was not preferred by breeders and fanciers, and consequently, the single-tail dorsalfinless morphotype goldfish was never established as a stable ornamental strain. A second hypothesis is that both mutations of lrp6S and chdS loci are required for the establishment of a stable dorsal-finless goldfish strain, based on the idea that chdS

212

6 Evodevo Questions Related to Ornamental Morphology

Fig. 6.11 Evolutionary appearance order of the three representative morphotypes. (a) Evolutionary relationship of the three morphotypes estimated from the molecular phylogenetic tree and analysis. (b) Hypothetical appearance process of the three morphotypes. White and black circles indicate the fixation timing of the twin-tail and dorsal-finless phenotypes, respectively

influences lrp6S with regard to the penetrance/expressivity of the dorsal-finless phenotypes. In fact, this idea is supported by reports indicating the relationship between chordin gene network and wnt8 genes and involvement of Dkk in axial mesoderm formation in zebrafish (Langdon and Mullins 2011; Hashimoto et al. 2000) (Fig. 6.9). Moreover, the primordial regions of the caudal and dorsal fin folds are located at closely related sites in embryonic zebrafish (Abe et al. 2007) (Fig. 6.12); for details, see the developmental process of the dorsal and caudal fins in wild-type goldfish in Chap. 4 (Figs. 4.12, 4.15, 4.21–4.31, 4.33 –4.35). Thus, it is natural to presume that the developmental process of the caudal and dorsal fins cannot be independent of each other at the cellular and molecular levels, even though they are recognized as independent morphological features at the late developmental stages (juvenile and adult). In other words, if the originally low penetrance/expressivity of lrp6S could be modified by the mutation of chdS, both chdS and lrp6S would be simultaneously selected by breeders during the establishment of a dorsalfinless morphotype goldfish strain, suggesting that the evolutionary appearance sequence might necessarily occur as shown in Fig. 6.2a. While there is evidence to suggest the validity of the second hypothesis, the above-mentioned hypotheses are not mutually exclusive. It is highly possible that due to a combination of low attractiveness and difficulty of genetic fixation, the single-tail dorsal-finless strains were not fixed as an ornamental goldfish population. Moreover, since the preference of Chinese breeders in the early Middle Ages cannot be directly examined, it is exceedingly difficult to test the first hypothesis. However, some indirect supportive evidence may be obtained by simple genetic analyses. If F2

6.2 Dorsal-Finless Morphotype and Its Deviated Morphology

213

Fig. 6.12 Schematic representation of embryonic primordia and adult morphological variations of median fins. (a) The lateral view of somite stage embryos. (b–d) Lateral views of three single-tail morphotype goldfish. (b) The single-tail morphotype. (c) The twin-tail morphotype. (d) Dorsalfinless morphotype. The pinkish colored regions indicate the median fin primordial region (a) and median fins. Embryonic primordial region of median fins is based on Abe et al. (2007)

progenies with single-tail dorsal-finless morphology can be easily produced by genetic crosses of F0 parents of the wild-type and dorsal-finless goldfish strain parents, the second hypothesis can be rejected, and this result would lend support to the first hypothesis. On the other hand, if the genetic crosses produce skewed results, the second hypothesis would be plausible, suggesting that breeders in the early Middle Ages could not easily reproduce the single-tail dorsal-finless strain, even if they had wanted to do so.

214

6.3

6 Evodevo Questions Related to Ornamental Morphology

Absence of “Mirror Scale Goldfish”

The so-called mirror carp, or scale reduced phenotype, is genetically fixed as a stable strain in common carp lineage. The mirror carp strains are missing a large portion of each scale, and this phenotype was fixed for both ornamental purposes and as food resource. However, in the goldfish lineage, established equivalent strains have not been recorded to my knowledge, except for one example which was presented by Smartt (2001). Although the rareness of the “scale-less goldfish” was not deeply examined by Smartt (2001), the reported scale-less goldfish is a hybrid between mirror carp and goldfish, suggesting that there is no genetically fixed scale-less goldfish strain in existence. How can the absence of the stable scale-less goldfish strain be explained? It is known that the gene responsible for the mirror carp phenotype is fgfr1 (Rohner et al. 2009), so the same phenotype could potentially be genetically fixed in the goldfish lineage via an fgfr1 mutation that reduces the protein function. Moreover, there seems to be no reason to think that the scale-less goldfish would not be recognized as valuable phenotype by breeders and fanciers. Therefore, the likely answers to the question are: (a) no functional mutations in the fgfr1 genes occurred in the goldfish lineage, or (b) molecular developmental mechanisms (absence of sub-functionalized paralogs) impeded the expression of a scale-less morphology in the goldfish. Although it is still unknown how fgfr1 and related genes might differ between goldfish and common carp, the absences of a twin-tail common carp and scale-less goldfish seem to be dictated by interspecific differences in genomic backgrounds and developmental processes. In fact, the comparative analyses of chdS and chdL paralogous genes (described above) suggested that differences in gene expression patterns reflect the differences in penetrance/expressivity of the chdS gene-depleted phenotypes (Sect. 6.1.2), allowing one to hypothesize that fgfr1 paralogs may have evolved in a manner opposite to chd paralogs in these two closely related teleost species. Notably, this hypothesis does not conform to the implications of a comparative genome sequence analyses between goldfish and common carp (Kon et al. 2020), and the analysis suggests that, in general, the sub-genomes of goldfish are highly different to each other in comparison with common carp, in line with the idea that chdS and chdL are highly differentiated in their expression patterns. Thus, to test the hypothesis, it is necessary to observe the expression patterns of fgfr1 paralogs. If the fgfr1 paralogs exhibit completely overlapping expression patterns in goldfish, the scale-less goldfish strains might be hard to be generated in the goldfish lineage, even under domestication. Although the results of experiments showing the expression patterns of fgfr1 in goldfish are eagerly awaited, the absence of a mirror scale goldfish strains provides empirical evidence for two conclusions: (a) even though the goldfish and carp are closely related species, the same sets of morphological mutations cannot be recapitulated in both species, and (b) the differences in morphological mutations cannot be explained by a simple comparison of genomic backgrounds.

6.4 Different Ways to the Globular Body Shape

6.4

215

Different Ways to the Globular Body Shape

Three of the representative ornamental goldfish strains (Ranchu, Oranda, and Ryukin) examined in Chaps. 3 and 5 exhibit the globular body shape (Figs. 3.8, 3.9, 3.13 and 5.27), which results from a modified axial skeleton. In fact, according to Asano and Kubo (1972), the number of the vertebrae of Ranchu and Ryukin strains are reduced compared to the wild-type goldfish; by their count, Ranchu has 19–23 vertebrae and Ryukin has 25–29, while the single-tail goldfish has 29–31. These reductions in number of vertebral elements seem to be the consequence of selective pressures for certain axial skeletal morphologies. However, the connection between the reduction of vertebrae and globular body shape may be further elaborated. First, it should be noted that breeders and fanciers might apply strong selective pressures to the body shape in general, but not to each vertebral element. Moreover, reducing the number of the vertebral elements is not the only way to achieve a globular body shape. Instead, a reduction the size of each vertebral element could also result in a short body. In fact, reductions in both the total number of vertebrae and the size of each vertebra were observed in mouse populations subjected to artificial evolutionary pressures by Rutledge et al. (1974). These authors conducted eight generations of artificial selection in mice, creating ten lines with differing body weights and tail lengths selected. Variations were found in the length of each vertebra and the total length of vertebrate in the two independent lines under selective pressure for tail length (individuals with longer tails were selected in these lines). The tail length was increased as a result of elongation of the length of individual vertebrae in one line, but in the other line, it was increased by increase of vertebrae number (Rutledge et al. 1974). These results imply that similar evolutionary events might occur in ornamental goldfish. In fact, the fusion patterns and sizes of vertebral elements differ between Ryukin and Ranchu strains (Fig. 3.13), suggesting that these two strains derive their globular body shapes via different modifications of the axial skeletal elements. Along this line, it is worthwhile to note that there are also several different cases of elongated/shortened axial skeletal morphologies with different types of morphological and numerical changes in the vertebral elements (Narita and Kuratani 2005; Varela-Lasheras et al. 2011), suggesting that the same evolutionary events could occur in the goldfish lineage. Molecular developmental studies in zebrafish and medaka mutants provide additional clues to understand how differences can occur in the globular body shape goldfish strains. As previously mentioned, the chordin mutation disrupts axial skeletal formation in both medaka and zebrafish. Moreover, a number of genes related to the formation of metameric segmentation patterns in axial skeletons have been reported; the production of Wnt4b by floor plate cells in medaka (Inohaya et al. 2010) and segmented entpd5 expression in notochord sheath cells in zebrafish are representative examples of how different genes can modify axial skeletal morphologies in the teleost species. These reports indicate that the globular body shape can be produced by mutations in various loci/alleles and combinations thereof.

216

6.5

6 Evodevo Questions Related to Ornamental Morphology

Differences in Developmental Timings Between Mutated Phenotypes

The appearance timings of mutated morphologies are different among the mutated phenotypes. For example, mutations in median fin (including caudal and dorsal fins) can first be detected at embryonic stages, but the protruding eyes and warty growth phenotypes become visible at later stages, as mentioned in Chap. 5 and several previous reports (Watase 1887; Smartt and Bundell 1996; Tsai et al. 2013; Li et al. 2015, 2019) (Fig. 6.13a). These initial phenomena might be used by breeders to cull larvae and juveniles, and developmental biologists with a practical perspective may create staging indexes (Smartt and Bundell 1996; Tsai et al. 2013; Li et al. 2015, 2019). In fact, in this book, differences between strains have been treated as a matter of course and goldish strains were categorized into three morphotypes (the singletail, the twin-tail, and dorsal-finless morphotypes) under the presumption that formation of these median-fin-fold-mutated morphotypes required a large-scale modification of the early developmental process (see Chap. 3). However, it was

Fig. 6.13 Schematic representation of the appearance order of mutated phenotypes. (a) Real appearance order of the phenotypes. (b) Two hypothetical examples of the appearance order. The first recognizable timing of the representative mutated phenotypes is indicated by the abbreviations: bifurcated fin fold (bif), dorsal-finless mutation (dfl), warty growth (wg), protruding (p-eyes)

6.5 Differences in Developmental Timings Between Mutated Phenotypes

217

not considered why the appearance timing would be different between these mutated phenotypes. Here, we more carefully compare the appearance timings of the three mutated phenotypes from several perspectives. Since the responsible/candidate genes for the twin-tail, dorsal-finless, and protruding eyes phenotypes are already respectively identified as chdS, lrp6S, and lrp2aL (Table 3.1), the appearance timing of these mutated phenotypes can be examined at the molecular level. Among them, chdS in goldfish and its homolog in zebrafish and medaka are the most thoroughly investigated, as described in Chap. 5 (Figs. 5.6 and 5.7) (see also, Abe et al. 2014; Takashima et al. 2007; Fisher and Halpern 1999; Kishimoto et al. 1997; Miller-Bertoglio et al. 1997; Muraoka et al. 2006; Schulte-Merker et al. 1997). Together, previous studies demonstrated that the chordin homologs influence the developmental process of early embryos. Although there is not much available information about lrp6 in goldfish, the molecular developmental mechanism of these genes are well investigated in zebrafish (Hashimoto et al. 2000; Kagermeier-Schenk et al. 2011; Caneparo et al. 2007). The zebrafish studies showed the lrp6 homolog is especially important for gastrulation. Similarly, lrp2 was also investigated in zebrafish by comparing wild-type and bugeye (the lrp2 mutant) zebrafish (Kur et al. 2011). According to Kur et al. (2011), bugeye mutants exhibit a large-eye phenotype at the adult stage and differ from wild-type in the embryonic brain and eyes in terms of immunohistological staining at 48 hpf. However, no significant differences were reported between wildtype and bugeye mutants at 24 hpf, 48 hpf, and 72 hpf in terms of cranial or brain anatomy (including eye morphology). These results suggest that the mutation in lrp2 is not likely to cause the anatomically detectable phenotypes seen in the Telescope or Celestial mutant strains. From these studies, the early and late appearance timings of mutated morphological phenotypes appear to follow the timing at which the responsible genes are activated. However, this conclusion only describes the chronological characteristics of the responsible genes, and it does not explain why the mutations were genetically fixed in those particular genes, which are expressed and are visible at those particular developmental stages. To simplify the discussion, we can use the following limited set of hypothetical examples: (1) Ranchu progeny with no mutations at the pharyngeal and hatching embryonic stages that develop a dorsal-finless morphology, and (2) a Telescope strain that develops enlarged embryonic eyes (Fig. 6.13b). We are aware that no such ornamental goldfish progenies (Fig. 6.13b) have been observed in real goldfish populations or are reported in any of the major articles dealing with goldfish development (Smartt and Bundell 1996; Tsai et al. 2013; Li et al. 2015, 2019). However, to explain why these hypothetical goldfish strains have not been found, the developmental processes should be carefully considered, especially focusing on differences in cell and tissue populations of each ornamental phenotype. The caudal fin contains skeleton (for example, fin ray and hemal arches), attached muscles and nerves. Hence, the tissues forming the fin fold represent multiple tissue types, which are derived from different developmental origins; peripheral nerves are derived from neural crest cells, while skeletal muscle tissues are differentiated from somite cells. More significantly, the bifurcated fin cannot be formed without the

218

6 Evodevo Questions Related to Ornamental Morphology

formation of bifurcated fin fold as shown in the individual tracing observation of the developmental process of the twin-tail goldfish (Figs. 5.28 and 5.29), suggesting that the bifurcated fin fold should be organized before the migration of primordial cells that generate the musculoskeletal tissues. Given that the developmental fields of the median fin fold are formed at the segmentation stage (Abe et al. 2007, 2014), it is reasonable to presume that the embryonic developmental mechanisms should be modified at this stage. Otherwise, the primordial musculoskeletal and peripheral nerve cells could not form the bifurcated structure. If the developmental field were not modified, primordial cells would migrate and differentiate to form a single-tail structure, which would probably not secondarily dedifferentiate and redistribute to form bifurcated caudal fin. The same principle may be applicable to the dorsalfinless phenotype, although creation of a bifurcated structure and reduction of a structure are fundamentally different processes. In fact, the pharyngula stage embryos of the Ranchu strain do not exhibit a dorsal fin fold, suggesting that a lack of dorsal fin fold and its developmental fields at earlier stages may be required for successful formation of the phenotype (Fig. 5.35). If the dorsal fin skeleton, muscle, and nerves were to develop, an additional process should be required to remove these structure (for example, apoptosis and metamorphosis), and addition of a developmental process seems less likely than impairment of a process. In contrast to the developmental process for median fin formation, the formation of warty growth and protruding eye seems to simply result from modifications in the growth of established developmental fields (Figs. 5.38 and 5.39). Furthermore, the relative simplicity of these processes might be related to their later developmental timing. During the formation of these two mutated morphologies, changes to the shape and number of developmental fields (or primordial regions) are not required. The protruding eye development can be explained as an increase in the size of the eye. Although the morphology of the attached cranial skeleton will be modified by the enlarged eye, removing or adding primordial regions is not required for the initial formation of enlarged eyes. Similarly, the formation of the warty growth can be explained as an increase in the one-cell population. Even though Koh (1932) reported that the shape and size of the cranial bones (for example, frontal, parietal, and their attaching cranial bones) are modified in the warty growth ornamental goldfish, these changes probably do not need large-scale modifications of the early developmental process that governs primordia of organs because there is no increase/decrease in the number of any organs in the protruding eye and the warty growth phenotypes. In short, the mutated phenotypes that can be produced by simply increasing the volume and/or number of pre-existing cells or tissues might not require large-scale modifications to the embryonic developmental process. Based on the above explanations, mutated phenotypes may be categorized as follows. The twin-tail and the dorsal-finless mutations are “early embryonic stageappearing mutated phenotypes,” while the warty growth and the protruding eye mutations can be designated as “late developmental stage-appearing mutated phenotypes.” The former designation refers to phenotypes that require modifications to the developmental process of the entire embryo, and the latter comprises mutations that can be produced by changes to the developmental process in a certain restricted

References

219

region. Although only these four mutated morphological phenotypes were used to define the two groups, it is highly possible that the same principle can be applied for other morphological phenotypes, such as narial bouquets and water bubble eyes, which would be categorized as late developmental stage-appearing mutated phenotypes. The above categories simply depend on a consistent correlation between the appearance timing of a mutated phenotype during the developmental process and the number of affected tissues and cell types. However, this simple partitioning allows us to identify problems to be solved in the context of evodevo research. The questions we pose by categorizing mutated phenotypes based on the appearance timing of the developmental process may be highly specific (Fig. 6.13). Can artificial selective pressures change an early embryonic stage-appearing mutated phenotype into a late developmental stage-appearing mutated phenotype? Can we shift the appearance timing of mutated phenotypes by modifying responsible genes (and/or their related genes) in ornamental goldfish using modern techniques? By answering these questions through both retrospective and experimental approaches, we can better define the relationships between mutation, selection, and development, which are the subject of research in the field of evodevo (for example, Koyabu and Son 2014; Koyabu et al. 2014; Irie and Kuratani 2011; Galis and Metz 2001).

References Abe G, Ota KG (2016) Evolutionary developmental transition from median to paired morphology of vertebrate fins: perspectives from twin-tail goldfish. Dev Biol 427(2):251–257. https://doi. org/10.1016/j.ydbio.2016.11.022 Abe G, Ide H, Tamura K (2007) Function of FGF signaling in the developmental process of the median fin fold in zebrafish. Dev Biol 304(1):355–366. https://doi.org/10.1016/j.ydbio.2006.12. 040 Abe G, Lee S-H, Chang M, Liu S-C, Tsai H-Y, Ota KG (2014) The origin of the bifurcated axial skeletal system in the twin-tail goldfish. Nat Commun 5:3360. https://doi.org/10.1038/ ncomms4360 Abe G, Lee S-H, Li I-J, Chang C-J, Tamura K, Ota KG (2016) Open and closed evolutionary paths for drastic morphological changes, involving serial gene duplication, sub-functionalization, and selection. Sci Rep 6:26838. https://doi.org/10.1038/srep26838 Abe G, Lee S-H, Li I-J, Ota KG (2018) An alternative evolutionary pathway for the twin-tail goldfish via szl gene mutation. J Exp Zool B Mol Dev Evol 330(4):234–241. https://doi.org/10. 1002/jez.b.22811 Asano H, Kubo Y (1972) Variation of spinal curvature and vertebral number in goldfish. Jpn J Ichthyol 19:233–231 Balfour FM (1878) A monograph on the development of elasmobranch fishes. Macmillan, London Balfour FM (1881) On the dedopment of the skeleton of the paired fins of elasmobranchii, considered in relation to its bearings on the nature of the limbs of the vertebrata. Proc Zool Soc London 49(3):656–670. https://doi.org/10.1111/j.1096-3642.1881.tb01323.x Bateson W (1894) Materials for the study of variation treated with especial regard to discontinuity in the origin of species. Macmillan, London Berthelot C, Brunet F, Chalopin D, Juanchich A, Bernard M, Noël B, Bento P, Da Silva C, Labadie K, Alberti A, Aury J-M, Louis A, Dehais P, Bardou P, Montfort J, Klopp C,

220

6 Evodevo Questions Related to Ornamental Morphology

Cabau C, Gaspin C, Thorgaard GH, Boussaha M, Quillet E, Guyomard R, Galiana D, Bobe J, Volff J-N, Genêt C, Wincker P, Jaillon O, Roest Crollius H, Guiguen Y (2014) The rainbow trout genome provides novel insights into evolution after whole-genome duplication in vertebrates. Nat Commun 5:3657. https://doi.org/10.1038/ncomms4657 Braus H (1906) Die Entwicklung der Form der Extremitäten und des Extremitätenskeletts. Handbuch der vergleichenden und experimentellen Entwicklungslehre der Wirbeltiere. Gustav Fish, Jena Caneparo L, Huang Y-L, Staudt N, Tada M, Ahrendt R, Kazanskaya O, Niehrs C, Houart C (2007) Dickkopf-1 regulates gastrulation movements by coordinated modulation of Wnt/βcatenin and Wnt/PCP activities, through interaction with the Dally-like homolog Knypek. Genes Dev 21 (4):465–480. https://doi.org/10.1101/gad.406007 Chen SC (1956) A history of the domestication and the factors of the varietal formation of the common goldfish, Carassius auratus. Sci Sinica 5:287–321 Chen Z, Omori Y, Koren S, Shirokiya T, Kuroda T, Miyamoto A, Wada H, Fujiyama A, Toyoda A, Zhang S (2019) De novo assembly of the goldfish (Carassius auratus) genome and the evolution of genes after whole-genome duplication. Sci Adv 5(6):eaav0547. https://doi.org/ 10.1126/sciadv.aav0547 Cori C (1896) Ueber paarige After-und Schwanzflossen bei Fischen. SB’Lotos 16:43–46 De Robertis EM (2009) Spemann’s organizer and the self-regulation of embryonic fields. Mech Dev 126(11–12):925–941. https://doi.org/10.1016/j.mod.2009.08.004 Du S, Draper BW, Mione M, Moens CB, Bruce A (2012) Differential regulation of epiboly initiation and progression by zebrafish Eomesodermin A. Dev Biol 362(1):11–23. https://doi. org/10.1016/j.ydbio.2011.10.036 Fisher S, Halpern ME (1999) Patterning the zebrafish axial skeleton requires early chordin function. Nat Genet 23(4):442–446. https://doi.org/10.1038/70557 Freitas R, Zhang G, Cohn MJ (2006) Evidence that mechanisms of fin development evolved in the midline of early vertebrates. Nature 442(7106):1033–1037 Galis F, Metz JAJ (2001) Testing the vulnerability of the phylotypic stage: on modularity and evolutionary conservation. J Exp Zool 291(2):195–204. https://doi.org/10.1002/jez.1069 Gegenbaur C (1878) Elements of comparative anatomy. Macmillan, London Hammerschmidt M, Pelegri F, Mullins MC, Kane DA, van Eeden FJ, Granato M, Brand M, Furutani-Seiki M, Haffter P, Heisenberg CP, Jiang YJ, Kelsh RN, Odenthal J, Warga RM, Nüsslein-Volhard C (1996) Dino and Mercedes, two genes regulating dorsal development in the zebrafish embryo. Development (Cambridge, England) 123:95–102 Hartl DL, Clark AG (1997) Principles of population genetics, vol 116. Sinauer associates, Sunderland, MA Hashimoto H, Itoh M, Yamanaka Y, Yamashita S, Shimizu T, Solnica-Krezel L, Hibi M, Hirano T (2000) Zebrafish Dkk1 functions in forebrain specification and axial mesendoderm formation. Dev Biol 217(1):138–152. https://doi.org/10.1006/dbio.1999.9537 Hassler C, Cruciat C-M, Huang Y-L, Kuriyama S, Mayor R, Niehrs C (2007) Kremen is required for neural crest induction in Xenopus and promotes LRP6-mediated Wnt signaling. Development 134(23):4255–4263. https://doi.org/10.1242/dev.005942 Hedrick P (2011) Genetics of populations. Jones & Bartlett Learning, Burlington Inohaya K, Takano Y, Kudo A (2010) Production of Wnt4b by floor plate cells is essential for the segmental patterning of the vertebral column in medaka. Development 137(11):1807–1813. https://doi.org/10.1242/dev.051540 Inomata H, Haraguchi T, Sasai Y (2008) Robust stability of the embryonic axial pattern requires a secreted scaffold for chordin degradation. Cell 134(5):854–865. https://doi.org/10.1016/j.cell. 2008.07.008 Irie N, Kuratani S (2011) Comparative transcriptome analysis reveals vertebrate phylotypic period during organogenesis. Nat Commun 2:248. https://doi.org/10.1038/ncomms1248 Janvier P (1996) Early vertebrates, vol QE851 J36. Oxford University Press, Oxford

References

221

Kagermeier-Schenk B, Wehner D, Özhan-Kizil G, Yamamoto H, Li J, Kirchner K, Hoffmann C, Stern P, Kikuchi A, Schambony A (2011) Waif1/5T4 inhibits Wnt/β-catenin signaling and activates noncanonical Wnt pathways by modifying LRP6 subcellular localization. Dev Cell 21 (6):1129–1143. https://doi.org/10.1016/j.devcel.2011.10.015 Kardong KV (2012) Vertebrates: comparative anatomy, function, evolution, 6th edn. McGraw-Hill Higher Education, Boston Katz MW, Abramsky Z, Kotler BP, Rosenzweig ML, Alteshtein O (2015) All that glitters is not gold: different anti-predatory behavior of two color morphs of goldfish (Carassius auratus). Environ Biol Fish 98(1):377–383. https://doi.org/10.1007/s10641-014-0268-1 Kishimoto Y, Lee KH, Zon L, Hammerschmidt M, Schulte-Merker S (1997) The molecular nature of zebrafish swirl: BMP2 function is essential during early dorsoventral patterning. Development 124(22):4457–4466 Koh T-P (1932) Osteological variations in the axial skeleton of goldfish (Carassius auratus). Sci Rep Natl Tsing Hua Univ 2:109–121 Komiyama T, Kobayashi H, Tateno Y, Inoko H, Gojobori T, Ikeo K (2009) An evolutionary origin and selection process of goldfish. Gene 430(1–2):5–11. https://doi.org/10.1016/j.gene.2008.10. 019 Kon T, Omori Y, Fukuta K, Wada H, Watanabe M, Chen Z, Iwasaki M, Mishina T, Shin-ichiro SM, Yoshihara D (2020) The genetic basis of morphological diversity in domesticated goldfish. Curr Biol 30:2260–2274. https://doi.org/10.1016/j.cub.2020.04.034 Korschelt E (1907) Regeneration und transplantation. G. Fischer, Jena Koyabu D, Son NT (2014) Patterns of postcranial ossification and sequence heterochrony in bats: life histories and developmental trade-offs. J Exp Zool B Mol Dev Evol 322(8):607–618. https:// doi.org/10.1002/jez.b.22581 Koyabu D, Werneburg I, Morimoto N, Zollikofer CP, Forasiepi AM, Endo H, Kimura J, Ohdachi SD, Son NT, Sánchez-Villagra MR (2014) Mammalian skull heterochrony reveals modular evolution and a link between cranial development and brain size. Nat Commun 5(1):1–9. https:// doi.org/10.1038/ncomms4625 Kur E, Christa A, Veth KN, Gajera CR, Andrade-Navarro MA, Zhang J, Willer JR, Gregg RG, Abdelilah-Seyfried S, Bachmann S (2011) Loss of Lrp2 in zebrafish disrupts pronephric tubular clearance but not forebrain development. Dev Dyn 240(6):1567–1577. https://doi.org/10.1002/ dvdy.22624 Langdon YG, Mullins MC (2011) Maternal and zygotic control of zebrafish dorsoventral axial patterning. Annu Rev Genet 45(1):357–377. https://doi.org/10.1146/annurev-genet-110410132517 Letelier J, de la Calle-Mustienes E, Pieretti J, Naranjo S, Maeso I, Nakamura T, Pascual-Anaya J, Shubin NH, Schneider I, Martinez-Morales JR, Gómez-Skarmeta JL (2018) A conserved Shh cis-regulatory module highlights a common developmental origin of unpaired and paired fins. Nat Genet 50(4):504–509. https://doi.org/10.1038/s41588-018-0080-5 Li J, Yue Y, Dong X, Jia W, Li K, Liang D, Dong Z, Wang X, Nan X, Zhang Q (2015) Zebrafish foxc1a plays a crucial role in early somitogenesis by restricting the expression of aldh1a2 directly. J Biol Chem 290(16):10216–10228. https://doi.org/10.1074/jbc.M114.612572 Li I-J, Lee S-H, Abe G, Ota KG (2019) Embryonic and post-embryonic development of the ornamental twin-tail goldfish. Dev Dyn 23:1–33. https://doi.org/10.1002/dvdy.15 Liem KF, Bemis WE, Walker WF, Grande L (2001) Functional anatomy of the vertebrates: an evolutionary perspective. Harcourt College, New York Luo J, Chai J, Wen Y, Tao M, Lin G, Liu X, Ren L, Chen Z, Wu S, Li S et al (2020) From asymmetrical to balanced genomic diversification during rediploidization: subgenomic evolution in allotetraploid fish. Sci Adv 6(22):eaaz7677. https://doi.org/10.1126/sciadv.aaz7677 Matsui Y (1934) Genetical studies on gold-fish of Japan. Imp Fish Inst XXX(1):1–96 Matsui Y, Kumagai T, Betts LC (1972) Pet Library Goldfish Guide. Pet Library Limited, London Miller-Bertoglio VE, Fisher S, Sanchez A, Mullins MC, Halpern ME (1997) Differential regulation of chordin expression domains in mutant zebrafish. Dev Biol 192(2):537–550

222

6 Evodevo Questions Related to Ornamental Morphology

Mivart SG (1879) XII. Notes on the fins of elasmobranchs, with considerations on the nature and homologues of vertebrate limbs. Trans Zool Soc Lond 10(10):439–484 Muraoka O, Shimizu T, Yabe T, Nojima H, Bae Y-K, Hashimoto H, Hibi M (2006) Sizzled controls dorso-ventral polarity by repressing cleavage of the Chordin protein. Nat Cell Biol 8 (4):329–338. https://doi.org/10.1038/ncb1379 Narita Y, Kuratani S (2005) Evolution of the vertebral formulae in mammals: a perspective on developmental constraints. J Exp Zool B Mol Dev Evol 304(2):91–106. https://doi.org/10.1002/ jez.b.21029 Ota KG, Abe G (2016) Goldfish morphology as a model for evolutionary developmental biology. Wiley Interdiscip Rev Dev Biol 5(3):272–295. https://doi.org/10.1002/wdev.224 Pietsch C, Hirsch P (2015) Biology and ecology of carp. CRC Press, Boca Raton Rohner N, Bercsényi M, Orbán L, Kolanczyk ME, Linke D, Brand M, Nüsslein-Volhard C, Harris MP (2009) Duplication of fgfr1 permits Fgf signaling to serve as a target for selection during domestication. Curr Biol 19(19):1642–1647. https://doi.org/10.1016/j.cub.2009.07.065 Roos AM (2019) Goldfish. Reaktion Books, London Rutledge JJ, Eisen EJ, Legates JE (1974) Correlated response in skeletal traits and replicate variation in selected lines of mice. Theor Appl Genet 45(1):26–31. https://doi.org/10.1007/ BF00281170 Sansom RS, Gabbott SE, Purnell MA (2013) Unusual anal fin in a Devonian jawless vertebrate reveals complex origins of paired appendages. Biol Lett 9(3):20130002. https://doi.org/10. 1098/rsbl.2013.0002 Schier AF, Talbot WS (2005) Molecular genetics of axis formation in zebrafish. Annu Rev Genet 39:561–613. https://doi.org/10.1146/annurev.genet.37.110801.143752 Schulte-Merker S, Lee KJ, McMahon AP, Hammerschmidt M (1997) The zebrafish organizer requires chordino. Nature 387(6636):862–863. https://doi.org/10.1038/43092 Semënov MV, Tamai K, Brott BK, Kühl M, Sokol S, He X (2001) Head inducer Dickkopf-1 is a ligand for Wnt coreceptor LRP6. Curr Biol 11(12):951–961. https://doi.org/10.1016/S09609822(01)00290-1 Shubin N, Tabin C, Carroll S (1997) Fossils, genes and the evolution of animal limbs. Nature 388 (6643):639–648 Shubin N, Tabin C, Carroll S (2009) Deep homology and the origins of evolutionary novelty. Nature 457(7231):818–824. https://doi.org/10.1038/nature07891 Smartt J (2001) Goldfish varieties and genetics: handbook for breeders. Blackwell Science, Malden, MA Smartt J, Bundell JH (1996) Goldfish breeding and genetics. TFH Publications, Neptune, New Jersey Storch O (1911) Untersuchungen über die paarige Afterflosse der Schleierschwänze. Arbeiten aus dem Zoologischen Institut der Universität Wien und der Zoologischen Station in Triest 19:195–218 Suzuki DG, Tanaka S (2017) A phenomenological and dynamic view of homology: homologs as persistently reproducible modules. Biol Theory 12(3):169–180. https://doi.org/10.1007/s13752017-0265-7265. [pii] Takashima S, Shimada A, Kobayashi D, Yokoi H, Narita T, Jindo T, Kage T, Kitagawa T, Kimura T, Sekimizu K, Miyake A, Setiamarga DHE, Murakami R, Tsuda S, Ooki S, Kakihara K, Hojo M, Naruse K, Mitani H, Shima A, Ishikawa Y, Araki K, Saga Y, Takeda H (2007) Phenotypic analysis of a novel chordin mutant in medaka. Dev Dyn 236(8):2298–2310. https://doi.org/10.1002/dvdy.21245 Thacher JK (1874) Median and paired fins, a contribution to the history of vertebrate limbs, vol 3. Connecticut Academy of Arts and Sciences, New Haven Thacher JK (1877) Ventral fins of Ganoids. Transactions of the Connecticut Academy [E. Hayes, Printer]

References

223

Tsai H-Y, Chang M, Liu S-C, Abe G, Ota KG (2013) Embryonic development of goldfish (Carassius auratus): a model for the study of evolutionary change in developmental mechanisms by artificial selection. Dev Dyn 242(11):1262–1283. https://doi.org/10.1002/dvdy.24022 van Eeden FJ, Granato M, Schach U, Brand M, Furutani-Seiki M, Haffter P, Hammerschmidt M, Heisenberg CP, Jiang YJ, Kane DA, Kelsh RN, Mullins MC, Odenthal J, Warga RM, NussleinVolhard C (1996) Genetic analysis of fin formation in the zebrafish, Danio rerio. Development 123:255–262 Varela-Lasheras I, Bakker AJ, van der Mije SD, Metz JAJ, van Alphen J, Galis F (2011) Breaking evolutionary and pleiotropic constraints in mammals: on sloths, manatees and homeotic mutations. EvoDevo 2(1):1–27. https://doi.org/10.1186/2041-9139-2-11 Wang SY, Luo J, Murphy RW, Wu SF, Zhu CL, Gao Y, Zhang YP (2013) Origin of Chinese goldfish and sequential loss of genetic diversity accompanies new breeds. PLoS One 8(3):1–8. https://doi.org/10.1371/journal.pone.0059571 Watase S (1887) On the caudal and anal fins of gold-fishes. J Coll Sci Imp Univ Japan 1:247–267 Xu P, Zhang X, Wang X, Li J, Liu G, Kuang Y, Xu J, Zheng X, Ren L, Wang G, Zhang Y, Huo L, Zhao Z, Cao D, Lu C, Li C, Zhou Y, Liu Z, Fan Z, Shan G, Li X, Wu S, Song L, Hou G, Jiang Y, Jeney Z, Yu D, Wang L, Shao C, Song L, Sun J, Ji P, Wang J, Li Q, Xu L, Sun F, Feng J, Wang C, Wang S, Wang B, Li Y, Zhu Y, Xue W, Zhao L, Wang J, Gu Y, Lv W, Wu K, Xiao J, Wu J, Zhang Z, Yu J, Sun X (2014) Genome sequence and genetic diversity of the common carp, Cyprinus carpio. Nat Genet 46(11):1212–1219. https://doi.org/10.1038/ng.3098 Yabe T, Shimizu T, Muraoka O, Bae Y-K, Hirata T, Nojima H, Kawakami A, Hirano T, Hibi M (2003) Ogon/secreted frizzled functions as a negative feedback regulator of Bmp signaling. Development 130(12):2705–2716. https://doi.org/10.1242/dev.00506 Yan N, Huo J, Chung-Davidson Y-W, Cui W, Huang W, He W, Zhang Q, Li W, Zhou Y, Ren J (2020) Differences in postembryonic dorsal fin development resulted in phenotypic divergence in two goldfish strains, Red Cap Oranda and Ranchu. Aquacult Fish. https://doi.org/10.1016/j. aaf.2020.07.009 (in press)

Chapter 7

Problems, Challenges, and Perspectives

Abstract Careful examinations of the development and evolution of ornamental goldfish suggest that the goldfish domestication process is a unique and powerful platform for addressing questions and problems regarding the relationship between genotype and phenotype. In order to generalize the findings from this model system, pertinent questions and problems are further examined in this chapter, taking into account several topical hypotheses and concepts in the fields of evodevo. First, the limitations of positing a one-to-one relationship between genes and phenotypes are demonstrated in several schematic drawings, which represent developmental processes that mediate the translation of genotypes to phenotypes (Garstang, Zool J Linnean Soc 35(232):81–101, 1922) and the modular relationships between them (Wagner and Altenberg 1996). Based on these schemes, this chapter also explores how perturbations, genetic background, and developmental processes interrelate during the establishment of ornamental goldfish strains. To further explore how domestication of ornamental goldfish may continue in the near future and the biological meanings of these trends, I also discuss how artificial selection and genome editing for ornamental purposes might influence the modular relationship between genotypes and phenotypes.

In Chap. 6, several problems related to the morphological features of ornamental goldfish were discussed. I covered several problems related to development and genetics of the ornamental morphology, such as problems of co-option and deep homology, the contribution of genome duplication, and selective pressures. In this chapter, rather than simply focusing on goldfish evolution and development, these phenomena are examined in the context of the relationship between genotype and phenotype, with the intention of clarifying how goldfish may be used for further understanding of the evolution and development of vertebrate species.

© The Author(s), under exclusive license to Springer Nature Singapore Pte Ltd. 2021 K. G. Ota, Goldfish Development and Evolution, https://doi.org/10.1007/978-981-16-0850-6_7

225

226

7.1

7

Problems, Challenges, and Perspectives

Fixable Mutations Through Developmental Process

As introduced in Chap. 2 and 5 (Figs. 2.5 and 5.6), goldfish experienced allotetraploidization (Abe et al. 2014; Chen et al. 2019; Kon et al. 2020; Xu et al. 2014, 2019). It is certain that this lineage-specific genomic event represented a duplication in the number of chromosomes and genes in the common ancestor of carp (Chen et al. 2019; Kon et al. 2020; Xu et al. 2014, 2019). Such a genome duplication might contribute to an increase in genetic mutations, which may then change the functions of certain complementary paralogs genes (Sémon and Wolfe 2007; Ohno 1970). In other words, even though a gene has a reduced original function, the paralog of the gene may compensate for the reduction of the original gene, as suggested by studies on the common carp (Sect. 6.1.2). Since the allotetraploidized genome consists of two different sub-genomes, its paralogous genes may become slightly more diverged than the genes in autotetraploidized genomes (Fig. 2.5). As such, genomes that underwent autotetraploidization and allotetraploidization might differ in terms of how diverged paralogous genes are from each other. In fact, examinations of locations and number of genetic mutations (including single-nucleotide polymorphisms and insertions/ deletions from transposable elements) in goldfish and common carp revealed that the different tendencies in the two chromosome groups were derived from the different ancestral species (Kon et al. 2020; Xu et al. 2019; see also Fig. 2.5), providing an explanation for the appearance of goldfish-lineage-specific mutated morphologies. According to Kon et al. (2020), the number of singleton genes in homologous group of chromosomes in goldfish is higher than that in common carp; chromosomes belonging to the L. subgenome of goldfish and the B subgenome of common carp are considered to be homologous. Moreover, a relatively ambiguous relationship between Carassius auratus and the other Carassius species suggests that some genetic variations can be maintained in domesticated populations by making inter-species hybridizations, similar to what has been shown in several domesticated plant species (see Meyer and Purugganan 2013). In fact, as we reviewed in Chap. 2, breeders and fanciers have genetically crossed domesticated goldfish with wild-type Carassius species to successfully produce new goldfish strains. These observations lead us to conclude that the goldfish population has sufficiently highly diverged genetic polymorphisms to allow for generation of many different ornamental morphologies (Figs. 3.8 and 3.9). It has been debated whether genome duplications can truly allow for significant phenotypic mutations (Otto 2007; Otto and Whitton 2000; Lynch and Conery 2000; Crow and Wagner 2006). Given that a paralogous gene usually compensates for the functions of its cognate gene, it is expected that the appearance of novel phenotypes by a mutation in one paralog would be suppressed, as shown in Chap. 6 (Sect. 6.1.2) (Abe and Ota 2016). Moreover, the explanation based on the goldfish-specific genomic background seems not to fit with several goldfish varieties. Surprisingly, the heterogeneity of genomic background was highly reduced in a few ornamental goldfish lineages, and the background became more heterogeneous in new strains

7.1 Fixable Mutations Through Developmental Process

227

Fig. 7.1 Diagram of the relationship between ontogeny and phylogeny by Garstang (1922). A0–9: Adult. The phyletic succession is indicated by the long dashed line connecting A0 to A9. Z0–9: Zygotes. Bold lines indicate the developmental process from zygote to adult. During the developmental process, adult specimens of metazoan species produce the next generation as fertilized eggs (zygote), unlike protozoan species that increase their number with a single cell division

derived from those lineages (Kon et al. 2020). Furthermore, under the assumption that genetic variations are directly reflected in phenotypic variations, one may conclude that more extreme morphological variations, as reported in Korschelt (1907) and Bateson (1894), could be readily genetically fixed in any kind of population. However, examples of genetic fixation for such extreme morphological variations are quite uncommon. For example, recent reports of two-headed (bicephalic) lampreys are considered to be quite rare in nature, and the phenotype has never been fixed in a lamprey population (Suzuki 2016). Thus, even though we know the genomic background of goldfish strains, this knowledge is insufficient to predict what mutations may or may not become genetically fixed in the population, due to the numerous intermediary steps between a genetic mutation and the expressed phenotype (see below). To conceptualize the intermediary steps and distance between genetic mutations and the expressed phenotypes, an illustration by Garstang (1922) explaining the differences between protozoans and metazoans is quite useful (Fig. 7.1). Because of historical context, Garstang’s intended message from the illustration is not exactly the same as mine; see Esposito (2020) for historical background on Garstang. However, this depiction of the relationship between zygote and adult allows us to

228

7

Problems, Challenges, and Perspectives

gain an intuitive understanding of how genetic events may be projected into adult morphology, using the examples of metazoan and protozoan development. From the figure (Fig. 7.1), we can see that a metazoan needs multiple rounds of cell divisions to develop and replicate, unlike protozoan species which reproduce with a single cell division; therefore, the distance between genotype and phenotype is different between protozoan and metazoan organisms (for example, Wagner 2018; Raff 1996). Given that the goldfish body consists of many highly specified and diverged cells (as shown in Chap. 4), one might conclude that the relationship between a specific genotype and phenotype is essential information to predict whether that genotype and phenotype can be fixed in the goldfish population.

7.2

Genotype and Phenotype

The relationship between genotype and phenotype is not a simple one-to-one relationship, as indicated by several prominent evodevo researchers (Alberch 1991; Pigliucci 2010; Houle et al. 2010; Gjuvsland et al. 2013; Salazar-Ciudad and Marín-Riera 2013; Orgogozo et al. 2015; Wagner and Zhang 2011; Klingenberg 2008). In fact, the complexity of genotype–phenotype relationships can be revealed in the examples of compensatory function of paralogous genes (as mentioned above) and the robustness of chordin gene-related networks in dorsal-ventral patterning. Moreover, a number of genes are expressed at all developmental stages and in different types of cells and tissues, so it should be obvious that the phenotypes and traits are not in a one-to-one relationship with genes. For example, bmp genes are involved not only in dorsal-ventral patterning but also in the development of some other tissues appearing at late developmental stages (skeletogenesis and sensory neurogenesis) in zebrafish (for example, Smith et al. 2006; Holzschuh et al. 2005). It is also highly expected that environmental differences might influence the penetrance/expressivity of phenotypes. Given that temperature and oxygen concentration are known to influence the penetrance/expressivity of many phenotypes, it may be concluded that individuals with different phenotypes may have appeared from fertilized eggs with identical phenotypes under other environmental conditions. For example, color variations serve as a typical example of phenotypes that are defined by both genetic factors and environmental factors (Gouveia et al. 2003; Eslamloo et al. 2015). Although comparative transcriptome analyses between individuals with different color variations indicate several potential genes underlie the phenotype (Zhang et al. 2017a), the expression patterns of these genes are changed by environmental conditions. Since expression of several genes related to dorsalventral patterning and somite segmentation processes is also influenced by temperature (Marvin et al. 2008; Crawford et al. 2011; Dick et al. 2000; Pei et al. 2007; see also below), it is certain that temperature plays an important role in morphogenesis. Moreover, the density of embryos also influences the developmental process (Tsai et al. 2013), especially hatching timing. This influence is presumably due to oxygen

7.2 Genotype and Phenotype

229

Fig. 7.2 Schematic representation of the relationship between genotype and phenotype. (a) A genotype–phenotype map based on Orgogozo et al. (2015). (b) The relationship between traits and genes, as depicted by Wagner and Altenberg (1996). (c) The relationship between functions, characters, and genes by Wagner and Altenberg (1996). F1 and F2 indicate functions. The gray ellipses indicated as C1 and C2 represent modular character complexes. The modular character complex of C1 and C2 consists of characters of [A, B, D, C] and [E, F, G], respectively. G1–G6 indicate genes. These genes connect to multiple characters, as indicated by arrows. (d) The relationship between genes (magenta boxes), developmental process, phenotypic traits (circles), and environmental factors (orange box) by Klingenberg (2008). Blue, orange, and magenta arrows indicate developmental pathways, genetic effects, and environmental effects, respectively

availability, suggesting that both biotic and abiotic factors influence how fertilized eggs grow to exhibit embryonic and post-embryonic morphologies. These examples that argue against a one-to-one relationship between genes and phenotypes are included in a genotype–phenotype map (Fig. 7.2) (Orgogozo et al. 2015; Houle et al. 2010; Gjuvsland et al. 2013; Salazar-Ciudad and Marín-Riera 2013; Wagner and Zhang 2011; Wagner and Altenberg 1996; Klingenberg 2008). A number of graphical representations for genotype–phenotype maps have been proposed and may facilitate understanding of how developmental processes act as an intermediate between genes and phenotypes in ornamental goldfish stains. For

230

7

Problems, Challenges, and Perspectives

example, the graph shown in Fig. 7.2a illustrates how developmental processes narrow-down or expand the expressed phenotypic variations, before the phenotypes can be used for selection by breeders and fanciers. Moreover, according to Wagner and Altenberg (1996), the relationships between multiple genes, characters, character complexes, and functions can be depicted, as shown in Fig. 7.2b, c, based on the concept of modularity (see also Schlosser and Wagner 2004). Furthermore, the influence of environmental factors is included in the illustrations by Klingenberg (2008) (Fig. 7.2d). In the fact, rather than one-to-one, the relationships among genes and phenotypes seems to be multiple-to-multiple, which provides a realistic explanation for the phenomena seen in ornamental goldfish. For example, it is empirically known that obtaining healthy individuals from the dorsal finless morphotype goldfish strains (e.g., Ranchu and Chotengan) is difficult. One of the factors that makes these strains hard to maintain is presumably the pleiotropic effects of the responsible mutated lrp6S alleles. Although there are no reports of detailed functional analyses on the lrp6S gene in goldfish, it is known that mouse embryos with mutations in the homologous gene exhibit developmental defects in multiple organs and tissues. In fact, homozygous mutant lrp6 mouse embryos exhibit significant malformations in the trunk skeleton, limbs, and neural tube (Pinson et al. 2000), suggesting that reduction of homologous lrp6 functions also causes severe effects in goldfish. However, this mutation is required for expression of the dorsal finless morphotype in goldfish, even though it also causes a reduction of the physiological viability. More specifically, the mutated locus is required for the development of the desired ornamental morphology (the dorsal finless morphology), which is positively selected, but simultaneously, this mutated allele reduces the physiological viability and fitness of the individuals. This outcome suggests that the mutated allele is simultaneously involved in the positively selected phenotype and negatively selected phenotypes. It is certain that such a simultaneous involvement in both positively and negatively selected phenotypes will be observed not only in not only the lrp6S gene but also in some of the other genes listed in Table 3.1. Thanks to Wagner and Altenberg (1996), the relationship between genes and phenotypes in ornamental goldfish can be generalized and illustrated according to Figs. 7.2c and 7.3. Using the illustration as a guide, the mutated morphology in median fins can be illustrated as follows. Given that the function of the median fin in Carassius species is related to locomotion in water (Fig. 7.3a), we can assume that the appearance of a bifurcated caudal fin and malformation of dorsal fin morphologies would reduce the original function (Fig. 7.3b). However, simultaneously, these morphological changes could attract breeders and fanciers interested in domestication for the ornamental purposes (Fig. 7.3c). During this process of domestication, the gene that largely influences development of the desired ornamental morphologies might be genetically fixed, but it is also highly possible this gene will also influence physiological viability (Fig. 7.3c). Moreover, the characters of physiological viability and swimming performance are also interrelated. From the illustration and argument, we can conclude that even though breeders and fanciers consciously select certain recognizable units (including, traits,

7.2 Genotype and Phenotype Fig. 7.3 Hypothetical process of the transition of the relationship between genotype and phenotypes. (a) An ancestral state. Six genes connected with characters. Characters 1 (C1) and 2 (C2) mainly contribute the locomotion function and physiological viability, respectively. (b) Gene 1 (G1) lost its original function by mutation; the mutated gene is represented with a strikethrough. Since the gene is connected with characters A, B, and D (gray-colored letters), these characters also have reduced functions, and subsequently, the modular character complex (C1) also does not exhibit its original function. Since C1 is related to physiological viability, individuals with the mutation in G1 might have reduced physiological viability. (c) Appearance of novel selective pressures by domestication for ornamental purpose (reddish-colored letters). Even though the loss of function of G1 causes a reduction of locomotor function and a slight reduction of physiological viability, the individuals with a mutation in G1 might be positively selected by breeders and fanciers

231

232

7

Problems, Challenges, and Perspectives

characters, character complexes, functions, whichever they choose), these conscious selections force the breeders and fanciers to inadvertently influence other phenotypic features, which are unrelated with the ornamental morphology. In other words, even though the selective pressure on ornamental goldfish strains appears to be predictable and straightforward, based on well-documented historical records (Chap. 1), and the criteria for each ornamental goldfish strain is well described (for example, Smartt 2001), the relationship between the selected phenotypic unit and genes can be quite complicated, as shown in Fig. 7.3. Such a complicated relationship suggests that the responsible genes, which were identified in several ornamental goldfish strains, might influence the developmental processes of other phenotypes and physiological viability (Table 3.1). Thus, it is reasonable when considering why these particular identified responsible genes are fixed in the populations, one should examine not only whether the resultant ornamental phenotypes are sufficiently attractive to be the subject of artificial selection but also whether the mutations cause deleterious effects to goldfish individuals under domesticated conditions. Moreover, given that the responsible gene functions are interrelated with the other genes and phenotypic traits thought multiple generations (Fig. 7.1), researchers who are performing evodevo studies might not accept that all of the evolution of phenotypes in ornamental goldfish can be explained by the “genes as a blueprint” metaphor, which has been criticized by several researchers in evodevo and related fields (see Pigliucci 2010).

7.3

Homozygosity, Development, Environment, and Polymorphisms

Intuitively, increasing genetic polymorphisms seems as though it would increase phenotypic variations. However, domestication of animals usually involves bottlenecks that reduce the number of genetic polymorphisms in a population, but simultaneously, breeders and fanciers tend to increase the number of phenotypically diverged strains. To explain this counterintuitive evolutionary phenomenon, researchers have examined several different hypotheses (for examples see, Meyer and Purugganan 2013; Moyers et al. 2018). Moreover, the same phenomenon is observed with regard to recent domestication of ornamental goldfish. According to the Smartt’s descriptions, the number of described strains with novel mutated phenotypes and novel combinations of phenotypes has increased in the last 100 years (Fig. 7.4). Although it is difficult to compare the numbers of strains reported by different studies (owing to differences in the criteria for categorizing goldfish strains), it is certain that the variety of goldfish strains have increased from the 1900s to the 1970s, largely due to hybridization of earlier strains; presumably, this trend resulted from curiosity of breeders and fanciers (Smartt 2001). Given that the ancestral goldfish population has sufficient genetic polymorphisms to ensure an appropriate level of diversity, the increasing production of novel various goldfish

7.3 Homozygosity, Development, Environment, and Polymorphisms

233

Fig. 7.4 Increasing number of described goldfish strains. The numbers of strains are derived from the study by Smartt (2001). (Reprinted with permission from Ota and Abe 2016)

strains can be explained as the consequence of breeders surveying allelic combinations that produce attractive ornamental phenotypes from (a) pre-existing alleles in the goldfish population, (b) interspecific hybridization, and (c) newly appearing spontaneous mutations in the lineage of the ornamental goldfish population. The reduction of genetic polymorphisms across the population can then be understood as a consequence of domestication and the establishment of goldfish strains. In this section, I explore how the developmental process is influenced by the reduction of genetic polymorphisms and how it may influence the genetic fixation of different goldfish strains. The influence of the reduction of genetic polymorphisms on the developmental process was argued by Lerner (1954). Lerner (1954) proposed the idea that a correlation exists between developmental stability and heterozygosity; his idea is called the “homeostasis-heterozygosity hypothesis” in Lynch and Walsh (1998). This hypothesis seems to fit with empirical evidence that individuals carrying a large number of the heterozygous loci tend to grow up healthy and do not often exhibit malformations during development. From another perspective, his idea provides an opportunity to assume a hypothesis wherein a certain level of individuals will experience abnormal development as a result of reduction of heterozygosity, which will increase the chance that mutated phenotypes will be expressed in ornamental goldfish. In other words, if penetrance or expressivity of the mutated phenotypes are increased by the reduction of heterozygosity in whole genome regions, this reduction of heterozygosity would be helpful for breeders and fanciers to find goldfish with genetic mutations that lead to expression of mutated phenotypic

234

7

Problems, Challenges, and Perspectives

features. Otherwise, the expression of these potentially detrimental phenotypes would normally be rare, as it would be suppressed by maintenance of heterozygosity. Thinking about environmental factors can make the discussion related with the homeostasis-heterozygosity hypothesis easier to understand (Fig. 7.2d). For example, if loci that contribute to developmental robustness, such as the chordin gene (Inomata et al. 2008; Yabe et al. 2003; Muraoka et al. 2006), have reduced function, it is expected that embryos might be easily influenced by environmental perturbations, and consequently, those exposed individuals will exhibit polymorphic phenotypes at the adult stages, even though the genetic background is highly homogenous. In fact, several examples can illustrate the relationship between developmental robustness, environmental factors, genetics, and phenotypic polymorphisms in various organisms (see for example, Needham 1933; Waddington 1956, 1957; Gilbert and Epel 2009; West-Eberhard 2003; Rohner et al. 2013; Connolly and Hall 2008). In the goldfish, the influence of temperature perturbations has been reported (Urushibata et al. 2019). Goldfish embryos can develop normally under temperatures ranging from 14 to 24  C, but temperatures lower than 14  C cause goldfish embryos exhibit an abnormal topological relationship between cells at early developmental stages (4-cell to 16-cell stages); the pattern of the cell division differs between embryos incubated under conventional and low temperatures. On the other hand, at temperatures greater than 26  C, the proportion of abnormally developed embryos is increased. Although there is no report that has examined whether temperature can influence the formation of twin-tail or dorsal-finless morphologies, it has been suggested based on empirical evidence that temperature conditions could potentially influence the expressivity/penetrancy of the twin-tail goldfish morphology (Smartt 2001). There are no sufficient molecular studies in goldfish showing the mechanisms of how environmental changes influence phenotypic features, but zebrafish researchers can provide some relevant information. For example, several genes or proteins that are sensitive to temperature changes have been reported in zebrafish. Heat shock proteins are an example of temperature-sensitive genetic regulation and were examined in terms of their differential expression patterns between control and heat shock conditions (Marvin et al. 2008; Crawford et al. 2011). Moreover, several temperature-sensitive alleles exist for genes related with early embryogenesis, such as bmp7 and sqt (Dick et al. 2000; Pei et al. 2007); in particular, bmp7 is known to be involved in dorsal-ventral patterning, and it might influence twin-tail formation. If the reduction of heterozygosity in these genes and fixation of homozygous mutated alleles in these loci simultaneously occurs in a goldfish population, those goldfish would have a genetic background that would be expected to produce polymorphic phenotypes with temperature perturbations. Chinese archives suggest goldfish breeders in the late Ming dynasty intensively conducted one-to-one genetic crosses in a single vessel (see Chap. 1). Therefore, a reduction in heterozygous loci and fixation of genetic mutations relating with morphogenesis seems to have simultaneously occurred, allowing for an increase in the percentage of goldfish individuals that exhibit mutant phenotypes upon perturbation of environmental conditions. Although these assumptions require further verification, the paradigm provides a

7.4 Perturbations, Development, and Evolution

235

feasible explanation for how the reduction of genetic polymorphisms could contribute to an increase in phenotypic variation. Recently, several studies have reported the occurrence of bottlenecks and reductions of heterogeneity in genomic background during the domestication of several animals, including goldfish (Kon et al. 2020; Wang et al. 2013), pigeons (Shapiro et al. 2013), and dogs (Lindblad-Toh et al. 2005). Moreover, general discussions of the domestications and its influence to the genetic and phenotypic backgrounds have been published (for example, Meyer and Purugganan 2013; Moyers et al. 2018). Although these reports largely explain reduction of heterozygosity as a consequence of domestication, the above evidence suggests that homogenous genetic backgrounds may also be a cause of the expression of visible phenotypic features. Testing the above assumptions (regarding the relationship between a highly homogenous genetic background and the penetrance/expressivity of mutated phenotypes) using goldfish as a model system may provide an opportunity to gather further insights into how developmental robustness is related to artificial selection.

7.4

Perturbations, Development, and Evolution

It is certain that developmental timing is important when considering how perturbations influence morphogenesis, because different developmental events occur at different embryonic and larval stages, as detailed in Chaps. 4 and 5. It is reasonable to assume that environmental perturbations at embryonic developmental stages will have different effects than those at larval developmental stages. Diversification, specification, and migration of primordial cells occur in the embryonic stages and will readily affect morphological features, but these processes are much more limited at later stages (see Chaps. 4 and 5). Therefore, environmental perturbations at embryonic stages may give rise to higher penetrance/expressivity of phenotypes. In this section, we further examine the relationship between developmental timing, perturbation, and phenotypic evolution. For a deeper understanding of the relationship between perturbations and developmental processes, it is worthwhile to introduce several recent reports describing transcriptome analyses of perturbation experiments (Galis and Metz 2001; Irie and Kuratani 2011; Uchida et al. 2018; Hu et al. 2017). The motivation of these researchers was to examine whether a funnel-like model, introduced by Haeckel, or an hourglass model, from von Baer, can plausibly explain the relationship between developmental and evolution processes. The funnel-like model suggests the highest conservation of developmental processes at the earliest stages of embryogenesis, while the latter proposes that the mid-embryonic and organogenesis stages are most highly conserved. Galis and Metz (2001) suggested that the highly morphologically conserved mid-embryonic stage of vertebrates (phylotypic stage) is extremely vulnerable, based on perturbations with teratogens in rodent species. Furthermore, Irie and his colleagues concluded that the most conserved developmental stage was the mid-embryonic stage, based on transcriptome analyses (Irie and

236

7

Problems, Challenges, and Perspectives

Kuratani 2011; Hu et al. 2017). These reports seem to provide evidence that the mid-embryonic stage is at least among the most highly conserved stages. However, according to Uchida et al. (2018), early stage embryos (blastula to gastrula stages) tend to show particular fragility when exposed to environmental and genetic perturbations of heat shock, small-molecule inhibitors, and UV-irradiation, in contrast with the results from rodent species (Galis and Metz 2001) and transcriptome analyses (Irie and Kuratani 2011; Hu et al. 2017). Since zebrafish and goldfish are closely related, the study by Uchida et al. (2018) allows us to posit that goldfish embryos should also show the same tendencies as zebrafish, with a temporally heterogeneous tendency to react to genetic and environmental perturbations. However, it is still uncertain why the perturbation experiments in zebrafish appear to be inconsistent with the other reports (Uchida et al. 2018). These reports also indicate that even under the assumption that genetic mutations can occur arbitrarily within a chromosome, the effects of developmental timing are highly dependent on conservation, fragility, and vulnerability, presumably at least partly because of pleiotropy (Hu et al. 2017). For example, a gene that plays a significant role in cellular physiology will exhibit a lethal mutant phenotype, so mutations will not be heritable even if the same genetic modification could produce an attractive morphological feature for breeders and fanciers. In the same manner, we can consider how the highly conserved developmental stages in the vertebrate lineages react to artificial environmental and genetic perturbations. Although it is still a matter of debate why such a highly conserved stage (so-called phylotypic stage) exits in vertebrate development, it is certain that animals at this stage exhibit conserved morphologies and also conserved molecular constituents (transcriptome profiles) (Irie and Kuratani 2011; Hu et al. 2017). Thus, evidence indicates that even though genetic mutations and conscious artificial selection act as strong driving forces, certain phenotypes and genotypes that require modifications of highly conserved molecular developmental processes might be hard to fix in domesticated populations due to internal selection, developmental constraints, and/or unconscious selection. Thus, the relationships between modifications of developmental timing and scales of phenotypic mutations are highly nuanced.

7.5

Novel Phenotype and Developmental Process

As argued in Chap. 6, different mutated phenotypes are different in terms of the timing at which they might be observed during the developmental process. The mutations involving major morphological changes, the twin-tail and dorsal-finless mutation, tend to be visible at earlier stages than other mutations (for example, protruding eyes, warty growth, and color variations), since the former require modification of the early embryonic molecular developmental program but the latter do not (see Sect. 6.5 in Chap. 6). The bifurcated caudal fin provides an especially useful empirical example of the relationship between scale of morphological evolution and the developmental process, because its underlying change in developmental

7.5 Novel Phenotype and Developmental Process

237

mechanisms and analogous examples can be seen in nature. Here, we compare twintail morphology and pelvic fin evolution among teleost species, as well as color variations in several vertebrate species, aiming to apply the findings in ornamental goldfish to the broad topic of phenotypic evolution. During the short time period of goldfish domestication, a bilateralization of the caudal fin primordia occurred in the lineage of twin-tailed goldfish strains. Other comparable examples in nature include the appearance of bilateral nasal capsules and paired fins in jawed vertebrates; the appearance of these bilateral morphological characteristics involved evolutionary bilateralization of different types of tissues, similar to the bifurcated caudal fin of goldfish (Kuratani et al. 2001; Oisi et al. 2013; Zhang and Hou 2004; Freitas et al. 2006; Abe and Ota 2016). It is known that these morphological features emerged after the divergence of jawed and jawless vertebrates, suggesting that the emergence of these bilaterally located morphological structures required a relatively long time (400–500 million years ago) (see; Kumar and Hedges 1998; Gai and Zhu 2017). Since similar phenotypes have not been found in cyclostomes or non-vertebrate chordate species, the paired fins and paired nostrils may be described as synapomorphic features of gnathostomes (Liem et al. 2001; Kardong 2012). If paired fins and paired nostrils were frequently found in extant and extinct cyclostome species or non-vertebrate chordate species, these phenotypes could not be utilized as significant morphological characteristics that define gnathostomes. The multiple appearances and disappearances of pelvic fins in the teleost lineage can provide context for the specific characteristics of twin-tail morphology. It is known that the sizes and positions of pelvic fins are highly divergent in teleost lineages, and pelvic fins have been independently lost in several lineages, suggesting that the developmental mechanisms are amenable to modification by genetic mutations (Nelson et al. 2016; Shapiro et al. 2004; Yamanoue et al. 2010; Murata et al. 2010; Cresko et al. 2004). It is also known that the reduction of pelvic fin in stickleback fish is caused by DNA fragility in the genomic region of the Pel locus (Xie et al. 2019). Although the disappearance of the pelvic fin can be considered to be a large-scale morphological change, it should be noted that independent and parallel losses of this tissue can be explained as secondary modifications of commonly shared ancestral molecular developmental mechanisms. Moreover, the genes that constitute these shared mechanisms are relatively independent from other major developmental mechanisms. From another point of view, the reason why fragility in the Pel locus is retained in the fish can be that the presence/absence of mutations in the locus does not cause any significant negative pleiotropic effects. The above explanation about the independent occurrence of disappearance of pelvic fins can also apply to color variations of almost all vertebrate species. The frequent changes in color variants can be explained as follows: the changing of body color increases fitness under certain environmental conditions due to selective pressure from predators (or potential predators), and consequently, such phenotypic changes are often observed in natural conditions (Hoekstra 2006; Manceau et al. 2010). There is a possibility that certain mutations in pigmentation-related genes would cause negative pleiotropic effects; for example, the null mutation in Mclr is

238

7

Problems, Challenges, and Perspectives

absent in natural populations, presumably due to negative pleiotropic effects. However, in general, genetic mutations can be relatively easily retained in genes related to color variation because they carry fewer pleiotropic effects, which easily explains the independent and frequent appearance of typical color variations. In fact, evidence from a number of genes known to be related to pigment variations (Hoekstra 2006; see also Stern and Orgogozo (2008), Martin and Orgogozo (2013)) suggests that several types of color variations can be genetically fixed in many different populations and species living in different environments. Although each instance represents a consequence of mutation and selection, the appearance of the twin-tail morphology, the independent disappearances of pelvic fins in teleost lineages, and color variations are all different with respect to whether similar mutated phenotypes are present or absent in closely related lineages. In addition, there are significant differences between frequently appearing and rarely observed phenotypic changes during evolution. As we showed in previous chapters (Chaps. 4 and 5), the appearance timing of these phenotypes is different. Among them, the caudal fin primordium appears first, before hatching and the time when pigment cells are visible, and before the pelvic fins are recognizable in goldfish and zebrafish (Tsai et al. 2013; Li et al. 2015a, 2019; Kimmel et al. 1995; Parichy et al. 2009). Moreover, the required modifications to the topological relationships between cells and tissues differ among the phenotypes in our discussion. It may be assumed that these changes have some relationship with each other. For such coordinated topological changes of different types of tissues to occur, modifications to early developmental processes are required. However, negative pleiotropic effects can easily occur as the result of genetic mutations related to embryonic development at a certain stage (Galis and Metz 2001; Irie and Kuratani 2011; Uchida et al. 2018), suggesting that the possible changes in genotype and phenotype may be biased by temporal pleiotropic effects along the developmental timeline. Although further studies are required for a thorough understanding of how developmental changes are involved in large-scale morphological evolution, it is certain that these processes are closely related to each other. There are a number of issues that needed to be overcome in order to find an answer which can be accepted by everyone about how large-scale morphological evolution, developmental, and genetic process are related. As Raff (1996) noted previously, there is a discrepancy between evolutionary biologists and developmental biologists in how they understand causality, genes, variations, history, and timescales. Moreover, the approaches that researchers take are also affected by the research materials they typically use. Presumably due to such differences in research models (animal species and phenomena), approaches, and field-specific doctrines, there is a continued discrepancy between these research fields about how the significance of the developmental process for the evolutions is recognized and how its related phenomena are interpreted (for example, see Lynch 2007; Hoekstra and Coyne 2007; Craig 2009; Pigliucci 2010; Klingenberg 2008). However, ornamental goldfish variations may be used to bridge this gap, as goldfish variations reflect several different levels of phenotypic evolution (including variations of skeletal architecture, color variations, and some other physiological features, as

7.6 Genome Editing-Derived Domestication

239

mentioned in Chap. 2); these phenotypes can be readily investigated using both developmental biology and population genetics approaches. Thus, the goldfish research model provides an opportunity to consider the similarities and differences between large- and small-scale phenotypic evolution, as well as how developmental processes are involved in phenotypic evolution.

7.6

Genome Editing-Derived Domestication

Recently, genome editing techniques have been applied in zebrafish molecular biological studies (Irion et al. 2014; Hruscha et al. 2013; Varshney et al. 2015; Li et al. 2016; Zhang et al. 2017a, b). Because of its ease of use, CRISPR/Cas9 technology has been adapted and optimized for editing the zebrafish genome (for example, Irion et al. 2014; Hruscha et al. 2013; Jao et al. 2013: Varshney et al. 2015; Li et al. 2016; Zhang et al. 2017a, b). Since researchers have already reported several examples of using CRISPR/Cas9 techniques in pigs and cows (Carlson et al. 2016; Whitworth et al. 2016; see also Barrangou and Doudna 2016), it is safe to predict that this genome editing technique will be applied to enhance physiological viability and produce favorable morphologies for livestock. However, it is less clear whether the application of CRISPR/Cas9-mediated genome editing will be widely applied in societies of ornamental goldfish breeders and fanciers, or if traditional methods will continue to dominate. Thus, to clarify our further discussion relating to the application of genome editing technologies in ornamental goldfish and the significance of its application in the context of evolutionary developmental biology, it seems to have worthwhile to delineate between “genome-editing-derived domestication” and “traditional domestication” methods for ornamental purpose in the context of evodevo. As mentioned in Chap. 1, the process to establish ornamental goldfish involves repetitive artificial selection for the establishment of stably fixed phenotypes that are “attractive” and/or “beautiful” to breeders and fanciers (Fig. 2.7). Although the designation of attractive and/or beautiful phenotypes is scientifically ambiguous, breeders and fanciers might have some consensus about their “ideal” phenotypes. Otherwise, judges of competitive exhibitions cannot evaluate the best goldfish from all those exhibited. In other words, the process of domestication for ornamental goldfish can be conceptualized as the process of externalizing ideal colorations and morphologies imagined in the minds of breeders and fanciers. However, breeders and fanciers cannot directly create the genotypes that underlie favorable phenotypes using traditional domestication practices, since the process depends entirely on spontaneous mutations comprising the pool of selectable options. Even if breeders were to apply mutagens to induce a large number of random mutations, a technique that is frequently used in zebrafish molecular biology (for example, Mullins et al. 1994; van Eeden et al. 1996), the basic procedure is almost the same as the traditional domestication process. This approach may accelerate the rate of new variations from accumulated spontaneous mutations, but no matter whether the source of the mutations is natural or artificial mutagens, this process

240

7

Problems, Challenges, and Perspectives

still depends on stochastically occurring mutations identified by screening a large number of individuals over a long time period. In short, it is hard for breeders and fanciers to directly affect their desired “codes” or “programs” in the genome, and it is harder still to re-write these codes/programs in such a way that their ideal phenotypic features would be expressed, if they depend on traditional domestication methods or random mutagenesis over short time periods. Such limitations may be largely overcome by genome editing techniques. It is likely that a near-future breeder will have the option to produce their ideal ornamental goldfish by using CRISPR/Cas9-mediated genome editing to actively re-write genetic codes/programs that will externalize the breeder’s favorite phenotypes in a real goldfish. For example, fine-tuning of chordin gene-related dorsalventral patterning mechanisms and the wnt signaling pathway can be accomplished using CRISPR/Cas9 genome editing techniques to create twin-tail and dorsal-finless phenotypes. As an extreme example, it may be possible to establish the highly valuable Ranchu strain from a single-tail common goldfish strain independent from the “traditional domestication-derived Ranchu strain” by editing genes related to the above-mentioned genetic mechanism and pathway, not including the chdS and lrp6S genes. If such a Ranchu morphology can be produced with genetic mutations that do not exist in traditional domesticated populations, a novel study can be performed, comparing the “genome editing technique derived ornamental strain” and the “domestication derived strains” in terms of their developmental process and physiological features. This may provide an opportunity to investigate whether the fixed alleles in domestication-derived goldfish are truly optimal, allowing us to consider whether mutation and selection are the major driving force of phenotypic evolution in goldfish, which have complicated and interrelated organs, tissues, and specialized cells. More generally, such an application may provide an opportunity to breeders and fanciers to genetically fix beautiful phenotypes in a healthy goldfish population by selectively creating mutations to genes without negative pleiotropic effects (Fig. 7.5a). It also might be possible to disassociate some genes from their negative pleiotropic effects (Fig. 7.5b). The avoidance of negative pleiotropic effects by using genome editing would enhance the parcellation of modules in ornamental domesticated goldfish during the externalization of ideal phenotypic features. Such application of highly advanced techniques would imply that the organization of modules can be enhanced by anthropogenic activities. The application of the genome editing techniques may not be restricted to generating ornamental goldfish that are similar to already existing ornamental morphologies. It is also highly possible that one may attempt to produce totally novel morphological features in goldfish strains by editing pre-existing genetic codes/programs that were established over a long period of evolutionary time, such as Hox and Dlx codes (see, Duboule and Morata 1994; Carroll et al. 2013; Slack et al. 1993; Depew et al. 2005; Stock et al. 1996; Sumiyama and Tanave 2020; Fujimoto et al. 2013). These imminent trials will provide insights into whether such conserved genetic codes/programs can be successfully modified by genome editing techniques, providing a deeper understanding of how established and conserved

7.6 Genome Editing-Derived Domestication

241

Fig. 7.5 Two examples of genome editing techniques. (a) Genes 2 and 3 (G2 and G3) are depleted with genome editing techniques. Since these two genes are not related with character 2 (C2), their depletion does not influence C2. (b) Modification of gene expression patterns by genome editing techniques. The influence of gene G1 on C2 as well as G5 and G6 on C1 is removed by changing the gene expression patterns with modification of the cis-regulatory elements in these genes. The genes with double strikethrough represent genes with depleted functions resulting from genome editing. The underlined genes have expression patterns that are modified. The white-colored letters (A, B, C, D) are characters that have been changed from their original states. The dotted arrows indicate modified gene expression patterns

genetic codes resist arbitrary changes in the basic body architecture of goldfish and by extension, other vertebrate species. I am not certain about whether widespread application of genome editing techniques in ornamental goldfish with extreme morphologies will be deemed socially and politically acceptable. However, I am sure that conventional retrospective evodevo approaches focusing on natural history will need to incorporate new evodevo approaches, which comprehensively investigate anthropogenic ornamental animals. These new approaches will be required before and after the number and range of anthropogenic genome-edited ornamental animals expands on Earth. It seems that the study of anthropogenic evolution and development (anthropogenic evo-devo) will be required to understand how similarities and differences between human-mediated large-scale morphological evolution and naturally occurring largescale morphological evolution may exist in several different contexts, including domestication history, ecology, environmental science, and related fields. I believe

242

7

Problems, Challenges, and Perspectives

that goldfish will make a significant contribution to the establishment of such anthropogenic evodevo studies.

References Abe G, Ota KG (2016) Evolutionary developmental transition from median to paired morphology of vertebrate fins: perspectives from twin-tail goldfish. Dev Biol 427(2):251–257. https://doi. org/10.1016/j.ydbio.2016.11.022 Abe G, Lee S-H, Chang M, Liu S-C, Tsai H-Y, Ota KG (2014) The origin of the bifurcated axial skeletal system in the twin-tail goldfish. Nat Commun 5:3360. https://doi.org/10.1038/ ncomms4360 Abe G, Lee S-H, Li I-J, Chang C-J, Tamura K, Ota KG (2016) Open and closed evolutionary paths for drastic morphological changes, involving serial gene duplication, sub-functionalization, and selection. Sci Rep 6:26838. https://doi.org/10.1038/srep26838 Alberch P (1991) From genes to phenotype: dynamical systems and evolvability. Genetica 84 (1):5–11 Barrangou R, Doudna JA (2016) Applications of CRISPR technologies in research and beyond. Nat Biotechnol 34(9):933–941. https://doi.org/10.1038/nbt.3659 Bateson W (1894) Materials for the study of variation treated with especial regard to discontinuity in the origin of species. Macmillan, London Carlson DF, Lancto CA, Zang B, Kim E-S, Walton M, Oldeschulte D, Seabury C, Sonstegard TS, Fahrenkrug SC (2016) Production of hornless dairy cattle from genome-edited cell lines. Nat Biotechnol 34(5):479–481. https://doi.org/10.1038/nbt.3560 Carroll SB, Grenier JK, Weatherbee SD (2013) From DNA to diversity: molecular genetics and the evolution of animal design. Wiley, New York Chen Z, Omori Y, Koren S, Shirokiya T, Kuroda T, Miyamoto A, Wada H, Fujiyama A, Toyoda A, Zhang S (2019) De novo assembly of the goldfish (Carassius auratus) genome and the evolution of genes after whole-genome duplication. Sci Adv 5(6):eaav0547. https://doi.org/ 10.1126/sciadv.aav0547 Connolly MH, Hall BK (2008) Embryonic heat shock reveals latent hsp90 translation in zebrafish (Danio rerio). Int J Dev Biol 52(1):71–79. https://doi.org/10.1387/ijdb.062241mc Craig LR (2009) Defending evo-devo: a response to Hoekstra and Coyne. Philos Sci 76(3):335–344 Crawford KC, Vega Flores M, Oehlers SH, Hall CJ, Crosier KE, Crosier PS (2011) Zebrafish heat shock protein a4 genes in the intestinal epithelium are up-regulated during inflammation. Genesis 49(12):905–911. https://doi.org/10.1002/dvg.20767 Cresko WA, Amores A, Wilson C, Murphy J, Currey M, Phillips P, Bell MA, Kimmel CB, Postlethwait JH (2004) Parallel genetic basis for repeated evolution of armor loss in Alaskan threespine stickleback populations. Proc Natl Acad Sci 101(16):6050–6055. https://doi.org/10. 1073/pnas.0308479101 Crow KD, Wagner GP (2006) What is the role of genome duplication in the evolution of complexity and diversity? Mol Biol Evol 23(5):887–892. https://doi.org/10.1093/molbev/msj083 Depew MJ, Simpson CA, Morasso M, Rubenstein JLR (2005) Reassessing the Dlx code: the genetic regulation of branchial arch skeletal pattern and development. J Anat 207(5):501–561. https://doi.org/10.1111/j.1469-7580.2005.00487.x Dick A, Hild M, Bauer H, Imai Y, Maifeld H, Schier AF, Talbot WS, Bouwmeester T, Hammerschmidt M (2000) Essential role of Bmp7 (snailhouse) and its prodomain in dorsoventral patterning of the zebrafish embryo. Development (Cambridge, England) 127(2):343–354. https://doi.org/10.1242/dev.127.2.343 Duboule D, Morata G (1994) Colinearity and functional hierarchy among genes of the homeotic complexes. Trends Genet 10(10):358–364

References

243

Eslamloo K, Akhavan SR, Eslamifar A, Henry MA (2015) Effects of background colour on growth performance, skin pigmentation, physiological condition and innate immune responses of goldfish, Carassius auratus. Aquac Res 46(1):202–215. https://doi.org/10.1111/are.12177 Esposito M (2020) Beyond Haeckel’s law: Walter Garstang and the evolutionary biology that might have been. J Hist Biol 53(2):249–268. https://doi.org/10.1007/s10739-020-09602-9 Freitas R, Zhang G, Cohn MJ (2006) Evidence that mechanisms of fin development evolved in the midline of early vertebrates. Nature 442(7106):1033–1037. https://doi.org/10.1038/ nature04984 Fujimoto S, Oisi Y, Kuraku S, Ota KG, Kuratani S (2013) Non-parsimonious evolution of hagfish Dlx genes. BMC Evol Biol 13(1):15. https://doi.org/10.1186/1471-2148-13-15 Gai Z-K, Zhu M (2017) Evolutionary history of Agnathans and their fossil records in China (无颌 类演化史与中国化石记录). Shanghai Scientific and Technical Publishers, Shanghai. [in Chinese] Galis F, Metz JAJ (2001) Testing the vulnerability of the phylotypic stage: on modularity and evolutionary conservation. J Exp Zool 291(2):195–204. https://doi.org/10.1002/jez.1069 Garstang W (1922) The theory of recapitulation: a critical re-statement of the biogenetic law. Zool J Linnean Soc 35(232):81–101 Gilbert SF, Epel D (2009) Ecological developmental biology. Sinauer Associates, Sunderland Gjuvsland AB, Vik JO, Beard DA, Hunter PJ, Omholt SW (2013) Bridging the genotype– phenotype gap: what does it take? J Physiol 591(8):2055–2066. https://doi.org/10.1113/ jphysiol.2012.248864 Gouveia L, Rema P, Pereira O, Empis J (2003) Colouring ornamental fish (Cyprinus carpio and Carassius auratus) with microalgal biomass. Aquac Nutr 9(2):123–129. https://doi.org/10. 1046/j.1365-2095.2003.00233.x Hoekstra HE (2006) Genetics, development and evolution of adaptive pigmentation in vertebrates. Heredity 97(3):222–234. https://doi.org/10.1038/sj.hdy.6800861 Hoekstra HE, Coyne JA (2007) The locus of evolution: evo devo and the genetics of adaptation. Evolution 61(5):995–1016. https://doi.org/10.1111/j.1558-5646.2007.00105.x Holzschuh J, Wada N, Wada C, Schaffer A, Javidan Y, Tallafuß A, Bally-Cuif L, Schilling TF (2005) Requirements for endoderm and BMP signaling in sensory neurogenesis in zebrafish. Development 132(16):3731–3742. https://doi.org/10.1242/dev.01936 Houle D, Govindaraju DR, Omholt S (2010) Phenomics: the next challenge. Nat Rev Genet 11 (12):855–866. https://doi.org/10.1038/nrg2897 Hruscha A, Krawitz P, Rechenberg A, Heinrich V, Hecht J, Haass C, Schmid B (2013) Efficient CRISPR/Cas9 genome editing with low off-target effects in zebrafish. Development 140 (24):4982–4987. https://doi.org/10.1242/dev.099085 Hu H, Uesaka M, Guo S, Shimai K, Lu T-M, Li F, Fujimoto S, Ishikawa M, Liu S, Sasagawa Y, Zhang G, Kuratani S, Yu J-K, Kusakabe TG, Khaitovich P, Irie N (2017) Constrained vertebrate evolution by pleiotropic genes. Nat Ecol Evol 1(11):1722–1730. https://doi.org/10.1038/ s41559-017-0318-0 Inomata H, Haraguchi T, Sasai Y (2008) Robust stability of the embryonic axial pattern requires a secreted scaffold for chordin degradation. Cell 134(5):854–865. https://doi.org/10.1016/j.cell. 2008.07.008 Irie N, Kuratani S (2011) Comparative transcriptome analysis reveals vertebrate phylotypic period during organogenesis. Nat Commun 2(1):246–248. https://doi.org/10.1038/ncomms1248 Irion U, Krauss J, Nüsslein-Volhard C, Auer TO, Bene FD, Auer TO, Duroure K, Cian AD, Concordet J-P, Bene FD, Cade L, Reyon D, Hwang WY, Tsai SQ, Patel S, Khayter C, Joung JK, Sander JD, Peterson RT, Yeh J-RJ, Cermak T, Doyle EL, Christian M, Wang L, Zhang Y, Schmidt C, Baller JA, Somia NV, Bogdanove AJ, Voytas DF, Dooley CM, Mongera A, Walderich B, Nusslein-Volhard C, Dooley CM, Schwarz H, Mueller KP, Mongera A, Konantz M, Neuhauss SCF, Nüsslein-Volhard C, Geisler R, Durai S, Mani M, Kandavelou K, Wu J, Porteus MH, Chandrasegaran S, Gaj T, Gersbach CA, Barbas CF, Gonzalez F, Zhu Z, Shi ZD, Lelli K, Verma N, Li QV, Huangfu D, Hruscha A, Krawitz P,

244

7

Problems, Challenges, and Perspectives

Rechenberg A, Heinrich V, Hecht J, Haass C, Schmid B, Hwang WY, Fu Y, Reyon D, Maeder ML, Kaini P, Sander JD, Joung JK, Peterson RT, Yeh J-RJ, Jao L-E, Wente SR, Chen W, Jinek M, Chylinski K, Fonfara I, Hauer M, Doudna JA, Charpentier E, Kelsh RN, Brand M, Jiang YJ, Heisenberg CP, Lin S, Haffter P, Odenthal J, Mullins MC, van Eeden FJ, FurutaniSeiki M, Streisinger G, Singer F, Walker C, Knauber D, Dower N, Wang H, Yang H, Shivalila CS, Dawlaty MM, Cheng AW, Zhang F, Jaenisch R, Yang H, Wang H, Shivalila CS, Cheng AW, Shi L, Jaenisch R, Zu Y, Tong X, Wang Z, Liu D, Pan R, Li Z, Hu Y, Luo Z, Huang P, Wu Q (2014) Precise and efficient genome editing in zebrafish using the CRISPR/Cas9 system. Development (Cambridge, England) 141(24):4827–4830. https://doi.org/10.1242/dev.115584 Jao L-E, Wente SR, Chen W (2013) Efficient multiplex biallelic zebrafish genome editing using a CRISPR nuclease system. Proc Natl Acad Sci 110(34):13904–13909. https://doi.org/10.1073/ pnas.1308335110 Kardong KV (2012) Vertebrates: comparative anatomy, function, evolution, 6th edn. McGraw-Hill Higher Education, Boston, MA Kimmel CB, Kimmel CB, Ballard WW, Ballard WW, Kimmel SR, Kimmel SR, Ullmann B, Ullmann B, Schilling TF, Schilling TF (1995) Stages of embryonic development of the zebrafish. Dev Dyn 203(3):253–310. https://doi.org/10.1002/aja.1002030302 Klingenberg CP (2008) Morphological integration and developmental modularity. Annu Rev Ecol Evol Syst 39(1):115–132. https://doi.org/10.1146/annurev.ecolsys.37.091305.110054 Kon T, Omori Y, Fukuta K, Wada H, Watanabe M, Chen Z, Iwasaki M, Mishina T, Shin-ichiro SM, Yoshihara D (2020) The genetic basis of morphological diversity in domesticated goldfish. Curr Biol 30(12):2260–2274.e6. https://doi.org/10.1016/j.cub.2020.04.034 Korschelt E (1907) Regeneration und transplantation. G. Fischer, Jena. [in German] Kumar S, Hedges SB (1998) A molecular timescale for vertebrate evolution. Nature 392 (6679):917–920. https://doi.org/10.1038/31927 Kuratani S, Nobusada Y, Horigome N, Shigetani Y (2001) Embryology of the lamprey and evolution of the vertebrate jaw: insights from molecular and developmental perspectives. Philos Trans R Soc Lond B Biol Sci 356(1414):1615–1632. https://doi.org/10.1098/rstb.2001.0976 Lerner IM (1954) Genetic homeostasis. Wiley, New York Li IJ, Chang CJ, Liu SC, Abe G, Ota KG (2015a) Postembryonic staging of wild-type goldfish, with brief reference to skeletal systems. Dev Dyn 244(12):1485–1518. https://doi.org/10.1002/dvdy. 24340 Li J, Zhang B-b, Ren Y-g, Gu S-y, Xiang Y-h, Huang C, Du J-l (2015b) Intron targeting-mediated and endogenous gene integrity-maintaining knockin in zebrafish using the CRISPR/Cas9 system. Cell Res 25(5):634–637. https://doi.org/10.1038/cr.2015.43 Li MY, Zhao LY, Page-McCaw PS, Chen WB (2016) Zebrafish genome engineering using the CRISPR-Cas9 system. Trends Genet 32(12):815–827. https://doi.org/10.1016/j.tig.2016.10.005 Li I-J, Lee S-H, Abe G, Ota KG (2019) Embryonic and post-embryonic development of the ornamental twin-tail goldfish. Dev Dyn 248(4):251–283. https://doi.org/10.1002/dvdy.15 Liem KF, Bemis WE, Walker WF, Kabce G (2001) Functional anatomy of the vertebrates: an evolutionary perspective, 3rd revised ed. Brooks Cole, Pacific Grove Lindblad-Toh K, Wade CM, Mikkelsen TS, Karlsson EK, Jaffe DB, Kamal M, Clamp M, Chang JL, Kulbokas EJ, Zody MC, Mauceli E, Xie X, Breen M, Wayne RK, Ostrander EA, Ponting CP, Galibert F, Smith DR, DeJong PJ, Kirkness E, Alvarez P, Biagi T, Brockman W, Butler J, Chin C-W, Cook A, Cuff J, Daly MJ, DeCaprio D, Gnerre S, Grabherr M, Kellis M, Kleber M, Bardeleben C, Goodstadt L, Heger A, Hitte C, Kim L, Koepfli K-P, Parker HG, Pollinger JP, Searle SMJ, Sutter NB, Thomas R, Webber C, Baldwin J, Abebe A, Abouelleil A, Aftuck L, Ait-Zahra M, Aldredge T, Allen N, An P, Anderson S, Antoine C, Arachchi H, Aslam A, Ayotte L, Bachantsang P, Barry A, Bayul T, Benamara M, Berlin A, Bessette D, Blitshteyn B, Bloom T, Blye J, Boguslavskiy L, Bonnet C, Boukhgalter B, Brown A, Cahill P, Calixte N, Camarata J, Cheshatsang Y, Chu J, Citroen M, Collymore A, Cooke P, Dawoe T, Daza R, Decktor K, DeGray S, Dhargay N, Dooley K, Dooley K, Dorje P, Dorjee K, Dorris L, Duffey N, Dupes A, Egbiremolen O, Elong R, Falk J, Farina A, Faro S, Ferguson D, Ferreira P, Fisher S,

References

245

FitzGerald M, Foley K, Foley C, Franke A, Friedrich D, Gage D, Garber M, Gearin G, Giannoukos G, Goode T, Goyette A, Graham J, Grandbois E, Gyaltsen K, Hafez N, Hagopian D, Hagos B, Hall J, Healy C, Hegarty R, Honan T, Horn A, Houde N, Hughes L, Hunnicutt L, Husby M, Jester B, Jones C, Kamat A, Kanga B, Kells C, Khazanovich D, Kieu AC, Kisner P, Kumar M, Lance K, Landers T, Lara M, Lee W, Leger J-P, Lennon N, Leuper L, LeVine S, Liu J, Liu X, Lokyitsang Y, Lokyitsang T, Lui A, Macdonald J, Major J, Marabella R, Maru K, Matthews C, McDonough S, Mehta T, Meldrim J, Melnikov A, Meneus L, Mihalev A, Mihova T, Miller K, Mittelman R, Mlenga V, Mulrain L, Munson G, Navidi A, Naylor J, Nguyen T, Nguyen N, Nguyen C, Nguyen T, Nicol R, Norbu N, Norbu C, Novod N, Nyima T, Olandt P, O’Neill B, O’Neill K, Osman S, Oyono L, Patti C, Perrin D, Phunkhang P, Pierre F, Priest M, Rachupka A, Raghuraman S, Rameau R, Ray V, Raymond C, Rege F, Rise C, Rogers J, Rogov P, Sahalie J, Settipalli S, Sharpe T, Shea T, Sheehan M, Sherpa N, Shi J, Shih D, Sloan J, Smith C, Sparrow T, Stalker J, Stange-Thomann N, Stavropoulos S, Stone C, Stone S, Sykes S, Tchuinga P, Tenzing P, Tesfaye S, Thoulutsang D, Thoulutsang Y, Topham K, Topping I, Tsamla T, Vassiliev H, Venkataraman V, Vo A, Wangchuk T, Wangdi T, Weiand M, Wilkinson J, Wilson A, Yadav S, Yang S, Yang X, Young G, Yu Q, Zainoun J, Zembek L, Zimmer A, Lander ES (2005) Genome sequence, comparative analysis and haplotype structure of the domestic dog. Nature 438(7069):803–819. https://doi.org/10. 1038/nature04338 Lynch M (2007) The frailty of adaptive hypotheses for the origins of organismal complexity. Proc Natl Acad Sci 104(Suppl 1):8597–8604. https://doi.org/10.1073/pnas.0702207104 Lynch M, Conery JS (2000) The evolutionary fate and consequences of duplicate genes. Science (New York, NY) 290(5494):1151–1155. https://doi.org/10.1126/science.290.5494.1151 Lynch M, Walsh B (1998) Genetics and analysis of quantitative traits. Sinauer, Sunderland, MA Manceau M, Domingues VS, Linnen CR, Rosenblum EB, Hoekstra HE (2010) Convergence in pigmentation at multiple levels: mutations, genes and function. Philos Trans R Soc B Biol Sci 365(1552):2439–2450. https://doi.org/10.1098/rstb.2010.0104 Martin A, Orgogozo V (2013) The loci of repeated evolution: a catalog of genetic hotspots of phenotypic variation. Evolution 67(5):1235–1250. https://doi.org/10.1111/evo.12081 Marvin M, O’Rourke D, Kurihara T, Juliano CE, Harrison KL, Hutson LD (2008) Developmental expression patterns of the zebrafish small heat shock proteins. Dev Dyn 237(2):454–463. https:// doi.org/10.1002/dvdy.21414 Meyer RS, Purugganan MD (2013) Evolution of crop species: genetics of domestication and diversification. Nat Rev Genet 14(12):840–852. https://doi.org/10.1038/nrg3605 Moyers BT, Morrell PL, McKay JK (2018) Genetic costs of domestication and improvement. J Hered 109(2):103–116. https://doi.org/10.1093/jhered/esx069 Mullins MC, Hammerschmidt M, Haffter P, Nusslein-Volhard C (1994) Large-scale mutagenesis in the zebrafish: in search of genes controlling development in a vertebrate. Curr Biol 4 (3):189–202. https://doi.org/10.1016/S0960-9822(00)00048-8 Muraoka O, Shimizu T, Yabe T, Nojima H, Bae Y-K, Hashimoto H, Hibi M (2006) Sizzled controls dorso-ventral polarity by repressing cleavage of the Chordin protein. Nat Cell Biol 8 (4):329–338. https://doi.org/10.1038/ncb1379 Murata Y, Tamura M, Aita Y, Fujimura K, Murakami Y, Okabe M, Okada N, Tanaka M (2010) Allometric growth of the trunk leads to the rostral shift of the pelvic fin in teleost fishes. Dev Biol 347(1):236–245. https://doi.org/10.1016/j.ydbio.2010.07.034 Needham J (1933) On the dissociability of the fundamental processes in ontogenesis. Biol Rev Biol P Camb 8(2):180–223. https://doi.org/10.1111/j.1469-185X.1933.tb01153.x Nelson JS, Grande TC, Wilson MV (2016) Fishes of the world. Wiley, Hoboken, NJ Ohno S (1970) Evolution by gene duplication. Springer-Verlag, Berlin Oisi Y, Ota KG, Kuraku S, Fujimoto S, Kuratani S (2013) Craniofacial development of hagfishes and the evolution of vertebrates. Nature 493(7431):175–180. https://doi.org/10.1038/ nature11794

246

7

Problems, Challenges, and Perspectives

Orgogozo V, Morizot B, Martin A (2015) The differential view of genotype–phenotype relationships. Front Genet 6:179. https://doi.org/10.3389/fgene.2015.00179 Ota KG, Abe G (2016) Goldfish morphology as a model for evolutionary developmental biology. Wiley Interdisciplinary Reviews: Developmental Biology 5(3):272–295. https://doi.org/10. 1002/wdev.224 Otto SP (2007) The evolutionary consequences of polyploidy. Cell 131(3):452–462. https://doi.org/ 10.1016/j.cell.2007.10.022 Otto SP, Whitton J (2000) Polyploid incidence and evolution. Annu Rev Genet 34(1):401–437. https://doi.org/10.1146/annurev.genet.34.1.401 Parichy DM, Elizondo MR, Mills MG, Gordon TN, Engeszer RE (2009) Normal table of postembryonic zebrafish development: staging by externally visible anatomy of the living fish. Dev Dyn 238(12):2975–3015. https://doi.org/10.1002/dvdy.22113 Pei W, Williams PH, Clark MD, Stemple DL, Feldman B (2007) Environmental and genetic modifiers of squint penetrance during zebrafish embryogenesis. Dev Biol 308(2):368–378. https://doi.org/10.1016/j.ydbio.2007.05.026 Pigliucci M (2010) Genotype–phenotype mapping and the end of the ‘genes as blueprint’ metaphor. Philos Trans R Soc B Biol Sci 365(1540):557–566. https://doi.org/10.1098/rstb.2009.0241 Pinson KI, Brennan J, Monkley S, Avery BJ, Skarnes WC (2000) An LDL-receptor-related protein mediates Wnt signalling in mice. Nature 407(6803):535–538 Raff RA (1996) The shape of life: genes, development, and the evolution of animal form. University of Chicago Press, Chicago Rohner N, Jarosz DF, Kowalko JE, Yoshizawa M, Jeffery WR, Borowsky RL, Lindquist S, Tabin CJ (2013) Cryptic variation in morphological evolution: HSP90 as a capacitor for loss of eyes in cavefish. Science 342(6164):1372–1375. https://doi.org/10.1126/science.1240276 Salazar-Ciudad I, Marín-Riera M (2013) Adaptive dynamics under development-based genotype– phenotype maps. Nature 497(7449):361–364. https://doi.org/10.1038/nature12142 Schlosser G, Wagner GP (2004) Modularity in development and evolution. University of Chicago Press, Chicago Sémon M, Wolfe KH (2007) Consequences of genome duplication. Curr Opin Genet Dev 17 (6):505–512. https://doi.org/10.1016/j.gde.2007.09.007 Shapiro MD, Marks ME, Peichel CL, Blackman BK, Nereng KS, Jónsson B, Schluter D, Kingsley DM (2004) Genetic and developmental basis of evolutionary pelvic reduction in threespine sticklebacks. Nature 428(6984):717–723. https://doi.org/10.1038/nature02415 Shapiro MD, Kronenberg Z, Li C, Domyan ET, Pan H, Campbell M, Tan H, Huff CD, Hu H, Vickrey AI (2013) Genomic diversity and evolution of the head crest in the rock pigeon. Science 339(6123):1063–1067. https://doi.org/10.1126/science.1230422 Slack JMW, Holland PWH, Graham CF (1993) The zootype and the phylotypic stage. Nature 361 (6412):490–492. https://doi.org/10.1038/361490a0 Smartt J (2001) Goldfish varieties and genetics: handbook for breeders. Wiley, New York Smith A, Avaron F, Guay D, Padhi BK, Akimenko MA (2006) Inhibition of BMP signaling during zebrafish fin regeneration disrupts fin growth and scleroblast differentiation and function. Dev Biol 299(2):438–454. https://doi.org/10.1016/j.ydbio.2006.08.016 Stern DL, Orgogozo V (2008) The loci of evolution: how predictable is genetic evolution? Evolution 62(9):2155–2177. https://doi.org/10.1111/j.1558-5646.2008.00450.x Stock DW, Ellies DL, Zhao Z, Ekker M, Ruddle FH, Weiss KM (1996) The evolution of the vertebrate Dlx gene family. Proc Natl Acad Sci 93(20):10858–10863. https://doi.org/10.1073/ pnas.93.20.10858 Sumiyama K, Tanave A (2020) The regulatory landscape of the Dlx gene system in branchial arches: shared characteristics among Dlx bigene clusters and evolution. Dev Growth Differ 62 (5):355–362. https://doi.org/10.1111/dgd.12671 Suzuki DG (2016) Two-headed mutants of the lamprey, a basal vertebrate. Zool Lett 2(1):1–6

References

247

Tsai H-Y, Chang M, Liu S-C, Abe G, Ota KG (2013) Embryonic development of goldfish (Carassius auratus): a model for the study of evolutionary change in developmental mechanisms by artificial selection. Dev Dyn 242(11):1262–1283. https://doi.org/10.1002/dvdy.24022 Uchida Y, Uesaka M, Yamamoto T, Takeda H, Irie N (2018) Embryonic lethality is not sufficient to explain hourglass-like conservation of vertebrate embryos. EvoDevo 9(1):1–11. https://doi.org/ 10.1186/s13227-018-0095-0 Urushibata H, Takahashi E, Shimizu Y, Miyazaki T, Fujimoto T, Arai K, Yamaha E (2019) Morphological differences in embryos of goldfish (Carassius auratus auratus) under different incubation temperatures. Int J Dev Biol 63(11-12):597–604. https://doi.org/10.1387/ijdb. 190144hu van Eeden FJ, Granato M, Schach U, Brand M, Furutani-Seiki M, Haffter P, Hammerschmidt M, Heisenberg CP, Jiang YJ, Kane DA, Kelsh RN, Mullins MC, Odenthal J, Warga RM, NüssleinVolhard C (1996) Genetic analysis of fin formation in the zebrafish, Danio rerio. Development (Cambridge, England) 123:255–262 Varshney GK, Pei W, LaFave MC, Idol J, Xu L, Gallardo V, Carrington B, Bishop K, Jones M, Li M, Harper U, Huang SC, Prakash A, Chen W, Sood R, Ledin J, Burgess SM (2015) Highthroughput gene targeting and phenotyping in zebrafish using CRISPR/Cas9. Genome Res 25 (7):1030–1042. https://doi.org/10.1101/gr.186379.114 Waddington CH (1956) Genetic assimilation of the bithorax phenotype. Evolution 10:1–13 Waddington CH (1957) The strategy of the genes. A discussion of some aspects of theoretical biology. With an appendix by H. Kacser. The strategy of the genes A discussion of some aspects of theoretical biology with an appendix by H Kacser Wagner GP (2018) Homology, genes, and evolutionary innovation. Princeton University Press, Princeton Wagner GP, Altenberg L (1996) Complex adaptations and the evolution of evolvability. Evolution 50(3):967–977 Wagner GP, Zhang J (2011) The pleiotropic structure of the genotype-phenotype map: the evolvability of complex organisms. Nat Rev Genet 12(3):204–213. https://doi.org/10.1038/ nrg2949 Wang SY, Luo J, Murphy RW, Wu SF, Zhu CL, Gao Y, Zhang YP (2013) Origin of Chinese goldfish and sequential loss of genetic diversity accompanies new breeds. PLoS One 8(3):1–8. https://doi.org/10.1371/journal.pone.0059571 West-Eberhard MJ (2003) Developmental plasticity and evolution. Oxford University Press, Oxford Whitworth KM, Rowland RRR, Ewen CL, Trible BR, Kerrigan MA, Cino-Ozuna AG, Samuel MS, Lightner JE, McLaren DG, Mileham AJ, Wells KD, Prather RS (2016) Gene-edited pigs are protected from porcine reproductive and respiratory syndrome virus. Nat Biotechnol 34 (1):20–22. https://doi.org/10.1038/nbt.3434 Xie KT, Wang G, Thompson AC, Wucherpfennig JI, Reimchen TE, MacColl AD, Schluter D, Bell MA, Vasquez KM, Kingsley DM (2019) DNA fragility in the parallel evolution of pelvic reduction in stickleback fish. Science 363(6422):81–84. https://doi.org/10.1126/science. aan1425 Xu P, Zhang X, Wang X, Li J, Liu G, Kuang Y, Xu J, Zheng X, Ren L, Wang G, Zhang Y, Huo L, Zhao Z, Cao D, Lu C, Li C, Zhou Y, Liu Z, Fan Z, Shan G, Li X, Wu S, Song L, Hou G, Jiang Y, Jeney Z, Yu D, Wang L, Shao C, Song L, Sun J, Ji P, Wang J, Li Q, Xu L, Sun F, Feng J, Wang C, Wang S, Wang B, Li Y, Zhu Y, Xue W, Zhao L, Wang J, Gu Y, Lv W, Wu K, Xiao J, Wu J, Zhang Z, Yu J, Sun X (2014) Genome sequence and genetic diversity of the common carp, Cyprinus carpio. Nat Genet 46(11):1212–1219. https://doi.org/10.1038/ng.3098 Xu P, Xu J, Liu G, Chen L, Zhou Z, Peng W, Jiang Y, Zhao Z, Jia Z, Sun Y (2019) The allotetraploid origin and asymmetrical genome evolution of the common carp Cyprinus carpio. Nat Commun 10(1):1–11. https://doi.org/10.1038/s41467-019-12644-1

248

7

Problems, Challenges, and Perspectives

Yabe T, Shimizu T, Muraoka O, Bae Y-K, Hirata T, Nojima H, Kawakami A, Hirano T, Hibi M (2003) Ogon/secreted frizzled functions as a negative feedback regulator of Bmp signaling. Development 130(12):2705–2716. https://doi.org/10.1242/dev.00506 Yamanoue Y, Setiamarga DHE, Matsuura K (2010) Pelvic fins in teleosts: structure, function and evolution. J Fish Biol 77(6):1173–1208. https://doi.org/10.1111/j.1095-8649.2010.02674.x Zhang XG, Hou XG (2004) Evidence for a single median fin-fold and tail in the Lower Cambrian vertebrate, Haikouichthys ercaicunensis. J Evol Biol 17(5):1162–1166. https://doi.org/10.1111/ j.1420-9101.2004.00741.x Zhang Y, Liu J, Peng L, Ren L, Zhang H, Zou L, Liu W, Xiao Y (2017a) Comparative transcriptome analysis of molecular mechanism underlying gray-to-red body color formation in red crucian carp (Carassius auratus, red var.). Fish Physiol Biochem 43(5):1387–1398. https://doi.org/10.1007/s10695-017-0379-7 Zhang Y, Qin W, Lu X, Xu J, Huang H, Bai H, Li S, Lin S (2017b) Programmable base editing of zebrafish genome using a modified CRISPR-Cas9 system. Nat Commun 8(1):1–5. https://doi. org/10.1038/s41467-017-00175-6

Chapter 8

Experimental Notes

Abstract The developmental process of goldfish is quite similar to that of zebrafish. This high similarity facilitates developmental biological studies in goldfish because methodologies that are frequently used in zebrafish may be easily adapted; for example, in situ hybridization and microinjection protocols can be adapted to goldfish. However, several goldfish-specific features still hinder experimental work in this species. Here, the accumulated knowledge in our laboratory provides the basis for detailed procedures for artificial fertilization, including obtaining fertilized eggs and experimental techniques like microscopic observations, histology, genotyping, analyses of the gene expression patterns, and functional analyses of genes. The techniques are illustrated with pictures, and I hope that this chapter will benefit enthusiastic breeders and fanciers who want to carefully observe the developmental process of their goldfish as well as all researchers who want to start goldfish evodevo studies in their own laboratories.

Several goldfish books for fanciers and breeders have been published by authors around the world (see Matsui 1934; Smartt 2001; Teichfischer 1994). However, to my knowledge, there is not yet any book that contains explicit instructions for goldfish developmental biology experimentation. In this chapter, several wellvalidated experimental procedures for evolutionary developmental biological studies are introduced. These protocols were optimized based on our extensive accumulated experience and include instructions for facilitating artificial fertilization, handling of embryos and juveniles, and conducting experiments on ornamental goldfish for the study of evolutionary developmental biology.

8.1 8.1.1

Parents Obtaining Parental Goldfish

Male and female adult goldfish should be prepared prior to the spawning season, which usually occurs in the spring. To prepare adult goldfish that can produce © The Author(s), under exclusive license to Springer Nature Singapore Pte Ltd. 2021 K. G. Ota, Goldfish Development and Evolution, https://doi.org/10.1007/978-981-16-0850-6_8

249

250

8

Experimental Notes

Fig. 8.1 Aquarium facilities at local fish breeders and fishery science institute. (a) Ponds are made from brick and concrete in a traditional fish farm in Yilan pref., Taiwan (SHUENSHIN Breeding Farm). (b) 200-L tanks are used in the Aquaculture Breeding Institute, Hualien, Taiwan. (Photographed by the author)

fertilized eggs for research purposes, there are several different approaches. One is to obtain fish from an outside facility just before the spawning season. For example, goldfish may be purchased from a pet shop and/or obtained from fanciers, breeders, and/or research institutes that maintain goldfish strains (Fig. 8.1). This method does not require large-scale aquarium facilities and space. Alternatively, candidate male and female adults can be maintained in the laboratory for 6 months or 1 year prior to the spawning season. This practice is costlier, as it requires a fully functional aquarium facility to properly maintain healthy goldfish for long periods, but it provides greater flexibility in experimental design (see Sect. 8.4).

8.1 Parents

8.1.2

251

Size of Adult Goldfish

The size of female adults is key for obtaining appropriate amounts of fertilized eggs for experimentation. It is relatively easy to acquire a sufficient volume of sperm from male goldfish of any size, since a single drop can be used for multiple artificial fertilizations. Even though the body size of a male may be small (often around 5–7 cm in standard length), any male that can release active sperm can be used for artificial fertilization. On the other hand, the size of a female goldfish is a decisive factor in whether a sufficient number of fertilized eggs can be obtained or not. Thus, it is recommended that the state of maturation and size of a female goldfish should be evaluated before using the individual for artificial fertilization. It is known that 2- to 3-year-old goldfish generally spawn the largest numbers of eggs, and females of this age are often used after hormone stimulation to harvest a maximal number of fertilized eggs (Matsui et al. 1972) (Fig. 8.2a, b). Nevertheless, 1-year-old goldfish also spawn eggs, and while the number of eggs in the abdomen may not be high, goldfish are relatively easy to handle at this age (Fig. 8.2c). Our empirical observations over more than 7 years indicate that adult females of more than 10 cm standard length routinely spawn mature eggs. During that observation period, 8–10 cm goldfish that were maintained for 1–2 years in our aquarium facility reliably spawned more than 200 eggs per year. Thus, the use of five 8–10 cm females for artificial fertilization provided around 1000 embryos and larvae; this number of fertilized eggs was deemed sufficient for conventional observation of embryos and for the experiments detailed below (Sects. 8.5–8.9). To obtain larger numbers of fertilized eggs from one clutch, the use of larger sized females is recommended. It can be expected that 2- or 3-year-old goldfish females (more than 15 cm standard

Fig. 8.2 Variations in size of parental fish. (a, b) Ornamental goldfish maintained for artificial fertilization in local fish farmer’s pond. (a) Ryukin strain. (b) Ranchu strain. The specimens were maintained for more than 2 years. (c) Lateral view of wild-type (transparent) goldfish in the hand. This specimen was maintained for less than 2 years. Eggs can be seen through the lateral side of the body. (Photographed by the author)

252

8

Experimental Notes

length, as shown in Fig. 8.2a, b) will spawn at least 500 eggs, and usually, the number of eggs per female will be more than 1000.

8.1.3

Identification of Individual Live Goldfish

For most genetics experiments, the male and female individuals derived from artificial fertilization should be identifiable and kept alive for experimental purposes. Thus, the larvae and juveniles are often maintained individually in small tanks (Fig. 8.3a). However, this method is unrealistic if a large number of adult goldfish individuals must be maintained in a conventional laboratory without a large-scale aquarium system (refer to Sect. 8.4.4). Therefore, to avoid a shortage of aquarium space, identifiable individual goldfish specimens must be maintained in the same aquarium tank. In our laboratory, each adult goldfish specimen is identified by (a) color pattern (Fig. 8.3b–d), (b) cutting of different fin(s) (Fig. 8.3e), or (c) IC-tag injection (Fig. 8.3e). The first option provides the easiest readout, and it is used most often to identify individual goldfish from strains with color variations (Figs. 3.1b and 8.3b–d). The second option is typically used for individuals that require genotyping. By cutting different fins (left or right, pelvic or pectoral fins), each goldfish in a tank can be uniquely identified (Fig. 8.3e). Moreover, the resected piece of fin can be preserved in ethanol or some other reagent for DNA preservation (for example, TNE-urea buffer, Asahida et al. 1996), after which it can be used for genotyping. When using fin resection for identification, it should be noted that the cut fin may be almost completely regenerated after 2–3 months if only the tip is removed (Fig. 8.3e). Therefore, this readout is only appropriate for tentative identification. Although the third method (IC-tag injection) requires several steps, it is suitable for goldfish of large sizes (more than 15 cm). Using a microchip tagging system (MUSICC Identification System and MiniTracker I, Avid), goldfish individuals can be identified by a uniquely assigned number (Fig. 8.3f). To inject the microchip, adult goldfish are anesthetized with MS-222, and the tag is injected into the dorsal trunk region. After injection of the microchip, the fish should be monitored until the injection site fully recovers; to prevent infection, the site of injection should be treated with povidone iodine cream.

8.1.4

Sexing in Spawning Season

By visual and manual inspection of cloaca, pectoral fins, and opercula, adult males and females can be distinguished from one another in the several weeks before spawning season (approximately February to March, in Taiwan) (Fig. 3.3); there is also a chance that eggs may be observable through the body wall of transparent goldfish, as shown in Fig. 8.2c.

8.1 Parents

253

Fig. 8.3 Tools and methods for identification of individuals. (a) The 1.5-L tanks are contained in an incubator. (b–c) Lateral views of wild-type goldfish with different color variations are shown. Color combinations on paired fins and lateral side of trunk allow these individuals to be distinguished. The black asterisk indicates a 1.5-mL tube for DNA sample collection. Scales or cut fin tissue can be collected into the tube. (e) Ventral view of Oranda strain. The black arrow indicates the resected fin. This individual has recovered its pectoral fin. (f) An IC-tag reader (the red instrument), an IC-tag injector (needle and syringe), and a micro-IC-tag indicated by asterisk. (Photographed by the author)

Due to a low volume of sperm, which is not visible in some cases, small males are often misidentified as females. To avoid mixing of misidentified males and females, individuals with ambiguous sex should be kept individually in different tanks (Fig. 8.4). These ambiguous individuals can then be inspected again after 1 or 2 weeks.

254

8

Experimental Notes

Fig. 8.4 Sorting of goldfish in the spring season. (a) Goldfish in 200-L tanks are retrieved for identification of males and females. (b) Identification of males and females is accomplished by visual and manual inspection. (Photographed by the author)

8.2

Live Feed

Commercially available dry pellet feeds may be purchased for maintenance of late juvenile and adult progenies. However, live planktonic feeds (paramecia and brine shrimp) are preferable for early stage larvae. Since live planktonic feed should be prepared before the embryos hatch out and exhibit active feeding behavior (Fig. 8.5), the equipment and settings for maintaining the feed should be checked and confirmed before spawning season. In particular, the cultivation of paramecia should be started 1or 2 months before conducting artificial fertilizations to ensure a stable supply for feeding of larvae. Although the goldfish larvae can be raised without paramecia, it is empirically known that a paramecium-based diet makes rearing larvae easy, since the organisms can survive in the freshwater. Live paramecia can be maintained in a 20-L bottle with fresh water and “Aojiru” powder, which is a Japanese vegetable drink mix (green drink or green juice) (Fig. 8.6a–d). A teaspoon of Aojiru powder should be mixed in tap water and incubated at room temperature until the water becomes opaque with blooming bacteria. The “seed” paramecia, which can be obtained from a zebrafish core facility or some other research division, should then be placed into the opaque water. The water containing paramecia can be directly poured into the aquarium tank for larval and juvenile maintenance. Although the goldfish larvae and juveniles can survive under low-oxygen environments, the density of paramecia should be monitored and controlled. If the surface of the water in the aquarium tank becomes covered by a biofilm, the amount of the paramecia-containing Aojiru poured into the tank should be reduced. To avoid a shortage of paramecia, multiple large containers should be used. In our laboratory, two 20-L tanks are used for maintenance of paramecia. To prepare feed for older goldfish, brine shrimp eggs can be hatched in 2- to 3-L of

8.3 Artificial Fertilization

255

Fig. 8.5 Photographs of goldfish larvae preying on live food. (a–c) Sequential photographs of the dorsal view of Psb stage larvae. White arrowheads indicate a paramecium that was consumed. (d–f) Sequential photographs of lateral view of Cr stage larvae. White arrows show a brine shrimp that was eaten. (These photos are derivatives of “Paramecium and goldfish larvae” and “Goldfish larvae and brine shrimps in the 3 L tank” by Laboratory of Aquatic Zoology used under CC BY 3.0)

bottles containing natural or artificial seawater. The hatched brine shrimp larvae can then be used to feed the goldfish (Fig. 8.6e). Since the brine shrimp cannot survive long in fresh water, the amount of feed should be properly adjusted based on the number of goldfish larvae.

8.3

Artificial Fertilization

Although goldfish spontaneously spawn in aquarium tanks and natural ponds, the use of hormonal stimulation can facilitate developmental biology experiments. In fact, all of the fertilized eggs used in our experiments were generated using hormonal stimulation and artificial insemination with dry methods in our laboratory. The brief procedure for artificial fertilization is as follows: (a) hormone injection one day (12–16 h) before artificial insemination, (b) sperm and egg collection, and (c) artificial insemination. The detailed procedures are described in the section below.

8.3.1

Preparation of Parent Fish

In the early part of the spawning season (March to April), goldfish show mating behavior. Mature males can be distinguished from females by checking the cloaca

256

8

Experimental Notes

Fig. 8.6 Tools for maintenance of paramecium and brine shrimps. (a) 20-L tanks for paramecium maintenance and green juice powder (indicated by the white asterisk). (b–d) Procedure for preparing the green juice solution. (e) Brine shrimp hatching container (approximately 1 L). (Panels a–d are derivatives of “Feeding for Paramecium” by Laboratory of Aquatic Zoology used under CC BY 3.0)

and breeding tubercles (Fig. 3.3). Breeding tubercles can sometimes be observed on opercular and pectoral fins, and the texture of the surface is evidently different between mature males and females. At this point, male and female individuals should be separated to avoid unregulated spawning before the experimental work begins. After separating the fish into different tanks, the degree of maturation in the females should be evaluated by manual inspection. Females with soft abdomens are appropriate for hormonal stimulation.

8.3.2

Hormone Stimulation

One day before artificial fertilization, the maturation state of male and female adults should be confirmed by manual and visual inspection. Gentle pressure to both sides of a well-matured male abdomen will cause sperm to leak from the cloaca. Similarly, gentle touch to the female ventral and/or lateral side abdomen will allow an observer to assess the maturation of the fish. Well-matured female abdomens are quite soft;

8.3 Artificial Fertilization

257

occasionally several eggs will leak from the cloaca upon gentle touch. These mature females should be separated from immature females for subsequent hormone treatment. Ovaprim (Syndel, USA), which contains a synthetic peptide analog of salmon gonadotropin-releasing hormone, is injected into goldfish adults to stimulate sperm production in males and induce spawning in females. Although well-matured males usually produce some sperm without hormone stimulation, the hormonal stimulation increases the amount of sperm, to ensure sufficient sperm is routinely available for the artificial fertilization. If the sperm from an individual male is to be used for multiple artificial fertilizations, hormonal stimulation is strongly recommended. Before the hormone is injected, goldfish should be lightly anesthetized with MS222 to prevent sudden movements. After the movement of goldfish is obviously slowed, the fish body can be held gently, and a needle can be carefully inserted in the abdomen cavity from the ventrolateral side of the body at a level near the posterior part of the pelvic fin; the hormone should then be injected slowly. If the plunger can be pressed smoothly, the injection is most likely successful. However, if strong pressure is required to inject the reagent, the placement of the needle tip might be incorrect. In this case, the position of the inserted needle should be changed; injection to the wrong site (requiring strong pressure on the plunger) may cause significant stress to the goldfish and possibly lethality. After injection with Ovaprim, the males and females should be separately maintained in different tanks with clean fresh water (clean aquarium tank water or water that has been dechlorinated with bubbling or sodium thiosulfate). Empirically, we have found that maintaining the fish in clean fresh water (low salinity) at this time most effectively stimulates spawning. Presumably, this effect of low salinity water is related to natural spawning conditions. Goldfish tend to spawn from April to June, when the salinity of their natural habitats will often be reduced by meltwater and/or rain water. Moreover, bacterial infection at the needle injection site can be prevented by keeping the fish in newly prepared water. Most of the hormone-injected females are ready to spawn about 12–16 h after Ovaprim injection. Thus, a female injected at 18:00 (6:00 PM) is likely to spawn at 06:00–10:00 (6:00 to 10:00 AM) on the following day.

8.3.3

Preservation of Sperm

On the morning of artificial fertilization, sperm are collected from hormone-injected males. After light anesthetization with MS222, the cloaca is examined. Gentle bilateral pressure to the male abdomen will cause sperm to leak from the cloaca, and subsequently, the leaked sperm on cloaca can be collected with a 25G needle on a 1-mL syringe containing 0.2–0.5 mL Modified Kurokura’s extender (Magyary et al. 1996) (Fig. 8.7a–d). Before the collection of sperm, the entire body of the male individual should be gently wiped with a soft paper towel to avoid water entering the syringe (Fig. 8.7b). The optimal ratio of sperm to Modified Kurokura’s extender is

258

8

Experimental Notes

Fig. 8.7 Procedure for sperm collection. (a) Lightly anesthetized goldfish male. (b) Posterior ventral view of goldfish. Cloaca region is wiped with soft paper towel. The black asterisk indicates cloaca. (c) Sperm is collected by needle with syringe. (d) Collected sperm is mixed with Kurokura extender 2. (e–h) Procedure to prepare sperm samples for checking activity under the microscope. The boundary between sperm and water (indicated by white asterisk, panel h) is observed under the microscope. White arrows indicate sperm samples. White arrowhead indicates a drop of water. (Photographed by the author)

1:9. The sperm in the syringe can be preserved for 1 or 2 days at 4
C; however, it is recommended that the sperm be used on the day of collection. To identify the male used for sperm collection, we keep the individual in an isolated tank with a numerical code, and the syringe containing sperm from this individual is labeled with the same code (Fig. 8.7d). To increase the success rate of the artificial fertilization, the quality of sperm should be confirmed under a microscope. An aliquot of preserved sperm sample dissolved in Kurokura’s extender can be dropped onto a glass slide. Fresh water is then added to the sperm sample, and the drop is covered with cover glass, after which the sample can be observed under the microscope (Fig. 8.7e–h). If actively moving

8.3 Artificial Fertilization

259

sperm are observed under the microscope, the preserved sperm sample is suitable for use. If preserved sperm are not active or show low activity, the sperm should not be used for the artificial fertilization.

8.3.4

A Note on Over-matured Eggs

To avoid the use of over-matured eggs, the spawned eggs should be carefully examined. Eggs that are healthy and suitable for artificial fertilization show strong adhesiveness; the adhesiveness of eggs is one of the best indexes of whether the female and its eggs are suitable for artificial fertilization. On the other hand, overmature goldfish females tend to spawn eggs that show little adhesion. Since these eggs frequently cannot be fertilized or do not develop properly, over-mature eggs should not be used for experimental work. As an additional index for the inspection of eggs, the color can also be used. Usually, the color of yolks ranges from greenish to yellowish, although it depends on the nutritional status and some individuals spawn eggs with different degrees of maturation (Fig. 8.8). Empirically, we see that greenish color eggs are better than yellowish color eggs, in terms of the hatching ratio. Moreover, it is likely that white opaque eggs, which do not attach to the surface of the dish, are over-matured eggs. According to a study on common carp by Davies and Hanyu (1986), eggs showing pale opaque color are atretic, resorbing, and residual eggs. These eggs should not be used for artificial fertilization.

8.3.5

Dry Method of Insemination

On laboratory bench or other suitable experimental station, polystyrene petri dishes, a polytetrafluoroethylene (PFTE; 6.5 cm in diameter) plastic disc, and the syringe with collected sperm (see Fig. 8.7) should be set out (Fig. 8.9a). Then the female should be lightly anesthetized with MS222, and its body should be wiped by soft texture paper towel before squeezing eggs; wiping the fish will prevent accumulation of fresh water on the PFTE disc and/or contact with eggs (Fig. 8.9b). Eggs are then squeezed from the female onto the PFTE plastic disc; the use of PFTE plastic will prevent significant loss of viable eggs by adhesion to the disc (Fig. 8.9c). A drop of the diluted sperm is then added onto the eggs on the PFTE disc. One or two drops of diluted sperm should be sufficient for the volume of squeezed eggs shown in Fig. 8.9. After adding the diluted sperm, the eggs and sperm should be mixed well by horizontal shaking of the PFTE disc. Although the amount of squeezed eggs depends on the size and condition of the female, a drop of eggs 1–3 cm in diameter should be expected. The well-mixed sperm and eggs are then placed in a 9-cm polystyrene dish containing tap water, one egg at a time (Fig. 8.9e). Before eggs sink to the bottom

260

8

Experimental Notes

Fig. 8.8 Goldfish eggs with different colors. Yellowish color eggs are extruded first (a), followed by greenish color eggs (b). (c) Yellowish (left) and green (right) color eggs. Yellowish eggs tend to show lower hatching rates due to over-maturation. (Photographed by the author)

of the dish, the water in the dish should be gently agitated by shaking the dish (Fig. 8.9f). A suitable number of eggs in one 9-cm polystyrene dish is less than 100. Small numbers of eggs in one dish are recommended to avoid delays in embryonic development. Too high an egg density will cause agglomeration of multiple eggs. These agglomerated eggs will exhibit delayed development and malformations of the resulting larvae. To prevent high density of eggs in a dish, the number of eggs should be carefully controlled when placing the eggs on the 9-cm polystyrene dishes (Fig. 8.9e). After the mixture of eggs and sperm contacts the fresh water, fertilization will occur.

8.3 Artificial Fertilization

261

Fig. 8.9 Procedure for artificial fertilization. (a) Setting a laboratory bench for artificial fertilization. (b) Wiping goldfish body. (c) Squishing goldfish eggs. (d) Adding the sperm from the syringe to eggs. (e) Dropping eggs to 9-cm petri dish with water. (f) Shaking the 9-cm dish with eggs and water. (Panels a–f are derivatives of “Goldfish Artificial Fertilization for Developmental Biology: 4min ver.” by Laboratory of Aquatic Zoology used under CC BY 3.0)

8.3.6

Blocking of the Bottom of the Polystyrene Plastic Dish (Optional)

Strong adhesion of goldfish eggs to the petri dish will impede the ability of an observer to change the orientation of the egg/embryo for observation and photography. Adhesion is especially problematic for experimental work that requires removal and harvesting of embryos (embryonic histology, in situ hybridization, etc.). Therefore, it is highly recommended that the bottom of the polystyrene plastic dish should be treated with green tea beverage (we use a green tea beverage called Cha-Li-Wang; Uni-President Corp., Taiwan) (Fig. 8.10). The treatment should be performed as follows: (a) Pour the green tea beverage into the polystyrene plastic dish. (b) Remove the green tea beverage from the polystyrene dish; the green tea beverage

262

8

Experimental Notes

Fig. 8.10 Blocking the bottom of plastic petri dish. (a) Pour the green tea drink into a petri dish. (b) Rinse the petri dish with tap water. (Photographed by the author)

can be transferred from the blocked dish to a fresh untreated dish more than ten times. (c) Briefly wash the bottom of the polystyrene dish with tap water.

8.3.7

Washing Fertilized Eggs

Five minutes after eggs contact the water, pervitelline space will appear (Fig. 4.4). After the appearance of pervitelline space, the eggs can be washed with running tap water. Because of this strong adhesiveness of goldfish eggs, the eggs will not detach from the bottom of the plastic dish, even under a mild stream of tap water. This simple washing method will remove any remaining sperm and other contaminants, increasing the survival rate of the eggs and maximizing the material available for embryological studies (for example, histology and analyses of gene expression patterns). If sterilization is required, fertilized goldfish eggs can be bleached with 0.005% sodium hypochlorite for 10 min, followed by neutralization with 0.5% sodium thiosulfate solution for 1–2 s, and rinsing with tap water (Fig. 8.11). This sterilization method reduces the risk of contamination of aquarium systems by pathogens from goldfish progenies.

8.4 Embryo and Juvenile Nursery

263

Fig. 8.11 Washing eggs on the petri dish. After treating eggs with sodium hypochlorite, the solution should be neutralized with sodium thiosulfate, and eggs should be rinsed with running tap water. (Photographed by the author)

Fig. 8.12 Incubation of goldfish embryos. (a) Distant view of the inside of an incubator. (b) Close-up view of the inside of the incubator. (c) Petri dishes with embryos in the incubator. (Photographed by the author)

8.4 8.4.1

Embryo and Juvenile Nursery Incubation Condition

In our work, fertilized eggs are maintained at 24
C until embryos reach the desired stage (Fig. 8.12). Although the embryos can be incubated at higher or lower

264

8

Experimental Notes

temperatures (for example, 20 or 28
C), incubation at a constant temperature of 24
C allows one to easily estimate the rate of the embryonic and larval development, in accordance with the goldfish embryonic and post-embryonic staging tables that were established using the 24
C condition (Tsai et al. 2013; Li et al. 2015; also see Chaps. 4 and 5). Moreover, a temperature of 24
C can be maintained relatively easily in a conventional laboratory room with an air conditioner, so the fertilized eggs can be maintained without need of an incubator, as shown in Fig. 8.12. Nevertheless, monitoring the water temperature is important for accurately estimating the timing of expected developmental stages.

8.4.2

Counting Live and Dead Eggs

The quality and health of the egg and embryo batches can be measured by counting those that are surviving or dead. To facilitate counting, the embryos on the dish can be photographed (Fig. 8.13a). Since dead eggs show a white color, they can be easily identified on a black background (Fig. 8.13b). If more than half of the embryos in a clutch of eggs are dead on the first or second day, the fertilized eggs were probably low quality, and most of the embryos will be expected to die before hatching. Such low-quality fertilized eggs presumably result from sperm that are insufficiently active and/or over-maturation of the eggs. Even though some of the individuals may hatch out from low-quality batches, the resultant larvae will often show unhealthy phenotypes. Thus, a low-quality clutch of fertilized eggs is not suitable for harvesting healthy goldfish embryonic materials. Although embryos of some strains tend to show severe phenotypes and high mortality, the conventional singletail common goldfish and representative twin-tail morphotype goldfish strains (Oranda and Ryukin) have high survival rates; in fact, more than half of the fertilized eggs are expected to eventually hatch out. At the first day post fertilization (dpf), pigmented tissues are observed in the embryos, and the appearance of these pigmented tissues can be used as an index to distinguish whether the developmental

Fig. 8.13 Recording embryonic survival rate. (a) Photographing a dish with goldfish embryos. (b) Goldfish embryos with black paper background. Dead eggs show whitish color. (c) Goldfish embryos on the white paper background. Embryos with black pigments can be recognized relatively easily. (Images courtesy of Ing-Jia Li)

8.4 Embryo and Juvenile Nursery

265

process is proceeding as expected. The pigmented embryos can be best distinguished from non-pigmented embryos against a white background (Fig. 8.13c). By photographing the dishes from 0 to 4 dpf (goldfish hatch out at 4 dpf) against both white and black backgrounds, the daily change in mortality and pigmentation can be recorded (Fig. 8.13c).

8.4.3

Maintenance of Larvae

At 3 or 4 dpf, most of the goldfish will hatch out and stay at the bottom of the plastic dish. For ease of maintenance, the hatched larvae should be moved to a small beaker (approximately 250 mL) or small tank (approximately 1.5 or 3 L) containing fresh water and paramecia (Fig. 8.14a–c). Since early stage larvae have yolks, only a small amount of paramecium culture is sufficient for feeding. However, it should be noted that the developmental process is not completely synchronized, and feeding may be required for some larvae but not for all. To avoid severe water contamination, pellet and brine shrimp diets are not recommended for larvae at this stage (prot). After a larva becomes equipped with a swim bladder, it will actively swim at the surface or middle of the tank. At this timing (Psb stage), brine shrimp can be used as a feed. Although Psb stage larvae can actively catch brine shrimp, it is recommended that the paramecia are also fed to the fish in order to minimize the risk of starvation. Moreover, to avoid starvation, the algae covering the surface of the aquarium tank are available to eat; algae can be left on the surface of one to three side(s) of the aquarium for goldfish to eat. With only algae on the aquarium wall and paramecia, the early goldfish larvae (prot to Psb) can survive around 2 days under the low density conditions (for example, less than 20 individuals in a 3-L tank). Although goldfish larvae can develop in a small tank, there are several inconveniences related to daily maintenance, especially with regard to water quality control. To avoid water contamination, a limited amount of food can be provided to larvae, and frequent exchange of the water in the tank is also required. Moreover, the density of goldfish larvae has to be kept low; otherwise, a high density of goldfish will cause a slow growth rate. Thus, once larvae achieve the Psb stage, they must be moved to larger tanks or separated into multiple tanks. In our laboratory, almost all goldfish larvae are moved to an overflow aquarium system, which is typically used for zebrafish mutagenesis studies (as introduced in Mullins et al. 1994). The quality of water in the aquarium system is automatically maintained at a conductivity of 200–300μS/cm, pH 6.5–7.5, and temperature of 24–26
C (Fig. 8.14c). Progenies are kept in this system from the Psb stage to the juvenile stage. During the stages when larvae are small (from Psb to Asb; less than ~6 mm standard length), the amount of input water should be kept as low as possible. Moreover, the tank should be divided, and the overflow hole from the major part of the tank should be segregated by a fish divider with small holes or fine mesh, to prevent escape of the larvae from the tank (Fig. 8.14b). Under these conditions, goldfish can grow to a juvenile stage within 2 months. However, it should be noted

266

8

Experimental Notes

Fig. 8.14 Containers for maintenance of larvae and juveniles. (a) Beakers (250 mL) are shown. (b) Tanks (1.5 L) with overflow hole. Separators are indicated with white asterisks. (c) Larger 3-L and 10-L tanks in the overflow circulation system. (Panel a is derivative of “Goldfish larvae and brine shrimps in beakers” by Laboratory of Aquatic Zoology used under CC BY 3.0)

that the density of the goldfish influences the development rate. It is recommended that the number of goldfish larvae be maintained at less than 40 individuals in a 3-L tank.

8.4 Embryo and Juvenile Nursery

8.4.4

267

Growth of Goldfish as Next Generation Parents

Juveniles must be moved from the overflow aquarium system to larger aquarium tanks for their development into mature adult fish. In our experience, we have found that 50-L to 200-L tanks are required for 20–50 early to late juveniles (Fig. 8.15a–d).

Fig. 8.15 Aquarium tanks for juvenile and adult goldfish. (a) 50-L tanks with circulation system. (b) 200-L tanks. (c) 200-L tanks covered by nets. (d) Lids for 200-L tanks. To prevent lids from being blown away, weights are put on top. (e) 4000-L tank. (f) Nets covering 4000-L tanks. (Images on panels a–f are photographed by the author and the lab members)

268

8

Experimental Notes

The 200-L tank can also be used to raise juveniles to adults. However, the number of adult individuals in a single tank should be reduced to around 20–30 individuals. For raising 200 or more juveniles to the adult stage, 4000-L tanks are used in our aquarium facility (Fig. 8.15e, f). The location of the aquarium tank also has a large influence on whether the goldfish are able to spawn during the next year. Empirically, it is known that goldfish adults maintained inside a laboratory with constant temperature control do not achieve sexual maturity, presumably because the seasonal changes in temperature and light are required for sexual maturation. In order to induce the sexual maturation of goldfish, it is recommended that the aquarium tank be located in an outdoor or semi-outdoor space (Fig. 8.15b–f). The aquarium setting should be covered by a roof to avoid extreme changes in water quality and temperature produced by direct sunlight or entry of rain water into the aquarium environment (Fig. 8.15f). To avoid attack by predators, it is also highly recommended that tanks be protected by a net or lid (Fig. 8.15b–d, f). Moreover, in the event of a typhoon, the lid should be secured by a weight and clamp before the typhoon arrives. This action will prevent the lid from being blown off and causing secondary accidents (Fig. 8.15d).

8.5

Conventional Stereomicroscopic Observations

The embryos and larvae of goldfish can be observed by methods similar to those used for zebrafish. In fact, most of the microscopic methods applied to goldfish were based on methods developed by zebrafish researchers (Kimmel et al. 1995, 2007, 2010; Parichy et al. 2009). Although the basic principles of the methods are the same, some aspects of the zebrafish methods were modified and optimized for goldfish research. Here, I mainly focus on methods for light and fluorescence observations of skeletal systems.

8.5.1

Detaching Eggs from the Dish and Dechorinoization

For handing goldfish embryos, fertilized eggs should be removed from the plastic dish. Although the adhesion of the chorion to the dish can be reduced by treating the plastic surface with tea beverage, mechanical force applied using a tungsten loop with handle is still required to detach goldfish eggs from the plastic dish (Fig. 8.16a). By using the tungsten loop like a shaving razor or plane to scrape the surface, fertilized eggs can be detached from the plastic dish. The detached eggs can then be treated with pronase solution (1 mg/mL) to enable removal of the chorion. To do so, eggs with chorion are placed into a dish with pronase solution and incubated for 15–30 min. Although this procedure is quite similar to the dechorinozation method for zebrafish eggs, it is recommended that the

8.5 Conventional Stereomicroscopic Observations

269

Fig. 8.16 Tungsten loop with handle. This tool is used for detaching embryos on plastic dishes. (Photographed by the author)

condition of the chorion and embryos be monitored under the stereoscope. When the surface shape of the chorion changes to resemble a slightly deflated balloon, the eggs should be moved onto an agarose-coated plate with E3 buffer (see also Westerfield

270

8

Experimental Notes

2007; Kaufman et al. 2009). Once the chorion is sufficiently affected by the pronase solution, it can be mechanically removed by gentle pipetting with a Pasteur pipette. At stages prior to the pharyngeal stage, embryos themselves will also adhere to the bottom of a polystyrene dish. We have observed that this adhesion tends to reduce the survival rate of the goldfish embryos. Thus, the dish containing early stage embryos also should be treated with tea beverage. The detached and dechorionized embryos can be incubated in E3 buffer until 3–4 dpf. After 3–4 dpf, the E3 water can be exchanged for fresh water in a fish tank.

8.5.2

Light Microscopic Observation of Live Embryos, Larvae, and Juveniles

For observation of live animals, embryonic and early larval stage goldfish are anesthetized with MS222. Suitable concentrations of MS222 for embryos and larvae depend on the condition of the fish and environmental temperature. To avoid an accidental overdose of MS222, embryos and larvae should be monitored under the microscope after adding one to five drops of MS222 stock solution (2.5 mg/mL) into a 5.5-cm or 9-cm dish filled to half its volume with water. Prior to treatment, the stock solution of MS222 should be adjusted to neutral pH. Otherwise, the fin fold and some other surface tissues may be damaged by the low pH. To orient embryos and larvae for observation, low melting temperature agarose is used. Live anesthetized embryos are placed in a 3.5-cm dish and molded into 0.5% agarose; see also Parichy et al. (2009). After being fixed in agarose, the molded embryo can be photographed from the bottom side of dish. Larger larvae and juveniles are handled with the tip of a fine fishing line and positioned on the agarose plate within a V-shaped trench (Fig. 8.17a); this trench allows an observer to position the fish for photography from lateral, dorsal, and ventral views and can be made using a V-shaped plastic sheet. To prepare the trench, a plastic folder is bent into a V-shape to create a mold (Fig. 8.17b). Moreover, the handling tool with the fine fishing line can be made from the combination of “4go fish line” (approximately equivalent to 16 lb line), a bamboo stick (such as a chopstick), and a pipette tip (Fig. 8.17c).

8.5.3

Observation of Skeletons

Calcein staining can be used to observe the skeletal features of intact early stage goldfish larvae (from proto to Ar stages). Larvae specimens are maintained in 0.1% calcein solution for 5–20 min, followed by washing two to three times in fresh fish water, anesthetization with MS222, and mounting in 0.5% low-melt agarose. The skeletons can then be observed under a fluorescence microscope system (Szx16 with

8.5 Conventional Stereomicroscopic Observations

271

Fig. 8.17 Photographing larvae and juveniles. (a) Setup of the microscope system. (b) Petri dish with V-shaped trench agar. (c) Fishing line attached to a bamboo stick with plastic pipette tip. A plastic sheet is used as a mold to make the V-shaped trench. (Photographed by the author)

DP80). Since brine shrimp tend to emit strong auto-fluorescence, feeding with brine shrimp should be avoided for 3–6 h before photography. The duration of the incubation in calcein solution and number of washes depends on the size and stage of the goldfish. Thus, it is recommended that calcein-stained goldfish larvae are checked under the fluorescence microscope before mounting in agarose. Alizarin red staining is suitable for imaging the skeletons of fixed goldfish larvae and is applicable for wide range of developmental stages (Cr to adult stage specimens). For the fixation, 4% PFA is recommended, since tissues fixed with 4% PFA can be used for both observations of the skeleton and also genotyping. One day after fixation, the specimen is washed with 70% ethanol overnight. The washed specimen is then stained with alizarin red solution (0.1% alizarin red in 95% ethanol), followed by washing with 70% ethanol to reduce background.

272

8

Experimental Notes

For observation of skeletal systems on the surface of body, alizarin red-stained specimens (opaque samples) are directly used for microscopic observation. In order to observe the skeleton inside the fish, the opaque samples must be processed with clearing reagents. In our studies, we mainly use ScaleA2 (Hama et al. 2011) for this purpose. Specimens cleared by ScaleA2 are then immersed in a 30–60% glycerol solution. The skeletons of alizarin red-stained samples can be observed either under a fluorescence microscope or a light microscope.

8.6 8.6.1

Conventional Histological Observation Fixation Process

For conventional histological observations, goldfish embryos, larvae, and juvenile specimens are anesthetized with MS222 and fixed using Bouin’s fixative. Before fixation of the embryos, the chorion should be removed. The larvae should not be fed for about 6 h before fixation. After fixing the samples overnight, the Bouin’s fixative is exchanged with 70% ethanol and preserved. It is recommended that the fixed embryos and larvae are photographed for later identification and referencing of the sectioned level.

8.6.2

Paraffin Embedding and Sectioning

The fixed samples are immersed in 80% ethanol and stained with eosin solution (0.25–1% in 80% ethanol) for 1–2 s. This brief staining can help workers locate the samples after paraffin embedding, as red-colored samples are easily recognized against the white paraffin background. The eosin-stained samples are dehydrated through an ethanol series; the samples are immersed in 80%, 90%, 95%, and 99.5% ethanol for 10–30 min, and 100% ethanol for 1–5 min. The ethanol-dehydrated samples are then immersed in methyl benzoate (30 min; two to three times) and xylene (30 min; two to three times). After xylene immersion, the samples are encased in melted paraffin at 60–65
C (30 min; three times) and embedded into a paraffin block upon cooling. The paraffin-embedded samples are trimmed according to careful visual inspection of the orientation and location of the samples, placed on a paraffin block holder, and sectioned to 5 μm using a microtome (RM2245, Leica).

8.6.3

Staining and Identification of Sectioned Level

The sectioned tissues may be stained with hematoxylin (Sigma MHS32) and eosin (Sigma AL-318906). Optionally, alcian blue (Sigma A5268) can be used to stain late

8.7 Genotyping Analysis

273

stage embryos (after pharyngeal stage) and larvae. The stained samples may then be observed under a standard microscope (BX43, Olympus). The levels of serial sections from early stage embryos (before segmentation stage) can be identified by the size and relative positional relationship of yolk, yolk syncytial layer and blastoderm; these three tissues exhibit obviously different staining patterns. The notochord, neural tube, pigmented cells, cloaca, anterior end of the median fin fold, paired fins, and the undigested brine shrimp eggs can be used as landmarks to determine levels of sections from later stage embryos and larvae.

8.7 8.7.1

Genotyping Analysis DNA Extraction

There are several DNA extraction methods that can be used depending on the research purpose. To prepare highly purified DNA samples for next-generation sequencing, it is recommended that DNA be isolated from tissues derived from live fish samples. Blood cells and fins are available for DNA extraction at late developmental stages (from juvenile to adult); these cells and tissues may be acquired from live fish without sacrificing the animals. If the fish can be sacrificed, the muscle tissues of adults are also available. It is recommended that the blood cells and muscle tissues to be used for next-generation sequencing should be preserved 80
C to prevent degradation of DNA. On the other hand, for PCR-based genotyping, it is sufficient to obtain a small amount of crude DNA from fins and scales of live or fixed samples (see Sect. 8.1.3). Larval and embryonic samples are also available for DNA isolation. Since these samples are relatively small, it is difficult to acquire a tissue sample without sacrificing the individual. After fixing the specimen, handling is easier. If phenotypes of larvae and embryos will be examined, larvae and embryos can be fixed in ethanol or 4% PFA. The latter preserves morphological features but long-term preservation in PFA is not recommended; a detailed fixation procedure is given in Sect. 8.5.3. Isolated tissues can be directly used for DNA extraction and/or preserved in TNES-urea buffer for more than 1 year at room temperature. The TNES-urea buffer allows for long-term preservation (Asahida et al. 1996), and the TNES-urea preserved tissues can be used for DNA extraction with phenol/chloroform or a commercial DNA extraction kit.

274

8.7.2

8

Experimental Notes

PCR-Based Genotyping of the Twin-Tail Gene (chdSE127X)

The gene responsible for twin-tail morphology is known to be chdS, and its nucleotide sequence has been determined. Therefore, the genotype of the locus can be examined by a simple PCR-based method, as follows: Using chda-f5 (TAACGCACAGATGCAGACGTGTG) and chd-r5 primers (TGCTGTTCTCCTCAGAGCTGATGTAGG) and a three-step PCR (20 s, 95
C; 20 s, 55
C; 20 s, 72
C; 30–35 cycles), a PCR fragment can be amplified. The amplified DNA fragments are digested by AvaI restriction enzyme and run on a 1.0–2.0% TAE gel. Since the stop codon site (E127X) is incorporated into the AvaI site, the digested amplified fragment of the chdSE127X/E127X individuals will show band patterns of one long (~300 bp) and one short (~100 bp) bands; undigested bands representing the wild-type allele will appear at around 400 bp.

8.8

Analysis of Gene Expression Patterns

In order to better understand how the developmental process was modified by certain alleles, gene expression patterns may be determined using in situ hybridization. Although the basic procedure of in situ hybridization for goldfish is quite similar to in situ hybridization in the zebrafish (Schulte-Merker et al. 1992), the method described below was optimized for goldfish embryos.

8.8.1

Complementary DNA (cDNA) Cloning and Sequence

Total RNA is extracted from embryonic samples using TRIzol Reagent (Ambion), and cDNA is synthesized using the GeneRacer kit (Invitrogen), according to the manufacturers’ protocols. Specific PCR primers can be designed from sequences in publicly available databases. PCR fragments are amplified using KOD-Plus-DNA polymerase (TOYOBO, Japan), ligated into vectors using a TOPO TA Cloning Kit Dual Promoter (Invitrogen), T&A Cloning Vector Kit (Yeastern Biotech), or PGEM-T Easy Vector system (Promega). The resulting vectors are then transformed into Escherichia coli (DH5α strain). At least 12 clones are selected from the transformed population for sequencing. The sequences of cDNA fragments are then used as a backbone to obtain almost complete gene sequences (containing 50 and 30 UTR regions) with specific primers and the GeneRacer kit (Invitrogen). The isolated genes are examined by generating multiple amino acid and nucleotide sequence alignments of genes in goldfish and common carp, and orthologous genes of zebrafish. The phylogenetic relationship of

8.8 Analysis of Gene Expression Patterns

275

the isolated gene with the other genes is investigated by constructing a phylogenetic tree.

8.8.2

Digoxigenin (DIG)-Labeled Antisense RNA Probe Synthetize

The vector containing an isolated cDNA clone can be used for the synthesis of digoxigenin-labeled antisense RNA probes, using the SP6T7 RNA polymerase Riboprobe Combination System (Promega), according to the manufacturer’s instructions. To avoid non-specific hybridization resulting from highly similar paralogues, it is recommended that the 50 or 30 UTR region be used for the template; these regions tend to contain ortholog-specific sequences and seem to exhibit high specificity of hybridization. A suitable length for the PCR product is between 300 and 1000 bp. The synthetized probe can be purified using mini-Quick Spin RNA Columns (Roche).

8.8.3

Harvesting and Fixation of Samples

Embryos on a dish may be incubated at 24
C until the desired stage and removed from the bottom of the plastic dish with a tungsten loop (Fig. 8.16). Early goldfish embryos (gastrula stage) should be fixed with 4% PFA in PBS overnight. The PFA-fixed embryos are then dechorionized using forceps, dehydrated through a methanol series, and preserved in 100% methanol at 20
C. The later stage embryos (after the bud stage) can be dechorionized with pronase, fixed with 4% PFA, dehydrated with methanol, and preserved at 20
C.

8.8.4

Hybridization, Detection of Signals, and Image Acquisition

Dehydrated embryos are re-hydrated with PBT and re-fixed with 4% paraformaldehyde in PBS. Embryos are then subsequently treated with Proteinase K for 20 min and re-fixed again. Pre-hybridization and hybridization steps are performed at 65
C for periods between 1 h and overnight. The samples are washed sequentially two times with 50% formamide/2 SSCT at 65
C for 30 min, 2 SSCT at 65
C for 15 min, and two final washes with 0.2 SSCT at 65
C for 30 min. The samples are then incubated in blocking solution, consisting of 10% heat-inactivated goat serum (Roche, Germany) and 0.1% Tween20 in PBS, for 1 h, before incubation with a 1:4000–8000 dilution of anti-digoxigenin-AP Fab fragments (Roche, Germany) at

276

8

Experimental Notes

room temperature for 4 h or at 4
C overnight. Samples are then washed four times with blocking solution at room temperature for 25 min each. Signals can be detected using BCIP/NBT Color Development Substrate (Promega). The reaction is stopped by washing samples with 20% methanol in PBS. To ensure an accurate comparison of gene expression levels, the embryos in a single experiment are treated at the same time, under identical conditions. To treat a small number of embryos (around 20 embryos), 2-mL tubes can be used. A large number of eggs (more than 100 eggs) are treated in 60-mL tubes. The above embryos are placed on a 0.5% agarose plate and photographed. To acquire images for quantitative analysis of gene expression patterns, the embryos should all be handled under identical conditions. To minimize bias from lighting, the position and angle of the light source should be adjusted while monitoring the light intensity in the active live image; such monitoring can be accomplished with the line profile function in the cellSense software (Olympus, Tokyo).

8.9 8.9.1

Functional Assays of Genes General Methods for Microinjection

Microinjection of goldfish embryos can be performed using a microinjector (Eppendorf Femtjet; Eppendorf), similar to the procedure for zebrafish (Fig. 8.18a, b). Unlike zebrafish, however, goldfish embryos are strongly attached to the surface of the plastic dish. While this adhesion of goldfish embryos prevents changes to the orientation of the eggs, it also holds the embryos on the surface of plastic dish. Thus, the goldfish embryos can be used for microinjection without first setting the eggs in an agarose plate with a trench. The level of adhesiveness of the chorion is different for each clutch of eggs. If the adhesiveness of the chorion is too strong, the eggs on the plastic dish should be washed with running tap water two or three times or treated with pronase for less than 5 min and then washed with running tap water two or three times. These treatments can help to reduce the adhesiveness of the chorion and facilitate injection with the glass needle. To avoid misidentification of injected and non-injected embryos, the operator should note the locations of embryos. For this purpose, grids or multiple lines are drawn on the bottom of the plastic dish with permanent ink pens (Fig. 8.18c). These drawn lines work as landmarks and help the worker to distinguish between injected and uninjected eggs. A microinjector (Eppendorf Femtojet; Eppendorf, Hamburg, Germany) is used to inject mRNA and/or morpholino (MO) into the yolk. For the microinjection, the MOs or RNAs are diluted into 0.2 M KCl with phenol red (final concentration 0.05%). Although the procedure is still under optimization, this basic technique might be useful for injection of guide RNA and Cas9 nuclear localization sequence (NLS) recombinant endonuclease into eggs for CRISPR/Cas9 genome editing (Fig. 8.18d).

8.9 Functional Assays of Genes Fig. 8.18 Microinjection of goldfish embryos. (a) Setting of a laboratory bench for microinjection. (b) A close-up view of the microscope and glass needle with reagent on ice. (c) Embryos on the plastic dish. A line drawn on the bottom of the petri dish provides a reference for two nearby eggs. The upper embryo was previously injected. (d) The embryo is being injected with reagent using a glass needle. The injected reagents can be seen according to the red color. (Photographed by the author)

277

278

8

Experimental Notes

The diluted reagent is loaded into the glass needle prior to injection. The glass needles are made using a Flaming/Brown Micropipette Puller (P-97; SUTTER INSTRUMENT) with the following conditions: heat ¼ 278, pull ¼ 200, velocity ¼ 150, time ¼ 200. The settings of the Eppendorf Femtojet are as follows; injection pressure (Pi; hPa) ¼ 600–700, injection time (Ti, second) ¼ 2 and constant pressure (Pc, hPa) ¼ 25. Under these pressure settings, the size of the drop is 160μm diameter (approximately 2.15 nL). For a goldfish embryo, 2μL is a suitable volume. This volume allows the worker to visually confirm the success of the injection under a stereomicroscope; the red color of phenol red can be observed in the injected embryos. Uninjected and mis-injected embryos should be discarded. Successfully injected embryos are incubated at 24
C.

8.9.2

Morpholinos

Morpholino reagents are diluted into nuclease-free water; check the instructions for proper volume of nuclease-free water (usually addition of 300μL nuclease-free water to a bottle received from GeneTools will yield 1 mM MO solution). The diluted reagent is aliquoted into working and stock solutions. The working and stock solutions should be kept at 4 and 80
C, respectively. To inject 10 ng/embryo, the reagents are mixed as follows: 0.83μL nuclease-free phenol red solution (0.5%), 0.83μL of 2 M KCl, 5μL MO (1 mM), and 1.64μL nuclease-free water.

8.9.3

Synthesized mRNA

A plasmid construct for in vitro transcription is generated from the coding region of the gene of interest. The coding region is amplified by PCR and cloned into the pCS2 + vector (Rupp et al. 1994). This construct can then be used as a template to synthesize capped mRNA with the mMESSAGE mMACHINE SP6 Kit, according to the manufacturer’s instructions (Ambion). The synthesized mRNA transcripts are purified with Quick Spin Columns and re-suspended in nuclease-free water. To check the quality of the synthetized mRNA, an aliquot should be run on an agarose gel by electrophoresis. The concentration of the stock solution of mRNA is adjusted to 250 ng/μL and stored at 80
C. To inject 100 pg mRNA into a single embryo, the injection mixture (50 pg/μL mRNA solution) is prepared as follows: 1μL nucleasefree phenol red solution (0.5%), 1μL of 2 M KCl, 2μL mRNA (250 ng/μL), and 6μL of nuclease-free water. By injecting 2 nL of the injection mixture into the yolk, a total of 100 pg mRNA is injected into a single embryo.

References

279

References Asahida T, Kobayashi T, Saitoh K, Nakayama I (1996) Tissue preservation and total DNA extraction form fish stored at ambient temperature using buffers containing high concentration of urea. Fish Sci 62(5):727–730. https://doi.org/10.2331/fishsci.62.727 Davies PR, Hanyu I (1986) Effect of temperature and photoperiod on sexual maturation and spawning of the common carp: I. Under conditions of high temperature. Aquaculture 51 (3–4):277–288 Hama H, Kurokawa H, Kawano H, Ando R, Shimogori T, Noda H, Fukami K, Sakaue-Sawano A, Miyawaki A (2011) Scale: a chemical approach for fluorescence imaging and reconstruction of transparent mouse brain. Nat Neurosci 14(11):1481–1488. http://www.nature.com/neuro/ journal/v14/n11/abs/nn.2928.html#supplementary-information Kaufman CK, White RM, Zon L (2009) Chemical genetic screening in the zebrafish embryo. Nat Protoc 4(10):1422. https://doi.org/10.1038/nprot.2009.144 Kimmel CB, Ballard WW, Kimmel SR, Ullmann B, Schilling TF (1995) Stages of embryonic development of the zebrafish. Dev Dyn 203(3):253–310. https://doi.org/10.1002/aja. 1002030302 Kimmel CB, Walker MB, Miller CT (2007) Morphing the hyomandibular skeleton in development and evolution. J Exp Zool B Mol Dev Evol 308B(5):609–624. https://doi.org/10.1002/jez.b. 21155 Kimmel CB, DeLaurier A, Ullmann B, Dowd J, McFadden M (2010) Modes of developmental outgrowth and shaping of a craniofacial bone in zebrafish. PLoS One 5(3):e9475. https://doi. org/10.1371/journal.pone.0009475 Li IJ, Chang CJ, Liu SC, Abe G, Ota KG (2015) Postembryonic staging of wild-type goldfish, with brief reference to skeletal systems. Dev Dyn 244(12):1485–1518. https://doi.org/10.1002/dvdy. 24340 Magyary I, Urbanyi B, Horvath L (1996) Cryopreservation of common carp (Cyprinus carpio L.) sperm II. Optimal conditions for fertilization. J Appl Ichthyol 12(2):117–119 Matsui Y (1934) Genetical studies on gold-fish of Japan. J Imp Fish Inst 30:1–98 Matsui Y, Kumagai T, Betts LC (1972) Pet library goldfish guide. Pet Library Limited, London Mullins MC, Hammerschmidt M, Haffter P, Nusslein-Volhard C (1994) Large-scale mutagenesis in the zebrafish: in search of genes controlling development in a vertebrate. Curr Biol 4 (3):189–202. https://doi.org/10.1016/S0960-9822(00)00048-8 Parichy DM, Elizondo MR, Mills MG, Gordon TN, Engeszer RE (2009) Normal table of postembryonic zebrafish development: staging by externally visible anatomy of the living fish. Dev Dyn 238(12):2975–3015. https://doi.org/10.1002/dvdy.22113 Rupp RA, Snider L, Weintraub H (1994) Xenopus embryos regulate the nuclear localization of XMyoD. Genes Dev 8(11):1311–1323. https://doi.org/10.1101/gad.8.11.1311 Schulte-Merker S, Ho RK, Herrmann BG, Nusslein-Volhard C (1992) The protein product of the zebrafish homologue of the mouse T gene is expressed in nuclei of the germ ring and the notochord of the early embryo. Development 116(4):1021–1032 Smartt J (2001) Goldfish varieties and genetics: handbook for breeders. Wiley, New York Teichfischer B (1994) Goldfische in aller Welt: Haltung, Zuchtformen und Geschichte der ältesten Aquarienfische der Welt. Tetra, Melle Tsai H-Y, Chang M, Liu S-C, Abe G, Ota KG (2013) Embryonic development of goldfish (Carassius auratus): a model for the study of evolutionary change in developmental mechanisms by artificial selection. Dev Dyn 242(11):1262–1283. https://doi.org/10.1002/dvdy.24022 Westerfield M (2007) The zebrafish book: a guide for the laboratory use of zebrafish Danio (“Brachydanio rerio”). University of Oregon, Eugene

Index

A Albino, 60–62 Alleles, 31, 32, 60, 61, 68, 141, 145, 182, 185, 186, 198, 202–205, 207, 209, 215, 230, 233, 234, 240, 274 Allotetraploidization, 19, 24, 25, 30, 33, 141, 191, 194, 195, 226 Amniote, 34 Anal fins, 2, 57–59, 66, 67, 70, 81, 101, 102, 107, 108, 110–118, 128, 129, 132, 133, 148, 151, 156, 158–163, 165, 171, 173, 174, 201, 207 Anguloarticular, 119 Anterior lobe of the swim bladder, 101, 110, 112 Anterior swim bladder (Asb), 81, 102, 111, 148, 151, 180 Apical epithelial ridge, 113, 155 Artificial selection, 10, 11, 13, 33, 34, 50, 137, 138, 184, 186, 187, 191, 192, 198, 202, 207, 208, 215, 232, 235, 236, 239 Autotetraploidization, 24, 226 Axial skeletons, 34, 49, 50, 70, 123, 124, 147, 151, 159, 167, 168, 187, 215

B Bifurcated anal fins, 57, 58, 67, 70, 148, 169, 170, 173, 174, 201 Birds, 12, 33, 34 Blastoderms, 78, 79, 81, 82, 85–88, 139, 142, 273 Blastopore closure (bc), 79, 85–88, 132

Blastula, 76, 78–85, 139, 140, 143, 177, 236 Bmp4, 142–145, 194 Branchiostegal, 119 Breeders, 1, 2, 4, 9–14, 18, 21, 23, 31–34, 45, 47, 50, 52, 53, 57, 59, 62, 67, 68, 70, 137, 138, 184, 188, 191, 192, 198, 203, 206, 208, 211–216, 226, 230–234, 236, 239, 240, 249, 250 Brine shrimps, 105, 254–256, 265, 266, 271, 273 Bubble eyes, 54, 63, 66, 69, 185, 219 Bud, 79, 80, 85–89, 91, 94–96, 98, 139, 140, 142, 148, 155, 177, 194, 275 Butterfly tail, 53, 59

C Carassius, 1, 7–9, 21–24, 48, 50, 64, 226, 230 Carassius auratus (C. auratus), 20–23, 27, 226 Caudal fin rays (Cr), 81, 101, 104, 106, 107, 109, 111, 112, 128, 130–132, 141, 144, 147, 148, 187, 202 Caudal fins, 33, 46, 47, 49, 50, 58, 59, 64, 65, 67–70, 80, 81, 101–105, 107–113, 117, 128–132, 139, 141, 142, 145–148, 150–162, 168–170, 172–177, 185, 186, 192, 194–196, 198, 200–208, 210, 212, 217, 218, 230, 236–238 Celestial, 54, 56, 57, 66, 69, 182, 184, 185, 217 Ceratobranchials, 119 ChdA, 60, 61 ChdL, 142, 145, 193, 194, 196–200, 202–203, 214

© The Author(s), under exclusive license to Springer Nature Singapore Pte Ltd. 2021 K. G. Ota, Goldfish Development and Evolution, https://doi.org/10.1007/978-981-16-0850-6

281

282 ChdS, 60, 61, 141, 142, 145, 167, 185–188, 193, 194, 196–203, 205, 206, 211, 212, 214, 217, 240, 274 Chick, 30 Chordin, 60, 61, 141, 144, 167, 186, 192–199, 202, 203, 206–208, 212, 215, 217, 228, 234, 240 Chromosomes, 23, 24, 61, 226, 236 Cleavage, 76, 78, 79, 81, 84, 139, 143, 177, 203 Cleithlum, 147 Cleithrum, 119, 126 Cloaca, 49, 99, 108, 109, 119, 145, 167, 169, 252, 255–258, 273 Color patterns, 59, 60 Color variations, 9, 12, 13, 228, 236–238, 252, 253 Comet, 54, 56, 59, 64, 69 Common ancestor, 23, 24, 61, 141, 194, 226 Common carp, 7–9, 11, 13, 18, 19, 24–27, 50, 60, 61, 141, 194–197, 199, 200, 203, 214, 226, 259, 274 Common goldfish, 46, 47, 54, 142, 201 Connective tissues, 187, 201 Cooption, 201, 202 Cow, 18 Cranial, 48, 49, 51, 54, 99, 119, 147, 151, 159, 167, 182–186, 217, 218 Cranial skeletons, 49, 119–122, 151, 156, 218 CRISPR/Cas9, 239, 240, 276 Crucian carp, 22, 23, 46 CsJ sub-stage, 118, 126, 128 Culling, 12, 138 Cypriniformes, 18, 49

D Dechorinoization, 268–270 Deep-homology, 202 Developmental biology, 1, 2, 13, 28, 30, 33, 34, 191, 239, 249, 255, 261 Developmental stages, 12, 64, 82, 138, 185, 187, 188, 209, 211, 212, 217, 228, 234–236, 264, 271, 273 DNA, 23, 66, 211, 237, 252, 253, 273–275 Dog, 18 Domed scale, 60, 70 Domesticated animals, 18, 33, 34 Domestications, 1, 2, 4, 5, 7, 9–14, 22, 34, 45, 59, 60, 66, 78, 137, 138, 162, 185, 188, 191, 194, 195, 202, 206–208, 211, 214, 230–233, 235, 237, 239–242

Index Dorsal fin folds, 81, 112, 148, 151, 175, 176, 178–180, 187, 210, 218 Dorsal-finless, 2, 11, 13, 56, 57, 60, 61, 64, 66–68, 70, 78, 138, 141, 179–182, 185, 187, 188, 191, 208–213, 216–218, 230, 234, 236, 240 Dorsal-finless morphotype, 65, 173–182, 186, 187, 208–213, 230 Dorsal fin ray (Dr), 81, 101, 102, 114, 128, 148, 151, 180 Dorsal fins, 57, 64, 66, 67, 69, 70, 81, 107–113, 116–118, 127, 128, 132, 133, 148, 151, 176, 178, 181, 185, 187, 209, 211, 212, 218, 230 Dorsal-ventral patterning, 141, 193–196, 198, 203, 207, 208, 228, 234, 240 Duplication, 24, 26, 30, 141, 196, 198, 201, 225, 226

E Embryogenesis, 28, 35, 140–141, 168, 234, 235 Embryology, 3, 28, 35 Epiboly, 79, 82–88, 209 Eve1, 142, 145, 194 Evodevo, 1, 13, 14, 18, 34, 35, 46, 48, 54, 62, 63, 66, 69, 188, 191–219, 228, 232, 239, 241 Evolution, 1, 2, 11, 13, 24, 30, 33, 34, 61, 66, 191, 196–200, 202, 205, 207, 225, 232, 235–241 Expressivity, 32, 57, 68, 169, 186, 206–209, 212, 214, 228, 233–235 Extracellular matrix, 159

F Fanciers, 1, 13, 14, 21, 23, 32, 33, 47, 50, 52, 53, 59, 62, 68, 70, 137, 138, 184, 188, 191, 192, 208, 211, 214, 215, 226, 230–233, 236, 239, 240, 249, 250 Fin rays, 49, 50, 56, 59, 67, 68, 70, 81, 101, 102, 106, 107, 111–114, 116, 117, 124–132, 147, 148, 151, 156, 157, 160, 161, 187, 217 Forked fin robes (Fcf), 81, 102, 107, 109, 119, 121, 130, 148–151, 154, 159, 163, 166, 167, 170, 181 Functions, 18, 25, 29, 32, 61, 62, 141, 182, 193, 194, 198, 202, 207–209, 214, 226, 228–232, 234, 241, 276

Index G Gastrula, 76, 79, 83, 85–89, 139–141, 143, 177, 194, 236, 275 Genetic codes, 240 Genetics, 1, 4, 5, 8, 11–13, 19, 23, 27, 28, 32, 34, 35, 46–48, 55, 57, 60–63, 66, 113, 137, 182, 187, 188, 192, 194, 196, 198, 206–209, 211–213, 225–229, 232–240, 252 Genome editing, 29, 239–241, 276 Genomes, 23–26, 29, 30, 33, 34, 61, 66, 186, 193, 194, 201, 207, 214, 225, 226, 233, 239–242 Genome wide association study (GWAS), 61–63, 66, 208, 209, 211 Globular body shapes, 2, 55, 56, 145, 148, 186, 215 Gnathostomes, 18, 237 Goldfish, 1–5, 7–14, 17–36, 45–71, 75–133, 137–188, 191–215, 217–219, 225–230, 232–242, 249–255, 257–268, 270–272, 274–278

H Heart-shaped tail, 60, 61 Hermal arches, 151 Heterozygous, 32, 233, 234 Hibuna, 23, 46 Homocercal, 50, 111 Homologous, 24, 25, 63, 64, 71, 200, 202, 226, 230 Homozygous, 31, 32, 61, 141, 145, 182, 230, 234 Hours post fertilization (hpf), 82, 83 Hyoid, 119

I Insemination, 255, 259–260 Interspecific hybridization, 233 Iridophores, 59, 112, 167 IsJ sub-stage, 117, 126, 128, 131

J Jawed vertebrates, 18, 200, 201, 237 Juveniles, 12, 50, 51, 65, 78, 81, 102, 115–120, 125–129, 131–133, 138, 148, 167–175, 180, 182–184, 186, 187, 203, 205, 212, 216, 249, 252, 254, 263–268, 270–273

283 K Kinethmoid bone, 49 Krox20, 143, 145, 193, 194 Kupffer’s vesicle, 140

L Larvae, 10, 76, 97–116, 121, 125–131, 133, 146–149, 151–153, 155–167, 170–177, 179–182, 187, 194, 201, 205, 211, 216, 251, 252, 254, 255, 260, 264–266, 268, 270–273 Lens, 80, 91, 139 Lobe-finned fish, 18 Loci, 32, 54, 60, 68, 145, 185, 211, 215, 233, 234 Locus, 32, 61, 145, 167, 185, 186, 188, 202, 209, 211, 230, 237, 274 Long fin, 57, 60, 61, 70 Long pec, 96–99, 146

M Malformations, 176, 180, 197, 201, 207, 211, 230, 233, 260 Mammals, 33, 34, 64 Matsui’s diagram, 5 Maxilla, 119, 147 Medaka, 28, 29, 192–194, 209, 215, 217 Median fins, 80, 91, 94–96, 99, 102, 113, 119, 139, 144, 187, 192–208, 210, 213, 216, 218, 230, 273 Melanophores, 59, 167 Mesenchymal cells, 95, 107, 113, 159–163, 165 Metapterygoid, 119 Mice, 215, 230 Ming dynasty, 10–13, 26, 234 Mirror carp, 60, 214 Mirror scale, 60, 214 Modularity, 230 Morpholino, 196, 276, 278 Morphologies, 2, 3, 13, 33–35, 45–71, 76, 118, 119, 128, 131, 137–140, 146, 159, 163, 168, 172, 173, 175–177, 179, 180, 182, 184–188, 191–219, 225, 226, 228–230, 232, 234, 236–241, 274 Morphotypes, 64–68, 70, 71, 138–173, 179, 180, 182, 185, 187, 188, 208, 211–213, 216 Mouse, 182 MRNAs, 61, 202, 276, 278

284 Mutations, 1, 7, 9, 13, 23, 30, 32, 33, 46, 51, 54, 55, 57, 59–62, 64, 141, 144, 167, 180, 182, 185–188, 191–212, 214–219, 226–228, 230–234, 236–240

N Neo-functionalization, 25 Neural tube, 187, 210, 230, 273 Notochords, 50, 81, 91, 95, 106–108, 111, 123, 130, 147, 148, 151–153, 166, 176–180, 192, 211, 215, 273

O Occipital, 119 One-cell, 80, 84, 177 Opercular, 119, 147, 256 Oranda, 53–55, 57, 59, 65, 69, 139–143, 145, 162, 167–172, 174–176, 180, 184, 186, 202, 204, 205, 215, 253, 264 Organs, 12, 71, 91, 207, 218, 230, 240 Orthologous, 24, 25, 274 Orthologues, 24, 29 Otic capsule, 119 Otic vesicle closure (OCV), 91, 94 Otic vesicles, 91, 93, 94, 97–100, 139 Otophysi, 18, 19

P Paired fins, 200–202, 237, 253, 273 Paralogues, 24, 25, 29, 61, 62, 192–196, 198, 199, 203, 206, 207, 214, 226, 275 Paramecia, 254, 265 Parcellation, 240 Pec fin, 96–99, 182 Pectoral fins, 49, 56, 57, 78, 80, 91, 93–96, 98–100, 119, 124–127, 139, 148, 169, 200, 252, 253, 256 Pelvic fin, 57 Pelvic fin buds, 81, 101, 102, 113–115, 133, 148, 155, 159–162, 165, 166, 201 Pelvic fin rays (Pr), 113, 126, 127, 157, 159, 160 Pelvic fins, 76, 81, 101, 102, 114, 116, 118, 126, 127, 148, 157–160, 162, 168, 237, 238, 257 Pelvic girdle, 57, 127, 147 Penetrance, 31, 32, 68, 186, 206–209, 212, 214, 228, 233, 235 Perlscale, 54 Perturbations, 234–236

Index Pharyngula, 76, 80, 91, 93, 94, 139–141, 144, 175, 176, 211, 218 Phenotypes, 1, 4, 5, 12, 13, 21, 25, 29–35, 45, 46, 54, 59–61, 67–70, 137, 138, 144, 147, 169, 173, 176, 180, 182–188, 192–194, 196, 198, 200–203, 205–212, 214, 216–219, 225–240, 264, 273 Phylogenetic analyses, 23, 24, 57, 66, 69, 211 Phylogeny, 17, 24, 66, 195, 227 Pig, 18 Pigeons, 13, 18, 235 Pleiotropic, 207, 230, 237, 238, 240 Polymorphisms, 32, 66, 76, 180, 207, 226, 232–235 Polyploidization, 24 Polyploids, 23, 24 Pompon, 66 Pop eye, 2, 69 Populations, 8, 11–13, 21–23, 30–33, 47, 62, 63, 66, 67, 102, 107, 185, 187, 188, 192, 194, 198, 199, 201–203, 205–208, 211, 212, 215, 217, 218, 226–228, 232–234, 236, 238–240, 274 Post-anal fin fold, 110, 111, 146, 148, 159–162 Post-cranial, 48, 49, 66, 130, 151, 208 Posterior swim bladder, 55, 56, 81, 107, 110, 147, 148, 150 Posterior swim bladder lobe (Psb), 102 Pre-anal fin fold, 112, 113, 115, 127, 133, 146, 151–163, 165, 167, 174, 201 Protozoan, 227, 228 Protruding mouth, 81, 96–99, 102, 103, 146, 148, 162 Protuberant eyes, 54, 70

Q Quadrate, 119

R Radial basements, 124 Radials, 49, 52, 124, 128, 159, 161, 165, 187 Ranch, 54 Ranchu, 21, 53–57, 62, 63, 65–67, 69, 173, 175–182, 184, 208, 209, 211, 215, 217, 218, 230, 240, 251 Random mutagenesis, 32, 33, 207, 240 Ray-finned fish, 18 Retina, 80, 94, 139 Retroarticular, 119 Rib, 49, 124 Robustness, 191, 208, 228, 234, 235

Index Ryukin, 21, 53–55, 57, 65, 67, 69, 70, 139–145, 149, 152–156, 158–164, 166, 167, 169, 180, 184, 186, 215, 251, 264

S Sarcopterygians, 18, 19 Segmentation periods, 83, 89–91, 139 Segmented fin spines, 50, 117, 128 Selection, 2, 9, 11–14, 32, 33, 138, 196, 198, 208, 219, 230, 236, 238, 240 Shield, 79, 85, 87, 142, 177 Shubunkin, 23, 54, 59, 64, 69 Single-tail common goldfish, 46–48, 51, 54, 56, 59, 64, 65, 69, 76–99, 101, 102, 114, 115, 132, 133, 142, 167, 179, 180, 195, 240, 264 Single-tail morphotype, 65, 66, 76, 78, 139, 140, 143, 145–147, 151, 155, 156, 158, 159, 163, 166–168, 182, 187, 199, 211, 213 SNP, 208 Somites, 80, 88–91, 94, 139, 140, 173, 177, 186, 187, 213, 217, 228 Song dynasty, 9–12 Sperms, 49, 81, 119, 148, 169, 251, 253, 255–262, 264 Staging indexes, 78, 82, 88, 89, 91, 92, 96, 104, 132, 133, 139–140, 147, 148, 156, 167, 168, 179–180, 216 Staging tables, 75–78, 85, 89, 91, 94, 133, 138, 147, 180, 208 Stop codon, 60, 141, 144, 145, 193, 207, 274 Sub-functionalization, 196, 198 Superneuralis, 121 Suspensorium, 124 Swim bladders, 18, 56, 99, 101, 105, 107–113, 179–181, 265 Swimming, 12, 13, 198, 230

T Taxonomy, 24 Teleosts, 13, 18, 19, 24, 26, 28, 29, 33, 46, 48, 50, 57, 76, 81, 86, 91, 193–196, 201, 214, 215, 234, 237, 238 Telescope, 53, 54, 60, 61, 65, 69, 70, 182–184, 217 Telescope-eye, 54, 60, 182–185 Tissues, 12, 46, 54, 59, 64, 71, 91, 99, 107, 119, 130, 147, 148, 151, 153, 159, 161, 165–167, 173, 176, 179, 184, 185, 187,

285 193, 217–219, 228, 230, 237, 238, 240, 253, 264, 270–273 Tosakin, 54, 59, 65, 69, 70 Tripus, 49, 124 Trunk, 48, 49, 52, 55–57, 64, 70, 78, 80, 91, 92, 95, 96, 100, 116–118, 121, 147, 148, 151, 157, 159–162, 186, 230, 252, 253 Tubercles, 49, 119, 169, 256 Twin-tail, 2, 3, 11, 13, 21, 32, 53–55, 57, 59–61, 64–70, 78, 138–173, 179, 180, 182, 185–188, 191–196, 198, 199, 201–203, 205–208, 211–214, 216–218, 234, 236–238, 240, 274 Twin-tail morphotype, 65, 66, 138–147, 151, 155–157, 159, 162, 163, 166–169, 173, 177, 179, 180, 186, 187, 192–209, 211, 213, 264

V Veiltail, 54, 59, 65, 69, 70 Vertebrae, 18, 49, 123, 151, 215 Vertebral centrums, 49, 121, 124, 130, 131, 147, 151, 166 Vertebral elements, 121, 130, 147, 148, 151, 163, 166, 181, 211, 215

W Wakin, 46–48, 53, 54, 65, 66, 69, 70, 102, 145, 186 Warty growth, 54, 70, 148, 167, 184–185, 188, 216, 218, 236 Weberian apparatus, 18, 49, 124 Wild-type, 13, 32, 46–48, 50, 51, 54–56, 61, 69, 75–133, 137, 138, 140–145, 162, 166, 180, 186, 187, 191, 193–197, 210, 212, 213, 215, 217, 226, 251, 253, 274 Wulin jiushi, 10

X Xanthophores, 59, 96, 99, 139, 167 Xenopus, 30, 180, 209

Y Yangyu Jing, 9, 11 Yolks, 28, 78–82, 85–91, 95, 107, 132, 139, 145–148, 175–177, 196, 197, 259, 265, 273, 276, 278

286 Z Zebrafish, 18, 19, 21, 24, 25, 27–33, 48, 50, 61, 64, 70, 76, 78, 80–83, 85, 86, 88, 89, 91, 92, 94, 96, 98, 105, 107, 112, 119, 132–133, 167, 181, 182, 186, 187,

Index 192–195, 200, 203, 206–210, 212, 215, 217, 228, 234, 236, 238, 239, 254, 265, 268, 274, 276