Functional and Preservative Properties of Phytochemicals [1 ed.] 0128185937, 9780128185933

Citation preview

Functional and Preservative Properties of Phytochemicals

This page intentionally left blank

Functional and Preservative Properties of Phytochemicals Edited by

Bhanu Prakash

Academic Press is an imprint of Elsevier 125 London Wall, London EC2Y 5AS, United Kingdom 525 B Street, Suite 1650, San Diego, CA 92101, United States 50 Hampshire Street, 5th Floor, Cambridge, MA 02139, United States The Boulevard, Langford Lane, Kidlington, Oxford OX5 1GB, United Kingdom Copyright © 2020 Elsevier Inc. All rights reserved. No part of this publication may be reproduced or transmitted in any form or by any means, electronic or mechanical, including photocopying, recording, or any information storage and retrieval system, without permission in writing from the publisher. Details on how to seek permission, further information about the Publisher’s permissions policies and our arrangements with organizations such as the Copyright Clearance Center and the Copyright Licensing Agency, can be found at our website: www.elsevier.com/permissions. This book and the individual contributions contained in it are protected under copyright by the Publisher (other than as may be noted herein). Notices Knowledge and best practice in this field are constantly changing. As new research and experience broaden our understanding, changes in research methods, professional practices, or medical treatment may become necessary. Practitioners and researchers must always rely on their own experience and knowledge in evaluating and using any information, methods, compounds, or experiments described herein. In using such information or methods they should be mindful of their own safety and the safety of others, including parties for whom they have a professional responsibility. To the fullest extent of the law, neither the Publisher nor the authors, contributors, or editors, assume any liability for any injury and/or damage to persons or property as a matter of products liability, negligence or otherwise, or from any use or operation of any methods, products, instructions, or ideas contained in the material herein. Library of Congress Cataloging-in-Publication Data A catalog record for this book is available from the Library of Congress British Library Cataloguing-in-Publication Data A catalogue record for this book is available from the British Library ISBN: 978-0-12-818593-3 For information on all Academic Press publications visit our website at https://www.elsevier.com/books-and-journals

Publisher: Charlotte Cockle Acquisitions Editor: Nina Rosa de Araujo Bandeira Editorial Project Manager: Lena Sparks Production Project Manager: Kamesh Ramajogi Cover Designer: Mark Rogers Typeset by TNQ Technologies

Contents

List of contributors 1

2

Antimicrobial and antioxidant properties of phytochemicals: current status and future perspective Bhanu Prakash, Akshay Kumar, Prem Pratap Singh and L.S. Songachan 1. Introduction 2. Plants as a source of antimicrobial and antioxidant agents: a historical perspective 3. Phytochemicals as a source of antimicrobial agents 4. Phytochemicals as a source of antioxidant agents 5. Phytochemicals as a source of functional food ingredients 6. Mechanism of action 7. Current existing limitations and role of modern science and technological innovations to boost the antimicrobial and antioxidant potential of phytochemicals in the food system 7.1 Use of waste material 7.2 Extraction technologies of phytochemicals 7.3 Biotechnology approaches 7.4 Nanotechnology approach 7.5 Bioinformatics 7.6 Mathematical modeling 7.7 Regulatory approval 8. Conclusion Acknowledgments References Further reading Functional food ingredients from old age cereal grains P. Anjali and P. Vijayaraj 1. Introduction 2. Taxonomic classification of millets 3. Global millet production and consumption 4. The general structure of millet grains 5. Millets: from coarse cereals to nutri grains

xiii

1 1 2 3 17 19 19

27 28 29 29 29 33 33 34

34 34 35 44 47 47 47 49 51 51

vi

Contents

6.

7.

8. 9.

10.

11.

12. 13.

3

Millet carbohydrates 6.1 Starch 6.2 Soluble sugars Millet proteins 7.1 Digestibility of millet proteins 7.2 Millet proteinsdapplications Millet lipids 8.1 Sorghum wax as edible biofilm Millet nutraceuticals 9.1 Phenolic acids 9.2 Tannins 9.3 Steryl ferulates 9.4 Carotenoids Antinutrients in millets 10.1 Phytic acid 10.2 Oxalates 10.3 Protease inhibitors 10.4 C-glycosylflavones Health benefits of millets 11.1 Prebiotic and probiotic source 11.2 Antioxidants Effect of processing in millet nutrition Conclusion and future perspectives References

Aquatic plants as a natural source of antimicrobial and functional ingredients Km Pooja, Sapna Rani, Vikrant Rana and Gaurav Kumar Pal 1. Introduction 2. Seaweeds 3. Seaweeds proteins 4. Bioactive compounds 5. Seaweed-derived bioactive hydrolysates/peptides 6. Methods used for the release of bioactive peptides 7. Computational approaches for exploring biological activity of peptides 8. Antimicrobial activity of the seaweed-derived bioactive compounds 9. Functional activities of the seaweed-derived bioactive compounds 9.1 Antioxidative activity 9.2 Antitumor activity 9.3 Neuroprotective activity 9.4 Anticoagulant activity 9.5 Immunomodulatory activity 9.6 Antiobesity activity 9.7 Antidiabetic activity

59 59 62

65 67 68

68 70

70 70 73 73 74

74 74 74 75 75

75 76 76

79 81 82

93 93 94 94 95 96 97 99 100 102 102 104 105 105 106 107 107

Contents

10. 11.

4

5

vii

Utilization of seaweeds and their derivates in healthier food products Conclusion References

Antimicrobial properties of selected plants used in traditional Chinese medicine Mishri Lal, Sandip Kumar Chandraker and Ravindra Shukla 1. Introduction 2. Character and significant features of Traditional Chinese medicine 3. Formulations of traditional Chinese medicinal plants 4. Antimicrobial properties of some common plants used in traditional Chinese medicine 4.1 Panax ginseng C. A. Mey 4.2 Ginkgo biloba L. 4.3 Ephedra sinica stapf 4.4 Artemisia annua L. 4.5 Alpinia officinarum hance 4.6 Angelica sinensis (oliv.) diels 4.7 Arctium lappa L. 4.8 Astragalus membranaceus (fisch.) bunge 4.9 Chrysanthemum morifolium ramat 4.10 Lycium chinense mill 4.11 Myristica fragrans houtt 4.12 Paeonia lactiflora pall 4.13 Paeonia suffruticosa andrews 4.14 Polygonum multiflorum thunb 4.15 Rheum palmatum L. 4.16 Salvia miltiorrhiza bunge 4.17 Schisandra chinensis (turcz.) baill 4.18 Scutellaria baicalensis georgi 5. Conclusion References

108 109 109

119 119 120 120 121 121 122 123 124 124 125 126 128 128 129 130 130 131 132 133 134 134 135

136 136

Natural products from plants: recent developments in phytochemicals, phytopharmaceuticals, and plant-based neutraceuticals as anticancer agents 145 S. Priya and P.K. Satheeshkumar 1. Plants: nature’s chemical factories 145 2. Cancer and chemotherapeutic targets 146 3. Major classes of anticancer molecules 147 4. Anticancer compounds from plants 148 5. What is an ideal anticancer molecule? 149 6. Commercial success stories 150 7. Why do we need more medicines for cancer treatment? 151

viii

Contents

8. 9. 10. 11. 12. 13. 14.

6

Traditional medicine resources for anticancer molecules High throughput screening for molecule identification Neutraceuticals with anticancer properties The proposed mechanisms of anticancer activity Can food ingredients be therapeutic? Our studies Future perspectives References

Foodborne microbial toxins and their inhibition by plant-based chemicals Somenath Das, Anand Kumar Chaudhari, Akanksha Singh, Deepika, Vipin Kumar Singh, Abhishek Kumar Dwivedy and Nawal Kishore Dubey 1. Introduction 2. Microbial toxins in food system 3. Factors affecting microbial toxins secretion in food system 4. Detection of microbial toxins in food system 4.1 Thin layer chromatography 4.2 High-performance liquid chromatography 4.3 High-performance thin layer chromatography 4.4 Gas chromatography-mass spectroscopy 4.5 Liquid chromatography-mass spectroscopy 4.6 Matrix-assisted laser desorption ionization-time of flight mass spectroscopy

5. 6.

7. 8.

4.7 Fourier transforms infrared spectroscopy 4.8 Nucleic acidebased techniques 4.9 Immunological-based techniques 4.10 Biosensor for toxin determination 4.11 Fluorescence microscopy Safety limits in food system Major groups of phytochemicals inhibitory to mycotoxins 6.1 Terpenes 6.2 Phenols 6.3 Nitrogen containing compounds 6.4 Lectins Phytochemicals against microbial toxins Conclusion and future perspectives References Further reading

152 153 154 155 156 157 158 159

165

165 166 168 169 171 171 177 177 177 177 178 178 178 179 179

179 180 181 182 182 188

190 191 192 206

Contents

7

8

Recent advances in extraction technologies of phytochemicals applied for the revaluation of agri-food by-products Sandra Pimentel-Moral, María de la Luz C adiz-Gurrea, Celia Rodríguez-Pérez and Antonio Segura-Carretero 1. Introduction 2. Phytochemicals from agri-food by-products 2.1 Carotenoids 2.2 Phenolic compounds 2.3 Dietary fiber 3. Extraction technologies applied for the revaluation of agri-food by-products 3.1 Conventional extraction 3.2 Ultrasound-assisted extraction 3.3 Microwave-assisted extraction 3.4 Pressurized liquid extraction 3.5 Pulsed electric field 3.6 Supercritical fluid extraction 3.7 Gas expanded liquids 4. Concluding remarks References Application of nanotechnology to boost the functional and preservative properties of essential oils Akshay Kumar, Priyanka Singh, Vishal Gupta and Bhanu Prakash 1. Introduction 2. Preservative and functional properties of essential oils 3. Nanotechnology: an efficient approach to enhance the bioactivity of essential oils 4. Delivery agents and techniques used for encapsulation of essential oils 4.1 Starch 4.2 Cellulose 4.3 Pectin 4.4 Guar gum 4.5 Chitosan 4.6 Alginate 4.7 Carrageenan 4.8 Dextrans 4.9 Cyclodextrin 5. Technique used for encapsulation of essential oils 6. Conclusion References Further reading

ix

209

209 210 210 211 213

214 214 216 219 222 225 226 231

231 232

241 241 242 245 246 246 255 255 256 256 256 256 257 257

257 258 260 267

x

Contents

9

10

11

Biotechnology: a tool for synthesis of novel bioactive compounds Sandeep Kumar, Praveena Bhatt and Sarma Mutturi 1. Introduction 2. Exploration and screening of novel bioactive compounds from microbial sources 2.1 Functional and homology screening 2.2 Other metagenomic surveys 3. Synthesis of oligosaccharides and peptides as bioactive compounds 3.1 Synthesis of oligosaccharides using microbial-derived enzymes 3.2 Bioactive peptides 4. Bioprobes for qualitative and quantitative detection of bioactive molecules/compounds 4.1 Biosensors for screening and detection of bioactive molecules 5. Systems biology enabled synthesis of bioactive compounds References Further reading Prospects of omics technologies and bioinformatics approaches in food science Bhanu Prakash, Prem Pratap Singh, Akshay Kumar and Vishal Gupta 1. Introduction 2. Foodomics: omics in the field of food science and nutrition 3. Role of bioinformatics in food science 4. Aflatoxin B1 inhibitory potential and therapeutic characterization of selected test compounds: selection of the receptor molecules 5. Modeling of the receptor molecules (ver-1 and omt A) 6. Selection of ligand molecules 7. Physicochemical characterization and drug-likeness scores of the compounds along with toxicity and their expected LD50 value 8. Docking 9. Observation 10. Concluding remarks and future perspectives Acknowledgment References Further reading Phytochemicals: extraction process, safety assessment, toxicological evaluations, and regulatory issues Monika Thakur, Karuna Singh and Renu Khedkar 1. Introduction 2. Phytochemicals 3. Types of phytochemicals 4. Phytochemicals and health benefits 5. Extraction process of phytochemicals

269 269 270 271 272

276 277 283

288 290

297 301 315

317 317 318 321 325 325 326

326 326 330 332 335 335 340

341 341 342 342 343 343

Contents

6. 7. 8. 9.

12

xi

5.1 Plant material 5.2 Choice of solvents 5.3 Choice of solvents 5.4 Extraction procedures Ethnobotanical studies on the use of phytochemicals Toxicological study Regulatory assessment Conclusion References

Phytochemicals: intellectual property rights Manoj Kumar Singh, Sandeep Kumar Singh, Anand Vikram Singh, Hariom Verma, Prem Pratap Singh and Ajay Kumar 1. Introduction 1.1 Phytochemical extraction 1.2 Phytochemicals in pediatrics and sports drink composition 1.3 Biological activity of the phytochemicals 1.4 Use claim of phytochemicals in patents 1.5 Plants and their extracted phytochemicals in legal terms 1.6 Patent protection: plant varieties and farmer’s rights act (2001) 1.7 Protection through the biological diversity act (2002) 1.8 Geographical indication of goods (registration and protection) act (1999)

2.

13

1.9 Traditional knowledge digital library (TKDL) 1.10 Important medicinal plants and their uses as medicines in India Conclusion References Further reading

Innovations and future trends in product development and packaging technologies Bababode Adesegun Kehinde, Ishrat Majid, Shafat Hussain and Vikas Nanda 1. Introduction 2. High hydrostatic pressure 2.1 Sterilization mechanism of HPP 2.2 Food-based applications of HPP 2.3 Fruits and vegetables 2.4 Milk and milk products 2.5 Cereal grains and legumes 2.6 Advantages of High Pressure Processing 2.7 HPP limitations 3. PEF 3.1 Principle 3.2 Mechanism of microbial inactivation

347 347 348 349

350 350 352 356 356 363

363 363 365 366 366 367 368 368 369 369 370

373 373 375

377

377 377 378 379 379 379 386 386 386

387 387 388

xii

Contents

4.

5.

6. 7. 8. 9.

10.

Index

3.3 Factors affecting PEF efficiency 3.4 Processing conditions 3.5 Electric field 3.6 Pulse wave shape 3.7 Treatment time and temperature 3.8 Product-related factors 3.9 Microbial factors 3.10 Advantages Cold plasma technology 4.1 Features of cold plasma technology 4.2 Principle of plasma 4.3 Classification of plasma 4.4 Applications in food processing 4.5 Inactivation of enzymes 4.6 Modification of food starches 4.7 Modification of packaging materials Nanotechnology 5.1 Food application 5.2 Nanocomposites 5.3 Lipophilic bioactives 5.4 Nanotechnology in dairy foods Future prospects of food packaging Biopackaging of food Active packaging Biosensors and food packaging 9.1 Categories of sensor packaging systems 9.2 Bioactive paper sensor 9.3 Enzymatic biosensor Conclusion References Further reading

388 388 388 389 389 389 390 390

390 391 391 392 392 392 392 393

393 394 394 394 395

395 396 396 397 397 397 397

398 398 406 411

List of contributors

Bababode Adesegun Kehinde Department of Biosystems and Agricultural Engineering, University of Kentucky, Lexington, Kentucky, United States P. Anjali Department of Lipid Science, Central Food Technological Research Institute (CSIR), Mysore, Karnataka, India Praveena Bhatt Microbiology and Fermentation Technology Department, CSIRCentral Food Technological Research Institute, Mysuru, Karnataka, India María de la Luz C adiz-Gurrea Department of Analytical Chemistry, Faculty of Sciences, University of Granada, Granada, Spain; Research and Development Functional Food Centre, Health Science Technological Park, Granada, Spain Sandip Kumar Chandraker Laboratory of Bio-resource Technology, Department of Botany, Indira Gandhi National Tribal University, Amarkantak, Madhya Pradesh, India Anand Kumar Chaudhari Centre of Advanced Study in Botany, Institute of Science, Banaras Hindu University, Varanasi, Uttar Pradesh, India Somenath Das Centre of Advanced Study in Botany, Institute of Science, Banaras Hindu University, Varanasi, Uttar Pradesh, India Deepika Centre of Advanced Study in Botany, Institute of Science, Banaras Hindu University, Varanasi, Uttar Pradesh, India Nawal Kishore Dubey Centre of Advanced Study in Botany, Institute of Science, Banaras Hindu University, Varanasi, Uttar Pradesh, India Abhishek Kumar Dwivedy Centre of Advanced Study in Botany, Institute of Science, Banaras Hindu University, Varanasi, Uttar Pradesh, India Vishal Gupta Centre of Advanced Study in Botany, Institute of Science, Banaras Hindu University, Varanasi, Uttar Pradesh, India Shafat Hussain Division of Fishery Biology, Faculty of Fisheries, Sher-e-Kashmir University of Agricultural Sciences and Technology, Srinagar, Jammu and Kashmir, India Renu Khedkar Amity Institute of Food Technology, Amity University, Noida, Uttar Pradesh, India

xiv

List of contributors

Akshay Kumar Centre of Advanced Study in Botany, Institute of Science, Banaras Hindu University, Varanasi, Uttar Pradesh, India Sandeep Kumar Microbiology and Fermentation Technology Department, CSIRCentral Food Technological Research Institute, Mysuru, Karnataka, India Ajay Kumar Department of Botany, Institute of Science, Banaras Hindu University, Varanasi, Uttar Pradesh, India Mishri Lal Laboratory of Bio-resource Technology, Department of Botany, Indira Gandhi National Tribal University, Amarkantak, Madhya Pradesh, India Ishrat Majid Department of Food Technology, Islamic University of Science and Technology, Awantipora, Jammu and Kashmir, India Sarma Mutturi Microbiology and Fermentation Technology Department, CSIRCentral Food Technological Research Institute, Mysuru, Karnataka, India Vikas Nanda Department of Food Engineering and Technology, Sant Longowal Institute of Engineering and Technology, Longowal, Punjab, India Gaurav Kumar Pal Department of Applied Agriculture, School of Basic and Applied Sciences, Central University of Punjab, Bathinda, Punjab, India; Department of Life Sciences, School of Life Sciences, Central University of Karnataka, Kalaburagi, Karnataka, India Sandra Pimentel-Moral Department of Analytical Chemistry, Faculty of Sciences, University of Granada, Granada, Spain; Research and Development Functional Food Centre, Health Science Technological Park, Granada, Spain Km Pooja Department of Botany, College of Education, Bilaspur, Greater Noida, Uttar Pradesh, India Bhanu Prakash Centre of Advanced Study in Botany, Institute of Science, Banaras Hindu University, Varanasi, Uttar Pradesh, India S. Priya Agro-Processing and Technology Division, CSIR-National Institute for Interdisciplinary Science and Technology (CSIR-NIIST), Trivandrum, Kerala, India Vikrant Rana Department of Applied Agriculture, School of Basic and Applied Sciences, Central University of Punjab, Bathinda, Punjab, India Sapna Rani Dairy Microbiology Division, ICAR-National Dairy Research Institute, Karnal, Haryana, India Celia Rodríguez-Pérez University College Dublin (UCD) Institute of Food and Health, UCD, Dublin, Ireland P.K. Satheeshkumar Centre of Advanced Study in Botany, Institute of Science, Banaras Hindu University, Varanasi, Uttar Pradesh, India

List of contributors

xv

Antonio Segura-Carretero Department of Analytical Chemistry, Faculty of Sciences, University of Granada, Granada, Spain; Research and Development Functional Food Centre, Health Science Technological Park, Granada, Spain Ravindra Shukla Laboratory of Bio-resource Technology, Department of Botany, Indira Gandhi National Tribal University, Amarkantak, Madhya Pradesh, India Manoj Kumar Singh Department of Chemistry, Indian Institute of Technology Delhi, Hauz Khas, New Delhi, India Karuna Singh Pradesh, India

Amity Institute of Food Technology, Amity University, Noida, Uttar

Prem Pratap Singh Centre of Advanced Study in Botany, Institute of Science, Banaras Hindu University, Varanasi, Uttar Pradesh, India Priyanka Singh Centre of Advanced Study in Botany, Institute of Science, Banaras Hindu University, Varanasi, Uttar Pradesh, India Sandeep Kumar Singh Department of Botany, Institute of Science, Banaras Hindu University, Varanasi, Uttar Pradesh, India Akanksha Singh Centre of Advanced Study in Botany, Institute of Science, Banaras Hindu University, Varanasi, Uttar Pradesh, India Anand Vikram Singh Department of Botany, Institute of Science, Banaras Hindu University, Varanasi, Uttar Pradesh, India Vipin Kumar Singh Centre of Advanced Study in Botany, Institute of Science, Banaras Hindu University, Varanasi, Uttar Pradesh, India L.S. Songachan Centre of Advanced Study in Botany, Institute of Science, Banaras Hindu University, Varanasi, Uttar Pradesh, India Monika Thakur Amity Institute of Food Technology, Amity University, Noida, Uttar Pradesh, India Hariom Verma Department of Botany, Institute of Science, Banaras Hindu University, Varanasi, Uttar Pradesh, India P. Vijayaraj Department of Lipid Science, Central Food Technological Research Institute (CSIR), Mysore, Karnataka, India

This page intentionally left blank

Antimicrobial and antioxidant properties of phytochemicals: current status and future perspective

1

Bhanu Prakash, Akshay Kumar, Prem Pratap Singh, L.S. Songachan Centre of Advanced Study in Botany, Institute of Science, Banaras Hindu University, Varanasi, Uttar Pradesh, India

1. Introduction Food spoilage due to microbial and oxidative deterioration is one of the major problems of food safety even in the 21st century. Microbial and oxidative spoilage may deteriorate the quantity and quality of food items and could impose several negative effects on the health of the consumer. Nowadays, food poisoning is one of the most common causes of illness in developing countries which is often associated with death (Doughari et al., 2007; Pirbalouti et al., 2009; Sapkota et al., 2008). As per an estimate approximately 9.4 million cases of foodborne diseases have been witnessed in both developing nations as well as in developed countries such as the USA (Scallan et al., 2011). Among the microbes, bacteria (Listeria monocytogenes, Escherichia coli O157:H7, Salmonella spp., Staphylococcus aureus, Bacillus cereus, Pseudomonas aeruginosa, Campylobacter spp., Clostridium perfringens) and molds (Aspergillus flavus, Aspergillus parasitic, Aspergillus niger, Penicillium and Fusarium spp.) are the most dangerous foodborne microorganisms (Kuorwel et al., 2011; Bukvicki et al., 2014; Prakash et al., 2018; Solomakos et al., 2008). Aflatoxins (AFB1, AFB2, AFM1, and AFM2), fumonisin, and zearalenone are the most common toxic secondary metabolite products of molds that impose several negative effects on the health of human beings and livestock. International agency for research on cancer has recognized aflatoxin B1 as a class 1 human carcinogen (IARC, 1993). In addition to microbial spoilage, oxidative deterioration such as lipid peroxidation and free radical damages of food items are other major causes of deterioration of nutritional quality. Hence, the combined effect of microbial and oxidative deterioration may cause the deleterious effect to overall quantity and quality of food items and also on consumers’ health. Nowadays, a range of synthetic preservatives (antimicrobial and antioxidant) along with the physical treatments (drying, chilling, freezing, UV or ionizing radiation, modified atmosphere packaging, and nonthermal treatments, viz., pulsed electric fields, oscillating magnetic fields, photodynamic effects) have been used to extend

Functional and Preservative Properties of Phytochemicals. https://doi.org/10.1016/B978-0-12-818593-3.00001-4 Copyright © 2020 Elsevier Inc. All rights reserved.

2

Functional and Preservative Properties of Phytochemicals

the shelflife of food commodities and their byproducts, by working against microbial growth and oxidative deterioration (Davidson, 2001). The organic acids and their salts (sorbic acid, benzoic acid, propionic acid, sodium benzoates, propionates, potassium sorbates, nitrites, ascorbic acid, citric acid, etc.), antioxidants (butylated hydroxyl toluene (BHT), butylated hydroxyl anisole (BHA), tert-butylated hydroquinone (TBHQ), propyl gallate (PG)) are some of the currently used preservative agents (Kuorwel et al., 2011; Prakash et al., 2018). However, both physical (thermal and nonthermal) and chemical treatments have their own limitations that restrict their continuous use in the food system. For instances, the high intensities needed to achieve the required safety levels during thermal treatment may negatively alter the sensorial and nutritional properties of foods (Vasconcelos et al., 2015). Recent studies reported that the nonthermal technologies such as pulsed electric fields and high hydrostatic pressure (HHP) are insufficient to ensure food safety, as these treatments can lead only to sublethal damage to the bacterial cell wall (Manas and Pag
an 2005; Liu et al., 2017; Wan et al., 2009). The prevalent antioxidants, viz., BHT, BHA, have suspected negative effect on the health including carcinogenic effect at high doses Kahl and Kappus (1993). Further, the microbial resistance to current synthetic chemicals has also been witnessed in the past few years resulting in the replacement of some of the prevalent synthetic preservatives. Therefore, food industries are looking toward alternative strategies to preserve the quantity and quality of food products. In this context, plant product such as herbs, spices, essential oils, and crude extracts which have been used as antimicrobial agent since long could be used as the preferred alternative to synthetic preservatives (Shan et al., 2007; Tiwari et al., 2009). Plants are the most abundant source of a wide variety of phytochemicals such as polyphenols, carotenoids, alkaloids, sulfur-containing group, terpenes, and terpenoids that possess inherent antimicrobial and antioxidant properties. Further, most of the plant-derived products are generally recognized as safe (GRAS) by US-Food and Drug Administration (FDA) (Burt, 2004). However, to date, only a handful formulations based on plant products are commercially available as food preservative agents. This chapter provides a brief overview of historical accounts on traditionally used plant products that possess antimicrobial and antioxidant activity. In addition, the current existing limitations and the potential role of recent advancement in science and technology to overcome the existing limitations with improved efficacy and worldwide applicability have been discussed.

2.

Plants as a source of antimicrobial and antioxidant agents: a historical perspective

As per an estimate approximately 250,000 to 500,000 plants species are available on Earth; of them nearly 1%e10% have been explored for their usefulness till now (Borris, 1996; Cowan, 1999). Ancient literature revealed that plant products, more often crude extracts, have been used as antimicrobial agents for the treatment of infectious diseases to most of the old age human civilizations. The hollyhock plant of family Malvaceae was used 60,000 years ago by the Neanderthals; in present-day Iraq it is known for

Antimicrobial and antioxidant properties of phytochemicals

3

its healing property (Cowan, 1999). The Holy Bible mentions the antimicrobial properties of traditionally used plants such as frankincense and myrrh (Cowan, 1999). Ancient records such as Sumerian clay tablets in cuneiform (Mesopotamia 2600 BC), Egyptian medicine (2900 BC), and Egyptian pharmaceutical record Ebers Papyrus (1500 BC) harbor excellent classical text about the antimicrobial activity of plant products. The use of plant such as willow (Salix alba L.), chamomile (Matricaria chamomilla L.), garlic (Allium sativum L.), onion (Allium cepa L.), nettle (Urtica dioica L.), common centaury (Centaurium erythraea Rafn), coriander(Coriandrum sativum L.), parsley (Apium crispum Mill.), and false hellebore (Veratrum viride Aiton) as antimicrobial agents have been well documented in ancient history record by Dioscorides (Wagner et al., 2017; Fierascu et al., 2018). Traditional Indian medicine (TIM) and traditional Chinese medicine (TCM) remain the source of knowledge about the use of the medicinal plants for the cure of disease and also to promote health in holistic fashion (Patwardhan et al., 2005). Many formulations based on the different plant parts such as leaf, flower, seeds, and twigs have been used for thousands of years to boost the body stamina as a traditional practice. For instances, spices such as garlic, black pepper, cumin, clove, ginger, and caraway have been used since long in traditional Indian system of medicine (Arora and Kaur, 1999). Traditional herbal formulations were made using different plant parts for different pharmacological actions, such as Kwatha (decoction), Phanta (hot infusion), Hima (cold infusion), Arka (liquid extract), Churna (powders), Guggul (resins and balsams), Taila (medicated oil) (Frawley and Ranade, 2001; Parasuraman et al., 2014). The Sarangdhar Samhita (1300 AD) of Ayurveda explores the benefit of plant-based formulations using different plants and their parts rather than the individual plants and highlights the concept of synergism in terms of polyherbalism. For instance, the formulation based on a combination of ginger, black pepper, and long pepper has better mucous-reducing effects, while the combination of cumin, black pepper, and asafoetida reduces bloating and (guduchi and turmeric) boosts the immunity (Parasuraman et al., 2014). The bark of cinchona tree has been used for the treatment of malaria in the ancient literature; later the antimalarial compound quinine was identified from the bark. Ancient history records revealed that herbal medicine had been used for the cure of diseases in Chinese, Greek, Egyptian, and Indian medicine. According to the World Health Organization, approximately 80% of the world’s inhabitants still rely on plant-based therapy for their primary healthcare. As per an estimate, nearly one-quarter to one-half of the currently used pharmaceuticals have been developed directly or indirectly based on higher plants. However, since the advent of antibiotics, the use of plant products sharply decreased in the past few decades. The recent reports on antibiotic resistance toward the major group of antibiotics have revived the interest of the scientific community in plant-based antimicrobials.

3. Phytochemicals as a source of antimicrobial agents Because of the suspected adverse effects of synthetic antimicrobial agents and the global demand for safe food with minimal chemical preservatives, the demand for plant-based antimicrobial agents has been increasing day by day. Plants harbor a range

4

Functional and Preservative Properties of Phytochemicals

of phytochemicals which have evolved in vivo, more often as a defense against harsh environmental conditions (free radical, salinity, and temperature), pathogenic microbes (viruses, bacteria, and fungi), and insect pests. In general, the phytochemicals are nonnutritive plant products that often possess strong antimicrobial potential against a range of foodborne microbes and their associated toxins. Based on their complex chemical structure the phytochemicals are generally classified into major groups such as polyphenols, carotenoids, alkaloids, sulfur-containing groups, terpenes, and terpenoids. Polyphenols are the secondary metabolites products of plants that possess potent antimicrobial, antioxidant, antiinflammatory, anticancer, antihypertensive properties. Fruits, vegetables, nuts, seeds, and flowers are the most abundant source of polyphenolic compounds. Based on the chemical structure polyphenols can be divided into two major groups: flavonoids (flavonols, flavones, flavanols, flavanones, anthocyanidins, and isoflavonoids) and nonflavonoids (phenolic acids, stilbenes, coumarins, and tannins). The chemical structure of flavonoids show a basic skeleton of diphenyl propane, the two benzene rings (rings A and B) linked with three carbon chains form a pyran ring with benzene ring A. The flavonoids such as galangin, kaempferol, quercetin, and myricetin have been reported to have broad-spectrum antibacterial activity. Among nonflavonoid polyphenolics, gallic acid, ferulic acid, coumaric acid, stilbenes, resveratrol, tannins, and chlorogenic acid exhibit enormous antimicrobial activity against a range of microbes such as Vibrio cholerae, Escherichia coli, and Streptococcus mutans (Barbieri et al., 2017; Augustine et al., 2014; Shao et al., 2015). The phenolic acids, viz., gallic, caffeic, and ferulic acids exhibit superior antibacterial activity over the two conventional antibiotics (gentamicin and streptomycin) against bacterial species S. aureus, Listeria monocytogenes, E. coli, and Pseudomonas aeruginosa (Daglia, 2012). The plant carotenoids (fat-soluble compounds constituted by eight isoprenoid units) play an important role in photoprotection and also have antibacterial efficacy. In general, they can be divided into two major groups based on their structure as carotenes (a-carotene, b-carotene, and lycopene) and xanthophylls (b-cryptoxanthin, lutein, and zeaxanthin). Dos Santos et al. (2015) studied the antimicrobial activity of lycopene in combination with synthetic antimicrobials agents gentamicin, amoxicillin, cephalexin, and ciprofloxacin against E. coli and S. aureus and reported that the combination is more effective against E. coli. Amalya and Sumathy (2015) showed that the carotenoids extracted from the leaves and flowers of Peltophorum petrocarpum are effective against the bacterial species, viz., S. aureus, Enterobacter spp., Streptococcus spp., S. paratyphi, E. coli. Tao et al. (2010) studied the antimicrobial effect of carotenoids from the peel of Citrus grandis against Bacillus subtilis, S. aureus, E. coli, Aspergillus niger, Aspergillus flavus, Penicillium chrysogenum, Rhizopus oryzae, and Saccharomyces cerevisiae. They reported that the carotenoid extract exhibited broad antimicrobial activity with the Minimum inhibitory concentrations (MIC) ranging between 18.75 and 140 mg/mL. However, the extract does not affect the growth of A. niger, A. flavus, and P. chrysogenum. Alkaloids, the organic nitrogenous bases, are the classical example of plant-based compounds that have been used as an antimicrobial agent since ancient time. In general, the alkaloids possess one nitrogen atom in the form of primary amine (RNH2), secondary amine (R2NH), and tertiary amine (R3N), but its number may vary up to

Antimicrobial and antioxidant properties of phytochemicals

5

five. Sanguinarine (derived from the rhizomes of Sanguinaria canadensis), piperine (seed of Piper nigrum and Piper longum), and quinine (bark of Cinchona spp.) possess broad-spectrum antimicrobial activity against E. coli, S. aureus, and B. subtilis (Beuria et al., 2005; Skogman et al., 2012; Dusane et al., 2014). A range of alkaloids such as ascididemin, xinghaiamine A, eudistomin Y4, hapalindole I, prosopilosidine, clausenol, chelerythrine, agelasine D, and sanguinarine have been reported to have a strong antibacterial effect against gram-positive and gram-negative bacteria. Squalamine, lysergol, tetrandrine, tomatidine, and compound 8 are the chief naturally occurring alkaloids that exhibit antibacterial activity (Cushnie et al., 2014). The sulfur-containing groups are often associated with vegetables such as Allium cepa, Allium sativum, and Brassica spp. (broccoli, cauliflowers, and cabbage). Isothiocyanates (glucosinolates), allicin, and ajoene are the major sulfur-containing compounds found in Brassica seed oil, and garlic exhibits antimicrobial activity against gram-positive and gram-negative bacteria, and mold species (Barbieri et al., 2017; Kyung, 2011). Isothiocyanates and thiosulfinates derived from glucosinolates (Brassica) and sulfoxides (Brassica and Allium) are the two powerful antimicrobial plant volatiles containing sulfur compounds. The isothiocyanates and thiosulfinates are formed upon enzymatic activation of glucosinolates and sulfoxides, respectively. Terpenes are the dominant group of hydrocarbons (isoprene unit (C5H8) synthesized in the cytoplasm via the mevalonic acid pathway. The combination of isoprene units form different compound groups, viz., monoterpenes (C10H16), diterpenes (C20H32), triterpenes (C30H40), and sesquiterpenes (C15H24). In general, the terpenes exhibit low antimicrobial activity than the terpenoids. For examples p-cymene, limonene, terpinene, sabinene, and pinene have poor antimicrobial activity. Terpenoids are formed by the biochemical modifications of terpenes mediated by certain enzymes that add oxygen molecules and remove methyl groups (Caballero et al., 2003). For example: linalool, linalyl acetate, thymol, menthol, geraniol, and carvacrol exhibit remarkable antimicrobial activity. A literature review suggested that the terpenoids showed strong antimicrobial effect against a range of bacteria and fungi species and hence could be used as a broad-spectrum antimicrobial agent in the food system. Essential oils (EOs) of aromatic plants are a complex mixture of terpenes and terpenoids that often show strong fumigant toxicity against a range of microbes. In general, EOs exert their antimicrobial activity as fumigant that makes their application easier than the other phytochemicals with less chance of residual toxicity. Further, the EOs are mixtures of several volatile compounds that may target different sites at a time, thereby, reducing the chance of resistance development. EOs of aromatic plants, viz., Ocimum gratissimum, Piper betle, Zanthoxylum alatum, Boswellia carteri, Gaultheria procumbens, etc., exhibited strong antifungal activity against the foodborne microbes as well as mycotoxin (Prakash et al., 2018). Therefore, currently the EO-based antimicrobial agents have gained a considerable interest in the scientific community. Ambrosio et al. (2017) showed the antibacterial activity of the selected EOs, extracted from the leaves of Eucalyptus globulus, Eucalyptus exserta, Pimenta pseudocaryophyllus, and byproduct of orange juice (orange oil and citrus terpenes), alone and in binary blends, against the pathogenic bacteria (Salmonella enteritidis S. aureus, E. coli, Enterococcus faecalis, and Listeria innocua). Among all, the orange oil and citrus terpenes showed the highest antibacterial activity.

6

Functional and Preservative Properties of Phytochemicals

Arasu et al. (2019) reported the antimicrobial efficacy of essential oils of selected medicinal plants, viz., Acorus calamus, Allium sativum, Mucuna pruriens, and Sesamum indicum against fruit-spoilage microbes. The minimum inhibitory concentration of the selected EOs ranged from 11.3
2.3 to 617
4.9 mg/mL and 1.1
0.4 to 292
3.2 mg/mL against bacterial (Bacillus subtilis, S. aureus, Pseudomonas aeruginosa, E. coli, and Enterobacter aerogenes) and fungal species (Aspergillus niger, Aspergillus flavus, Penicillium notatum, and Rhizopus microsporus), respectively. Tu et al. (2018) examined the antibacterial activity of chemically characterized essential oils of anise, peppermint, clove, cinnamon, pepper, citronella, and camphor against the gram-positive (B. subtilis and S. aureus) as well as gram-negative (E. coli and Salmonella typhimurium) bacteria. Among all, cinnamon EO exhibited a remarkable efficacy with the MIC value ranging between 0.125 and 0.25 mg/mL. Nikkhah et al. (2017) studied the antifungal efficacy of essential oils of thyme, cinnamon, rosemary, and marjoram against fruit rotting fungi Penicillium expansum and Botrytis cinerea. The results demonstrated that thyme and cinnamon oils were superior to the other with the lower MIC 312e625 mg/mL and 625e1250 mg/mL against Botrytis cinerea and Penicillium expansum. They also pointed out that the combination of cinnamon/rosemary/thyme has a more inhibitory effect than single EO treatments. da Rocha Neto et al. (2019) reported the antifungal efficacy of essential oils of Cymbopogon martinii, Illicium verum, and Melaleuca alternifolia against Penicillium expansum and elucidated the mode of action. The test EOs caused absolute inhibition (100%) of germination at 0.125 g/l (star anise) and 0.25 g/L (melaleuca and palmarosa). Further, the considerable damages to the plasma membrane, DNA, protein and glucose, and lipid have been reported as the speculated mode of action. Kujur et al. (2019) prepared a nanoencapsulated formulation based on methyl salicylate (MS) and examined its antifungal and aflatoxin B1 inhibitory effect against Aspergillus flavus. The minimum inhibitory concentration of nanoencapsulated MS against the growth and toxin production was found to be 1.00 mL/mL which was lower that the free MS. The study also demonstrated that the decrease in the ergosterol content, leakage of vital ions (Ca2þ, Mg2þ, and Kþ), and impairment in the utilization of different carbon sources by Aspergillus flavus could be the speculated mode of action of MS. Yadav et al. (2019) demonstrated the antimicrobial efficacy of nanoencapsulated mace (Ne-MEO) essential oil against foodborne molds, and aflatoxin B1 contamination. Ne-MEO exhibited better efficiency than the free MEO, as it causes complete inhibition of the growth and AFB1 production at a low dose of 1.25 mL/mL than the free MEO 1.50 mL/mL. Kumar et al. (2019) have prepared a synergistic formulation based on the combination of plant-based bioactive compounds, viz., thymol, methyl cinnamate, and linalool and studied their effect against a range of foodborne molds and aflatoxin B1 contamination in vitro as well as in the model food system. They also pointed out that the nanoformulation of developed formulation causes complete inhibition of growth and AFB1 production at a low dose of 0.3 mL/mL and 0.2 mL/mL, respectively. The antimicrobial activity of traditionally used plants and their bioactive compounds have been summarized in Table 1.1.

Table 1.1 Antimicrobial activity of plant-derived bioactive compounds. Plants

1.

Melaleuca alternifolia (Maiden and Betch)

2.

3.

Major bioactive components

Results

References

Terpinen-4-ol, a-terpineol, linalool, a-pinene and b-pinene, and 1,8cineole

Candida albicans, C. parapsilosis, Saccharomyces cerevisiae, Trichosporon sp., Rhodotorula rubra, Epidermophyton floccosum, Microsporum canis, Trichophyton mentagrophytes var. interdigitale, Aspergillus niger, A. flavus, A. fumigatus, and Penicillium sp.

MICs of M. alternifolia was ranged 0.03%e5.0% (v/v) against all test microbes.

Hammer et al. (2003)

Rosmarinus officinalis L.

a-pinene, 1,8-cineole, and camphor

A. flavus (LHP-6)

MIC of essential oil, a-pinene, 1,8-cineole, and camphor against the growth of A. flavus and aflatoxin B1 production was reported as (1.5, >5.0, 4.0 and 3.0 mL/mL) and (1.25, >5.0, 3.5 and 3.0 mL/mL), respectively.

Prakash et al. (2015)

Piper betle L.

Eugenol and acetyleugenol

Aspergillus flavus, Aspergillus niger, Aspergillus fumigatus, Aspergillus terreus, Aspergillus sydowi, Aspergillus candidus, Penicillium italicum,

MIC of P. betle was ranged from 0.3 to 0.7 mL/mL against all tested molds.

Prakash et al. (2010)

7

Microbes

Antimicrobial and antioxidant properties of phytochemicals

S.No.

Continued

Table 1.1 Antimicrobial activity of plant-derived bioactive compounds.dcont’d Plants

Major bioactive components

8

S.No.

Microbes

Results

References

Fusarium oxysporum, Alternaria alternate, Cladosporium cladosporioides, Curvularia lunata, Mucor sp., Nigrospora sp., and Mycelia sterillia Salvia tomentosa (Miller)

b-pinene, a-pinene, and camphor

Staphylococcus aureus, Streptococcus pneumonia, Moraxella catarrhalis, Bacillus cereus, Acinetobacter lwoffii, Enterobacter aerogenes, Escherichia coli, Klebsiella pneumonia, Proteus mirabilis, Pseudomonas aeruginosa, Clostridium perfringens, Mycobacterium smegmatis, Candida albicans, and Candida krusei

MIC of S. tomentosa was ranged from 0.54 to 72.0 mg/mL against all microorganisms.

Tepe et al. (2005)

5.

Ocimum basilicum L.

Linalool, epia-cadinol, a-bergamotene and c-cadinene

Bacterial strains: Staphylococcus aureus, Escherichia coli, Bacillus subtilis, Pasteurella multocida pathogenic fungi: Aspergillus niger, Mucor mucedo, Fusarium solani, Botryodiplodia theobromae, Rhizopus solani

MIC of O. basilicum was ranged from 1.3
0.0 to 4.9
0.3 mg/mL against all test bacteria and fungi.

Hussain et al. (2008)

Functional and Preservative Properties of Phytochemicals

4.

Mentha piperita L.

Menthone, menthol, pulegone, and 1,8cineole

Escherichia coli, Staphylococcus aureus, Pseudomonas aeruginosa, Enterobacter aerogenes, Proteus vulgaris, Salmonella typhimurium, Klebsiella pneumonia, Yersinia enterocolitica, Listeria monocytogenes, Bacillus cereus, Staphylococcus epidermidis, Xanthomonas campestris pv. Phaseoli, Pseudomonas syringae pv. Phaseolicola, Pseudomonas syringae pv. Tomato, Pseudomonas syringae pv. Syringae, Xanthomonas campestris pv. Campestris, and Candida albicans

MIC of M. piperita was ranged from 0.07 to 5.0 mg/mL. While, MIC of menthone and menthol were ranged from 0.625 to 5.0 mg/mL against all tested microbes.

Iscan et al. (2002)

7.

Artemisia annua L.

Camphor, germacrene D, trans-pinocarveol, b-selinene, b-caryophyllene, and artemisia ketone

Escherichia coli, Staphylococcus aureus, Enterococcus hirae, Candida albicans, and Saccharomyces cerevisiae

Completely inhibit the growth of test microbes at 0.1e0.2 mg/mL. No significant activity was seen against E. coli and S. aureus.

Juteau et al. (2002)

8.

Cuminum cyminum L.

Cymene and Gammaterpinene

Absidia ramose, Alternaria alternate, Aspergillus fumigatus, Aspergillus flavus, Aspergillus glaucus, Aspergillus niger, Aspergillus terreus,

C. cyminum essential oil inhibited 100% mycelium growth of all test foodborne mold at 0.6 mL/mL except R. stolonifer.

Kedia et al. (2014)

Antimicrobial and antioxidant properties of phytochemicals

6.

9

Continued

S.No.

Plants

Major bioactive components

Microbes

10

Table 1.1 Antimicrobial activity of plant-derived bioactive compounds.dcont’d Results

References

9.

Callistemon lanceolatus Sm.

1,8-cineole

Absidia ramose, Alternaria alternata, Aspergillus fumigatus, Aspergillus flavus, Aspergillus niger, Aspergillus oryzae, Chaetomium sp., Drechslera sp., Fusarium nivale, Fusarium oxysporum, Fusarium sp., Mucor sp., Penicillium citrinum, and Trichoderma sp.

C. lanceolatus showed 100% mycelium inhibition against all test foodborne mold at 0.908 mg/mL.

Shukla et al. (2012)

10.

Mentha spicata L.

Carvone and DLlimonen

Absidia ramose, Alternaria alternate, Aspergillus

M. spicata essential oil inhibited 100% mycelium

Kedia et al. (2014a,b)

Functional and Preservative Properties of Phytochemicals

Aspergillus unguis, Cladosporium cladosporioides, Curvularia lunata, Fusarium oxysporum, Mucor sp., Mycelia sterilia, Penicillium citrinum, Penicillium italicum, Penicillium luteum, Penicillium purpurogenum, Penicillium, Rhizopus stolonifer and Spondylocladium australe

growth of all test foodborne mold at 1.0 mL/mL except A. terreus and A. luchuensis.

Ocimum gratissimum L.

Methyl cinnamate, g eterpinene, and 1,8-cineole

Aspergillus flavus, Aspergillus niger, Aspergillus fumigatus, Aspergillus terreus, Aspergillus sydowi, Alternaria alternate, Penicillium italicum, Fusarium nivale, Curvularia lunata, and Cladosporium spp.

Ocimum gratissimum essential oil inhibited 100% mycelium growth of all test foodborne mold at 0.7 mL/ mL except A. niger.

Prakash et al. (2011)

12

Zanthoxylum alatum Roxb.

Linalool and methyl cinnamate

Aspergillus flavus

MIC of Zanthoxylum alatum essential oil, linalool, and methyl cinnamate compound were found to 1.25, 2.0, and 0.6 mL/mL against A. flavus, respectively.

Prakash et al. (2012a,b)

11

11.

Antimicrobial and antioxidant properties of phytochemicals

fumigatus, Aspergillus flavus, Aspergillus glaucus, Aspergillus niger, Aspergillus terreus, Aspergillus unguis, Cladosporium cladosporioides, Curvularia lunata, Fusarium oxysporum, Mucor sp., Mycelia sterilia, Penicillium citrinum, Penicillium italicum, Penicillium luteum, Penicillium purpurogenum, Penicillium, Rhizopus stolonifer, and Spondylocladium australe

Continued

Table 1.1 Antimicrobial activity of plant-derived bioactive compounds.dcont’d Microbes

Results

References

13.

Caesulia axillaris Roxb.

DL-Limonene

Aspergillus flavus, Aspergillus niger, Aspergillus terreus, Aspergillus fumigatus, Fusarium sp., Curvularia lunata, Pencillium sp., Mucorales, and Mycelia sterilia

MIC of Caesulia axillaris essential oil was ranged 0.75e1.25 mL/mL against all tested molds.

Mishra et al. (2012)

14.

Cymbopogon citratus (DC.) Stapf.

Citral, neral, b-myrcene and geraniol

Aspergillus fumigatus, Aspergillus niger, Aspergillus terreus, Alternaria alternata, Cladosporium herbarum, Curvularia lunata, Fusarium oxysporum, Penicillum italicum, and Trichoderma viride

C. citratus essential oil inhibited 100% fungal growth at 0.75 mL/mL except A. niger and C. herbarum.

Singh et al. (2010) Ali et al. (2017)

15.

Origanum vulgare ssp. Hirtum and Origanum dictamnus L.

Carvacrol, gterpinene, and a-caryophyllene

Escherichia coli (NCIMB 8879 and NCIMB 12210), Pseudomonas aeruginosa (NCIMB 12469), Salmonella typhimurium (NCIMB 10248), Staphylococcus aureus (NCIMB 9518 and NCIMB 8625), Rhizobium leguminosarum (NCIMB 11478), and Bacillus subtilis (NCIMB 3610).

The both EO exhibited high levels of antimicrobial activity against test bacterial strain.

Sivropoulou et al. (1996)

and

Euasarone

Functional and Preservative Properties of Phytochemicals

Plants

12

Major bioactive components

S.No.

Eugenol

Aspergillus fumigatus and Aspergillus niger, Microsporum canis, Microsporum gypseum, Trichophyton rubrum, Trichophyton mentagrophytes and Epidermophyton floccosum, Candida parapsilosis and Candida krusei

MIC of S. aromaticum EO was ranged between the 0.08e0.6 mL/mL against all tested fungi.

Pinto et al. (2009)

17.

Foeniculum vulgare Mill.

(E)-anethole, fenchone and methyl chavicol

Alternaria alternate, Aspergillus niger, Aspergillus ochraceus, Aspergillus versicolor, Aspergillus flavus Aspergillus terreus, Cladosporium cladosporioides, Fusarium tricinctum, Penicillium ochrochloron, Penicillium funiculosum, Phomopsis helianthi, Trichoderma viride, Trichophyton mentagrophytes Microsporum canis and Epidermophyton floccusum

MIC of F. vulgare essential oil was ranged between 0.8 and 3.2 mL/mL against all tested fungi.

Mimica-Duki
c et al. (2003)

18.

Ageratum conyzoides L.

Precocene II, precocene I coumarin, and Transcaryophyllene

Aspergillus flavus

A. conyzoides essential oil causes 100% inhibition of toxin production by the A. flavus at 0.1 mg/mL. However, at this dose it causes only 49% inhibition of growth.

Nogueira et al. (2010)

13

Syzygium aromaticum L.

Antimicrobial and antioxidant properties of phytochemicals

16.

Continued

Table 1.1 Antimicrobial activity of plant-derived bioactive compounds.dcont’d Plants

Major bioactive components

19.

Anethum graveolens L.

20.

14

S.No.

Results

References

Limonene, dillapiole, and carvone

Aspergillus flavus, Aspergillus oryzae, Aspergillus niger, and Alternaria alternata

A. graveolens essential oil completely inhibited the growth of all tested fungi at 2.0 mL/mL.

Tian et al. (2011) Mahran et al. (1992)

Cinnamomum jensenianum Hand.-Mazz

Eucalyptol and a-terpineol

Aspergillus flavus

C. jensenianum essential oil completely inhibited growth and AFB1 at 8.0 and 6 m/mL against A. flavus.

Tian et al. (2012)

21.

Gaultheria procumbens L.

Methyl salicylate

Aspergillus flavus (EC-03)

G. procumbens essential oil completely inhibited the growth and aflatoxin B1 at 1.50 mL/mL.

Kujur et al. (2017)

22.

Curcuma longa L.

Turmerone, a-Turmerone, and b-Turmerone

A. flavus (AF42)

C. longa essential oil causes considerable inhibition (93.41%) of growth at 8.0 mL/mL.

Ferreira et al. (2013) Hu et al. (2017)

23.

Olea europaea L.

Caffeic acid, verbascoside, oleuropein, luteolin 7-O-glucoside, rutin, apigenin 7O-glucoside, and luteolin 40 -Oglucoside

Gram-positive (Bacillus cereus, B. subtilis, and Staphylococcus aureus), gram-negative bacteria (Pseudomonas aeruginosa, Escherichia coli, and Klebsiella pneumoniae), and fungi (Candida albicans and Cryptococcus neoformans)

Leaf extracts contain high phenolic contents that exhibited considerable antibacterial and antifungal activity.

Pereira et al. (2007a,b)

Functional and Preservative Properties of Phytochemicals

Microbes

Magnolia grandiflora L.

Magnolol, honokiol, and 3,50 -diallyl-20 hydroxy-4methoxybiphenyl

Bacillus subtilis (ATCC 6633), Staphylococcus aureus (ATCC 6538), Escherichia coli (ATCC 10536), Pseudomonas aeruginosa (ATCC 15442), Mycobacterium smegmatis (ATCC 607), Candida albicans (ATCC 102311, Saccharomyces cerevisiae (ATCC 9763), Aspergillus niger (ATCC 16888), And Trichophyton mentagrophytes (ATCC 9972)

Phenolic compound, magnolol, honokiol, and 3, 50 -diallyl-20 -hydroxy-4methoxybiphenyl exhibited significant antimicrobial activity against grampositive bacteria, acid-fast bacterium, and yeastlike and filamentous fungi.

Clark et al. (1981)

25.

Cynara scolymus L.

Chlorogenic acid, cynarin, 3,5- di-Ocaffeoylquinic acid, 4,5-di-Ocaffeoylquinic acid, luteolin-7rutinoside, cynaroside, apigenin-7rutinoside, and apigenin-7-O-a-D glucopyranoside

Gram-positive bacteria: Bacillus subtilis (CGMCC 1.1849), Staphylococcus aureus (ATCC 6358P), Agrobacterium tumefaciens (CGMCC 1.1415), and Micrococcus luteus (CGMCC 1.880). Gramnegative bacteria: Escherichia coli (CGMCC 1.90), Salmonella typhimurium (CGMCC 1.1190), and Pseudomonas aeruginosa (CGMCC

MIC of test compounds were ranges between 50 and 200 mg/mL against all test microbes.

Zhu et al. (2004)

Antimicrobial and antioxidant properties of phytochemicals

24.

Continued 15

ˇ

Table 1.1 Antimicrobial activity of plant-derived bioactive compounds.dcont’d Plants

Major bioactive components

Microbes

Results

References

26.

Lupinus angustifolius L.

13aHydroxylupanine, lupanine, angustifoline

Staphylococcus aureus, Bacillus subtilis, Pseudomonas aeruginosa, Candida albicans, and Candida krusei

Alkaloids extracted of L. angustifolius causes 100% growth inhibition of S. aureus, B. subtilis, P. aeruginosa at 62.5 mg/L. While for C. albicans and C. krusei it was 250 mg/L.

Erdemoglu et al. (2007)

27.

Sida acuta Var.

Cryptolepine and quindoline,

Staphylococcus aureus, Enterococcus faecalis,Shigella boydii, Shigella flexneri, Shigella dysenteriae, Salmonella typhi, Salmonella paratyphi B, and Escherichia coli

Minimal bactericidal concentration (MBC) values range from 80 to 400 mg/mL against all tested bacterial spp.

Karou et al. (2006)

Functional and Preservative Properties of Phytochemicals

1.2031). Yeasts: Candida albicans (ATCC 10231), Candida lusitaniae (ATCC 2201), Saccharomyces cerevisiae (IFFI 1611), and Saccharomyces carlsbergensis (ACCCs 2166). Molds: Aspergillus niger (CGMCC 3.316), Penicillium oxalicum (CGMCC 3.4022), Mucormucedo (CGMCC 3.15), and Cladosporium cucumerinum (ATCC11,279)

16

S.No.

Antimicrobial and antioxidant properties of phytochemicals

17

4. Phytochemicals as a source of antioxidant agents Free radicals (atoms or molecules containing an unpaired electron in their atomic orbital) are unstable and highly reactive molecules that deteriorate the overall quality of food and confer various negative changes to the nutritional composition of food commodities. Superoxide anion, oxygen singlet, hydroxyl radical, hydrogen peroxide, nitric oxide radical, and peroxynitrite radical are some of the prevalent free radicals that confer damaging effect on biomolecules such as DNA, proteins, carbohydrates, and lipids. Although free radicals have played an important role in cellular homeostasis, the imbalance between free radical generation and antioxidant defense system of the cell leads to a critical condition called oxidative stress, responsible for the damaging effect to the biomolecules. In general, at low level the reactive oxygen species acts as a signaling agent; however, at high levels it becomes toxic. In the food system, the primary target sites of the free radicals are more often the lipids, nucleic acids, and proteins. Rancidity is a very common phenomenon of oxidation of lipid biomolecules that have a significant adverse effect on nutritional quality, flavors of food products, and overall quality of food items, making them unpalatable. A recent report suggests that lipid peroxidation products could have a negative impact on health including carcinogenic effect (Casadey et al., 2019). Therefore, the uses of antioxidants, either natural or synthetic, are recommended to prevent the damages caused by the free radicals. An antioxidant is a molecule that delays the oxidation process or neutralizes the free radical at lower concentrations than the substrate thereby reducing the damaging effect. The antioxidants can interact with free radicals and terminate the chain reaction required for the damaging effect of the vital cellular organ. Currently, vitamin E (a-tocopherol), vitamin C (ascorbic acid), b-carotene, butylhydroxyanisole (BHA), butylhydroxytoluene (BHT), propyl gallate (PG), and tertbutylated hydroquinone (TBHQ) are used as antioxidant agents in the food system. However, the prevalent synthetic antioxidant such as BHA, BHT, and PG are reported to have toxic, carcinogenic effect, and low solubility, respectively (Papas, 1999; Chanda and Nagani, 2010, 2013; Adamez et al., 2012; Botterweck et al., 2000). Therefore, the industries are looking for a natural alternative to synthetic antioxidants. In this context, traditionally used plant-based bioactive compounds (nonnutritive constituents usually occur in very small quantities), viz., flavonoids, carotenoids, phenolic acids, alcohols, tocopherols, lignans, stilbenes, tannins, and ascorbic acid that possess considerable antioxidant activity could be a preferred alternative to synthetic antioxidants that quench reactive oxygen species (ROS) with low toxicity (Ahmad and Aqil, 2007; Kasote et al., 2015). The green and black teas are the richest sources of antioxidants in the palatable form available to a significant number of the world population (Lin et al., 1998). Acacia catechu, Aegle marmelos, Allium sativum, Cinnamomum verum, Cinnamomum tamala, Curcuma longa, Emblica officinalis, Glycyrrhiza glabra, Momordica charantia, Murraya koenigii, Nigella sativa, Ocimum sanctum, Piper betle, and Zingiber officinalis (ginger) are some of the traditionally used plants that possess strong radical scavenging activity (Devasagayam et al., 2004). Currently, the essential oils of aromatic plants (Piper betle, Ocimum gratissimum, Zanthoxylum

18

Functional and Preservative Properties of Phytochemicals

alatum, Cinnamomum glaucescens, Cinnamomum zeylanicum Boswellia carteri, Rosmarinus officinalis) and their bioactive compounds (eugenol, geranyl acetate, 1,8-cineole, b-caryophyllene) have proven their efficacy as free radical scavengers (Prakash et al., 2010, 2011, 2012a,b, 2013, Kiran et al., 2016; Mishra et al., 2013). Lim et al. (2019) reported the antioxidant activities of Sargassum serratifolium using different solvent extracts such as ethyl acetate, hexane, ethanol, and methanol. They have reported that the hexane and ethyl acetate extract exhibited the strongest antioxidant activity over other solvents. Sargahydroquinoic acid, sargachromanol, and sargaquinoic acid have been identified as the major bioactive components responsible for antioxidant activity. Yadav et al. (2019) studied the free radical scavenging activity of Ne-MEO using DPPH (2, 2-diphenyl-1-picrylhydrazyl) assay and reported that the Ne-MEO exhibited promising antioxidant activity with IC50 2.1 mL/mL. Kiran et al. (2016) explored the antioxidant efficacy of Cinnamomum zeylanicum essential oil using DPPH, ferric reducing antioxidant power (FRAP), ABTS assay. They reported the total equivalent antioxidant capacities of oils using trolox as standard as 5.47, 11.99, and 2.66 mM trolox/mg for DPPH, FRAP, and ABTSþ respectively. The antioxidant activity was found to relate with the high phenolic content 106.95 mg gallic acid equivalents/mg. Samsonowicz et al. (2019) studied the antioxidant activity of acorns coffee infusions using DPPH, FRAP, ABTS, and phenolic content assay. Acorns coffee extract exhibited low EC50 values (EC50 ¼ 0.063e0.066 mgd.w./mL) for DPPH (EC50 ¼ 0.021e0.029 mgd.w./mL) for ABTS, and highest ability to Fe3þ reduction (FRAP) (w1.1 mmolFe/gd.w) with the high polyphenol (45e50 mgGA/gd.w) content. Da-Cruz et al. (2019) studied the comparative antioxidant activity of ripe and unripe acerola extracts with two prevalent synthetic antioxidants BHA and BHT using DPPH and ABTS assay. They have pointed out that even though the unripe acerola exhibited efficient antioxidant activity, it loses its efficacy in in vivo system that could be because of different factors such as chemical complexity, concentration, and localization of the oxidation site in the model organism or applicable system. Nowadays, different in vitro and in vivo methods have been used to investigate the antioxidant properties of plant-based bioactive compounds. In vitro methods such as DPPH scavenging activity, hydrogen peroxide scavenging (H2O2) assay, nitric oxide scavenging activity, peroxynitrite radical scavenging activity, ABTS radical cation decolorization assay, total radical-trapping antioxidant parameter (TRAP) method, ferric reducing antioxidant power (FRAP) assay, b-carotene linoleic acid method/conjugated diene assay are some the most common methods for screening of antioxidant potential of plant bioactive compounds. The in vivo assay such as reduced glutathione (GSH) estimation, glutathione peroxidase (GSHPx) estimation, glutathione-Stransferase (GST), reducing ability of plasma, superoxide dismutase (SOD), catalase (CAT) and lipid peroxidation (LPO) assay are used to decipher the antioxidant potential of phytochemicals in the model organism (Alam et al., 2013). Among all, the DPPH and LPO methods have been extensively used for in vitro and in vivo validation

Antimicrobial and antioxidant properties of phytochemicals

19

of antioxidant activity (Alam et al., 2013). The in vitro and in vivo antioxidant efficacy of plant-based bioactive compounds has been summarized in Table 1.2.

5. Phytochemicals as a source of functional food ingredients Since ancient time plant products have been used as a source of food, as well as for the treatment of chronic health diseases. Even in the modern era of science, as per an estimate by the World Health Organization, nearly 80% of the world population still relies on plant-based formulations for their primary healthcare. In general, plants harbor a complex mixture of bioactive compounds that possess functional properties claiming beneficial physiological effects, in addition to their nutritive function (Prakash et al., 2017). Plant-derived bioactive compounds such as isoflavones (soy extracts), lycopene (tomato) lutein, and zeaxanthin (spinach and collard greens), b-glucan (oat), allicin, allylic sulfides (garlic), curcumin (haldi), and (-)-epicatechin, (-)-epicatechin-3gallate, (-)-epigallocatechin, and (-)-epigallocatechin-3-gallate (green tea) have already been used as food supplements to boost health (Prakash et al., 2017). Thus, plant-derived bioactive compounds could be used as functional food (food that provides health benefits beyond the essential nutrients) ingredients to design the fortified food for the effective treatment of chronic disease through diet. Table 1.3 summarizes the functional properties of plant-derived bioactive compounds and their probable mode of action.

6. Mechanism of action Phytochemicals exert their antimicrobial activity through different mechanisms. In general the antimicrobial mechanism of action of phytochemicals is related to changes in the cell morphology, membrane disruption associated with ion leakage, reduction of membrane potential, impairment in the intracellular pH homeostasis, changes in proteome and transcriptome, inhibition of ATP-ase activity, enzymatic reaction, toxins biosynthesis, biofilm formation, antiquorum sensing, suppression of virulence factors, inhibiting nucleic acid synthesis, altering the lipid profile composition, mitochondrial dysfunction, and impairment in the carbon source utilization (Vasconcelos et al., 2018; Lagrouh et al., 2017; Kumar et al., 2019). Thus, the plant bioactive compounds cause considerable alteration in the various biological functions of the cell that lead to impairment in the vital cellular processes required for the survival of the cell (Fig. 1.1) (Oussalah et al., 2007). The antioxidant mechanistic investigation is related to depleting molecular oxygen, removing prooxidative metal ions, and quenching of reactive oxygen species such as superoxide anion radical, hydrogen peroxide, and scavenging chain-initiating radicals (hydroxyl HO$, alkoxyl RO$, or peroxyl ROO$). Based on the mechanism of action, the antioxidants can be divided into two groups, primary and secondary. The primary

Table 1.2 In vitro and In vivo antioxidant activities of plant-derived bioactive compounds. Major compounds

Antioxidant methods

20

Plant

Results

References 1

Myrcene, a-pinene, and limonene

DPPH FRAP ABTS•þ

IC50 ¼ 29.64
3.04 mg mL , IC50 ¼ 38.57
4.22 mg mL1, IC50 ¼ 73.80
3.96 mg mL1

Bouyahya et al. (2019)

Mentha piperita L. (Peppermint)

Menthol, menthone, transcarane

DPPH b-carotene NO radical activity

IC50 ¼ 4.45
0.75 mL mL1 IC50 ¼ 0.37
0.05 mL mL1 IC50 ¼ 0.42
0.01 mL mL1

Riachi & De Maria (2015)

Mentha piperita L. (Chocolate mint)

Menthol, menthone, 1,8cineole

DPPH b-carotene NO radical activity

IC50 ¼ 19.86
1.25 mL mL1 IC50 ¼ 5.07
0.17 mL mL1 IC50 ¼ 0.31
0.06 mL mL1

Tsai et al. (2013)

Citrus lumia Risso

D-Limonene,

b-carotene ORAC DPPH Folin- Ciocalteu FRAP TEAC

IC50 ¼ 22 mg mL1 IC50 ¼ 46 mg mL1 IC50 ¼ 104 mg mL1 IC50 ¼ 181 mg mL1 IC50 ¼ 202 mg mL1 IC50 ¼ 233 mg mL1

Smeriglio et al. (2018)

Cananga odorata Hook.f. and Thomson

Linalool, Linalool acetate, a-Pinene, Eugenol, a-Terpineol, acetate, etc.

DPPH b-carotene

IC50 ¼ 1.30
0.03 mL mL1 51.28
0.34% inhibition

Prakash et al. (2012a); Cheng et al. (2012)

Achillea millefolium subsp. millefolium Afan.

Eucalyptol, camphor, a-terpineol, b-pinene, and borneol

DPPH OH LPIC

IC50 ¼ 1.56
0.03 mg mL1 IC50 ¼ 2.70
0.03 mg mL1 IC50 ¼ 13.50
0.07 mg mL1

Candan et al. (2003)

Ocimum labiatum

Labdane

DPPH FRAP CUPRAC Crocin bleaching assay

IC50 ¼ 13
0.8 mg mL1 IC50 ¼ 53.62
0.57 mg mL1 IC50 ¼ 47.32
0.76 mg mL1 IC50 ¼ 54.86
1.28 mg mL1

Kapewangolo et al. (2015)

Linalool, Linalyl anthranilate, b-Pinene, and a-Terpineol

Functional and Preservative Properties of Phytochemicals

Pistacia lentiscus L.

Naringin, chlorogenic acid, quercetin, gallic acid, and rosmarinic acid

DPPH

IC50 ¼ 12.87 mg mL1

Rebey et al. (2019)

Allium cepa L.

Quercetin, Protocatechuic acid, and Isorhamnetin

DPPH FRAP OH

IC50 ¼ 43.24 mg mL1 IC50 ¼ 560.61 mg mL1 IC50 ¼ 12.97 mg mL1

Ouyang et al. (2018)

Pinus koraiensis

Chlorogenic acid, apigenin hexoside, phloretin-Chexoside, quercetin 3-Opentoside, etc.

ABTS•þ DPPH

IC50 ¼ 523.44
36.98 mg (VCE)/g IC50 ¼ 111.26
17.09 mg VCE/g

Wang et al. (2019)

Zanthoxylum alatum Roxb.

Linalool, methyl cinnamate, DL-limonene, b-myrcene

DPPH b-carotene

IC50 ¼ 5.6
00.06 mL mL1 29.08
0.31% inhibition

Prakash et al. (2012b)

Citrus lumia

Chlorogenic acid, vanillic acid, ferulic acid, eriocitrin, neoeriocitrin, hesperidin

TEAC DPPH ORAC Folin-Ciocalteu b-Carotene FRAP

IC50 ¼ 73.19 mg mL1 IC50 ¼ 533.03 mg mL1 IC50 ¼ 2.57 mg mL1 IC50 ¼ 8.94 mg mL1 IC50 ¼ 118.21 mg mL1 IC50 ¼ 5.22 mg mL1

Smeriglio et al. (2019)

Passiflora ligularis Juss.

Ellagic acid, gallic acid, and rutin

DPPH ABTS•þ FRAP O• 2 radical activity NO• radical activity • OH radical activity

IC50 ¼ 19.13 mg mL1 9800.94 mmol L1 trolox equi/g 43.06 mmol Fe (II)/mg 78.27% inhibition 79.95% inhibition 77.90% inhibition

Saravanan and Parimelazhagan (2014)

Malus domestica

Favanoid, flavanol, tannin

ABTS DPPH FRAP

3.10e67.36 mmol AAE kg1 FW 4.99e14.06 mmol AAE kg1 FW 4.70e39.21 mmol AAE kg1 FW

Bahukhandi et al. (2018)

21

Continued

Antimicrobial and antioxidant properties of phytochemicals

Pimpinella anisum L.

22

Table 1.2 In vitro and In vivo antioxidant activities of plant-derived bioactive compounds.dcont’d Results

References

Gallic acid, protocatechuic acid, 3, 4dihydroxyphenylacetic acid, chlorogenic acid, 4hydroxybenzoic acid, caffeic acid, etc.

DPPH ABTS CUPRAC FRAP

29.45
0.46 mg TE/g dp 32.34
1.76 mg TE/g dp 73.17
0.30 mg TE/g dp 41.89
0.55 mg TE/g dp

Elfalleh et al. (2019)

Rosmarinus officinalis

a-pinene, 1,8-cineole, and camphor

DPPH b-carotene

IC50 ¼ 0.042 mL mL1 71.05% inhibition

Prakash et al. (2015)

Syzygium cumini

Gallic acid, quercetin, caffeic acid, sinapic acid, and delphinidin chloride

DPPH ABTS FRAP

6.7 mM TE/g dw 8.2 mM TE/g dw 7.5 mM TE/g dw

Singh et al. (2016)

Thymus mastichina subsp. mastichina

Chlorogenic acid, caffeic acid, rosmarinic acid, luteolin glucoside, and luteolin

DPPH FRAP

44e98 mg TE/g DW 52e115 mg TE/g DW

Méndez-Tovar et al. (2015)

Gastrocotyle hispida

b-Sitosterol, b-sitosterol 3glucoside, 1-Ob-glucopyranosyl-1, 4dihydroxy-2prenylbenzene, 6-hydroxy2, 2-dimethyl-3-chromen, rosmarinic acid

DPPH ABTS

IC50 ¼ 10.2e234 mg mL1 IC50 ¼ 5.2e241.8 mg mL1

Shahat et al. (2019)

Cinnamomum zeylanicum Blume

Phenol, 2-methoxy-3-(2propenyl), caryophyllene, 2-propenal, 3-phenyl, etc.

DPPH FRAP ABTSþ

5.47 mM trolox/mg 11.99 mM trolox/mg 2.66 mM trolox/mg

Kiran et al. (2016)

Major compounds

Stachys tmolea

Functional and Preservative Properties of Phytochemicals

Antioxidant methods

Plant

Quinolone (4-carbomethoxy6-hydroxy-2-quinolone)

DPPH

IC50 ¼ 36.4 mg mL1

Chung & Woo (2001)

Fumaria officinalis

Protopine, cryptopine, sinactine, parfumine, adlumine, fumariline, fumaritine, fumarophycine, stylopine, bicuculline, and corlumine

DPPH ABTS•þ LPIC

IC50 ¼ 15.74
0.04 mg mL1 IC50 ¼ 70.71
0.04 mg mL1 IC50 ¼ 41.67
0.17 mg mL1

KhamtacheAbderrahim et al. (2016)

Fumaria bastardii

Protopine, stylopine,fumaritine, fumaricine, fumarophycine, fumariline, fumarofine

DPPH

IC50 ¼ 50 mg mL1

Maiza-Benabdesselam et al. (2007)

Ocimum gratissimum L.

Methyl cinnamate, geterpinene, 1,8-cineole, isoleden, P-allylanisole, etc.

DPPH b-carotene

IC50 ¼ 5.5 mL mL1 27.12% inhibition

Prakash et al. (2011)

Coptidis Rhizoma

Berberine, magnoflorine, palmatine, jateorrhizine, epiberberi ne, coptisine, and groenlandicine

NORAC

IC50 ¼ 0.78e23.06 mM

Jung et al. (2009)

Stephania rotunda

Cepharanthine and fangchinoline

DPPH ABTS•þ DMPD•þ

IC50 ¼ 6.4e22.2 mg mL1 IC50 ¼ 3.90e7.26 mg mL1 IC50 ¼ 19.4e21.6 mg mL1

G€ ulçin et al. (2010)

Plumula nelumbinis

Norcoclaurine, argemexirine, lotusine, norisoliensinine, etc.

DPPH ORAC FRAP

IC50 ¼ 81.86e99.85 mg mL1 0.25e5.53 mmol Trolox/mg DW 0.43e1.50 mmol Fe (II)/mg DW

Tian et al. (2018)

23

Continued

Antimicrobial and antioxidant properties of phytochemicals

Oryza sativa cv. Heugjinmi

24

Table 1.2 In vitro and In vivo antioxidant activities of plant-derived bioactive compounds.dcont’d Results

References

Iraqiine, kareemine, muniranine, kinabaline, Omethylmoschatoline, Nmethylouregidione

DPPH

IC50 ¼ 48.77e144.15 mg mL1

Aldulaimi et al. (2019)

Crinum latifolium

4,8-dimethoxy-cripowellin C, 4,8-dimethoxy-cripowellin D, 9-methoxy-cripowellin B, 4-methoxy-8-hydroxycripowellin B

DPPH ABTS•þ

IC50 ¼ 62.1e130.7 mM IC50 ¼ 52.2e125.6 mM

Chen et al. (2018)

Ocimum minimum L.

Eugenol, a-terpinolene, 1.8cineole, terpineol-4, germacrene D, etc.

FRAP DPPH TBARS

2.7 mmol Trolox/L 95.9% inhibition 87.2% inhibition

Alves-Silva et al. (2013)

Pergularia daemia

40 5,7 Trihydroxy isoflavone, a- carotene, 11 Octadecanoic acid methyl ester, heptadecanoic acid 16 methyl-methyl ester, etc.

SOD CAT GPx GSH Vitamin C

0.55e3.84 min/mg ptn 4.23e6.98 mmol/min/mg ptn 3.23e4.58 min/mg ptn 0.33e0.43 min/mg ptn 365e460 mg/mg ptn

Sridevi et al. (2018); Packirisamy et al. (2017)

Azima tetracantha Lam.

FRIEDELIN (40 MG/KG) þ CCL4

SOD CAT GPx GSH

42.47 U/mg protein 163.66 U/mg protein 284.33 mU/mg protein 3.33 m/mg protein

Sunil et al. (2013)

Major compounds

Alphonsea cylindrica

DPPH ¼ 2,2-diphenyl-1-picrylhydrazyl, ABTS•þ ¼ 2,20 -azino-bis(3-ethylbenzothiazoline-6-sulphonic acid), FRAP ¼ Ferric Reducing Antioxidant Power, TBARSs ¼ Thiobarbituric acid reactive substances, ORAC ¼ Oxygen Radical Absorbance Capacity, LPIC ¼ Lipid Peroxidation Inhibition Capacity, DMPD ¼ N, N-dimethyl-p-phenylenediamine,CUPRAC ¼ Cupric Reducing Antioxidant Capacity, TEAC ¼ Trolox Equivalent Antioxidant Capacity, NORAC ¼ Peroxynitrite Averting Capacity, SOD ¼ Superoxide Dismutase, CAT ¼ Catalase, GPx ¼ Glutathione Peroxidase, GSH ¼ Reduced Glutathione.

Functional and Preservative Properties of Phytochemicals

Antioxidant methods

Plant

Table 1.3 Functional properties of plant-derived bioactive compounds and their mode of action. Functional activity

Mechanism of action

References

Acemannan

Aloe vera

Wound healing activity

Induction of cell proliferation along with hard tissue regeneration and stimulation of Vascular Endothelial Growth Factor (VEGF) and type I collagen synthesis

S
anchez-Machado et al. (2017)

Andrographolide

Andrographis paniculata

Decreased platelets aggregation

Induced by thrombin concentration

Thisoda et al. (2006)

Allicin

Allium sativum

Antioxidant activity

Thiol containing proteins, particularly those which possess very reactive or unshielded SH-groups

Rabinkov et al. (1998)

Acetogenins

Annona muricata

Anticancerous activity(enhancing the effect of chemotherapy)

Block production of adenosine triphosphate (inhibition of the mitochondrial complex I (NADH: ubiquinone oxidoreductase))

Zafra-Polo et al. (1998)

Cannabinoids

Cannabis sativa

Antiemetic effect (Prolonged nausea and emesis/vomiting as side effect of cancer chemotherapeutic drugs)

Induce inhibition of digestive tract motility caused by blockage of acetylcholine release and act on CB1 receptors that are localized in the dorsalevagal complex of the brainstem (region that controls the vomiting reflex)

Guzman (2003)

Saponins

Centella asiatica

Wound healing effect

Decrease the expression of interleukin 1 beta (il-1b) and nuclear factor kappa light-chain-enhancer of activated b cells (NF-kB), reduce the expression of matrix metalloproteinases, increase epithelialization, and enhance collagen synthesis

Mahmood et al. (2016)

25

Plant source

Antimicrobial and antioxidant properties of phytochemicals

Compounds

Continued

26

Table 1.3 Functional properties of plant-derived bioactive compounds and their mode of action.dcont’d Plant source

Functional activity

Mechanism of action

References

Matrine

Sophora flavescens

Treatment of Autoimmune diseases (Sclerosis)

Inhibit ICAM-1, VCAM-1 (adhesive molecule), CCL3 and CCL5 (chemokines)

Kan et al. (2013)

Quinine

Cinchona calisaya

Antimalarial effect

Target the metabolic process of parasite

Foley and Tilley (1997)

Artemisinin

Artemisia annua

Antimalarial effect

Alkylation of heme along with protein, causing inhibition of PFATP6, accumulating within neutral lipids and damaging parasite membrane

O’Neill et al. (2010)

Plumbagin

Plumbago zeylanica

Antidiabetic effect

Enhance GLUT 4 translocation of glucose causing glucose homeostasis

Sunil et al. (2012)

Catechins

Camellia sinensis

Neuroprotective effects

Inhibit neurodegenerative cascade leading to the prevention of cell death and induce eNOS production, which acts as a neuroprotectant

Sutherland et al. (2006)

Lycopene

Solanum lycopersicum

Antioxidant activity

Can trap singlet oxygen

Trejo-Solís et al. (2013)

Curcumin

Curcuma longa

Antiinflammatory properties

Formation and utilization of cellular arachidonic acid for the generation and release of proinflammatory eicosanoids, such as prostaglandins and leukotrienes

Joe et al. (2004)

Functional and Preservative Properties of Phytochemicals

Compounds

Antimicrobial and antioxidant properties of phytochemicals

27

antioxidants are free radical scavengers that act by donating a hydrogen atom to prevent/delay the various steps in autooxidation and propagation. Butylated hydroxytoluene (BHT), butylated hydroxyl anisole (BHA), tert-butylated hydroquinone (TBHQ), and propyl gallate (PG) are the commonly used primary antioxidants, in the food system, which donate the H2 atom to free radicals such as ROO. and convert them into stable antioxidant radicals, and thereby prevent the further progress of the reaction. Contrary to this, the secondary antioxidants exert their efficacy by chelating the prooxidants and converting the hydroperoxides to nonradical species, scavenging oxygen, absorbing UV radiation, inhibiting the various enzymes. For instances, ascorbic acid, ascorbyl palmitate, and sulfites prevent oxidation by scavenging oxygen; carotenoids (b-carotene, lycopene, and lutein) quench the singlet oxygen; citric acid and ethylenediaminetetraacetic acid (EDTA) chelate the metals (Figs. 1.2) (Makris and Boskou, 2014).

7. Current existing limitations and role of modern science and technological innovations to boost the antimicrobial and antioxidant potential of phytochemicals in the food system Although plant products have been used for millennia as a source of antimicrobial and antioxidant agents, the availability of raw materials, seasonal variation, and high cost

Figure 1.1 Schematic representation of antimicrobial activity of phytochemicals.

28

Functional and Preservative Properties of Phytochemicals

Figure 1.2 Schematic representations of commonly used antioxidant methods of phytochemicals and their speculated mode of action.

compared to synthetic preservatives restrict their commercial use. In addition, most of the information available is often limited to in vitro tests which are insufficient for a better understanding of the preservative and functional utility of phytochemicals in the food system. The study of the effects of absorption, distribution, metabolism, bioavailability, and toxicity during in vivo applications is lacking/limited so far in the literature. Further, more often the phytochemicals could not exert their full preservative effect in the food system compared to in vitro assessment. Therefore, it is imperative that the current existing limitations of phytochemicals must be considered as a priority of research. To achieve this, an effective transdisciplinary collaboration between research institutions, universities, food industries, and regulatory authorities at regional, national, and international levels is required. In view of recent consumer awareness toward green consumerism, the use of plant-based bioactive compounds has been preferred as a safer alternative to synthetic food additives. Therefore, there is a strict need for evaluation of stability, sensory acceptance, toxicity, and regulatory aspect of phytochemicals either alone or as adjuvant in the food system. Further, the use of modern science and technological innovations such as biotechnology, extraction methods, nanotechnology, and bioinformatics could expand the application domain of high-value phytochemicals and also overcome the current hurdles faced in the commercial production and utility of plant-based preservative agents in the food system.

7.1

Use of waste material

The plant waste materials such as leaves, flowers, vegetable, and fruits peels during harvesting and processing in various industries are currently one of the primary causes of environmental pollution. A recent study revealed that such waste products possess potent antimicrobial and antioxidant activity and could be used as economical alternative sources of bioactive phytochemicals. In spite of tremendous antimicrobial and

Antimicrobial and antioxidant properties of phytochemicals

29

antioxidant potential, these plant wastes are thrown into the environment as unused items due to lack of awareness, technological advancement, and support from the local authorities. Vegetable and fruit waste material such as peels, seeds, stems, and pulp are the richest source of flavonoids, phenolic vitamin C, carotenes, tocopherols, terpenes, and sterols (Anwar et al., 2018; Guo et al., 2003). Therefore, these waste products are currently gaining considerable interest as an environmentally friendly and costeffective source of bioactive compounds. We hope that diversified use of all available techniques, especially extraction process, could enhance the application domain of waste materials as a source of the plant-based antimicrobial and antioxidant agent in the near future. The antimicrobial and antioxidant activity of waste plant materials have been summarized in Table 1.4.

7.2

Extraction technologies of phytochemicals

The modern extraction technique offers low-cost isolation, separation, and purification of phytochemicals than the conventional method. The recent advancement in the extraction technologies such as ultrasound-assisted extraction, microwave-assisted extraction, pressurized liquid extraction, supercritical fluid extraction, and pulse electric field have explored the application domain of phytochemicals in the food industries. Nowadays, ultrasound-assisted extraction and microwave-assisted extraction have been widely used to extract biologically active phytochemicals from plant materials. These techniques have significantly reduced the extraction time with low solvent volume and high yield of phytochemicals. Further, the spectroscopic techniques such as UV-visible, infrared, nuclear magnetic resonance, and mass spectroscopy have revealed the structure of phytochemicals which help in the prediction of toxicity and mechanism of action against the targeted microbes.

7.3

Biotechnology approaches

The recent advances in genomic, transcriptomic proteomic, and metabolomic studies could play an important role in the identification of biosynthetic genes, mRNAs, proteins which are responsible for the production of all kinds of primary and secondary metabolites. The study of RNA transcripts produced under specific circumstances could enhance the practical potential of phytochemicals. Today, a range of bioactive compounds that possess antimicrobial, antitumor, enzyme inhibiting, immunemodulating, fungicidal, and herbicidal properties have been discovered with their targeted site of action. The application of biotechnological advances could enhance the application domain of phytochemicals in the food industries.

7.4

Nanotechnology approach

Nowadays, nanotechnology has been used to encapsulate the plant bioactive compounds to enhance their inherent bioactivity, stability, and bioavailability at the targeted site. Currently, a range of nanodelivery systems such as solid lipid nanocarriers, nanoemulsions, and nanoliposomes have been used for the effective

Table 1.4 Antimicrobial and antioxidant activity of waste plant parts. Sr. No. Plants

Part (waste material) Major compounds

1

Rosa damascene Mill.

Flower

2

Citrus sinensis L.

3

Citrus aurantifolia Christm.

Antimicrobial

Antioxidants

Microbes

Results

Method

Results

References

Phenyl ethylalcohol, citronellol, nerol, and geraniol

Chromobacterium violaceum (ATCC 12472), Escherichia coli (ATCC 25922), Pseudomonas aeruginosa (ATCC 27853), Bacillus subtilis (ATCC 6633), Staphylococcus aureus (ATCC 6538), and Erwinia carotovora (ATCC 39048).

Strong antimicrobial activity against all test microbes; C. violaceum 12472 was reported as most sensitive (inhibition zone >25 mm).

DPPH (phosphomolybdenum complex) Antioxidant capacity

74.51% inhibition of free radical (at 100 ppm). 372.26
0.96 mg/g extract equivalent to ascorbic acid.

Ulusoy et al. (2009), Ozkan et al. (2004)

Peels

D-Limonene

Salmonella typhi, Bacillus MIC ranged between 0.5 ABTS DPPH and 2.0 mg/mL cereus, Staphylococcus against all tested aureus, and Listeria microbes. monocytogenes.

IC50 ¼ 68.40
0.39 mg/mL Torres-Alvarez IC50 ¼ 70.17
5.15 mg/mL et al. (2017)

Peels

b-pinene, limonene, gterpinene, terpinolene, a-terpineol and citral

DPPH MIC against all test Bacillus subtilis, microbes were ranged ABTS Enterococcus durans, from 0.25% to 1.00% Enterococcus hirae, v/v Listeria monocytogenes, Staphylococcus aureus, Staphylococcus epidermidis, Enterobacter cloacae, Proteus mirabilis, Pseudomonas aeruginosa, Escherichia coli, Serratia marcescens¸ Salmonella typhi, and Candida albicans

IC50 ¼ 201.3
3.2 mg/mL IC50 ¼ 19.6
1.1 mg/mL IC50 ¼ 42.6 mg/mL after 60 min

Costa et al. (2014), Tundis et al. (2012)

Limonene, geranial, neral, Alternaria alternata, Rhizoctonia solani, geranyl acetate, Curvularia lunata, geraniol, Fusarium oxysporum, b-caryophyllene,nerol, and Helminthosporium and neryl acetate oryzae

MIC of C. reticulate was DPPH found to be 0.2 mL/ 100 mL for A. alternata, R. solani, and C. lunata.

EC50 ¼ 0.179 mg/mL

Chutia et al. (2009), Tumbas et al. (2010)

Citrus lemon L. Peels

Limonene, a-Terpineol, linalyl acetate, and Linalool

Aspergillus niger, Aspergillus flavus, Penicillium chrysogenum, and Penicillium verrucosum

DPPH Complete inhibition of growth of test molds b-carotene bleaching at concentration of 0.94% of essential oil

IC50 ¼ 15.056 mg/mL IC50 ¼ 40.147 mg/mL

Viuda-Martos et al. (2008), Hsouna et al. (2017)

6

Citrus paradisi L.

D-limonene,

b-Myrcene, a-Pinene, and Caryophyllene

Aspergillus niger, Aspergillus flavus, Penicillium chrysogenum, and Penicillium verrucosum

DPPH Complete inhibition of growth of test molds ABTS at concentration of 0.94% of essential oil

EC50 ¼ 40 mg/mL EC50 ¼ 25.7 mg/mL

Viuda-Martos et al. (2008), Ou et al. (2015)

7

Punica Fruit peel granatum L.

IC50 ¼ 302.43
1.9 mg/mL, IC50 ¼ 294.35
1.68 mg/mL

Barathikannan et al. (2016)

4

Citrus Reticulate Blanco

5

Peels

Peels

5-hydroxymethylfurfural, Escherichia coli MTCC 4-fluorobenzyl alcohol 441, Klebsiella pneumonia ATCC 1705, Streptomyces diastaticus MTCC 1394, and Enterococcus faecalis MTCC 439. Enterobacter aerogenes,

Studied the effect of solvent extract (hexane, ethyl acetate, methanol) and reported that ethyl acetate extract exhibited broadspectrum antimicrobial activity

DPPH Total antioxidant activity

Continued

Table 1.4 Antimicrobial and antioxidant activity of waste plant parts.dcont’d Sr. No. Plants

Part (waste material) Major compounds

Antimicrobial Microbes

Results

Antioxidants Method

Results

References

IC50 ¼ 29.48 mg/mL

Tripathi et al. (2012)

Klebsiellapneumoniae, Enterococcus faecalis, Staphylococcus epidermidis, Mycobacterium smegmatis and Escherichia coli, Aspergillus flavus, A. niger, and Curvularia lunata 8

Tagetes erecta L.

Flower

cis-ocimene, L-limonene, (E)-tagetone, (E)oscimene, and b-caryophyllene

Staphylococcus aureus (MTCC 3160), Klebsiella pneumonia (MTCC 7028), Pseudomonas aeruginosa (MTCC 2581) and Xanthomonas oryzae (ITCC B-47) Rhizoctonia solani, Sclerotium rolfsii, and Macrophomina phaseolina

MIC of essential oil was DPPH ranged between 20.83 and 93.33 mg/mL against bacteria. It also showed remarkable antifungal activity against R. solani (EC50 ¼ 235.00 mg/ L), S. rolfsii (EC50 ¼ 483.349 mg/ L), and M. phaseolina (EC50 ¼ 1280.98 mg/l)

DPPH (2 2-diphenyl-1-picrylhydrazyl), ABTS (2,20 -azino-bis(3-ethylbenzothiazoline-6-sulphonic acid)), MIC, MTCC ¼ Microbial Type Culture Collection, ITCC ¼ Indian Type Culture Collection, ATCC ¼ American Type Culture Collection.

Antimicrobial and antioxidant properties of phytochemicals

33

delivery of plant-based bioactive compounds in the food system. In general, the nanoencapsulated bioactive compounds exhibited strong efficacy over the free form due to the increased surface area, protection of encapsulated compounds from external (oxygen, light, and moisture) as well as the internal environment (pH variation, chemical composition of food, and water activity) of food system with controlled release. Although the use of nanotechnology in the food science has enormous potential to boost the preservative potential of plant-based bioactive compounds, the lack of information about the possible interaction of nanoparticles with the food components, living cells, and consumers’ organs limits the regulatory approval of most of the carrier agents in the food system. Therefore, a detailed understanding of the possible interaction between the nanomaterials and food component as well as its intended effect on the consumers’ health must be explored for their worldwide application.

7.5

Bioinformatics

Bioinformatics plays a central role in almost every field of biological science, and it also has a revolutionary impact on food science. The technique helps in compilation of huge data obtained from genomic, transcriptomic, proteomic, and metabolomic approaches to obtain useful information related to biological activity of plant-based bioactive compounds. In the past few years, bioinformatics has received significant attention from the researchers for the preliminary screening of bioactive compounds and their biological activity with the target sites. The bioinformatics approaches reduce the time expense during the pipeline process, viz., target selection, lead compound identification, optimization, and in vitro evaluation of selected bioactive compounds. Thus, the use of in silico-associated molecular tools such as computer modeling, virtual screening, and properties predictions significantly decrease the time and money consuming steps during the screening process of novel bioactive compounds.

7.6

Mathematical modeling

The availability of raw material of the active ingredient of plant is one of the obstacles for their commercial use. Further, in most of the cases, the active phytochemical constituents of plants are usually present in very less quantity; hence their use for commercial purpose is not possible. Therefore, currently the use of semisynthetic formulation based on the combination of plant bioactive compounds and the available synthetic preservative agent would have more prospect than the individual compound in a sustainable manner. Further, the literature review suggested that the combined effect of phytochemicals have a more significant result compared to the individual effect of a single plant due to the synergism. Therefore, the mathematical approaches such as simplex centroid design, partial least squares regression modeling, full factorial design, etc., could be used for the development of novel synergistic formulation to address the insufficient availability of raw material and cost-benefit ratio, thus expanding the application domain of plant-based compounds in food industries.

34

7.7

Functional and Preservative Properties of Phytochemicals

Regulatory approval

Before commercial application of phytochemicals that possess strong antimicrobial and antioxidant activity in food system, their safety assessment including toxicity, their interaction with the vital cellular components of food items, and product chemistry must be scrutinized for worldwide acceptability. Therefore, any food additive either based on phytochemicals or their derivatives must be approved by the regulatory authorities, viz., USFDA, European Food Safety Authority (EFSA), Food Safety and Standard Authority of India (FSSAI), and China Food Additives Association (CFAA). A range of traditionally used essential oils, plant extracts, and their bioactive products have been listed in Generally Recognized as Safe (GRAS) by US-FDA that could be used as food preservatives (Prakash et al., 2018). Hence, in the near future effective regulation of plant-derived antimicrobials and antioxidants could be expected for their worldwide application.

8.

Conclusion

The plant-based bioactive compounds exhibited potent antimicrobial, antioxidant, and functional activity and proved their potential use as a preferred alternative to the chemical preservative agents. Many of them have been recognized as GRAS by US-FDA, which enhances their potential use in the food system with minimal safety concerns. However, the insufficient availability of raw materials, toxicity, low stability, high production costs, unknown mode of action, and lack of effective regulatory system limit the commercial uses of plant-based bioactive compounds. Therefore, the present obstacles of plantbased bioactive compounds must be addressed for their commercial use and worldwide acceptability. We hope that the transdisciplinary research between the research institutions, universities, food industries, and regulatory authorities at local, regional, national, and international levels could successfully address the current obstacles and help in developing cost-effective plant-based preservatives and functional food ingredients.

Acknowledgments The authors acknowledge the financial support from the Science and Engineering Research Board (SERB), New Delhi, India, under Early Carrier Research Awards (Project ECR/2016/ 000299).

Conflict of Interest The authors declare no conflict of interest.

Antimicrobial and antioxidant properties of phytochemicals

35

References Ad
amez, J.D., Samino, E.G., S
anchez, E.V., Gonz
alez-G
omez, D., 2012. In vitro estimation of the antibacterial activity and antioxidant capacity of aqueous extracts from grape-seeds (Vitis vinifera L.). Food Control 24 (1e2), 136e141. Ahmad, I., Aqil, F., 2007. In vitro efficacy of bioactive extracts of 15 medicinal plants against ESbL-producing multidrug-resistant enteric bacteria. Microbiological Research 162 (3), 264e275. Alam, M.N., Bristi, N.J., Rafiquzzaman, M., 2013. Review on in vivo and in vitro methods evaluation of antioxidant activity. Saudi Pharmaceutical Journal 21 (2), 143e152. Aldulaimi, A.K.O., Azziz, S.S.S.A., Bakri, Y.M., Nafiah, M.A., Aowda, S.A., Awang, K., Litaudon, M., 2019. Two New isoquinoline alkaloids from the bark of Alphonsea cylindrica King and their antioxidant activity. Phytochemistry Letters 29, 110e114. Ali, M.M., Yusuf, M.A., Abdalaziz, M.N., 2017. GC-MS analysis and antimicrobial screening of essential oil from lemongrass (Cymbopogon citratus). International Journal of Pharmaceutical Chemistry 3 (6), 72.
Alves-Silva, J.M., dos Santos, S.M.D., Pintado, M.E., Pérez-Alvarez, J.A., Fern
andez-L
opez, J., Viuda-Martos, M., 2013. Chemical composition and in vitro antimicrobial, antifungal and antioxidant properties of essential oils obtained from some herbs widely used in Portugal. Food Control 32 (2), 371e378. Amalya, J.T.J., Sumathy, J.H.V., 2015. Antimicrobial and anticancer activity of the leaf, flower and carotenoid extracts of Peltophorum petrocarpum. International Journal of Current Trends in Pharmaceutical Research 3 (1), 748e753. Ambrosio, C.M., de Alencar, S.M., de Sousa, R.L., Moreno, A.M., Da Gloria, E.M., 2017. Antimicrobial activity of several essential oils on pathogenic and beneficial bacteria. Industrial Crops and Products 97, 128e136. Anwar, H., Hussain, G., Mustafa, I., 2018. Antioxidants from natural sources. In: Antioxidants in Foods and Its Applications. InTech, pp. 3e28. Arasu, M.V., Viayaraghavan, P., Ilavenil, S., Al-Dhabi, N.A., Choi, K.C., 2019. Essential oil of four medicinal plants and protective properties in plum fruits against the spoilage bacteria and fungi. Industrial Crops and Products 133, 54e62. Arora, D.S., Kaur, J., 1999. Antimicrobial activity of spices. International Journal of Antimicrobial Agents 12 (3), 257e262. Augustine, N., Goel, A.K., Sivakumar, K.C., Kumar, R.A., Thomas, S., 2014. Resveratrolea potential inhibitor of biofilm formation in Vibrio cholerae. Phytomedicine 21 (3), 286e289. Bahukhandi, A., Dhyani, P., Bhatt, I.D., Rawal, R.S., 2018. Variation in polyphenolics and antioxidant activity of traditional apple cultivars from West Himalaya, Uttarakhand. Horticultural Plant Journal 4 (4), 151e157. Barathikannan, K., Venkatadri, B., Khusro, A., Al-Dhabi, N.A., Agastian, P., Arasu, M.V., Kim, Y.O., 2016. Chemical analysis of Punica granatum fruit peel and it’s in vitro and in vivo biological properties. BMC Complementary and Alternative Medicine 16 (1), 264. Barbieri, R., Coppo, E., Marchese, A., Daglia, M., Sobarzo-S
anchez, E., Nabavi, S.F., Nabavi, S.M., 2017. Phytochemicals for human disease: an update on plant-derived compounds antibacterial activity. Microbiological Research 196, 44e68. Beuria, T.K., Santra, M.K., Panda, D., 2005. Sanguinarine blocks cytokinesis in bacteria by inhibiting FtsZ assembly and bundling. Biochemistry 44 (50), 16584e16593. Borris, R.P., 1996. Natural products research: perspectives from a major pharmaceutical company. Journal of Ethnopharmacology 51 (1e3), 29e38.

36

Functional and Preservative Properties of Phytochemicals

Botterweck, A.A.M., Verhagen, H., Goldbohm, R.A., Kleinjans, J., Van den Brandt, P.A., 2000. Intake of butylated hydroxyanisole and butylated hydroxytoluene and stomach cancer risk: results from analyses in The Netherlands cohort study. Food and Chemical Toxicology 38 (7), 599e605. Bouyahya, A., Assemian, I.C.C., Mouzount, H., Bourais, I., Et-Touys, A., Fellah, H., Benjouad, A., Dakka, N., Bakri, Y., 2019. Could volatile compounds from leaves and fruits of Pistacia lentiscus constitute a novel source of anticancer, antioxidant, antiparasitic and antibacterial drugs? Industrial Crops and Products 128, 62e69. Bukvicki, D., Stojkovi
c, D., Sokovi
c, M., Vannini, L., Montanari, C., Pejin, B., Savi
c, A., Velji
c, M., Gruji
c, S., Marin, P.D., 2014. Satureja horvatii essential oil: in vitro antimicrobial and antiradical properties and in situ control of Listeria monocytogenes in pork meat. Meat Science 96 (3), 1355e1360. Burt, S., 2004. Essential oils: their antibacterial properties and potential applications in foodsda review. International Journal of Food Microbiology 94 (3), 223e253. Caballero, B., Trugo, L.C., Finglas, P.M., 2003. Encyclopedia of Food Sciences and Nutrition. Academic. Candan, F., Unlu, M., Tepe, B., Daferera, D., Polissiou, M., S€ okmen, A., Akpulat, H.A., 2003. Antioxidant and antimicrobial activity of the essential oil and methanol extracts of Achillea millefolium subsp. millefolium Afan., Asteraceae. Journal of Ethnopharmacology 87 (2e3), 215e220. Casadey, R., Challier, C., Senz, A., Criado, S., 2019. Antioxidant ability of tyrosol and derivative-compounds in the presence of O2 (1Dg)-species. Studies of synergistic antioxidant effect with commercial antioxidants. Food Chemistry 285, 275e281. Chanda, S.V., Nagani, K.V., 2010. Antioxidant capacity of Manilkara zapota L. leaves extracts evaluated by four in vitro methods. Natural Science 8 (10), 260e266. Chanda, S., Nagani, K., 2013. In vitro and in vivo methods for anticancer activity evaluation and some Indian medicinal plants possessing anticancer properties: an overview. Journal of Pharmacognosy and Phytochemistry 2 (2), 140e152. Chen, M.X., Huo, J.M., Hu, J., Xu, Z.P., Zhang, X., 2018. Amaryllidaceae alkaloids from Crinum latifolium with cytotoxic, antimicrobial, antioxidant, and anti-inflammatory activities. Fitoterapia 130, 48e53. Cheng, J., Yang, K., Zhao, N.N., Wang, X.G., Wang, S.Y., Liu, Z.L., 2012. Composition and insecticidal activity of the essential oil of Cananga odorata leaves against Sitophilus zeamais Motschulsky (Coleoptera: Curculionidae). Journal of Medicinal Plants Research 6 (18), 3482e3486. Chung, H.S., Woo, W.S., 2001. A quinolone alkaloid with antioxidant activity from the aleurone layer of anthocyanin-pigmented rice. Journal of Natural Products 64 (12), 1579e1580. Chutia, M., Bhuyan, P.D., Pathak, M.G., Sarma, T.C., Boruah, P., 2009. Antifungal activity and chemical composition of Citrus reticulata Blanco essential oil against phytopathogens from North East India. Lebensmittel-Wissenschaft und -Technologie- Food Science and Technology 42 (3), 777e780. Clark, A.M., El-Feraly, A.S., Li, W.S., 1981. Antimicrobial activity of phenolic constituents of Magnolia grandiflora L. Journal of Pharmaceutical Sciences 70 (8), 951e952. Costa, R., Bisignano, C., Filocamo, A., Grasso, E., Occhiuto, F., Spadaro, F., 2014. Antimicrobial activity and chemical composition of Citrus aurantifolia (Christm.) Swingle essential oil from Italian organic crops. Journal of Essential Oil Research 26 (6), 400e408. Cowan, M.M., 1999. Plant products as antimicrobial agents. Clinical Microbiology Reviews 12 (4), 564e582.

Antimicrobial and antioxidant properties of phytochemicals

37

Cushnie, T.T., Cushnie, B., Lamb, A.J., 2014. Alkaloids: an overview of their antibacterial, antibiotic-enhancing and antivirulence activities. International Journal of Antimicrobial Agents 44 (5), 377e386. Da Cruz, R.G., Beney, L., Gervais, P., De Lira, S.P., de Souza Vieira, T.M.F., Dupont, S., 2019. Comparison of the antioxidant property of acerola extracts with synthetic antioxidants using an in vivo method with yeasts. Food Chemistry 277, 698e705. da Rocha Neto, A.C., Navarro, B.B., Canton, L., Maraschin, M., Di Piero, R.M., 2019. Antifungal activity of palmarosa (Cymbopogon martinii), tea tree (Melaleuca alternifolia) and star anise (Illicium verum) essential oils against Penicillium expansum and their mechanisms of action. Lebensmittel-Wissenschaft and Technologie 105, 385e392. Daglia, M., 2012. Polyphenols as antimicrobial agents. Current Opinion in Biotechnology 23 (2), 174e181. Davidson, P.M., 2001. Chemical preservatives and naturally antimicrobial compounds. In: Doyle, M.P., Beuchat, L.R. (Eds.), Food Microbiology: Fundamentals and Frontiers, third ed. ASM Press, pp. 713e745. cit Celikel, N., Kavas, G., 2008. Antimicrobial properties of some essential oils against some pathogenic microorganisms. Czech Journal of Food Sciences 26 (3), 174e181. Devasagayam, T.P.A., Tilak, J.C., Boloor, K.K., Sane, K.S., Ghaskadbi, S.S., Lele, R.D., 2004. Free radicals and antioxidants in human health: current status and future prospects. The Journal of the Association of Physicians of India 52 (794804), 4. Dos Santos, P.P., Paese, K., Guterres, S.S., Pohlmann, A.R., Costa, T.H., Jablonski, A., Flores, S.H., de Oliveira Rios, A., 2015. Development of lycopene-loaded lipid-core nanocapsules: physicochemical characterization and stability study. Journal of Nanoparticle Research 17 (2), 107. Doughari, J.H., Pukuma, M.S., De, N., 2007. Antibacterial effects of balanites aegyptiaca L. Drel. And Moringa oleifera lam. On Salmonella typhi. African Journal of Biotechnology 6 (19). Dusane, D.H., Hosseinidoust, Z., Asadishad, B., Tufenkji, N., 2014. Alkaloids modulate motility, biofilm formation and antibiotic susceptibility of uropathogenic Escherichia coli. PLoS One 9 (11), e112093. Guzman, M., 2003. Cannabinoids: potential anticancer agents. Nature Reviews Cancer 3 (10), 745. Elfalleh, W., Kirkan, B., Sarikurkcu, C., 2019. Antioxidant potential and phenolic composition of extracts from Stachys tmolea: an endemic plant from Turkey. Industrial Crops and Products 127, 212e216. Erdemoglu, N., Ozkan, S., Tosun, F., 2007. Alkaloid profile and antimicrobial activity of Lupinus angustifolius L. alkaloid extract. Phytochemistry Reviews 6 (1), 197e201. Ferreira, F.D., Kemmelmeier, C., Arrotéia, C.C., da Costa, C.L., Mallmann, C.A., Janeiro, V., Machinski Jr., M., 2013. Inhibitory effect of the essential oil of Curcuma longa L. and curcumin on aflatoxin production by Aspergillus flavus Link. Food Chemistry 136 (2), 789e793. Fierascu, R.C., Ortan, A., Fierascu, I.C., Fierascu, I., 2018. In vitro and in vivo evaluation of antioxidant properties of wild-growing plants. A short review. Current Opinion In Food Science 24, 1e8. Foley, M., Tilley, L., 1997. Quinoline antimalarials: mechanisms of action and resistance. International Journal for Parasitology 27 (2), 231e240. Frawley, D., Ranade, S., 2001. Ayurveda. Nature Medicine, pp. 1e138. Library of congress control number 134342. ˇ

38

Functional and Preservative Properties of Phytochemicals

G€ ulçin, I., Elias, R., Gepdiremen, A., Chea, A., Topal, F., 2010. Antioxidant activity of bisbenzylisoquinoline alkaloids from Stephania rotunda: cepharanthine and fangchinoline. Journal of Enzyme Inhibition and Medicinal Chemistry 25 (1), 44e53. Guo, C., Yang, J., Wei, J., Li, Y., Xu, J., Jiang, Y., 2003. Antioxidant activities of peel, pulp and seed fractions of common fruits as determined by FRAP assay. Nutrition Research 23 (12), 1719e1726. Hammer, K., Carson, C.F., Riley, T.V., 2003. Antifungal activity of the components of Melaleuca alternifolia (tea tree) oil. Journal of Applied Microbiology 95 (4), 853e886. Hsouna, A.B., Halima, N.B., Smaoui, S., Hamdi, N., 2017. Citrus lemon essential oil: chemical composition, antioxidant and antimicrobial activities with its preservative effect against Listeria monocytogenes inoculated in minced beef meat. Lipids in Health and Disease 16 (1), 146. Hu, Y., Zhang, J., Kong, W., Zhao, G., Yang, M., 2017. Mechanisms of antifungal and antiaflatoxigenic properties of essential oil derived from turmeric (Curcuma longa L.) on Aspergillus flavus. Food Chemistry 220, 1e8. Hussain, A.I., Anwar, F., Sherazi, S.T.H., Przybylski, R., 2008. Chemical composition, antioxidant and antimicrobial activities of basil (Ocimum basilicum) essential oils depends on seasonal variations. Food Chemistry 108 (3), 986e995. International Agency for Research on Cancer, 1993. Some naturally occurring substances: food items and constituents. Heterocyclic Amines and Mycotoxins 56, 245. _ ¸ can, G., Ki_ri_mer, N., K€urkc€uoǧlu, M., Bas¸er, H.C., DEMIrci, F., 2002. Antimicrobial Is screening of Mentha piperita essential oils. Journal of Agricultural and Food Chemistry 50 (14), 3943e3946. Joe, B., Vijaykumar, M., Lokesh, B.R., 2004. Biological properties of curcumin-cellular and molecular mechanisms of action. Critical Reviews in Food Science and Nutrition 44 (2), 97e111. Jung, H.A., Min, B.S., Yokozawa, T., Lee, J.H., Kim, Y.S., Choi, J.S., 2009. Anti-Alzheimer and antioxidant activities of Coptidis Rhizoma alkaloids. Biological and Pharmaceutical Bulletin 32 (8), 1433e1438. Juteau, F., Masotti, V., Bessiere, J.M., Dherbomez, M., Viano, J., 2002. Antibacterial and antioxidant activities of Artemisia annua essential oil. Fitoterapia 73 (6), 532e535. Kahl, R., Kappus, H., 1993. Toxicology of the synthetic antioxidants BHA and BHT in comparison with the natural antioxidant vitamin E. Zeitschrift fur Lebensmittel-untersuchung und-forschung 196 (4), 329e338. Kan, Q.C., Zhu, L., Liu, N., Zhang, G.X., 2013. Matrine suppresses expression of adhesion molecules and chemokines as a mechanism underlying its therapeutic effect in CNS autoimmunity. Immunologic Research 56 (1), 189e196. Kapewangolo, P., Omolo, J.J., Bruwer, R., Fonteh, P., Meyer, D., 2015. Antioxidant and antiinflammatory activity of Ocimum labiatum extract and isolated labdane diterpenoid. Journal of Inflammation Research 12 (1), 4. Karou, D., Savadogo, A., Canini, A., Yameogo, S., Montesano, C., Simpore, J., Traore, A.S., 2006. Antibacterial activity of alkaloids from Sida acuta. African Journal of Biotechnology 5 (2), 195e200. Kasote, D.M., Katyare, S.S., Hegde, M.V., Bae, H., 2015. Significance of antioxidant potential of plants and its relevance to therapeutic applications. International Journal of Biological Sciences 11 (8), 982. Kedia, A., Prakash, B., Mishra, P.K., Dubey, N.K., 2014a. Antifungal and antiaflatoxigenic properties of Cuminum cyminum (L.) seed essential oil and its efficacy as a preservative in stored commodities. International Journal of Food Microbiology 168, 1e7.

Antimicrobial and antioxidant properties of phytochemicals

39

Kedia, A., Prakash, B., Mishra, P.K., Chanotiya, C.S., Dubey, N.K., 2014b. Antifungal, antiaflatoxigenic, and insecticidal efficacy of spearmint (Mentha spicata L.) essential oil. International Biodeterioration and Biodegradation 89, 29e36. Khamtache-Abderrahim, S., Lequart-Pillon, M., Gontier, E., Gaillard, I., Pilard, S., Mathiron, D., Maiza-Benabdesselam, F., 2016. Isoquinoline alkaloid fractions of Fumaria officinalis: characterization and evaluation of their antioxidant and antibacterial activities. Industrial Crops and Products 94, 1001e1008. Kiran, S., Kujur, A., Prakash, B., 2016. Assessment of preservative potential of Cinnamomum zeylanicum Blume essential oil against food borne molds, aflatoxin B1 synthesis, its functional properties and mode of action. Innovative Food Science and Emerging Technologies 37, 184e191. Kujur, A., Kiran, S., Dubey, N.K., Prakash, B., 2017. Microencapsulation of Gaultheria procumbens essential oil using chitosan-cinnamic acid microgel: improvement of antimicrobial activity, stability and mode of action. Lebensmittel-Wissenschaft und -TechnologieFood Science and Technology 86, 132e138. Kujur, A., Yadav, A., Kumar, A., Singh, P.P., Prakash, B., 2019. Nanoencapsulated methyl salicylate as a biorational alternative of synthetic antifungal and aflatoxin B 1 suppressive agents. Environmental Science and Pollution Research 1e11. Kumar, A., Kujur, A., Singh, P.P., Prakash, B., 2019. Nanoencapsulated plant-based bioactive formulation against food-borne molds and aflatoxin B1 contamination: preparation, characterization and stability evaluation in the food system. Food Chemistry 287, 139e150. Kuorwel, K.K., Cran, M.J., Sonneveld, K., Miltz, J., Bigger, S.W., 2011. Essential oils and their principal constituents as antimicrobial agents for synthetic packaging films. Journal of Food Science 76 (9), R164eR177. Kyung, K.H., 2011. Antimicrobial activity of volatile sulfur compounds in foods, in: ACS symposium series. American Chemical Society 323e338. Lagrouh, F., Dakka, N., Bakri, Y., 2017. The antifungal activity of Moroccan plants and the mechanism of action of secondary metabolites from plants. Journal de Mycologie Medicale 27 (3), 303e311. Lim, S., Choi, A.H., Kwon, M., Joung, E.J., Shin, T., Lee, S.G., Kim, N.G., Kim, H.R., 2019. Evaluation of antioxidant activities of various solvent extract from Sargassum serratifolium and its major antioxidant components. Food Chemistry 278, 178e184. Lin, J.K., Lin, C.L., Liang, Y.C., Lin-Shiau, S.Y., Juan, I.M., 1998. Survey of catechins, gallic acid, and methylxanthines in green, oolong, pu-erh, and black teas. Journal of Agricultural and Food Chemistry 46 (9), 3635e3642. Liu, H.B., Li, P., Sun, C., Du, X.J., Zhang, Y., Wang, S., 2017. Inhibitor-assisted high-pressure inactivation of bacteria in skim milk. Journal of Food Science 82 (7), 1672e1681. € Ali, S., 2016. Triterpenoid saponin-rich fraction Mahmood, A., Tiwari, A., S¸ahin, K., K€uç€uk, O., of Centella asiatica decreases IL-1ß and NF-kB, and augments tissue regeneration and excision wound repair. Turkish Journal of Biology 40 (2), 399e409. Mahran, G.H., Kadry, H.A., Thabet, C.K., El-Olemy, M.M., Al-Azizi, M.M., Schiff, P.L., Liv, N., 1992. GC/MS analysis of volatile oil of fruits of Anethum graveolens. International Journal of Pharmacognosy 30 (2), 139e144. Maiza-Benabdesselam, F., Khentache, S., Bougoffa, K., Chibane, M., Adach, S., Chapeleur, Y., Max, H., Laurain-Matta, D., 2007. Antioxidant activities of alkaloid extracts of two Algerian species of Fumaria: fumaria capreolata and Fumaria bastardii. Records of Natural Products 1 (2e3), 28e35. Makris, D.P., Boskou, D., 2014. Plant-derived antioxidants as food additives., in: plants as a source of natural antioxidants. CABI 169e190.

40

Functional and Preservative Properties of Phytochemicals

Manas, P., Pag
an, R., 2005. Microbial inactivation by new technologies of food preservation. Journal of Applied Microbiology 98 (6), 1387e1399. Méndez-Tovar, I., Sponza, S., Asensio-S-Manzanera, M.C., Novak, J., 2015. Contribution of the main polyphenols of Thymus mastichina subsp. mastichina to its antioxidant properties. Industrial Crops and Products 66, 291e298. Mimica-Duki
c, N., Kujundzi
c, S., Sokovi
c, M., Couladis, M., 2003. Essential oil composition and antifungal activity of Foeniculum vulgare Mill. obtained by different distillation conditions. Phytotherapy Research 17 (4), 368e371. Mishra, P.K., Shukla, R., Singh, P., Prakash, B., Dubey, N.K., 2012. Antifungal and antiaflatoxigenic efficacy of Caesulia axillaris Roxb. essential oil against fungi deteriorating some herbal raw materials, and its antioxidant activity. Industrial Crops and Products 36 (1), 74e80. Mishra, P.K., Singh, P., Prakash, B., Kedia, A., Dubey, N.K., Chanotiya, C.S., 2013. Assessing essential oil components as plant-based preservatives against fungi that deteriorate herbal raw materials. International Biodeterioration and Biodegradation 80, 16e21. Nikkhah, M., Hashemi, M., Najafi, M.B.H., Farhoosh, R., 2017. Synergistic effects of some essential oils against fungal spoilage on pear fruit. International Journal of Food Microbiology 257, 285e294. Nogueira, J.H., Gonçalez, E., Galleti, S.R., Facanali, R., Marques, M.O., Felício, J.D., 2010. Ageratum conyzoides essential oil as aflatoxin suppressor of Aspergillus flavus. International Journal of Food Microbiology 137 (1), 55e60. Ou, M.C., Liu, Y.H., Sun, Y.W., Chan, C.F., 2015. The composition, antioxidant and antibacterial activities of cold-pressed and distilled essential oils of Citrus paradisi and Citrus grandis (L.) Osbeck. Evidence-Based Complementary and Alternative Medicine 2015, 1e9. Oussalah, M., Caillet, S., Saucier, L., Lacroix, M., 2007. Inhibitory effects of selected plant essential oils on the growth of four pathogenic bacteria: E. coli O157: H7, Salmonella typhimurium, Staphylococcus aureus and Listeria monocytogenes. Food Control 18 (5), 414e420. Ouyang, H., Hou, K., Peng, W., Liu, Z., Deng, H., 2018. Antioxidant and xanthine oxidase inhibitory activities of total polyphenols from onion. Saudi Journal of Biological Sciences 25 (7), 1509e1513. Ozkan, G., Sagdic, O., Baydar, N.G., Baydar, H., 2004. Note: antioxidant and antibacterial activities of Rosa damascena flower extracts. Food Science and Technology International 10 (4), 277e281. O’neill, P.M., Barton, V.E., Ward, S.A., 2010. The molecular mechanism of action of artemisinindthe debate continues. Molecules 15 (3), 1705e1721. Packirisamy, V., Parameswaran, I., Vijayalakshmi, K., 2017. GC-MS analysis of Pergularia daemia and Terminalia catappa L. Leaf extracts. International Journal of Pharmacy and Biological Sciences 7 (3), 21e29. Papas, A.M., 1999. Diet and antioxidant status. Food and Chemical Toxicology: An International Journal Published for the British Industrial Biological Research Association 37 (9e10), 999. Parasuraman, S., Thing, G.S., Dhanaraj, S.A., 2014. Polyherbal formulation: concept of ayurveda. Pharmacognosy Reviews 8 (16), 73. Patwardhan, B., Warude, D., Pushpangadan, P., Bhatt, N., 2005. Ayurveda and traditional Chinese medicine: a comparative overview. Evidence-Based Complementary and Alternative Medicine 2 (4), 465e473.

Antimicrobial and antioxidant properties of phytochemicals

41

Pereira, A., Ferreira, I., Marcelino, F., Valent~ao, P., Andrade, P., Seabra, R., Pereira, J., 2007a. Phenolic compounds and antimicrobial activity of olive (Olea europaea L. Cv. Cobrançosa) leaves. Molecules 12 (5), 1153e1162. Pereira, J.A., Oliveira, I., Sousa, A., Valent~ao, P., Andrade, P.B., Ferreira, I.C., Estevinho, L., 2007b. Walnut (Juglans regia L.) leaves: phenolic compounds, antibacterial activity and antioxidant potential of different cultivars. Food and Chemical Toxicology 45 (11), 2287e2295. Pinto, E., Vale-Silva, L., Cavaleiro, C., Salgueiro, L., 2009. Antifungal activity of the clove essential oil from Syzygium aromaticum on Candida, Aspergillus and dermatophyte species. Journal of Medical Microbiology 58 (11), 1454e1462. Pirbalouti, A.G., Chaleshtori, A.R., Tajbakhsh, E., Momtaz, H., Rahimi, E., Shahin, F., 2009. Bioactivity of medicinal plant extracts against Listeria monocytogenes isolated from food. Journal of Food Agriculture and Environment 7, 66e69. Prakash, B., Shukla, R., Singh, P., Kumar, A., Mishra, P.K., Dubey, N.K., 2010. Efficacy of chemically characterized Piper betle L. essential oil against fungal and aflatoxin contamination of some edible commodities and its antioxidant activity. International Journal of Food Science and Technology 142 (1e2), 114e119. Prakash, B., Shukla, R., Singh, P., Mishra, P.K., Dubey, N.K., Kharwar, R.N., 2011. Efficacy of chemically characterized Ocimum gratissimum L. essential oil as an antioxidant and a safe plant-based antimicrobial against fungal and aflatoxin B1 contamination of spices. Food Research International 44 (1), 385e390. Prakash, B., Singh, P., Kedia, A., Dubey, N.K., 2012a. Assessment of some essential oils as food preservatives based on antifungal, antiaflatoxin, antioxidant activities and in vivo efficacy in food system. Food Research International 49 (1), 201e208. Prakash, B., Singh, P., Mishra, P.K., Dubey, N.K., 2012b. Safety assessment of Zanthoxylum alatum Roxb. essential oil, its antifungal, antiaflatoxin, antioxidant activity and efficacy as antimicrobial in preservation of Piper nigrum L. fruits. International Journal of Food Microbiology 153 (1e2), 183e191. Prakash, B., Kedia, A., Mishra, P.K., Dwivedy, A.K., Dubey, N.K., 2015. Assessment of chemically characterised Rosmarinus officinalis L. essential oil and its major compounds as plant-based preservative in food system based on their efficacy against food-borne moulds and aflatoxin secretion and as antioxidant. International Journal of Food Science and Technology 50 (8), 1792e1798. Prakash, B., Singh, P., Yadav, S., Singh, S.C., Dubey, N.K., 2013. Safety profile assessment and efficacy of chemically characterized Cinnamomum glaucescens essential oil against storage fungi, insect, aflatoxin secretion and as antioxidant. Food and Chemical Toxicology 53, 160e167. Prakash, B., Kujur, A., Singh, P.P., Kumar, A., Yadav, A., 2017. Plants-derived bioactive compounds as functional food ingredients and food preservative. Journal of Nutrition and Food Sciences 2, 1e7. Prakash, B., Kujur, A., Yadav, A., Kumar, A., Singh, P.P., Dubey, N.K., 2018. Nanoencapsulation: An efficient technology to boost the antimicrobial potential of plant essential oils in food system. Food Control 89, 1e11. Rabinkov, A., Miron, T., Konstantinovski, L., Wilchek, M., Mirelman, D., Weiner, L., 1998. The mode of action of allicin: trapping of radicals and interaction with thiol containing proteins. Biochimica et Biophysica Acta 1379 (2), 233e244. Rebey, I.B., Wannes, W.A., Kaab, S.B., Bourgou, S., Tounsi, M.S., Ksouri, R., Fauconnier, M.L., 2019. Bioactive compounds and antioxidant activity of Pimpinella anisum L. accessions at different ripening stages. Scientia Horticulturae 246, 453e461.

42

Functional and Preservative Properties of Phytochemicals

Riachi, L.G., De Maria, C.A., 2015. Peppermint antioxidants revisited. Food Chemistry 176, 72e81. Samsonowicz, M., Regulska, E., Karpowicz, D., Le
sniewska, B., 2019. Antioxidant properties of coffee substitutes rich in polyphenols and minerals. Food Chemistry 278, 101e109. S
anchez-Machado, D.I., L
opez-Cervantes, J., Send
on, R., Sanches-Silva, A., 2017. Aloe vera: ancient knowledge with new frontiers. Trends in Food Science and Technology 61, 94e102. Sapkota, A., Sapkota, A.R., Kucharski, M., Burke, J., McKenzie, S., Walker, P., Lawrence, R., 2008. Aquaculture practices and potential human health risks: current knowledge and future priorities. Environment International 34 (8), 1215e1226. Saravanan, S., Parimelazhagan, T., 2014. In vitro antioxidant, antimicrobial and anti-diabetic properties of polyphenols of Passiflora ligularis Juss. fruit pulp. Food Science and Human Wellness 3 (2), 56e64. Scallan, E., Hoekstra, R.M., Angulo, F.J., Tauxe, R.V., Widdowson, M.A., Roy, S.L., Jones, J.L., Griffin, P.M., 2011. Foodborne illness acquired in the United Statesdmajor pathogens. Emerging Infectious Diseases 17 (1), 7. Shahat, A.A., Hidayathulla, S., Khan, A.A., Alanazi, A.M., Al Meanazel, O.T., Alqahtani, A.S., Alsaid, M.S., Hussein, A.A., 2019. Phytochemical profiling, antioxidant and anticancer activities of Gastrocotyle hispida growing in Saudi Arabia. Acta Tropica 191, 243e247. Shan, B., Cai, Y.Z., Brooks, J.D., Corke, H., 2007. The in vitro antibacterial activity of dietary spice and medicinal herb extracts. International Journal of Food Microbiology 117 (1), 112e119. Shao, D., Li, J., Li, J., Tang, R., Liu, L., Shi, J., Huang, Q., Yang, H., 2015. Inhibition of gallic acid on the growth and biofilm formation of Escherichia coli and Streptococcus mutans. Journal of Food Science 80 (6), M1299eM1305. Shukla, R., Singh, P., Prakash, B., Dubey, N.K., 2012. Antifungal, aflatoxin inhibition and antioxidant activity of Callistemon lanceolatus (Sm.) Sweet essential oil and its major component 1, 8-cineole against fungal isolates from chickpea seeds. Food Control 25 (1), 27e33. Singh, P., Shukla, R., Kumar, A., Prakash, B., Singh, S., Dubey, N.K., 2010. Effect of Citrus reticulata and Cymbopogon citratus essential oils on Aspergillus flavus growth and aflatoxin production on Asparagus racemosus. Mycopathologia 170 (3), 195e202. Singh, J.P., Kaur, A., Singh, N., Nim, L., Shevkani, K., Kaur, H., Arora, D.S., 2016. In vitro antioxidant and antimicrobial properties of jambolan (Syzygium cumini) fruit polyphenols. Lebensmittel-Wissenschaft und -Technologie- Food Science and Technology 65, 1025e1030. Sivropoulou, A., Papanikolaou, E., Nikolaou, C., Kokkini, S., Lanaras, T., Arsenakis, M., 1996. Antimicrobial and cytotoxic activities of Origanum essential oils. Journal of Agricultural and Food Chemistry 44 (5), 1202e1205. Skogman, M.E., Vuorela, P.M., Fallarero, A., 2012. Combining biofilm matrix measurements with biomass and viability assays in susceptibility assessments of antimicrobials against Staphylococcus aureus biofilms. The Journal of Antibiotics 65 (9), 453. Smeriglio, A., Alloisio, S., Raimondo, F.M., Denaro, M., Xiao, J., Cornara, L., Trombetta, D., 2018. Essential oil of Citrus lumia Risso: phytochemical profile, antioxidant properties and activity on the central nervous system. Food and Chemical Toxicology 119, 407e416. Smeriglio, A., Cornara, L., Denaro, M., Barreca, D., Burlando, B., Xiao, J., Trombetta, D., 2019. Antioxidant and cytoprotective activities of an ancient Mediterranean citrus (Citrus lumia Risso) albedo extract: microscopic observations and polyphenol characterization. Food Chemistry 279, 347e355.

Antimicrobial and antioxidant properties of phytochemicals

43

Solomakos, N., Govaris, A., Koidis, P., Botsoglou, N., 2008. The antimicrobial effect of thyme essential oil, nisin and their combination against Escherichia coli O157: H7 in minced beef during refrigerated storage. Meat Science 80 (2), 159e166. Sridevi, G., Srividya, S., Sembulingam, K., Sembulingam, P., 2018. An evaluation of in vitro and in vivo free radical scavenging and antioxidant potential of ethanolic extract of Pergularia daemia. Biocatalysis and Agricultural Biotechnology 15, 131e137. Sunil, C., Duraipandiyan, V., Agastian, P., Ignacimuthu, S., 2012. Antidiabetic effect of plumbagin isolated from Plumbago zeylanica L. root and its effect on GLUT4 translocation in streptozotocin-induced diabetic rats. Food and Chemical Toxicology 50 (12), 4356e4363. Sunil, C., Duraipandiyan, V., Ignacimuthu, S., Al-Dhabi, N.A., 2013. Antioxidant, free radical scavenging and liver protective effects of friedelin isolated from Azima tetracantha Lam. leaves. Food Chemistry 139 (1e4), 860e865. Sutherland, B.A., Rahman, R.M., Appleton, I., 2006. Mechanisms of action of green tea catechins, with a focus on ischemia-induced neurodegeneration. The Journal of Nutritional Biochemistry 17 (5), 291e306. Tao, N., Gao, Y., Liu, Y., Ge, F., 2010. Carotenoids from the peel of Shatian pummelo (Citrus grandis Osbeck) and its antimicrobial activity. American-Eurasian Journal of Agricultural and Environmental Sciences 7 (1), 110e115. Tepe, B., Daferera, D., Sokmen, A., Sokmen, M., Polissiou, M., 2005. Antimicrobial and antioxidant activities of the essential oil and various extracts of Salvia tomentosa Miller (Lamiaceae). Food Chemistry 90 (3), 333e340. Thisoda, P., Rangkadilok, N., Pholphana, N., Worasuttayangkurn, L., Ruchirawat, S., Satayavivad, J., 2006. Inhibitory effect of Andrographis paniculata extract and its active diterpenoids on platelet aggregation. European Journal of Pharmacology 553 (1e3), 39e45. Tian, J., Ban, X., Zeng, H., Huang, B., He, J., Wang, Y., 2011. In vitro and in vivo activity of essential oil from dill (Anethum graveolens L.) against fungal spoilage of cherry tomatoes. Food Control 22 (12), 1992e1999. Tian, J., Huang, B., Luo, X., Zeng, H., Ban, X., He, J., Wang, Y., 2012. The control of Aspergillus flavus with Cinnamomum jensenianum Hand.-Mazz essential oil and its potential use as a food preservative. Food Chemistry 130 (3), 520e527. Tian, W., Zhi, H., Yang, C., Wang, L., Long, J., Xiao, L., et al., 2018. Chemical composition of alkaloids of Plumula nelumbinis and their antioxidant activity from different habitats in China. Industrial Crops and Products 125, 537e548. Tiwari, B.K., Valdramidis, V.P., O’Donnell, C.P., Muthukumarappan, K., Bourke, P., Cullen, P.J., 2009. Application of natural antimicrobials for food preservation. Journal of Agricultural and Food Chemistry 57 (14), 5987e6000. Torres-Alvarez, C., N
u~nez Gonz
alez, A., Rodríguez, J., Castillo, S., Leos-Rivas, C., B
aezGonz
alez, J.G., 2017. Chemical composition, antimicrobial, and antioxidant activities of orange essential oil and its concentrated oils. CyTA e Journal of Food 15 (1), 129e135. Trejo-Solís, C., Pedraza-Chaverrí, J., Torres-Ramos, M., Jiménez-Farf
an, D., Cruz Salgado, A., Serrano-García, N., Osorio-Rico, L., Sotelo, J., 2013. Multiple molecular and cellular mechanisms of action of lycopene in cancer inhibition. Evidence-Based Complementary and Alternative Medicine 2013. Tripathi, B.R., Bhatia, R.O., Walia, S.U., Kumar, B.I., 2012. Chemical composition and evaluation of Tagetes erecta (var. Pusa narangi genda) essential oil for its antioxidant and antimicrobial activity. Biopesticides International 8, 138e146. Tsai, M.L., Wu, C.T., Lin, T.F., Lin, W.C., Huang, Y.C., Yang, C.H., 2013. Chemical composition and biological properties of essential oils of two mint species. Tropical Journal of Pharmaceutical Research 12 (4), 577e582.

44

Functional and Preservative Properties of Phytochemicals

Tu, X.F., Hu, F., Thakur, K., Li, X.L., Zhang, Y.S., Wei, Z.J., 2018. Comparison of antibacterial effects and fumigant toxicity of essential oils extracted from different plants. Industrial Crops and Products 124, 192e200.
 Tumbas, V.T., Cetkovi
c, G.S., Djilas, S.M., Canadanovi
c-Brunet, J.M., Vuli
c, J.J., Knez, Z., Skerget, M., 2010. Antioxidant activity of Mandarin (Citrus reticulata) peel. Acta Periodica Technologica 41, 195e203. Tundis, R., Loizzo, M.R., Bonesi, M., Menichini, F., Mastellone, V., Colica, C., Menichini, F., 2012. Comparative study on the antioxidant capacity and cholinesterase inhibitory activity of Citrus aurantifolia Swingle, C. aurantium L., and C. bergamia Risso and Poit. peel essential oils. Journal of Food Science 77 (1), H40eH46. Ulusoy, S., Bos¸gelmez-Tınaz, G., Seçilmis¸-Canbay, H., 2009. Tocopherol, carotene, phenolic contents and antibacterial properties of rose essential oil, hydrosol and absolute. Current Microbiology 59 (5), 554. Vasconcelos, N.C.M.D., Salgado, S.M., Livera, A.V.S., Andrade, S.A.C.D., Oliveira, M.G.D., Stamford, T.L.M., 2015. Influence of heat treatment on the sensory and physical characteristics and carbohydrate fractions of French-fried potatoes (Solanum tuberosum L.). Food Science and Technology 35 (3), 561e569. Vasconcelos, N.G., Croda, J., Simionatto, S., 2018. Antibacterial mechanisms of cinnamon and its constituents: a review. Microbial Pathogenesis 120, 198e203.
Viuda-Martos, M., Ruiz-Navajas, Y., Fern
andez-L
opez, J., Pérez-Alvarez, J., 2008. Antifungal activity of lemon (Citrus lemon L.), Mandarin (Citrus reticulata L.), grapefruit (Citrus paradisi L.) and orange (Citrus sinensis L.) essential oils. Food Control 19 (12), 1130e1138. Wagner, C.S., De Gezelle, J., Robertson, M., Robertson, K., Wilson, M., Komarnytsky, S., 2017. Antibacterial activity of medicinal plants from the Physicians of Myddvai, a 14th century Welsh medical manuscript. Journal of Ethnopharmacology 203, 171e181. Wan, J., Coventry, J., Swiergon, P., Sanguansri, P., Versteeg, C., 2009. Advances in innovative processing technologies for microbial inactivation and enhancement of food safetyepulsed electric field and low-temperature plasma. Trends in Food Science and Technology 20 (9), 414e424. Wang, L., Li, X., Wang, H., 2019. Physicochemical properties, bioaccessibility and antioxidant activity of the polyphenols from pine cones of Pinus koraiensis. International Journal of Biological Macromolecules 126, 385e391. Yadav, A., Kujur, A., Kumar, A., Singh, P.P., Prakash, B., Dubey, N.K., 2019. Assessing the preservative efficacy of nanoencapsulated mace essential oil against food borne molds, aflatoxin B1 contamination, and free radical generation. Lebensmittel-Wissenschaft und -Technologie- Food Science and Technology 108, 429e436. Zafra-Polo, M.C., Figadere, B., Gallardo, T., Tormo, J., Cortes, D., 1998. Natural acetogenins from Annonaceae, synthesis and mechanisms of action. Phytochemistry 48 (7), 1087e1117. Zhu, X., Zhang, H., Lo, R., 2004. Phenolic compounds from the leaf extract of artichoke (Cynara scolymus L.) and their antimicrobial activities. Journal of Agricultural and Food Chemistry 52 (24), 7272e7278.

Further reading Anastasaki, E., Zoumpopoulou, G., Astraka, K., Kampoli, E., Skoumpi, G., Papadimitriou, K., Tsakalidou, E., Polissiou, M., 2017. Phytochemical analysis and evaluation of the antioxidant and antimicrobial properties of selected herbs cultivated in Greece. Industrial Crops and Products 108, 616e628.

Antimicrobial and antioxidant properties of phytochemicals

45

Bardaa, S., Halima, N.B., Aloui, F., Mansour, R.B., Jabeur, H., Bouaziz, M., Sahnoun, Z., 2016. Oil from pumpkin (Cucurbita pepo L.) seeds: evaluation of its functional properties on wound healing in rats. Lipids in Health and Disease 15 (1), 73. Eswaraiah, G., Peele, K.A., Krupanidhi, S., Kumar, R.B., Venkateswarulu, T.C., 2019. Studies on phytochemical, antioxidant, antimicrobial analysis and separation of bioactive leads of leaf extract from the selected mangroves. Journal of King Saud University Science. https:// doi.org/10.1016/j.jksus.2019.03.002. € Ferdes, M., Al Juhaimi, F., Ozcan, M.M., Ghafoor, K., 2017. Inhibitory effect of some essential oils on growth of Aspergillus Niger, Aspergillus oryzae, Mucor pusillus and Fusarium oxysporum. South African Journal of Botany 113, 457e460. Fyfe, L., Armstrong, F., Stewart, J., 1998. Inhibition of Listeria monocytogenes and Salmonella enteriditis by combinations of plant oils and derivatives of benzoic acid: the development of synergistic antimicrobial combinations. International Journal of Antimicrobial Agents 9 (3), 195e199. Hammer, K.A., Carson, C.F., Riley, T.V., 1999. Antimicrobial activity of essential oils and other plant extracts. Journal of Applied Microbiology 86 (6), 985e990. Hasheminejad, N., Khodaiyan, F., Safari, M., 2019. Improving the antifungal activity of clove essential oil encapsulated by chitosan nanoparticles. Food Chemistry 275, 113e122. Okunowo, W.O., Oyedeji, O., Afolabi, L.O., Matanmi, E., 2013. Essential oil of grape fruit (Citrus paradisi) peels and its antimicrobial activities. American Journal of Plant Sciences 4 (07), 1. Oliveira, A.P., Valent~ao, P., Pereira, J.A., Silva, B.M., Tavares, F., Andrade, P.B., 2009. Ficus carica L.: metabolic and biological screening. Food and Chemical Toxicology 47 (11), 2841e2846. Shiban, M.S., Al-Otaibi, M.M., Al-Zoreky, N.S., 2012. Antioxidant activity of pomegranate (Punica granatum L.) fruit peels. Food and Nutrition Sciences 3 (07), 991. Tang, X., Xu, C., Yagiz, Y., Simonne, A., Marshall, M.R., 2018. Phytochemical profiles, and antimicrobial and antioxidant activities of greater galangal [Alpinia galanga (Linn.) Swartz.] flowers. Food Chemistry 255, 300e308.

This page intentionally left blank

Functional food ingredients from old age cereal grains

2

P. Anjali, P. Vijayaraj Department of Lipid Science, Central Food Technological Research Institute (CSIR), Mysore, Karnataka, India

1. Introduction Millets are ancient cereal grains consumed as traditional staple food in developing countries of Asia and Africa. They are small seeded, tall, annual grasses that can grow in poor agronomical (marginal soil fertility and moisture) and extreme climatic conditions (drought and high temperature). Millets require only 350e400 mm annual rain fall, minimum pesticides, and fertilizers to give optimum yield. They possess a short growing season of 65 days compared to 100e120 days for rice and wheat and have a long shelflife of minimum 2 years under proper storage conditions. They are a host of nutrients; serve as a single rich source for proteins, dietary fibers, polyunsaturated fatty acids (PUFAs), vitamins, and minerals; have a low glycemic index; and are gluten free. Also, they are alkalizing grains which make digestion easy and soothing and least allergenic with no reported tolerance. Due to these features, millets are often labeled as “super grains, miracle grains, famine reserves and poor man’s rice.” Millets have gained more prominence in the last few years as they are gluten free, have low glycemic index, and are rich in beneficial phytochemicals making them a suitable diet for people with metabolic disorders. They have the potential to be the ideal crops of future, where the situations will not be favorable for other crops to grow, like less cultivation area, poor soil fertility, drought, climate changes, and high population. The commonly known millets include small or minor millets, pearl millet, and sorghum. The smaller or minor millets comprise proso millet, kodo millet, little millet, foxtail millet, finger millet, browntop millet, and barnyard millet.

2. Taxonomic classification of millets Millets belong to the grass family, Poaceae or Graminaceae. There are about 10 genera and at least 14 species (Bora, 2013). The common taxonomic classification and details of individual millets are given in Tables 2.1 and 2.2, respectively. The grain stalk structures of common millets are shown in Fig. 2.1.

Functional and Preservative Properties of Phytochemicals. https://doi.org/10.1016/B978-0-12-818593-3.00002-6 Copyright © 2020 Elsevier Inc. All rights reserved.

48

Functional and Preservative Properties of Phytochemicals

Table 2.1 Taxonomic classification of millets. Kingdom

Plantae (plants)

Subkingdom

Tracheobionta (Vascular plants)

Super division

Spermatophyta (Seed plants)

Division

Magnoliophyta (Flowering plants)

Class

Liliopsida (Monocotyledons)

Subclass

Commelinidae

Order

Cyperales/Poales

Family

Poaceae/Graminaceae

Table 2.2 Taxonomic details of commonly cultivated millets. S.N.

Scientific name

Order

Family

Common names

1

Panicum miliaceum

Poales

Poaceae

Proso millet, broomcorn millet, common millet, broomtail millet, hog millet, Kashfi millet, red millet, and white millet

2

Paspalum scrobiculatum

Cyperales/ Poales

Poaceae

Kodo millet, cow grass, rice grass, ditch millet, Indian paspalum

3

Setaria italica

Poales

Poaceae

Foxtail millet, dwarf setaria, foxtail bristle-grass, giant setaria, green foxtail, Italian millet, German millet, and Hungarian millet

4

Eleusine coracana

Poales

Poaceae

Finger millet, African millet, Koracan, Natcheny, ragi

5

Echinochloa frumentacea

Poales

Poaceae

Indian barnyard millet, sawa millet, billion dollar grass

6

Pennisetum glaucum

Poales/ Cyperales

Poaceae

Pearl millet, bulrush millet, candle millet, dark millet

Functional food ingredients from old age cereal grains

49

Table 2.2 Taxonomic details of commonly cultivated millets.dcont’d S.N.

Scientific name

Order

Family

Common names

7

Urochloa ramosa

Poales

Poaceae

Dixie signal grass, brown top millet

8

Panicum sumatrens

Poales

Poaceae

Little millet

9

Sorghum Bicolor

Poales

Graminaceae/ Poaceae

Jowar, great millet

10

Echinochloa esculenta

Poales

Poaceae

Japanese millet, Japanese barnyard millet

11

Digitaria exilis

Poales

Poaceae

White fonio, hungry rice, hungrymillet, acha

12

Digitaria iburua

Poales

Poaceae

Black fonio, black acha

13

Urochloa deflexa

Poales

Poaceae

Brachiaria, signal grass, guinea millet

Figure 2.1 The grain stalk structures of different millets.

3. Global millet production and consumption Millets were in use in different parts of the world from prehistoric period. The major production was in Asian and African countries. According to a survey by Food and Agriculture organization (FAO, UN) from 1994 to 2016, the global millet production has not changed much during two decades (1994d28,050,180 tons, 2016d28,357,451 tons) (Fig. 2.2), though there was a reduction in the total harvested area (1994d38,521,427 ha, 2016d31,705,489 ha) (Fig. 2.2). Also, sorghum and millets are ranked fifthand sixth, respectively, in the world cereal production after wheat, maize, rice, and barley (FAOSTAT, 2016).

50

Functional and Preservative Properties of Phytochemicals

Figure 2.2 Global millet production and area harvested.

Figure 2.3 Major millet producing countries.

The top millet producers include India, ranked first, followed by Nigeria, Niger, China, and other African countries. According to various reports, the global millet production is 29,870,058 tons where India contributed 42% of the production (Fig. 2.3). Pearl millet accounts for almost half of the global millet production (excluding sorghum). They are the most climate-resilient crops that contribute to food security in some of the hottest and driest cultivation areas where other crops fail to grow. Foxtail millet ranks second in global production followed by proso and finger millets (Annex I, FAO). Millets and sorghum serve as multipurpose grains worldwide; as food grains, fodder for livestock, bird feed, and for brewing. They are staple food for millions of people living in the arid and semiarid regions of African countries. Africa serves as the home for the origin, domestication, and cultivation of diversity of millets and has a pool of genetic varieties. Sorghum, pearl, and finger millets are widely cultivated in Africa. In addition, white fonio, black fonio, and guinea millets are cultivated in West African dry lands (Garí, 2002; Orr et al., 2016). Millets were indigenous food in developing nations like India, but Green revolution, urbanization, and different

Functional food ingredients from old age cereal grains

51

government policies favored the cultivation of rice and wheat more, which eventually resulted in a decline in millet production and consumption. A decline in cultivation area: 80% for small millets, 46% for finger millet, 59% for sorghum; and 23% for pearl millet and a 76% decrease in total production of small millets were reported in India during 1961e2009 (Dhan foundation, 2012). India harvests sorghum as well as different varieties of proso, kodo, foxtail, finger, pearl, little, Indian barnyard, and browntop millets. Several reports indicate that Japanese millet was domesticated in the northeastern Japan where the other crops like rice suffered cool weather damage (Yabuno, 1987; Nasu and Momohara, 2016). Proso millet and foxtail millets are used in China and some parts of Europe as cereal food. In the United States, proso millet was primarily used as fodder and bird feed but now human consumption of sorghum and proso millet is on the rise. In general, the millet popularity is rising, people are realizing their importance in terms of nutrition and agronomic benefits, and thus there is a global trend to increase their production and consumption.

4. The general structure of millet grains Although the basic kernel structure of different millets and sorghum are pericarp, germ or embryo, and endosperm, they have considerable difference in their size, shape, structure, color, and certain anatomical structures. Sorghum and pearl millet have caryopsistype kernel (pericarp is completely fused to the endosperm) whereas finger, proso, and foxtail millets have utricle type kernel (saclike pericarp, loosely attached to the endosperm at only one point). The structural information of the millets as given by FAO is summarized in Tables 2.3 and 2.4.

5. Millets: from coarse cereals to nutri grains According to Organisation for Economic Co-operation and Development (OECD) definition, coarse cereals are the grains that are used primarily for animal feed or brewing. Unfortunately, millets were in use as coarse cereals from past few decades. Human consumption of millets was reduced due to various reasons and limited as fodder. The emerging consequences of metabolic diseases made the world to adapt to the ancient life style, which slowly returned the millets back to diet. They have turned to be an interesting area for research too. Millets are known to contain different bioactive molecules beyond serving the basic nutrition. The following tables (Tables 2.5e2.9) summarize the overall nutritional profile of several millets and regular grains. Most of the millets have a nutritional profile similar to that of whole rice and wheat. The fact still remains that we majorly consume polished rice and wheat where the total nutrition is much lower than the raw grains. Among the millets, foxtail, proso, and pearl millets have 12% of protein which is 2%e4% higher than the major grains. Carbohydrate content is almost similar among all millets (60%e70%) and wheat (64%),

52

Functional and Preservative Properties of Phytochemicals

Table 2.3 Structural features of kernels of sorghum and few types of millets. Seed coat No of layers

Endosperm: Pigmented germ

Gray, yellow, white, brown, purple

1

Sometimes

4.5:1

Spherical

White, yellow, red, brown

1

Sometimes

8:4:1

Utricle

Globose

Yellow, white, red, brown, violet

5

Yes

11:1

Proso millet

Utricle

e

e

1

No

12:1

Foxtail millet

Utricle

e

e

1

e

12:1

Grain

Type

Shape

Color

Pearl millet

Caryopsis

Ovoid, hexagonal, globose

Sorghum

Caryopsis

Finger millet

which is much lower than rice (74%). Millets and wheat therefore have a low glycemic index than rice. As is well known, finger millet has the highest calcium content among all cereals (Devi et al., 2014) and is approximately threefold higher than milk. Calcium levels of other millets are also higher than that of rice and maize, which make them a promising option in place of calcium fortified foods. Kodo millet, pearl millet, finger millet, and sorghum carry iron content two to six times higher than rice, 0e2 fold higher than wheat, and 0e3 fold higher than maize. Thus, regular consumption of these millets will be beneficial for improving diet-based anemia prevalent in women and children worldwide. The levels of other minerals such as potassium, magnesium, and phosphorus are also comparable with that of the major cereals. Toxic minerals such as arsenic, cadmium, lead, and mercury are below the minimum risk level. Millets are rich in vitamins and possess a unique composition. The folate (vitamin B9) content in the millets ranges from 34 to 39 mg/100 g, which is higher; 23%e28% than rice, 4%e9% than wheat, and 9%e14% than maize. Except niacin (vitamin B3, high in proso millet), biotin (vitamin B7, high in little millet), ergocalciferol (vitamin D2, high in finger millet), and phylloquinones (vitamin K1, high in sorghum), the levels of all other vitamins are comparable among the millets and cereals.

Starch granules Grain

Diameter (mm)

Peripheral zone (mm)

Corneous zone (mm)

Sorghum

20e30

Pearl millet

10e12

6.4

6.4

Finger millet

3e21

8e16.5

Proso millet

2e10

Foxtail millet

10

Protein bodies Floury zone (mm)

Type

Size (mm)

Location

Simple

0.3e3

All areas

7.6

Simple

0.6e0.7

All areas

3e19

11e21

Simple/ compound

2.0

Peripheral/ corneous

3.9

4.1

4.1

Simple

0.5e1.7

Peripheral

e

e

e

e

e

e

Functional food ingredients from old age cereal grains

Table 2.4 Characteristics of starch granules and protein bodies of sorghum and millets.

53

54

Table 2.5 Proximate and dietary fiber composition of millets and major cereal grains per 100 g edible portion. All blank spaces in the table represent below detectable limit (Longvah et al., 2017). Moisture (g)

Protein (g)

Proso milleta

e

12.50

Kodo millet

14.23
0.45

08.92
1.09

Pearl millet

8.97
0.60

Little millet

Total fat (g)

Carbohydrate (g)

Energy (g)

1.10

70.04

341

1.72
0.27

2.55
0.13

66.19
1.19

1388
10

10.96
0.26

1.37
0.17

5.43
0.64

61.78
0.85

1456
18

14.23
0.45

08.92
1.09

1.72
0.27

2.55
0.13

65.55
1.29

1449
19

10.89
0.61

07.16
0.63

2.04
0.34

1.92
0.14

66.82
0.73

1342
10

e

12.30

e

4.30

60.09

331

e

06.20

e

2.20

65.55

307

Sorghum

09.01
0.77

09.97
0.43

1.39
0.34

1.73
0.31

67.68
1.03

1398
13

Rice raw brown

09.33
0.39

09.16
0.75

1.04
0.18

1.24
0.08

74.80
0.85

1480
10

Wheat whole

10.58
1.11

10.59
0.60

1.42
0.19

1.47
0.05

64.72
1.74

1347
23

Maize

09.26
0.55

08.80
0.49

1.17
0.16

3.77
0.48

64.77
1.58

1398
25

Finger millet Foxtail millet

a

Barnyard millet

a

a

Nutritive value of Indian foods, NIN e 2007.

Ash (g)

Functional and Preservative Properties of Phytochemicals

Millets & cereals

Table 2.6 Mineral and trace element composition of millets and major cereals per 100 g edible portion. All blank spaces in the table represent below detectable limit (Longvah et al., 2017).

a

Millets & cereals

Aluminum (mg)

Arsenic (mg)

Cadmium (mg)

Calcium (mg)

Chromium (mg)

Cobalt (mg)

Copper (mg)

Iron (mg)

Lithium (mg)

Lead (mg)

Proso milleta

e

e

e

e

0.020

e

1.60

e

e

e

Kodo millet

1.07
0.83

e

e

15.27
1.28

0.021
0.027

0.005
0.003

0.26
0.05

2.34
0.46

0.027
0.003

e

Pearl millet

2.21
0.78

0.97
0.24

0.003
0.001

27.35
2.16

0.025
0.006

0.030
0.015

0.54
0.11

6.42
1.04

0.003
0.001

0.008
0.002

Little millet

e

0.49
0.15

0.001
0.000

16.06
154

0.016
0.006

0.001
0.00

0.34
0.08

1.26
0.44

e

e

Finger millet

3.64
0.69

e

0.004
0.004

364
58

0.032
0.019

0.022
0.009

0.67
0.22

4.62
0.36

0.003
0.003

0.005
0.002

Foxtail milleta

e

e

e

e

0.030

e

1.40

e

e

e

Barnyard milleta

e

e

e

20

0.090

e

0.60

5

e

e

Sorghum

2.56
0.59

1.53
0.04

0.002
0.002

27.60
3.71

0.010
0.003

0.012
0.007

0.45
0.11

3.95
0.94

0.001
0.001

0.008
0.003

Rice raw brown

0.60
0.18

e

0.002
0.001

10.93
1.79

0.005
0.002

0.011
0.003

0.37
0.14

1.02
0.35

e

0.002
0.001

Wheat whole

0.55
0.23

e

0.002
0.001

39.36
5.65

0.006
0.003

0.003
0.002

0.49
0.12

3.97
0.78

0.005
0.004

e

Maize

2.82
0.16

e

e

8.94
0.61

0.010
0.006

0.010
0.003

0.45
0.23

2.49
0.32

0.002
0.001

e

Nutritive value of Indian foods, NIN e 2007.

Table 2.7 Mineral and trace element composition of millets and major cereals per 100 g edible portion. All blank spaces in the table represent below detectable limit (Longvah et al., 2017). Millets & cereals

Magnesium (mg)

Manganese (mg)

Mercury (mg)

Molybdenum (mg)

Nickel (mg)

Phosphorus (mg)

Potassium (mg)

Selenium (mg)

Sodium (mg)

Zinc (mg)

Proso millet

e

e

e

e

e

e

e

e

e

e

Kodo millet

122
5.9

0.33
0.05

0.74
0.15

0.020
0.007

0.074
0.019

101
5.2

94
10.7

14.12
2.26

3.35
0.04

1.65
0.18

Pearl millet

124
19.5

1.12
0.17

0.77
1.48

0.050
0.025

0.056
0.022

289
25.3

365
18.0

30.40
5.22

4.11
0.09

2.76
0.36

Little millet

91.41
12.63

0.23
0.08

0.020
0.010

0.086
0.029

130
27.5

105
15.7

40.41
24.09

4.77
0.14

1.82
0.14

Finger millet

146
10.7

3.19
0.88

3.96
1.41

0.011
0.008

0.078
0.020

210
58.4

443
59.6

15.30
6.23

4.75
0.14

2.53
0.51

Foxtail millet

e

e

e

e

e

e

e

e

e

e

Barnyard millet

e

e

e

e

e

280

e

e

e

e

Sorghum

133
14.8

1.19
0.11

2.62
2.15

0.042
0.021

0.059
0.021

274
35.7

328
25.1

26.29
11.08

5.42
0.21

1.96
0.31

Rice raw brown

93.91
9.11

1.70
0.45

e

0.053
0.026

0.038
0.024

267
64.9

199
40.9

2.26
0.43

3.64
0.08

1.68
0.33

Wheat whole

6125
14.8

3.19
0.59

e

0.073
0.030

0.014
0.005

315
41.8

366
59.6

47.76
5.96

2.50
0.20

2.85
0.65

145
12.4

0.71
0.08

3.19
2.64

0.035
0.014

0.035
0.013

279
35.3

291
27.7

8.69
1.81

4.44
0.18

2.27
0.23

Maize

Millets & cereals

Thiamine B1 (mg)

Riboflavin B2 (mg)

NiacineB3 (mg)

Pantothenic AcideB5 (mg)

Total B6 (mg)

BiotineB7 (mg)

Total folateseB9 (mg)

Proso milleta

0.41

0.28

4.50

1.20

e

e

e

Kodo millet

0.29
0.054

0.20
0.018

1.49
0.08

0.63
0.07

0.07
0.017

1.49
0.18

39.49
4.52

Pearl millet

0.25
0.044

0.20
0.038

0.86
0.10

0.50
0.05

0.27
0.09

0.64
0.05

36.11
5.05

Little millet

0.26
0.042

0.05
0.008

1.29
0.02

0.60
0.07

0.04
0.005

6.03
0.57

36.20
7.04

Finger millet

0.37
00.041

0.17
0.008

1.34
002

0.29
0.19

0.05
0.007

0.88
0.05

34.66
4.97

Foxtail milleta

0.59

0.11

3.20

0.82

e

e

e

Barnyard milleta

0.33

0.10

4.20

e

e

e

e

Sorghum

0.35
0.039

0.14
0.014

2.10
0.09

0.27
0.02

0.28
0.023

0.70
0.06

39.42
3.13

Rice raw brown

0.27
0.023

0.06
0.011

3.40
0.12

0.16
0.04

0.37
0.035

1.38
0.21

11.51
1.69

Wheat whole

0.46
0.067

0.15
0.041

2.68
0.19

1.08
0.21

0.26
0.036

1.03
0.58

30.09
3.79

Maize

0.33
0.32

0.09
0.009

2.69
0.06

0.34
0.03

0.34
0.017

0.49
0.05

25.81
1.44

Functional food ingredients from old age cereal grains

Table 2.8 Water-soluble vitamins profile of millets and major cereals per 100 g of edible portion. All blank spaces in the table represent detectable limit (Longvah et al., 2017).

a

Nutritive value of Indian foods, NIN e 2007.

57

Table 2.9 Fat-soluble vitamins profile of millets and major cereals per 100 g of edible portion. All blank spaces in the table represent below detectable limit (Longvah et al., 2017). Tocotrienols (mg)

Ergocaliferol a (mg)

a

b

g

d

a

b

g

d

Phylloquino nes (K1) mg

Proso milleta

e

e

e

e

e

e

e

e

e

e

Kodo millet

e

0.03
0.010

0.19
0.05

0.19
0.05

03.75
0.63

Pearl millet

5.65
0.27

0.10
0.01

e

1.42
0.20

e

e

e

e

e

2.85
0.63

Little millet

3.75
0.80

0.28
0.14

0.67
0.40

e

e

e

e

0.28
0.09

e

4.47
0.38

Finger millet

41.46
3.12

0.09
0.01

e

0.66
0.06

e

e

e

e

e

3.00
0.44

Foxtail milleta

e

e

e

e

e

e

e

e

e

e

Barnyard milleta

e

e

e

e

e

e

e

e

e

e

Sorghum

3.96
0.30

0.04
0.01

e

0.27
0.03

e

e

e

e

e

43.82
4.84

0.62
0.08

0.05
0.02

0.42
0.57

0.05
0.02

0.02
0.01

2.00
0.83

0.37
0.12

e

e

0.07
0.03

e

e

1.75
0.26

1.29
0.17

0.38
0.05

0.05
0.00

Rice raw brown

a

Tocopherol (mg)

Millets & cereals

Wheat whole

17.49
3.51

0.60
0.33

Maize

33.60
2.82

0.21
0.04

Nutritive value of Indian foods, NIN e 2007.

0.43
0.12

0.03
0.02 e

2.50
0.76

Functional food ingredients from old age cereal grains

59

6. Millet carbohydrates For millions of people from developing countries, millets serve as the major source of carbohydrates. Millet carbohydrates are composed of both structural (cellulose, hemicelluloses, and pectin) and nonstructural carbohydrates (starch, sugars, and fructosans), whereas sorghum has starch, soluble sugar, and fiber (pentasons, cellulose, and hemicellulose) (Dayakar Rao et al., 2017).

6.1

Starch

Starch is the major nonstructural carbohydrate component in the millets that accounts for upto 70% of the seed and determines the quality of millet products. Millet starch granules are simple, with mostly spherical and polygonal shapes (Zhu, 2014). The study conducted by various research groups shows the starch yield varying from 52% to 93.7% for different millets (Table 2.10). Millet starches generally exhibit higher gelatinization temperature and water binding capacity but slow enzymatic hydrolysis than wheat or rice starches (Seetharam et al., 1989). The millet starch is composed of amylase and amylopectin. Amylase is a more water-soluble form in which the D-glucose molecules are linked by a (1 / 4) glycosidic linkage. It has a tightly packed helical structure because of which it is resistant to digestion and thus forms the resistant starch and is the storage starch preferred by plants. Amylopectin is water insoluble, formed by the linear arrangement of D-glucose linked by a (1 / 4) glycosidic bond and branched at every 24 to 30 glucose units with a (1 / 6) glycosidic bond. The quality of the starch is known to play a pivotal role in the metabolic consequences. Several studies have shown that amylose starch diet reduces postprandial glucose levels, weight gain, and fat pad mass, and improves insulin sensitivity because of slower digestion (Aziz et al., 2009; Matsumoto et al., 2016; Robertson et al., 2005). Different studies have determined the amylase percentage in the millets which is summarized in Table 2.10. The variability in the results would be due to the difference in the genotype studied and the method of measurement. Finger millet and pearl millet have about 30% amylose content, while all other millets have more than 10% amylose content. Though a detailed comparison is difficult, the amylose content probably could be contributing to their beneficial effects such as prevention of hyperglycemia, hypercholesteremia, gall stone formation, and colon cancer (Sajilata et al., 2006).

6.1.1

Enzyme digestibility of millet starch

The extent of in vivo digestion of any starch is determined by its susceptibility toward the gastrointestinal amylases, which is determined by starch source, amylose content, structure of amylose and amylopectin, granule size, etc. Gelatinized starch is more susceptible to digestion than native starch (Wankhede et al., 1990). Though different studies on millet starch a-amylose hydrolysis are available, a comparison is difficult because of the difference in the species, variety, and experimental conditions followed (Zhu, 2014). Annor (2013) investigated the effects of starch-protein-lipid interaction

60

Functional and Preservative Properties of Phytochemicals

Table 2.10 The starch and amylose composition of millets. No of genotypes studied

Starch yield (%)

Amylose (%)

Reference

Proso millet

1

93.7

33.9

Annor et al. (2014)

3

84.4e85.67

1.2e21.5

Kim et al. (2012)

Kodo millet

1

e

19.6

Kumari and Thayumanavan (1998)

Pearl millet

1

70.4

32.5

Annor et al. (2014)

3

53.1e56.5

24e31.9

Hoover et al. (1996)

1

60.2

22.8

Wankhede et al. (1990)

1

63

34.1

Malleshi et al. (1986)

e

63

17

Shelton and Lee (2000)

Little millet

1

e

18.8

Kumari and Thayumanavan (1998)

Finger millet

1

63.4

32.4

Annor et al. (2014)

1

55.7

38.6

Malleshi et al. (1986)

3

57.5e59.2

14.4e16.2

Wankhede et al. (1979)

1

52

32

Malleshi et al. (1986)

1

56.2

16.9e17.5

Wankhede et al. (1979)

1

67.5e68.5

3.3e11.4

Kim et al. (2009)

Barnyard millet

1

e

20.0

Kumari and Thayumanavan (1998)

Sorghum

3

68.2e71.4

14e23.7

Sang et al. (2008)

e

60e77

21e28

Shelton and Lee (2000)

22.6e26.1

Carcea and Acquistucci (1997)

Millet

Foxtail millet

White fonio

2

Rice

e

71.31
1.91

0.2e25

Longvah et al. (2017); Zhou et al. (2002)

Wheat

e

56.82
2.69

3e25

Longvah et al. (2017); Chen et al. (2016)

e

63e72

23.4e27.6

Shelton and Lee (2000)

e

59.35
0.83

25e35

Longvah et al. (2017); Wang. et al. (1993)

e

64e78

24

Shelton and Lee (2000)

Maize

Functional food ingredients from old age cereal grains

61

on millet starch hydrolysis rates and glycemic index. The increased starch hydrolysis and glycemic index were observed while removing the proteins, lipids, or both, with starch-lipid interaction having more effect than starch-protein interactions. The complexing index (CI) of fatty acids with millet starches was observed to be increased with increasing degree of unsaturation, and cis-oleic acid was very effective in reducing millet starch hydrolysis rates while linoleic acid-complexed starches were much less resistant to hydrolysis. Different studies have compared slowly digestible (SDS) and resistant (RS) fractions of millets and the major cereals. Enzyme susceptibility to porcine pancreatic a-amylase was similar in maize and proso millet starches (Yanez and Walker, 1986) whereas rice starch was more susceptible than both native and gelatinized starch of finger millet (Madhusudhan and Tharanathan, 1995). In another study, the resistant starch content in the kodo millet flour starch was found to be high than the rice and wheat flour starch (Annor, 2013). Also, the millet starches that have more of long amylose chains with long chain segments between branch points would likely have lower enzymatic starch hydrolysis. In conclusion, the low glycemic and insulinemic response of the millet starches vary depending on the species, genotype, processing techniques, and interaction with other macromolecules, such as proteins and lipids.

6.1.2

Uses of millet starch

The millet starch is in use by various food and nonfood industries (Table 2.11) either in the native or modified form. Millet flourebased baked foods such as bread, muffins, cookies, and pasta are already in the market. Despite providing the additional nutrition than wheat-based products, millets are a sigh of relief to the people with celiac disease. Different studies from decades have concluded the conditions most suitable for baking millet flour with high sensory qualities (Badi and Hoseney, 1976, Olatunji et al., 1992; Marston et al., 2016; Ferreira et al., 2016). Sorghum is also used for beer production, mainly in African countries. From Nigeria alone, beer production using sorghum in 2012 was around two billion liters (Taylor and Taylor, 2018). Sorghum being a starch rich grain is suitable for bioethanol production (Ai et al., 2011). Approximately 1.7 billion liters of bioethanol was produced from sorghum in the United States in 2016 (Taylor and Taylor, 2018). The starch composition of sorghum is similar to maize and uses the same fermentation method for bioethanol production. Suresh et al. (1999) developed a method for ethanol production from damaged and high quality sorghum, where raw flour starch was saccharified by Bacillus subtilis and fermented by Saccharomyces cerevisiae. The ethanol yield from the damaged grain and the high quality sorghum grains were 3.5% and 5%, respectively. The effect of decorticating sorghum prior to starch hydrolysis and ethanol fermentation was investigated by Corredor et al. (2006), where decortication decreased the protein content of the samples up to 12% and increased starch content by 5%e16%. An increase in the ethanol yield of 3%e11% for 10% decorticated sorghum and 8%e18% for 20% decorticated sorghum was observed. The ethanol fermentation of the pearl millet using S. cerevisiae was also investigated (Wu et al., 2006). The final ethanol yields were

62

Functional and Preservative Properties of Phytochemicals

Table 2.11 The nonfood applications of millet starch. Millet

Form

Use

Reference

Sorghum

Raw flour

Bioethanol production

Suresh et al. (1999)

Pearl millet

Native

Bioethanol production

Wu et al. (2006)

Pearl millet

Native

Tablet formulation of calcium carbonate, sodium bicarbonate, sulphadimidine, and chloroquine phosphate

Akande et al. (1991)

Pearl millet

Pre-gelatinized/ acid modified/ native

Tablet formulation of chloroquine

Odeku and Alabi. (2007)

Finger millet

Acetylated/ oxidized

Tablet and capsule formulation

Afolabi et al. (2012)

Proso millet

Neutralized

Nanoparticle production

Sun et al. (2014)

8.7%e16.8% (v/v) at dry mass concentrations of 20%e35% with an efficiency of 94.2%, which is similar to that of maize and sorghum. The pregelatinized millet starch was used for preparing the biodegradable polymer mud which is highly pure and more suitable for drilling operations (Ukachukwu et al., 2010). Native and differently modified starches have been utilized for tablet formulations (Akande et al., 1991; Odeku and Alabi, 2007). Odeku and Alabi (2007) compared the pearl millet chloroquine formulation with that of corn starch, where there was no significant difference in the mechanical and drug release properties of native millet and corn starches, but tablets containing the modified forms of millet starches showed significantly lower values of disintegration and dissolution times than those of corn starch. Sun et al. (2014) prepared starch nanopartices of size 20 e100 nm from proso millet starch using a green and facile method combined with enzymolysis and recrystallization. In general, the millet starches are yet to be studied in detail and explored for successful nonfood applications. Again, the properties of individual millet starches and possible applications have to be investigated in detail.

6.2

Soluble sugars

The soluble sugar content is a varying factor during development of grains. Sucrose and glucose serve as the major soluble fraction in all the millets. The soluble sugars of various millet grains have concluded in Table 2.12.

Millet

Fructose (g)

Glucose (g)

Sucrose (g)

Maltose (g)

Raffinose

Stachyose

Total free sugars (g)

Proso millet

e

e

e

e

0.08

e

e

Kodo millet

e

0.89
0.11

0.40
0.02

e

e

e

1.29
0.10

Pearl millet

0.21
0.01

0.60
0.02

e

e

0.71

0.09

0.81
0.01

Little millet

e

0.24
0.10

0.13
0.01

e

e

e

0.37
0.09

Finger millet

e

0.25
0.06

0.12
0.02

e

0.07

e

0.34
0.06

Foxtail millet

e

e

e

e

0.04

e

e

Barnyard millet

e

e

e

e

e

e

e

Sorghum

0.57
0.07

0.10
0.01

0.60
0.04

e

0.10e0.39

0.10

1.27
0.05

Rice raw brown

e

0.55
0.08

0.14
0.02

e

e

e

0.69
0.08

Wheat whole

0.72
0.03

0.78
0.05

0.30
0.02

e

e

e

1.80
0.06

Maize dry

0.16
0.03

0.80
0.01

0.70
0.03

e

e

e

1.66
0.04

Functional food ingredients from old age cereal grains

Table 2.12 The soluble sugar composition of millets and major cereals (per 100 g of edible portion) (all blank space in the table represent below detectable limit).

Longvah et al., 2017; Subramanian et al., 1980, FAO data sheet.

63

64

6.2.1

Functional and Preservative Properties of Phytochemicals

Dietary fiber

Dietary fibers have gained considerable attention in past few decades due to their protective role in health. A fiber-rich diet is already a health habit for many and millets have turned to be a choice for the same. Table 2.13 represents the dietary fiber composition of millets and the major cereal grains. According to FDA (Food and drug administration), the recommended daily value of dietary fiber is 25 g/day. The daily intake of whole millets provides 24%e44% depending on the millet, which is higher than 16% from brown rice and is equal to whole wheat. The dietary fibers can be either soluble or insoluble. Generally they exist in 1:2 ratios. The soluble fibers will dissolve in water forming a viscous gel, bypass the digestion in small intestine, and are fermented by the microflora in the colon (Lattimer and Haub, 2010). Examples include some hemicelluloses, pectins, b-glucans, inulin-type fructans, etc. According to the available data, the soluble fiber content of millets is around 2% which is higher than major grains. Ugare et al. (2014) have reported 4% soluble fiber in barnyard millet. Zhao et al. (2018), have explained a positive correlation between dietary fibers, short chain fatty acid (SCFA) producing gut microbiota, and type 2 diabetes. The soluble dietary fibers will promote the growth of SCFA producing strains in the colon, and they indeed inhibit the growth of other strains that produce detrimental compounds. These effects together will prevent/improve type 2 diabetes. Relatively high soluble fiber content in the millets will thus help to have a healthy gut microbiota which ultimately ameliorates the metabolic and cardiovascular diseases. Table 2.13 The dietary fiber composition of millets and major cereals (per 100 g of edible portion). Dietary fiber (g)

Minerals and cereals Total

Soluble

Insoluble

e

e

e

Kodo millet

06.39
0.60

2.11
0.34

4.29
0.82

Pearl millet

11.49
0.62

2.34
0.42

9.14
0.58

Little millet

06.39
0.60

2.27
0.52

5.45
0.48

11.18
1.14

1.67
0.55

9.51
0.65

8.07
0.89

e

e

12.6

4.2

8.4

Sorghum

10.22
0.49

1.73
0.40

8.49
0.40

Rice raw brown

04.43
0.54

0.82
0.15

3.60
0.55

Wheat whole

11.23
0.77

1.60
0.75

9.63
0.19

Maize

12.24
0.93

0.94
0.18

11.29
0.85

Proso millet

a

Finger millet Foxtail millet

a

Barnyard millet

a

b

Anju, and Sarita, 2010. Ugare et al., 2014. Longvah et al., 2017. b

Functional food ingredients from old age cereal grains

65

Insoluble fibers neither solubilize in water nor get fermented by microbiota in human GI tract. Cellulose, lignin, and some hemicelluloses are the examples. Insoluble fiber content in the millets varies from 4.2% to 9.5%. Pearl millet, finger millet, and sorghum have higher insoluble fiber content among millets. The high insoluble fiber content will prevent colon cancer, constipation, and helps for weight loss. The arabinoxylan composition of millets is less explored. The pearl millet arabinoxylan is highly branched (Nandini and Salimath, 2002), whereas the purified arabinoxylans from finger millet exhibited different molecular weights with a different extraction method (Prashanth and Muralikrishna, 2014). The same group has also reported the immune modulatory effects of arabinoxylans. The alkali extracted from arabinoxylans showed mitogenic activity, activation of macrophages including phagocytosis, and directly proportional to the amount of bound ferulic acid content, and independent of molecular weight as well as arabinose/xylose ratio (Prashanth et al., 2015). Hydroxycinnamic acid bound arabinoxylans (HCA-AXs) from finger, proso, barnyard, and foxtail millets have shown potential antioxidant activity (Bijalwan et al., 2016). Together, the dietary fiber content in the millets will help to improve digestive health, bowel movement, blood glucose levels, serum cholesterol levels, and support the growth of beneficial gut microflora. The dietary fiber components except arabinoxylan (exists in endosperm cell walls) are mainly associated with the pericarp and endosperm cell walls due to which a considerable loss will happen during manual or mechanical decortications. Thus like any other cereals, the whole millet intake will be more beneficial than the processed one.

7. Millet proteins As is the case with carbohydrates, millets and sorghum serve the major portions of dietary proteins for a significant population in Africa and part of Asia. Millet proteins are gluten free. They are distributed as endosperm (80%), germ (16%), and pericarp (3%) (Taylor and Schussler, 1986). The amino acid composition of the millet proteins are summarized in Table 2.14. A comparison among the millets and cereals is difficult with the available data, since their composition can be varied with agronomic conditions and genotype. Kalinova and Moudry (2006) evaluated the protein content and quality of eight varieties of proso millets, where it was shown that protein content was significantly influenced by weather during the year. The dry conditions increased the protein content but quality was compromised. The similar difference was also reported on a study of 14 varieties of foxtail millet (Monteiro et al., 1982). Tryptophan, lysine, and sulfur containing amino acids (methionine and cysteine) are limited in millets and sorghum. In case of foxtail millet, utilization of lysine and isoleucine were found to be interfered by excess leucine content (Monteiro et al., 1982). However, Ravindran (1992) concluded that millets are fair sources of essential amino acids except lysine. Also, on a comparative study of proso, foxtail, and finger millet, the latter one was found to be better for a balanced protein diet. Contrarily, Han et al. (2019) reported that diets based on proso millet and foxtail millet require more amino

Table 2.14 The amino acid composition of millets and major cereals (per 100 g of edible portion). Millets & cereals

Histidine

Isoleucine

Leucine

Lysine

Methionine

Cysteine

Phenyl alanine

Threonine

Tryptophan

Valine

Proso milleta

2.4

4.9

14

1.7

4.1

1.0

6.3

4.1

e

6.4

Kodo millet

2.14
0.07

4.55
0.22

11.96
1.65

1.42
0.17

2.69
0.16

1.92
0.05

6.27
0.34

3.89
0.16

1.32
0.19

5.49
0.23

Pearl millet

2.15
0.37

3.45
0.74

8.52
0.86

3.19
0.49

2.11
0.50

1.23
0.33

4.82
1.18

3.55
0.40

1.33
0.30

4.79
1.04

Little millet

2.35
0.18

4.14
0.08

08.08
0.06

2.42
0.10

2.21
0.10

1.85
0.14

6.14
0.10

4.24
0.12

1.35
0.10

5.31
0.16

Finger millet

2.37
0.46

3.70
0.44

08.86
0.54

2.83
0.34

2.74
0.27

1.48
0.23

5.70
1.27

3.84
0.45

0.91
0.30

5.65
0.44

Foxtail milleta

2.3

5.1

16

1.9

4

1.1

6.2

4.5

e

6.3

Barnyard millet

e

e

e

e

e

e

e

e

e

e

Sorghum

2.07
0.20

3.45
0.63

12.03
1.51

2.31
0.40

1.52
0.50

1.06
0.30

5.10
0.50

2.96
0.17

1.03
0.21

4.51
0.71

Rice raw brown

2.36
0.18

4.08
0.05

08.40
0.55

3.63
0.29

2.39
0.26

2.02
0.12

5.50
0.49

3.38
0.25

1.00
0.17

6.72
0.36

Wheat whole

2.65
0.31

3.83
0.20

06.81
0.33

3.13
0.26

3.13
0.26

2.35
0.23

4.75
0.38

3.01
0.17

1.40
1.10

5.11
0.05

Maize

2.70
0.21

3.67
0.22

12.24
0.57

2.64
0.18

2.10
0.17

1.55
0.14

5.14
0.29

3.23
0.29

0.57
0.12

5.41
0.71

a Ravindran, 1992. Longvah et al., 2017.

Functional food ingredients from old age cereal grains

67

acid supplementation than those based on wheat, brown rice, oats, and buckwheat, based on DIAAS (Digestible Indispensable Amino Acid Score) values. The major storage proteins of millets and sorghum are prolamines followed by glutelins. Unlike maize prolamines, sorghum prolamines otherwise known as kafirins are hydrophobic in nature (Shewry and Halford, 2003) and form disulfide linkages because of their high protein content. They are distributed in four groups; a, b, g, and d. Alpha-type forms are the major prolamin components in sorghum, which are similar to the maize zeins. b and g kafirins are analogous to b and g maize zeins and are also present in millets and sorghum, whereas d zein analog in sorghum does not contain a methionine-rich region, but there is some indication that they do exist in millets (Belton and Taylor., 2004). The kafirins are rich in glutamine, proline, alanine, and leucine but contain little lysine (Taylor and Belton, 2002). The presence of two methionine rich proteins named as a and b setarins are reported in the prolamine fractions of foxtail millet and fonio (Naren and Virupaksha, 1990; Shewry and Halford, 2003). Monteiro et al. (1982) have observed a positive correlation between the total protein content and prolamine content that the increase in protein is largely due to an increase in the prolamin content. Three protein fractions: albumin-globulin, prolamin, and glutelin were analyzed in the same study; prolamin fraction was rich in glutamic acid, proline, leucine, and phenylalanine. Albumin-globulin fraction contained basic amino acids such as lysine and arginine, and the glutelin fraction had high amounts of lysine and histidine. The prolamine fraction had least lysine content among the three due to which an increase in the prolamine content negatively affects the protein quality. In conclusion, millets have adequate quantities of protein with a less balanced essential amino acid composition. The generation of varieties with reduced prolamine fraction and increased albumin-globulin and glutelin fractions can improve the protein quality of millets.

7.1

Digestibility of millet proteins

Unlike wheat, barley, and rye, kafirins of sorghum are slow digesting and nonallergic for celiac people. The absence of toxic gliadinlike peptides was confirmed in sorghum by genome and immunochemical studies (Pontier et al., 2013). The poor digestibility of these proteins is multifactorial resulting from both endogenous and exogenous factors (interactions of proteins with nonprotein components such as polyphenols, starch, nonstarch polysaccharides, phytates, and lipids). Other factors contributing to the slow digestion of the millet proteins include low protein solubility, digestive enzyme inhibitors (proteases and tannins), poor enzyme accessibility due to rigid cell walls and/or seed coat, etc. (Becker and Yu, 2013). The in vitro protein digestibility (IVPD) has been studied by different groups which have been reviewed in detail by Annor et al. (2017). The solubility of sorghum proteins was reduced during heating due to the formation of disulfide-mediated protein crosslinking (Duodu et al., 2003). The proso millet proteins are similar to that of kafirins. Gulati et al. (2017) have reported that the proso millet protein processed by both heat and wet drying have a low digestibility (50% lesser) than the unprocessed flour due to the formation of hydrophobic aggregates. An inverse relationship between tannin content and IVPD was reported in finger

68

Functional and Preservative Properties of Phytochemicals

millet, where tannins are associated with the glutelin fraction (Ramachandra et al., 1977). Ravindran (1992) reported an improved IVPD for proso foxtail and finger millets suggesting the presence of heat-labile antiproteinase factors in the uncooked flours. Since the reasons of slow digestibility are different among the millets, it has to be studied individually in detail.

7.2

Millet proteinsdapplications

Kafirins are used to prepare edible or nonedible, biodegradable biofilms. The brewers spent grain and distillers dried grains with solubles (DDGS), the coproducts of sorghum brewing and bioethanol production, respectively, are the ideal raw materials for biofilms (Taylor and Taylor, 2018). The starch fermentation increases the protein concentration by up to 40% for brewers spent grain (Holmes et al., 2013) and 30%e45% for DDGS (Yan et al., 2011) and thus give a high yield of kafirin. The kafirin extracted from bran layers (removed by food industries) is used for biofilm production (da Silva and Taylor, 2005). Thus, Taylor and Taylor (2018) suggested that kafirin extraction and bioplastic manufacture would have to occur on the same site as sorghum bioethanol production, where there is a constant supply of high-protein feedstock from DDGS. Taylor et al. (2006) have reviewed the different studies of kafirin biofilm production and modification. Kafirin films had similar tensile and water vapor barrier properties to films made from commercial maize zein when plasticized with glycerol and polyethyleneglycol (PEG) 400 but were intensely colored than the latter (Buffo et al., 1997). Taylor et al. (2006) also mentioned the use of kafirin coating on fruits. Coating pears with kafirin delayed ripening, reduced stem-end shriveling, and increased their shelflife, whereas the same caused an unacceptable darkening of the litchi peel surface. In both cases, it was found that kafirin coating reduced respiration rate.

8.

Millet lipids

Millet lipids are less studied compared to starch and proteins. Free lipids constitute 60%e70% of the total lipids in millets. They are located in the scutellar area of the germ and are thus significantly lost during decortication or degermination. Millet oils are rich in mono and polyunsaturated fatty acids (Table 2.15). Osagie and Kates (1984) have studied the lipid composition of pearl millet, where the total lipid consisted of 85% neutral lipids, 12% phospholipids, and 3% glycolipids. Triacylglycerols are the major components in neutral lipids and small amounts of mono- and diacylglycerols, sterols (campesterol and stigmasterol), free fatty acids were also present. Among phospholipids, lysophosphatidylcholine was the major phospholipid (42%) followed by phosphatidylcholine (24%); lysophosphatidylethanolamine (21%); and trace amounts of phosphatidylglycerol, phosphatidic acid, phosphatidylserine, and phosphatidylinositol. Glycolipids were present as esters: sterol glycoside, monogalactosyldiacylglycerol, digalactosyldiacylglycerol, and cerebrosides. Sorghum oil has similar fatty acid composition of maize oil with palmitic acid, oleic acid, and linoleic

Table 2.15 The fatty acid composition of millets and major cereals (per 100 g of edible portion). Millets & cereals

Palmitic acid (C16) (mg)

Palmitoleic acid (C16: 1) (mg)

Stearic acid (C18) (mg)

Oleic acid (C18:1) (mg)

Linoleic acid (C18: 2) (mg)

Linolenic acid (C18:3) (mg)

TSFA (mg)

TMUFA (mg)

TPUFA (mg)

Proso millet

e

e

e

e

e

e

e

e

e

Kodo millet

211
0.9

3.21
0.11

28.40
1.22

291
7.2

576
17.8

21.02
1.20

246
2.3

297
6.8

597
18.4

Pearl millet

729
21.3

6.97
0.45

128
19.6

1040
39.8

1844
56.7

140
5.8

875
34.5

1047
39.9

1984
55.0

487
26.1

e

102
11.9

868
24.2

1230
42.9

47.20
5.17

589
31.9

868
24.2

1277
47.5

290
15.4

e

27.86
2.43

585
36.3

362
15.3

68.58
11.85

317
17.0

585
36.3

431
20.7

6.40

e

e

e

e

e

e

e

e

Barnyard millet

10.80

e

e

e

e

e

e

e

e

Sorghum

149
5.6

e

14.22
0.79

314
13.7

508
18.3

16.54
1.31

163
6.2

314
13.7

524
18.3

Rice raw brown

273
14.9

2.77
0.46

33.01
4.34

197
15.4

490
33.2

16.10
0.92

346
20.3

203
15.7

506
33.6

Wheat whole

176
7.4

e

4.83
2.25

141
9.4

616
22.1

38.51
3.88

191
8.0

141
9.4

654
23.7

Maize dry

363
4.6

e

42.45
2.76

700
17.9

1565
18.2

40.76
2.43

413
5.6

706
17.4

1606
18.5

Little millet Finger millet

a

Foxtail millet

a

a

Nutritive value of Indian foods, NIN e 2007. Longvah et al., 2017.

70

Functional and Preservative Properties of Phytochemicals

acid being the major fatty acids (Osman et al., 2000). The oil content of the germ, bran, and endosperm were 28.1%, 4.9%, and 0.6%, respectively. The bran oil contained more wax (Rooney, 1978). In proso millet, free lipids in the bran and flour were higher than that of bound lipids and ranged from 3.2% to 4.06% and 3.45%e6.84%. The prevalent fatty acids are linoleic acid, oleic acid, and palmitic acid (Lorenz and Hwang, 1986). Liang et al. (2010) studied the lipid composition of foxtail millet bran oil. The crude oil availability was 9.39
0.17%, majorly composed of linoleic acid (66.5%), oleic acid (13.0%), palmitic acid (6.4%), and stearic acid (6.3%). It was observed that linoleic acid is present abundantly in the sn-2 position (71.2%). Trilinoleate (LLL, 29.3%) and dilinoleoyl-monoolein (LLO, 17.2%) were the dominant triglyceride species present. The total lipids amounted to 8.3%, 5.1%, and 8.0% in little, kodo, and barnyard millet cereals, respectively (Sreedhar and Lakshminarayana, 1992). Linoleic (18:2), oleic (18:1), and palmitic (16:0) acids were dominant in all lipid classes.

8.1

Sorghum wax as edible biofilm

Weller and Hwang (2005) have reported that wax and other lipid classes can be extracted from the distillers dried grains (DDG) remains of sorghum after bioethanol production using n-hexane. Reports on extraction with other nonpolar solvents are also available. Sorghum wax has a high melting point (77 C e85 C) similar to the carnauba wax. Hwang et al. (2002) have reviewed various studies on the chemical composition (alkanes, aldehydes, alcohols, and acids) of the sorghum wax and analyzed the inconsistencies in the wax composition among research groups. However, different groups have attempted the use of sorghum wax as edible biofilm. Sorghum wax/medium chain triglyceride (MCT) oil mixture was used to coat gelatinbased candies and compared with carnauba wax coat. Samples treated with the laboratory-extracted sorghum wax rated lower than carnauba wax-treated samples for surface reflection, clarity, chalkiness, off-flavor, and aftertaste on sensory analysis (Weller et al., 1998a). In another study, Weller et al. (1998b) have reported that sorghum and refined carnauba wax are equally effective in improving water vapor barrier properties of zein films. Further research is needed to explore the uses of sorghum wax.

9.

Millet nutraceuticals

Exploring natural curatives over the synthetic counterparts for lifestyle disorders is in demand. Millets are known to contain several bioaccessible compounds with beneficial effects. The major nutraceutical components of the millets are summarized below.

9.1

Phenolic acids

Millets are abundant source of a variety of conjugated and free phenolics. Their composition is varied among the genotypes and with respect to the extraction methods. About 90% of phenolics is concentrated in the seed coat, and the rest of it is distributed

Functional food ingredients from old age cereal grains

71

in the endosperm cell walls (Chethan and Malleshi, 2007). Thus milling process will remove a major portion of the phenolics. According to Chandrasekara and Shahidi (2011b), the insoluble bound phenols attached to the cell wall contribute majorly to the millet phenolics and the soluble extracts of kodo whole grain millet has the highest total polyphenols and proso millet has the least. This was further confirmed by a study of Hegde and Chandra (2005), where the kodo millet flour showed highest DPPH quenching activity (70%) compared to other millet extracts (15%e53%). Also, the white varieties of sorghum, finger millet, and foxtail millet had a lower quenching activity than their colored counterparts, indicating that phenolics in the seed coat could be responsible for the antioxidant activities. In finger millet, 90% phenolics were in seed coat and 10% in endosperm wall (Chethan and Malleshi, 2007). The major phenolics of millets are hydroxybenzoic acids, hydroxycinnamic acids, and flavanoids. Their composition is similar among millets. The available phenolic compositions of millets are given in Table 2.16.

Table 2.16 Phenolic composition of millets. Millet

Class of phenolics

Examples

Reference

Finger millet

Hydroxybenzoic acids and Hydroxy cinnamic acids

Gallic, protocatechuic, vanillic, gentistic, syringic, p-hydroxy benzoic, ferulic (most abundant), caffeic, pcoumaric, cinnamic, sinapic

McDonough et al. (1986), McDonough et al. (1986), Rao and Muralikrishna (2001)

Flavanoids

Quercetin, apigenin, rutin, procyanidins, catechin, epicatechin, vitexin, tricin, luteolin, myricetin, epicatechin, epigallocatechin, naringenin

Xiang et al. (2019), Shobana et al. (2009)

Hydroxy cinnamic acids and Hydroxybenzoic acids

Coumaric acid, caffeic acid, cinnamic acid, ferulic acid, p-hydroxy benzoic acid, vanillic acid

Chandrasekara and Shahidi (2011a,b,c), Zhang et al. (2017)

Flavanoids

Catechin, quercetin, kempherol, epigenin

Shahidi and Chadrasekara. (2013)

Flavanoids

Luteolin and tricin

Watanabe, Mitsuru. (1999)

Foxtail millet

Barnyard millet

Continued

72

Functional and Preservative Properties of Phytochemicals

Table 2.16 Phenolic composition of millets.dcont’d Millet

Class of phenolics

Examples

Reference

Proso millet

Hydroxy cinnamic acids & Hydroxybenzoic acids

Coumaric acid, ferulic acid, sinapic acid, caffeic acid, vanillic acid, syringic acid

Chandrasekara and Shahidi (2011a,b,c), Han et al. (2018), Zhang et al. (2014)

Flavanoids

Myricetin, kempherol, and apigenin

Shahidi and Chadrasekara. (2013)

Hydroxy cinnamic acids & Hydroxybenzoic acids

p-hydroxybenzoic acid, protocatechuic acid, gallic acid, caffeic acid, p-coumaric acid, sinapic acid, transferulic acid, syringic acid, vanillic acid, chlorogenic acid

Shahidi and Chadrasekara. (2013)

Flavanoids

Vitexin, isovitexin, luteolin, quercetin, apigenin, kempherol

Hydroxy cinnamic acids & Hydroxybenzoic acids

Gallic acid, protocatechuic acid, p-hydroxybenzoic acid, gentisic acid, salicylic acid, vanillic acid, syringic acid, coumaric acid, ferulic acid, sinapic acid, caffeic acid, cinnamic acid

Flavanoids

Apigeninidin, apigeninidin 5glucoside, luteolinidin, apigenin, luteolin, naringenin, taxifolin, apiforol, luteoforol, catechin

Hydroxy cinnamic acids & Hydroxybenzoic acids

Vanillic acid, syringic acid,salicylic acid, coumaric acid

Nambiar et al. (2012)

Flavanoids

Glucosylvitexin, glucosylorientin, and vitexin

Reichert (1979)

Kodo millet

Sorghum

Pearl millet

Awika et al. (2004), Bate-Smith (1969), Nip and Burns (1971), Gujer et al. (1986), Gupta and Haslam (1978), Hahn et al. (1983)

Functional food ingredients from old age cereal grains

73

Table 2.16 Phenolic composition of millets.dcont’d Millet

Class of phenolics

Examples

Reference

Little millet

Hydroxy cinnamic acids & Hydroxybenzoic acids

Vanillic acid, syringic acid, gallic acid, protocatechuic acid, ferulic acid, gentisic acid, syringic acid, phydroxy benzoic acid

Pradeep and Guha (2011)

Flavanoids

Apigenin

9.2

Tannins

Tannins act as a double-edged sword in case of nutrition. They are potential nutraceuticals (antioxidants) as well as antinutrients (impairs the protein digestibility and mineral absorption) in millets. They are present mainly in the testa layer of millets, are the reason for the dark color (Siwela et al., 2007), and exhibit high variance in the composition. Among millets, brown and dark brown varieties of finger millets have high tannin content ranging from 0.04% to 3.74% of catechin equivalents (Rao and Deosthale, 1988). Condensed tannins known as proanthocyanidins or procyanidins are present in some varieties of sorghum (Dykes and Rooney, 2006). Lorenz (1983) evaluated the tannin content in the proso millet which was 0.357%e1.301% of catechin equivalents in hulled grains and 0.023%e0.034% in dehulled grains. Tannin content of barnyard millet varieties ranged from 3.25 to 3.96 mg/g according to Panwar et al. (2016). In addition to the well-known antioxidant properties, Links et al. (2016) studied the antihyperglycemic effect of kafirin-encapsulated tannins and found that they are efficient in decreasing blood glucose levels and insulin levels in rats. In contrast, tannins impaired mineral absorption in pearl millet varieties (Lestienne et al., 2005).

9.3

Steryl ferulates

Steryl ferulates (SFs) are the esters of phytosterols/triterpene alcohols and ferulic acid. Oryzanol (mixture of cycloartenyl ferulate, 24-methylenecycloartanyl ferulate, campesteryl ferulate, campestanyl ferulate, and b-sitosteryl ferulate) present in the rice bran is the most studied class of SFs. They are excellent antioxidants and improve the metabolic diseases like hypercholesteremia and diabetes (Kikuzaki et al., 2002, Chen and Cheng, 2006). These health claims are highly dependent on their composition. Different studies have explored the presence of SF compositions in other cereal brans like wheat, barley, and rye (Nystr€ om et al., 2005). Tsuzuki et al. (2018) reported the presence of unique steryl ferulate compositions in barnyard and foxtail millets. The whole foxtail millet had SF content which is about 80% of oryzanol in brown rice. Though stigmastanyl ferulate, stigmastanyl coumalate, b-sitosteryl ferulate, campestanyl ferulate, and campestanyl coumalate were identified as major SFs in both foxtail and barnyard millets, their percentile composition was significantly different. The SF composition in other millets and their physiological effects are yet to be studied.

74

9.4

Functional and Preservative Properties of Phytochemicals

Carotenoids

The whole millets are rich sources of carotenoids. The total carotenoid content of pearl millet, kodo milet, sorghum, finger millet, and little millet are 293
55.7, 272
25.1, 212
48.9, 154
25.6, 120
09.0 ug, respectively (Longvah et al., 2017). The major carotenoids present in millets are b-carotene, lutein, and zeaxanthin.

10.

Antinutrients in millets

Antinutrients are compounds that interfere with the absorption of nutrients. The millet antinutrients are yet to be studied in detail.

10.1

Phytic acid

Phytic acid (myo-inositol-1,2,3,4,5,6-hexakisphosphate or InsP6), the abundant storage form of phosphorus, is the major antinutrient present in the millets. Phytic acid will chelate with the mineral cations, particularly to the divalent cations of iron, magnesium, calcium, and zinc and impair their bioavailability. They also inhibit the digestive enzymes like pepsin, a amylase, and trypsin. During germination, the endogenous phytase will degrade phytate, releasing stored phosphorus, myo-inositol, and bound mineral cations which are utilized by the developing seedling. Ravindran (1991) analyzed the phytic acid content of proso, finger, and foxtail millets, which ranged from 0.5% to 0.7% higher than that of polished rice and lower than wheat and maize. In pearl millet, the levels were found to be 179e306 mg/100 g and vary according to the location and genotype. It was slightly lower than wheat and present high in germ than endosperm (Simwemba et al., 1984). In another study, pearl millet contained 354e796 mg/g phytic acid which forms 77% of total phosphorus (Abdalla et al., 1998). According to Panwar et al. (2016) phytic acid content in seeds of barnyard millet varieties ranged from 3.30 to 3.70 mg/g, whereas in finger millet varieties it ranged from 5.54 to 5.58 mg/g. Mohammed et al. (2011) reported 317.65 mg phytic acid/ 100 g in sorghum flour. To our knowledge, the phytate levels of other millets are scanty.

10.2

Oxalates

Oxalates interfere with the calcium bioavailability. An oxalate content of 21e29 mg/ 100 g dry weight was reported in proso, finger, and foxtail millets (Ravindran, 1991). Pearl millet is having a slightly higher oxalate content: 36e64.8 mg (Suma and Urooj, 2014) and the unprocessed whole sorghum flour had 1.12 mg/g oxalate content (Ojha et al., 2018). In general, the oxalate content in the millets is relatively low and similar oxalate content has been reported in different fruits and vegetables. Thus they are not raising any major nutritional challenge. Also, 50%e70% of the oxalates are present in the soluble form which will be leached out during normal cooking (Ravindran, 1991).

Functional food ingredients from old age cereal grains

10.3

75

Protease inhibitors

The protease inhibitors are other nutritional barrier for millets. Chandrasekher et al. (1982) analyzed the protease inhibitors of trypsin, chymotrypsin, and pepsin in the different millet varieties in detail. Proso and kodo millets have not showed any detectable inhibition, whereas finger millet showed both antitryptic and antichymotryptic activity. Antitryptic activity alone was exhibited by pearl and foxtail millets. Except two varieties, sorghum exhibited higher antichymotryptic activity than the antitryptic activity. Ravindran (1991) reported that the antitryptic activities of proso, finger, and foxtail millets were high compared to their antichymotryptic activities. Proso millet was having higher antitryptic activities than the other two, and foxtail millet had no detectable antichymotryptic activity under the assay conditions used. There was no any significant difference observed in trypsin inhibition activity of barnyard millet (7.87%e8.37%) and finger millet (8.02%e8.36%) varieties (Panwar et al., 2016). Veerabhadrappa et al. (1978) showed that during germination, the antitryptic activity and antichymotryptic activity were markedly reduced in the endosperm of finger millet. Udupa and Pattabiraman (1985) isolated and characterized the inhibitor protein from Japanese barnyard millet. It was a 14 Kda protein which inhibited bovine trypsin at 1:2 and bovine chemotrypsin at 1:1 ratios in a noncompetitive manner. Amino and guanido groups were found to be essential for antitryptic activity, whereas only guanido groups were essential for antichemotryptic activity. Pearl millet is reported to have amylase inhibitor, which is more in the debranned sample (Sharma and Kapoor, 1996). Amylase inhibitor identified in the barnyard millet was 10.72 kDa protein, which was expressed from 7 to 28 days of development (Panwar et al., 2018). We observed apparent discrepancies in the studies which are due to difference in genotype, age of seeds, extraction procedures, assay sensitivity, and the stability of inhibitors.

10.4

C-glycosylflavones

Millets are notorious for the claim of inducing goiter. Gaitan et al. (1989) analyzed this hypothesis in pearl millet using in vitro and in vivo models. The fractions rich in three Cglycosylflavones present in millet, glucosylvitexin, glycosylorientin, and vitexin, were significantly inhibited by thyroid peroxidase when compared to the control methimazole. They concluded that a millet diet along with iodine deficiency will contribute to the genesis of endemic goiter. Fermentation was shown to increase the goitrogenic activity by removing considerable amounts of Mg (>50%), Zn (27%e39%), and K (45%) (Elnour et al., 1998). Development of goiter and enterohepatonephropathy was observed in Nubian Goats fed with pearl millet for 62 days (Gadir and Adam, 1999). The antithyroid effect of fonio was reported to be due to apigenin and luteolin (Sartelet et al., 1996). However the studies on other millets are limited.

11.

Health benefits of millets

Millets are popular as a potent alternative for common grains because of their added nutritional and health benefits. They possess the richness of minerals, phenolics, dietary fibers, and polyunsaturated fatty acids, as well as the lack of gluten. However, a detailed study on the health benefits of many millet types are lacking.

76

11.1

Functional and Preservative Properties of Phytochemicals

Prebiotic and probiotic source

Presence of short chain oligosaccharides, dietary fibers, and resistant starch in millets will promote the growth of beneficial gut microbiota. Also, fermented millet products act as probiotics. Di Stefano et al. (2017) have developed a millet-based fermented food in milk by adding Lactobacillus rhamnosus GR-1 and Streptococcus thermophilus C106 and was favorable in sensory evaluation. Xylooligosaccharides (XOS) from water-soluble xylan of finger millet also showed as a potential prebiotic source (Palaniappan et al., 2017). Murtaza et al. (2014) have reported that finger millet bran supplementation improved the abundance of beneficial gut microbiome (Lactobacillus, Bifidobacteria, and Roseburia) and suppressed the abundance of Enterobacter in high fat diet-fed LACA mice. The same group reported that kodo millet supplementation exerts the same effect on gut microbiome (Sarma. et al., 2017).

11.2

Antioxidants

Abundance of phenolics makes millets a potential source of antioxidants. Presence of tocopherols, tocotrienols, and carotenoids also enhance their antioxidant property (Asharani et al., 2010). Chandrasekara and Shahidi (2010) have evaluated the soluble and insoluble-bound phenolic extracts of finger, foxtail, little, kodo, proso, and pearl millets for antioxidant activity using different assays. They reported that both fractions are rich in phenolics and all the millets have high antioxidant potential. Hegde et al. (2005) have reported that whole millet grain diet can improve hyperlipidemia, and oxidative stress from alloxan in Wistar rats. Of the two millets (finger and kodo) studied, kodo millet was more efficient in improving serum glucose and cholesterol levels. In another study, the methanolic extract of bran-rich fraction of foxtail millet showed higher scavenging activity than the whole millet fraction (Suma and Urooj, 2012). The condensed tannins in the black sorghum hybrids have increased antioxidant activity (Dykes et al., 2013). Bijalwan et al. (2016) analyzed the role of hydroxycinnamic acid bound arabinoxylan as antioxidants. Among the five millets studied (proso, kodo, foxtail, finger, barnyard), kodo millet was having the hydroxycinnamic acid bound low branched arabinoxylan which exhibited higher antioxidant activity. In conclusion, antioxidant properties have been reported for all millets.

11.2.1

Diabetes

The intake of whole grains is commonly suggested for diabetic patients. Thus, millets with low glycemic index and high dietary fiber content are a suitable option. Also, the presence of antinutrients like tannins can be responsible for the hypoglycemic effect due to the impairment in starch digestion. Kim et al. (2011) evaluated the a-glucosidase and a-amylase inhibitory effects of ethanol extracts from whole sorghum, foxtail millet, and proso millet, where only sorghum exhibited higher inhibitory activity. According to the study by Pradeep and Sreerama (2018), the soluble and bound phenolic

Functional food ingredients from old age cereal grains

77

fractions of foxtail and little millet showed strong inhibition toward a-glucosidase and a-amylase, and little millet displayed superior effect. Finger millet is well-known food for diabetic patients in India. Phenolic compounds from finger millet seed coat are reported to have strong inhibitory effect toward a-glucosidase and pancreatic amylase (Shobana et al., 2009). The same group have also reported the protective effects of finger millet seed coat in diabetes-related complications such as cataract and altered kidney pathology. Chung et al. (2011a) have analyzed the antidiabetic effects of different Korean sorghum phenolic extracts in streptozotocin-induced diabetic rats. One variety showed significant hypoglycemic activity similar to known antidiabetic drug glibenclamide. A 28-day intervention carried out in type 2 diabetic and nondiabetic volunteers with dehulled and heat treated grains of barnyard millet was found to improve serum glucose and lipid levels (Ugare et al., 2014). The polyphenol rich ethyl acetate fraction of barnyard millet inhibited the a-glucosidase enzyme in vitro assays. The potential inhibitors of the fraction were N-p-coumaroyl serotonin, feruloyl serotonin, and luteolin. Also, N-p-coumaroyl serotonin, feruloyl serotonin significantly inhibited the rat intestinal sucrase activity (Seo et al., 2015). Kodo millet extracts have showed reversion of serum glucose, lipids, and glycated hemoglobin levels in alloxan induced diabetic rats (Jain et al., 2010). Hegde et al. (2002) reported that the methanolic extracts of kodo and finger millets inhibit collagen glycation and crosslinking in vitro which are associated with late diabetic complications like retinopathy and nephropathy. Foxtail millet aqueous extract was also shown to improve the serum glucose, lipid, and glycated hemoglobin levels in streptozotocin induced diabetic rats (Sireesha et al., 2011). In a self-controlled clinical study, the consumption of foxtail millet steamed bread, containing 50 g in raw weight for 12 weeks, improved serum glucose and insulin levels (Ren et al., 2018). The hypoglycemic effects of other millets are not available up to our knowledge. Also, the detailed studies on the compounds responsible for the antidiabetic effects and their mechanisms of action are lacking.

11.2.2 Obesity Obesity and diabetes concurrently occur in many patients. Thus, most of the animal/ human studies carried out with millet diet has showed an improvement in serum lipid profiles. The high dietary fiber content of millets play a role in the hypolipidemic effects, as they delay gastric emptying, glucose absorption, and reduce the LDLcholesterol fraction without affecting HDL-cholesterol levels. On a comparative study of finger millet whole grain and finger millet bran supplementation in high fat diet-fed LACA mice for 12 weeks, the latter was more efficient in preventing body weight gain and improving hyperlipidemic and inflammatory status (Murtaza et al., 2014). They further examined the effect of finger millet arabinoxylan supplementation on high fat diet-fed mice and reported a beneficial effect on body weight gain, serum lipid profile, hepatic lipid accumulation, and inflammation (Sarma et al., 2018). The same group also showed similar effects with kodo millet supplementation in Swiss albino mice (Sarma et al., 2017). The ethyl acetate extract of sorghum has shown to significantly reduce the plasma total cholesterol and triglyceride levels in obese rats on two weeks supplementation (Chung et al., 2011a,b). As mentioned above, each millet species has to be subjected to a detailed study to unravel their mechanism of action.

78

11.2.3

Functional and Preservative Properties of Phytochemicals

Antimicrobial activity

Finger millet is reported to have antibacterial activity. The seed coat extract of finger millet has showed higher activity against Bacillus cereus and Aspergillus flavus (Varsha et al., 2009). The fermented flour of finger millet inhibited S. typhimurium and E. coli (Antony et al., 1998). In another study with albino mice, the long-term intake of a prebiotic beverage prepared from whey, germinated pearl millet flour, and barley reduced the infection induced by Shigella dysenteriae (Ganguly et al., 2019). The fermented foxtail millet flour also showed significant inhibition against S. aureus (Amadou et al., 2013). Radhajeyalakshmi. et al. (2000) reports the antifungal activity of chitinase purified from pearl millet against Trichoderma viride. Xu et al. (2011) have isolated an efficient antifungal peptide from foxtail millet seeds, which could interrupt the cell wall. Mousa et al. (2016) have concluded from their study that finger millet has fungal endophytes which synthesize antifungal compounds. They purified eight antifungal compounds of which four compounds have the potential for the breakage of F. graminearum hyphae (Mousa et al., 2015, 2016).

11.2.4

Millets and cancer

The abundance of phenolics in the millets contributes to the antiproliferative effects. Zhang et al. (2014) have evaluated the antiproliferative properties of three varieties of proso millet using breast cancer cell line MDA and liver cancer cell line HepG2. The free extracts of edible proso millet showed to have relatively higher antiproliferative activities toward MDA cells than bound extracts in a dose-dependent manner. They also claimed that the activity is not caused by cytotoxicity. Similar kind of study on Chinese proso millet varieties was carried out by Shen et al. (2018) where the nonwaxy proso millet varieties showed better activity than the waxy varieties. In another study, millet phenolic extracts have shown inhibition of human colon adenocarcinoma proliferation in a time- and dose-dependent manner. Among the millet varieties studied, kodo and proso millet extracts demonstrated superior antiproliferative activity than the others, and pearl millet showed the least activity. Despite having the lower total phenolics and total flavanoid content, abundance of free caffeic and gallic acid content were expected to be responsible for better antiproliferative activity of proso millet (Chandrasekara and Shahidi, 2011a,b,c). The antiproliferative mechanism of bound polyphenols of inner shell (BPIS) from foxtail millet was exploited by Shi et al. (2015). Over different studies it has been shown that BPIS can inhibit the human colorectal cancer through the reactive oxygen species (ROS) generation (Shi et al., 2015), which leads to reduction in the pro-inflammatory cytokines and increase in the antiinflammatory cytokines by blocking the NF-kB nuclear translocation (Shi et al., 2017). Further, BPIS has shown to reverse the multidrug resistance in colorectal cancer human cells and ferulic acid and p-coumaric acid were the main active components (Lu et al., 2018). The proanthocyanin extracts from the sorghum bran were effective against hepatocellular carcinoma (Zhu et al., 2017).

Functional food ingredients from old age cereal grains

12.

79

Effect of processing in millet nutrition

Processing of grains will improve the shelflife, nutritional quality, bioavailability, and digestibility and eliminate the antinutrients. Processing converts the millets to edible forms like rice, flour, roasted, popped, sprouting, salted ready-to-eat grains, porridges, and fermented products (Jaybhaye et al., 2014). As for other grains, the common processing methods employed for millets include decortications, milling, soaking, cooking, germination, fermentation, malting, popping, etc. The efficiency of the processing is highly dependent on the size of the seed, structure, and endosperm thickness. The smaller size makes the decortications of the millets difficult. Also, Hama et al. (2011) reported that the effects of decortication varied according to the type of grain. In their study, more germ was removed in sorghum than in pearl millet. Moreover, most of the nutrients are located in the pericarp or aleurone layer. Therefore, the nutrient loss is unavoidable with decortication. Germination improves the nutritional availability and digestability, mainly due to the increased phytase activity and removes the antinutrients. Fermentation of millets is practiced in African and Asian countries (Saleh et al., 2013). Few researchers have studied the effects of several combined processing techniques. Sripriya et al. (1997) concluded that fermentation of the germinated finger millets improved the sugar and free amino acid content, reduced phytate content, and thus enhanced the zinc availability. Chandrasekara and Shahidi (2012) analyzed the effect of processing on the antioxidant potential of the millets (kodo, finger, proso, foxtail, little, and pearl millet) and was in the order of hull > whole grain > dehulled grain > cooked dehulled grain. Some of the common processing methods are summarized in Table 2.17. Since the processing methods are very vast and discussed in detail elsewhere we are not explaining further. Table 2.17 Different methods of millet processing. Method Decortication/ Dehulling

Millet studied Finger millet Pearl millet Sorghum Proso millet

Effects

References

Remove hull and make the millets, reduce mineral content, polyphenols, dietary fibers and tannins, increase the bioavailability of calcium, zinc, and iron, decrease phytic acid content, increase protein digestibility No effect on the fat content Decrease in fat content No difference in the protein and fat content, decrease in crude fiber, dietary fiber, minerals, total phenols, and antioxidant activity

Krishnan et al. (2012), Lestienne et al. (2007), Hama et al. (2011), Bagdi. et al. (2011)

Continued

80

Functional and Preservative Properties of Phytochemicals

Table 2.17 Different methods of millet processing.dcont’d Method

Millet studied

Effects

References

Germination and malting

Proso millet Finger millet Pearl millet Foxtail millet

Increase in free amino (lysine and tryptophan) acids, albumin, globulin, and sugars Decrease in dry weight, prolamine content, and starch content Increase in mineral extractability Malting improved the in vitro protein (14%e26%) and starch (86%e112%) digestibility Increase in soluble sugars, vitamins, minerals, phytase and amylase activity Decrease in total phenolics and fat content

Parameswaran and Sadasivam (1994), Mamiro et al. (2001), Sehgal and Kawatra. (2001), Coulibaly and Chen. (2011)

Popping

Foxtail millet Finger millet

Reduction in the crude fat and fiber content, high carbohydrate content Decrease in calcium content, oxalic acid content, trypsin inhibitor activity, increase in iron and phosphorus content

Choudhury et al. (2011), Chauhan (2018)

Fermentation

Pearl millet Finger millet Different millets

Decrease in the phytic acid content thus improved bioavailability Reduction in the total phenolics, condensed tannins, and phytic acid content, no difference in the bioaccessibility to zinc and iron Decrease in starch and long chain fatty acid content Improved bioaccessibility to phenolic compounds, release of the phenolic compounds bound to the insoluble fibers

Di Stefano et al. (2017), Gabaza et al. (2018), Antony et al. (1996), Chandrasekara and Shahidi (2012)

Functional food ingredients from old age cereal grains

81

Table 2.17 Different methods of millet processing.dcont’d Method Cooking

13.

Millet studied Pearl millet Foxtail millet

Effects

References

Decrease in globulin and true-prolamin fractions, increase in prolamin-like, true-glutelin, albumin, and insoluble proteins Effects of cooking on volatile aroma compounds a. Boilingdincrease in several unsaturated aldehydes, alcohols, and benzene derivatives. b. Roastingdincrease in pyrazine content

Ali et al. (2009), Bi et al. (2019)

Conclusion and future perspectives

Millets are foreseen as the “grains of future” due to their agronomic and nutritional attributes. They provide additional health benefits apart from ensuring food security. Thus, United Nation declared the year 2018 as “international year of millets” to promote the acceptance of millets over other staple grains. The salient features of millets include; a. Highly resilient cropsdcan survive in dry, poor soil, and drought conditions where other crops can’t grow. b. Need no fertilizers or pesticides for optimum yield. c. They have a short growing season compared to rice and wheat. d. Total carbohydrate content of the millets are similar to rice and wheat, but have a low glycemic index because of the high content of resistant starch and dietary fibers. e. Foxtail, proso, and pearl millets have higher protein content than the major cereals, and millet proteins are gluten free. f. Contain higher percentage of polyunsaturated fatty acids than other cereals. g. Rich source of iron, calcium, folate, polyphenols, and other nutraceuticals. h. Provide added health benefits like source of prebiotics and exert antioxidant, antidiabetic, anticancer, and hypolipidemic effects.

The major antinutrients present in the millets are phytic acid and protease inhibitors. The processing methods like germination and fermentation are effective in reducing phytic acid content. Also, pearl millet-based diet along with iodine deficiency was reported to induce goiter in in vivo models. These factors have to be studied in different populations and with different varieties. Since millets are already a part of daily diet for many, these factors may not be a major global concern. Also more research has to be carried out for improving the processing methods with minimum nutrient loss.

82

Functional and Preservative Properties of Phytochemicals

Genetic transformation of the millets is an emerging interest to improve the yield, seed size, palatability and softness of the grain, and resistance to biotic and abiotic stress (Dosad and Chawla, 2018). Most of the transformations are performed by biolistic particle delivery system. Agrobacterium-mediated transformation is in growing stage with successful reports in finger and foxtail millets (Ceasar et al., 2017, Ceasar and Ignacimuthu, 2011). Genetic modifications can create better millet varieties with improved qualities. This will ensure global food security in future, when the agronomic conditions will not be suitable for the cultivation of other crops.

References Abdalla, A.A., El Tinay, A.H., Mohamed, B.E., Abdalla, A.H., 1998. Proximate composition, starch, phytate and mineral contents of 10 pearl millet genotypes. Food Chemistry 63 (2), 243e246. Afolabi, T.A., Olu-Owolabi, B.I., Adebowale, K.O., Lawal, O.S., Akintayo, C.O., 2012. Functional and tableting properties of acetylated and oxidised finger millet (Eleusine coracana) starch. Starch Staerke 64 (4), 326e337. Ai, Y., Medic, J., Jiang, H., Wang, D., Jane, J.L., 2011. Starch characterization and ethanol production of sorghum. J Agric Food Chem 59 (13), 7385e7392. Akande, O.F., Deshpande, A.V., Bangudu, A.B., 1991. An evaluation of starch obtained from pearl millet-pennisetum typhoides. As a binder and disintegrant for compressed tablets. Drug Development and Industrial Pharmacy 17 (3), 451e455. Ali, M.A., Tinay, A.H.E., Mohamed, I.A., Babiker, E.E., 2009. Supplementation and cooking of pearl millet: changes in protein fractions and sensory quality. World Journal of Dairy and Food Sciences 4 (1), 41e45. Amadou, I., Le, G.W., Shi, Y.H., 2013. Evaluation of antimicrobial, antioxidant activities, and nutritional values of fermented foxtail millet extracts by Lactobacillus paracasei Fn032. International Journal of Food Properties 16 (6), 1179e1190. Anju, T., Sarita, S., 2010. Suitability of foxtail millet (Setaria italica) and barnyard millet (Echinochloa frumentacea) for development of low glycemic index biscuits. Malaysian Journal of Nutrition 16 (3), 361e368. Annor, G.A., 2013. Millet Starches: Structural Characteristics and Glycemic Attributes (Doctoral dissertation). Annor, G.A., Marcone, M., Bertoft, E., Seetharaman, K., 2014. Physical and molecular characterization of millet starches. Cereal Chemistry 91 (3), 286e292. Annor, G.A., Tyl, C., Marcone, M., Ragaee, S., Marti, A., 2017. Why do millets have slower starch and protein digestibility than other cereals? Trends in Food Science and Technology 66, 73e83. Antony, U., Sripriya, G., Chandra, T.S., 1996. Effect of fermentation on the primary nutrients in finger millet (Eleusine coracana). Journal of Agricultural and Food Chemistry 44 (9), 2616e2618. Antony, U., Moses, L.G., Chandra, T.S., 1998. Inhibition of Salmonella typhimurium and Escherichia coli by fermented flour of finger millet (Eleusine coracana). World Journal of Microbiology and Biotechnology 14 (6), 883e886. Asharani, V.T., Jayadeep, A., Malleshi, N.G., 2010. Natural antioxidants in edible flours of selected small millets. International Journal of Food Properties 13 (1), 41e50.

Functional food ingredients from old age cereal grains

83

Awika, J.M., Rooney, L.W., Waniska, R.D., 2004. Properties of 3-deoxyanthocyanins from sorghum. Journal of Agricultural and Food Chemistry 52 (14), 4388e4394. Aziz, A.A., Kenney, L.S., Goulet, B., Abdel-Aal, E.S., 2009. Dietary starch type affects body weight and glycemic control in freely fed but not energy-restricted obese rats. Journal of Nutrition 139 (10), 1881e1889. Badi, S.M., Hoseney, R.C., 1976. Use of sorghum and pearl millet flours in cookies. Cereal Chemistry 53 (5), 733e738. Bagdi, A., Balazs, G., Schmidt, J., Szatmari, M., Schoenlechner, R., Berghofer, E., T€om€osk€ozia, S., 2011. Protein characterization and nutrient composition of Hungarian proso millet varieties and the effect of decortication. Acta Alimentaria 40 (1), 128e141. Bate-Smith, E.C., 1969. Luteoforol (30 , 4, 40 , 5, 7-pentahydroxyflavan) in sorghum vulgare L. Phytochemistry 8 (9), 1803e1810. Becker, P.M., Yu, P., 2013. What makes protein indigestible from tissue-related, cellular, and molecular aspects? Molecular Nutrition and Food Research 57 (10), 1695e1707. Belton, P.S., Taylor, J.R., 2004. Sorghum and millets: protein sources for Africa. Trends in Food Science and Technology 15 (2), 94e98. Bi, S., Wang, A., Wang, Y., Xu, X., Luo, D., Shen, Q., Wu, J., 2019. Effect of cooking on aroma profiles of Chinese foxtail millet (Setaria italica) and correlation with sensory quality. Food Chemistry 289, 680e692. Bijalwan, V., Ali, U., Kesarwani, A.K., Yadav, K., Mazumder, K., 2016. Hydroxycinnamic acid bound arabinoxylans from millet brans-structural features and antioxidant activity. International Journal of Biological Macromolecules 88, 296e305. Bora, P., 2013. Nutritional Properties of Different Millet Types and Their Selected Products (Doctoral dissertation). Buffo, R.A., Weller, C.L., Gennadios, A., 1997. Films from laboratory-extracted sorghum kafirin. In: Biological Systems Engineering: Papers and Publications, p. 105. Ceasar, S.A., Ignacimuthu, S., 2011. Agrobacterium-mediated transformation of finger millet (Eleusine coracana (L.) Gaertn.) using shoot apex explants. Plant Cell Reports 30 (9), 1759e1770. Carcea, M., Acquistucci, R., 1997. Isolation and physicochemical characterization of fonio (Digitaria exilis Stapf) starch. Starch/St€arke 49 (4), 131e135. Ceasar, S.A., Baker, A., Ignacimuthu, S., 2017. Functional characterization of the PHT1 family transporters of foxtail millet with development of a novel Agrobacterium-mediated transformation procedure. Scientific Reports 7 (1), 14064. Chandrasekara, A., Shahidi, F., 2010. Content of insoluble bound phenolics in millets and their contribution to antioxidant capacity. Journal of Agricultural and Food Chemistry 58 (11), 6706e6714. Chandrasekara, A., Shahidi, F., 2011a. Bioactivities and antiradical properties of millet grains and hulls. Journal of Agricultural and Food Chemistry 59 (17), 9563e9571. Chandrasekara, A., Shahidi, F., 2011b. Antiproliferative potential and DNA scission inhibitory activity of phenolics from whole millet grains. Journal of Functional Foods 3 (3), 159e170. Chandrasekara, A., Shahidi, F., 2011c. Determination of antioxidant activity in free and hydrolyzed fractions of millet grains and characterization of their phenolic profiles by HPLCDAD-ESI-MSn. Journal of Functional Foods 3 (3), 144e158. Chandrasekara, A., Shahidi, F., 2012. Bioaccessibility and antioxidant potential of millet grain phenolics as affected by simulated in vitro digestion and microbial fermentation. Journal of Functional Foods 4 (1), 226e237.

84

Functional and Preservative Properties of Phytochemicals

Chandrasekher, G., Raju, D.S., Pattabiraman, T.N., 1982. Natural plant enzyme inhibitors. Protease inhibitors in millets. Journal of the Science of Food and Agriculture 33 (5), 447e450. Chauhan, E.S., 2018. Effects of processing (germination and popping) on the nutritional and anti-nutritional properties of finger millet (eleusine coracana). Current Research in Nutrition and Food Science Journal 6 (2), 566e572. Chen, C.W., Cheng, H.H., 2006. A rice bran oil diet increases LDL-receptor and HMG-CoA reductase mRNA expressions and insulin sensitivity in rats with streptozotocin/ nicotinamide-induced type 2 diabetes. Journal of Nutrition 136 (6), 1472e1476. Chen, G.X., Zhou, J.W., Liu, Y.L., Lu, X.B., Han, C.X., Zhang, W.Y., Xu, Y.H., Yan, Y.M., 2016. Biosynthesis and regulation of wheat amylose and amylopectin from proteomic and phosphoproteomic characterization of granule-binding proteins. Scientific Reports 6, 33111. Chethan, S., Malleshi, N.G., 2007. Finger millet polyphenols: characterization and their nutraceutical potential. American Journal of Food Technology 2 (7), 582e592. Choudhury, M., Das, P., Baroova, B., 2011. Nutritional evaluation of popped and malted indigenous millet of Assam. Journal of Food Science and Technology 48 (6), 706e711. Chung, I.M., Kim, E.H., Yeo, M.A., Kim, S.J., Seo, M.C., Moon, H.I., 2011a. Antidiabetic effects of three Korean sorghum phenolic extracts in normal and streptozotocin-induced diabetic rats. Food Research International 44 (1), 127e132. Chung, I.M., Yeo, M.A., Kim, S.J., Kim, M.J., Park, D.S., Moon, H.I., 2011b. Antilipidemic activity of organic solvent extract from Sorghum bicolor on rats with diet-induced obesity. Human and Experimental Toxicology 30 (11), 1865e1868. Corredor, D.Y., Bean, S.R., Schober, T., Wang, D., 2006. Effect of decorticating sorghum on ethanol production and composition of DDGS. Cereal Chemistry 83 (1), 17e21. Coulibaly, A., Chen, J., 2011. Evolution of energetic compounds, antioxidant capacity, some vitamins and minerals, phytase and amylase activity during the germination of foxtail millet. American Journal of Food Technology 6 (1), 40e51. da Silva, L.S., Taylor, J.R., 2005. Physical, mechanical, and barrier properties of kafirin films from red and white sorghum milling fractions. Cereal Chemistry 82 (1), 9e14. Dayakar Rao, B., Bhaskarachary, K., Arlene Christina, G.D., Sudha Devi, G., Vilas, A.T., 2017. Nutritional and Health Benefits of Millets. ICAR_Indian Institute of Millets Research (IIMR), Rajendranagar, Hyderabad, p. 112. Devi, P.B., Vijayabharathi, R., Sathyabama, S., Malleshi, N.G., Priyadarisini, V.B., 2014. Health benefits of finger millet (Eleusine coracana L.) polyphenols and dietary fiber: a review. Journal of Food Science and Technology 51 (6), 1021e1040. Di Stefano, E., White, J., Seney, S., Hekmat, S., McDowell, T., Sumarah, M., Reid, G., 2017. A novel millet-based probiotic fermented food for the developing world. Nutrients 9 (5), 529. Dosad, S., Chawla, H.S., 2018. Genetic transformation of millets: the way ahead. In: Biotechnologies of Crop Improvement, vol. 2. Springer, Cham, pp. 249e286. Duodu, K.G., Taylor, J.R.N., Belton, P.S., Hamaker, B.R., 2003. Factors affecting sorghum protein digestibility. Journal of Cereal Science 38 (2), 117e131. Dykes, L., Rooney, L.W., 2006. Sorghum and millet phenols and antioxidants. Journal of Cereal Science 44 (3), 236e251. Dykes, L., Rooney, W.L., Rooney, L.W., 2013. Evaluation of phenolics and antioxidant activity of black sorghum hybrids. Journal of Cereal Science 58 (2), 278e283.

Functional food ingredients from old age cereal grains

85

Elnour, A., Liedén, S.Å., Bourdoux, P., Eltom, M., Khalid, S.A., Hambraeus, L., 1998. Traditional fermentation increases goitrogenic activity in pearl millet. Annals of Nutrition and Metabolism 42 (6), 341e349. FAO, 2016. FAOSTAT. Food and Agriculture Organization of the United Nations, Rome, Italy. Ferreira, S.M.R., de Mello, A.P., dos Anjos, M.D.C.R., Kr€ uger, C.C.H., Azoubel, P.M., de Oliveira Alves, M.A., 2016. Utilization of sorghum, rice, corn flours with potato starch for the preparation of gluten-free pasta. Food Chemistry 191, 147e151. Gabaza, M., Shumoy, H., Louwagie, L., Muchuweti, M., Vandamme, P., Du Laing, G., Raes, K., 2018. Traditional fermentation and cooking of finger millet: implications on mineral binders and subsequent bioaccessibility. Journal of Food Composition and Analysis 68, 87e94. Gadir, W.S.A., Adam, S.E.I., 1999. Development of goitre and enterohepatonephropathy in Nubian goats fed with pearl millet (pennisetum typhoides). The Veterinary Journal 157 (2), 178e185. Gaitan, E., Lindsay, R.H., Reichert, R.D., Ingbar, S.H., Cooksey, R.C., Legan, J., Meydrech, E.F., Hill, J., Kubota, K., 1989. Antithyroid and goitrogenic effects of millet: role of Cglycosylflavones. Journal of Clinical Endocrinology and Metabolism 68 (4), 707e714. Ganguly, S., Sabikhi, L., Singh, A.K., 2019. Effect of whey-pearl millet-barley based probiotic beverage on Shigella-induced pathogenicity in murine model. Journal of Functional Foods 54, 498e505. Garí, J.A., 2002. Review of the African millet diversity. In: International Workshop on Fonio, Food Security and Livelihood Among the Rural Poor in West Africa. IPGRI/IFAD, Bamako, Mali, pp. 19e22. Gujer, R., Magnolato, D., Self, R., 1986. Glucosylated flavonoids and other phenolic compounds from sorghum. Phytochemistry 25 (6), 1431e1436. Gulati, P., Li, A., Holding, D., Santra, D., Zhang, Y., Rose, D.J., 2017. Heating reduces proso millet protein digestibility via formation of hydrophobic aggregates. Journal of Agricultural and Food Chemistry 65 (9), 1952e1959. Gupta, R.K., Haslam, E., 1978. Plant proanthocyanidins. Part 5. Sorghum polyphenols. Journal of the Chemical Society, Perkin Transactions 1 (8), 892e896. Hama, F., Icard-Verniere, C., Guyot, J.P., Picq, C., Diawara, B., Mouquet-Rivier, C., 2011. Changes in micro-and macronutrient composition of pearl millet and white sorghum during in field versus laboratory decortication. Journal of Cereal Science 54 (3), 425e433. Hahn, D.H., Faubion, J.M., Rooney, L.W., 1983. Sorghum phenolic acids, their high performance liquid chromatography separation and their relation to fungal resistance. Cereal Chemistry 60 (4), 255e259. Han, F., Zheng, L., Di, W., Li, A., 2018. Effect of roasting on phenolics content and antioxidant activity of proso millet. International Journal of Food Engineering 4 (2), 110e116. Han, F., Han, F., Wang, Y., Fan, L., Song, G., Chen, X., Jiang, P., Miao, H., Han, Y., 2019. Digestible indispensable amino acid scores of nine cooked cereal grains. British Journal of Nutrition 121 (1), 30e41. Hegde, P.S., Chandrakasan, G., Chandra, T.S., 2002. Inhibition of collagen glycation and crosslinking in vitro by methanolic extracts of Finger millet (Eleusine coracana) and Kodo millet (Paspalum scrobiculatum). The Journal of Nutritional Biochemistry 13 (9), 517e521. Hegde, P.S., Chandra, T.S., 2005. ESR spectroscopic study reveals higher free radical quenching potential in kodo millet (Paspalum scrobiculatum) compared to other millets. Food Chemistry 92 (1), 177e182.

86

Functional and Preservative Properties of Phytochemicals

Hegde, P.S., Rajasekaran, N.S., Chandra, T.S., 2005. Effects of the antioxidant properties of millet species on oxidative stress and glycemic status in alloxan-induced rats. Nutrition Research 25 (12), 1109e1120. Holmes, C.P., Cahill, G., Smart, K.A., Cook, D.J., 2013. The composition and ultrastructure of sorghum spent grains. Journal of the Institute of Brewing 119 (1e2), 41e47. Hoover, R., Swamidas, G., Kok, L.S., Vasanthan, T., 1996. Composition and physicochemical properties of starch from pearl millet grains. Food Chemistry 56 (4), 355e367. Hwang, K.T., Cuppett, S.L., Weller, C.L., Hanna, M.A., 2002. Properties, composition, and analysis of grain sorghum wax. Journal of the American Oil Chemists Society 79 (6), 521e527. Jain, S., Bhatia, G., Barik, R., Kumar, P., Jain, A., Dixit, V.K., 2010. Antidiabetic activity of Paspalum scrobiculatum Linn. in alloxan induced diabetic rats. Journal of Ethnopharmacology 127 (2), 325e328. Jaybhaye, R.V., Pardeshi, I.L., Vengaiah, P.C., Srivastav, P.P., 2014. Processing and technology for millet based food products: a review. Journal of Ready to Eat Food 1 (2), 32e48. Kalinova, J., Moudry, J., 2006. Content and quality of protein in proso millet (Panicum miliaceum L.) varieties. Plant Foods for Human Nutrition 61 (1), 43. Kikuzaki, H., Hisamoto, M., Hirose, K., Akiyama, K., Taniguchi, H., 2002. Antioxidant properties of ferulic acid and its related compounds. Journal of Agricultural and Food Chemistry 50 (7), 2161e2168. Kim, J.S., Hyun, T.K., Kim, M.J., 2011. The inhibitory effects of ethanol extracts from sorghum, foxtail millet and proso millet on a-glucosidase and a-amylase activities. Food Chemistry 124 (4), 1647e1651. Kim, S.K., Sohn, E.Y., Lee, I.J., 2009. Starch properties of native foxtail millet, Setaria italica Beauv. Journal of Crop Science and Biotechnology 12 (1), 59e62. Kim, S.K., Choi, H.J., Kang, D.K., Kim, H.Y., 2012. Starch properties of native proso millet (Panicum miliaceum L.). Agronomy Research 10 (1e2), 311e318. Krishnan, R., Dharmaraj, U., Malleshi, N.G., 2012. Influence of decortication, popping and malting on bioaccessibility of calcium, iron and zinc in finger millet. LWT-Food Science and Technology 48 (2), 169e174. Kumari, S.K., Thayumanavan, B., 1998. Characterization of starches of proso, foxtail, barnyard, kodo, and little millets. Plant Foods for Human Nutrition 53 (1), 47e56. Longvah, T., Ananthan, R., Bhaskarachary, K., Venkaiah, K., 2017. Indian Food Composition Table. National Institute of Nutrition (ICMR), Hyderabad, India. Lattimer, J.M., Haub, M.D., 2010. Effects of dietary fiber and its components on metabolic health. Nutrients 2 (12), 1266e1289. Lestienne, I., Besançon, P., Caporiccio, B., Lullien-Péllerin, V., Tréche, S., 2005. Iron and zinc in vitro availability in pearl millet flours (Pennisetum glaucum) with varying phytate, tannin, and fiber contents. Journal of Agricultural and Food Chemistry 53 (8), 3240e3247. Lestienne, I., Buisson, M., Lullien-Pellerin, V., Picq, C., Treche, S., 2007. Losses of nutrients and anti-nutritional factors during abrasive decortication of two pearl millet cultivars (Pennisetum glaucum). Food Chemistry 100 (4), 1316e1323. Liang, S., Yang, G., Ma, Y., 2010. Chemical characteristics and fatty acid profile of foxtail millet bran oil. Journal of the American Oil Chemists Society 87 (1), 63e67. Links, M.R., Taylor, J., Kruger, M.C., Naidoo, V., Taylor, J.R., 2016. Kafirin microparticle encapsulated sorghum condensed tannins exhibit potential as an anti-hyperglycaemic agent in a small animal model. Journal of Functional Foods 20, 394e399. Lorenz, K., 1983. Tannins and phytate content in proso millets (Panicum miliaceum). Cereal Chemistry 60, 424e426.

Functional food ingredients from old age cereal grains

87

Lorenz, K., Hwang, Y.S., 1986. Lipids in proso millet (Panicum Miliaceum) flours and brans. Cereal chemistry. USA. Lu, Y., Shan, S., Li, H., Shi, J., Zhang, X., Li, Z., 2018. Reversal effects of bound polyphenol from foxtail millet bran on multidrug resistance in human HCT-8/Fu colorectal cancer cell. Journal of Agricultural and Food Chemistry 66 (20), 5190e5199. Madhusudhan, B., Tharanathan, R.N., 1995. Legume and cereal starchesdwhy differences in digestibility?dPart II. Isolation and characterization of starches from rice (O. sativa) and ragi (finger millet, E. coracana). Carbohydrate Polymers 28 (2), 153e158. Malleshi, N.G., Desikachar, H.S.R., Tharanathan, R.N., 1986. Physico-chemical properties of native and malted finger millet, pearl millet and foxtail millet starches. Starch Staerke 38 (6), 202e205. Mamiro, P.R.S., Van, J., Mwikya, S.M., Huyghebaert, A., 2001. In vitro extractability of calcium, iron, and zinc in finger millet and kidney beans during processing. Journal of Food Science 66 (9), 1271e1275. Marston, K., Khouryieh, H., Aramouni, F., 2016. Effect of heat treatment of sorghum flour on the functional properties of gluten-free bread and cake. LWT-Food Science and Technology 65, 637e644. Matsumoto, K., Yasuyoshi, E., Nishi, K., Honda, Y., Nakaya, M., Kitamura, S., 2016. Resistant starch-rich wx/ae brown rice prevents insulin resistance and hypertriglyceridaemia in type 2 diabetic NSY mice. Journal of Functional Foods 23, 556e564. McDonough, C.M., Rooney, L.W., Earp, C.F., 1986. Structural characteristics of Eleusine corocana (finger millet) using scanning electron and fluorescence microscopy. Food Structure 5 (2), 9. Mohammed, N.A., Ahmed, I.A.M., Babiker, E.E., 2011. Nutritional evaluation of sorghum flour (Sorghum bicolor L. Moench) during processing of injera. World Academy of Science, Engineering and Technology 51, 72e76. Monteiro, P.V., Virupaksha, T.K., Rao, D.R., 1982. Proteins of Italian millet: amino acid composition, solubility fractionation and electrophoresis of protein fractions. Journal of the Science of Food and Agriculture 33 (11), 1072e1079. Mousa, W., Schwan, A., Raizada, M., 2016. Characterization of antifungal natural products isolated from endophytic fungi of finger millet (Eleusine coracana). Molecules 21 (9), 1171. Mousa, W.K., Schwan, A., Davidson, J., Strange, P., Liu, H., Zhou, T., Auzanneau, F.I., Raizada, M.N., 2015. An endophytic fungus isolated from finger millet (Eleusine coracana) produces anti-fungal natural products. Frontiers in Microbiology 6, 1157. Murtaza, N., Baboota, R.K., Jagtap, S., Singh, D.P., Khare, P., Sarma, S.M., Podili, K., Alagesan, S., Chandra, T.S., Bhutani, K.K., Boparai, R.K., 2014. Finger millet bran supplementation alleviates obesity-induced oxidative stress, inflammation and gut microbial derangements in high-fat diet-fed mice. British Journal of Nutrition 112 (9), 1447e1458. Nambiar, V.S., Sareen, N., Daniel, M., Gallego, E.B., 2012. Flavonoids and phenolic acids from pearl millet (Pennisetum glaucum) based foods and their functional implications. Functional Foods in Health and Disease 2 (7), 251e264. Nandini, C.D., Salimath, P.V., 2002. Structural features of arabinoxylans from bajra (pearl millet). Journal of Agricultural and Food Chemistry 50 (22), 6485e6489. Naren, A.P., Virupaksha, T.K., 1990. Alpha-and beta-setarins: methionine-rich proteins of Italian millet (Setaria italica (L.) Beauv.). Cereal Chemistry (USA) 67, 32e34. Nasu, H., Momohara, A., 2016. The beginnings of rice and millet agriculture in prehistoric Japan. Quaternary International 397, 504e512.

88

Functional and Preservative Properties of Phytochemicals

Nip, W.K., Burns, E.E., 1971. Pigment characterization in grain sorghum. II. White varieties. Cereal Chemistry 48, 74e80. Nystr€om, L., M€akinen, M., Lampi, A.M., Piironen, V., 2005. Antioxidant activity of steryl ferulate extracts from rye and wheat bran. Journal of Agricultural and Food Chemistry 53 (7), 2503e2510. Odeku, O.A., Alabi, C.O., 2007. Evaluation of native and modified forms of Pennisetum glaucum (millet) starch as disintegrant in chloroquine tablet formulations. Journal of Drug Delivery Science and Technology 17 (2), 155e158. Ojha, P., Adhikari, R., Karki, R., Mishra, A., Subedi, U., Karki, T.B., 2018. Malting and fermentation effects on antinutritional components and functional characteristics of sorghum flour. Food Science and Nutrition 6 (1), 47e53. Olatunji, O., Koleoso, O.A., Oniwinde, A.B., 1992. Recent experience on the milling of sorghum, millet, and maize for making nonwheat bread, cake, and sausage in Nigeria. In: Utilization of Sorghum and Millets. International Crops Research Institute for the Semi-arid Tropics, Patancheru, India, pp. 83e88. Orr, A., Mwema, C., Gierend, A., Nedumaran, S., 2016. Sorghum and Millets in Eastern and Southern Africa: Facts, Trends and Outlook. Osagie, A.U., Kates, M., 1984. Lipid composition of millet (Pennisetum americanum) seeds. Lipids 19 (12), 958e965. Osman, R.O., El-Gelil, F.A., El-Noamany, H.M., Dawood, M.G., 2000. Oil content and fatty acid composition of some varieties of barley and sorghum grains. Grasas Y Aceites 51 (3), 157e162. Palaniappan, A., Balasubramaniam, V.G., Antony, U., 2017. Prebiotic potential of xylooligosaccharides derived from finger millet seed coat. Food Biotechnology 31 (4), 264e280. Panwar, P., Dubey, A., Verma, A.K., 2016. Evaluation of nutraceutical and antinutritional properties in barnyard and finger millet varieties grown in Himalayan region. Journal of Food Science and Technology 53 (6), 2779e2787. Panwar, P., Verma, A.K., Dubey, A., 2018. Purification, developmental expression, and in silico characterization of a-amylase inhibitor from Echinochloa frumentacea. 3 Biotech 8, 1e16. Parameswaran, K.P., Sadasivam, S., 1994. Changes in the carbohydrates and nitrogenous components during germination of proso millet, Panicum miliaceum. Plant Foods for Human Nutrition 45 (2), 97e102. Pontieri, P., Mamone, G., De Caro, S., Tuinstra, M.R., Roemer, E., Okot, J., De Vita, P., Ficco, D.B., Alifano, P., Pignone, D., Massardo, D.R., 2013. Sorghum, a healthy and gluten-free food for celiac patients as demonstrated by genome, biochemical, and immunochemical analyses. Journal of Agricultural and Food Chemistry 61 (10), 2565e2571. Pradeep, P.M., Sreerama, Y.N., 2018. Phenolic antioxidants of foxtail and little millet cultivars and their inhibitory effects on a-amylase and a-glucosidase activities. Food Chemistry 247, 46e55. Pradeep, S.R., Guha, M., 2011. Effect of processing methods on the nutraceutical and antioxidant properties of little millet (Panicum sumatrense) extracts. Food Chemistry 126 (4), 1643e1647. Prashanth, M.S., Muralikrishna, G., 2014. Arabinoxylan from finger millet (Eleusine coracana, v. Indaf 15) bran: purification and characterization. Carbohydrate Polymers 99, 800e807. Prashanth, M.S., Shruthi, R.R., Muralikrishna, G., 2015. Immunomodulatory activity of purified arabinoxylans from finger millet (Eleusine coracana, v. Indaf 15) bran. Journal of Food Science and Technology 52 (9), 6049e6054. Radhajeyalakshmi, R., Meena, B., Thangavelu, R., Deborah, S.D., Vidhyasekaran, P., Velazhahan, R., 2000. A 45-kDa chitinase purified from pearl millet (Pennisetum glaucum

Functional food ingredients from old age cereal grains

89

(L.) R. Br.) shows antifungal activity/Reinigung einer 45-kDa Chitinase mit antimykotischer Aktivit€at aus Perlhirse (Pennisetum glaucum (L.) R. Br.). Zeitschrift f€ ur Pflanzenkrankheiten und Pflanzenschutz/Journal of Plant Diseases and Protection 605e616. Ramachandra, G., Virupaksha, T.K., Shadaksharaswamy, M., 1977. Relation between tannin levels and in vitro protein digestibility in finger millet (Eleusine coracana Gaertn.). Journal of Agricultural and Food Chemistry 25 (5), 1101e1104. Rao, M.S., Muralikrishna, G., 2001. Non-starch polysaccharides and bound phenolic acids from native and malted finger millet (Ragi, Eleusine coracana, Indaf-15). Food Chemistry 72 (2), 187e192. Rao, P.U., Deosthale, Y.G., 1988. In vitro availability of iron and zinc in white and coloured ragi (Eleusine coracana): role of tannin and phytate. Plant Foods for Human Nutrition 38 (1), 35e41. Ravindran, G., 1991. Studies on millets: proximate composition, mineral composition, and phytate and oxalate contents. Food Chemistry 39 (1), 99e107. Ravindran, G., 1992. Seed protein of millets: amino acid composition, proteinase inhibitors and in-vitro protein digestibility. Food Chemistry 44 (1), 13e17. Reichert, R.D., 1979. PH-sensitive pigments in pearl millet. Cereal Chemistry 56 (4). Ren, X., Yin, R., Hou, D., Xue, Y., Zhang, M., Diao, X., Zhang, Y., Wu, J., Hu, J., Hu, X., Shen, Q., 2018. The glucose-lowering effect of foxtail millet in subjects with impaired glucose tolerance: a self-controlled clinical trial. Nutrients 10 (10), 1509. Robertson, M.D., Bickerton, A.S., Dennis, A.L., Vidal, H., Frayn, K.N., 2005. Insulinsensitizing effects of dietary resistant starch and effects on skeletal muscle and adipose tissue metabolism. American Journal of Clinical Nutrition 82 (3), 559e567. Rooney, L.W., 1978. Sorghum and pearl millet lipids. Cereal Chemistry 55 (5), 584e590. Sajilata, M.G., Singhal, R.S., Kulkarni, P.R., 2006. Resistant starchea review. Comprehensive Reviews in Food Science and Food Safety 5 (1), 1e17. Saleh, A.S., Zhang, Q., Chen, J., Shen, Q., 2013. Millet grains: nutritional quality, processing, and potential health benefits. Comprehensive Reviews in Food Science and Food Safety 12 (3), 281e295. Sang, Y., Bean, S., Seib, P.A., Pedersen, J., Shi, Y.C., 2008. Structure and functional properties of sorghum starches differing in amylose content. Journal of Agricultural and Food Chemistry 56 (15), 6680e6685. Sarma, S.M., Khare, P., Jagtap, S., Singh, D.P., Baboota, R.K., Podili, K., Boparai, R.K., Kaur, J., Bhutani, K.K., Bishnoi, M., Kondepudi, K.K., 2017. Kodo millet whole grain and bran supplementation prevents high-fat diet induced derangements in a lipid profile, inflammatory status and gut bacteria in mice. Food and Function 8 (3), 1174e1183. Sarma, S.M., Singh, D.P., Singh, P., Khare, P., Mangal, P., Singh, S., Bijalwan, V., Kaur, J., Mantri, S., Boparai, R.K., Mazumder, K., 2018. Finger millet arabinoxylan protects mice from high-fat diet induced lipid derangements, inflammation, endotoxemia and gut bacterial dysbiosis. International Journal of Biological Macromolecules 106, 994e1003. Sartelet, H., Serghat, S., Lobstein, A., Ingenbleek, Y., Anton, R., Petitfrere, E., Aguie-Aguie, G., Martiny, L., Haye, B., 1996. Flavonoids extracted from fonio millet (Digitaria exilis) reveal potent antithyroid properties. Nutrition 12 (2), 100e106. Seetharam, A., Riley, K.W., Harinarayana, G., 1989. Small millets in global agriculture. In: International Small Millets Workshop 1986: Bangalore, India. Oxford & IBH Publishing Co. Pvt. Ltd. Sehgal, S., Kawatra, A., 2001. In vitro protein and starch digestibility of pearl millet (Pennisetum gluacum L.) as affected by processing techniques. Food/Nahrung 45 (1), 25e27.

90

Functional and Preservative Properties of Phytochemicals

Seo, K.H., Ra, J.E., Lee, S.J., Lee, J.H., Kim, S.R., Lee, J.H., Seo, W.D., 2015. Antihyperglycemic activity of polyphenols isolated from barnyard millet (Echinochloa utilis L.) and their role inhibiting a-glucosidase. Journal of the Korean Society for Applied Biological Chemistry 58 (4), 571e579. Shahidi, F., Chandrasekara, A., 2013. Millet grain phenolics and their role in disease risk reduction and health promotion: a review. Journal of Functional Foods 5 (2), 570e581. Shelton, D.R., Lee, W.J., 2000. Cereal carbohydrates. In: Kulp, K., Ponte, J.G. (Eds.), handbook of cereal science and technology, 2nd Ed. Marcel Dekker, New York, pp. 385e415. Sharma, A., Kapoor, A.C., 1996. Levels of antinutritional factors in pearl millet as affected by processing treatments and various types of fermentation. Plant Foods for Human Nutrition 49 (3), 241e252. Shen, R., Ma, Y., Jiang, L., Dong, J., Zhu, Y., Ren, G., 2018. Chemical composition, antioxidant, and antiproliferative activities of nine Chinese proso millet varieties. Food and Agricultural Immunology 29 (1), 625e637. Shewry, P.R., Halford, N.G., 2003. The Prolamin Storage Proteins of Sorghum and Millets. AFRIPRO, Pretoria, South Africa. Shi, J., Shan, S., Li, Z., Li, H., Li, X., Li, Z., 2015. Bound polyphenol from foxtail millet bran induces apoptosis in HCT-116 cell through ROS generation. Journal of functional foods 17, 958e968. Shi, J., Shan, S., Li, H., Song, G., Li, Z., 2017. Anti-inflammatory effects of millet bran derivedbound polyphenols in LPS-induced HT-29 cell via ROS/miR-149/Akt/NF-kB signaling pathway. Oncotarget 8 (43), 74582. Shobana, S., Sreerama, Y.N., Malleshi, N.G., 2009. Composition and enzyme inhibitory properties of finger millet (Eleusine coracana L.) seed coat phenolics: mode of inhibition of a-glucosidase and pancreatic amylase. Food Chemistry 115 (4), 1268e1273. Simwemba, C.G., Hoseney, R.C., Varriano-Marston, E., Zeleznak, K., 1984. Certain B vitamin and phytic acid contents of pearl millet [Pennisetum americanum (L.) Leeke]. Journal of Agricultural and Food Chemistry 32 (1), 31e34. Sireesha, Y., Kasetti, R.B., Nabi, S.A., Swapna, S., Apparao, C., 2011. Antihyperglycemic and hypolipidemic activities of Setaria italica seeds in STZ diabetic rats. Pathophysiology 18 (2), 159e164. Siwela, M., Taylor, J.R., de Milliano, W.A., Duodu, K.G., 2007. Occurrence and location of tannins in finger millet grain and antioxidant activity of different grain types. Cereal Chemistry 84 (2), 169e174. Sridhar, R., Lakshminarayana, G., 1992. Lipid class contents and fatty acid composition of small millets: little (Panicum sumatrense), kodo (Paspalum scrobiculatum), and barnyard (Echinochloa colona). Journal of Agricultural and Food Chemistry 40 (11), 2131e2134. Sripriya, G., Antony, U., Chandra, T.S., 1997. Changes in carbohydrate, free amino acids, organic acids, phytate and HCl extractability of minerals during germination and fermentation of finger millet (Eleusine coracana). Food Chemistry 58 (4), 345e350. Subramanian, V., Jambunathan, R., Suryaprakash, S., 1980. Note on the soluble sugars of sorghum. Cereal Chemistry 57 (6), 440e441. Suma, P.F., Urooj, A., 2012. Antioxidant activity of extracts from foxtail millet (Setaria italica). Journal of Food Science and Technology 49 (4), 500e504. Suma, P.F., Urooj, A., 2014. Nutrients, antinutrients & bioaccessible mineral content (invitro) of pearl millet as influenced by milling. Journal of Food Science and Technology 51 (4), 756e761.

Functional food ingredients from old age cereal grains

91

Sun, Q., Gong, M., Li, Y., Xiong, L., 2014. Effect of retrogradation time on preparation and characterization of proso millet starch nanoparticles. Carbohydrate Polymers 111, 133e138. Suresh, K., Kiransree, N., Rao, L.V., 1999. Production of ethanol by raw starch hydrolysis and fermentation of damaged grains of wheat and sorghum. Bioprocess Engineering 21 (2), 165e168. Taylor, J.R.N., Belton, P.S., 2002. Sorghum. In: Belton, P.S., Taylor, J.R.N. (Eds.), Pseudocereals and less well-known cereals. Springer, Berlin, Germany, pp. 25e38. Taylor, J., Taylor, J.R., 2018. Making kafirin, the sorghum prolamin, into a viable alternative protein source. Journal of the American Oil Chemists Society 95 (8), 969e990. Taylor, J.R., Schober, T.J., Bean, S.R., 2006. Novel food and non-food uses for sorghum and millets. Journal of Cereal Science 44 (3), 252e271. Taylor, J.R.N., Sch€ussler, L., 1986. The protein compositions of the different anatomical parts of sorghum grain. Journal of Cereal Science 4 (4), 361e369. Tsuzuki, W., Komba, S., Kotake-Nara, E., Aoyagi, M., Mogushi, H., Kawahara, S., Horigane, A., 2018. The unique compositions of steryl ferulates in foxtail millet, barnyard millet and naked barley. Journal of Cereal Science 81, 153e160. Udupa, S.L., Pattabiraman, T.N., 1985. Isolation and characterization of a trypsin/chymotrypsin inhibitor from the millet Echinochloa frumentacea. Journal of Agricultural and Food Chemistry 33 (4), 642e646. Ugare, R., Chimmad, B., Naik, R., Bharati, P., Itagi, S., 2014. Glycemic index and significance of barnyard millet (Echinochloa frumentacae) in type II diabetics. Journal of Food Science and Technology 51 (2), 392e395. Ukachukwu, C.O., Ogbobe, O., Umoren, S.A., 2010. Preparation and characterization of biodegradable polymer mud based on millet starch. Chemical Engineering Communications 197 (8), 1126e1139. Varsha, V., Asna, U., Malleshi, N.G., 2009. Evaluation of antioxidant and antimicrobial properties of finger millet polyphenols (Eleusine coracana). Food Chemistry 114 (1), 340e346. Veerabhadrappa, P.S., Manjunath, N.H., Virupaksha, T.K., 1978. Proteinase inhibitors of finger millet (Eleusine coracana Gaertn.). Journal of the Science of Food and Agriculture 29 (4), 353e358. Wang, Y.J., White, P.J., Pollak, L.M., Jane, J., 1993. Characterization of starch structures of 17 maize endosperm mutant genotypes with Oh43 inbred line background. Cereal Chemistry 70 (2), 171. Wankhede, D.B., Rathi, S.S., Gunjal, B.B., Patil, H.B., Walde, S.G., Rodge, A.B., Sawate, A.R., 1990. Studies on isolation and characterization of starch from pearl millet (Pennisetum americanum (L.) Leeke) grains. Carbohydrate Polymers 13 (1), 17e28. Wankhede, D.B., Shehnaz, A., Raghavendra Rao, M.R., 1979. Preparation and physicochemical properties of starches and their fractions from finger millet (Eleusine coracana) and foxtail millet (Setaria italica). Starch Staerke 31 (5), 153e159. Watanabe, M., 1999. Antioxidative phenolic compounds from Japanese barnyard millet (Echinochloa utilis) grains. Journal of Agricultural and Food Chemistry 47 (11), 4500e4505. Weller, C.L., Gennadios, A., Saraiva, R.A., 1998a. Edible bilayer films from zein and grain sorghum wax or carnauba wax. LWT-Food Science and Technology 31 (3), 279e285. Weller, C.L., Gennadios, A., Saraiva, R.A., Cuppett, S.L., 1998b. Grain sorghum wax as an edible coating for gelatinebased candies 1. Journal of Food Quality 21 (2), 117e128.

92

Functional and Preservative Properties of Phytochemicals

Weller, C.L., Hwang, K.T., 2005. Extraction of lipids from grain sorghum DDG. Transactions of the ASAE 48 (5), 1883e1888. Wu, X., Wang, D., Bean, S.R., Wilson, J.P., 2006. Ethanol production from pearl millet by using Saccharomyces cerevisiae. In: 2006 ASAE Annual Meeting. American Society of Agricultural and Biological Engineers, p. 1. Xiang, J., Apea-Bah, F.B., Ndolo, V.U., Katundu, M.C., Beta, T., 2019. Profile of phenolic compounds and antioxidant activity of finger millet varieties. Food Chemistry 275, 361e368. Xu, W., Wei, L., Qu, W., Liang, Z., Wang, J., Peng, X., Zhang, Y., Huang, K., 2011. A novel antifungal peptide from foxtail millet seeds. Journal of the Science of Food and Agriculture 91 (9), 1630e1637. Yabuno, T., 1987. Japanese barnyard millet (Echinochloa utilis, Poaceae) in Japan. Economic Botany 41 (4), 484e493. Yan, S., Wu, X., Bean, S.R., Pedersen, J.F., Tesso, T., Chen, Y.R., Wang, D., 2011. Evaluation of waxy grain sorghum for ethanol production. Cereal Chemistry 88 (6), 589e595. Yanez, G.A., Walker, C.E., 1986. Effect of tempering parameters on extraction and ash of proso millet flours. Cereal Chemistry 63 (2), 164e167. Zhang, L., Li, J., Han, F., Ding, Z., Fan, L., 2017. Effects of different processing methods on the antioxidant activity of 6 cultivars of foxtail millet. Journal of Food Quality 1e9. https:// doi.org/10.1155/2017/8372854. Article ID 8372854. Zhang, L., Liu, R., Niu, W., 2014. Phytochemical and antiproliferative activity of proso millet. PLoS One 9 (8), e104058. Zhao, L., Zhang, F., Ding, X., Wu, G., Lam, Y.Y., Wang, X., Fu, H., Xue, X., Lu, C., Ma, J., Yu, L., 2018. Gut bacteria selectively promoted by dietary fibers alleviate type 2 diabetes. Science 359 (6380), 1151e1156. Zhou, Z., Robards, K., Helliwell, S., Blanchard, C., 2002. Composition and functional properties of rice. International Journal of Food Science and Technology 37 (8), 849e868. Zhu, F., 2014. Structure, physicochemical properties, and uses of millet starch. Food Research International 64, 200e211. Zhu, Y., Shi, Z., Yao, Y., Hao, Y., Ren, G., 2017. Antioxidant and anti-cancer activities of proanthocyanidins-rich extracts from three varieties of sorghum (Sorghum bicolor) bran. Food and Agricultural Immunology 28 (6), 1530e1543.

Aquatic plants as a natural source of antimicrobial and functional ingredients

3

Km Pooja 1 , Sapna Rani 2 , Vikrant Rana 3 , Gaurav Kumar Pal 3,4 1 Department of Botany, College of Education, Bilaspur, Greater Noida, Uttar Pradesh, India; 2 Dairy Microbiology Division, ICAR-National Dairy Research Institute, Karnal, Haryana, India; 3Department of Applied Agriculture, School of Basic and Applied Sciences, Central University of Punjab, Bathinda, Punjab, India; 4Department of Life Sciences, School of Life Sciences, Central University of Karnataka, Kalaburagi, Karnataka, India

1. Introduction Marine plants survive and live within complex communities and in close association with others in a competitive and hostile environment. Aquatic plants have developed the physiological adaptations, including the synthesis of bioactive compounds which confer them defense against several grazers. They produce complex secondary metabolites as a response to ecological pressure, such as competition for space, predation, and tide variations. Some of the secondary metabolites or compounds produced by aquatic plants may be useful for inhibiting the growth of pathogenic microorganisms (Pérez et al., 2016). The aquatic plantsederived photochemical compounds, crude extracts, and their partially purified or purified components may exhibit anticoagulant, antiviral, antioxidant, antihelminthic, antibacterial, antifungal, anticancer, and antiinflammatory activities (Pérez et al., 2016). In the last few decades, the number of research studies on the properties of plantsbased antimicrobial compounds’ has been increased consistently, as they are considered as potential sources of biologically active compounds. Due to this reason, aquatic plants have attracted the interest of scientific community and shown themselves as promising sources of bioactive compounds for their utilization as antimicrobial and functional food ingredients (Rossi et al., 2011). Various research studies have shown the potential of aquatic plantsebased compounds as a potential source of the antimicrobial agents as well as have other functional activities that could lead to the development of functional food ingredients (Rossi et al., 2011). Hence, aquatic plants are one of the sources of a variety of biologically active compounds with anticancer, antimicrobial, antifungal, antiviral, antiinflammatory properties, and are potential sources of novel functional food ingredients (Pérez et al., 2016). The development of emerging strategies by foodborne pathogenic microorganisms to avoid the effect of antibiotics leads to the development of multiple drug resistant microbial strains. There are many published reports on the foodborne microbial

Functional and Preservative Properties of Phytochemicals. https://doi.org/10.1016/B978-0-12-818593-3.00003-8 Copyright © 2020 Elsevier Inc. All rights reserved.

94

Functional and Preservative Properties of Phytochemicals

pathogens that show resistance to various group of antibiotics. Public health is one of the major priorities that leads to explore the natural compounds/ingredients, especially aquatic plants, because it is cheaper and have effective natural antimicrobial agents with better potential, less side effects compared to antibiotics, good bioavailability, and minimal toxicity toward the control of drug-resistant foodborne pathogens (Pérez et al., 2016). Hence, It is also worthwhile to test the aquatic plantebased antimicrobials for possible synergism with existing drugs (Arya et al., 2019). Therefore, the main objective of this chapter is to explore the potential of aquatic plant (especially seaweed)ebased compounds toward the development of novel antimicrobial agents and functional food ingredients.

2.

Seaweeds

Seaweeds are one of the taxonomically diverse groups of the marine plants from which the land-based plants diverged. Traditionally, they were classified based on the color of the plant such as green, brown, and red. However, the modern molecular biology level systematic evidences suggest that these plants are extraordinarily diverse and nonvascular. It is also well reported that there are several species of edible seaweeds which are projected as a major source of future foods (Bast, 2014). Seaweeds are also considered as one of the future aquatic plants, and have been projected as the viable and sustainable source for biofuel production without disturbing the global food scenario, and also have a number of pharmaceutical, industrial, and biotechnological applications. Seaweeds are also important to humanity in a number of ways, such as a source of medicines, food supplements, industrial chemicals, and a potential candidate for biofuel research (Bast, 2013).

3.

Seaweeds proteins

Seaweeds are consumed traditionally as food, sea vegetables, or as herbal medicine due to their high nutritional and pharmaceutical values, for treating and prevention of several diseases and disorders (Cermeno et al., 2019; H. K. Kang et al., 2019; Okolie et al., 2018). They are also used as animal feed, fertilizer, fungicides, herbicides, condiments, dietary supplements, and as a resource of agar, alginate, and carrageenan for various industrial and pharmaceutical applications (Pangestuti and Kim, 2015; Peng et al., 2015). It is well known that seaweeds have been efficiently utilized as a protein source since from several decades globally, especially in developing countries. Nowadays, seaweeds have become a cheaper alternative source of protein mainly due to presence of essential amino acids in high-value proteins (Pangestuti and Kim, 2015; Peng et al., 2015). In the major species of seaweeds, the protein content varies in the range of 10%e40% on the basis of dry weight. It was also stated that the highest protein content in seaweeds was found during the period of winter and the least during summer

Aquatic plants as a natural source of antimicrobial and functional ingredients

95

(Pangestuti and Kim, 2015). The minimum protein content in summer might be due to the destruction of phycobiliproteins, which are the major part of proteins present in the seaweed. It is also reported that red seaweeds contain high protein content as compared to green and brown seaweeds (Pangestuti and Kim, 2015). Sometimes, the protein content of red seaweed is comparable to protein-rich vegetables such as soybean (S.-K. Kim, et al, 2011). Seaweed proteins are majorly grouped in to two functionally active proteins called lectin and phycobiliproteins (Pangestuti and Kim, 2011). Lectins are usually glycoproteins which bind with carbohydrates and participate in many biological processes like intercellular communication and have the ability to agglutinate red blood cells. Phycobiliproteins are fluorescent proteins found in red seaweeds, which are highly stable and soluble (Pangestuti and Kim, 2015). Phycobiliproteins (phycocyanins, allophycocyanins, and phycoerythrins) are light-harvesting pigments present in red seaweeds and are commonly used as fluorescent probes in scientific experiments (Glazer, 1994; Sekar and Chandramohan, 2008). The structural and biological activities of the seaweed proteins are still not documented well. However, most of the seaweed bioactive constituents including proteins are intracellular under a highly rigid and structural complex cell wall, which is a major obstacle to the efficient extraction and digestibility of seaweed-derived protein fractions. It is also stated that the seaweed protein is highly cohesive due to the presence of polysaccharides (Adalbj€ ornsson and J onsd ottir, 2015; Admassu et al., 2018; Fleurence et al., 2012; Harnedy and FitzGerald, 2013; Wang et al., 2010; Wijesinghe and Jeon, 2012b). Therefore, novel emerging technologies such as microwave-assisted extraction, supercritical fluid extraction, pressurized solvent extraction, ultrasoundassisted extraction, pulsed electric fieldeassisted extraction, and enzyme-assisted extraction have been recently used to extract the protein with higher yield and desirable functional properties (Admassu et al., 2018; Jiménez-Escrig et al., 2011; Samarakoon and Jeon, 2012; Wijesinghe and Jeon, 2012a, 2012b).

4. Bioactive compounds Research investigation of the biochemical composition and general phytochemistry of seaweeds has been widely carried out throughout the world. Nutrients (proteins, minerals, vitamins, dietary fiber, and lipids) and numerous structurally unique secondary metabolites from various species of seaweeds have been reported (Pangestuti and Kim, 2015). Most of the aquatic plants (especially seaweeds) are widely used as potential and valuable sources of bioactive compounds in a wide range of industries, including food, pharmaceutical, cosmetic, nutraceutical, and biomedicine industries (Peng et al., 2015). These bioactive compounds have various antibacterial, antifungal, antimicrobial, antiviral, and other functional biological properties (Gupta and Abu-Ghannam, 2011; Khalid et al., 2018). The compounds which are responsible for these activities comprise phenolic compounds, sulfated polysaccharides, organic acids, and complex

96

Functional and Preservative Properties of Phytochemicals

mixtures of phytochemicals which possess antimicrobial and functional properties (Gupta and Abu-Ghannam, 2011). Some of the natural factors such as geographical location, seasonality, environmental conditions (light, temperature, and salinity), life stage, reproductive state, and age of the seaweed also affect the antimicrobial activities of aquatic plants, which is attributed due to the presence of a single compound (H. K. Kang et al., 2019; Khalid et al., 2018; Pangestuti and Kim, 2015; Peng et al., 2015). However, some times the antimicrobial activities and other functional activities of the aquatic plants could also be related to a combination of two or more than two metabolic compounds. Seaweeds are the potential sources of a great variety of metabolites and natural bioactive compounds such as polysaccharides, polyunsaturated fatty acids, phlorotannins, other phenolic compounds, and carotenoids with antimicrobial as well as other functional biological activities (Khalid et al., 2018).

5.

Seaweed-derived bioactive hydrolysates/peptides

Bioactive peptides are specific and small protein fragments (2e20 amino acids in size) that are inactive within the sequence of their parent protein. In the past decades, bioactive peptides derived from marine sources have been recognized as novel functional ingredients in food, as well as in pharmaceutical sectors. Bioactive molecules have a positive impact on the body function and may influence the human health. It is also been reported to mimic hormones and exhibit druglike activities. Bioactive peptides could also be able to alter the physiological functions or create a positive impact through binding to specific receptors and interacting with target cells or inhibiting enzymatic reactions (Samarakoon and Jeon, 2012). Seaweeds-derived, protein-based bioactive peptides can be released by chemical and biological (gastrointestinal digestion, food processing, or fermentation) processes. Enzymatic hydrolysis methods are most commonly used to release the bioactive hydrolysates and peptides from various sources (Pal and Suresh, 2016a,b, 2017b; Pooja and Rani, 2017; Pooja et al., 2017; Rani and Pooja, 2018; Rani et al., 2017; Rani et al., 2018). A number of natural sources have gained much attention to release the potential biologically active hydrolysates and peptides due to their lower cost and higher availability (Mohan et al., 2015; Rani et al., 2018). The biological and functional activities of peptides are usually based on their amino acid position and composition (Pal and Suresh, 2016a,b, 2017a,b). The bioactivity of peptides also depends on the primary sequence of protein and specificity of the enzymes used to release the peptides from parent sequence (Harnedy and FitzGerald, 2012; Pal and Suresh, 2016b, 2017b; Rani et al., 2018). The structural characteristics of peptides most probably influence their profiles of biological and functional activities. The presence of tyrosine, phenylalanine, tryptophan, proline, valine, leucine, lysine, isoleucine, and arginine in peptides strongly influences the binding of peptides with angiotensin converting enzyme (ACE) (Harnedy and FitzGerald, 2012; Pooja et al., 2017; Rani et al., 2018). The activities of antimicrobial peptides is associated

Aquatic plants as a natural source of antimicrobial and functional ingredients

97

with positively charged residues. The radical scavenging activity is associated with histidine, leucine, tyrosine, methionine, and cysteine amino acid residues (Pal and Suresh, 2017a). Hydrophobic amino acids (proline and hydroxyproline) appear to play a major role in the inhibition of lipid peroxidation (Harnedy and FitzGerald, 2012; Rani et al., 2018). The most abundantly present amino acids in brown, red, and green seaweed species are aspartic and glutamic acid which play an important role in the development of flavor and taste (umami) sensations, respectively (Pangestuti and Kim, 2015). Red, brown, and green seaweeds contains a good combination of essential amino acid profiles. In most of the brown seaweeds, glutamic acids content is highest (Samarakoon and Jeon, 2012). Plant, animal, and microbial enzymes can be utilized to improve protein digestibility of seaweed fibers and also separation and purification of bioactive peptides (Rani et al., 2018). The commercialization of seaweedderived bioactive peptides can be utilized in several industries and also have potential interest in the nutraceutical and pharmaceutical sectors.

6. Methods used for the release of bioactive peptides After the extraction of seaweed-derived proteins, these proteins are subjected to hydrolysis in order to release bioactive peptide fragments with their specific bioactivities. The most common methods used for the development of seaweed-derived bioactive hydrolysates and peptides are chemical, biological, and integrated methods. The bioactive hydrolysates and peptides can be generated by chemical hydrolysis (acid and alkali hydrolysis) process. These hydrolysis methods are cost-effective, easy to operate, and require short hydrolysis time (Anal et al., 2013; Rani et al., 2018). In biological methods, the bioactive hydrolysates and peptides are majorly released using exogenous enzymes, endogenous enzymes, fermentation, and gastrointestinal digestion process (Admassu et al., 2018; Jiménez-Escrig et al., 2011). Enzymatic hydrolysis is favored by several food and pharmaceutical industries to avoid the chemical and physical treatments as well as to preserve the functional and nutritional values of the released peptides (Samarakoon and Jeon, 2012). Therefore, enzymatic hydrolysis is the most widely used method to improve the functional and nutritional characteristics of protein hydrolysates and peptides released from various natural sources (Fig. 3.1). The molecular weight of peptides is one of the most critical parameter, as it is also extensively reported that low molecular weight peptides can be easily absorbed in the gastrointestinal tract and cardiovascular circulation system and finally exhibit physiological-regulating properties (Pooja and Rani, 2017; Pooja et al., 2017; Rani et al., 2017, 2018). The commercial available food grade and non-food-grade proteolytic enzymes from microbes, plants, and animal sources have been widely used for the release of seaweed proteinederived peptides with functional activities. The choice of enzyme and enzyme reaction conditions play a crucial role in the release of bioactive peptides with desirable characteristics (S.-K. Kim and Wijesekara, 2010; Kumar and Rani, 2017; Samarakoon and Jeon, 2012; Samaranayaka and Li-Chan, 2011).

98

Functional and Preservative Properties of Phytochemicals

Figure 3.1 Protocol for the preparation and exploration of the biological activity of the peptides derived from the seaweeds.

It is also well known that only few peptides have the potential functional activity among the peptides released after hydrolysis. Therefore, it is important to stress here that in vitro analysis to evaluate the biological and functional activity of the peptides is not enough and needs to be confirmed by in vivo methods to observe a real health benefit. The bioactive peptides must be resistant to the gastrointestinal digestive

Aquatic plants as a natural source of antimicrobial and functional ingredients

99

enzymes and further reach the target site for exhibiting its biological activity. The length of amino acid chain and its composition are key factors that play a crucial role in absorption and resistance to degradation by gastrointestinal digestive enzymes (Lopez-Barrios et al., 2014; Rani et al., 2018). However, the cost of enzyme is a rate limiting step for the successful preparation of bioactive hydrolysates and peptides. Hence, it is recommended to use cheap sources of enzymes, those derived from byproducts of microorganisms (Fig. 3.1). Most of these cost-effective enzymes are derived from microbial sources (Agyei and Danquah, 2011; Agyei et al., 2018; Zambrowicz et al., 2013).

7. Computational approaches for exploring biological activity of peptides In the last decade, various research studies have been focused on the identification, characterization, and purification of bioactive peptides from seaweeds. Classical or traditional approaches, in silico or computational approaches, and a combination of both, i.e., integrated approaches can be used to explore the potential of bioactive peptides (Rani et al., 2018). There has been growing interest in the use of computational-derived approaches for screening of bioactive peptides from the novel substrates especially from the seaweeds (Agirbasli and Cavas, 2017; Bleakley et al., 2017; Cermeno et al., 2019; Chang and Alli, 2012; Huang et al., 2015; Huang et al., 2015; Iwaniak et al., 2016; Kumagai et al., 2019; Minkiewicz et al., 2008, 2011). The screening for biological activities containing peptides from novel substrates using conventional methods is an expensive and time-consuming process as compared with in silico analysis (Pooja and Rani, 2017; Pooja et al., 2017; Rani and Pooja, 2018; Rani et al., 2017, 2018). However, this process can be simplified using computational approaches such as basic local alignment search tool (BLAST) (Altschul et al., 1997, 2005), BIOPEP (Iwaniak et al., 2016; P. Minkiewicz et al., 2011; Piotr Minkiewicz et al., 2008), PeptideRanker (Mooney et al., 2012), PeptideLocator (Mooney et al., 2013), Pepdrew, Pepcalc (Rani and Pooja, 2018; Rani et al., 2018), ToxinPred (Gupta et al., 2013), and Allergencity (Dimitrov et al., 2014), etc. In classical approaches, various steps are involved in the release of bioactive peptides. Firstly, the selection of particular enzyme and its sources (food-grade and non-food-grade enzymes) for the release of peptides. Subsequently, prepared protein hydrolysates are subjected to fractionation and purification. The most potential bioactive hydrolysates/peptide sequences are subjected to identification using mass spectrometry method. Further, activities of released peptides are validated by chemically synthesized peptides (Agyei et al., 2018; Udenigwe, 2014; Udenigwe and Aluko, 2012; Udenigwe et al., 2013). It is a time-consuming process which may lead to lower yields of desirable bioactive peptides. During the purification process, loss of some potential bioactive peptides may occur (Hayes et al., 2015). The computational simulated approaches can be used for predicting the release of potential bioactive peptides from known parental protein sequences. It is a suitable and

100

Functional and Preservative Properties of Phytochemicals

emerging approach for exploring the novel and unexplored proteins and peptides which have not been previously studied as sources of bioactive peptides (Lafarga and Hayes, 2014; Lafarga et al., 2014). Several popular bioinformatics tools, such as BLAST, BIOPEP database tool, PeptideDB, CAMP, APD2 or PepBank, and QSAR (quantitative structure-activity relationship) have been well employed to predict and design the potential bioactive peptides from the plants, animals, and food-derived proteins (Pripp et al., 2005; Rani et al., 2018; J. Wu et al., 2006). PeptideCutter, EnzymePredictor, PeptideRanker, or PeptideLocator tools can be used to predict possible cleavage sites of the given protein sequences (Mooney et al., 2013, 2012). In silico approaches have several advantages over classical approaches toward the exploration of potential bioactive hydrolysates and peptides. It is a time-saving, economical process for prediction of biologically active protein fragments that can also be used to investigate bioactive peptides derived from various food-source proteins. The utilization of computational approach can also reduce the number of experiments performed (Rani et al., 2018). It was also reported that the peptides released from computational-derived approaches may not be generated experimentally due to the complex interaction between enzymes and proteins, as well as their posttranslational modifications (Mohan et al., 2015). The predicted bioactive peptides need to be evaluated by real laboratory synthesis under optimal temperature and pH conditions, and their bioactivity also needs to be validated by in vitro as well as in vivo methods (Rani and Pooja, 2018; Rani et al., 2018). Therefore, insilico analysis is regarded as an important tool by food scientists, as a result of this approach may reflect in in vitro and in vivo results.

8.

Antimicrobial activity of the seaweed-derived bioactive compounds

Clinical health problems are sometimes very difficult to treat due to antimicrobial resistance. Therefore, to overcome the problem of antimicrobial resistance several new types of antimicrobial agents are developed. It has been revealed that marine environment is a rich source of natural antimicrobial compounds when compared to terrestrial environment (Cox et al., 2010; Eom et al., 2012). Among most of the marine organisms, seaweeds have been recognized as a special source of bioactive compounds of medical interest. Seaweeds are potential sources of different types of metabolites that might be an indicator for checking the presence of antimicrobial activity of compounds. Various secondary metabolites present in seaweeds are known to possess a wide range of biological activities. These activities are antimicrobial, antioxidant, antiinflammatory, and so on. The antibacterial activity of seaweeds also depends on the species, the extraction method efficiency, and also on the exact concentration of the bioactive molecules (Gupta et al., 2010; Kajiwara et al., 2006; Rajauria et al., 2013; Vlachos et al., 1997). Several research studies have been done on the antibacterial activity of the seaweed extract and seaweed-

Aquatic plants as a natural source of antimicrobial and functional ingredients

101

derived other bioactive components against multidrug resistance and pathogenic microorganisms (Bansemir et al., 2006; Devi et al., 2008; Moubayed et al., 2017; Rao and Parekh, 1981; Reichelt and Borowitzka, 1984; Shanmughapriya et al., 2008; Val et al., 2001). Bioactive compounds from seaweeds have shown antimicrobial action against pathogenic and nonpathogenic gram positive and negative bacteria. Seaweeds have soluble dietary fibers and indigestible polysaccharides (such as laminarin, fucoidan, ulvan, and alginate) that possess strong antimicrobial activities (Lynch et al., 2010). Phlorotannins, terpenes, and lipophilic compounds found in macroalgae have potential antimicrobial activity (Eom et al., 2012). Phlorotannins isolated from Ecklonia kurome, Ecklonia cava, and Fucus vesiculosus showed antimicrobial bioactivities against gram positive and gram negative bacteria (Hayes, 2015). Recently, seaweeds and seaweed extracts have been explored as an alternative to the antibiotics (Bach et al., 2008; Craigie, 2011; Gardiner et al., 2008; Kajiwara et al., 2006; Makkar et al., 2016; Patra et al., 2008). The antimicrobial activity of seaweed constituents showed a better influence on gut microbiota, which could be used to improve the prevalence of beneficial microorganisms even at lower concentrations. The prevalence of enterohemorrhagic E. coli O157 and O157:H7 in seaweed supplemented animals was reduced by 33%e36% in hide swabs and 9%e11% in fecal samples (Bach et al., 2008; Braden et al., 2004). Kajiwara et al. (2006) investigated the antimicrobial browning-inhibitory effects of volatile compounds in the essential oils of several seaweed species (Lonicera japonica, Kjellmaniella carrifolia, Gracilaria verrucosa, and Ulva pertusa). This study reported that presence of flavor compounds ((3Z)-hexenal, (2E)-hexenal, and (2E)-nonenal), which have strong antimicrobial activity. The study has been conducted to determine the effects of brown seaweed extract (Ascophyllum nodosum) supplementation on skin and carcass microbial contamination in goats. Study indicated that the goats subjected to seaweed extract dietary treatment had the lowest skin E. coli counts. Therefore, seaweed extract supplementation before slaughtering can be used as a viable decontamination strategy in goat processing (Kannan et al., 2019). Six different seaweeds (Chnoospora implexa, Dictyota dichotoma, Gracilaria corticata, Hynea panosa, Enteromorpha intestinalis, and Caulerpa racemose) have been studied to control the downy mildew and powdery mildew of grapes under field trial. The results revealed that 19 compounds were present, among them d-Mannitol, 1decylsulfonyl might be majorly responsible to reduce the mildew diseases (Thankaraj et al., 2019). Two seaweeds species (Hypnea musciformis and Enteromorpha intestinalis) were studied to evaluate their antimicrobial activities. The ethanol extracts of H. musciformis and E. intestinalis have inhibited the growth of selected bacterial strains (Pseudomonas sp., Staphylococcus aureus, Klebsiella sp.). Results indicated that seaweed extracts possessed higher amount of phytochemicals and showed promising antimicrobial activities (Hasan et al., 2019).

102

9.

Functional and Preservative Properties of Phytochemicals

Functional activities of the seaweed-derived bioactive compounds

Traditionally, alginate, carrageen, and agar have been derived from the various types of seaweeds, which come under the category of excellent gelling agents. Carrageenan and agar could be able to form the thermally reversible gels on cooling their aqueous solution. Peptides derived from natural sources can be used as potential alternatives of chemosynthetic drugs in the food, pharmaceutical, and biotechnological sectors. Due to the increasing consumer awareness regarding the safety and cost of bioactive peptides, there is a need to understand the molecular mechanism of actions of bioactive peptides on specific cellular targets (Admassu et al., 2018). The huge diversity of the seaweeds is explored for various commercial food, agricultural, horticultural, pharmaceutical, cosmetic, and bioenergy applications (Beaulieu et al., 2016; Harnedy and FitzGerald, 2011). Therefore, seaweeds are considered as potential reservoirs of novel biologically active components. Specifically, they are rich sources of proteins and amino acids and can be used as potential starting materials in the production of bioactive peptides with a wide range of bioactivities (Agirbasli and Cavas, 2017; Daud et al., 2016; Harnedy and FitzGerald, 2011).

9.1

Antioxidative activity

Usually, antioxidants are used to neutralize the free radicals and provide protection to humans against infection and degenerative diseases. The antioxidant molecules play a significant role to reduce the oxidative processes in human body, as well as in several food commodities. In food commodities, antioxidant molecules/compounds are able to retard the protein oxidation, lipid peroxidation, and secondary product formation during lipid peroxidation (Airanthi et al., 2011; Bansemir et al., 2006; Chandini et al., 2008; Devi et al., 2008; Ganesan et al., 2008; Heo et al., 2005; Moubayed et al., 2017; Rao and Parekh, 1981; Reichelt and Borowitzka, 1984; Val et al., 2001). Currently, researchers are looking for natural antioxidants as compared to synthetic antioxidants, which is most probably due to the safety and human health prospective. The antioxidant activity can be measured by various radical scavenging methods (beta carotene, total phenol content, total antioxidant capacity and 1,1-diphenyl-2picrylhydrazyl activity (DPPH)). The antioxidant activity were found in the various types of seaweeds (Moubayed et al., 2017; Palanisamy et al., 2017; Pérez-Larran et al., 2019; Val et al., 2001). The natural-derived antioxidants and synthetic antioxidants are widely used to maintain the flavor, texture, and color of the food product during storage. Artificial or synthetic antioxidants such as butylated hydroxytoluene (BHT), butylated hydroxyanisole (BHA), and tert-Butylhydroquinone (TBHQ) are most widely used in the lipid containing foods. Nowadays, the natural antioxidants (such as vitamin C, tocopherols, rosemary, and tea extracts) have been well known as alternative to synthetic antioxidants (Rani et al., 2017, 2018; Sila and Bougatef, 2016). In the various plant

Aquatic plants as a natural source of antimicrobial and functional ingredients

103

sources, natural antioxidants such as beta carotene, polyphenols, and alpha tocopherol are found in rich amount and can prevent the various chronic diseases. Among all the natural antioxidants, phenolic antioxidant compounds are widely found in seaweeds. It was reported that various seaweed species contains different types of phenolic compounds which could be used as a source of natural antioxidants (Ganesan et al., 2008; Heo et al., 2005; Matanjun et al., 2008). Seaweeds are the potential source of various novel antioxidant molecules and compounds, which may have a variety of structures and biological activities. Seaweeds could be able to play a vital role in hindering the free radicals. Therefore, they are widely used in life science, food, and medical sectors. However, there is scanty information on the antioxidant activities of seaweed-derived protein hydrolysates and peptides. For a better understanding of antioxidant activities of hydrolysate and peptides from seaweeds, the peptides contributing to those activities need to be studied. The antioxidant potential of the protein hydrolysates and peptides derived from various sources (animals, plants and other sources such as milk, soy, egg, fish, etc.) have also been demonstrated (Admassu et al., 2018; Agirbasli and Cavas, 2017; Gallego et al., 2019; Hayes et al., 2015; Korhonen and Pihlanto, 2006; Lopez-Barrios et al., 2014; Pooja et al., 2017; Rani et al., 2017; Shanmughapriya et al., 2008; J. Wu et al., 2006; R. Wu et al., 2017; Yan et al., 2015). Nowadays, seaweeds have been receiving increasing attention as a promising natural source of antioxidants (Marinho et al., 2019). The seaweed extract of sugar kelp, Saccharina latissima, has been studied to evaluate the seasonal variation in the antioxidant activity. The results of the study revealed that there is a strong positive correlation between total phenolic content and total antioxidant capacity. Additionally, total phenolic content and total flavonoid content have been reported to contribute positively to the radical scavenging activity (Marinho et al., 2019). The various extracts (water and ethanolic) of 26 species of seaweeds collected from the Kuwait coast of Arabian Gulf have been studied for phytochemicals, phenolics, and antioxidant activities (Farvin et al., 2019). The results of the study revealed that Canistrocarpus cervicornis and almost all of the selected Sargassum species showed better radical scavenging and reduced power activity. The seaweeds from this geographical location contain more flavonoids than phlorotannins. Almost all of the studied seaweeds contained hydroquinone which is known as a skin whitening agent. This study concluded that seaweeds could be potentially rich sources of antioxidants for food and pharma sectors (Farvin et al., 2019). The antioxidant activities of three Indian brown seaweeds (Sargassum marginatum, Padina tetrastromatica and Turbinaria conoides) have been studied using in vitro methods such as total antioxidant activity, DPPH radical scavenging, and deoxyribose assays (Chandini et al., 2008). The results of the in vitro study indicated that methanolic extracts from three seaweeds showed potential antioxidant activity in the dose dependency manners (Chandini et al., 2008). The study reveals that the seaweeds showed the highest antioxidant activity and protect the cell against hydrogen peroxide (Sathya et al., 2017). It is also reported that the natural antioxidants is one of the important area among the present research scenario of seaweed application and utilization (Airanthi et al., 2011; Chandini

104

Functional and Preservative Properties of Phytochemicals

et al., 2008). Therefore, it has got many demands in food and pharmaceuticals industries for the development of natural bioactive, antiaging, and anticarcinogenic compounds that may cause detrimental effects on health. Various naturally available antioxidants are derived from the seed oil, fruits, spices, and various other natural sources.

9.2

Antitumor activity

Cancer is a pathological condition and remains one of the leading causes of human death in the world. Globally, breast cancer is the second leading cause of death in women among all types of cancer (Bray et al., 2018). Presently, chemotherapy is widely used for the treatment of cancer with a wide range of side effects. The ocean contains a wide diversity of plant and animal organisms; among these organisms seaweeds are considered as a rich source of natural products and bioactive compounds such as polyphenols, peptides, polysaccharides, vitamins, and fatty acids with different structures and functional properties, which provide the numerous health benefits to living organisms (Ganesan et al., 2008; Gardiner et al., 2008; Hayes, 2015; Okolie et al., 2018; Synytsya et al., 2010; Wijesinghe and Jeon, 2012b). Many groups of researchers are focusing on these issues to identify potent natural compounds with minimal side effects. Seaweeds contain a group of sulfated hetero polysaccharide compounds known as fucoidan, which have been reported to perform various admirable biological activities such as antioxidant, antiinflammatory, antiobesity, anticoagulant, antiallergic, antitumor, antiviral, antiuropathy, antihepatopathy, and antirenalpathy effects (Gutiérrez-Rodríguez et al., 2018; Vo and Kim, 2013; L. Wu et al., 2016). The seaweed-derived fucoidan has been shown to be effective in inhibiting the growth of various cell lines as studied by in vitro assays. The anticancer potential of fucoidan was evidenced by clinical trials of various types of the cancer patients (Bray et al., 2018; Palanisamy et al., 2017; Synytsya et al., 2010; Vo and Kim, 2013). Studies have been done to isolate and purify the fucoidan and also investigate their antitumor activity (Synytsya et al., 2010). The results of this study indicated that miyeokgui fucoidan showed antitumour activity against PC-3 (prostate cancer), HeLa (cervical cancer), A549 (alveolar carcinoma), and HepG2 (hepatocellular carcinoma) cells (Synytsya et al., 2010). The study has also been done to extract the six heterofucans from the brown seaweed Dictyopteris delicatula (Magalhaes et al., 2011) and result of the study indicated that heterofucans showed antitumor activity (Magalhaes et al., 2011). The polysaccharides extracted from the brown seaweed Sargassum pallidum showed significantly higher antitumor activity against the HepG2 cells, A549 cells, and MGC-803 cells (Ye et al., 2008). The sulfated polysaccharides have been isolated from brown seaweeds (Saccharina japonica and Undaria pinnatifida), and their antitumor activity was tested against human breast cancer T-47D and melanoma SK-MEL-28 cell lines (Vishchuk et al., 2011). Fucoidans from S. japonica and U. pinnatifida noticeably inhibited the proliferation and colony formation in breast cancer and melanoma cell lines in a dosedependent manner (Gutiérrez-Rodríguez et al., 2018; Vishchuk et al., 2011; L. Wu et al., 2016). Therefore, the results obtained from the various studies indicated that

Aquatic plants as a natural source of antimicrobial and functional ingredients

105

the use of seaweeds-derived molecules might be a potential approach for the cancer treatment (Vishchuk et al., 2011).

9.3

Neuroprotective activity

Oxidative stress leads to the generation of reactive oxygen species (ROS) which may cause extensive damage to proteins, lipids, and DNA. It results from an imbalance of antioxidant homeostasis and plays a crucial role in neurodegenerative diseases (Pal and Suresh, 2016b). Parkinson disease is commonly related with neuroprotective factor. It is common in elderly individuals and increasing rapidly. It has a very complicated mechanism as this disease is directly linked with dopaminergic neuron loss (H. Liu, Wang et al., 2018). Ten fucoidan derivatives have been successfully synthesized and their neuroprotective, anticomplement activities were determined by employing various established in vitro systems. All fucoidan derivatives showed considerable neuroprotective and anticomplement activities and had stronger activities than fucoidan in certain tests (H. Liu et al., 2018). The result of the study also indicated that sulfate and benzoylate groups could enhance the neuroprotective activity of fucoidan (H. Liu et al., 2018). Alzheimer and Parkinson diseases are increasing with the population age and related to the nerves and neurons. Crude fucoidan had been extracted from Saccharina japonica and its fractions were tested for their neuroprotective activities. The results obtained from this study indicated that a fraction of fucoidans have neuroprotective effects and also suggest that heteropolysaccharides might contribute to their neuroprotective activity (Jin et al., 2013). Marine brown seaweed Bifurcaria bifurcata was studied for its antioxidant and neuroprotective activities. Neuroprotective effects of seaweeds were evaluated in a neurotoxic model which is induced by 6-hydroxydopamine in a human neuroblastoma cell line (SH-SY5Y) (Silva et al., 2019). The study also investigated the mechanisms associated to neuroprotection by determination of H2O2 production, Caspase-3 activity, mitochondrial membrane potential, and DNA fragmentation observation. The isolated diterpenes (eleganolone and eleganonal) fractions exhibited the best neuroprotective activities by preventing the changes in mitochondrial potential, reduction of H2O2 levels and an increase in cell viability (Silva et al., 2019). Therefore, the results obtained from various research studies indicated that seaweedsderived molecules are potential natural sources of the molecules with neuroprotective activities (Alghazwi et al., 2016; Alghazwi et al., 2019; Suganthy et al., 2010).

9.4

Anticoagulant activity

Anticoagulant molecules are used as an in vivo medication for thrombotic disorder. In past years, many efforts have been undertaken to obtain an enhanced form of anticoagulants, which may have less risk of hemorrhage. Seaweeds are the rich source of sulfated polysaccharides, which have potential anticoagulant properties. These polysaccharides usually have the ability to prevent coagulation and obtained from the red and brown seaweeds. Nowadays, there is a growing interest in the alternative

106

Functional and Preservative Properties of Phytochemicals

anticoagulant agents from various natural resources. It is also stated that polysaccharides from brown, red, and green algae are the promising sources for anticoagulant activities (Carvalhal et al., 2019; Venkatesan et al., 2019). Novel water-soluble polysaccharides were isolated from three selected Indian seaweeds Enteromorpha compressa (green algae), Gracilaria filiforms (red algae), and Turbinaria conoides (brown algae) and their therapeutic applications were evaluated. The results of the study showed that all the three seaweeds demonstrated pronounced in vitro anticoagulant activities, which confirmed the unambiguous role in the prolongation time of the intrinsic coagulation pathway (Venkatesan et al., 2019). The seaweed (Monostroma angicava) polysaccharides were evaluated for their anticoagulant property by in vitro and in vivo methods and results indicated that polysaccharides effectively prolonged the clotting time and exhibited strong anticoagulant activity in in vitro and in vivo conditions. Therefore, results suggested that seaweed derived polysaccharide is a potential novel anticoagulant agent (X. Liu et al., 2018). An anticoagulant-active sulfated polysaccharide was extracted with boiling water from the green seaweed Monostroma angicava; it has been reported to have a high anticoagulant activity (Li et al., 2017). Sulfated and pyruvylated galactans isolated from three tropical species of the green seaweeds Penicillus capitatus, Udotea flabellum, and Halimeda opuntia showed a moderate anticoagulant activity as evaluated by general coagulation tests (Arata et al., 2015).

9.5

Immunomodulatory activity

Immunomodulation is known as the work or action taken under medication on auto regulating processes that enhance the immunological defense system. Currently, research focusing on the natural compounds that can modulate the immune system is gaining attention (Pérez-Recalde et al., 2014). It is also well reported that seaweed-derived molecules could be a promising source for enhancing the immunomodulatory activity. However, the effects of polysaccharides from seaweeds on the immune system are much less studied (Pérez-Recalde et al., 2014). Water-soluble sulfated polysaccharides from the red seaweed (Nemalion helminthoides) were investigated to determine their in vitro and in vivo immunomodulatory activities and results suggest that seaweed polysaccharides could be a strong immunomodulators (Pérez-Recalde et al., 2014). The aqueous extract of Sargassum vulgare, Padina tetrastromatica, and Amphiroa fragilissima exhibited promising immunomodulator properties (Talluri et al., 2017). Watersoluble sulfated polysaccharides extracted from Enteromorpha prolifera were also investigated to determine their in vitro and in vivo immunomodulatory activities and results suggest that the sulfated polysaccharides are strong immunostimulators (J.-K. Kim, Cho et al., 2011).

Aquatic plants as a natural source of antimicrobial and functional ingredients

9.6

107

Antiobesity activity

Obesity is a disorder that can be defined as the increase in body weight caused by excess body fat accumulation that may impair health (C.-H. Wu et al., 2010). As per World Health Organization, overweightness and obesity are the fifth leading risk for global death, and at least 2.8 million death cases have been reported due to overweightness or obesity (Chandrasekaran et al., 2012). Many researchers have been trying to find natural remedies to combat life-threatening obesity. In some studies, it was reported that the seeds of Hunteria umbellata, Panax ginseng, and Embelia ribes showed effects in high-fat diet (HFD)-fed mice (Adeneye et al., 2010; Bhandari et al., 2013; Lee et al., 2013). Study conducted by Kang et al. (2016) reported that Plocamium telfairia extract (PTE) decreased the expression of adipogenic-specific proteins peroxisome proliferator-activated receptor-g, CCAAT/ enhancer-binding protein-a, sterol regulatory element-binding protein 1, and fatty acid-binding protein 4 compared with that in the untreated 3T3-L1 cells. This study also indicated that the oral administration of PTE was found to significantly reduce body weight, fatty liver, amount of white adipose tissue, and levels of triglyceride and glucose in the experimental tested animals (M.-C. Kang et al., 2016). The lipids from edible seaweed, Undaria pinnatifida (consisting mainly of carotenoid and fucoxanthin), showed significant increase in mitochondrial uncoupling protein 1 (UCP1) in white adipose tissue (WAT), although there is little expression of UCP1 in WAT of mice fed with control diet (Maeda et al., 2005). Diet rich in fucoxanthin-rich wakame lipids (WLs) along with high fat (HF) showed significant reduction in body weight and WAT (Maeda et al., 2009). Similarly, fucoxanthin from brown seaweeds induces UCP1 in abdominal WAT mitochondria, leading to the oxidation of fatty acids and heat production in WAT (Miyashita et al., 2011).

9.7

Antidiabetic activity

Morgen and Sørensen (2014) state that the number of people suffering from glucose and lipid metabolic disorders has increased exponentially in recent decades, and diabetes has become a major public health problem worldwide (Morgen and Sørensen, 2014). Glucose and lipid metabolic disorders induce type 2 diabetes mellitus which is a common metabolic disorder characterized by high blood glucose and relative lack of insulin secretion (Morgen and Sørensen, 2014). Most of the marine algae are rich in bioactive ingredients with diverse biological activities and potential health benefits (Zhao et al., 2018). Prebiotics which are the derivatives of marine macroalgal polysaccharides and oligosaccharides have various effects on animal health, including the modulation of gut microbiota. Brown seaweed Sargassum confusum (SCO) has a sequence of sulfated anhydrogalactose and methyl sulfated galactoside units. Fasting blood glucose levels were significantly decreased after SCO administration (Yang et al., 2019). Study conducted by Oh et al. (2016) reported that consumption of brown seaweeds did not prevent long-term HFD-induced obesity in C57BL/6N mice; it reduced insulin resistance and circulation of proinflammatory cytokines (Oh et al., 2016).

108

Functional and Preservative Properties of Phytochemicals

It was also reported that including edible brown seaweed in the diet has a number of positive bioactivities including antidiabetic and so on. The study showed that the seaweed contains nutrients such as protein, vitamins, minerals and dietary fibers which further could be able to act as antidiabetic agents (L. Wang et al., 2018).

10.

Utilization of seaweeds and their derivates in healthier food products

In the recent decades, the role of food commodities in human health and diet is progressively gaining more attention. The foods not only contain essential nutrients but also have other bioactive compounds and metabolites which have been found to be considered as important for good health and disease prevention (Gupta and Abu-Ghannam, 2011). Seaweed has been used as an important dietary component for centuries in East Asia, due to its health benefits. However, seaweeds are attracting attention of the researchers and industries as a valuable food source in other parts of Asia, Africa, and Western parts of the world, and growing interest to explore the all possible seaweed interventions, including functional food product development (Birch et al., 2019). The main focus of new formulations of the food products usually depends on the consumer interest toward healthier foods (Khalid et al., 2018). In most cases, seaweeds are used in foods for their mineral contents or for the functional properties of their polysaccharides. However, seaweeds are rarely promoted for the nutritional value of their proteins (Pangestuti and Kim, 2015). Edible seaweeds are a promising source of antioxidants, dietary fibers, essential amino acids, vitamins, phytochemicals, polyunsaturated fatty acids, and minerals. Several research studies have evaluated the gelling, thickening, and therapeutic properties of various species of the seaweeds when they are used individually (Roohinejad et al., 2017). Food products enriched with seaweeds and seaweed extracts may have improved nutritional, textural, sensorial, and health promoting properties. Various seaweeds have been incorporated in various food products such as meat, fish, bakery, and other food products (J onsd ottir et al., 2016; Moreno et al., 2016; Rioux et al., 2017). Moreover, foods enriched with seaweeds and seaweed extracts showed positive effects on the different lifestyle diseases such as obesity, hypertension, dyslipidemia, and diabetes. The results of various studies demonstrated that the addition of seaweeds (either in powder or extract form) can significantly improve the nutritional and textural properties of food products (Senthil et al., 2011). Moreover, the addition of seaweeds also affected the properties of food products such as color etc. (Jonsdottir et al., 2016; Rioux et al., 2017). As well as, low-fat products with less calories and less saturated fatty acids can be prepared using seaweeds. The results of several research studies demonstrated that the health value, shelflife, and overall quality of foods can be improved through the addition of either seaweeds or seaweed extracts (Rioux et al., 2017).

Aquatic plants as a natural source of antimicrobial and functional ingredients

109

The effects of dietary supplementation with seaweed extracts, vitamin E, and galacto-oligosaccharides in porcine diets for 5 weeks have been studied on the color, microbiology, lipid peroxidation, and antioxidant status of the meat. Compared to basal diet, dietary supplementation with seaweed extracts and galactooligosaccharides exhibited lower bacterial count throughout the storage period. These results demonstrate the potential for the incorporation of seaweed extracts into muscle foods (Rajauria et al., 2016).

11.

Conclusion

Seaweeds are the promising and good reservoir of bioactive molecules and compounds with numerous potential biological and biomedical activities. They are good source of natural antioxidants, antimicrobials, and hydrocolloids molecules. Incorporation of seaweeds and their derivates into the food systems can improve the shelflife, nutritional, textural, organoleptic, sensory, and also improve the health promoting activities of final products. However, there is a need to optimize the amount of seaweed in the formulation of desired food products composition. Usually, seaweeds are enriched with remarkably amount of polymers such as sulfated polysaccharides, and fucoidan. However, the proteins present in the seaweed need to be explored to release their bioactive peptides from the parental sequences. Computational-derived approaches can be used to explore the seaweed as a source of various bioactive peptides that may have various applications in the food, pharma, and other biotechnological sectors. Seaweeds are also considered as a potential source of food ingredients especially in the Asian countries, and further studies need to be conducted on the functional characteristics of seaweeds and its utilization for various food and pharmaceutical applications.

References Agirbasli, Z., Cavas, L., 2017. In silico evaluation of bioactive peptides from the green algae Caulerpa. Journal of Applied Phycology 29 (3), 1635e1646. Adalbj€ornsson, B.V., Jonsdottir, R., 2015. Enzyme-enhanced extraction of antioxidant ingredients from algae. In: Natural Products from Marine Algae. Springer, pp. 145e150. Adeneye, A.A., Adeyemi, O.O., Agbaje, E.O., 2010. Anti-obesity and antihyperlipidaemic effect of Hunteria umbellata seed extract in experimental hyperlipidaemia. Journal of Ethnopharmacology 130 (2), 307e314. Admassu, H., Gasmalla, M.A.A., Yang, R., Zhao, W., 2018. Bioactive peptides derived from seaweed protein and their health benefits: Antihypertensive, antioxidant, and antidiabetic properties. Journal of Food Science 83 (1), 6e16. Agyei, D., Danquah, M.K., 2011. Industrial-scale manufacturing of pharmaceutical-grade bioactive peptides. Biotechnology Advances 29 (3), 272e277. Agyei, D., Tsopmo, A., Udenigwe, C.C., 2018. Bioinformatics and peptidomics approaches to the discovery and analysis of food-derived bioactive peptides. Analytical and Bioanalytical Chemistry 410 (15), 3463e3472. https://doi.org/10.1007/s00216-018-0974-1.

110

Functional and Preservative Properties of Phytochemicals

Airanthi, M.W.-A., Hosokawa, M., Miyashita, K., 2011. Comparative antioxidant activity of edible Japanese brown seaweeds. Journal of Food Science 76 (1), C104eC111. Alghazwi, M., Kan, Y.Q., Zhang, W., Gai, W.P., Garson, M.J., Smid, S., 2016. Neuroprotective activities of natural products from marine macroalgae during 1999e2015. Journal of Applied Phycology 28 (6), 3599e3616. https://doi.org/10.1007/s10811-016-0908-2. Alghazwi, M., Smid, S., Karpiniec, S., Zhang, W., 2019. Comparative study on neuroprotective activities of fucoidans from Fucus vesiculosus and Undaria pinnatifida. International Journal of Biological Macromolecules 122, 255e264. https://doi.org/10.1016/ j.ijbiomac.2018.10.168. Altschul, S.F., Madden, T.L., Sch€affer, A.A., Zhang, J., Zhang, Z., Miller, W., Lipman, D.J., 1997. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Research 25 (17), 3389e3402. Altschul, S.F., Wootton, J.C., Gertz, E.M., Agarwala, R., Morgulis, A., Sch€affer, A.A., Yu, Y.K., 2005. Protein database searches using compositionally adjusted substitution matrices. FEBS Journal 272 (20), 5101e5109. https://doi.org/10.1111/j.1742-4658.2005.04945.x. Anal, A.K., Noomhorm, A., Vongsawasdi, P., 2013. Protein hydrolysates and bioactive peptides from seafood and Crustacean waste: their extraction, bioactive properties and industrial perspectives. In: Marine Proteins and Peptides: Biological Activities and Applications, pp. 709e735. Arata, P.X., Quintana, I., Canelon, D.J., Vera, B.E., Compagnone, R.S., Ciancia, M., 2015. Chemical structure and anticoagulant activity of highly pyruvylated sulfated galactans from tropical green seaweeds of the order Bryopsidales. Carbohydrate Polymers 122, 376e386. Arya, K., Gupta, R., Verma, H., Pal, G.K., Saxena, V.L., 2019. Drug designing to combat MDR bacteria using potential bioactive compounds from medicinal plant. Trends in Bioinformatics 12 (1), 7e19. Bach, S.J., Wang, Y., McAllister, T.A., 2008. Effect of feeding sun-dried seaweed (Ascophyllum nodosum) on fecal shedding of Escherichia coli O157: H7 by feedlot cattle and on growth performance of lambs. Animal Feed Science and Technology 142 (1e2), 17e32. Bansemir, A., Blume, M., Schr€oder, S., Lindequist, U., 2006. Screening of cultivated seaweeds for antibacterial activity against fish pathogenic bacteria. Aquaculture 252 (1), 79e84. Bast, F., 2013. Agronomy and cultivation methods for edible seaweeds. International Journal of Agriculture and Food Science Technology 4 (7), 661e666. Bast, F., 2014. Ancestors of Land Plants with Rich Diversity. Resonance 19 (2), 1032e1043. https://doi.org/10.1007/s12045-014-0018-x.  2016. Evaluation of the in vitro biological activity of Beaulieu, L., Sirois, M., Tamigneaux, E., protein hydrolysates of the edible red alga, Palmaria palmata (dulse) harvested from the Gaspe coast and cultivated in tanks. Journal of Applied Phycology 28 (5), 3101e3115. Bhandari, U., Chaudhari, H.S., Bisnoi, A.N., Kumar, V., Khanna, G., Javed, K., 2013. Antiobesity effect of standardized ethanol extract of Embelia ribes in murine model of high fat diet-induced obesity. Pharma Nutrition 1 (2), 50e57. Birch, D., Skallerud, K., Paul, N.A., 2019. Who are the future seaweed consumers in a Western society? Insights from Australia. British Food Journal 121 (2), 603e615. Bleakley, S., Hayes, M., O’Shea, N., Gallagher, E., Lafarga, T., 2017. Predicted release and analysis of novel ACE-I, renin, and DPP-IV inhibitory peptides from common oat (Avena sativa) protein hydrolysates using in silico analysis. Foods 6 (12), 108. Braden, K.W., Blanton Jr., J.R., Allen, V.G., Pond, K.R., Miller, M.F., 2004. Ascophyllum nodosum supplementation: a preharvest intervention for reducing Escherichia coli O157: H7 and Salmonella spp. in feedlot steers. Journal of Food Protection 67 (9), 1824e1828.

Aquatic plants as a natural source of antimicrobial and functional ingredients

111

Bray, F., Ferlay, J., Soerjomataram, I., Siegel, R.L., Torre, L.A., Jemal, A., 2018. Global cancer statistics 2018: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA: A Cancer Journal for Clinicians 68 (6), 394e424. Carvalhal, F., Cristelo, R.R., Resende, D.I., Pinto, M.M., Sousa, E., Correia-da-Silva, M., 2019. Antithrombotics from the sea: polysaccharides and beyond. Marine Drugs 17 (3), 170. Cermeno, M., Stack, J., Tobin, P., O’Keeffe, M.B., Harnedy, P.A., Stengel, D., FitzGerald, R.J., 2019. Peptide identification from a Porphyra dioica protein hydrolysate with antioxidant, angiotensin converting enzyme and dipeptidyl peptidase IV inhibitory activities. Food and Function 10 (6), 3421e3429. Chandini, S.K., Ganesan, P., Bhaskar, N., 2008. In vitro antioxidant activities of three selected brown seaweeds of India. Food Chemistry 107 (2), 707e713. Chandrasekaran, C.V., Vijayalakshmi, M.A., Prakash, K., Bansal, V.S., Meenakshi, J., Amit, A., 2012. Herbal approach for obesity management. American Journal of Plant Sciences 3 (07), 1003. Chang, Y.-W., Alli, I., 2012. In silico assessment: suggested homology of chickpea (Cicer arietinum L.) legumin and prediction of ACE-inhibitory peptides from chickpea proteins using BLAST and BIOPEP analyses. Food Research International 49 (1), 477e486. Cox, S., Abu-Ghannam, N., Gupta, S., 2010. An Assessment of the Antioxidant and Antimicrobial Activity of Six Species of Edible Irish Seaweeds. International Food Research Journal 17, 205e220. https://doi.org/10.21427/D7HC92. Craigie, J.S., 2011. Seaweed extract stimuli in plant science and agriculture. Journal of Applied Phycology 23 (3), 371e393. Daud, N., Ghassem, M., Fern, S.S., Babji, A.S., 2016. Functional bioactive compounds from freshwater fish, edible birdnest, marine seaweed and phytochemical. American Journal of Food and Nutrition 6 (2), 33e38. Devi, K.P., Suganthy, N., Kesika, P., Pandian, S.K., 2008. Bioprotective properties of seaweeds: in vitro evaluation of antioxidant activity and antimicrobial activity against food borne bacteria in relation to polyphenolic content. BMC Complementary and Alternative Medicine 8 (1), 38. Dimitrov, I., Bangov, I., Flower, D.R., Doytchinova, I., 2014. AllerTOP v. 2da server for in silico prediction of allergens. Journal of Molecular Modeling 20 (6), 1e6. Eom, S.-H., Kim, Y.-M., Kim, S.-K., 2012. Antimicrobial effect of phlorotannins from marine brown algae. Food and Chemical Toxicology 50 (9), 3251e3255. Farvin, K.H.S., Surendraraj, A., Al-Ghunaim, A., Al-Yamani, F., 2019. Chemical profile and antioxidant activities of 26 selected species of seaweeds from Kuwait coast. Journal of Applied Phycology 31 (4), 2653e2668. https://doi.org/10.1007/s10811-019-1739-8. Fleurence, J., Morançais, M., Dumay, J., Decottignies, P., Turpin, V., Munier, M., et al., 2012. What are the prospects for using seaweed in human nutrition and for marine animals raised through aquaculture? Trends in Food Science and Technology 27 (1), 57e61. Gallego, M., Mora, L., Hayes, M., Reig, M., Toldra, F., 2019. Peptides with potential cardioprotective effects derived from dry-cured ham byproducts. Journal of Agricultural and Food Chemistry 67 (4), 1115e1126. Ganesan, P., Kumar, C.S., Bhaskar, N., 2008. Antioxidant properties of methanol extract and its solvent fractions obtained from selected Indian red seaweeds. Bioresource Technology 99 (8), 2717e2723. Gardiner, G.E., Campbell, A.J., O’Doherty, J.V., Pierce, E., Lynch, P.B., Leonard, F.C., et al., 2008. Effect of Ascophyllum nodosum extract on growth performance, digestibility, carcass characteristics and selected intestinal microflora populations of growerefinisher pigs. Animal Feed Science and Technology 141 (3e4), 259e273.

112

Functional and Preservative Properties of Phytochemicals

Glazer, A.N., 1994. Phycobiliproteinsda family of valuable, widely used fluorophores. Journal of Applied Phycology 6 (2), 105e112. Gupta, S., Abu-Ghannam, N., 2011. Recent developments in the application of seaweeds or seaweed extracts as a means for enhancing the safety and quality attributes of foods. Innovative Food Science and Emerging Technologies 12 (4), 600e609. Gupta, S., Rajauria, G., Abu-Ghannam, N., 2010. Study of the microbial diversity and antimicrobial properties of Irish edible brown seaweeds. International Journal of Food Science and Technology 45 (3), 482e489. Gupta, S., Kapoor, P., Chaudhary, K., Gautam, A., Kumar, R., Consortium, O.S.D.D., Raghava, G.P.S., 2013. In Silico approach for predicting toxicity of peptides and proteins. PLoS One 8 (9), e73957. https://doi.org/10.1371/journal.pone.0073957. Gutiérrez-Rodríguez, A.G., Juarez-Portilla, C., Olivares-Ba~ nuelos, T., Zepeda, R.C., 2018. Anticancer activity of seaweeds. Drug Discovery Today 23 (2), 434e447. https://doi.org/ 10.1016/j.drudis.2017.10.019. Harnedy, P.A., FitzGerald, R.J., 2011. Bioactive proteins, peptides, and amino acids from macroalgae 1. Journal of Phycology 47 (2), 218e232. Harnedy, P.A., FitzGerald, R.J., 2012. Bioactive peptides from marine processing waste and shellfish: a review. Journal of Functional Foods 4 (1), 6e24. Harnedy, P.A., FitzGerald, R.J., 2013. Extraction of protein from the macroalga Palmaria palmata. LWT-Food Science and Technology 51 (1), 375e382. Hasan, M., Imran, M.A.S., Bhuiyan, F.R., Ahmed, S.R., Shanzana, P., Moli, M.A., et al., 2019. Phytochemical constituency profiling and antimicrobial activity screening of seaweeds extracts collected from the bay of bengal sea coasts. BioRxiv. https://doi.org/10.1101/ 680348. Hayes, M., 2015. Seaweeds: a nutraceutical and health food. In: Seaweed Sustainability. Elsevier, pp. 365e387. Hayes, M., García-García, M., Fitzgerald, C., Lafarga, T., 2015. Seaweed and milk derived bioactive peptides and small molecules in functional foods and cosmeceuticals. In: Gupta, V.K., Tuohy, M.G. (Eds.), Biotechnology of Bioactive Compounds: Sources and Applications. Chichester: John Wiley and Sons, Ltd., pp. 669e691 Heo, S.-J., Park, E.-J., Lee, K.-W., Jeon, Y.-J., 2005. Antioxidant activities of enzymatic extracts from brown seaweeds. Bioresource Technology 96 (14), 1613e1623. Huang, B.-B., Lin, H.-C., Chang, Y.-W., 2015. Analysis of proteins and potential bioactive peptides from tilapia (Oreochromis spp.) processing co-products using proteomic techniques coupled with BIOPEP database. Journal of Functional Foods 19, 629e640. Iwaniak, A., Minkiewicz, P., Darewicz, M., Sieniawski, K., Starowicz, P., 2016. BIOPEP database of sensory peptides and amino acids. Food Research International 85, 155e161. Jiménez-Escrig, A., Gomez-Ordo~nez, E., Rupérez, P., 2011. Seaweed as a source of novel nutraceuticals: sulfated polysaccharides and peptides. In: Advances in Food and Nutrition Research, vol. 64. Elsevier, pp. 325e337. Jin, W., Wang, J., Jiang, H., Song, N., Zhang, W., Zhang, Q., 2013. The neuroprotective activities of heteropolysaccharides extracted from Saccharina japonica. Carbohydrate Polymers 97 (1), 116e120. https://doi.org/10.1016/j.carbpol.2013.04.055. J onsdottir, R., Geirsdottir, M., Hamaguchi, P.Y., Jamnik, P., Kristinsson, H.G., Undeland, I., 2016. The ability of in vitro antioxidant assays to predict the efficiency of a cod protein hydrolysate and brown seaweed extract to prevent oxidation in marine food model systems. Journal of the Science of Food and Agriculture 96 (6), 2125e2135.

Aquatic plants as a natural source of antimicrobial and functional ingredients

113

Kajiwara, T., Matsui, K., Akakabe, Y., Murakawa, T., Arai, C., 2006. Antimicrobial browninginhibitory effect of flavor compounds in seaweeds. Journal of Applied Phycology 18 (3e5), 413e422. Kang, M.-C., Kang, N., Ko, S.-C., Kim, Y.-B., Jeon, Y.-J., 2016. Anti-obesity effects of seaweeds of Jeju Island on the differentiation of 3T3-L1 preadipocytes and obese mice fed a high-fat diet. Food and Chemical Toxicology 90, 36e44. Kang, H.K., Lee, H.H., Seo, C.H., Park, Y., 2019. Antimicrobial and immunomodulatory properties and applications of marine-derived proteins and peptides. Marine Drugs 17 (6), 350. Kannan, G., Lee, J.H., Kouakou, B., Terrill, T.H., 2019. Reduction of microbial contamination in meat goats using dietary brown seaweed (Ascophyllum nodosum) supplementation and chlorinated wash. Canadian Journal of Animal Science 99 (3), 570e577. https://doi.org/ 10.1139/cjas-2018-0156. Khalid, S., Abbas, M., Saeed, F., Bader-Ul-Ain, H., Suleria, H.A.R., 2018. Therapeutic potential of seaweed bioactive compounds. In: Seaweed Biomaterials. IntechOpen. Kim, S.-K., Wijesekara, I., 2010. Development and biological activities of marine-derived bioactive peptides: a review. Journal of Functional Foods 2 (1), 1e9. Kim, J.-K., Cho, M.L., Karnjanapratum, S., Shin, I.-S., You, S.G., 2011. In vitro and in vivo immunomodulatory activity of sulfated polysaccharides from Enteromorpha prolifera. International Journal of Biological Macromolecules 49 (5), 1051e1058. https://doi.org/ 10.1016/j.ijbiomac.2011.08.032. Kim, S.-K., Pangestuti, R., Rahmadi, P., 2011. Sea lettuces: culinary uses and nutritional value. In: Advances in Food and Nutrition Research, vol. 64. Elsevier, pp. 57e70. Korhonen, H., Pihlanto, A., 2006. Bioactive peptides: production and functionality. International Dairy Journal 16 (9), 945e960. Kumagai, Y., Miyabe, Y., Takeda, T., Adachi, K., Yasui, H., Kishimura, H., 2019. In Silico analysis of relationship between proteins from plastid genome of red alga Palmaria sp. (Japan) and Angiotensin I converting enzyme inhibitory peptides. Marine Drugs 17 (3), 190. Kumar, B., Rani, S., 2017. Technical note on the isolation and characterization of collagen from fish waste material. Journal of Food Science and Technology 54 (1), 276e278. Lafarga, T., Hayes, M., 2014. Bioactive peptides from meat muscle and by-products: generation, functionality and application as functional ingredients. Meat Science 98 (2), 227e239. Lafarga, T., O’Connor, P., Hayes, M., 2014. Identification of novel dipeptidyl peptidase-IV and angiotensin-I-converting enzyme inhibitory peptides from meat proteins using in silico analysis. Peptides 59, 53e62. Lee, M., Lee, H.H., Lee, J.-K., Ye, S.-K., Kim, S.H., Sung, S.H., 2013. Anti-adipogenic activity of compounds isolated from Idesia polycarpa on 3T3-L1 cells. Bioorganic and Medicinal Chemistry Letters 23 (11), 3170e3174. Li, N., Liu, X., He, X., Wang, S., Cao, S., Xia, Z., et al., 2017. Structure and anticoagulant property of a sulfated polysaccharide isolated from the green seaweed Monostroma angicava. Carbohydrate Polymers 159, 195e206. https://doi.org/10.1016/ j.carbpol.2016.12.013. Liu, H., Wang, J., Zhang, Q., Zhang, H., 2018. The effect of different substitute groups and molecular weights of fucoidan on neuroprotective and anticomplement activity. International Journal of Biological Macromolecules 113, 82e89. https://doi.org/10.1016/ j.ijbiomac.2018.02.109.

114

Functional and Preservative Properties of Phytochemicals

Liu, X., Wang, S., Cao, S., He, X., Qin, L., He, M., et al., 2018. Structural characteristics and anticoagulant property in vitro and in vivo of a seaweed sulfated rhamnan. Marine Drugs 16 (7), 243. https://doi.org/10.3390/md16070243. L opez-Barrios, L., Gutiérrez-Uribe, J.A., Serna-Saldívar, S.O., 2014. Bioactive peptides and hydrolysates from pulses and their potential use as functional ingredients. Journal of Food Science 79 (3), R273eR283. Lynch, M.B., Sweeney, T., Callan, J.J., O’Sullivan, J.T., O’Doherty, J.V., 2010. The effect of dietary Laminaria-derived laminarin and fucoidan on nutrient digestibility, nitrogen utilisation, intestinal microflora and volatile fatty acid concentration in pigs. Journal of the Science of Food and Agriculture 90 (3), 430e437. Maeda, H., Hosokawa, M., Sashima, T., Funayama, K., Miyashita, K., 2005. Fucoxanthin from edible seaweed, Undaria pinnatifida, shows antiobesity effect through UCP1 expression in white adipose tissues. Biochemical and Biophysical Research Communications 332 (2), 392e397. Maeda, H., Hosokawa, M., Sashima, T., Murakami-Funayama, K., Miyashita, K., 2009. Antiobesity and anti-diabetic effects of fucoxanthin on diet-induced obesity conditions in a murine model. Molecular Medicine Reports 2 (6), 897e902. Magalhaes, K.D., Costa, L.S., Fidelis, G.P., Oliveira, R.M., Nobre, L.T.D.B., Dantas-Santos, N., et al., 2011. Anticoagulant, antioxidant and antitumor activities of heterofucans from the seaweed Dictyopteris delicatula. International Journal of Molecular Sciences 12 (5), 3352e3365. Makkar, H.P., Tran, G., Heuzé, V., Giger-Reverdin, S., Lessire, M., Lebas, F., Ankers, P., 2016. Seaweeds for livestock diets: a review. Animal Feed Science and Technology 212, 1e17. Marinho, G.S., Sørensen, A.-D.M., Safafar, H., Pedersen, A.H., Holdt, S.L., 2019. Antioxidant content and activity of the seaweed Saccharina latissima: a seasonal perspective. Journal of Applied Phycology 31 (2), 1343e1354. https://doi.org/10.1007/s10811-018-1650-8. Matanjun, P., Mohamed, S., Mustapha, N.M., Muhammad, K., Ming, C.H., 2008. Antioxidant activities and phenolics content of eight species of seaweeds from North Borneo. Journal of Applied Phycology 20 (4), 367. Minkiewicz, P., Dziuba, J., Iwaniak, A., Dziuba, M., Darewicz, M., 2008. BIOPEP database and other programs for processing bioactive peptide sequences. Journal of AOAC International 91 (4), 965e980. Minkiewicz, P., Dziuba, J., Michalska, J., 2011. Bovine meat proteins as potential precursors of biologically active peptidesda computational study based on the BIOPEP database. Food Science and Technology International 17 (1), 39e45. https://doi.org/10.1177/ 1082013210368461. Miyashita, K., Nishikawa, S., Beppu, F., Tsukui, T., Abe, M., Hosokawa, M., 2011. The allenic carotenoid fucoxanthin, a novel marine nutraceutical from brown seaweeds. Journal of the Science of Food and Agriculture 91 (7), 1166e1174. Mohan, A., Rajendran, S.R., He, Q.S., Bazinet, L., Udenigwe, C.C., 2015. Encapsulation of food protein hydrolysates and peptides: a review. RSC Advances 5 (97), 79270e79278. Mooney, C., Haslam, N.J., Pollastri, G., Shields, D.C., 2012. Towards the improved discovery and design of functional peptides: common features of diverse classes permit generalized prediction of bioactivity. PLoS One 7 (10), e45012. https://doi.org/10.1371/ journal.pone.0045012. Mooney, C., Haslam, N.J., Holton, T.A., Pollastri, G., Shields, D.C., 2013. PeptideLocator: prediction of bioactive peptides in protein sequences. Bioinformatics 29 (9), 1120e1126. https://doi.org/10.1093/bioinformatics/btt103.

Aquatic plants as a natural source of antimicrobial and functional ingredients

115

Moreno, H.M., Herranz, B., Pérez-Mateos, M., Sanchez-Alonso, I., Borderías, J.A., 2016. New alternatives in seafood restructured products. Critical Reviews in Food Science and Nutrition 56 (2), 237e248. Morgen, C.S., Sørensen, T.I., 2014. Obesity: global trends in the prevalence of overweight and obesity. Nature Reviews Endocrinology 10 (9), 513. Moubayed, N.M., Al Houri, H.J., Al Khulaifi, M.M., Al Farraj, D.A., 2017. Antimicrobial, antioxidant properties and chemical composition of seaweeds collected from Saudi Arabia (Red Sea and Arabian Gulf). Saudi Journal of Biological Sciences 24 (1), 162e169. Oh, J.-H., Kim, J., Lee, Y., 2016. Anti-inflammatory and anti-diabetic effects of brown seaweeds in high-fat diet-induced obese mice. Nutrition Research and Practice 10 (1), 42e48. Okolie, C.L., Mason, B., Critchley, A.T., 2018. Seaweeds as a source of proteins for use in pharmaceuticals and high-value applications. In: Novel Proteins for Food, Pharmaceuticals, and Agriculture: Sources, Applications, and Advances, 217. Pal, G.K., Suresh, P.V., 2016. Microbial collagenases: challenges and prospects in production and potential applications in food and nutrition. RSC Advances 6 (40), 33763e33780. Pal, G.K., Suresh, P.V., 2016. Sustainable valorisation of seafood by-products: recovery of collagen and development of collagen-based novel functional food ingredients. Innovative Food Science and Emerging Technologies 37 (Part B), 201e215. https://doi.org/10.1016/ j.ifset.2016.03.015. Pal, G.K., Suresh, P.V., 2017a. Comparative assessment of physico-chemical characteristics and fibril formation capacity of thermostable carp scales collagen. Materials Science and Engineering: C 70, 32e40. Pal, G.K., Suresh, P.V., 2017b. Physico-chemical characteristics and fibril-forming capacity of carp swim bladder collagens and exploration of their potential bioactive peptides by in silico approaches. International Journal of Biological Macromolecules 101, 304e313. Palanisamy, S., Vinosha, M., Marudhupandi, T., Rajasekar, P., Prabhu, N.M., 2017. Isolation of fucoidan from Sargassum polycystum brown algae: structural characterization, in vitro antioxidant and anticancer activity. International Journal of Biological Macromolecules 102, 405e412. Pangestuti, R., Kim, S.-K., 2011. Biological activities and health benefit effects of natural pigments derived from marine algae. Journal of Functional Foods 3 (4), 255e266. Pangestuti, R., Kim, S.-K., 2015. Seaweed proteins, peptides, and amino acids. In: Seaweed Sustainability. Elsevier, pp. 125e140. Patra, J.K., Rath, S.K., Jena, K., Rathod, V.K., Thatoi, H., 2008. Evaluation of antioxidant and antimicrobial activity of seaweed (Sargassum sp.) extract: a study on inhibition of Glutathione-S-Transferase activity. Turkish Journal of Biology 32 (2), 119e125. Peng, Y., Hu, J., Yang, B., Lin, X.-P., Zhou, X.-F., Yang, X.-W., Liu, Y., 2015. Chemical composition of seaweeds. In: Seaweed Sustainability. Elsevier, pp. 79e124. Pérez, M.J., Falqué, E., Domínguez, H., 2016. Antimicrobial action of compounds from marine seaweed. Marine Drugs 14 (3), 52. Pérez-Larran, P., Balboa, E.M., Torres, M.D., Domínguez, H., 2019. Antioxidant and antitumoral properties of aqueous fractions from frozen Sargassum muticum. Waste and Biomass Valorization 1e9. Pérez-Recalde, M., Matulewicz, M.C., Pujol, C.A., Carlucci, M.J., 2014. In vitro and in vivo immunomodulatory activity of sulfated polysaccharides from red seaweed Nemalion helminthoides. International Journal of Biological Macromolecules 63, 38e42. https://doi.org/ 10.1016/j.ijbiomac.2013.10.024.

116

Functional and Preservative Properties of Phytochemicals

Pooja, K., Rani, S., 2017. Physico-chemical, sensory and toxicity characteristics of dipeptidyl peptidase-IV inhibitory peptides from rice bran-derived globulin using computational approaches. International Journal of Peptide Research and Therapeutics 23 (4), 519e529. Pooja, K., Rani, S., Prakash, B., 2017. In silico approaches towards exploration of rice bran proteins derived angiotensin-I-converting enzyme inhibitory peptides. International Journal of Food Properties 20, 2178e2191. https://doi.org/10.1080/10942912.2017.1368552. Pripp, A.H., Isaksson, T., Stepaniak, L., Sørhaug, T., Ard€ o, Y., 2005. Quantitative structure activity relationship modelling of peptides and proteins as a tool in food science. Trends in Food Science and Technology 16 (11), 484e494. Rajauria, G., Jaiswal, A.K., Abu-Gannam, N., Gupta, S., 2013. Antimicrobial, antioxidant and free radical-scavenging capacity of brown seaweed Himanthalia elongata from western coast of Ireland. Journal of Food Biochemistry 37 (3), 322e335. Rajauria, G., Draper, J., McDonnell, M., O’Doherty, J.V., 2016. Effect of dietary seaweed extracts, galactooligosaccharide and vitamin E supplementation on meat quality parameters in finisher pigs. Innovative Food Science and Emerging Technologies 37, 269e275. Rani, S., Pooja, K., 2018. Elucidation of structural and functional characteristics of collagenase from Pseudomonas aeruginosa. Process Biochemistry 64, 116e123. https://doi.org/ 10.1016/j.procbio.2017.09.029. Rani, S., Pooja, K., Kumar, G., 2017. Exploration of potential angiotensin converting enzyme inhibitory peptides generated from enzymatic hydrolysis of goat milk proteins. Biocatalysis and Agricultural Biotechnology 11, 83e88. https://doi.org/10.1016/j.bcab.2017.06.008. Rani, S., Pooja, K., Pal, G.K., 2018. Exploration of rice protein hydrolysates and peptides with special reference to antioxidant potential: computational derived approaches for bioactivity determination. Trends in Food Science and Technology 80, 61e70. Rao, P.S., Parekh, K.S., 1981. Antibacterial activity of Indian seaweed extracts. In: Botanica Marina, vol. 24 (11), pp. 577e582. Reichelt, J.L., Borowitzka, M.A., 1984. Antimicrobial activity from marine algae: results of a large-scale screening programme. In: Eleventh International Seaweed Symposium. Springer, pp. 158e168. Rioux, L.-E., Beaulieu, L., Turgeon, S.L., 2017. Seaweeds: a traditional ingredients for new gastronomic sensation. Food Hydrocolloids 68, 255e265. Roohinejad, S., Koubaa, M., Barba, F.J., Saljoughian, S., Amid, M., Greiner, R., 2017. Application of seaweeds to develop new food products with enhanced shelf-life, quality and health-related beneficial properties. Food Research International 99, 1066e1083. Rossi, C.C., Aguilar, A.P., Diaz, M.A.N., Ribon, A., 2011. Aquatic plants as potential sources of antimicrobial compounds active against bovine mastitis pathogens. African Journal of Biotechnology 10 (41), 8023e8030. Samarakoon, K., Jeon, Y.-J., 2012. Bio-functionalities of proteins derived from marine algaeda review. Food Research International 48 (2), 948e960. Samaranayaka, A.G., Li-Chan, E.C., 2011. Food-derived peptidic antioxidants: a review of their production, assessment, and potential applications. Journal of Functional Foods 3 (4), 229e254. Sathya, R., Kanaga, N., Sankar, P., Jeeva, S., 2017. Antioxidant properties of phlorotannins from brown seaweed Cystoseira trinodis (Forsskal) C. Agardh. Arabian Journal of Chemistry 10, S2608eS2614. Sekar, S., Chandramohan, M., 2008. Phycobiliproteins as a commodity: trends in applied research, patents and commercialization. Journal of Applied Phycology 20 (2), 113e136.

Aquatic plants as a natural source of antimicrobial and functional ingredients

117

Senthil, A., Mamatha, B.S., Vishwanath, P., Bhat, K.K., Ravishankar, G.A., 2011. Studies on development and storage stability of instant spice adjunct mix from seaweed (Eucheuma). Journal of Food Science and Technology 48 (6), 712e717. Shanmughapriya, S., Manilal, A., Sujith, S., Selvin, J., Kiran, G.S., Natarajaseenivasan, K., 2008. Antimicrobial activity of seaweeds extracts against multiresistant pathogens. Annals of Microbiology 58 (3), 535e541. Sila, A., Bougatef, A., 2016. Antioxidant peptides from marine by-products: isolation, identification and application in food systems. A review. Journal of Functional Foods 21, 10e26. Silva, J., Alves, C., Freitas, R., Martins, A., Pinteus, S., Ribeiro, J., et al., 2019. Antioxidant and neuroprotective potential of the Brown seaweed Bifurcaria bifurcata in an in vitro Parkinson’s disease model. Marine Drugs 17 (2), 85. https://doi.org/10.3390/md17020085. Suganthy, N., Karutha Pandian, S., Pandima Devi, K., 2010. Neuroprotective effect of seaweeds inhabiting South Indian coastal area (hare Island, Gulf of mannar marine biosphere reserve): cholinesterase inhibitory effect of hypnea valentiae and Ulva reticulata. Neuroscience Letters 468 (3), 216e219. https://doi.org/10.1016/j.neulet.2009.11.001. Synytsya, A., Kim, W.-J., Kim, S.-M., Pohl, R., Synytsya, A., Kvasnicka, F., et al., 2010. Structure and antitumour activity of fucoidan isolated from sporophyll of Korean brown seaweed Undaria pinnatifida. Carbohydrate Polymers 81 (1), 41e48. Talluri, V.P., Kandula, S.K., Saladi, R.V., 2017. Identification of seaweeds from north Visakhapatnam sea coast exhibiting immunomodulatory activity using balb/c models. Regenerative Engineering and Translational Medicine 3 (2), 70e74. https://doi.org/10.1007/ s40883-017-0024-0. Thankaraj, S.R., Sekar, V., Kumaradhass, H.G., Perumal, N., Hudson, A.S., 2019. Exploring the antimicrobial properties of seaweeds against Plasmopara viticola (Berk. And MA Curtis) Berl. And De Toni and Uncinula necator (Schwein) Burrill causing downy mildew and powdery mildew of grapes. Indian Phytopathology 1e17. Udenigwe, C.C., 2014. Bioinformatics approaches, prospects and challenges of food bioactive peptide research. Trends in Food Science and Technology 36 (2), 137e143. Udenigwe, C.C., Aluko, R.E., 2012. Food protein-derived bioactive peptides: production, processing, and potential health benefits. Journal of Food Science 77 (1), R11eR24. Udenigwe, C.C., Gong, M., Wu, S., 2013. In silico analysis of the large and small subunits of cereal RuBisCO as precursors of cryptic bioactive peptides. Process Biochemistry 48 (11), 1794e1799. Val, A., Platas, G., Basilio, A., Cabello, A., Gorrochategui, J., Suay, I., et al., 2001. Screening of antimicrobial activities in red, green and brown macroalgae from Gran Canaria (Canary Islands, Spain). International Microbiology 4 (1), 35e40. Venkatesan, M., Arumugam, V., Pugalendi, R., Ramachandran, K., Sengodan, K., Vijayan, S.R., et al., 2019. Antioxidant, anticoagulant and mosquitocidal properties of water soluble polysaccharides (WSPs) from Indian seaweeds. Process Biochemistry 84, 196e204. https://doi.org/10.1016/j.procbio.2019.05.029. Vishchuk, O.S., Ermakova, S.P., Zvyagintseva, T.N., 2011. Sulfated polysaccharides from brown seaweeds Saccharina japonica and Undaria pinnatifida: isolation, structural characteristics, and antitumor activity. Carbohydrate Research 346 (17), 2769e2776. https:// doi.org/10.1016/j.carres.2011.09.034. Vlachos, V., Critchley, A.T., Von Holy, A., 1997. Antimicrobial activity of extracts from selected southern African marine macroalgae. South African Journal of Science 93 (7), 328e332. Vo, T.-S., Kim, S.-K., 2013. Fucoidans as a natural bioactive ingredient for functional foods. Journal of Functional Foods 5 (1), 16e27.

118

Functional and Preservative Properties of Phytochemicals

 Thorkelsson, G., Wang, T., Jonsdottir, R., Kristinsson, H.G., Hreggvidsson, G.O., J onsson, J.O.,  Olafsdottir, G., 2010. Enzyme-enhanced extraction of antioxidant ingredients from red algae Palmaria palmata. LWT-Food Science and Technology 43 (9), 1387e1393. Wang, L., Park, Y.-J., Jeon, Y.-J., Ryu, B., 2018. Bioactivities of the edible brown seaweed, Undaria pinnatifida: a review. Aquaculture 495, 873e880. Wijesinghe, W., Jeon, Y.-J., 2012. Biological activities and potential industrial applications of fucose rich sulfated polysaccharides and fucoidans isolated from brown seaweeds: a review. Carbohydrate Polymers 88 (1), 13e20. Wijesinghe, W., Jeon, Y.-J., 2012. Enzyme-assistant extraction (EAE) of bioactive components: a useful approach for recovery of industrially important metabolites from seaweeds: a review. Fitoterapia 83 (1), 6e12. Wu, J., Aluko, R.E., Nakai, S., 2006. Structural requirements of angiotensin I-converting enzyme inhibitory peptides: quantitative structure- activity relationship study of di-and tripeptides. Journal of Agricultural and Food Chemistry 54 (3), 732e738. Wu, C.-H., Yang, M.-Y., Chan, K.-C., Chung, P.-J., Ou, T.-T., Wang, C.-J., 2010. Improvement in high-fat diet-induced obesity and body fat accumulation by a Nelumbo nucifera leaf flavonoid-rich extract in mice. Journal of Agricultural and Food Chemistry 58 (11), 7075e7081. Wu, L., Sun, J., Su, X., Yu, Q., Yu, Q., Zhang, P., 2016. A review about the development of fucoidan in antitumor activity: progress and challenges. Carbohydrate Polymers 154, 96e111. https://doi.org/10.1016/j.carbpol.2016.08.005. Wu, R., Chen, L., Liu, D., Huang, J., Zhang, J., Xiao, X., et al., 2017. Preparation of antioxidant peptides from Salmon byproducts with bacterial extracellular proteases. Marine Drugs 15 (1), 4. Yan, Q.-J., Huang, L.-H., Sun, Q., Jiang, Z.-Q., Wu, X., 2015. Isolation, identification and synthesis of four novel antioxidant peptides from rice residue protein hydrolyzed by multiple proteases. Food Chemistry 179, 290e295. Yang, C., Lai, S., Chen, Y., Liu, D., Liu, B., Ai, C., et al., 2019. Anti-diabetic effect of oligosaccharides from seaweed Sargassum confusum via JNK-IRS1/PI3K signalling pathways and regulation of gut microbiota. Food and Chemical Toxicology 110562. Ye, H., Wang, K., Zhou, C., Liu, J., Zeng, X., 2008. Purification, antitumor and antioxidant activities in vitro of polysaccharides from the brown seaweed Sargassum pallidum. Food Chemistry 111 (2), 428e432. https://doi.org/10.1016/j.foodchem.2008.04.012. Zambrowicz, A., Timmer, M., Polanowski, A., Lubec, G., Trziszka, T., 2013. Manufacturing of peptides exhibiting biological activity. Amino Acids 44 (2), 315e320. Zhao, C., Yang, C., Liu, B., Lin, L., Sarker, S.D., Nahar, L., et al., 2018. Bioactive compounds from marine macroalgae and their hypoglycemic benefits. Trends in Food Science and Technology 72, 1e12.

Antimicrobial properties of selected plants used in traditional Chinese medicine

4

Mishri Lal, Sandip Kumar Chandraker, Ravindra Shukla Laboratory of Bio-resource Technology, Department of Botany, Indira Gandhi National Tribal University, Amarkantak, Madhya Pradesh, India

1. Introduction There are various types of microorganisms in nature, which can cause multiple infectious diseases in human beings. The leading cause of morbidity and mortality are still microbial contagious diseases. The microbial illness remains a dominant threat to the world, regardless of efforts and progress in the development of modern medicine (Cos et al., 2006). According to a WHO report, infectious or microbial diseases are responsible for approximately half of the deaths occurring mainly in tropical and developing countries worldwide (Kuete et al., 2011). The effect of microbial diseases is particularly significant in these countries, where there is limited access to modern medications, and costs are mostly unaffordable when the latter are available (Lulekal et al., 2014). The number of multidrug-resistant microbial strains and the appearance of isolates with reduced susceptibility to antibiotics are continuously increasing (Selvamohan et al., 2012). Currently, the increasingly dangerous threat from drugresistant microorganisms invokes a global effort to discover novel solutions, based on natural products obtained from plants (Theuretzbacher, 2012). Many naturally occurring compounds found in medicinal plants were identified with antimicrobial activity that can be used as sources of antimicrobial agents against pathogenic microorganisms without side effects caused by synthetic antimicrobial agents (Teng and Lee, 2014). Therefore, there is a need to search for a new infection-fighting approach to control microbial infections. Herbal medications have been used to treat infectious ailments since the early ages of humanity. The main reason for the dependence on traditional medicines is socioeconomic condition and unavailability of modern medicine. As new infections and microbial resistance are continually emerging, the search for novel medications from herbal formulations to combat microbial infection is always needed. Plants had been utilized empirically long before the concept, and recognizable proof of etiologic infectious agents had been developed. In general, plant products targeted different sites against drug-resistant microbial pathogens other than those used by prevalent antibiotics (Padalia et al., 2017). Many recent studies showed significant agreement between the traditional use of plants in the treatment of infectious diseases and experimental antimicrobial activity in the laboratory (Fabricant and Farnsworth, 2001). Functional and Preservative Properties of Phytochemicals. https://doi.org/10.1016/B978-0-12-818593-3.00004-X Copyright © 2020 Elsevier Inc. All rights reserved.

120

Functional and Preservative Properties of Phytochemicals

Traditional Chinese medicine (TCM) continues to be used today and has deep and rich roots that have been growing for over a 1000 years. In addition to being an alternative treatment process for certain chronic diseases, traditional Chinese medicine is useful in understanding that it offers more personalized remedies than Western medicine and emphasizes the body. It is centered on acupuncture, moxibustion, cupping, and herbal medicine. The treatments in traditional Chinese medicine focus on balance within and between the body and the environment around the body. The traditional Chinese medicines are relatively safer than synthetic alternatives with very few side effects, high effectiveness, offering profound therapeutic benefits, and inexpensive treatment (Padalia et al., 2017).

2.

Character and significant features of Traditional Chinese medicine

The essence of traditional Chinese medication has dependably been the most advanced and experienced in the world. TCM is a system with its very own luxurious customs and a sizable collection of information from more than 3000 years of persistent use and refinement through observation, testing, and critical thinking. In theory and practice, TCM is not quite the same as Western medication, both as far as thinking about how the human body functions and how ailment occurs and should be treated. Its extensive system is full of practical medical technology and proven experiences, which have been gradually included in modern medicine. It has knowledge which can affect the future direction of therapeutic development, yet its philosophy is simple enough to fit changing times and different cultures. TCM is an overall system of health care that uses a variety of treatments and therapies to deal with the disease and to get optimum health for patients. TCM can help manage stress and infectious diseases and enhance understanding of healthy and balanced community life. Traditional Chinese medicinal plants promise an excellent source of natural antimicrobial agents.

3.

Formulations of traditional Chinese medicinal plants

Chinese therapeutic formulations are prepared in various ways; such as herbal decoctions, herbal powders, syrups, etc. Decoctions: The most traditional form of developing a herbal formula in China, the decoction can involve lengthy preparation and result in “tea” it has strong flavor and aroma. Due to these reasons, decoctions are not as popular or as widely used in the West. Powders: Herbal Powder, which can be mixed with hot water to make tea, is easier to prepare and use and is not as sharp as a traditional decoction. Syrups: It is a soothing preparation for cough and sore throat, and also a convenient way of administering herbal formulations for children.

Antimicrobial properties of selected plants used in traditional Chinese medicine

121

4. Antimicrobial properties of some common plants used in traditional Chinese medicine 4.1

Panax ginseng C. A. Mey

The plant, commonly known as “Ginseng” or “Ren-Shen” is utilized in TCM as a tonic and an adaptogen to lessen fatigue and boost the immune system. Ginseng is a perennial adaptogenic herb plant belonging to the genus Panax of the family Araliaceae. As of late, ginseng extracts are shown to have both bacteriostatic and bactericidal activities and seem to exert their effects by several systems, including interruption of biofilms, inhibition of majority detecting and harmfulness factors, and altering motility (Kachur and Suntres, 2016). It has also shown antifungal properties as demonstrated by its ability to inhibit the growth of several mold and yeast species. The extract obtained from the root has potent antiviral activity against the RNA viruses in cell cultures and animal models. The major phytocompounds or bioactive compounds of ginseng are ginsenosides, panaxans, sesquiterpenes, and acetylenic compounds. But ginsenosides are the primary pharmacological components in Ginseng that have various biological functions, including antidiabetic, immunomodulatory, antitumor, antiaging, and anti-inflammatory properties (Peng et al., 2012). Ginsenosides are also one type of saponin, and at least 289 saponins have been reported in different species of Ginseng or Panax species (Yang et al., 2014). According to Jia et al. (2009) and Ru et al. (2015) ginsenosides are dammarane-type, triterpenoid saponin compounds found in most parts of the plant, but are most often extracted from the roots (Fig. 4.1). Ginsenosides inhibit the growth of human pathogenic fungi such as Candida albicans, Saccharomyces cerevisiae, and Trichosporon beigelii (Sung and Lee, 2008). Investigations in the mechanisms of antifungal activity of these ginsenosides revealed

OH O

HO

HO

H

H

H

OH O OH

H O

OH

H

O

HO

OH OH

OH Figure 4.1 Chemical structure of ginsenoside.

122

Functional and Preservative Properties of Phytochemicals

that decreased growth rate of fungi and cell death are due to the ability of ginsenosides to inhibit the cellular membrane of the fungus (Kachur and Suntres, 2016). Pretreatment or coadministration of ginsenosides with antifungal agents may increase the viability of existing antifungal medications by permitting their administration at lower, nontoxic dimensions. Ginsenosides also have good antibacterial activity against Pseudomonas aeruginosa, Listeria monocytogenes, and Helicobacter pylori (Song et al., 1997a,b; Kim et al., 2017). Ginsenosides also are capable of reducing influenza viral infections (Yoo et al., 2012; Park et al., 2014; Song et al., 2014). Recently, Kim et al. (2019) investigated the antimicrobial potential of metabolites extracted from ginseng bacterial endophyte Burkholderia stabilis against ginseng pathogens.

4.2

Ginkgo biloba L.

Ginkgo biloba is an old Chinese gymnosperm tree and commonly known as “Bai Guo.” The plant is the leading surviving member from the Ginkgoaceae family, which appeared 250 million years ago; therefore, it is also called as “living fossil.” Now for a long time, Ginkgo biloba is being used as a herbal medicine not only in China but also in the United States and Europe for various diseases, and the demand for its extracts in many natural products is increasing day by day (Blumenthal, 2002; Mahadevan and Park, 2008). Concentrated and partly purified products made from Ginkgo biloba constituents have been marketed widely under different trade names, for the treatment and management of cognitive deficiencies, other age-related impairments, and many other chronic and acute diseases such as cardiovascular and bronchial pathologies (Fig. 4.2) (Kanowski et al., 1996; Diamond et al., 2000).

O

O O

H O

HO

O

OH

O

O H

(A)

OH OH OH

(B)

(C) Figure 4.2 Chemical structures of (A) Bilobalide, (B) Ginkgolic acid, and (C) Alkylphenol.

Antimicrobial properties of selected plants used in traditional Chinese medicine

123

Ginkgo contains several biologically active compounds such as ginkgolides, bilobalides, flavonol, glycosides, ginkgolic acid, ginkgols, bilobols, and alkylphenols. Many of them show good antimicrobial activity against pathogenic microbes. Ginkgolides and bilobalides are the same type of terpenes which show perfect antiviral and antifungal activity (De Tommasi et al., 1990; Watanabe et al., 1990; Anke and Sterner, 1991). Bombardellii and Ghione (1993) reported bilobalide to be active in vitro against pathological bacterial strains of Trichomas vaginalis, Staphylococcus aureus, Enterococcus faecalis, Escherichia coli, and Lactobacillus spp. A similar investigation was also done by Lee and Kim (2002) with the help of flavonol glycosides against Clostridium perfringens and E. coli. Itokawa et al. (1987) reported weak antimicrobial activity by alkylphenols (bilobol and cardanol) against S. aureus and E. faecalis. In contrast, Choi et al. (2009) reported vigorous exercise of hydroxyalkenyl salicylic acids (ginkgolic acid) as low as 2 mg/mL against vancomycinresistant Enterococcus spp.

4.3

Ephedra sinica stapf

Ephedra sinica belongs to the Ephedraceae family. Ephedra sinica has a long history in traditional Chinese medicine (approximately 5000 years), with uses in the treatment of allergies, nasal congestion, bronchial asthma, coughs, and flu. The drug is known under the name of “Ma-huang” which was traditionally obtained from the dry stems of Ephedra sinica. The plant contains many bioactive components such as alkaloids, i.e., ephedrine, pseudoephedrine (isoephedrine), nor-pseudoephedrine (cathine), nor-ephedrine, methyl ephedrine, methyl pseudoephedrine, tannins, and other constituents, including quinoline and 6-hydroxy kynurenic acid (Friedrich and Wiedemeyer, 1976; Cui et al., 1991; Caveney and Starratt, 1994). The phenolic compounds isolated from Ephedra exhibit substantial antimicrobial activity against Pseudomonas aeruginosa, a gram-negative bacterium, Staphylococcus aureus, a gram-positive bacterium, and Aspergillus niger, a fungus (Khan et al., 2017). From the n-BuOH-soluble fraction of the EtOH extracts from E. sinica, 12 A-type proanthocyanidins are isolated and identified. These compounds are tested by measuring the minimum inhibitory concentrations (MIC) against bacteria (both gram-positive and gram-negative) and fungi, with a concentration range of 0.00515e1.38 mmol/L (Zang et al., 2013) (Fig. 4.3).

NH

OH Figure 4.3 Chemical structure of ephedrine.

124

4.4

Functional and Preservative Properties of Phytochemicals

Artemisia annua L.

Artemisia annua L. is one of the famous traditional Chinese medicines commonly known as “Qing Hao.” It has been used in China for more than 2000 years to treat many disorders. In China, it is traditionally used for the treatment of fever (especially malaria) and hemorrhoids. It is used in the crafting of aromatic wreaths, as a flavoring for spirits such as vermouth, and as a source of essential oils for the perfume industry. A large variety of compounds have been extracted from A. annua such as sesquiterpenoids, flavonoids, coumarins, lipids, phenolics, purines, steroids, triterpenoids, aliphatics, and artemisinin (Kim et al., 2015). Artemisinin is the primary bioactive compound of A. annua. Galal et al. (2005) reported antifungal activity of A. annua (Artemisinin derivatives) against two opportunistic pathogens, Candida albicans, and Cryptococcus neoformans. The antibacterial properties of artemisinin have been tested on a wide range of bacteria, such as E. coli, S. aureus, P. aeruginosa, Mycobacterium intracellulare, Bacillus subtilis, Bacillus thuringiensis, and Salmonella sp. (Sack, 1975; Slade et al., 2009; Appalasamy et al., 2014). Kim et al. (2014) also reported antimicrobial activity of the plant extracts against the periodontopathic microorganisms Aggregatibacter actinomycetemcomitans, Fusobacterium nucleatum subsp. animalis, Fusobacterium nucleatum subsp. polymorphum, and Prevotella intermedia (Fig. 4.4).

4.5

Alpinia officinarum hance

Alpinia officinarum (Gao Liang Jiang) is one of the most popular Chinese herbal medicines, belonging to Zingiberaceae family. It is native to Lingan Range in southern China and is cultivated for food in Guangdong Province. Modern pharmacological studies have indicated A. officinarum to have bioactivities such as antibacterial, antiviral, antitumor, antioxidant, as well as suppressive properties for gastrointestinal bleeding. Diarylheptanoid is the main component of this plant; however, flavonoids and volatile oils (alpha-pinene, cineole, linalool, sesquiterpene, lactones) are the primary bioactive compounds of A. officinarum (Fig. 4.5). Several investigations show the volatile oil of A. officinarum having an excellent antimicrobial activity. Srividya et al. (2010) investigated that the methanolic extracts

O O

H

O O H Figure 4.4 Chemical structure of artemisinin.

H O

Antimicrobial properties of selected plants used in traditional Chinese medicine

O

125

O

HO

OH OCH3

OCH3

Figure 4.5 Chemical structure of diarylheptanoid.

showed moderate to potent antimicrobial activity against Bacillus cereus, S. aureus, P. aeroginosa, and E. coli but no antifungal activity against Aspergillus niger and C. albicans. However, methanolic extract from the rhizome displayed antifungal activity on clotrimazole resistant C. albicans at a MIC value of 2.5 mg/mL (Bonjar, 2004). Hexane, ethanol, and acetone extracts obtained from the rhizome inhibited 50% growth of C. albicans (Liu et al., 2012). Chen et al. (2004) reported antimicrobial activity from the methanolic extracts of A. officinarum against food microorganisms E. coli and S. aureus. In contrast, Zhang et al. (2013) reported that ethanolic extract showed no antifungal activity on C. albicans at a concentration of up to 1 mg/mL. In the same report, 100% growth inhibition was observed against S. aureus. Lakshmanan et al. (2018) suggested that the potential application of plant against bacterial virulence and drug resistance considering the swarming motility property of P. aeruginosa is vital to exerting its effect on host cells. Indrayan et al. (2007) investigated antimicrobial activity against S. aureus, Bacillus subtilis, E. coli, Klebsiella pneumoniae, Salmonella typhi, and the fungus C. albicans from the essential oil of A. officinarum. Honmore et al. (2016) reported that various isomers of diarylheptanoids induced a potent in vitro and in vivo antitubercular effect against a dormant strain of Mycobacterium tuberculosis with IC50 values of 0.34e47.69 mM and 0.13e22.91 mM, respectively, comparable to positive controls rifampicin and isoniazid with lesser effects.

4.6

Angelica sinensis (oliv.) diels

The roots of A. sinensis have a long history of remedy for women’s disorders in traditional Chinese medicine (Hou et al., 2005; Deng et al., 2006; Kuang et al., 2006). Traditionally, it is known as “Dang Gui” or “Female ginseng.” In addition, A. sinensis root is used as a dietary supplement of women’s care in Asia, Europe, and America. A. sinensis in specific formulation is prescribed for women in China as a remedy for menopausal symptoms and improves their health by strengthening body organs and nourishing the blood (Haines et al., 2008). To extract bioactive compounds for medicinal applications or to further purify it for therapeutic synthesis, it is impractical to use the root as a rootstock (Zhao et al., 2018). The active constituents of A. sinensis roots appear to include polysaccharides, organic acids, and phthalides. The main bioactive components of A. sinensis are phthalides, ferulic acid, decursin, n-butylidenephthalide, pyranocoumarins, Z-ligustilide, and coniferyl ferulate (Katoh

126

Functional and Preservative Properties of Phytochemicals

HO

O

OH

O

HO

OH O

O

O

(A)

O

(B) O O

O

O

O

(C)

O

(D)

O

O

(E) Figure 4.6 Chemical structure of (A) Ferulic acid, (B) Coniferyl ferulate, (C) n-Butylidenephthalide, (D) Pyranocoumarins, (E) Z-Ligustilide.

et al., 2011; Jeong et al., 2015; Tan et al., 2015; Wei et al., 2016). Coniferyl ferulate shows antioxidant, antiinflammatory, anti-Alzheimer functionalities, and antibacterial, anticancer effects (Fig. 4.6). Several investigations show good antimicrobial activity of A. sinensis. Antimicrobial property of A. sinensis was reported against two biomonitor strains, Chromobacterium violaceum CV026, and Pseudomonas aeruginosa PAO1. Han and Guo (2012) reported antimicrobial activity of A. sinensis against E. coli, S. aureus, and Shigella sp. (Z)-Ligustilide, which is one of the major components of A. sinensis, showed antiviral properties and antimicrobial activity against gram-positive bacteria, gram-negative bacteria, and yeast (Beck and Stermitz, 1995). A. sinensis oil was also evaluated for antifungal activity against three Colletotrichum sp. (C. acutatum, C. fragariae, and C. gloeosporides), which cause anthracnose disease on strawberry, using directbioautography assay and a strawberry detached leaf assay (Tabanca et al., 2008).

4.7

Arctium lappa L.

Arctium lappa, commonly known as “Niu Bang Zi” in CTM system, is believed to be a healthy and nutritious food in Chinese societies. It is a perennial herb belonging to the Asteraceae family and also known as Burdock. In traditional medicine, the seeds of burdock are crushed to form a mixture that provides relief against measles, arthritis,

Antimicrobial properties of selected plants used in traditional Chinese medicine

127

tonsillitis, throat pain, and common cold. Burdock root can also be used to treat gout, rheumatism, ulcers, acne, eczema, and psoriasis. Chinese also used dried burdock as a diuretic, diaphoretic, and a blood purifying agent. It purifies the blood by removing dangerous toxins. The extract from different parts of A. lappa has long been considered to be good for health because it helps to enhance the body’s immune system and improves metabolic functions (Lin et al., 2002). Tannin, arctigenin, arctiin, beta-eudesmol, caffeic acid, chlorogenic acid, inulin, trachelogenin, sitosterol-beta-D-glucopyranoside, lappaol, and diarctigenin are the main active ingredients isolated from this herb. Antiinflammatory, anticancer, antidiabetic, antimicrobial, antiviral, and other biological activities and pharmacological functions have been reported for A. lappa (Chan et al., 2011) (Fig. 4.7). There are also restrictive effects of chlorogenic acid isolated from the leaves on E. coli, S. aureus, and Micrococcus luteus (Lin et al., 2004). Thikra et al. (2015) evaluated the in vitro antimicrobial activity of crude extract of A. lappa on some grampositive and gram-negative pathogenic bacteria, i.e., P. aeruginosa, S. aureus, Salmonella typhimurium, E.coli, Listeria monocytogene, Streptococcus pyogenes, Brucella abortus, and Bacillus anthracis. Aboutabl et al. (2013) evaluated the antimicrobial activity of volatile constituents from the roots, leaves, and seeds of A. lappa against gram-positive bacteria (Bacillus subtilis), gram-negative bacteria (E. coli), and fungi (Aspergillus niger and C. albicans). Lyophilized extract from A. lappa leaves have been reported to exhibit antimicrobial activity against oral microorganisms and are most effective against endodontic pathogens including Bacillus subtilis, C. albicans, Lactobacillus acidophile, and P. aeruginosa (Pereira et al., 2005). Gentil et al. (2006) observed that A. lappa ethyl acetate fraction was used effectively as an intracanal medication for 5 days in teeth infected with C. albicans, E. coli, L. acidophilus, P. aeruginosa. A. lappa also showed antiviral activity. Strong inhibitory effects on herpes virus (HSV-1, HSV-2) and adenovirus (ADV-3, ADV-11) are present in phenolic constituents, like caffeic acid and chlorogenic acid (Chiang et al., 2002). Arctigenin, one of the lignanoid ingredients, has demonstrated in vivo and in vitro activity against human immunodeficiency virus type-1 (HIV-1) (Schroder et al., 1990; Eich et al., 1996).

O

O

O O

O O HO

O

O O

O OH

HO

O OH

-O

OH

(A)

OH

(B)

OH O

O

(C)

Figure 4.7 Chemical structure of (A) Arctiin, (B) Caffeic acid, (C) Arctigenin.

128

4.8

Functional and Preservative Properties of Phytochemicals

Astragalus membranaceus (fisch.) bunge

Astragalus membranaceus (Huang Qi) root is being used in TCM since long. The root juice of the plant is one of the most popular herbal tonics in China. It is an energy drink especially to make people young and active. It increases stamina and endurance, and improves resistance to the cold. Astragalus was found to have some promising effects in reducing proteinuria and increasing hemoglobin and serum albumin as adjunctive therapy to conventional therapies (Zhong et al., 2013). Polysaccharides, saponins, flavonoids, isoflavonoids, sterols, and astragalosides are the major chemical components of A. membranaceus roots. Two families of cysteine-rich peptides (CRPs), known as a- and b-astratides, identified and characterized by the A. membranaceus roots possess potent antifungal activity (Huang et al., 2019). Astragaloside IV is extracted, isolated, patented, and marketed as a longevity agent under the name TA-65 (Fig. 4.8). Bai et al. (2018) reported the antibacterial activity of the seed extract of A. membranaceus against Bacillus dysenteriae, Staphylococcus aureus, and Escherichia coli. Lai et al. (2018) evaluated the antimicrobial activity of aqueous root extracts of the plant against pathogenic bacteria Alcaligenes faecalis, Aeromonos hydrophila, Bacillus cereus, Salmonella newport, and Shigella sonnei. The methanolic and ethanolic extracts of the plants have reported potential antibacterial activity against diarrheal pathogens E. coli, Salmonella enteritidis, Shigella sp., and Campylobacter (Balachandar et al., 2012). b-astratides possessed potent antifungal activity against four phytopathogenic fungal strains, i.e., Fusarium oxysporum, Alternaria alternata, Rhizoctonia solani, and Curvularia lunata (Huang et al., 2019).

4.9

Chrysanthemum morifolium ramat

Chrysanthemum morifolium, known as “Ju Hua,” in China is a bitter herb used in Chinese medicine for thousands of years. Health benefits of chrysanthemum flowers have been reported as antiinflammatory, antipyretic, sedative, antiarthritic, and antihypertensive (Bensky et al., 2004). Flavonoids, phenolic acids, and lignans are the major phyto-compounds of C. morifolium. OH O HO

O O

OH O

OH

OH OH

OH OH

Figure 4.8 Chemical structure of astragaloside.

O

OH

Antimicrobial properties of selected plants used in traditional Chinese medicine

129

Cui et al. (2018) reported that the plant inhibits growth of gram-positive bacteria (S. aureus, Listeria monocytogenes, Bacillus cereus, and Bacillus subtilis) as well as gram-negative bacteria (E. coli, Salmonella enteritidis, and Salmonella typhimurium). Five bacterial strains (Bacillus cereus, S. aureus, Streptococcus pneumoniae, E. coli, and Shigella flexneri) were investigated for comparative analysis of the antimicrobial activity of C. morifolium extracts (Nowrid, 2017). Yeasmin et al. (2016) evaluated the antibacterial activity of pink, yellow, and white flower extracts of C. morifolium against five gram-positive bacteria, viz. S. aureus, Bacillus cereus, Streptococcus-b-haemolytica, Bacillus subtilis, Sarcina lutea ,and four gramnegative bacteria, viz. Klebsiella pneumonia, P. aeruginosa, Salmonella typhi, and Shigella dysenteriae.

4.10

Lycium chinense mill

Lycium chinense or “Chinese desert thorn” is a well-known traditional Chinese herb which is considered to be an ingredient for eternal youth and long life. A tonic is prepared from the plant that reduces the risk of arteriosclerosis and arterial hypertension (Wang et al., 2009). The fruits of L. Chinense are used in traditional Chinese medicine as a mild Yin tonic, enriching the liver and kidneys, and moistening lungs (Bensky et al., 2004). It is used to treat blurry vision and diminished visuality, infertility, abdominal pain, dry cough, fatigue, and headache. The berries are also used in folk medicine to increase longevity and to prevent premature gray hair (Chen et al., 2004). D-glucopyranoside, flavonols, cinnamic acids, catechins, lyciumlignan D, and lyciumphenyl propanoid A are the major bioactive compounds of L. chinese. Lycium-lignan D and lyciumphenyl propanoid A were isolated from the root bark of L. chinense (Fig. 4.9). Mocan et al. (2014a,b) reported antimicrobial activities of L. chinense extracts against S. aureus, Bacillus subtilis, Listeria monocytogenes, E. coli, and S. typhimurium. D-glucopyranoside, isolated from an ethyl acetate extract of the root bark, exhibited potent antimicrobial activity against antibiotic-resistant bacterial strains, methicillin-resistant Staphylococcus aureus (MRSA), and human pathogenic fungi C. albicans (Lee et al., 2005).

OH O

HO

OH

OH OH

Figure 4.9 Chemical structure of D-glucopyranoside.

130

Functional and Preservative Properties of Phytochemicals

O

O

O

OH

O

(A)

(B)

(C)

(D)

Figure 4.10 Chemical structure of (A) Myristicin, (B) Myristic acid, (C) Alpha-pinene, (D) Beta-pinene.

4.11

Myristica fragrans houtt

Myristica fragrans, popularly known as “‘Rou Dou Kou” or “Nutmeg” belongs to the family Myristicaceae. According to TCM, the most common applications of nutmeg are in preventing diarrhea and gastroenteritis. Nutmeg also helps to reduce symptoms associated with digestive problems, such as nausea and vomiting, and can increase appetite. The major bioactive chemical constituents of M. fragrans are myristicin, myristic acid, elemicin, saffrole, eugenol, palmitic acid, oleic acid, alpha-pinene, betapinene, etc. (Fig. 4.10). Sylvester et al. (2018) reported antimicrobial activity of aqueous seed extract of M. fragrans against E. coli, S. aureus, Bacillus sp., and Streptococcus sp. Nurjanah et al. (2017) investigated the antibacterial activity of M. fragrans essential oil against gram-positive bacteria, viz. S. aureus, Staphylococcus epidermis, and gram-negative bacteria, viz. Shigella dysenteriae and Salmonella typhi. Ethanolic and methanolic extracts of M. fragrans were investigated for antibacterial activity against five foodborne pathogens P. aeruginosa, S. aureus, E. coli, Salmonella typhi, and Vibrio sp. (Anibijuwon et al., 2013). M. fragrans was also evaluated for its bactericidal potential against three gram-positive cariogenic bacteria (Streptococcus mutans ATCC 25,175, Streptococcus mitis ATCC 6249, and Streptococcus salivarius ATCC 13,419), and three gram-negative periodontopathic bacteria (Aggregatibacter actinomycetemcomitans ATCC 29522, Porphyromonas gingivalis ATCC 33277, and Fusobacterium nucleatum ATCC 25586) (Shafiei et al., 2012). Narasimhan and Dhake (2006) reported antimicrobial activity of ethanolic extract of M. fragrans seeds against enterohemorrhagic E. coli O157. Some important antimicrobial compounds in M. fragrans seeds like alpha-pinene, beta-pinene, p-cymene, carvacrol, and b-caryophyllene were found effective against Acinetobacter calcoaceticus, Alcaligenes faecalis, Bacillus subtilis, Beneckea natriegens, Brevibacterium linens, Brocothrix thermosphacta, Citrobacter freundii, Enterobacter aerogenes, Erwinia carotovora, E. coli, Flavobacterium suaveolens, Klebsiella pneumoniae, Lactobacillus plantarum, Micrococcus luteus, Moraxella sp., Proteus vulgaris, Salmonella pullorum, Serratia marcescens, S. aureus, and Yersinia enterocolitica (Dorman and Deans, 2004).

4.12

Paeonia lactiflora pall

Paeonia lactiflora is regarded primarily as a women’s herb and mostly used by Chinese women as tonic. The plant is commonly known as “Bai Shao Yao.”

Antimicrobial properties of selected plants used in traditional Chinese medicine HO OH HO

HO HO

O O

HO HO

HO

HO

O O (A)

O O O O

HO HO

OH

O

O O

OH

(B)

131

O

O

HO

OH OH

•HC O

(C)

Figure 4.11 chemical structure of (A) Paeonol, (B) 1,2,3,4,6-Pentagalloylglucose, (C) Pyrethrin.

P. lactiflora is predominantly used for menstrual disorders, viz. dysmenorrhoea or menorrhagia and various painful inflammatory conditions such as cholecystitis. However, it is also recommended for dysentery, hypertension, and spermatorrhoea (Hempen and Fischer, 2009). Paeoniflorin, paeonol, pyrethrin, albiflorin, palbinone, casuariin, pedunculagin, strictinin, casuarictin, benzoic acid, methyl gallate, 1,2,3,4,6-pentagalloylglucose, glycoside oxypaeoniflorin, paeoniflorigenone, 1O-galloyl-beta-D-glucose, 1,2,3-tri-O-galloyl-b-D-glucose, and 1,2,6-tri-O-galloylb-D-glucose are the primary bioactive compounds of P. lactiflora (Fig. 4.11) (Parker et al., 2016). Lee et al. (2018) evaluated the antimicrobial activities of the ethanol extract of P. Lactiflora against enine common bacterial strains like Streptococcus mutans, S. sanguinis, S. parasanguinis, S. sobrinus, S. ratti, S. criceti, S. downei, S. anginosus, S. gordonii, and against bacterial pathogens present in the oral cavity like Aggregatibacter actinomycetemcomitans and Fusobacterium nucleatum. Methanol extracts of P. lactiflora roots showed good antibacterial activity against Bacillus subtilis, and also showed a pivotal inhibition role in the trafficking of viral glycoprotein in virus-infected baby hamster kidney cells (Boo et al., 2011). Ngan et al. (2012) assessed the bactericidal and inhibitory activities of root extract components like paeonol, benzoic acid, methyl gallate, and 1,2,3,4,6-penta-O-galloyl-b-d glucopyranose against Helicobacter pylori. Aqueous extract of P. lactiflora was tested for antimicrobial activities against food-putrefactive microbes viz. Corynebacterium xerosis, C. albicans, Listeria monocytogenes, and Pseudomonas syringae (Park and Cho, 2010).

4.13

Paeonia suffruticosa andrews

The plant is traditionally known as “Chi-shao.” The root of the plant is used for herbal preparations in traditional Chinese medicine. In traditional Chinese medicine, P. suffruticosa is used to treat bleeding or lack of blood movement. The plant extract

132

Functional and Preservative Properties of Phytochemicals HO HO

O

HO

O

HO

OH O

O

OH

O

OH

O

O

H O

O

O H

O

O

H O

HO

OH

HO

(A)

H O O

O

O OH OH

(B)

Figure 4.12 Chemical structure of (A) Galloylpaeoniflorin and (B) Mudanpioside-H.

is believed to stop platelet aggregation. P. suffruticosa contains major bioactive compounds such as galloylpaeoniflorin, 6-O-vanillyoxypaeoniflorin, mudanpioside-H, paeoniflorin, oxy-paeoniflorin, benzoylpaeoniflorin, albi-florin, paeoniflorigenone, and lacioflorin (Fig. 4.12). The methanol extract of P. suffruticosa was studied for their antibacterial activity against E. coli (Espiritu et al., 2014). The extracts of P. suffruticosa also displayed in vitro antibacterial activity against antibiotic-resistant pathogens like Acinetobacter baumannii, P. aeruginosa, S. aureus, and Escherichia (Yang et al., 2014). The compounds 6-O-vanillyoxypaeoniflorin, mudanpioside-H, galloyl-oxypaeoniflorin were isolated from the root bark of P. suffruticosa and showed moderate antibacterial activity against Salmonella paratyphi, S. typhi, Shigella dysenteriae, S. flexneri, and Vibrio cholera (An et al., 2006).

4.14

Polygonum multiflorum thunb

Polygonum multiflorum is known as the “Chinese climbing knotweed” or “He Shou Wu.” Root extracts of the plant have been used for centuries in traditional Chinese medicine for a multitude of conditions and as an agent to prevent aging. It is also used as a tonic in liver and kidney problems and to fortify muscles and bones. Trans-2,3,5,4-tetrahydroxy-stilbene-2-O-d-glucoside and catechin are the main bioactive compounds of P. multiflorum (Fig. 4.13). HO OH O OH HO OH

Figure 4.13 Chemical structure of catechin.

Antimicrobial properties of selected plants used in traditional Chinese medicine

133

The antimicrobial activity of P. multiflorum root extracts were investigated against gram-negative bacteriadE. coli and Salmonella enteritidis, as well as against grampositive bacteriadS. aureus, Bacillus subtilis, and Listeria monocytogenes (Quoc et al., 2018). They also reported antifungal activity of the plant against Fusarium equiseti, Aspergillus niger, and Trichoderma asperellum. Methanolic extracts of P. multiflorum roots were used for antimicrobial activity against pathogenic microorganisms like S. aureus, P. aeruginosa, E. coli, and pathogenic fungi Fusarium oxysporum, and A. niger (Thiruvengadam et al., 2014).

4.15

Rheum palmatum L.

Rheum palmatum (Da Hung) belongs to Polygonaceae family and is one of the most popular traditional Chinese medicines used to control various diseases. R. palmatum plays the roles of anticoagulation and antithrombosis agent and improves microcirculation through lowering the endotoxin-induced permeability of microvascular tissue, reducing tissue edema, decreasing inflammatory exudation and necrosis, and enhancing cytoprotection mechanism. The major bioactive components of R. palmatum that are responsible for antimicrobial activites are five hydroxyanthraquinones (HAQs), namely aloe-emodin, rhein, emodin, chrysophanol, and physcion (Fig. 4.14) (Wang et al., 2010). In vitro inhibitory activity of two major compounds (rhein, and aloe-emodin) isolated from R. palmatum were evaluated against Saprolegnia mycelial growth and spore germination (Yao et al., 2017). Aly and Gumgumjee (2011) evaluated antimicrobial activity of methanol and butanol extract of R. palmatum against seven pathogenic bacteria and six fungi (E. coli, P. aeruginosa, Shigella dysenteriae, Klebsiella pneumoniae, Bacillus subtilis, S. aureus, Micrococcus roseus, C. albicans, Candida OH

O

OH

OH OH

O

O

O

OH

HO O

(A) OH

O

(B) O

OH

OH O

(C)

OH

O

OH

(D)

Figure 4.14 Chemical structure of (A) Aloe-emodin, (B) Rhein, (C) Emodin, (D) ChrysophanolI.

134

Functional and Preservative Properties of Phytochemicals

tropicalis, Candida neoformans, Alernaria solani, Fusarium oxosporium, and Aspergillus niger). The five hydroxyanthraquinones (HAQs) inhibited the growth of Bifidobacterium adolescentis and the sequence of growth inhibition of five compounds are as follows: rhein > emodin > aloe-emodin > chrysophanol > physicion (Wang et al., 2010).

4.16

Salvia miltiorrhiza bunge

Salvia miltiorrhiza, commonly known in China as “Danshen,” is a member of the Lamiaceae family. It is one of the best-known Chinese traditional herbs. The roots of the plants are used in the treatment of cardiovascular disease, neurasthenic insomnia, liver fibrosis, and cancer. It is also used in health supplements and cosmetics as an ingredient. The main active ingredient in the roots of S. miltiorrhiza include water-soluble phenolic acids such as rosmarinic acid, salvianolic acid, fat-soluble diterpenoid quinines such as dihydrotanshinone, cryptotanshinone, tanshinone I, and tanshinone IIA (Fig. 4.15). Lee and Kim (2016) reported antifungal activity of the ethanol extract from S. miltiorrhiza against C. albicans. The antimicrobial activity of S. miltiorrhiza hexane fraction against S. aureus and methicillin-resistant S. aureus was demonstrated by its ability to inhibit expression of resistant gene, mecA, mecR1, and femA (Lee et al., 2007). Zhao et al. (2011) isolated and identified four diterpenoid tanshinones (tanshinone IIA, tanshinone I, cryptotanshinone, dihydrotanshinone I) and three phenolic acids (rosmarinic acid, caffeic acid, danshensu) from the crude ethanol extract of hairy roots of S. miltiorrhiza. These compounds were evaluated to show a broad antimicrobial spectrum on test microorganisms including eight bacterial and one fungal species, viz. Agrobacterium tumefaciens, E. coli, Pseudomonas lachrymans, Ralstonia solanacearum, Xanthomonas vesicatoria, Bacillus subtilis, Staphylococcus aureus, Staphylococcus haemolyticus and Magnaporthe oryzae (Zhao et al., 2011).

4.17

Schisandra chinensis (turcz.) baill

Schisandra chinensis is a member of the Schisandraceae family and commonly known as “Wu Wei Zi.” It is initially found in northern China and neighboring Russian and OH

HO O

HO

O

O HO HO

HO

O O

(A)

O OH OH

HO OH

OH

(B)

OH

Figure 4.15 Chemical structure of (A) Salvianolic acid, and (B) Rosmarinic acid.

Antimicrobial properties of selected plants used in traditional Chinese medicine

135

O O

OO

O O

Figure 4.16 Chemical structure of deoxyschizandrin.

Korean regions. It is used for the treatment of cough, asthma, nocturnal emissions, and chronic diarrhea in traditional Chinese herbal medicines. Lignans (schizandrin, deoxyschizandrin, gomisin) triterpenes, and volatile oils are the main bioactive components of S. chinensis (Fig. 4.16). In a conference report, the methanol extract of S. chinensis was evaluated for their antimicrobial activity against four common gastrointestinal bacteria like E. coli, Bacillus lincheniformis, Bacillus subtili, Lactobacillus bulgaricu s (Yu, 2016). Six dibenzocyclooctadiene lignans showed antibacterial activity in human epithelial cells against pathogenic Chlamydia pneumoniae and Chlamydia trachomatis (Hakala et al., 2015). According to Mocan et al. (2014a,b) in an antimicrobial assay, the extract of S. chinensis leaves was found more active than the fruit extract against target bacteria (S. aureus, B. subtilis, L. monocytogenes, E. coli, S. typhimurium). S. schisandra seed oils have been tested for sensitivity to five bacterial strains including foodborne pathogens E. coli and Bacillus cereus, as well as raspberry and mulberry deteriorating Micrococcus luteus, Enterobacter aerogens, and Serratia marcescens (Teng and Lee, 2014).

4.18

Scutellaria baicalensis georgi

Scutellaria baicalensis (Huang Quin) is a perennial herbaceous plant which belongs to the family Lamiaceae. Chinese people have used the dried root of this medicinal plant for more than 2000 years. It is known as Huang-Qin in the traditional Chinese medicine system and now listed officially in the Chinese Pharmacopoeia. Baicalin, wogonoside, and wogonin are the major bioactive compounds of S. baicalensis (Fig. 4.17). Da et al. (2019) investigated two components baicalein and wogonin from the crude extract of S. baicalensis with potent antifungal activity. Baicalein showed potent antifungal activity against the common human pathogenic fungi, viz. Trichophyton rubrum, Trichophyton mentagrophytes, Aspergillus fumigatus, and C. albicans. However, wogonin displayed antifungal activity against all four fungi except C. albicans. Trinh et al. (2018) evaluated in vitro antimicrobial activity of S. baicalensis ethanol extract against pathogenic fungi (Aspergillus niger, Aspergillus oryzae, C. albicans, Candida tropicalis, and Candida glabrata), gram-negative bacteria (E. coli and

136

Functional and Preservative Properties of Phytochemicals

O

OH

HO

O

OH O O

O

HO

OH

OH

O

O OH

O O

OH

O O

OH

(A)

OH OH

(B)

O

OH

O (C)

OH O

Figure 4.17 Chemical structures of (A) Baicalin, (B) Wogonoside, and (C) Wogonin.

Pseudomonas aeruginosa), and gram-positive bacteria (Bacillus subtilis and S. aureus) by using broth microdilution assay, modified-disc diffusion, and agar dilution methods. Leach (2011) investigated antimicrobial properties of S. baicalensis water extracts against E. coli, S. aureus, and Saccharomyces cerevisiae by using the disc diffusion method with water as a negative control and vancomycin as the positive control. Baicalin, isolated from S. baicalensis, has been applied as a natural antibacterial agent against foodborne pathogens such as Salmonella spp. and Staphylococcus spp. in homemade mayonnaise (Bruzewicz et al., 2006).

5.

Conclusion

Many pharmacological studies have been conducted on traditional Chinese medicinal plants, which are potential sources of new medicines, and can improve the effects of conventional antimicrobials, and quality of treatment. Regardless of the importance of traditional Chinese medicine in Asian countries and their growing popularity in the industrialized West, the therapeutic potential of traditional Chinese medicinal plants must be addressed scientifically in the context of antimicrobial potential. Bioavailability, pharmacodynamics, the understanding of therapeutic synergy and possible network of complex blends, and more rigorous studies on pharmacology are essential for making real progress in this field.

References Aboutabl, E.A., El-Tantawy, M.E., Shams, M.M., 2013. Chemical composition and antimicrobial activity of volatile constituents from the roots, leaves, and seeds of Arctium lappa L.(Asteraceae) grown in Egypt. Egyptian Pharmaceutical Journal 12 (2), 173e176.

Antimicrobial properties of selected plants used in traditional Chinese medicine

137

Aly, M.M., Gumgumjee, N.M., 2011. Antimicrobial efficacy of Rheum palmatum, Curcuma longa and Alpinia officinarum extracts against some pathogenic microorganisms. African Journal of Biotechnology 10 (56), 12058e12063. An, R.B., Kim, H.C., Lee, S.H., Jeong, G.S., Sohn, D.H., Park, H., et al., 2006. A new monoterpene glycoside and antibacterial monoterpene glycosides from Paeonia suffruticosa. Archives of Pharmacal Research 29 (10), 815e820. Anibijuwon, I.I., Omojasola, P.F., Olayiwole, A., Abioye, J.A., Odaibo, D.O., 2013. Antibacterial activity of Myristica fragrans and curry powder against selected organisms. Nigerian Journal of Biochemistry and Molecular Biology 28 (1&2), 103e111. Anke, H., Sterner, O., 1991. Comparison of the antimicrobial and cytotoxic activities of twenty unsaturated sesquiterpene dialdehydes from plants and mushrooms. Planta Medica 57 (04), 344e346. Appalasamy, S., Lo, K.Y., Ch’ng, S.J., Nornadia, K., Othman, A.S., Chan, L.K., 2014. Antimicrobial activity of artemisinin and precursor derived from in vitro plantlets of Artemisia annua L. BioMed Research International 2014, 1e6. Bai, C.Z., Hao, J.Q., Hao, X.L., Feng, M.L., 2018. Preparation of Astragalus membranaceus lectin and evaluation of its biological function. Biomedical Reports 9 (4), 345e349. Balachandar, S., Jagadeeswari, M., Dhanabalan, R., Meenachi, M., 2012. Antimicrobial activity of Astragalus membranaceus against diarrheal bacterial pathogens. International Journal of Pharmacy 2 (2), 416e418. Beck, J.J., Stermitz, F.R., 1995. Addition of methyl thioglycolate and benzylamine to (Z)-ligustilide, a bioactive unsaturated lactone constituent of several herbal medicines. An improved synthesis of (Z)-ligustilide. Journal of Natural Products 58 (7), 1047e1055. Bensky, D., Clavey, S., St~oger, E., 2004. Materia Medica. Chinese Herbal Medicine, third ed. Eastlandpress, Seattle. Blumenthal, M., 2002. Herb sales down in mainstream market, up in natural food stores. HerbalGram. Bombardelli, E., Ghione, M., 1993. U.S. Patent No. 5,264,216. Washington, DC: U.S. Patent and Trademark Office. Bonjar, G.S., 2004. Inhibition of Clotrimazole-resistant Candida albicans by plants used in Iranian folkloric medicine. Fitoterapia 75 (1), 74e76. Boo, K.H., Lee, D., Woo, J.K., Ko, S.H., Jeong, E.H., Hong, Q., et al., 2011. Anti-bacterial and anti-viral activity of extracts from Paeonia lactiflora roots. Journal of the Korean Society for Applied Biological Chemistry 54 (1), 132e135. Bruzewicz, S., Malicki, A., Oszmia~nski, J., Jaroslawska, A., Jarmoluk, A., Pawlas, K., 2006. Baicalin, added as the only preservative, improves the microbiological quality of homemade mayonnaise. Pakistan Journal of Nutrition 5, 30e33. Caveney, S., Starratt, A., 1994. Glutamatergic signals in Ephedra. Nature 372 (6506), 509. Chan, Y.S., Cheng, L.N., Wu, J.H., Chan, E., Kwan, Y.W., Lee, S.M.Y., et al., 2011. A review of the pharmacological effects of Arctium lappa (burdock). Inflammopharmacology 19 (5), 245e254. Chen, J.K., Chen, T.T., Crampton, L., 2004. Chinese Medical Herbology and Pharmacology, vol. 1267. Art of Medicine Press, City of Industry, CA. Chiang, L.C., Chiang, W., Chang, M.Y., Ng, L.T., Lin, C.C., 2002. Antiviral activity of Plantago major extracts and related compounds in vitro. Antiviral Research 55 (1), 53e62. Choi, J.G., Jeong, S.I., Ku, C.S., Sathishkumar, M., Lee, J.J., Mun, S.P., Kim, S.M., 2009. Antibacterial activity of hydroxyalkenyl salicylic acids from sarcotesta of Ginkgo biloba against vancomycin-resistant Enterococcus. Fitoterapia 80 (1), 18e20.

138

Functional and Preservative Properties of Phytochemicals

Cos, P., Vlietinck, A.J., Berghe, D.V., Maes, L., 2006. Anti-infective potential of natural products: how to develop a stronger in vitro ‘proof-of-concept’. Journal of Ethnopharmacology 106 (3), 290e302. Cui, J.F., Niu, C.Q., Zhang, J.S., 1991. Determination of six Ephedra alkaloids in Chinese Ephedra (ma huang) by gas chromatography. Yao xue xue bao¼ Acta Pharmaceutica Sinica 26 (11), 852e857. Cui, H., Bai, M., Sun, Y., Abdel-Samie, M.A.S., Lin, L., 2018. Antibacterial activity and mechanism of Chuzhou chrysanthemum essential oil. Journal of Functional Foods 48, 159e166. Da, X., Nishiyama, Y., Tie, D., Hein, K.Z., Yamamoto, O., Morita, E., 2019. Antifungal activity and mechanism of action of Ou-gon (Scutellaria root extract) components against pathogenic fungi. Scientific Reports 9 (1), 1683. De Tommasi, N., Pizza, C., Conti, C., Orsi, N., Stein, M.L., 1990. Structure and in vitro antiviral activity of sesquiterpene glycosides from Calendula arvensis. Journal of Natural Products 53 (4), 830e835. Deng, S., Chen, S.N., Yao, P., Nikolic, D., van Breemen, R.B., Bolton, J.L., et al., 2006. Serotonergic activity-guided phytochemical investigation of the roots of Angelica s inensis. Journal of Natural Products 69 (4), 536e541. Diamond, B.J., Shiflett, S.C., Feiwel, N., Matheis, R.J., Noskin, O., Richards, J.A., Schoenberger, N.E., 2000. Ginkgo biloba extract: mechanisms and clinical indications. Archives of Physical Medicine and Rehabilitation 81 (5), 668e678. Dorman, H.D., Deans, S.G., 2004. Chemical composition, antimicrobial and in vitro antioxidant properties of Monarda citriodora var. citriodora, Myristica fragrans, Origanum vulgare ssp. hirtum, Pelargonium sp. and Thymus zygis oils. Journal of Essential Oil Research 16 (2), 145e150. Eich, E., Pertz, H., Kaloga, M., Schulz, J., Fesen, M.R., Mazumder, A., Pommier, Y., 1996. ()-Arctigenin as a lead structure for inhibitors of human immunodeficiency virus type-1 integrase. Journal of Medicinal Chemistry 39 (1), 86e95. Espiritu, A.G., Doma Jr., B.T., Wang, Y.F., Masim, F.C.P., 2014. Efficacy of methanol extracts of Mentha haplocalyx Briq. and Paeonia suffruticosa Andr. for potential antibacterial activity. Sustainable Environment Research 24 (5), 319e324. Fabricant, D.S., Farnsworth, N.R., 2001. The value of plants used in traditional medicine for drug discovery. Environmental Health Perspectives 109 (Suppl. 1), 69e75. Friedrich, H., Wiedemeyer, H., 1976. Quantitative determination of the tannin-precursors and the tannins in Ephedra helvetica (author’s transl). Planta Medica 30 (3), 223e231. Galal, A.M., Ross, S.A., Jacob, M., ElSohly, M.A., 2005. Antifungal activity of artemisinin derivatives. Journal of Natural Products 68 (8), 1274e1276. Gentil, M., Pereira, J.V., Sousa, Y.T.C.S., Pietro, R., Neto, M.D.S., Vansan, L.P., de Castro França, S., 2006. In vitro evaluation of the antibacterial activity of Arctium lappa as a phytotherapeutic agent used in intracanal dressings. Phytotherapy Research: An International Journal Devoted to Pharmacological and Toxicological Evaluation of Natural Product Derivatives 20 (3), 184e186. Haines, C.J., Lam, P.M., Chung, T.K.H., Cheng, K.F., Leung, P.C., 2008. A randomized, double-blind, placebo-controlled study of the effect of a Chinese herbal medicine preparation (Dang Gui Buxue Tang) on menopausal symptoms in Hong Kong Chinese women. Climacteric 11 (3), 244e251. Hakala, E., Hanski, L., Uvell, H., Yrj€onen, T., Vuorela, H., Elofsson, M., Vuorela, P.M., 2015. Dibenzocyclooctadiene lignans from Schisandra spp. selectively inhibit the growth of the

Antimicrobial properties of selected plants used in traditional Chinese medicine

139

intracellular bacteria Chlamydia pneumoniae and Chlamydia trachomatis. Journal of Antibiotics 68 (10), 609. Han, C., Guo, J., 2012. Antibacterial and anti-inflammatory activity of traditional Chinese herb pairs, Angelica sinensis and Sophora flavescens. Inflammation 35 (3), 913e919. Hempen, C.H., Fischer, T., 2009. A Materia Medica for Chinese Medicine: Plants, Minerals, and Animal Products. Elsevier Health Sciences. Honmore, V.S., Rojatkar, S.R., Nawale, L.U., Arkile, M.A., Khedkar, V.M., Natu, A.D., Sarkar, D., 2016. In vitro and ex vivo antitubercular activity of diarylheptanoids from the rhizomes of Alpinia officinarum Hance. Natural Product Research 30 (24), 2825e2830. Hou, Y.Z., Zhao, G.R., Yuan, Y.J., Zhu, G.G., Hiltunen, R., 2005. Inhibition of rat vascular smooth muscle cell proliferation by extract of Ligusticum chuanxiong and Angelica sinensis. Journal of Ethnopharmacology 100 (1e2), 140e144. Huang, J., Wong, K.H., Tay, S.V., Serra, A., Sze, S.K., Tam, J.P., 2019. Astratides: insulinmodulating, insecticidal, and antifungal cysteine-rich peptides from Astragalus membranaceus. Journal of Natural Products 82 (2), 194e204. Indrayan, A.K., Garg, S.N., Rathi, A.K., Sharma, V., 2007. Chemical composition and antimicrobial activity of the essential oil of Alpinia officinarum rhizome. Indian Journal of Chemistry 46B, 2060e2063. Itokawa, H., Totsuka, N., Nakahara, K., Takeya, K., Lepoittevin, J.P., Asakawa, Y., 1987. Antitumor principles from Ginkgo biloba L. Chemical and Pharmaceutical Bulletin 35 (7), 3016e3020. Jeong, S.Y., Kim, H.M., Lee, K.H., Kim, K.Y., Huang, D.S., Kim, J.H., Seong, R.S., 2015. Quantitative analysis of marker compounds in Angelica gigas, Angelica sinensis, and Angelica acutiloba by HPLC/DAD. Chemical and Pharmaceutical Bulletin 63, 504e511 c15-00081. Jia, L., Zhao, Y., Liang, X.J., 2009. Current evaluation of the millennium phytomedicineginseng (II): collected chemical entities, modern pharmacology, and clinical applications emanated from traditional Chinese medicine. Current Medicinal Chemistry 16 (22), 2924e2942. Kachur, K., Suntres, Z.E., 2016. The antimicrobial properties of ginseng and ginseng extracts. Expert Review of Anti-infective Therapy 14 (1), 81e94. Kanowski, S., Herrmann, W.M., Stephan, K., Wierich, W., H€ orr, R., 1996. Proof of efficacy of the ginkgo biloba special extract EGb 761 in outpatients suffering from mild to moderate primary degenerative dementia of the Alzheimer type or multi-infarct dementia. Pharmacopsychiatry 29 (02), 47e56. Katoh, A., Fukuda, S., Fukusaki, E., Hashimoto, T., Hayasaki, T., Kanaya, S., et al., 2011. Systems biology in a commercial quality study of the Japanese Angelica radix: toward an understanding of traditional medicinal plants. The American Journal of Chinese Medicine 39 (04), 757e777. Khan, A., Jan, G., Khan, A., Gul Jan, F., Bahadur, A., Danish, M., 2017. In vitro antioxidant and antimicrobial activities of Ephedra gerardiana (root and stem) crude extract and fractions. Evidence-based Complementary and Alternative Medicine 2017, 6. Kim, W.S., Choi, W.J., Lee, S., Kim, W.J., Lee, D.C., Sohn, U.D., Shin, H.S., Kim, W., 2015. Anti-inflammatory, Antioxidant and Antimicrobial Effects of Artemisinin Extracts from Artemisia annua L. The Korean Journal of Physiology & Pharmacology 19 (1), 21e27. Kim, H., Rim, S.O., Bae, H., 2019. Antimicrobial potential of metabolites extracted from ginseng bacterial endophyte Burkholderia stabilis against ginseng pathogens. Biological Control 128, 24e30.

140

Functional and Preservative Properties of Phytochemicals

Kim, J.H., Yi, Y.S., Kim, M.Y., Cho, J.Y., 2017. Role of ginsenosides, the main active components of Panax ginseng, in inflammatory responses and diseases. Journal of Ginseng Research 41, 435e443. Kuang, X., Yao, Y., Du, J.R., Liu, Y.X., Wang, C.Y., Qian, Z.M., 2006. Neuroprotective role of Z-ligustilide against forebrain ischemic injury in ICR mice. Brain Research 1102 (1), 145e153. Kuete, V., Kamga, J., Sandjo, L.P., Ngameni, B., Poumale, H.M., Ambassa, P., Ngadjui, B.T., 2011. Antimicrobial activities of the methanol extract, fractions and compounds from Ficus polita Vahl.(Moraceae). BMC Complementary and Alternative Medicine 11 (1), 6. Lai, W., Cock, I.E., Cheesman, M.J., 2018. Interactive antimicrobial profiles of Astragalus membranaceus (fisch.) bunge extracts and conventional antibiotics against pathogenic and non-pathogenic gastrointestinal bacteria. Pharmacognosy Communications 8 (4), 158e164. Lakshmanan, D., Nanda, J., Jeevaratnam, K., 2018. Inhibition of swarming motility of Pseudomonas aeruginosa by methanol extracts of Alpinia officinarum hance. And Cinnamomum tamala T. Nees and eberm. Natural Product Research 32 (11), 1307e1311. Leach, F.S., 2011. Anti-microbial properties of Scutellaria baicalensis and Coptis chinensis, two traditional Chinese medicines. Bioscience horizons 4 (2), 119e127. Lee, H.S., Kim, M.J., 2002. Selective responses of three Ginkgo biloba leaf-derived constituents on human intestinal bacteria. Journal of Agricultural and Food Chemistry 50 (7), 1840e1844. Lee, H.S., Kim, Y., 2016. Antifungal activity of Salvia miltiorrhiza against Candida albicans is associated with the alteration of membrane permeability and (1, 3)-b-D-glucan synthase activity. Journal of Microbiology and Biotechnology 26 (3), 610e617. Lee, D.G., Jung, H.J., Woo, E.R., 2005. Antimicrobial property of (þ)-lyoniresinol-3a-O-b-DGlucopyranoside isolated from the root bark ofLycium chinense Miller against human pathogenic microorganisms. Archives of Pharmacal Research 28 (9), 1031e1036. Lee, J.W., Ji, Y.J., Lee, S.O., Lee, I.S., 2007. Effect of Saliva miltiorrhiza bunge on antimicrobial activity and resistant gene regulation against methicillin-resistant Staphylococcus aureus (MRSA). Journal of Microbiology 45 (4), 350e357. Lee, K.Y., Cha, J.D., Choi, S.M., Jang, E.J., Ko, E.S., Cha, S.M., Yun, S., 2018. Antimicrobial activity of ethanol extracts of Paeonia lactiforia on growth of oral bacteria. Journal of Oral Health and Dental Science 2 (2), 1e9. Lin, S.C., Lin, C.H., Lin, C.C., Lin, Y.H., Chen, C.F., Chen, I.C., Wang, L.Y., 2002. Hepatoprotective effects of Arctium lappa Linne on liver injuries induced by chronic ethanol consumption and potentiated by carbon tetrachloride. Journal of Biomedical Science 9 (5), 401e409. Lin, X., Liu, C., Chen, K., Li, G., 2004. Extraction and content comparison of chlorogenic acid in Arctium lappa L. leaves collected from different terrain and its restraining bacteria test. Natural Product Research and Development 16 (4), 328e330. Liu, D., Qu, W., Zhao, L., Liang, J.Y., 2012. A novel dimeric diarylheptanoid from the rhizomes of Alpinia officinarum. Chinese Chemical Letters 23 (2), 189e192. Lulekal, E., Rondevaldova, J., Bernaskova, E., Cepkova, J., Asfaw, Z., Kelbessa, E., et al., 2014. Antimicrobial activity of traditional medicinal plants from Ankober district, North Shewa zone, Amhara region, Ethiopia. Pharmaceutical Biology 52 (5), 614e620. Mahadevan, S., Park, Y., 2008. Multifaceted therapeutic benefits of Ginkgo biloba L.: chemistry, efficacy, safety, and uses. Journal of Food Science 73 (1), R14eR19. Mocan, A., Crișan, G., Vlase, L., Crișan, O., Vodnar, D., Raita, O., et al., 2014. Comparative studies on polyphenolic composition, antioxidant and antimicrobial activities of Schisandra chinensis leaves and fruits. Molecules 19 (9), 15162e15179.

Antimicrobial properties of selected plants used in traditional Chinese medicine

141

Mocan, A., Vlase, L., Vodnar, D., Bischin, C., Hanganu, D., Gheldiu, A.M., et al., 2014. Polyphenolic content, antioxidant and antimicrobial activities of Lycium barbarum L. and Lycium chinense Mill. leaves. Molecules 19 (7), 10056e10073. Narasimhan, B., Dhake, A.S., 2006. Antibacterial principles from Myristica fragrans seeds. Journal of Medicinal Food 9 (3), 395e399. Ngan, L.T.M., Moon, J.K., Shibamoto, T., Ahn, Y.J., 2012. Growth-inhibiting, bactericidal, and urease inhibitory effects of Paeonia lactiflora root constituents and related compounds on antibiotic-susceptible and-resistant strains of Helicobacter pylori. Journal of Agricultural and Food Chemistry 60 (36), 9062e9073. Nowrid, N., 2017. Phytochemical Screening and the Analysis of Antibacterial Activity in Chrysanthemum morifolium Ramat. Doctoral dissertation. BRAC University. Nurjanah, S., Putri, I.L., Sugiarti, D.P., 2017. Antibacterial activity of nutmeg oil. KnE Life Sciences 563e569. Padalia, H., Rathod, T., Chanda, S., 2017. Evaluation of antimicrobial potential of different solvent extracts of some medicinal plants of semi-arid region. Asian Journal of Pharmaceutical and Clinical Research 10 (11), 295e299. Park, K.D., Cho, S.H., 2010. Antimicrobial characteristics of Paeonia lactiflora Pall. extract tested against food-putrefactive microorganisms. Korean Journal of Food Preservation 17 (5), 706e711. Park, E.H., Yum, J., Ku, K.B., Kim, H.M., Kang, Y.M., Kim, J.C., et al., 2014. Red Ginsengcontaining diet helps to protect mice and ferrets from the lethal infection by highly pathogenic H5N1 influenza virus. Journal of ginseng research 38 (1), 40e46. Parker, S., May, B., Zhang, C., Zhang, A.L., Lu, C., Xue, C.C., 2016. A pharmacological review of bioactive constituents of Paeonia lactiflora Pallas and Paeonia veitchii Lynch. Phytotherapy Research 30 (9), 1445e1473. Peng, D., Wang, H., Qu, C., Xie, L., Wicks, S.M., Xie, J., 2012. Ginsenoside Re: its chemistry, metabolism and pharmacokinetics. Chinese Medicine 7 (1), 2. Pereira, J.V., Bergamo, D.C.B., Pereira, J.O., França, S.D.C., Pietro, R.C.L.R., SilvaSousa, Y.T.C., 2005. Antimicrobial activity of Arctium lappa constituents against microorganisms commonly found in endodontic infections. Brazilian Dental Journal 16 (3), 192e196. Quoc, T., Pham, L., Van Muoi, N., 2018. Phytochemical screening and antimicrobial activity of polyphenols extract from Polygonum multiflorum thunb. root. Carpathian Journal of Food Science and Technology 10 (4), 137e148. Ru, W., Wang, D., Xu, Y., He, X., Sun, Y.E., Qian, L., et al., 2015. Chemical constituents and bioactivities of Panax ginseng (CA Mey.). Drug discoveries and therapeutics 9 (1), 23e32. Sack, R.B., 1975. Human diarrheal disease caused by enterotoxigenic Escherichia coli. Annual Review of Microbiology 29 (1), 333e354. Schr€oder, H.C., Merz, H., Steffen, R., M€uller, W.E., Sarin, P.S., Trumm, S., et al., 1990. Differential in vitro anti-HIV activity of natural lignans. Zeitschrift f€ ur Naturforschung C 45 (11e12), 1215e1221. Selvamohan, T., Ramadas, V., Kishore, S.S.S., 2012. Antimicrobial activity of selected medicinal plants against some selected human pathogenic bacteria. Advances in Applied Science Research 3 (5), 3374e3381. Shafiei, Z., Shuhairi, N.N., Md Fazly Shah Yap, N., Harry Sibungkil, C.A., Latip, J., 2012. Antibacterial activity of Myristica fragrans against oral pathogens. Evidence-based Complementary and Alternative Medicine 2012 (12), 825362. Slade, D., Galal, A.M., Gul, W., Radwan, M.M., Ahmed, S.A., Khan, S.I., et al., 2009. Antiprotozoal, anticancer and antimicrobial activities of dihydroartemisinin acetal dimers and monomers. Bioorganic and Medicinal Chemistry 17 (23), 7949e7957.

142

Functional and Preservative Properties of Phytochemicals

Song, Z.J., Johansen, H.K., Faber, V., Høiby, N., 1997a. Ginseng treatment enhances bacterial clearance and decreases lung pathology in athymic rats with chronic P. aeruginosa pneumonia. Apmis 105 (1-6), 438e444. Song, Z., Johansen, H.K., Faber, V., Moser, C., Kharazmi, A., Rygaard, J., Høiby, N.I.E.L.S., 1997b. Ginseng treatment reduces bacterial load and lung pathology in chronic Pseudomonas aeruginosa pneumonia in rats. Antimicrobial Agents and Chemotherapy 41 (5), 961e964. Song, J.H., Choi, H.J., Song, H.H., Hong, E.H., Lee, B.R., Oh, S.R., et al., 2014. Antiviral activity of ginsenosides against coxsackievirus B3, enterovirus 71, and human rhinovirus 3. Journal of Ginseng Research 38 (3), 173e179. Srividya, A.R., Dhanabal, S.P., Misra, V.K., Suja, G., 2010. Antioxidant and antimicrobial activity of Alpinia officinarum. Indian Journal of Pharmaceutical Sciences 72 (1), 145e148. Sung, W.S., Lee, D.G., 2008. In vitro candidacidal action of Korean red ginseng saponins against Candida albicans. Biological and Pharmaceutical Bulletin 31 (1), 139e142. Sylvester, C., Izah, et al., 2018. Antibacterial efficacy of aqueous extract of myristica fragrans (Common Nutmeg). EC Pharmacology and Toxicology 6, 291e295. Tabanca, N., Wedge, D.E., Wang, X., Demirci, B., Baser, K.H.C., Zhou, L., Cutler, S.J., 2008. Chemical composition and antifungal activity of Angelica sinensis essential oil against three Colletotrichum species. Natural product communications 3 (7), 1073e1078. Tan, H.S., Hu, D.D., Song, J.Z., Xu, Y., Cai, S.F., Chen, Q.L., et al., 2015. Distinguishing radix angelica sinensis from different regions by HS-SFME/GCeMS. Food Chemistry 186, 200e206. Teng, H., Lee, W.Y., 2014. Antibacterial and antioxidant activities and chemical compositions of volatile oils extracted from Schisandra chinensis Baill. seeds using simultaneous distillation extraction method, and comparison with Soxhlet and microwave-assisted extraction. Bioscience Biotechnology and Biochemistry 78 (1), 79e85. Theuretzbacher, U., 2012. Accelerating resistance, inadequate antibacterial drug pipelines and international responses. International Journal of Antimicrobial Agents 39 (4), 295e299. Thikra, M., Ali, Z.R., Zghair, Z., 2015. The inhibitory Effect of Crude Extract of Arctium lappa on some pathogenic bacteria. MRVSA 4 (3), 32e39. Thiruvengadam, M., Praveen, N., Kim, E.H., Kim, S.H., Chung, I.M., 2014. Production of anthraquinones, phenolic compounds and biological activities from hairy root cultures of Polygonum multiflorum thunb. Protoplasma 251 (3), 555e566. Trinh, H., Yoo, Y., Won, K.H., Ngo, H.T., Yang, J.E., Cho, J.G., et al., 2018. Evaluation of invitro antimicrobial activity of Artemisia apiacea H. and Scutellaria baicalensis G. extracts. Journal of Medical Microbiology 67 (4), 489e495. Wang, N.T., Lin, H.I., Yeh, D.Y., Chou, T.Y., Chen, C.F., Leu, F.C., et al., December 2009. Effects of the antioxidants lycium barbarum and ascorbic acid on reperfusion liver injury in rats. In: Transplantation Proceedings, Vol. 41. Elsevier, pp. 4110e4113. Wang, J., Zhao, H., Kong, W., Jin, C., Zhao, Y., Qu, Y., Xiao, X., 2010. Microcalorimetric assay on the antimicrobial property of five hydroxyanthraquinone derivatives in rhubarb (Rheum palmatum L.) to Bifidobacterium adolescentis. Phytomedicine 17 (8e9), 684e689. Watanabe, N., Yamagishi, M., Mizutani, T., Kondon, H., Omura, J., Hanada, K., Kushida, K., 1990. Caf 603: a new antifungal carotene sesquiterpene. Isolation and structure elucidation. Journal of Natural Products 53, 1176e1181. Wei, W.L., Zeng, R., Gu, C.M., Qu, Y., Huang, L.F., 2016. Angelica sinensis in China-A review of botanical profile, ethnopharmacology, phytochemistry and chemical analysis. Journal of Ethnopharmacology 190, 116e141.

Antimicrobial properties of selected plants used in traditional Chinese medicine

143

Yang, W.Z., Hu, Y., Wu, W.Y., Ye, M., Guo, D.A., 2014. Saponins in the genus Panax L.(Araliaceae): a systematic review of their chemical diversity. Phytochemistry 106, 7e24. Yao, J.Y., Lin, L.Y., Yuan, X.M., Ying, W.L., Xu, Y., Pan, X.Y., Ge, P.H., 2017. Antifungal activity of rhein and aloe-emodin from Rheum palmatum on fish pathogenic Saprolegnia sp. Journal of the World Aquaculture Society 48 (1), 137e144. Yeasmin, D., Swarna, R.J., Nasrin, S., Parvez, S., Alam, M.F., 2016. Evaluation of antibacterial activity of three flower colours Chrysanthemum morifolium Ramat. against multi-drug resistant human pathogenic bacteria. International Network for Natural Sciences 9 (2), 78e87. Yoo, D.G., Kim, M.C., Park, M.K., Song, J.M., Quan, F.S., Park, K.M., et al., 2012. Protective effect of Korean red ginseng extract on the infections by H1N1 and H3N2 influenza viruses in mice. Journal of Medicinal Food 15 (10), 855e862. Yu, H., April 2016. Antimicrobial activity and mechanism of Schisandra chinensis extract. In: Proceedings of the 5th International Conference on Environment, Materials, Chemistry and Power Electronics (EMCPE 2016). Ankang University: Ankang, Zhengzhou, China, pp. 192e196. Zang, X., Shang, M., Xu, F., 2013. A-type proanthocyanidins from the stems of Ephedra sinica (Ephedraceae) and their antimicrobial activities. Molecules 18 (5), 5172e5189. Zhang, H., Li, N., Wu, J., Su, L., Chen, X., Lin, B., Luo, H., 2013. Galangin inhibits proliferation of HepG2 cells by activating AMPK via increasing the AMP/TAN ratio in a LKB1independent manner. European Journal of Pharmacology 718 (1e3), 235e244. Zhao, J., Lou, J., Mou, Y., Li, P., Wu, J., Zhou, L., 2011. Diterpenoid tanshinones and phenolic acids from cultured hairy roots of Salvia miltiorrhiza bunge and their antimicrobial activities. Molecules 16 (3), 2259e2267. Zhao, C., Jia, Y., Lu, F., 2018. Angelica stem: a potential low-cost source of bioactive phthalides and phytosterols. Molecules 23 (12), 3065. Zhong, Y., Deng, Y., Chen, Y., Chuang, P.Y., He, J.C., 2013. Therapeutic use of traditional Chinese herbal medications for chronic kidney diseases. Kidney International 84 (6), 1108e1118.

This page intentionally left blank

Natural products from plants: recent developments in phytochemicals, phytopharmaceuticals, and plantbased neutraceuticals as anticancer agents

5

S. Priya 1 , P.K. Satheeshkumar 2 1 Agro-Processing and Technology Division, CSIR-National Institute for Interdisciplinary Science and Technology (CSIR-NIIST), Trivandrum, Kerala, India; 2Centre of Advanced Study in Botany, Institute of Science, Banaras Hindu University, Varanasi, Uttar Pradesh, India

1. Plants: nature’s chemical factories Plants belong to one of the most diverse living kingdoms on earth and are represented by nearly 3,90,000 identified species. It is estimated that our knowledge about the actual diversity is not yet complete as many new species are reported every year. Even though plants were used in the medical practices of ancient civilizations worldwide, the development of a unified nomenclature and cataloging during the 17th and 18th century customized the usage of plants in the therapeutic preparations. Among more than 450 families of plants, around 20 plant families are known for its medicinal properties. Some of the families like Lamiaceae, Asteraceae, Amaranthaceae, Arecaceae, Aristolochiaceae, Cucurbitaceae, Piperaceae, Rubiaceae, Ranunculaceae, Zingiberaceae, Rutaceae, Solanaceae, etc., are characterized by the presence of specific classes of active molecules (Reddy, 2017). For example, while many Zingiberaceae members contain flavonoids and terpenoids like monoterpene and sesquiterpene as their major active molecule constituent along with other compounds, Fabaceae members contain flavonoids, tannins, phenolics, and alkaloids as the major active compounds (Macêdo et al., 2018). However, there has been a steep decline in the number of plant-based therapeutics reaching the market during the past few decades. Despite the challenges existing in developing therapeutic molecules from plants, many research groups and companies worldwide are engaged in the search of plant-based active principles. Plants produce a huge number (more than 30,000) of chemical compounds as secondary metabolites and many of them have their proven roles in the defense strategies against various pathogens and predators. Other than their natural occurrence, studies

Functional and Preservative Properties of Phytochemicals. https://doi.org/10.1016/B978-0-12-818593-3.00005-1 Copyright © 2020 Elsevier Inc. All rights reserved.

146

Functional and Preservative Properties of Phytochemicals

have also revealed that plants produce many unnatural compounds as a part of their defense strategy when exposed to extreme conditions of the environment. They are highly diverse based on their chemical structure, composition, solubility, and the pathways by which they are synthesized. The structure of secondary metabolites falls into many chemical scaffolds with varying substitutions of active moieties. Some of the secondary metabolites have significant health effects which are exploited in traditional healthcare practices. Plant-derived compounds are used as medicines and many contemporary pharmaceuticals are natural products or their derivatives. The research on plant-derived medicines started in the 17th century but the real breakthrough happened by the discovery of first purified plant compound (alkaloid) morphine from opium. The first antimalarial compound quinine was isolated from the bark of the cinchona tree. Acetylsalicylic acid (aspirin) is the derivative of salicin, which was isolated from the willow tree and is the first pain reliever used by ancient Greeks. More than 25% of the currently used drugs are derived from plants. Other than the direct therapeutic application against diseases, many of the plant parts are known for its disease prevention activity. The scientific literature of the 20th century showed many examples of such activity against many lifestyle diseases like diabetes, hypertension, cardiovascular diseases, kidney and liver diseases. Various plant products are available commercially to serve the purpose of nutrition and to improve the overall resistance against various diseases. The commercial companies further expanded its application by isolating the active principle and making it as food additives/flavors and an ingredient in many artificial health supplements.

2.

Cancer and chemotherapeutic targets

Cancer is the prominent cause of death worldwide after cardiovascular diseases. It is a term used to describe a group of diseases which is characterized by an uncontrolled division of abnormal cells and some of them gradually gain the ability to invade other tissues (metastasis). Metastasis is the main reason responsible for the mortality associated with cancer. International Agency for Research on Cancer (IARC) has postulated an estimated incidence and mortality of cancer worldwide using GLOBOCAN 2018. The study estimated 18.1 million new cases and 9.6 million deaths in 2018. With 11.6% of total cases, lung cancer was the most commonly diagnosed and lethal cancer (18.6%), which was closely followed by breast cancer, prostate cancer, and colorectal cancer. The major hallmarks of cancer cells include self-sufficiency in growth signals, unresponsive to inhibitory signals, escape from apoptosis, unlimited proliferation, sustained angiogenesis, and tissue invasion and metastasis. In males, lung cancer is the most commonly diagnosed cancer followed by prostate and colorectal cancer. However, in females, breast cancer was the most incident cancer followed by colorectal, lung, and cervical cancer (Bray et al., 2018). The root cause of cancer is usually genetic or epigenetic alterations, but the progression of cancer involves multiple steps associated with a complex interplay between the tumor cells and their environment; genetic or epigenetic mutation in a critical gene which leads to uncontrolled proliferation giving rise to a clone of dividing neoplastic

Natural products from plants: recent developments in phytochemicals

147

cells. For the unimpeded growth of tumors beyond a certain size and its metastasis, proximity to the vasculature is very essential. As the tumor size increases, the core loses access to oxygen and nutrients, and this leads to the recruitment of new blood vessels toward the tumor in the process known as angiogenesis (Sever and Brugge, 2015). The invasion and migration of cancer cells can only be possible when the adherent epithelial cells can detach and invade the surrounding tissues. This is made possible by the transformation of the polarized primary tumor cells into motile and invasive mesenchymal cells in the process known as an epithelial-mesenchymal transition (EMT). The metastatic cascade involves multiple steps such as invasion, intravasation, and extravasation, leading to secondary tumor formation at a distant site. The treatment of cancer mainly depends on the type, location, and stage of development. Chemotherapy makes use of the application of drugs or chemicals that are loaded in the bloodstream to reach cells. Chemotherapeutic drugs are usually cytotoxic or cytostatic toward cells with increased cell division potential like cancer cells. This is the reason behind the side effects associated with chemotherapy, as fast-dividing normal cells are also affected in the treatment process (Chakraborty and Rahman, 2012). Despite this, it has been successfully applied for the treatment of various cancer cells. So far, there are several different classes of anticancer drugs based on their mechanisms of action, and they include alkylating agents, antimetabolites, antibiotics, topoisomerase inhibitors, mitotic inhibitors, DNA crosslinking agents, monoclonal antibodies, etc. (Huang et al., 2017). The chemotherapeutics induce a well-organized string of events, known as apoptosis, leading to the destruction of cancer cells. Apoptosis or programmed cell death is activated by both intracellular and extracellular signals. Two different pathways lead to the induction of apoptosis: the intrinsic (mitochondria-mediated) and extrinsic (death receptor) pathways that correlate with the signal type. Most of the current anticancer drugs target diverse cellular functions to mediate apoptosis. Epigenetics is the alterations in the gene expression without changing the genome structure. Epidrugs is the new class of drugs that target enzymes that induce epigenetic changes, and several epigenetic targets are currently under validation for new anticancer therapies. The prominent targets include histone deacetylases (HDAC) and DNA methyltransferases (DNMT), along with several other classes of enzymes which can operate posttranslational modifications to histone tails. DNMT and HDAC inhibitors induce DNA demethylation and histone acetylation, respectively, leading to reactivation of silenced genes, and dramatic morphological and functional changes in cancer cells (Verma and Kumar, 2018). Energy metabolism in most cancer cells differs remarkably from that of normal cells. The glycolytic enzymes, PFK-2 and PKM2, have also gained attention as important molecular targets for anticancer compounds (Chen et al., 2015).

3. Major classes of anticancer molecules Classically the anticancer drugs are classified according to the treatment modality in which they are used such as chemotherapy, hormonal therapy, and immunotherapy. Chemotherapy mainly includes cytotoxic drugs that have been further classified based on their structure and function. Major classes of cytotoxic drugs include

148

Functional and Preservative Properties of Phytochemicals

1. Alkylating agents: Crosslinking of DNA appears to be of major importance to the cytotoxic action of alkylating agents resulting in the inhibition of DNA synthesis and function, and replicating cells are most susceptible to these drugs. Cyclophosphamide, chlorambucil, and busulfan are a few of the drugs from this class. 2. Antimetabolites: These drugs target the metabolism of cancer cells by inhibiting DNA synthesis. They include antifolates (capecitabine), purine antagonists (6-mercaptopurine), deoxycytidine analogs (cytarabine), and fluoropyrimidines (5-fluorouracil). 3. Topoisomerase enzyme inhibitors: Epipodophyllotoxins inhibit DNA topoisomerase II enzyme thereby interfering with DNA replication. Examples are etoposide and teniposide. Camptothecins inhibit topoisomerase I, the critical enzyme required for cutting and joining single-stranded DNA which ultimately results in DNA damage. Topotecan and irinotecan are the two camptothecin analogs currently used in clinical practice. 4. Antitumor antibiotics: Most of these microbial antibiotics bind to DNA through intercalation between specific bases and block the synthesis of RNA, DNA, or both; causing DNA strand breaks; hence interfering with replication. Anthracyclins are widely used cytotoxic drugs that act through four major mechanisms: inhibition of topoisomerase II, inhibition of the synthesis of DNA and RNA through intercalation, generation of semiquinone free radicals and oxygen free radicals, and binding to cellular membranes to alter fluidity and ion transport. Doxorubicin and idarubicin are a few of the currently used anthracyclins. Mitomycin is a DNA crosslinking agent while bleomycin binds to DNA releasing oxygen free radicals to cause single and double-stranded DNA breaks. 5. Platinum analogs: They form intrastrand and interstrand DNA crosslinks, binding to nuclear and cytoplasmic proteins and interrupting DNA synthesis. They include cisplatin, carboplatin, etc. 6. Microtubule inhibitors: They inhibit the microtubules which are part of the structural elements in the cell. It can affect the rapid cell division in the cancer cells. For example, Vinca alkaloids inhibit tubulin polymerization thereby disrupting the mitotic spindle assembly; they includes vincristine, vinblastine, and vinorelbine. Taxanes inhibit mitosis and cell division by enhancing microtubule polymerization and include drugs like paclitaxel and docetaxel.

A major source of consternation associated with cancer chemotherapy is the short and long-term side effects that diminish the standard of life of the patients. Some of the wellinvestigated symptoms include nausea, vomiting, hair loss, muscle toxicity, neurotoxicity, gastrointestinal ulceration and associated anemia, fatigue, weight loss, etc. Various drugs and methods are employed currently to alleviate many of the sideeffects, but they are often ineffective, thereby demanding the need for new approaches to reduce sequelae associated with chemotherapy. Studies have shown that the use of natural bioactive compounds along with standard drugs especially during the later stages of disease increases the chemosensitivity and lowers the adverse effects (Nurgali et al., 2018).

4.

Anticancer compounds from plants

Plants use many chemicals for their normal growth activities including stress adaptation and defense against different types of their enemies. These chemicals with a highly specific structure and activity are shown to be effective in protecting the plants from adverse

Natural products from plants: recent developments in phytochemicals

149

conditions. Many of such plant compounds proved to have activity against different disease conditions in animals. The major groups of compounds include alkaloids, terpenes, flavonoids, saponins, lignans, vitamins, beta carotene, alpha-tocopherol, fiber, kaempferol, caffeic acid, tannin, ascorbic acid, essential oils, gums, and many primary and secondary metabolites. With the advancement of cancer research, more and more anticancer drugs are being discovered from plants and other organisms, owing to the need for more potent, selectively toxic, chemosensitive agents. Many existing anticancer drugs in the market have been derived from natural resources such as plants, microorganisms, and marine life forms (Ratovitski, 2017). Plant-derived drugs are considered to be more tolerated and less toxic toward normal cells. A recent review stated that only 10% of the available plant species had been investigated for drug discovery. Polyphenols include a complex assortment of chemicals such as flavonoids, tannins, curcumin, resveratrol, and gallocatechin. Resveratrol is usually found in dietary products such as peanuts and red wine while gallocatechin is present in green tea. Even the consumption of such polyphenol-rich food in the diet was reported to be chemopreventive. Purified flavonoids extracted from Erythrina suberosa, namely 4‟methoxy licoflavanone and alpinum isoflavone induced apoptosis in HL-60 cells (Kumar et al., 2018). Polyphenols attenuate cancer through several mechanisms including oxidative DNA fragmentation. Derivatives of Vinca alkaloids from Catharanthus roseus such as vincristine, vinblastine, vinorelbine, vindesine, and vinflunine are drugs which on binding to b tubulin, inhibit its polymerization and hence mitosis. Derivatives of taxanes from Taxus genus, namely paclitaxel and docetaxel, are microtubule-targeting agents that bind to polymerized microtubules and prevent tubulin depolymerization, leading ultimately to cell death by apoptosis. Compounds including sulforaphane, isothiocyanates, isoflavones, and pomiferin are considered to be HDAC inhibitors. They reactivate epigenetically silenced genes in cancer cells, leading to cell cycle arrest and apoptosis. Studies suggest that dietary constituents, such as the isothiocyanates, can act as HDAC inhibitors. Sulforaphane is an isothiocyanate found in various cruciferous vegetables like broccoli or its sprouts that inhibit HDAC activity in cancer cells. The antioxidant activity of green tea is attributed to its most abundant catechin, epigallocatechin-3-gallate (EGCG). Epipodophyllotoxin is an anticancer compound derived from Podophyllum peltatum that has shown proapoptotic effects and cell cycle inhibition toward lymphoma and testicular cancer. Combretastatin A-4 phosphate from Combretum caffrum shuts down vascular support to the tumors. Roscovitine from Raphanus sativus inhibits cell cycle progression. Flavopiridol from Dysoxylum binectariferum and noscapine from Papaver somniferum are in phase II clinical trials (Greenwell and Rahman, 2015).

5. What is an ideal anticancer molecule? Cancer is the uncontrolled division of cells, and an ideal cancer drug should target and destroy only those cells, which lose its control over mitotic division. This can be the simplest definition of an ideal anticancer molecule at the beginning of the disease. One

150

Functional and Preservative Properties of Phytochemicals

of the factors which may differentiate cancer from other diseases is its pathology when it is affecting different organs or parts of the body. As the disease progresses, the manifestations of the disease start affecting other organs and if it is metastatic, other parts of the body. So the drug should be able to take care of all the negative effects which are part of the disease progression. The drugs which are used as chemotherapeutic agents act on different biochemicals, which may play crucial roles in the pathology. Even though certain drugs are highly efficient against a certain type of cancers, the same drug may be ineffective against other types. So, it is needed to develop a cancerspecific drug, which can be a combination of more than one drug, and acts upon different mechanisms involved in the disease pathology. The modern medicine proposes the development of “personalized” or “precision” medicines for each patient depending on the individual difference in the immune system, physiology, and the overall health conditions. So the drug represents a combination of inhibitors specific to over or underexpressed cancer-specific molecules such as growth factors, receptors, ligands, adaptors, enzymes, cytokine/chemokine, etc. (Maeda and Khatami, 2018). But the studies reveal that the success rates of such treatments are highly variable and the inefficiency sometimes increases the patients’ burden (Mattina et al., 2017). In this aspect, it can be argued that the traditional phytochemical preparations used for cancer treatment contain extracts from different plant species, and it represents the active principles targeting different pathways of cancer progression.

6.

Commercial success stories

Development of any medication in the present time requires a lot of investment in terms of time, money, infrastructure, and scrutiny by the experts, as it is important to ensure the safety and efficacy of the drug. Compared to the second half of the 19th and 20th century, the discoveries of vital plant therapeutic molecules are quite less in the 21st century. This is because of the knowledge we have gained about the mechanism involved in the pathology of disease and the mode of action of the drug molecules. Refining which is targeted to increase the efficiency and safety of new drugs demands more detailed evaluations about the drugs’ action and negative effects. This pushes the companies who are working in the pharma field to invest huge on clinical trials and the related analysis, making the drug development a costly affair. The same applies to cancer medicines also, as most of the medicines used at present are developed and got approval in the 20th century, and the novel medicines are mainly immunotherapeutic. There are few plant-based compounds which are found to be promising in the clinical trial (Cravotto et al., 2010). Time since the beginning of modern medicine in the early 18th century, which was based on the scientific research, attempts have been made to utilize the galore of information available with the traditional medical practitioners all around the world. Ancient civilizations present in different parts of the globe had their healthcare systems mainly rely on native plants and animals. Traditional medicine preparations used to treat various diseases by different populations were analyzed extensively with the

Natural products from plants: recent developments in phytochemicals

151

help of modern scientific methods to identify the components and understand the mechanism of action of each component in an individual and synergistic mode. Identification of secondary metabolites in plants and their purification accelerated the invention of plant-based anticancer molecules. At present, there are 17 drugs of natural origin among the total of 174 molecules in the market to treat different cancers (Newman and Cragg, 2016). There are nine plant-derived compounds approved by the FDA for use as anticancer drugs including vinblastine, vincristine, taxol, navelbine, etoposide, topotecan, teniposide, taxotere, and irinotecan. There are few plantderived compounds like curcumol, curdione, 10-hydroxycamptothecin, homoharringtonine, lycobetaine, colchicinamide, monocrotaline, gossypol, and D-tetrandrine in the clinical trials, which may also hope to get approved soon for the commercial use.

7. Why do we need more medicines for cancer treatment? It is estimated that by 2020, 20% of all the human deaths on earth will be due to cancer. Compared to other diseases, developing a drug against cancer is very difficult as only less than 5% of the total candidate drugs entered in the clinical trials succeed to come to the market. But in general, in the last few decades, more than 30% of the new drugs approved by the FDA have their origin in plants (Newman and Cragg, 2012). Considering the complexity of the disease, the treatment methods used for various types of cancer are found to be inefficient in controlling the overall negative impacts in many common cancers. Sideeffects associated with the drugs against cancer sometimes fasten the deterioration of health for the patients. The treatment methods like chemotherapy, immunotherapy, surgery, radiation therapy, stem cell transformation, or a combination of any of these methods generally result in various sideeffects (Wang et al., 2012). It may affect the normal functioning of the vital organs, complicating the treatment, especially in old people. Different chemotherapeutic drugs working with a common method may impart entirely different side effects. For example, both doxorubicin and irinotecan are topoisomerase inhibitors used commonly in the treatment of many types of cancers. While doxorubicin is cardiotoxic, irinotecan exhibits neurotoxicity, neutropenia, and diarrhea. There are many cell types such as bone marrow cells and hair follicle cells in our body that divide rapidly under normal conditions. The drugs meant to destroy the cancer cells also target these normal cells. Moreover, prolonged use of certain drugs leads to the development of drug-resistant cancer cells (Vinogradov and Wei, 2012). There are few reports on the combined use of plant-derived compounds with the cancer drugs which showed less toxicity than the drugs used alone (Aung et al., 2017). Drugs of plant origin mostly belong to the category of secondary metabolites and obviously are part of the membrane transport system. This feature makes them more amenable for stability within the human body, more bioavailability, and possibility to reach the site of action.

152

8.

Functional and Preservative Properties of Phytochemicals

Traditional medicine resources for anticancer molecules

Evolution of the human race from a nomadic lifestyle to an advanced society is the subsequent product of the knowledge, mankind had gained throughout. Since the most ancient civilization which was estimated to be around 10,000 BCE, nature was the primary source of all the necessities of life including healthcare. Highly established and well-documented treatment modalities using plants or plant products such as medicines against various diseases are evident in the history of many ancient populations. Ayurveda practiced in ancient India was one of those well-established traditional systems of healthcare. All around the world, there are traditional healthcare systems, which use plant products for the treatment of various cancers. India with its diverse fauna and flora, second most diverse in the world, has the richest tradition of known use of plants as therapeutic agents and offers a magnificent opportunity in searching for novel therapeutics. Ayurveda, one of the oldest healthcare systems on earth dates back to more than 5000 years. Charaka and Sushruta Samhitas explain cancer as an inflammatory or noninflammatory swelling in the body and indicate that in malignant tumors, the body system made of three basic factors (Vata, Pitha, Kapha) gets out of control (Tridosha). It causes a complete alteration in functions leading to the proliferation and metastasis of cancer (Balachandran and Govindarajan, 2005). The ayurvedic preparations used in the cancer treatment contains more than one plant product, which may represent multiple active compounds working on different biochemical pathways of cancer development or progression (Smit et al., 1995). This holistic approach considering all the vital systems of our body may be beneficial as cancer affects not only the organ in which it is present but other organs also. There are more than 30 plants including Ocimum sanctum, Andrographis paniculata, Piper longum, Tinospora cordifolia, Semecarpus anacardium, Phyllanthus niruri, Baliospermum montanum, Pandanus odoratissimum, Oroxylum indicum, Morus rubra, Pterospermum acerifolium, Barleria prionitis, Prosopis cineraria, Amorphophallus campanulatus, Emblica officinalis, Raphanus sativus, Ficus bengalensis, Curcuma domestica, Curcuma longa, etc., mentioned in the ayurvedic texts with anticancer properties; they were proved to contain active principles against different cancers using modern scientific studies. Chinese traditional medicine, evolved through centuries, has given significant contributions to anticancer molecules. Ancient Chinese have developed specific molecules and combinations to treat successfully many diseases including cancer (Huang et al., 2018). Recent studies have proved its efficacy by evaluating the anticancer properties of the components involved in the preparation on different animal models. Some of the plant-derived products with anticancer property used by Chinese are, green tea, Prunella vulgaris, Ginseng, Scutellaria barbata, curcumin, rosmarinic acid, and honokial (Jiao et al., 2018). There are few reports on the clinical trials using the traditional medicines for cancer treatment. Effect of green tea on the precancerous mucosa lesions was studied in a clinical trial and confirmed that compared to the control group the treated group has showed difference in the proliferating index (Li et al., 1999). Another study

Natural products from plants: recent developments in phytochemicals

153

with green tea also suggests that there is an inverse relation between green tea consumption and head and neck cancer (Huang et al., 2014). ATB (antitumor B) is a combination formula made of components from six different Chinese traditional plants. A study conducted with more than 2500 volunteers revealed that the cancerization rate of esophageal dysplasia has been reduced by 52.2% in the third year, 47.3% in the fifth year, and 42.1% in the ninth year (Ding et al., 1999). Combination therapy with the traditional Chinese medicine is also found to be reducing the negative effects of chemotherapy. Ginsenoside Rg1 obtained from the plant ginseng can alleviate cisplatin-induced hepatic injury in mice, and baicalein from Scutellaria radix can relieve doxorubicin-induced cardiotoxicity (Yu et al., 2018). According to recent studies, many of the Islamic countries like Jordan (35%), Iran (42%), and Ethiopia (90%) use conventional medicines for cancer treatment (Afifi et al., 2010; Montazeri et al., 2007). Traditional Arabic and Islamic methods use many vegetables and fruits including cabbage, tomato, apples, and grapes. Other than the commonly used beverages and spices like tea, garlic, ginger, cumin, black pepper, etc., many portions of cereals and olive are reported to be used in the medical practices of Arab populations. Many of the traditional plants used in cancer treatment are found to contain anticancer compounds in modern scientific studies (Ahmad et al., 2017). There are more than 40 Arabic traditional medicinal plants with anticancer properties against several cell lines that were reported.

9. High throughput screening for molecule identification Classical pharmacology deals with the screening of extracts from natural sources or synthetic small molecules on the cells or whole organism to identify its therapeutic effect on the target tissue. Depending on the assay used, the number of molecules which can be identified per screening was highly restricted in these procedures and the amount of molecule in the extract played a major role in detection. Advancements in the scientific instrumentation led to the development of screening methods in which thousands of molecules are screened at the same time and the detection sensitivity has been increased considerably. In High Throughput Screening (HTS), large number of compounds (biological or synthetic) can be tested in an automated manner (Broach and Thorner, 1996). HTS process involves the target identification, reagent preparation, assay development, screening, and data analysis. The data will be further validated by the similarity algorithm and the structure activity relationship will be determined. Once a strong significant interaction is proved, the molecule will be made in large quantity, either by purification from its natural source or by chemical synthesis, for the elaborated activity assays. Combinatorial chemistry can be used extensively to make the synthetic mimics which are varied slightly in their structure and the efficacy of the molecule can be tested. HTS can be used to identify only the lead compounds and the final drug may or may not be the same molecule identified in the HTS (Macarron et al., 2011). It depends on the factors like, bioavailability,

154

Functional and Preservative Properties of Phytochemicals

toxicity, absolute specificity, and pharmacokinetics of the molecule. So it may be possible that a modified biomimic may be a more suitable candidate molecule than a natural compound from which the mimic is developed. NPCARE is a public database domain which contains information about the natural products from different sources with anticancer properties. This website contains a list of more than 730 plant species of 197 families, with anticancer compounds. Each of the entries was annotated for the activity on specific cancer types and cell lines, scientific explanations for the source plant, PubChem ID, and information about the target genes (Choi et al., 2017). NPCARE is expected to reduce the repetition in the natural product research by providing a comprehensive idea about the plant and the compounds along with its anticancer activity on various cancer types and cell lines.

10.

Neutraceuticals with anticancer properties

The nutritional need of any animal including humans is highly specific especially during different stages of its growth and development. Ingredients need to be included in the food preparations, in general, are classified into carbohydrates, protein, vitamins, minerals, antioxidants, fats, and lipids. The functional role that each of these compounds play in the body is different. When the equilibrium is lost for a long time and if the food is continuously lacking the presence of any of the above ingredients, the body ends up having a deficiency of the specific compound, which leads to diseases. It is shown that several herbal components can interfere with vital systems and one such example is the anticoagulant properties of garlic supplements. So the drugs used to treat the patients for blood coagulation malfunctions can be affected by the nutritional supplement containing garlic. In cancer, organosulfides of garlic suppress the function of cytochrome P4502E1, involved in the metabolism of analgesics like acetaminophen used in the treatment (Gwilt et al., 1994). While the anticancer properties of many of the conventional food have been studied extensively, many of them possess a rather unexplored property of a therapeutic supplement. Neutraceuticals differ from therapeutics in such a way that they are consumed in an assumption that they contain certain specific ingredients that have the ability to prevent a specific disease, i.e., they provide both nutrition and therapeutic effects. There are many categories of neutraceuticals used for different purposes such as for antidiabetic properties, to control blood pressure, to reduce aging, to control cardiovascular diseases and neurological disorders. And it is also noticed that the nutraceuticals are used as alternative medicines. There are many plant-based nutraceuticals in the market claiming to be beneficial in preventing the occurrence of cancer. A study conducted among the cancer survivors of 13 countries indicated that around 30% of the cancer patients used some type of alternative medicines during treatment (Ernst and Cassileth, 1998), but the percentage varies from 65% to 95% in different locations with other studies (Richardson et al., 2000). Most of the patients used dietary products either in the form of multivitamins or herbal-based dietary supplements. The neutraceuticals like pepper, clove, ginger, fenugreek, grape, green tea, soy, and turmeric are reported

Natural products from plants: recent developments in phytochemicals

155

to inhibit various cancer types in the in vitro studies and in the model organisms using different mechanisms. Even though, there are no direct indication of the plant products’ involvement in preventing the cancer occurrence, consumption of neutraceuticals along with modern medicines has proved to be beneficial especially in the later stages of cancer treatment (Wargovich et al., 2010).

11.

The proposed mechanisms of anticancer activity

A considerable increase in the cancer case is attributable to excess weight, physical inactivity, and unhealthy dietary habits (Behrens et al., 2018). The development of cancer is a complex multistep process in which, we cannot control the genetic changes once it occurs, but we can modify some of the risk factors which have the potential to further complicate the disease. One study in the United States showed that 70%e80% of cancers diagnosed are due to unhealthy eating styles. Research indicates that plantbased foods have the best chemopreventive properties and 30% of death associated with cancer can be prevented by diet alone. Phytochemicals present in the foods can interfere with cellular communication and inflammation which stimulate cancer growth and metastasis. Ursolic acid, vitamin D, curcumin, epigallocatechin gallate, sulforaphane, quercetin, apigenin, etc., are few to mention for their cancer prevention properties. Nutritionists call the cruciferous vegetables as a green superfood because of the enormous property of cancer prevention due to the presence of compounds like sulforaphane, indole 3 carbinol, vitamin C, quercetin, and beta carotene (Abbaoui et al., 2018). The person following an unhealthy diet plan for a long time could induce inflammation and oxidative stress which lead to chronic diseases. In recent years gut microbiota has emerged as an important research topic because of its disturbance due to junk food and other lifestyles leading to cancer, inflammatory and metabolic disorders. Nutrition can potentially enhance the immune response against cancer and supplements like omega 3, polyphenols, etc., could benefit for immunotherapy (boosting immune system) (Soldati et al., 2018). Different types of food and drinks have the potential to make epigenetic marks on DNA which leads to a healthy outcome. The isothiocyanates in broccoli and other cruciferous vegetables increase histone acetylation, ECCG in green tea and genistein the isoflavone from soy decrease histone methylation. These epigenetic modifications are reversible, and there is great interest in finding dietary molecules to prevent the development of cancer (Zhang, 2015). Metastasis is the major reason for morbidity and mortality in cancer patients. Nutrients/specific phytochemicals in fruits, vegetables, and spices can inhibit metastasis and can be availed for cancer prevention. American Cancer Society and World Cancer Research Fund gave two guidelines for preventing cancer: (1) Eating nonstarchy plant foods with anticancer properties (2) decrease the consumption of red meat as a source of protein. Natural substances can modulate the epigenetic mechanism and many of the tumor suppressor genes work through this mechanism. No clear data are available on how diet can manipulate the epigenetic modulation of tumor suppressor genes. Also, it

156

Functional and Preservative Properties of Phytochemicals

is important to consider the additive or synergistic effects of natural compounds on metastatic suppression (Meadows, 2012). High levels of dietary saturated fats increase the cancer risk by inducing inflammatory markers and activating Akt/mTOR pathway. High-fat diet fuels cancer cells by overexpressing CD36, highlighting that the fat-fed diet promotes metastasis (Pascual et al., 2017). The bioactive compounds like antioxidant from berries, curcumin from turmeric, and isothiocyanates from cruciferous vegetables induce the activation of tumor suppressor genes. Flavonoids like apigenin and luteolin present in parsley, celery, etc., have shown to decrease the pancreatic cell proliferation in vitro. The nutritive flavonoid-rich sweet potato foliage arrests the PC3 cell growth in G1 phase and induces apoptosis by upregulating Bax. The molecules such as schweinfurthins present in some edible leaves can interfere in the PI3K-Akt signaling pathway and prevent cancer cell proliferation. Curcumin and docosahexaenoic acid have the ability to reduce colon cancer cell proliferation by inhibiting the MEK-ERK signaling pathway. Aged garlic extract is found to inhibit the mitotic cycle in colon cancer cells by inactivating NF-kappaB. Prebiotic foods which enhance the gut microbiota have also a role in cancer prevention. Pterostilbene from berries and almonds induced cell cycle arrest at the G2M phase in gastric carcinoma cells by decreasing the phosphorylated Rb and cyclin/cdk complex and reactivation of tumor suppressor system. Targeting glycolysis is an important approach in cancer therapy and resveratrol and quercetin have shown to have effects on this. Vitamin E and tocotrienols have the potential to suppress HIF-1 by inhibiting VEGF and modulate the glycolysis pathway in cancer cells. Vitamin D and bioactive compounds from raspberries have anticancer effects through immunomodulation. Lycopene and beta carotene are associated with decreased risk of various types of cancers mainly because of their antiangiogenic effects. Lycopene exerted its effects by upregulating IL-12, inhibiting MMP-2, UPA, and VEGFR2 mediated PI3K/Akt/mTOR and ERK/p38 pathways. Consumption of ECCG from green tea and capsaicin from chilli pepper prevents various types of cancer by preventing angiogenesis (Chen et al., 2017).

12.

Can food ingredients be therapeutic?

Anticancer diet/dietary supplements can be an important strategy by which one can prevent or reduce the risk of cancer (Iqbal et al., 2017). G-BOMBS is an acronym for the best anticancer food health-promoting foods on the planet where G-stands for greens. The health benefits of leafy greens are so compelling and extra research on how they can serve better is worth much. Greens are the powerhouse of low glycemic nutrition, and daily dietary consumption should be two cups for adult/teenagers, one cup for ages 4-8, and 1/2 cup for 2e3 year olds. Leafy vegetables like spinach, kale, lettuce, mustard greens, chicory have a wide range of carotenoids such as lutein and zeaxanthin along with saponins and flavonoids, and research indicates that these can inhibit certain types of breast cancer, skin cancer, lung cancer, and stomach cancer (Donalson, 2004). Spinach is regarded as a functional food due to its diverse

Natural products from plants: recent developments in phytochemicals

157

nutritional composition which contributes to anticancer, antiobesity, and hypolipidemic effects (Roberts and Moreau, 2016). Selenium compounds have demonstrated anticancer effects clinically and preclinically. Leafy vegetables such as Amaranthus hybridus, Amaranthus sp., Cucurbita maxima, Ipomoea batatas, Solanum villosum, Solanum scabrum, and Vigna unguiculata were explored for their capabilities to accumulate selenium when grown on selenium-enriched soil and for use as a potential source of selenium-enriched functional foods (Mabeyo et al., 2015; Evans et al., 2018). Dark greens can supply a significant amount of folate and colon polyps (responsible for colon cancer) are 30%e40% less in people with high folate intake. Also diet low in folate increases the risk of breast, cervix, and lung cancers. A higher intake of green leafy vegetables is associated with lower risk of non-Hodgkin lymphoma (Chiu et al., 2011). Selected cruciferous vegetables including canola leafy greens were effective in reducing AOMinduced colon cancer in male rats (Miller-Cebert et al., 2016). High amount of dietary fibers are associated with a high intake of whole grains and leafy vegetables. Experimental and clinical studies suggest that the risk of colon cancer and other types of cancers may be reduced with a large intake of dietary fibers and other dietary components from fruits and vegetables. Also, scientific evidence from human and animal models indicate that dietary fibers reduce the risk of breast cancer by modulating the endocrine mechanism. Vitamin A and E have a role in cancer prevention. Retinol, the preformed vitamin A found in deep greens has the ability to boost the immune system. Retinoids can inhibit the malignant transformation in cells induced by radiation, chemical carcinogen, testosterone, etc. The carotene-rich foods have protective effects against lung cancer also (Pal et al., 2012). Anthocyanins and phenolic pigments from greens have cell-protective effects, inhibit tyrosinase activity, and obstruct initiation of malignant melanoma. Other pigments such as lutein, astaxanthin, violaxanthin, and antheraxanthin are good antioxidants and protect from colon cancer by inducing cell cycle arrest and apoptosis (Upadhyay, 2018).

13.

Our studies

We are working extensively in the field of anticancer molecules of natural origin. We have purified and characterized a few molecules and studied their mechanism of action. Morus alba (white mulberry) is a valuable medicinal plant, and we have purified and characterized a cytotoxic galactose-specific lectin from it. The isolated lectin showed toxicity in breast cancer cells (MCF-7) with a GI50 value 8.5 mg and colon cancer cells (HCT-15) with GI50 value 16 mg (Deepa and Priya, 2012). Further studies have shown that this lectin is capable of inducing apoptosis by the activation of caspase and cell cycle arrest in breast and colon cancer cells (Deepa et al., 2012). Anoikis is a type of programmed cell death when the cells are detached from the surrounding extracellular matrix. Unfortunately, cancer cells evade anoikis and remain in the circulatory system, which is the prime reason for metastasis. Compounds which can induce anoikis in cancer cells have prime therapeutic value. Our studies revealed that the

158

Functional and Preservative Properties of Phytochemicals

isolated lectin from mulberry leaf has the potential to induce anoikis, thereby preventing metastasis. The lectin was able to sensitize anoikis in breast cancer cells by activation of caspase 99-mediated mitochondrial apoptosis by the blockage of fibronectin-mediated integrin FAK signaling through Ras activation and activation of p38 MAPK (Saranya et al., 2017b). We have also found out that the methanolic extract of M. alba leaf showed cytotoxicity in MCF-7 cells (GI50 value 9.2 mg/mL) and colon cancer cells (GI50 value 13.8 mg/mL). The HPLC analysis identified major phytomolecules in it as epicatechin, myricetin, quercetin, luteolin, and kaempferol. The mechanism of action in inducing apoptosis is by the downregulation of nitric oxide produced by inducible nitric oxide synthase (Deepa et al., 2013). Zingiberaceae family of plants is widely used in traditional medicines and their rhizomes are a rich source of sesquiterpenes like zerumbone, humulene, and camphene. Out of these molecules, zerumbone has a wide range of pharmacological activities like anticancer, antioxidant, antiinflammatory, etc. Structural modifications of zerumbone gives rise to a number of anticancer compounds, and among this one pendant derivative namely ZPD was found to be highly active compared to zerumbone. The GI50 value of the parent zerumbone was found to be 16.6 mM in HeLa cells whereas for ZPD it was found to be 6.35 mM. Moreover, it was nontoxic to normal cells. ZPD induced programmed cell death in HeLa cells, which was confirmed by nuclear fragmentation, phosphatidylserine translocation, increased activity of caspase 3, upregulation of the proapoptotic proteins Bax, and downregulation of antiapoptotic BCl-2. ZPD also inhibited the cancer cell migration, decreased the production of MMP-2, 9 and downregulation of vascular endothelial growth factors required for tumor angiogenesis (Saranya et al., 2017a). Another plant molecule that we have purified and studied was epoxyazadiradione (EAD), a limonoid present in neem. Azadirachta indica (neem plant) is known as the drug house of nature, and it has been extensively used in traditional medicines for several ailments. Diverse type of limonoids in the category like azadirone type, gedunin type, and nimbin type are in general responsible for anticancer properties of neem and nimbin, azadirachtin, gedunin, nimbidiol, and nimbidin are few cytotoxic compounds isolated from it. We have observed the GI50 value of EAD was 7.5 mM in cervical cancer cells (HeLa) and nontoxic to normal cells. It modulates the cells to undergo apoptosis through the intrinsic pathway, and it inhibits the nuclear translocation of NFƘB, thus demonstrated as a safe therapeutic agent (Shilpa et al., 2017).

14.

Future perspectives

Plant-based molecules with medicinal properties can be useful in the treatment as a therapeutic and as a component to alleviate the negative effects of chemotherapy. The neutraceutical use of plant products is still a controversy. There are reports on the usage of neutraceuticals like green tea extract in a capsule form, which caused severe damage to the kidneys, maybe due to the toxic effect of the polyphenols present in it and the prooxidative properties of some of the components. It points to the fact that the effective dosage of the active component present in the preparation and the overall

Natural products from plants: recent developments in phytochemicals

159

health condition of the person consuming it is important. Moreover, the concentration of the same component can be different in the same species collected from two different locations. So it is advised every time to go for a reliable method to ensure the same concentration in all the preparations and the maximum dosage to be used by a person also to be determined. More clinical trials are needed to get a clearer picture, which may facilitate the popularization of the usage of plant-based therapeutics in the combination therapy and as a neutraceutical. Even though there are many reports on the effect of many plant-based molecules, mainly identified due to their use in traditional medicine, a thorough scientific study is needed before they can be used for treatment purpose. It is because traditional medicine and the treatment methods were handled in the ancient communities by a restricted group of members in the society, which had few inverse effects. One, the member of the family will get a chance to be with the practitioner from a very young age, and secondly, it used to give him enough opportunities to improve himself in the preparations. More than the written information, the experience gained through the interaction made the practitioner successful. Opposite to this, the knowledge passed on to a normal student of traditional medicine may get the recorded information, but lacking the much needed experience. So the enrichment of the system is hampered by the broken links or incomplete information. The biggest challenge of modern scientists in decoding the traditional knowledge available with the practitioners lies in the fact that the information may be incomplete. It is observed that among the different populations on earth, some races are prone to certain diseases but some are highly resistant. There are many indications that traditional food materials used by the population have a positive effect on health. One of the studies conducted on the food habits of rural Indian women indicated a negative correlation between traditional food and the occurrence of breast cancer. A steep rise in certain cancers can be connected to the changed food habits of the modern lifestyle, which has replaced fresh leafy vegetables and other such ingredients with fried, fat-loaded food. The cleaning and resurrection of vital systems mainly attained through the ingredients of our consumption are dampened, and we become more receptive to many diseases like cancer. Going back to the traditional food habits which are close to nature can be an answer to many lifestyle diseases of the present century.

References Abbaoui, B., Lucas, C.R., Riedl, K.M., Clinton, S.K., Mortazavi, A., 2018. Cruciferous vegetables, isothiocyanates, and bladder cancer prevention. Molecular Nutrition and Food Research e1800079. Afifi, F.U., Wazaify, M., Jabr, M., Treish, E., 2010. The use of herbal preparations as complementary and alternative medicine (CAM) in a sample of patients with cancer in Jordan. Complementary Therapies in Clinical Practice 16, 208e212. Ahmad, R., Ahmad, N., Naqvi, A.A., Shehzad, A., Al-Ghamdi, M.S., 2017. Role of traditional Islamic and Arabic plants in cancer therapy. Journal of Traditional and Complementary Medicine 7, 195e204.

160

Functional and Preservative Properties of Phytochemicals

Aung, T.N., Qu, Z., Kortschak, R.D., Adelson, D.L., 2017. Understanding the effectiveness of natural compound mixtures in cancer through their molecular mode of action. International Journal of Molecular Sciences 18 (3), 656. Balachandran, P., Govindarajan, R., 2005. Cancer: an ayurvedic perspective. Pharmacological Research 51, 19e30. Behrens, G., Gredner, T., Stock, C., Leitzmann, M.F., Brenner, H., Mons, U., 2018. Cancers due to excess weight, low physical activity, and unhealthy diet. Dtsch Arztebl International 115, 578. Bray, F., Ferlay, J., Soerjomataram, I., Siegel, R.L., Torre, L.A., Jemal, A., 2018. Global cancer statistics 2018: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA: A Cancer Journal for Clinicians. Broach, J.R., Thorner, J., 1996. High-throughput screening for drug Discovery. Nature 384, 14e18. Chakraborty, S., Rahman, T., 2012. The difficulties in cancer treatment. Ecancermedicalscience 6, ed16. PMC. Web. 26 Sept. 2018. Chen, K., Chu, B.Z., Liu, F., Li, B., Gao, C.M., Li, L.L., Sun, Q.S., Shen, Z.F., Jiang, Y.Y., 2015. New benzimidazole acridine derivative induces human colon cancer cell apoptosis in vitro via the ROS-JNK signaling pathway. Acta Pharmacologica Sinica 36, 1074e1084. Chen, K.L., Jung, P., Kulkoyluoglu-cotul, E., Liguori, C., Lumibao, J., Mazewski, C., Ranard, K., Rowles, J.L., Wang, Y., Xue, L., Madak-Erdogan, Z., 2017. Impact of diet and nutrition on cancer hallmarks. Journal of Cancer Prevention and Current Research 7, 240. Chiu, B.C., Kwon, S., Evens, A.M., Surawicz, T., Smith, S.M., Weisenburger, D.D., 2011. Dietary intake of fruit and vegetables and risk of non-Hodgkin lymphoma. Cancer Causes and Control 22, 1183. Choi, H., Cho, S.Y., Pak, H.J., Kim, Y., Choi, J., Lee, Y.J., Gong, B.H., Kang, Y.S., Han, T., Choi, G., Cho, Y., Lee, S., Ryoo, D., Park, H., 2017. NPCARE: database of natural products and fractional extracts for cancer regulation. Journal of Cheminformatics 9, 2. Cravotto, G., Boffa, L., Genzini, L., Garella, D., 2010. Phytotherapeutics: an evaluation of the potential of 1000 plants. Journal of Clinical Pharmacy and Therapeutics 35, 11e48. Deepa, M., Priya, S., 2012. Purification and characterization of a novel anti-proliferative lectin from Morus alba L. leaves. Protein and Peptide Letters 19, 839e845. Deepa, M., Sureshkumar, T., Satheeshkumar, P.K., Priya, S., 2012. Purified mulberry leaf lectin (MLL) induces apoptosis and cell cycle arrest in human breast cancer and colon cancer cells. Chemico-Biological Interactions 200, 38e44. Deepa, M., Sureshkumar, T., Satheeshkumar, P.K., Priya, S., 2013. Antioxidant rich Morus alba leaf extract induces apoptosis in human colon and breast cancer cells by the downregulation of nitric oxide produced by inducible nitric oxide synthase. Nutrition and Cancer 65, 305e310. Ding, Z.W., Gao, F., Lin, P.Z., 1999. Long term effect of treating patients with precancerous lesions of the esophagus. Chinese Journal of Oncology 21, 275. Donalson, S.M., 2004. Nutrition and cancer: a review of the evidence for an anticancer diet. Nutrition Journal 3, 19. Ernst, E., Cassileth, B.R., 1998. The prevalence of complementary/alternative medicine in cancer: a systematic review. Cancer 83, 777e782. Evans, S.O., Jacobson, G.M., Goodman, H.J.B., Bird, S., Jameson, M.B., 2018. Comparative safety and pharmacokinetic evaluation of three oral selenium compounds in cancer patients. Biological Trace Element Research 5, 1501. Greenwell, M., Rahman, P.K.S.M., 2015. Medicinal plants: their use in anticancer treatment. International Journal of Pharmaceutical Sciences and Research 6 (10), 4103e4112.

Natural products from plants: recent developments in phytochemicals

161

Gwilt, P.R., Lear, C.L., Tempero, M.A., Birt, D.D., Grandjean, A.C., Ruddon, R.W., Nagel, D.L., 1994. The effect of garlic extract on human metabolism of acetaminophen. Cancer Epidemiology, Biomarkers and Prevention 3, 155e160. Huang, C.C., Lee, W.T., Tsai, S.T., CY, O., Lo, H.I., Wong, T.Y., 2014. Tea consumption and risk of head and neck cancer. PLoS One 9, e96507. Huang, L., Liu, Q., Chen, S., Shao, Z., 2017. Cisplatin versus carboplatin in combination with paclitaxel as neoadjuvant regimen for triple negative breast cancer. OncoTargets and Therapy 10, 5739e5744. https://doi.org/10.2147/OTT.S145934. Huang, M., Zhang, L., Ding, J., Lu, J., 2018. Anticancer drug discovery from Chinese medicinal herbs. Chinese Medicine 13, 35. Iqbal, J., Abbasi, A., Mahmood, T., Kanwal, S., Ali, B., Shah, A.S., Khalil, T.A., 2017. Plantderived anticancer agents: a green anticancer approach. Asian Pacific Journal of Tropical Biomedicine 7, 1129. Jiao, L., Bi, L., Lu, Y., Wang, Q., Gong, Y., Shi, J., Xu, L., 2018. Cancer chemoprevention and therapy using Chinese herbal medicine. Biological Procedures Online 20, 1. Kumar, D., Haldar, S., Gorain, M., Kumar, S., Mulani, F.A., Yadav, A.S., Miele, L., Thulasiram, H.V., Kundu, G.C., 2018. Epoxyazadiradione suppresses breast tumor growth through mitochondrial depolarization and caspase-dependent apoptosis by targeting PI3K/ Akt pathway. BMC Cancer 18 (1), 52. Li, N., Sun, Z., Han, C., Chen, J., 1999. The chemopreventive effects of tea on human oral precancerous mucosa lesions. Proceedings of the Society for Experimental Biology and Medicine 220, 218e224. Mabeyo, P.E., Monoko, M.L., Gruhonjic, A., Fitzpatrick, P.A., Landberg, G., Erdelyi, M., Nyandoro, S.S., 2015. Selenium accumulating leafy vegetables are a potential source of functional foods. International Journal of Food Science 549676. Macarron, R., Banks, M.N., Bojanic, D., Burns, D.J., Cirovic, D.A., Garyantes, T., Green, D.V., Hertzberg, R.P., Janzen, W.P., Paslay, J.W., Schopfer, U., Sittampalam, G.S., 2011. Impact of high-throughput screening in biomedical research. Nature Reviews Drug Discovery 10 (3), 188e195. https://doi.org/10.1038/nrd3368. Macêdo, M.J.F., Ribeiro, D.A., Santos, M.O., de Macêdo, D.G., Macedo, J.G.F., de Almeida, B.V., Saraiva, M.E., de Lacerda, M.S.L., Souza, M.M.A., 2018. Fabaceae medicinal flora with therapeutic potential in Savanna areas in the Chapada do Araripe, Northeastern Brazil. Revista Brasileira de Farmacognosia 28 (6), 738e750. Maeda, H., Khatami, M., 2018. Analyses of repeated failures in cancer therapy for solid tumors: poor tumor-selective drug delivery, low therapeutic efficacy and unsustainable costs. Clinical and Translational Medicine 7, 11. Mattina, J., Carlisle, B., Hachem, Y., Fergusson, D., Kimmelman, J., 2017. Inefficiencies and patient burdens in the development of the targeted cancer drug sorafenib: a systematic review. PLoS Biology 15 (2), e2000487. https://doi.org/10.1371/journal.pbio.2000487. Meadows, G.G., 2012. Diet, nutrients, phytochemicals, and cancer metastasis suppressor genes. Cancer and Metastasis Reviews 13, 9369. Miller-Cebert, R.L., Boateng, J., Cebert, E., Shackelford, L., Verghese, M., 2016. Chemopreventive potential of canola leafy greens and other cruciferous vegetables on azoxymethen induced colon cancer in Fisher 344 male rats. Food and Nutrition Sciences 7, 964. Montazeri, A., Sajadian, A., Ebrahimi, M., Haghighat, S., Harirchi, I., 2007. Factors predicting the use of complementary and alternative therapies among cancer patients in Iran. European Journal of Cancer Care 16, 144e149. Newman, D.J., Cragg, G.M., 2012. Natural products as sources of new drugs over the 30 years from 1981 to 2010. Journal of Natural Products 75, 311e335.

162

Functional and Preservative Properties of Phytochemicals

Newman, D.J., Cragg, G.M., 2016. Natural products as sources of new drugs from 1981 to 2014. Journal of Natural Products 79. https://doi.org/10.1021/acs.jnatprod.5b01055. Nurgali, K., Jagoe, R.T., Abalo, R., 2018. Editorial: adverse effects of cancer chemotherapy: anything new to improve tolerance and reduce sequelae? Frontiers in Pharmacology 9, 245. Pal, D., Banerjee, S., Ghosh, K.A., 2012. Dietary-induced cancer prevention: an expanding research arena of emerging diet related to healthcare system. Journal of Advanced Pharmaceutical Technology and Research 3, 16. Pascual, G., Avgustinova, A., Mejetta, S., Martin, M., Castellanos, A., Attolini, C.S., Berenguer, A., Prats, N., Toll, A., Hueto, J.A., Bescos, C., Di Crore, L., Benitah, S.A., 2017. Targeting metastasis-initiating cells through the fatty acid receptor CD36. Nature 541, 41. Ratovitski, E.A., 2017. Anticancer natural compounds: molecular mechanisms and functions. Part I. Current Genomics 18 (1), 2. Reddy, J., 2017. Important medicinal plant families and plant based drugs: a review. In: Proceeding 5th International Conference on Civil, Architecture, Environment and Waste Management (CAEWM-17) Singapore March 29e30. https://doi.org/10.17758/ EAP.AE0317304. Richardson, M.A., Sanders, T., Palmer, J.L., Greisinger, A., Singletary, S.E., 2000. Complementary/alternative medicine use in a comprehensive cancer center and the implications for oncology. Journal of Clinical Oncology 18, 2505e2514. Roberts, J.L., Moreau, R., 2016. Functional properties of spinach (Spinacia oleracea L.) phytochemicals and bioactives. Food & Function 7, 3337. Saranya, J., Dhanya, B.P., Greeshma, G., Radhakrishnan, K.V., Priya, S., 2017. Effects of a new synthetic zerumbone pendant derivative (ZPD) on apoptosis induction and anti-migratory effects in human cervical cancer cells. Chemico-Biological Interactions 278, 32e39. Saranya, J., Shilpa, G., Raghu, K.G., Priya, S., 2017. Morus alba leaf lectin (MLL) sensitizes MCF-7 cells to anoikis by inhibiting fibronectin mediated integrin-FAK signaling through Ras and activation of P38 MAPK. Frontiers in Pharmacology 8, 34. Sever, R., Brugge, J.S., 2015. Signal transduction in cancer. Cold Spring Harbor Perspectives in Medicine 5 (4), a006098. Shilpa, G., Renjitha, J., Saranga, R., Sajin Francis, K., Nair, M.S., Joy, B., Sasidhar, B.S., Priya, S., 2017. Epoxyazadiradione purified from the Azadirachta indica seed induced mitochondrial apoptosis and inhibition of NFkB nuclear translocation in human cervical cancer cells. Phytotherapy Research 12, 1892e1902. Smit, H.F., Woerdenbag, H.J., Singh, R.H., Meulenbeld, G.J., Labadie, R.P., Zwaving, J.H., 1995. Ayurvedic herbal drugs with possible cytostatic activity. Journal of Ethnopharmacology 47, 75e84. Soldati, L., Di Renzo, L., Jirillo, E., Ascierto, A.P., Marincola, F.M., De Lorenzo, A., 2018. The influence of diet on anticancer immune responsiveness. Journal of Translational Medicine 16, 75. Upadhyay, R.K., 2018. Plant pigments as dietary anticancer agents. International Journal of Green Pharmacy 12, S93. Verma, M., Kumar, V., 2018. Epigenetic drugs for cancer and precision. Epigenetics of Aging and Longevity 4, 439e451. Vinogradov, S., Wei, X., 2012. Cancer stem cells and drug resistance: the potential of nanomedicine. Nanomedicine 7, 597e615. Wang, H., Khor, T.O., Shu, L., Su, Z., Fuentes, F., Lee, J., Kong, A.T., 2012. Plants against cancer: a review on natural phytochemicals in preventing and treating cancers and their druggability. Anti-Cancer Agents in Medicinal Chemistry 12, 1281e1305.

Natural products from plants: recent developments in phytochemicals

163

Wargovich, M.J., Morris, J., Brown, V., Ellis, J., Logothetics, B., Weber, R., 2010. Nutraceutical use in last-stage cancer. Cancer and Metastasis Reviews 29, 503e510. Yu, J., Wang, C., Kong, Q., Wu, X., Lu, J.J., Chen, X., 2018. Recent progress in doxorubicininduced cardiotoxicity and protective potential of natural products. Phytomedicine 40, 125e139. Zhang, N., 2015. Epigenetic modulation of DNA methylation by nutrition and its mechanisms in animals. Animal Nutrition 1, 144.

This page intentionally left blank

Foodborne microbial toxins and their inhibition by plant-based chemicals

6

Somenath Das, Anand Kumar Chaudhari, Akanksha Singh, Deepika, Vipin Kumar Singh, Abhishek Kumar Dwivedy, Nawal Kishore Dubey Centre of Advanced Study in Botany, Institute of Science, Banaras Hindu University, Varanasi, Uttar Pradesh, India

1. Introduction Prevention of food spoilage by bacteria, fungi, and their associated toxins is currently a burning issue. Spoilage is generally based on the change in qualitative, quantitative, and organoleptic properties of food with reference to off-flavor and off-odor (Kaczmarek et al., 2019). Microbe-mediated spoilage of food commodities generally relies on the postharvest storage conditions including variable temperature, rainfall, and relative humidity. It has been reported that 25% of globally produced food products are lost through post-slaughter and post-harvest conditions (Gram et al., 2002). The growth of food spoilage microorganisms and subsequent toxin secretion depend on chemical nature or ingredients of the substrate and different physical parameters such as pH, atmosphere, temperature, and relative humidity of the environment. Although every food commodity harbors specific microflora, secretion of toxins is largely associated with unlimited growth and favorable climatic as well as environmental conditions. Different species of bacteria and fungi have been reported to produce health hazardous and toxic metabolites (bacterial toxins and mycotoxins) in food system, which upon consumption can cause severe illness or even death of humans and animals (Bhunia, 2018). The most commonly encountered toxins produced in food by bacteria include emetin and enterotoxin by Bacillus sp. (Griffiths and Schraft, 2017), hemolysin and leucotoxins by Staphylococcus sp. (Otto, 2014), botulinum toxin by Clostridium sp. (Williamson et al., 2016), cytolethal distending toxin (CDT) by Campylobacter sp. (He et al., 2019), typhoid toxin by Salmonella sp. (Gal
an, 2016), shiga toxin by some species of Shigella, and Escherichia coli (Lamba et al., 2016) and cholera toxin by the Vibrio species. In addition to bacteria, fungi pose second major threat to human health. These fungi include the species of Aspergillus, Fusarium, and Penicillium, which produce several hundreds of mycotoxins in foods. Among different mycotoxins known so far, aflatoxin produced by Aspergillus sp., ochratoxins by Aspergillus and Penicillium sp., fumonisins and zearalenones by Fusarium sp. are the momentous concern due to their mutagenic, carcinogenic, teratogenic, immunosuppressive, nephrotoxic, and estrogenic hormone suppressive properties upon acute

Functional and Preservative Properties of Phytochemicals. https://doi.org/10.1016/B978-0-12-818593-3.00006-3 Copyright © 2020 Elsevier Inc. All rights reserved.

166

Functional and Preservative Properties of Phytochemicals

exposure (Marroquín-Cardona et al., 2014; Chaudhari et al., 2019). Bhat et al. (2010) reported that approximately 1000 million metric tons of food commodities are spoiled due to molds and mycotoxin contamination globally. Several physical strategies like heat, irradiation and microwave-assisted treatments, and synthetic chemical preservatives have been used to remove these microbial toxins from contaminated foods; however, their adverse effect on food properties and residual toxicity to nontarget organisms can persuade the industrial sectors to develop some alternatives which are safe and ecofriendly in nature. Since past few years, different plant-derived secondary metabolites have been reported to act as an alternative food preservative to the chemical ones due to their potential antimicrobial activity as well as toxin degrading properties. Phytochemical is a broad term referring to a wide array of compounds that occurs naturally in plants and can be classified into different classes viz. terpenes, phenolics, flavanoids, bioactive compounds, etc. (Barbieri et al., 2017). Among terpenes, essential oils (EOs), volatile constituents made up of blended mixture of mono- and sesquiterpenes, are reported to be present in different parts of the plants. Different investigators have reported the antibacterial, antifungal, and antiaflatoxigenic properties of EOs and at the same time have also been claimed for their utilization as safe plant-based preservatives to protect the food items from microbial toxinemediated degradation thereby enhancing their shelflife (Burt, 2004; Kalemba and Kunicka, 2003; Kordali et al., 2005; Pandey et al., 2017; Fadil et al., 2018; Mehalaine et al., 2018; Sabo et al., 2019; Wi
nska et al., 2019). Based on the above background, the article presents a detailed account on the role of different phytochemicals to overcome the challenge associated with foodborne toxicity caused by different bacterial and fungal pathogens. Further, the chapter addresses the important factors responsible for toxin secretion in foods, detection techniques for foodborne microbial toxins, and protection of food products by using important classes of phytochemicals.

2.

Microbial toxins in food system

Foods are commonly contaminated with bacteria, fungi, protozoa and their associated toxins causing serious illness, and regular consumption of the contaminated foods causes severe human health disorders in different regions of the world. Majority of mold species easily proliferate on the food system and secrete low molecular weight mycotoxins leading to major losses of different food substances. Scallan et al. (2011) reported 9.4 million foodborne illness, 1351 deaths and 55,961 hospitalizations in United Kingdom in each year. In Germany and France, shiga toxin secreted by Escherichia coli O104:H4 causing vast food poisoning has been reported for the death of millions of people (Frank et al., 2011). Till now, different types of bacterial food poisoning, viz. infection, intoxication, and secretion of enterotoxin have been reported. Several researchers have classified the food poisoning toxins into in general TX group. Heat labile, heat stable, verotoxin, and several proteinaceous toxins are known to be secreted by a number of food poisoning bacteria such as Campylobacter spp., Aeromonas spp., Salmonella spp. and Vibrio cholerae (Rose et al., 1989). Seven different

Foodborne microbial toxins and their inhibition by plant-based chemicals

167

toxins affecting neuromuscular system were detected in the food contaminated by Clostridium botulinum and C. tetani affecting Zn2þ transportation in neuronal proteins (Montecucco and Schiavo, 1994). Mycotoxin secretion is stimulated by a variety of environmental factors such as altered geographical variations, susceptible food bioactives, toxigenic races of fungi, and variable agricultural processing. Common filamentous mold species that easily sporulate and secrete mycotoxins in food systems under postharvest conditions are Aspergillus spp., Fusarium spp., Penicillium spp., Alternaria spp., and Cladosporium spp., while, species of Trichoderma and Trichothecium are major contaminants of different food products in the preharvest conditions (Snyder et al., 2019). Molds have been placed at the second rank for food grain damage after insect pests. Traditional harvesting practices, improper packaging, and less drying of food products easily contaminate the products with a major risk of mycotoxin occurrence (Bhat et al., 2010). The mold species are colonized as saprophytic, parasitic, and symbiotic agents in the food substrate and degrade different food chemicals such as carbohydrates, vitamins, proteins, and enzymes. However, pH, moisture, and water activity (aw) level may significantly contribute to food contamination in pre- and postharvest conditions (Suhr and Nielsen, 2004). Diverse toxicological nature and synergistic behavior of secondary metabolites has made the mycotoxins under the category of “common risk factor” for livestock as well as human beings. In consideration, varieties of mycotoxins with their potential health hazards have been listed. Among them aflatoxins, fumonisins, ochratoxins, patulin, deoxynevalenol, trichothecenes, and zearalenone are of common occurrence. However, other mycotoxins that are frequently detected in the food commodities are citrinin, fusaric acids, penicillic acids, cyclopiazonic acids, mycophenolic acids, sterigmatocystin, and gliotoxin (Bhat et al., 2010). Recent report of Venkatesh and Keller (2019) suggests that bacterial association enhances mycotoxin secretion in different species of Fusarium by inducing chlamydospore formation. In addition, cocontamination of Alternaria tenuissima and Fusarium culmorum in food system also stimulates the synthesis of zearalenone and deoxynivalenol by F. culmorum (Muller et al., 2012). Aflatoxins are commonly occurring foodborne mycotoxins secreted by Aspergillus flavus, Aspergillus parasiticus, and Aspergillus nomius. Four major types of aflatoxins (AFB1, AFB2, AFG1, and AFG2) are commonly isolated from food system (Barac, 2019). Aflatoxin M1 (AFM1) and aflatoxin M2 (AFM2) are hepatic metabolites of AFB1 and AFB2, respectively. AFB1, B2, G1, and G2 have been classified under class 1 human carcinogen, while AFM1, sterigmatocystin, and ochratoxins are classified into class 2B. Wu and Santella (2012) reported that synergistic interaction between AFB1 and hepatitis B virus can significantly promote the prevalence of liver cancers in human beings. Fumonisins are commonly secreted in maize products and are basically produced by Fusarium proliferatum and Fusarium verticillioides. Fumonisin contamination in silages and baby foods (maize products) leading to neural tube defects in several regions of South Africa and Netherlands is recognized. Fumonisin exhibits very low oral bioavailability in the range of 2%e3% which is generally excreted through bile (Fink-Gremmels and van der Merwe, 2019). Trichothecenes are primary byproducts of Stachybotrys atra and have been used as bio warfare agent. C12 and C13

168

Functional and Preservative Properties of Phytochemicals

epoxides of trichothecenes are reported to generally substitute the C3 and C4 positions and efficiently inhibit 60S ribosomal subunit of protein synthesis pathway. Trichothecenes directly act on protein synthesis based on peptidyl transferase like aflatoxin metabolic adducts formation. Modified synthesis of immunoglobulins and lymphocyte formation is actively regulated upon exposure to combinations of trichothecenes A and B. Furthermore, diacetoxyscirpenol (a potent trichothecenes A) actively regulates the development of advanced malignancy and alimentary toxic aleukia. Zearalenone, an estrogenic pollutant in human and animals directly acts on MCF7 human breast carcinoma (Shier et al., 2001). Mechanism of toxicity of different bacterial and fungal mycotoxins gives a definitive cornerstone idea for biological plausibility and causation factors. Bacterial toxins mainly affect the host cellular membranes leading to formation of pores and ultimately causing haemolysis of cells. Sphingomyelinase b toxins secreted by Streptococcus aureus covalently cross the plasma membrane and promote the formation of biofilms in endocarditis infections (Huseby et al., 2010). Different species of Staphylococcus are reported to develop phenol-soluble surfactant-like toxins with at least eight genes (PSM a1, a2, a3, b1, b2, b3, PSM-mec, and delta toxin) in short peptides causing disintegration of cellular membrane and respiratory systems (Li et al., 2015). Shiga toxin secreted by Shigella dysenteriae causes immunomodulatory effect on endothelial cells, with offensive metabolite utilizing activity. Other classes of foodborne bacterial toxins that facilitate endospore formation are botulinum toxin, tetanus toxin, and zincdependent proteases that confer human illness as well as neuromuscular disorders. Enhanced transmission in different cellular organelles may change the plasma membrane antigen specificity receptors. Toxins produced by members of Yersinia, Staphylococcus, and Streptococcus cause changes in major histocompatibility complex and T-cell antigen receptor with trace level expression of superantigens (Xu and Mccormick, 2012). Among different mycotoxins, aflatoxins have been classified as class 1 human carcinogen and actively participate in the development of guanine N7 adduct and aflatoxin 8, 9 exoepoxides (Kumar et al., 2018). It also causes transition and transversion mutation in cellular system, as well as liver injury by hepatotoxic carcinoma development. Moreover, fumonisin also possesses considerable carcinogenic property with potential role in inhibition of ceramide kinase inflammatory pathways (Riley and Merrill, 2019). Trichothecene T2 may also alter leukocyte development, reduce hypersensitivity, and induce the depletion of antibody formation. A range of ochratoxins are described to severely disrupt the cellular respiration and ATP generation and subsequently hamper protein synthesis by aminoacyl acyl t RNA containing phenylalanine (Creppy et al., 1983).

3.

Factors affecting microbial toxins secretion in food system

Food systems are vital source of carbohydrate, proteins, fatty acids, and different types of minerals and ions which provide a pivotal platform for growth and proliferation of microbes and biosynthesis of several toxins upon onset of favorable physiological and

Foodborne microbial toxins and their inhibition by plant-based chemicals

169

environmental conditions (Corlett Jr, 1987). Several examples of mutualistic association of microbes with A. flavus and A. parasiticus actively participating in enhanced secretion of aflatoxins in food products are well documented. Negative correlation between bacterial species in relation to mycotoxin degradation was reported in Streptococcus lactis. Cureo et al. (1987) have reported frequent occurrence of Bacillus amyloliquefaciens and Hyphopichia burtonii with fungi contaminating maize grains causing stimulation of aflatoxin biosynthesis. Micronutrients of food commodities such as metal ions can also induce mycotoxin secretion in maize and chicken products. Versicolorin, a potent intermediate of aflatoxin biosynthesis, was stimulated by different concentrations of cadmium in growth media. Also, the differential role of ethylene in aflatoxin secretion in foods has been described by Tiwari et al. (1986) and Failla and Niehaus (1986). Genetic resistance and development of hybrid vigor are major factors that facilitate Fusarium spp. infestation in maize and mycotoxin secretion at variable temperature periods, rainfall, and maturation phases (Marasas et al., 2000). Millers (2001) suggested impact of drought stress on Fusarium verticillioides infection and fumonisin production in food system. Moreover, annual recurrence of insect pest also facilitates the fumonisin contamination in maize kernels. In postharvest storage condition, stimulation of deoxynivalenol by F. verticillioides was reported by Velluti and coworkers (2001). Several species of Aspergillus are reported to actively participate in inhibition of Fusarium growth without affecting the fumonisin production. All the fungal species and their mycotoxins can be regulated and coordinated by complex interaction of temperature, pH, relative humidity, water activity of substrate, and their genetic regulations (Marin et al., 2013). Fungal infestation that causes necrosis in food products may be regulated by differential expression of pH regulators with specific virulence factors (Alkan et al., 2013). In addition to fungal infestation, bacterial poisoning of food commodities is one of the major issues throughout the world, especially in Asian countries. Mostly enterotoxigenic bacteria severely contaminate food commodities which cause an outbreak of diarrhea, vomiting, epilepsy, lowering of blood pressure, and gastrointestinal disorders. According to an estimation of World Health Organization (WHO), 22 enteric foodborne pathogens are major burden of foodborne diseases (Keisam et al., 2019). Major groups of enterotoxin secreting bacteria such as Bacillus cereus, Staphylococcus aureus, Clostridium perfringens, Escherichia, Salmonella, Campylobacter spp., Yersinia enterocolitica, Brucella spp., and Listeria monocytogenes cause food poisoning based on their genetic regulations and environmental effects (Bennett et al., 2013). Enteritis, botulism, shigellosis, hepatitis A, and histamine poisoning are directly linked to the etiological behavior and different fatality rates. A schematic diagram of variable factors affecting microbial growth and toxin secretion is presented in Fig. 6.1.

4. Detection of microbial toxins in food system Foodborne diseases, originated by different pathogenic microorganisms which include bacteria, viruses, fungi, mycoplasma, etc., are the most serious human health concerns

170

Functional and Preservative Properties of Phytochemicals

Food system Major ingredients Carbohydrate

Protein

Fatty acids

Ions and minerals

Suitable platform for bacterial, fungal infestation and toxin secretion

Fungal toxins

Bacterial toxins Clostridium, Salmonella,

Enterobacter, Bacillus

and

Vibrio spp. Entrotoxins and Heat labile toxins

Aspergillus flavus, A. parasiticus, A. candidus, Cladosporium cladosporoides, Alternaria alternata Fusarium oxysporum and F. verticilloides Aflatoxins, Fumonisins, Zearalenone, deoxynivalenole, ochratoxin, patulin and trichothecene

Environmental factors

Abiotic factors

Genetic factors

Temperature, rainfall, Relative humidity and maturation periods

pH, Moisture content and Aw

Transcriptome, metagenomics, sequencing, genetic resistance and hybrid vigour

Variable synthesis and regulation in food system

Figure 6.1 Factors affecting microbial growth and toxin secretion.

of the current generation. Salmonella sp., Listeria sp., Campylobacter sp., Escherichia sp., and Bacillus sp. have been categorized under etiologic agents of food contamination (Fusco and Quero, 2012). Not only bacterial contamination, but fungal contamination is also responsible for huge economic losses of agricultural food commodities up to 30% per year during the postharvest storage conditions (Rao et al., 2019). Therefore, WHO has documented food contamination as a global challenge and stated that “food contaminations that occur in one place may affect the physical condition of clients living on the other side of the globe” (Hussain, 2016). To overcome these economic losses, numerous advanced technologies have been employed for identification of pathogens and toxin quantification in order to ensure food sustainability and safety (Ge and Meng, 2009) along with the detailed information regarding genetic and metabolic profiling of the organisms (Pillai, 2004). Different instrumentation techniques for

Foodborne microbial toxins and their inhibition by plant-based chemicals

171

identification, detection, and quantification of microbial toxins (Fig. 6.2, Tables 6.1 and 6.2) occurring in food and food products under different environmental conditions are briefly presented.

4.1

Thin layer chromatography

TLC is based on the stationary and mobile phase where components move according to their affinities toward adsorbent. The solvent (mobile phase) is drawn up due to capillary action over the surface of the stationary phase. During movement, the compounds with higher affinity to mobile phase move faster while others move slower. Thus, components separated from the mixture (Bele and Khale, 2011) are used for identification, and quantification of microbial toxins. TLC is a commonly used technique due to its ease in operation, sensitive analysis, specificity, and high sample throughput properties. Ochratoxin and aflatoxins contamination in maize, wheat, triticale, and rye are reported to be separated by TLC (Braicu et al., 2008).

4.2

High-performance liquid chromatography

HPLC is a column chromatography in which mobile phase is liquid while stationary phase may be either liquid or solid. In HPLC, mobile phase is pumped through high

Figure 6.2 Instrumentation techniques for detection and quantification of microbial toxins produced under different environmental conditions.

Table 6.1 Important characterization and quantification techniques for bacterial toxins. Assay

Organisms

Treatment type

Food matrices

Limit of detection (LOD)

Limit of quantification (LOQ)

References

Nucleic acid based

Salmonella enteritidis

Nanoparticles

Raw milk

8 CFU/mL

24 CEU/mL

Bai et al. (2013)

Listeria monocytogenes

Nanoparticles centrifugation

Raw milk, salad

13 CFU/mL 103e105 CFU/mL

39 CFU/mL 3103e105 CFU/mL

Bai et al. (2013), Isonhood et al. (2006)

Escherichia. coli O157:H7

Metal hydroxide Filtration

Ground beef

103 CFU/mL

3  103 CFU/mL

Taylor et al. (2005), Cui et al. (2003)

Campylobacter jejuni

Immunomagnetic separation

Milk

1 CFU/mL

3 CFU/mL

Waage et al. (1999)

Salmonella typhimurium

ELISA

MilkJuice

107 cells/mL 106 cells/mL

3  107 cells/mL 3  106 cells/mL

Chattopadhyay et al. (2013)

E. coli O157:H7

Immunomagnetic separation

Vegetable Milk

6.8  102 CFU/mL 6.8  103 CFU/mL

20.4  102 CFU/mL 20.4  103 CFU/mL

Shen et al. (2014)

Botulinum neurotoxin serotypes B

Centrifugation

Milk

39 pg/mL

117 pg/mL

Scotcher et al. (2010)

Vibrio cholerae

Lateral flow immunoassay

Seafood

5105e106 CFU/ mL

15105e106 CFU/mL

Chaivisuthangkura et al. (2013)

Immunological based

Biosensor

FTIR

C. jejuni

Surface Plasmon resonance (SPR) immunosensor

Chicken

103 CFU/mL

3  103 CFU/mL

Wei et al. (2007)

E. coli O157:H7

SPR immunosensor

Milk, juice, beef Cucumber Iceberg lettuce

102e103 CFU/mL 3.4  103 to 1.2  105 CFU/ mL 10 CFU/mL

3102e103 CFU/mL 10.2  103 to 3.6  105 CFU/mL 30 CFU/mL

Waswa et al. (2007), Taylor et al. (2006), You et al. (2011)

Listeria innocua

Impedimetric biosensor

milk

105 CFU/mL

3  105 CFU/mL

Tolba et al. (2012)

Bacillus cereus

Filtration

Alfalfa, strawberries, lettuce, tomato

35 CFU/mL

105 CFU/mL

Pal et al. (2008)

E. coli, Bacillus subtilis, and Salmonella enterica

-

Sterile and contaminated solution

e

e

Quintelas et al. (2015)

Table 6.2 Instrumentebased characterization and quantification techniques of mycotoxins. Limit of detection (LOD)

Limit of quantification (LOQ)

0.3e1 mg/kg

0.9e3 mg/kg

Pons and Franz (1978)

Technique

Toxin

Detection type

Food commodities

HPLC

AFB1, AFB2

UV detector

e

AFG1, AFG2 AFB1 Citrinin Ochratoxin

Fluorescence

Rice

0.3e1 mg/kg 0.07 mg/kg 0.11 mg/kg 0.08 mg/kg

0.9e3 mg/kg 0.21 mg/kg 0.33 mg/kg 0.24 mg/kg

Pons and Franz (1978), Nguyen et al. (2007)

Fumonisin

OePhthalaldehyde postcolumn derivatization followed by fluorescence detector

corn

10 mg/kg

30 mg/kg

Akiyama et al. (1997)

Ochratoxin A

HPLC followed by immunoaffinity cleanup

wine

0.01 ng/mL

0.03 ng/mL

Visconti et al. (1999)

AFB1, AFB2, AFG1, AFG2, citrinin

Fluorescence

e

e

e

Betina (1985)

AFM1

Fluorescence with sulfuric spray

e

0.5 mg/kg

1.5 mg/kg

Serralheiro and Quinta (1985)

Aflatoxin

fluorescence

Peanut

e

e

Tosch et al. (1984)

TLC

HPTLC

References

AFB1, AFB2, AFG1, AFG2, Ochratoxin A

e

e

1 mg/kg and 50 mg/kg

3 mg/kg and 150 mg/kg

Aiko and Mehta (2015)

AFM1, Ochratoxin A, Zearalenone

With electrospray ionization triple quadrupole tandem mass spectrometry

Milk

0.003e0.015 mg/ kg

0.009e0.045 mg/ kg

Huang et al. (2014)

GC-MS

Trichothecenes

Heptafluorobutyric anhydride

Corn

10e40 mg/kg

30e120 mg/kg

Aiko and Mehta (2015), Milanez and ValenteSoares (2006)

Fluorescence microscopy

AFM1

With surface plasmon

Milk

0.6 pg/mL

1.8 pg/mL

Wang et al. (2009)

FTIR

DON

Near infrared spectroscopy

Wheat kernel

400 mg/kg

1200 mg/kg

Pettersson and Aberg (2003)

AFB1, Ochratoxin

Near infrared spectroscopy

Red paprika

e

e

Hernandez-Hierro et al. (2008)

AFB1

Rice

0.02 ng/kg

0.06 ng/kg

Reddy et al. (2009)

Fumonisin

beer

3 ng/mL

9 ng/mL

Torres et al. (1998)

LC-MS

ELISA

Radioimmunoassay (RIA)

AFB1

Solid-phase RIA

Corn, wheat

e

e

Sun and Chu (1977)

Ochratoxin A

e

Food and feed stuff

1 mg/kg

3 mg/kg

Fukal (1990) Continued

Table 6.2 Instrumentebased characterization and quantification techniques of mycotoxins.dcont’d Food commodities

Limit of detection (LOD)

Limit of quantification (LOQ)

References

Technique

Toxin

Detection type

Lateral flow immunoassay

Aflatoxin B1

e

Chili, pig feed

2 mg/kg

6 mg/kg

Saha et al. (2007), Delmulle et al. (2005)

Ochratoxin A

e

Chili

10 mg/kg

30 mg/kg

Saha et al. (2007)

Deoxynivalenol

Colloidal gold-based

Wheat

1500 mg/kg

4500 mg/kg

Kolosova et al. (2007)

Zearalenone

Colloidal gold-based

Wheat

100 mg/kg

300 mg/kg

Kolosova et al. (2007)

T2 toxin

e

Wheat and oat

e

e

Molinelli et al. (2008)

AFM1

e

Milk

e

e

Zhang et al. (2012)

AFB1

e

Groundnut, corn, wheat, cheese, chili

8 pg/mL

24 pg/mL

Aiko and Mehta (2015)

Ochratoxin A

e

Food and feed stuff

30 pg/mL

90 pg/mL

Aiko and Mehta (2015)

Zearalenone

e

Food and feed stuff

15 pg/mL

45 pg/mL

Aiko and Mehta (2015)

Signal amplification method

Foodborne microbial toxins and their inhibition by plant-based chemicals

177

pressure; hence, it gives high speed and high performance as compared to traditional column chromatography. In HPLC, resolution power is high and analysis time is short as compared to classical column chromatography because it permits us to employ very small size particle as packing material in column that gives high surface area for interactions between the molecules flowing in it and stationary phase (Kazakevich and LoBrutto, 2007; Sahu et al., 2018). This analysis was done to estimate the Aflatoxin contamination in Andrographis paniculata (Mishra et al., 2015) and Pistacia vera (Dwivedy et al., 2018) during storage condition.

4.3

High-performance thin layer chromatography

HPTLC is an extension of thin layer chromatography (TLC), which is rapid, robust, simple, and efficient tool in quantitative analysis of compounds. The working principle of HPTLC is based on the separation of components on their different affinity for a stationary phase and their differential solubility in a moving phase. The HPTLC profile disclosed the remarkable degradation of andrographolide content of raw materials of Andrographis paniculata during storage due to A. flavus contamination (Mishra et al., 2015).

4.4

Gas chromatography-mass spectroscopy

GC-MS is a combination of two analytical techniques, gas chromatography (GC) and mass spectrophotometry (MS). The samples are swept through the gas column where it is fragmented and sorted by mass to form a fragmented pattern and detected by MS (Hussain and Maqbool, 2014). GC-MS analysis is an efficient instrument to identify the presence of O-nitrophenol and indole, released from bacterial cells (Hameed et al., 2018).

4.5

Liquid chromatography-mass spectroscopy

Here, the separation of individual components of a mixture occurs on the basis of their mass/charge ratio and then subjected to an electron multiplier tube detector for identification and quantification (Pitt, 2009). LC-MS is used for detection of low molecular weight toxic components and residues in the food system. It is extensively used for quantification of DON, T-2 toxin, ZEN, AFs, OTA, and Alternaria toxin from maize, barley, peanuts, and other food commodities (Malachov
a et al., 2018; Ostry, 2008).

4.6

Matrix-assisted laser desorption ionization-time of flight mass spectroscopy

In this technique, samples are fixed in a crystalline matrix and are bombarded by a laser to make them ionized in MALDI-TOF mass spectrometer. Thereafter, based on mass to charge ratio, samples are analyzed by the time it takes for the ions to arrive at the detector. The high performance and potential of this technique are used for

178

Functional and Preservative Properties of Phytochemicals

identification of species and strain of Fusarium sp. (Dong et al., 2009; Kemptner et al., 2009), as well as characterization of the aflatoxigenic and nonaflatoxigenic strain of Aspergillus sp. (El Sheikha, 2019). MALDI-TOF has also been used for detection of Bacillus sp., Brucella sp., Yersinia sp., Francisella sp., and Burkholderia sp. (Lasch et al., 2016) in food samples.

4.7

Fourier transforms infrared spectroscopy

FTIR is infrared (IR) spectrumebased instrumentation technique used for characterization of substance within the specified wavelength range. It is coupled with the vibrations of excited molecules through IR beam and then the absorbance spectrum gives specific peaks that represent a distinctive feature of any chemical substance (Hameed et al., 2018). Ellis et al. (2004) have demonstrated the significant role of FTIR for quick detection of microbial contamination on meat surface.

4.8

Nucleic acidebased techniques

Nucleic acidebased tools have been rapidly used for detection, identification, and typing of those microorganisms which are associated with milk and dairy products. It may be done through polymerase chain reaction (PCR) and its derivatives, realtime PCR, fluorescent amplified fragment length polymorphism (FAFLP), etc. It has been extensively used in dairy industries due to its rapid outputs, high specificity, reproducibility, simplicity, and low detection limits (Lui et al., 2009). Sastalla et al. (2013) have identified hemolysin BL, nonhemolytic enterotoxin, enterotoxin T, and cytotoxin K contamination secreted from Bacillus cereus in the food system through this technology. PCR-based methodology has also been extensively used for the recognition of Aspergillus, Penicillium, and Fusarium strains as food contaminants (Konietzny and greiner, 2003).

4.9

Immunological-based techniques

An immunological-based technique works on the specific binding phenomenon of the antigen and antibodies (Hameed et al., 2018). Here, immunological reactions take place with various toxins which may help to distinguish the type of contamination in the food system. Hemagglutination, coagglutination, enzyme-linked immunosorbent assay (ELISA), enzyme-linked immunofiltration assay, reverse passive latex agglutination (RPLA), lateral flow immunoassay (LFI), and radioimmunoassay (RIA) are some immunological-based techniques for detection of microbial toxins (Pimbley and Patel, 1998). ELISA is rapidly used for detection of botulinum toxins, various enterotoxins produced by E. coli and for Staphylococcal enterotoxins A, B, C, and E (Foley and Grant, 2007). It is one of the most versatile immunoassay approaches in food diagnostics and assessment of food poisoning (V€alimaa et al., 2015; Nagaraj et al., 2016). This test is commercially offered for the recognition of mycotoxins, viz. AFM1, AFB1, DON, OTA, ZEA, T-2 toxin, fumonisin, trichothecenes, and citrinin in several foodstuffs (Goryacheva et al., 2007). Besides, by using

Foodborne microbial toxins and their inhibition by plant-based chemicals

179

immune-chromatographic approaches, viz. lateral flow immunoassay L. monocytogenes contamination in milk samples were detected (Cho and Irudayaraj, 2013). Blazkova et al. (2009) quantified Listeria sp. in milk sample with the use of lateral flow immunoassay with PCR.

4.10

Biosensor for toxin determination

The biosensor is a chemical sensing apparatus consisting of two main parts: i) biological components and ii) electronic parts that convert the biological response into electrical signal and further quantification with different physicochemical methods (Hameed et al., 2018). It has been improvised for real-time, rapid onsite and multiple analyses for bacterial and toxins detection in perishable and semiperishable food items (Baeumner et al., 2003; Bae et al., 2004; Shahdordizadeh et al., 2017).

4.11

Fluorescence microscopy

Fluorescence microscopy allows selective examination of a particular component in the form of fluorescence that results from the absorption of photons (Coling and Kachar, 1998). Boenisch and Sch€afer (2011) have reported the identification of Fusarium graminearum infection through fluorescence microscopy. Recently, the emergence of nanotechnology in food industries has also been proved as a unique approach for the detection of microbial toxins. Zhao et al. (2004) prepared dye-doped silica nanoparticles, and these particles were conjugated with E. coli O157: H7 antibodies for detection of bacterial contamination in ground beef within 20 min. In addition, nanotechnology along with microfluidic system has been successfully used to detect pathogens and their associated toxins (Ge and Meng, 2009). Verdoodt et al. (2017) have estimated Lactobacillus and Staphylococcus aureus contamination in food samples with the help of colorimetric biosensor and gold nanoparticles.

5. Safety limits in food system Sustainable nutrition, production, and food security are the major themes within the United Nations Sustainable Development Goals (UN, 2015). But, several pieces of literature have looked at the food-related health threats due to unprotected food consumption (Ohri-Vichaspati, 2014; Petruzzelli et al., 2018a,b). For that, the global food sectors announced different policies, standard regulations, and guidelines related to food safety (King et al., 2017). The European regulatory units have designed strict hygienic rules to ensure the safety of the end products that are mainly based on instructions written according to the Codex Alimentarius (2009) and included in the internationally recognized system, i.e., Hazard Analysis and Critical Control Point (HACCP) guideline (Trafialek et al., 2019). The HACCP approach is a precautionary approach to microbiological quality control and is planned to check problems before they happen rather than finding

180

Functional and Preservative Properties of Phytochemicals

them in the finished product (Smith et al., 1990). To ensure the safety of food system from microbial contamination, regulation 852/2004 requires up-to-date verification of the working status of HACCP by business operators (Powell et al., 2013; Trafialek and Kolanowski, 2014, 2017). Therefore, different regulatory organizations such as the Food and Agriculture Organization (FAO), Food and Drug Administration (FDA), World Health Organization (WHO) have confirmed the safety limit of microbial toxins in the food system. For example, regulatory risk assessment has defined the acceptable limits of bacterial toxins as 1 CFU/25 g in beverages, 5 CFU/25 g in meat products, 1 CFU/25 g in eggs and milk for E. coli: O157, 103 CFU/g in Alfalfa sprouts for Salmonella sp. (Bisha and Brehm-Stecher, 2009, 2010), and 103 CFU/g in milk for Bacillus cereus (Laflamme et al., 2009). Not only bacterial contamination, but fungal contamination in food system also affects human health by releasing several toxic secondary metabolites, i.e., mycotoxins. Therefore, several regulatory authorities have set the limits to control the risk of health hazards for balancing food security. For example, Joint FAO/ WHO Expert Committee on Food Additives (JECFA) have suggested the provisionally most tolerable daily intake for fumonisin as 10

Da Porto et al. (2017)

e

>8

Da Porto et al. (2014)

CO2 þ 20% EtOH

e

0.329; 2.18; 0.47

Yilmaz et al. (2011)

CO2 þ 20% EtOH

e

0.788; 0.35

Yilmaz et al. (2011)

t (min)

Extraction solvent (%)

40

0.8

6

900

CO2 þ 20% EtOH-H2O at 57% (v/v)

Grape seeds

40

0.8

6

900

CO2 þ 20% EtOH-H2O at 57% (v/v)

Oligomers of proanthocyanidins

Grape seeds

40

0.8

6

900

CO2 þ 20% EtOH-H2O at 57% (v/v)

Gallic acid, epigallocatechin, and epigallocatechin gallate

Grape seeds

50

3

0.3

60

Catechin and epicatechin

Grape seeds

30

3

0.3

60

Phenolic compounds

Grape seeds

Monomers of proanth ocyanidins

T, temperature; p, pressure; Q CO2, solvent flow rate; t, extraction time; *Standard liter/min.

References

Functional and Preservative Properties of Phytochemicals

Q CO2 (kg/h)

Source

T (8C)

Extraction yield (%, w/w)

p (MPa)

Phytochemical extracted

230

Table 7.5 Supercritical fluid extraction applications devoted to the extraction of phytochemicals from agri-food by-products.dcont’d

Recent advances in extraction technologies

231

57% (v/v), at 40 C, 0.8 MPa, and a CO2 flow rate of 6 kg/h (Da Porto and Natolino, 2017). Despite finding that decreasing pressure and increasing cosolvent, the total phenolic content was higher, earlier research studies using a single SFE step found the opposite. One example is the research carried out by Yilmaz et al. (2011) who reported that the amount of epigallocatechin was increased when pressure and the percentage of ethanol was increased. Due to the heterogeneity of the compounds present in the agri-food industry, the optimization of the extraction system is decisive to extract the compounds of interest.

3.7

Gas expanded liquids

A variation of SFE is GXLs. In this case, the liquids are expanded with a gaseous cosolvent, e.g., CO2 or ethane. The most commonly used class of GXLs is CXLs in which a variation in the CO2 composition, a continuum of liquid media ranging from neat organic solvent to scCO2 will be generated (Herrero et al., 2017). Most GXL applications have been focused on the extraction of mainly pigments, carotenoids, and fatty acids from algae (Gilbert-L
opez et al., 2015; Reyes et al., 2014; Golmakani et al., 2012) and phytochemicals such as phenolic compounds from plant materials such as Moringa oleifera leaves (Rodríguez-Pérez et al., 2016a, 2016b). However, there is still a lack of research focused on the use of this extraction system for revalorizing agri-foods by-products. In this regard, Fuentes-G
andara et al. (2019) employed a downstream chemical fractionation using SFE followed by CXLs for the extraction of fatty acids, terpenes, or flavonoids from Helianthus annuus L. (sunflower) leaves. For this purpose, authors tested CO2 þ 50% EHOH/H2O mixtures varying the percentage of ethanol in water from 0% to 100%. The combination of the properties of typical solvent liquids with the transporting properties of supercritical fluids using of CXLs showed higher extraction yields compared to the use of SFE. The highest yield (w39%) was obtained using CO2/EtOH/H2O in the following proportions 50:25:25, respectively, 400 bars at 55 C for 4 h, and those parameters also allowed the recovery of compounds with different polarity range such as fatty acids, sesquiterpenes, triterpenes, sterols, diterpenes, flavonoids, lignans, and bisnorsesquiterpene. Despite very promising results in terms of extraction of bioactive compounds from several plant matrices and algae that have been described so far, GXL is a very promising extraction system that deserves to be exploited.

4. Concluding remarks The applications described in this chapter show the great potential of valorizing agrifood by-products. In fact, by-products used as sustainable ingredients or sources of bioactive compounds have been shown to be effective for a wide range of technological and nutritional purposes in food and cosmetic industry. This approach not only takes a step forward to waste reduction in the food chain but also offers new ways

232

Functional and Preservative Properties of Phytochemicals

to diversify the production of agri-food products, creating the possibility of satisfying a market niche based on functional and sustainable products. On the other hand, it is necessary to evaluate the perception of consumers and potential safety on the use of by-products in food and cosmetic formulations.

References Abuajah, C.I., Ogbonna, A.C., Osuji, C.M., 2015. Functional components and medicinal properties of food: a review. Journal of Food Science & Technology 52 (5), 2522e2529. https://doi.org/10.1007/s13197-014-1396-5. Ajila, C.M., et al., 2010. Mango peel powder: a potential source of antioxidant and dietary fiber in macaroni preparations. Innovative Food Science & Emerging Technologies 11 (1), 219e224. https://doi.org/10.1016/j.ifset.2009.10.004. Al Bittar, S., et al., 2013. An innovative grape juice enriched in polyphenols by microwaveassisted extraction. Food Chemistry 141 (3), 3268e3272. https://doi.org/10.1016/j.foodchem.2013.05.134. Elsevier Ltd.
Alvarez, M.V., et al., 2015. Exploring feasible sources for lutein production: food by-products and supercritical fluid extraction, a reasonable combination. Phytochemistry Reviews 14 (6), 891e897. https://doi.org/10.1007/s11101-015-9434-0.
Alvarez-Casas, M., et al., 2014. Effect of experimental parameters in the pressurized solvent extraction of polyphenolic compounds from white grape marc. Food Chemistry 157, 524e532. https://doi.org/10.1016/j.foodchem.2014.02.078. Ameer, K., Shahbaz, H.M., Kwon, J.H., 2017. Green extraction methods for polyphenols from plant matrices and their byproducts: a review. Comprehensive Reviews in Food Science and Food Safety 16 (2), 295e315. https://doi.org/10.1111/1541-4337.12253. Arruda, H.S., et al., 2019. Effects of high-intensity ultrasound process parameters on the phenolic compounds recovery from araticum peel. Ultrasonics Sonochemistry 50, 82e95. https://doi.org/10.1016/j.ultsonch.2018.09.002. Elsevier (August 2018). Ayala-Zavala, J.F., et al., 2011. Agro-industrial potential of exotic fruit byproducts as a source of food additives. Food Research International 44 (7), 1866e1874. https://doi.org/10.1016/ j.foodres.2011.02.021. Elsevier Ltd. Balasundram, N., Sundram, K., Samman, S., 2006. Phenolic compounds in plants and agriindustrial by-products: antioxidant activity, occurrence, and potential uses. Food Chemistry 99 (1), 191e203. https://doi.org/10.1016/j.foodchem.2005.07.042. Ballard, T.S., et al., 2010. Microwave-assisted extraction of phenolic antioxidant compounds from peanut skins. Food Chemistry 120 (4), 1185e1192. https://doi.org/10.1016/j.foodchem.2009.11.063. Elsevier Ltd. Banerjee, J., et al., 2017. Bioactives from fruit processing wastes: green approaches to valuable chemicals. Food Chemistry 225, 10e22. https://doi.org/10.1016/j.foodchem.2016.12.093. Elsevier Ltd. Berman, J., et al., 2015. Nutritionally important carotenoids as consumer products. Phytochemistry Reviews 14 (5), 727e743. https://doi.org/10.1007/s11101-014-9373-1. Bobinait_e, R., et al., 2015. Application of pulsed electric field in the production of juice and extraction of bioactive compounds from blueberry fruits and their by-products. Journal of Food Science & Technology 52 (9), 5898e5905. https://doi.org/10.1007/s13197-0141668-0.

Recent advances in extraction technologies

233

B€ oger, B.R., et al., 2018. Optimization of ultrasound-assisted extraction of grape-seed oil to enhance process yield and minimize free radical formation. Journal of the Science of Food and Agriculture. https://doi.org/10.1002/jsfa.9036. Boulekbache-Makhlouf, L., et al., 2013. Effect of solvents extraction on phenolic content and antioxidant activity of the byproduct of eggplant. Industrial Crops and Products 49, 668e674. https://doi.org/10.1016/j.indcrop.2013.06.009. Elsevier B.V. Bravo, L., 2009. Polyphenols: chemistry, dietary sources, metabolism, and nutritional significance. Nutrition Reviews 56 (11), 317e333. https://doi.org/10.1111/j.1753-4887.1998.tb01670.x. Butnariu, M., 2016. Methods of analysis (extraction, separation, identification and quantification) of carotenoids from natural products. Journal of Ecosystem & Ecography 6 (2). https://doi.org/10.4172/2157-7625.1000193. C
adiz-Gurrea, M.L., Fern
andez-Arroyo, S., Segura-Carretero, A., 2014. Pine bark and green tea concentrated extracts: antioxidant activity and comprehensive characterization of bioactive compounds by HPLC-ESI-QTOF-MS. International Journal of Molecular Sciences 15 (11), 20382e20402. https://doi.org/10.3390/ijms151120382. C
adiz-Gurrea, M.L., et al., 2015. Proanthocyanidins in agro-industrial by-products: health benefits. In: Motohashi, N. (Ed.), Occurrences, Structure, Biosynthesis, and Health Benefits Based on Their Evidences of Medicinal Phytochemicals in Vegetables and Fruits, vol. 3, pp. 63e114. C
adiz-Gurrea, M.L., et al., 2017. Cocoa and grape seed byproducts as a source of antioxidant and anti-inflammatory proanthocyanidins. International Journal of Molecular Sciences 18 (2). https://doi.org/10.3390/ijms18020376. C¸am, M., 2010. Pressurised water extraction of polyphenols from pomegranate peels. Food Chemistry 123, 878e885. https://doi.org/10.1016/j.foodchem.2010.05.011. Cardador-Martínez, A., Jiménez-Martínez, C., Sandoval, G., 2011. Revalorization of cactus pear (Opuntia spp.) wastes as a source of antioxidants. Ciência e Tecnologia de Alimentos 31 (3), 782e788. https://doi.org/10.1590/S0101-20612011000300036. Cardoso, L.A.C., et al., 2017. Biotechnological production of carotenoids and their applications in food and pharmaceutical products. In: Carotenoids. InTech. https://doi.org/10.5772/ 67725. Castro-Vargas, H.I., et al., 2010. Extraction of phenolic fraction from guava seeds (Psidium guajava L.) using supercritical carbon dioxide and co-solvents. The Journal of Supercritical Fluids 51 (3), 319e324. https://doi.org/10.1016/J.SUPFLU.2009.10.012. Elsevier. Chafer, A., et al., 2005. Supercritical fluid extraction and HPLC determination of relevant polyphenolic compounds in grape skin. Journal of Separation Science 28 (16), 2050e2056. https://doi.org/10.1002/jssc.200500128. Chalermchat, Y., Fincan, M., Dejmek, P., 2004. Pulsed electric field treatment for solideliquid extraction of red beetroot pigment: mathematical modelling of mass transfer. Journal of Food Engineering 64 (2), 229e236. https://doi.org/10.1016/J.JFOODENG.2003.10.002. Elsevier. Chan, C.H., et al., 2011. Microwave-assisted extractions of active ingredients from plants. Journal of Chromatography A 1218 (37), 6213e6225. https://doi.org/10.1016/ j.chroma.2011.07.040. Elsevier B.V. Cheaib, D., et al., 2018. Biological activity of apricot byproducts polyphenols using solid e liquid and infrared-assisted technology. Journal of Food Biochemistry 1e9. https://doi.org/ 10.1111/jfbc.12552. Chen, B.H., Tang, Y.C., 1998. Processing and stability of carotenoid powder from carrot pulp waste. Journal of Agricultural and Food Chemistry 46 (6), 2312e2318. https://doi.org/ 10.1021/jf9800817.

234

Functional and Preservative Properties of Phytochemicals

Corrales, M., et al., 2008. Extraction of anthocyanins from grape by-products assisted by ultrasonics, high hydrostatic pressure or pulsed electric fields: a comparison. Innovative Food Science & Emerging Technologies 9 (1), 85e91. https://doi.org/10.1016/J.IFSET.2007.06.002. Elsevier. CRDO. Consejo Regulador de la Denominaci
on de Origen Chufa de Valencia, 2009. http://www. chufadevalencia.org/ver/265/New-on-line-image-of-the-D-O–Chufa-de-Valencia.html. Da Porto, C., Natolino, A., Decorti, D., 2014. Extraction of proanthocyanidins from grape marc by supercritical fluid extraction using CO2 as solvent and ethanolewater mixture as co-solvent. The Journal of Supercritical Fluids 87, 59e64. Da Porto, C., Natolino, A., 2017. Supercritical fluid extraction of polyphenols from grape seed (Vitis vinifera): study on process variables and kinetics. The Journal of Supercritical Fluids 130, 239e245. https://doi.org/10.1016/J.SUPFLU.2017.02.013. Elsevier. da Silva, R.P.F.F., Rocha-Santos, T.A.P., Duarte, A.C., 2016. Supercritical fluid extraction of bioactive compounds. TrAC e Trends in Analytical Chemistry 76, 40e51. https://doi.org/ 10.1016/j.trac.2015.11.013. Dang, Y., Xiu, Z., 2013. Microwave-assisted aqueous two-phase extraction of phenolics from grape (Vitis vinifera) seed. Journal of Chemical Technology and Biotechnology. https:// doi.org/10.1002/jctb.4241. de Andrade Lima, M., Charalampopoulos, D., Chatzifragkou, A., 2018. Optimisation and modelling of supercritical CO2 extraction process of carotenoids from carrot peels. The Journal of Supercritical Fluids 133, 94e102. https://doi.org/10.1016/J.SUPFLU.2017.09.028. Elsevier. de Lucasa, A., et al., 2002. Supercritical fluid extraction of tocopherol concentrates from olive tree leaves. The Journal of Supercritical Fluids 22 (3), 221e228. https://doi.org/10.1016/ S0896-8446(01)00132-2. Diem, Q., Elisa, A., Tran-Nguyen, P.L., 2013. Effect of extraction solvent on total phenol content, total flavonoid content, and antioxidant activity of Limnophila aromatica. Journal of Food and Drug Analysis 22 (3), 296e302. https://doi.org/10.1016/j.jfda.2013.11.001. Elsevier Ltd. Dimitrov, K., et al., 2019. Modeling and optimization of extraction and energy consumption during ultrasound-assisted extraction of antioxidant polyphenols from pomegranate peels. Environmental Progress & Sustainable Energy 1e7. https://doi.org/10.1002/ep.13148. 
Djilas, S., Canadanovi
c-Brunet, J., Cetkovi
c, G., 2009. By-products of fruits processing as a source of phytochemicals. Chemical Industry and Chemical Engineering Quarterly 15 (4), 191e202. https://doi.org/10.2298/CICEQ0904191D. Elleuch, M., et al., 2011. Dietary fibre and fibre-rich by-products of food processing: characterisation, technological functionality and commercial applications: a review. Food Chemistry 124 (2), 411e421. https://doi.org/10.1016/j.foodchem.2010.06.077. Fern
andez-Ponce, M.T., et al., 2012. Extraction of antioxidant compounds from different varieties of Mangifera indica leaves using green technologies. The Journal of Supercritical Fluids 72, 168e175. https://doi.org/10.1016/J.SUPFLU.2012.07.016. Elsevier. Ferreira, S.S., et al., 2018. Microwave assisted dehydration of broccoli by-products and simultaneous extraction of bioactive compounds. Food Chemistry 246, 386e393. https:// doi.org/10.1016/j.foodchem.2017.11.053. Elsevier (October 2017). Figueroa, J.G., et al., 2018. Comprehensive identification of bioactive compounds of avocado peel by liquid chromatography coupled to ultra-high-definition accurate-mass Q-TOF. Food Chemistry 245, 707e716. https://doi.org/10.1016/j.foodchem.2017.12.011. Elsevier (December 2017). Fuentes-Alventosa, J.M., et al., 2009. Effect of extraction method on chemical composition and functional characteristics of high dietary fibre powders obtained from asparagus by-

Recent advances in extraction technologies

235

products. Food Chemistry 113 (2), 665e671. https://doi.org/10.1016/ j.foodchem.2008.07.075. Fuentes-G
andara, F., et al., 2019. Selective fractionation and isolation of allelopathic compounds from Helianthus annuus L. leaves by means of high-pressure techniques. The Journal of Supercritical Fluids 143, 32e41. https://doi.org/10.1016/j.supflu.2018.08.004. Gilbert-L
opez, B., et al., 2015. Downstream processing of Isochrysis galbana: a step towards microalgal biorefinery. Green Chemistry 17 (9), 4599e4609. https://doi.org/10.1039/ c5gc01256b. Golmakani, M.-T., et al., 2012. Expanded ethanol with CO2 and pressurized ethyl lactate to obtain fractions enriched in g-Linolenic Acid from Arthrospira platensis (Spirulina). The Journal of Supercritical Fluids 62, 109e115. https://doi.org/10.1016/ j.supflu.2011.11.026. Gonçalves, E.C.B.A., et al., 2018. Byproduct generated during the elaboration process of isotonic beverage as a natural source of bioactive compounds. Journal of Food Science 83. https://doi.org/10.1111/1750-3841.14336. Han, Z.-P., et al., 2013. Microwave-assisted extraction and lc/ms analysis of phenolic antioxidants in sweet apricot (Prunus armeniaca L.) kernel skins. Journal of Liquid Chromatography & Related Technologies 36 (15), 2182e2195. https://doi.org/10.1080/ 10826076.2012.717057. _ ¸ çimen, E.M., 2018. Antidiabetic, antihypertensive and antioxidant properties of Hayta, M., Is grapevine leaf extracts obtained by ultrasound, microwave assisted, and classical solvent extraction. Erwerbs-Obstbau 60, 79e85. https://doi.org/10.1007/s10341-018-0406-6. Herrero, M., et al., 2015. Plants, seaweeds, microalgae and food by-products as natural sources of functional ingredients obtained using pressurized liquid extraction and supercritical fluid extraction. Trends in Analytical Chemistry 71, 26e38. https://doi.org/10.1016/ j.trac.2015.01.018. Elsevier B.V. Herrero, M., Mendiola, J.A., Ib
a~nez, E., 2017. Gas expanded liquids and switchable solvents. Current Opinion in Green and Sustainable Chemistry 5, 24e30. https://doi.org/10.1016/ J.COGSC.2017.03.008. Elsevier. Ho, K.K.H.Y., Ferruzzi, M.G., Liceaga, A.M., et al., 2015. Microwave-assisted extraction of lycopene in tomato peels: effect of extraction conditions on all-trans and cis-isomer yields. LWT e Food Science and Technology 62, 160e168. https://doi.org/10.1016/ j.lwt.2014.12.061. Iriondo-dehond, M., Miguel, E., Del Castillo, M.D., 2018. Food byproducts as sustainable ingredients for innovative and healthy dairy foods. Nutrients 1e24. https://doi.org/10.3390/ nu10101358. Jacotet-Navarro, M.A.V.M., et al., 2019. Green ultrasound-assisted extraction of antioxidant phenolic compounds determined by high performance liquid chromatography from bilberry (Vaccinium myrtillus L.) juice by-products. Waste and Biomass Valorization 10 (7), 1945e1955. https://doi.org/10.1007/s12649-018-0207-z. Springer Netherlands. Jahurul, M.H.A., et al., 2015. Mango (Mangifera indica L.) by-products and their valuable components: a review. Food Chemistry 183, 173e180. https://doi.org/10.1016/ j.foodchem.2015.03.046. Jimenez, P., et al., 2011. Oxidative stability of oils containing olive leaf extracts obtained by pressure, supercritical and solvent-extraction. European Journal of Lipid Science and Technology 113 (4), 497e505. https://doi.org/10.1002/ejlt.201000445. Jun, X., 2013. High-pressure processing as emergent technology for the extraction of bioactive ingredients from plant materials. Critical Reviews in Food Science and Nutrition. https:// doi.org/10.1080/10408398.2011.561380.

236

Functional and Preservative Properties of Phytochemicals

Kassama, L.S., Shi, J., Mittal, G.S., 2008. Optimization of supercritical fluid extraction of lycopene from tomato skin with central composite rotatable design model. Separation and Purification Technology 60 (3), 278e284. https://doi.org/10.1016/j.seppur.2007.09.005. Ko, M., et al., 2011. Subcritical water extraction of flavonol quercetin from onion skin. Journal of Food Engineering 102 (4), 327e333. https://doi.org/10.1016/j.jfoodeng.2010.09.008. Elsevier Ltd. Kumar, H., et al., 2014. Phenolic compounds and their health benefits: a review. Journal of Food Research and Technology 2 (2), 46e59. Kumari, B., et al., 2018. Recent advances on application of ultrasound and pulsed electric field technologies in the extraction of bioactives from agro-industrial by-products. Food and Bioprocess Technology 223e241. https://doi.org/10.1007/s11947-017-1961-9. Liau, B., et al., 2017. Development of pressurized hot water extraction for five flavonoid glycosides from defatted Camellia oleifera seeds (byproducts). Industrial Crops and Products 95, 296e304. https://doi.org/10.1016/j.indcrop.2016.10.034. Elsevier B.V. Liazid, A., et al., 2007. Investigation on phenolic compounds stability during microwaveassisted extraction. Journal of Chromatography A 1140 (1e2), 29e34. https://doi.org/ 10.1016/j.chroma.2006.11.040. Lim, S.B., et al., 2003. Extraction of carotenoids from citrus unshiu press cake by supercritical carbon dioxide. Food Science in Biotechnology 12, 513e520. Louis, C., et al., 2019. Influence of conventional and recent extraction technologies on physicochemical properties of bioactive macromolecules from natural sources: a review. Food Research International 116, 827e839. https://doi.org/10.1016/j.foodres.2018.09.018. Elsevier (September 2017). Lozano-S
anchez, J., et al., 2011. Wastes generated during the storage of extra virgin olive oil as a natural source of phenolic compounds. Journal of Agricultural and Food Chemistry 59 (21), 11491e11500. https://doi.org/10.1021/jf202596q.
Luengo, E., Alvarez, I., Raso, J., 2013. Improving the pressing extraction of polyphenols of orange peel by pulsed electric fields. Innovative Food Science & Emerging Technologies 17, 79e84. Machmudah, S., et al., 2018. Supercritical fluids extraction of valuable compounds from algae: future perspectives and challenges. Engineering Journal 22 (5), 13e30. https://doi.org/ 10.4186/ej.2018.22.5.13. Marriott, R.J., 2010. Greener chemistry dreparation of traditional: lavour extracts and molecules. Agro Food Industry Hi-Tech 21 (2), 46e48. Mirabella, N., Castellani, V., Sala, S., 2014. Current options for the valorization of food manufacturing waste: a review. Journal of Cleaner Production 65, 28e41. https://doi.org/ 10.1016/j.jclepro.2013.10.051. Naffati, A., Vladi, J., Vidovi, S., 2017. Biorefining of filter tea factory by-products: classical and ultrasound-assisted extraction of bioactive compounds from wild apple fruit dust. Journal of Food Process Engineering 1e11. https://doi.org/10.1111/jfpe.12572 (August 2016). Ndayishimiye, J., Chun, B.S., 2017. Optimization of carotenoids and antioxidant activity of oils obtained from a co-extraction of citrus (Yuzu ichandrin) by-products using supercritical carbon dioxide. Biomass and Bioenergy 106, 1e7. https://doi.org/10.1016/ j.biombioe.2017.08.014. Noziere, P., et al., 2006. Carotenoids for ruminants: from forages to dairy products. Animal Feed Science and Technology 131 (3e4), 418e450. https://doi.org/10.1016/ j.anifeedsci.2006.06.018. Okiyama, D.C.G., et al., 2019. Effect of the temperature on the kinetics of cocoa bean shell fat extraction using pressurized ethanol and evaluation of the lipid fraction and defatted meal.

Recent advances in extraction technologies

237

Industrial Crops and Products 130, 96e103. https://doi.org/10.1016/ j.indcrop.2018.12.063. Elsevier (December 2018). Ollanketo, M., et al., 2001. Supercritical carbon dioxide extraction of lycopene in tomato skins. European Food Research and Technology 212 (5), 561e565. https://doi.org/10.1007/ s002170100298. Ord
o~nez-Santos, L.E., Pinz
on-Zarate, L.X., Gonz
alez-Salcedo, L.O., 2015. Optimization of ultrasonic-assisted extraction of total carotenoids from peach palm fruit (Bactris gasipaes) by-products with sunflower oil using response surface methodology. Ultrasonics Sonochemistry 27, 560e566. https://doi.org/10.1016/j.ultsonch.2015.04.010. Pan, Z., et al., 2011. Continuous and pulsed ultrasound-assisted extractions of antioxidants from pomegranate peel. Ultrasonics Sonochemistry 18 (5), 1249e1257. https://doi.org/10.1016/ J.ULTSONCH.2011.01.005. Elsevier. Pavli
c, B., Naffati, A., Hojan, T., et al., 2017. Microwave-assisted extraction of wild apple fruit dustdproduction of polyphenol-rich extracts from filter tea factory. Journal of Food Process Engineering 1e11. https://doi.org/10.1111/jfpe.12508 (September 2016). Pfaltzgraff, L.A., et al., 2013. Food waste biomass: a resource for high-value chemicals. Green Chemistry 307e314. https://doi.org/10.1039/c2gc36978h. Pinelo, M., et al., 2005. Optimization of continuous phenol extraction from Vitis vinifera byproducts. Food Chemistry 92, 109e117. https://doi.org/10.1016/ j.foodchem.2004.07.015. Pourmortazavi, S.M., et al., 2018. Application of supercritical fluids in cholesterol extraction from foodstuffs: a review. Journal of Food Science & Technology 55 (8), 2813e2823. https://doi.org/10.1007/s13197-018-3205-z. Pradal, D., et al., 2016. Kinetics of ultrasound-assisted extraction of antioxidant polyphenols from food by-products: extraction and energy consumption optimization. Ultrasonics Sonochemistry 32, 137e146. https://doi.org/10.1016/j.ultsonch.2016.03.001. Elsevier B.V. Puértolas, E., et al., 2013. Pulsed-electric-field-assisted extraction of anthocyanins from purplefleshed potato. Food Chemistry 136 (3e4), 1330e1336. https://doi.org/10.1016/ J.FOODCHEM.2012.09.080. Elsevier. Radojkovi
c, M., et al., 2018. Microwave-assisted extraction of phenolic compounds from Morus nigra leaves: optimization and characterization of the antioxidant activity and phenolic composition. Journal of Chemical Technology and Biotechnology 93 (6), 1684e1693. https://doi.org/10.1002/jctb.5541. Rajha, H.N., et al., 2014. Industrial byproducts valorization through energy saving processes. Alkaline extraction of polyphenols from vine shoots. In: International Conference on Renewable Energies for Developing Countries 2014. IEEE, pp. 89e94. https://doi.org/ 10.1109/REDEC.2014.7038537. Rami
c, M., et al., 2015. Modeling and optimization of ultrasound-assisted extraction of polyphenolic compounds from Aronia melanocarpa by-products from filter-tea factory. Ultrasonics Sonochemistry 23, 360e368. https://doi.org/10.1016/j.ultsonch.2014.10.002. Reyes, F.A., et al., 2014. Astaxanthin extraction from Haematococcus pluvialis using CO2expanded ethanol. The Journal of Supercritical Fluids 92, 75e83. https://doi.org/10.1016/ J.SUPFLU.2014.05.013. Elsevier. Rodrigues, F., et al., 2018. Cosmetics. In: Galanakis, C. (Ed.), Polyphenols: Properties, Recovery, and Applications. Elsevier, Chania, Greece, p. 400 (Chapter 12). Rodríguez-Pérez, C., et al., 2016a. Green downstream processing using supercritical carbon dioxide, CO2-expanded ethanol and pressurized hot water extractions for recovering bioactive compounds from Moringa oleifera leaves. The Journal of Supercritical Fluids 116. https://doi.org/10.1016/j.supflu.2016.05.009.

238

Functional and Preservative Properties of Phytochemicals

Rodríguez-Pérez, C., et al., 2016b. Emerging green technologies for the extraction of phenolic compounds from medicinal plants. In: Recent Progress in Medicinal Plants. Analytical and Processing Techniques, vol. 41, pp. 81e104. Roohinejad, S., Nikmaram, N., Brahim, M., 2017. Potential of novel technologies for aqueous extraction of plant bioactives. Water Extraction of Bioactive Compounds. https://doi.org/ 10.1016/B978-0-12-809380-1.00016-4. Elsevier Inc. Rozzi, N.L., et al., 2002. Supercritical fluid extraction of lycopene from tomato processing byproducts. Journal of Agricultural and Food Chemistry 50 (9), 2638e2643. https:// doi.org/10.1021/jf011001t. S¸ahin, S., Elhussein, E.A.A., 2018. Valorization of a biomass: phytochemicals in oilseed byproducts. Phytochemistry Reviews 17 (4), 657e668. https://doi.org/10.1007/s11101018-9552-6. S¸ahin, S., Bilgin, M., Dramur, M.U., 2011. Investigation of oleuropein content in olive leaf extract obtained by supercritical fluid extraction and soxhlet methods. Separation Science and Technology 46 (11), 1829e1837. https://doi.org/10.1080/01496395.2011.573519. S
anchez-Zapata, E., et al., 2009. Preparation of dietary fiber powder from tiger nut (Cyperus esculentus) milk (“Horchata”) byproducts and its physicochemical properties. Journal of Agricultural and Food Chemistry 57 (17), 7719e7725. https://doi.org/10.1021/jf901687r. Saravana, P.S., et al., 2016. Optimization of phytochemicals production from the ginseng byproducts using pressurized hot water: experimental and dynamic modelling. Biochemical Engineering Journal 113, 141e151. https://doi.org/10.1016/j.bej.2016.06.006. Elsevier B.V. Sasidharan, S., et al., 2011. Extraction, isolation and characterization of bioactive compounds from plants’ extracts. African Journal of Traditional, Complementary and Alternative Medicines 8 (1), 1e10. https://doi.org/10.4314/ajtcam.v8i1.60483. Schieber, A., Stintzing, F., Carle, R., 2001. By-products of plant food processing as a source of functional compoundsdrecent developments. Trends in Food Science & Technology 12, 401e413. https://doi.org/10.1016/S0924-2244(02)00012-2. Shahidi, F., Ambigaipalan, P., 2015. Phenolics and polyphenolics in foods, beverages and spices: antioxidant activity and health effects e a review. Journal of Functional Foods 18, 820e897. https://doi.org/10.1016/j.jff.2015.06.018. Elsevier Ltd. Sharma, S.K., et al., 2016. Utilization of food processing by-products as dietary, functional, and novel fiber: a review. Critical Reviews in Food Science and Nutrition 56 (10), 1647e1661. https://doi.org/10.1080/10408398.2013.794327. Singh, P.P., Salda~na, M.D.A., 2011. Subcritical water extraction of phenolic compounds from potato peel. Food Research International 44 (8), 2452e2458. https://doi.org/10.1016/ j.foodres.2011.02.006. Elsevier Ltd. Strati, I.F., Oreopoulou, V., 2016. Recovery and isomerization of carotenoids from tomato processing by-products. Waste and Biomass Valorization 7 (4), 843e850. https://doi.org/ 10.1007/s12649-016-9535-z. Tian, Y., et al., 2017. Phenolic compounds extracted by acidic aqueous ethanol from berries and leaves of different berry plants. Food Chemistry 220, 266e281. https://doi.org/10.1016/ j.foodchem.2016.09.145. Toepfl, S., Siemer, C., Heinz, V., 2014. Effect of high-intensity electric field pulses on solid foods. Emerging Technologies for Food Processing 147e154. https://doi.org/10.1016/ B978-0-12-411479-1.00008-5. Academic Press. Valadez-Carmona, L., et al., 2018. Valorization of cacao pod husk through supercritical fluid extraction of phenolic compounds. The Journal of Supercritical Fluids 131, 99e105. https://doi.org/10.1016/J.SUPFLU.2017.09.011. Elsevier.

Recent advances in extraction technologies

239

Vega-Vega, V., et al., 2013. Antimicrobial and antioxidant properties of byproduct extracts of mango fruit. Journal of Applied Botany and Food Quality 211, 205e211. https://doi.org/ 10.5073/JABFQ.2013.086.028. Vicente, G., et al., 2012. Supercritical fractionation of rosemary extracts to improve the antioxidant activity. Chemical Engineering & Technology 35 (1), 176e182. https://doi.org/ 10.1002/ceat.201100367. Vidal, L., Beltra, A., Canals, A., 2015. Microwave-assisted extraction of phenolic compounds from almond skin byproducts (Prunus amygdalus): a multivariate analysis approach. Journal of Agricultural and Food Chemistry. https://doi.org/10.1021/acs.jafc.5b01011. Vigan
o, J., et al., 2016. Pressurized liquids extraction as an alternative process to readily obtain bioactive compounds from passion fruit rinds. Food and Bioproducts Processing 100, 382e390. https://doi.org/10.1016/j.fbp.2016.08.011. Institution of Chemical Engineers. Wang, B., et al., 2018. Optimization of ultrasound-assisted extraction of flavonoids from olive (Olea europaea) leaves, and evaluation of their antioxidant and anticancer activities. Molecules 23 (10). https://doi.org/10.3390/molecules23102513. Wijngaard, H., et al., 2012. Techniques to extract bioactive compounds from food by-products of plant origin. Food Research International 46 (2), 505e513. https://doi.org/10.1016/ j.foodres.2011.09.027. Elsevier Ltd. Yang, Z., Zhai, W., 2010. Optimization of microwave-assisted extraction of anthocyanins from purple corn (Zea mays L.) cob and identification with HPLCeMS. Innovative Food Science & Emerging Technologies 11 (3), 470e476. https://doi.org/10.1016/ j.ifset.2010.03.003. Elsevier B.V. Yara-Var
on, E., Selka, A., et al., 2016. Solvent from forestry biomass. Pinane a stable terpene derived from pine tree byproducts to substitute n-hexane for the extraction of bioactive. Green Chemistry 6596e6608. https://doi.org/10.1039/c6gc02191c. Royal Society of Chemistry. € Yilmaz, E.E., Ozvural, E.B., Vural, H., 2011. Extraction and identification of proanthocyanidins from grape seed (Vitis vinifera) using supercritical carbon dioxide. The Journal of Supercritical Fluids 55 (3), 924e928. https://doi.org/10.1016/J.SUPFLU.2010.10.046. Elsevier. Young, A., Lowe, G., 2018. Carotenoidsdantioxidant properties. Antioxidants 7 (2), 28. https:// doi.org/10.3390/antiox7020028. Yuan, B., et al., 2018. Valorization of hazelnut shells into natural antioxidants by ultrasoundassisted extraction: process optimization and phenolic composition identification. Journal of Food Process Engineering. https://doi.org/10.1111/jfpe.12692. Zardo, I., Espíndola, A. De, 2019. Optimization of ultrasound assisted extraction of phenolic compounds from sunflower seed cake using response surface methodology. Waste and Biomass Valorization 10 (1), 33e44. https://doi.org/10.1007/s12649-017-0038-3. Springer Netherlands.

This page intentionally left blank

Application of nanotechnology to boost the functional and preservative properties of essential oils

8

Akshay Kumar, Priyanka Singh, Vishal Gupta, Bhanu Prakash Centre of Advanced Study in Botany, Institute of Science, Banaras Hindu University, Varanasi, Uttar Pradesh, India

1. Introduction Essential oils (EOs) are the volatile secondary metabolite products of aromatic plants obtained from different parts such as roots, wood, leaves, twigs, bark, buds, flowers, and seeds. Approximately, 17,000 aromatic plants belonging to the angiospermic families such as Myrtaceae, Rutaceae, Lamiaceae, Zingiberaceae, and Asteraceae have been identified as the source of essential oils. Essential oils are a complex mixture of volatile compounds such as terpenes, phenolics, ketones, alcohols, esters, amines, and amides that possess strong antimicrobial and functional properties. Terpenes are the major constituent of essential oils constituted by several isoprene units (C5H8). In general, terpenes have been classified into different classes based on the number of carbon atoms such as monoterpenes (C10H16), sesquiterpenes (C15H24), and diterpenes (C20H32). Terpenoids (monoterpenoids and sesquiterpenoids) are the most abundant form of terpenes obtained due to the enzymatic modification of terpenes that add oxygen molecules and remove methyl groups (Caballero et al., 2003). The essential oils were synthesized in the plant via two different pathways such as mevalonic acid and methyl-D-erythritol-4-phosphate (MEP) pathways in cytoplasm and plastids, respectively. Nearly 300 plants volatile oils are commercially available, particularly for the pharmacology; agronomy; food industries; sanitary, cosmetics, and perfume industries (Bakkali et al., 2008). Several different techniques have been used for the extraction of essential oil, viz. Hydrodistillation, Supercritical Fluid Extraction, Microwave-Assisted Hydrodistillation, and Ultrasound-Assisted Extraction (Rassem et al., 2016). However, hydrodistillation technique for extraction of EOs was first practiced in the East (Egypt, India, and Persia) (Guenther and Althausen, 1948) over 2000 years back and was improved in the 9th century by the Arabs (Burt, 2004). Gas chromatography and mass spectroscopy (GC-MS) is one of the most widely used techniques for the identification and characterization of essential oil components based on their retention time/mass spectrometry and computer-based library (Adams, 2007). Literature review suggested that most of the essential oils exhibited broad

Functional and Preservative Properties of Phytochemicals. https://doi.org/10.1016/B978-0-12-818593-3.00008-7 Copyright © 2020 Elsevier Inc. All rights reserved.

242

Functional and Preservative Properties of Phytochemicals

spectrum activity, viz. bactericidal, virucidal, fungicidal, antiparasitic, anticancer, antiinflammatory, sedative, and analgesic effects (Bakkali et al., 2008). Therefore, in the past few decades essential oils have gained considerable attention from the industries such as pharmaceuticals, agriculture, and food industry as a green preservative to improve the shelflife, as well as the quality of food products (Prakash et al. 2015). However, the high volatility, hydrophobicity, susceptibility to oxidation, low stability, solubility, and unknown mode of action are major characteristic drawbacks that limit the widespread uses of essential oils (Prakash et al., 2015). Therefore, the use of suitable coating materials as the carrier agents represent an excellent strategy to overcome the current existing limitation of essential oilsebased products. The nanotechnology idea was first introduced in 1959 by the renowned physicist Richard Feynman; later in 1974, Norio Taniguchi first used the terminology “nanotechnology” (Handford et al., 2014). Nanotechnology is generally used in all fields of research such as biology, physics, chemistry, and material engineering, which deals with the particle size range between 1 and 100 nm. The nanosize of particle expanded surface area thus increases the practical application of phytochemicals (Rashidi and Khosravi-Darani, 2011). Nowadays, the nanoencapsulation of essential oils is a fast-growing practice to improve the bioactivity (antimicrobial and functional activity), thermal stability, and targeted site-specific delivery, with controlled release in the food system (LopezRubio et al., 2006; Bilia et al., 2014). Currently, a range of carrier agents, such as starch, cellulose, pectin, guar gum, chitosan, alginate, carrageenan, xanthan, dextran, and cyclodextrins, have been used as coating material of essential oils. The chapter highlights the antimicrobial, functional properties of essential oils and significance of encapsulation strategies to address the current existing challenges of essential oilse based preservatives and functional ingredients. In addition, currently used coating materials, techniques for encapsulation, and future prospects of nanoencapsulated essential oils in the food industries have been discussed.

2.

Preservative and functional properties of essential oils

Essential oils exhibit several biological properties such as antimicrobial, insecticidal, antioxidant, antiinflammatory, anticancer, antidiabetic, antiulcerogenic, and antianxiety activities (Ribeiro-Santos et al., 2017). In general, the biological properties of essential oils are based on their major compounds or due to the synergistic effect of major as well as minor components (Ribeiro-Santos et al., 2017). Essential oils exhibit their biological properties as a fumigant and have less/no toxic effect on the health; hence, they could be used as preferred alternative to synthetic preservative. Most of the EOs (Clove, oregano, thyme, nutmeg, basil, mustard, cinnamon) and their bioactive compounds (linalool, thymol, eugenol, carvone, cinnamaldehyde, vanillin, carvacrol, citral, and limonene) are kept in Generally Recognized as Safe (GRAS) category by US FDA. Arasu et al. (2019) investigated the antibacterial and antifungal activity of essential oils such as Acorus calamus, Allium sativum, Mucuna pruriens, and

Application of nanotechnology to boost

243

Sesamum indicum against the bacterial (Bacillus subtilis, Staphylococcus aureus, Pseudomonas aeruginosa, Escherichia coli, and Enterobacter aerogenes) and fungal species (Aspergillus niger, Aspergillus flavus, Penicillium notatum, and Rhizopus microsporus). The minimum inhibitory concentration of the essential oils were ranged (11.3
2.3 to 617
4.9 mg/mL) and (1.1
0.4 to 27
2.8 mg/mL) against the bacteria and fungi, respectively. Bertella et al. (2018) studied the antibacterial activity of Artemisia herba-alba essential oils against Staphylococcus aureus, Bacillus cereus, Proteus mirabilis, Salmonella enteritidis, Acinetobacter baumannii, and Klebsiella pneumonia. They also reported the minimum inhibitory concentration (5e 10 mg mL1) and the minimum bactericidal concentration (10e20 mg mL1) values against the test bacterial species. Akarca (2019) investigated the antibacterial activity of Hibiscus surattensis L. essential oils against Escherichia coli, Staphylococcus aureus, Listeria monocytogenes, Enterococcus aerogenes, Salmonella typhimurium, and Shigella flexneri. The result demonstrated that the EOs exhibited strong antibacterial effect on L. monocytogenes with a diameter zone of 25.26 mm, followed by Staphylococcus aureus (23.42 mm) and Escherichia coli (22.93 mm). Cui et al. (2019) studied the antibacterial activity of oregano essential oil against the Methicillin-resistant Staphylococcus aureus (MRSA) and reported the inhibition of tricarboxylic acid cycle pathway and its key enzymes along with downregulation expression of the pvl gene as the major target sites of action of test oil. In general, the gram-negative bacteria are less vulnerable than gram-positive bacteria due to the presence of hydrophilic lipopolysaccharides (LPS) in the outer membrane of gramnegative bacteria that interfere with hydrophobic compounds and make EOs less effective (Hyldgaard et al., 2012). Lasram et al. (2019) studied the antifungal and antiaflatoxigenic activities of Carum carvi L., and Coriandrum sativum L. seed essential oils and their major terpenes against Aspergillus flavus. C. carvi exhibited better antifungal property than Coriandrum sativum with a minimum inhibitory concentration of about 0.4% and 0.7%, respectively. Hu et al. (2017) investigated the antifungal and aflatoxin B1 inhibitory potential of Curcuma longa essential oils and reported their probable mode of action related to the disruption of fungal cell membrane; impairment in mitochondrial functioning; inhibition of ergosterol synthesis, mitochondrial ATPase, malate dehydrogenase, succinate dehydrogenase activities; and downregulation of expression of genes in aflatoxin biosynthetic pathway. The antimicrobial activities of some of the traditionally used essential oils and bioactive compounds have been reported by Prakash et al. (2015). In addition, essential oils exhibited potent functional properties such as acetylcholinesterase inhibition, antioxidant, antiinflammatory, antidiabetic, cognitive impairment, anticancer activity, etc. Alzheimer disease (old age dementia) is associated with decrease in the level of several neurotransmitters, such as acetylcholine, noradrenaline, and serotonin in brain (Byrne and Russon, 1998), responsible for the inhibition of signal transmission. Inhibition of acetylcholinesterase (AchE) enzyme activity is one of the primary target sites of action of compounds used for the cure of Alzheimer disease. Therefore, plant products such as galantamine and amaryllidaceae alkaloids possess acetyl cholinesterase inhibitory potential that could be used for the treatment of Alzheimer disease. Karak et al. (2018) reported the antiacetylcholinesterase,

244

Functional and Preservative Properties of Phytochemicals

anti-b-glucuronidase, and cytotoxic properties of Piper betle L. leaves essential oil. A large number of plant essential oils and their bioactive compounds such as Mentha spp., 1, 8-cineole, a-pinene, eugenol, citral a-terpineol, eugenol, and terpinen-4-ol exhibited potent acetylcholinesterase enzyme inhibitory activity (Dohi et al., 2009). Myristicin, a major component of Myristica fragrans, exhibited hepatoprotective effect against liver damage by inhibition of TNF-a and suppression of apoptosis (Morita et al., 2003). Trans-citral, the major compound of aromatic plants such as lemon grass, enhances the activity of glutathione-S-transferase P enzyme. Thus trans-citral (geranial) could be used as the chemopreventive agent against inflammation-related carcinogenesis (Henderson et al., 1998). Afoulous et al. (2013) studied the anticancer, antiinflammatory, antioxidant, and antimalarial activities of leaves essential oil of Cedrelopsis grevei and reported that essential oil was active against human breast cancer cells MCF-7 cell lines (IC50 ¼ 21.5 mg/L), antiinflammatory (IC50 ¼ 21.33 mg/L), antioxidant activity against DPPH (IC50 > 1000 mg/L) and ABTS (IC50 ¼ 110 mg/L), and Plasmodium falciparum (IC50 ¼ 17.5 mg/L). Pavithra et al. (2009) investigated the anticancer (epidermal) properties of essential oil of Pamburus missionis. They have reported the significant changes in vital cellular activity such as induced nuclear condensation, loss of membrane integrity, DNA fragmentation, increase in sub-G1 DNA content, and elevation in intracellular ROS level in microbial cell exposed to EO. In addition, the essential oilsebased compounds such as thymoquinone (Nigella sativa), D-limonene (orange essential oil), D-limonene and b-myrcene (Foeniculum vulgare) elicit hepatoprotective activity (Mansour et al., 2001; Bodake et al., 2002; € Ozbek et al., 2018). Antidiabetic activities of Foeniculum vulgare Mill. essential oil was found to be related with the corrected hyperglycemia and pathological abnormalities in rat due to its antioxidative effect and restoring of redox homeostasis (El-Soud et al., 2011). Satureja khuzestanica essential oil significantly reduces the fasting blood glucose level in model system (diabetic rats) (Abdollahi et al., 2003). Essential oils of chamomile, eucalyptus, rosemary, lavender, millefolia pine, clove, and myrrh exhibited potent antiinflammatory activity, which could be used for the treatment of eczema, dermatitis, and irritation. Seed cones of Juniperus macrocarpa exhibited considerable antiinflammatory activity (Lesjak et al., 2014). Sarikurkcu et al. (2018) reported that the antioxidant ability of Marrubium parviflorum essential oil is related to its high phenolic content using various methods, viz. b-carotene-linoleic acid, 1,1diphenyl-2-picrylhydrazyl (DPPH) radical scavenging, and reducing power assays and reported that antioxidant activity of oils is because of high phenolic contents. Senthilkumar et al. (2019) investigated the antioxidant activity of Moringa peregrina essential oil extracted from seed kernel and reported the radical scavenging activities in terms of IC50 value for several assays such as DPPH•radical (IC50 ¼ 37.70 mg/mL), ABTS•þ radical (IC50 ¼ 34.03 mg/mL), superoxide anion (IC50 ¼ 36.57 mg/mL), nitric oxide radical (IC50 ¼ 29.15 mg/mL), hydrogen peroxide (IC50 ¼ 43.93 mg/mL), and hydroxyl radical (IC50 ¼ 29.99 mg/mL). The antioxidant activity of some of the traditionally used essential oils (Thymus caramanicus, Magnolia liliflora, Artemisia scoparia, Piper betle, Thymus algeriensis, Origanum majorana, Coriandrum sativum, Hedychium spicatum, Commiphora myrrha, Cananga odorata, etc.) and bioactive compounds (thymol, eugenol, geranyl acetate, 1,8-cineol, E-citral, b-asarone,

Application of nanotechnology to boost

245

b-caryophyllene, carvone, P-cymene, carvacrol) have been reported by Prakash et al. (2015). Thus, the plant essential oils possess remarkable antioxidant and functional activity that could be used as natural ingredients during the formulation of dietary product to prevent disease/stress through dietary management.

3. Nanotechnology: an efficient approach to enhance the bioactivity of essential oils In spite of tremendous biological activity the industrial application of EOs and their bioactive compounds are limited due to their high volatility, intense aroma (can alter the taste of food), photosensitivity (autoxidation of its component in the presence of high temperatures, UV light, or oxygen), hydrophobicity (negative interaction of its hydrophobic components with fat, starch, and proteins), low stability, and solubility. Therefore, to overcome these existing limitations of essential oilsebased preservative and functional ingredients, an additional innovative research is needed related to innovative cost-effective and safe delivery system to enhance the application domain of essential oilsebased products at industrial level. In this context, the use of nanoencapsulation technology holds great promise to boost the efficacy of essential oils in the food system. Nanoencapsulation offers several advantages such as protection of essential oils from degradation, increase solubility in aqueous medium, masking the intense aroma, avoiding the negative interactions with food components with enhanced bioactivity and targeted delivery, thereby reducing the effective dose to achieve the preservative and functional effect. The nanoencapsulation of essential oils can expand the concentration in the food zone where microorganisms are ideally situated, for instance, water-rich stages or strong fluid interfaces and improve their bioactivity, circulation time, and target specificity (Ribeiro-Santos et al., 2017). Risaliti et al. (2019) studied the antioxidant, anti-inflammatory, and antibacterial activities of Salvia triloba and Rosmarinus officinalis EOs-loaded nanovesicles and reported that liposomes-based formulations were stable over 1 month period with significant antioxidant, antiinflammatory, and antibacterial activities. Celia et al. (2013) reported the improved in vitro anticancer activity of Bergamot essential oil (BEO) against human SH-SY5Y neuroblastoma cells using liposomal formulation of BEO with improved water solubility. Giongo et al. (2017) reported the antiinflammatory effect of geranium nanoemulsion (NEG) using nitric oxide (NO), cytokines (interleukin IL-1, IL-6, and IL-10), tumor necrosis factor-a (TNF), and the expression levels gene of interleukin (IL-2), cyclooxygenase-2 (COX-2), and inducible nitric oxide synthase (iNOS). Ngwabebhoh et al. (2018) reported antiinflammatory, antimicrobial, and anticancer activity of nanoencapsulated emulsions of coumarin and curcumin with improved bioavailability against using human cell lines (L929 and MCF-7) and different microorganisms. Sun et al. (2014) reported that nanostructured lipid carriers (Q-NLC) enhanced the anticancer activities of quercetin by improving its bioavailability, solubility, stability, and increased content at targeted

246

Functional and Preservative Properties of Phytochemicals

site. Gundewadi et al. (2018a,b) reported that the nanoemulsion of basil oil exhibited enhanced antimicrobial activity (up to 20%) against the two most common food spoilage fungi Penicillium chrysogenum and Aspergillus flavus. The prepared nanoemulsion at 1000 ppm causes significant growth inhibition (64%e67%) over the synthetic fungicide Carbendazim. Lee et al. (2017) prepared nanoencapsulation of silymarin using water-soluble chitosan and poly-gamma glutamic acid and reported that the nanoencapsulation significantly improved solubility (7.7-fold) and antimicrobial activity of silymarin. Mohammadi et al. (2015a) investigated the in vitro and in vivo antimicrobial activity of nanoencapsulated Cinnamomum zeylanicum essential oil (Ne-CEO) against Phytophthora drechsleri. The in vivo results showed that at 1.5 g/L Ne-CEO significantly reduced the disease severity and incidence of pathogen. Hasani et al. (2018) prepared the nanoformulation of lemon essential oil using chitosan (CS) and modified starch (Hicap) by freeze drying technique to enhance the physicochemical properties and thermal stability of essential oil. Literature review suggested that chitosan has been widely used as the carrier agent of essential oil, bioactive compounds, and formulations such as Zataria multiflora (Mohammadi et al., 2015b), insulin (Das and Chaudhury, 2011), oregano (Hosseini et al., 2013), thyme (Ghaderi-Ghahfarokhi et al., 2016), mace (Yadav et al., 2019), eugenol, menthol, t-anethol, thymol, methyl cinnamate, linalool, and formulations based on compounds such as EMT and TML with improved bioactivity (Kumar et al., 2019a,b). The antimicrobial and antioxidant activities of encapsulated essential oils have been summarized in Tables 8.1 and 8.2.

4.

Delivery agents and techniques used for encapsulation of essential oils

Currently a range of carrier agents such as starch, cellulose, pectin, guar gum, chitosan, dextran, and cyclodextrin have been used for the encapsulation of essential oils. Among all, chitosan and its modified form exhibited promising carrier agent properties, due to their biocompatible, biodegradable, mucoadhesive, safe, and economically viable nature. The molecular structure of the plant-based delivery agent such as starch, cellulose, pectin, and guar gum are suitable to entrap the essential oil. Therefore, in the past few years delivery agents either plant/microbes/animal-based have gained considerable interest of food industries as the carrier agent of volatile agent in food system (Prakash et al., 2018). Table 8.3 summarized the different type of delivery agents, sources, and their application.

4.1

Starch

Starch is one of the major storage polysaccharides in plant which consists of glucose units linked with a-d-(1 / 4) or a-d-(1 / 6) linkages (Fathi et al., 2014). Amylose and amylopectin are the two principal structural components of starch. In general, they are nontoxic, biodegradable, biocompatible, and costeffective that enhances their

Table 8.1 Antimicrobial activity of nanoencapsulated essential oils and bioactive compounds. Essential oil/ compounds

Delivery agents

1

Clove

2

Microbes

Results

References

Chitosan

Oil-in-water emulsion technique

Aspergillus niger

Encapsulated clove essential oil exhibited complete inhibition of A. niger mycelia growth at 1.5 mg/mL.

Hasheminejad et al. (2019)

Cinnamon and Clove

Chitosan-gum arabic

Emulsion

Gram-positive bacteria (Staphylococcus aureus ATCC 25923) and Gram-negative bacteria (Escherichia coli ATCC 25922)

Compared to the control film, 10% Cinnamon oil and 10% Clove films could reduce the OD values concerning to E. coli and S. aureus to 0.21, 0.13 and 0.26, 0.14 at 15 h, respectively.

Xu et al. (2019)

3

Origanum vulgare

Chitosan

Nanoemulsions, phase inversion temperatures

Staphylococcus aureus and Escherichia coli

The MIC value of nanoemulsion containing Origanum vulgare EO was reported at 0.56 and 0.60 mg while MBC value was found at 0.90 and 3.32 mg/mL for S. aureus and E. coli, respectively.

MoraesLovison et al. (2017)

4

Zataria multiflora

Chitosan

Ionic gelation technique

Botrytis cinerea

Zataria multiflora EO-chitosan nanoparticle completely inhibited fungal growth at 1500 ppm.

Mohammadi et al. (2015b)

5

Thymus vulgaris

Chitosan

Nanogel

A. flavus (ATCC 5004)

Nanoencapsulated T. vulgaris essential oil caused complete inhibition of A. flavus growth at 500mg/L.

Khalili et al. (2015) 247

Method

Application of nanotechnology to boost

S. N.

Continued

Table 8.1 Antimicrobial activity of nanoencapsulated essential oils and bioactive compounds.dcont’d Delivery agents

6

Citral

7

Method

Microbes

Results

References

Polyoxyethylene (10) oleyl ether

Nanoemulsions

S. aureus [American Type Culture Collection (ATCC) 27690], E. coli (ATCC 23815), Pseudomonas aeruginosa (ATCC 15442), Enterococcus faecalis (ATCC 29212), Salmonella typhimurium (ATCC 14028), and Listeria monocytogenes (ATCC 19113)

Antibacterial activity nanoemulsion containing citral were ranged 2.0
0.1 to 19.2
2.3 mm (inhibition zone) against the test microbes.

Lu et al. (2018)

Cardamom essential oil

Chitosan

Ionic gelation Process

E. coli and S. aureus

MIC of encapsulated cardamom essential oil was calculated to be 25%(v/v) for E. coli and 10% (v/v) for S. aureus.

Jamil et al. (2016)

8

Coriandrum sativum

Chitosan

Nanoemulsion

Aspergillus flavus

MIC ¼ 0.5 mL/mL; MAIC ¼ 0.4 mL/mL

Das et al. (2019)

9

Satureja hortensis L.

Chitosan

Oil-in-water (o/ w) emulsion

E. coli O157:H7 ATCC 33150, S. aureus ATCC 25923 and Listeria monocytogenes(ATCC 19118)

Encapsulated S. hortensis essential oil completely inhibited L. monocyto genes and E. coli bacterial growth in the broth, while growth inhibition of S. aureus is dose-dependent.

Feyzioglu and Tornuk (2016)

Functional and Preservative Properties of Phytochemicals

Essential oil/ compounds

248

S. N.

Carum copticum

Chitosan

Oil-in-water emulsion

Gram-positive bacteria S. aureus (ATCC 29737), Staphylococcus epidermidis (ATCC 12228), and Bacillus cereus (ATCC 11778) and three strains of gramnegative bacteria E. coli (ATCC 8739), Salmonella typhimurium (ATCC13311), and Proteus vulgaris (ATCC 6380)

Antibacterial activities of C. copticum loaded nanoparticle were ranged between 8.0
1.0 to 12.3
1.0 mm inhibition zone against the test microbes.

Esmaeili and Asgari. (2015)

11

Lime essential oil

Chitosan

Nanoprecipitation

S. aureus, Listeria monocytogenes,Shigella dysenteriae, and E. coli

For CSNPs-LEO (nanopart icle), the minimum inhi bitory volume (MIV) was 2.5 mL for E. coli and 1.25 mL for S. aureus, L. monocytogenes and S. dysenteriae. While for CSNCs-LEO (nanocapsules) it was 5 mL for S. aureus, L. monocytogenes, and S. dysenteriae and 10 mL.for E. coli.

Sotelo-Boyas et al. (2017)

12

Bergamot

Chitosan

Emulsion

Aspergillus flavus

A. flavus conidial germination was significantly inhibited (87%e90%) with the treatment of encapsulated bergamot EO compared with the control.

Aloui et al. (2014)

249

Continued

Application of nanotechnology to boost

10

Table 8.1 Antimicrobial activity of nanoencapsulated essential oils and bioactive compounds.dcont’d 250

Essential oil/ compounds

Delivery agents

Method

Microbes

Results

References

13

Myristica fragrans

Chitosan

Nanogel

Aspergillus flavus

MIC and MAIC ¼ 1.25 mL/mL.

Yadav et al. (2019)

14

Mentha piperita

Chitosan

Nanogel

Aspergillus flavus

Encapsulated M. piperita essential oils causes complete inhibition growth of A. flavus at 500 ppm.

Beyki et al. (2014)

15

Methyl salicylate

Chitosan

Nanogel

Aspergillus flavus

MIC and MAIC ¼ 1.0 mL/mL

Kujur et al. (2019)

16

eugenol, menthol and t-anethole (EMT) formulation

Chitosan

Nanogel

Aspergillus flavus

The MIC and MAIC value of Ne-EMT was found at 0.4 mL/mL and 0.3 mL/mL.

Kumar et al. (2019a)

17

Thymol (T), methyl cinnamate (M), and linalool (L) (TML) formulation

Chitosan

Nanogel

Aspergillus flavus

The MIC and MAIC value of Ne-TML was found at 0.3 mL/mL and 0.2 mL/mL.

Kumar et al. (2019b)

18

Gaultheria procumbens

Chitosan

Nanogel

Aspergillus flavus

Microencapsulated G. procumbens essential oil causes complete inhibition of A. flavus growth and aflatoxin B1 production at 1.0 mL/mL

Kujur et al. (2017)

Functional and Preservative Properties of Phytochemicals

S. N.

Pimenta dioica

Chitosan/kcarrageenan

Coacervation

Bacillus subtilis MIUG B106B, Bacillus cereus MIUGB107B, Rhodotorula glutinis MIUG D7, Candida utilis MIUG D8, Saccharomyces cerevisiae MIUG D9, Aspergillus niger MIUG M5, Penicillium glaucumMIUG M9, Geotrichum candidum MIUG M13

Encapsulated P. dioica essential oil zone of inhibition were ranged 1.1
0.13 to 4.8
0.21 against all tested bacteria.

Dima et al. (2014)

20

Ocimum sanctum

Chitosan

Nanoemulsion

Aspergillus flavus

MIC ¼ 60 mL/L; MAIC ¼ 30 mL/L

Singh et al. (2019)

Application of nanotechnology to boost

19

MIC ¼ Minimum inhibitory concentration, MAIC ¼ Minimum aflatoxin inhibitory concentration, MBC ¼ Minimum bactericidal concentration.

251

252

Table 8.2 Antioxidant activity of nanoencapsulated essential oils. Results Method

Free

Nanoencapsulated

References

1

Satureja hortensis

DPPH

-

Activity ranging between43.66% to 56.99%.

Feyzioglu and Tornuk (2016)

2

Coriandrum sativum

DPPH ABTS

IC50 ¼ 16.04 mL/mL IC50 ¼ 3.26 mL/mL

IC50 ¼ 10.26 mL/mL IC50 ¼ 2.41 mL/mL

Das et al. (2019)

3

Ocimum sanctum

DPPH

IC50 ¼ 2810 mL/L

IC50 ¼ 1390 mL/L

Singh et al. (2019)

4

Mace essential oil

DPPH

IC50 ¼ 3.89 mL/mL

IC50 ¼ 2.1 mL/mL

Yadav et al. (2019)

5

Peppermint oil

DPPH

IC50 ¼ 3.25 mg/mL

IC50 ¼ 1.61 mg/mL .

Shetta et al. (2019)

6

Green tea oil

DPPH

IC50 ¼ 0.81 mg/mL

IC50 ¼ 0.34 mg/mL

Shetta et al. (2019)

7

Thymus capitatus essential oil

DPPH; b-carotene

IC50 ¼ 300.00
3.06 mg/ mL IC50 ¼ 200.00
2.52 mg/ mL

IC50 ¼ 390.0
2.65 mg/mL IC50 ¼ 220.0
1.04 mg/mL

Jemaa et al. (2018)

8

Limonene

DPPH

-

IC50 ¼ 116 ppm

Sarjono et al. (2019)

- not evaluated.

Functional and Preservative Properties of Phytochemicals

S. N.

Nanoencapsulated essential oil/compounds

S.N. 1.

2.

Delivery agents to nanoencapsulation Plant origin

Animal origin

Source

Application

References

Starch

Specially cereals, legumes, potato, carrot, and banana

Drug delivery, food preservation

Fathi et al. (2014)

Cellulose

Wood pulp and cotton fibers

Essential oil encapsulation, enzyme immobilization, synthesis of antimicrobial and medical materials, green catalysis, biosensing, synthesis of drug carrier in therapeutic and diagnostic medicine

George and Sabapathi (2015)

Pectin

Plant cell wall

Drug delivery, pharmaceutic, gelling agents

Srivastava and Malviya (2011)

Guar gum

Cyamopsis tetragonoloba

Food applications, encapsulation, drug delivery

Mudgil et al. (2014)

Chitosan

crustacean group shells such as crabs, shrimp, and crayfish

Food applications, encapsulation, drug delivery

Elgadir et al. (2015); Prakash et al. (2018) 253

Continued

Application of nanotechnology to boost

Table 8.3 Types of delivery agents, their source, and application.

254

Table 8.3 Types of delivery agents, their source, and application.dcont’d S.N. 3.

Algal origin

Microbial origin

Source

Application

References

Alginate

brown sea algae

Food applications, gelling agents, encapsulation, drug delivery

Lee and Mooney. (2012)

Carrageenan

Rhodophyceae family member such as Chondrus crispus, Eucheuma, Gigartina stellata, Iridaea, Hypnea, Solieria, Agardhiella, and Sarconema

Gelling agents, encapsulation, food application, drug delivery, stabilizing agents

Stanley (1987)

Xanthan

Xanthomonas campestris

Drug delivery, hydrogel, matrix Systems, nanoparticles

Benny et al. (2014)

Dextran

Family Lactobacillaceae and basically from Leuconostoc mesenteroids, Leuconostoc dextranicum, and Streptobacterium dextranicum

Food applications, gelling agents, encapsulation, drug delivery

Fathi et al. (2014)

Cyclodextrins

Bacillus amylobacter

Anticancer drug delivery, food application, siRNA delivery system, improvement in antitumor activity and reduction in toxicity

Gidwani and Vyas (2015)

Functional and Preservative Properties of Phytochemicals

4.

Delivery agents to nanoencapsulation

Application of nanotechnology to boost

255

industrial application as carrier agents of plant-based bioactive molecules in food system (Builders and Arhewoh, 2016). A range of carrier agents based on starch or its derivatives have been used for the delivery of bioactive compounds such as menthone (Qiu et al., 2017), insulin (Jain et al., 2008), lutein (Fu et al., 2019), flaxseed (Gokmen et al., 2011). The hydrophilic nature of starch limits its industrial application as encapsulating material of hydrophobic compounds. However, such a limitation could be overcome by acetylating of starch that not only elevates its hydrophobicity but also reduces swelling ability with significant resistance to enzymatic hydrolysis during its application as delivery systems for bioactive agents (Tuovinen, et al., 2004; Xu et al., 2019). Souza et al. (2013) investigated the antimicrobial activity of cinnamon essential oil coated within cassava starch films, and reported that essential oil incorporated with cassava starch composite films exhibited significant antimicrobial activity against Penicillium commune and Eurotium amstelodami.

4.2

Cellulose

Cellulose is one of the most abundant polysaccharides on the earth, consisting of glucose units linked with b-d-(1e4) linkages. Otoni et al. (2014) prepared coarse emulsions (1.3e1.9 mm) and nanoemulsions (180e250 nm) of Syzygium aromaticum and Origanum vulgare essential oils using methylcellulose through low-speed mixing/ ultrasonication. They have reported that nanosize particles exhibited improved antimicrobial properties and could be used as shelflife extenders of sliced bread (the model food). Liakos et al. (2016) reported that nanocapsules of lemongrass oil incorporated within the cellulose acetate have significant antimicrobial properties against E. coli and S. aureus at low doses. The current limitations such as large dimension and low water solubility of cellulose-based delivery agents could be overcome by physical, chemical, and biochemical modification in cellulose.

4.3

Pectin

Pectin is an anionic polysaccharide linked with a-d-(1 / 4) galacturonic acid residues. It is widely used as the carrier agent of acid-sensitive bioactive compounds, as it shows resistance to the enzymatic digestion in mouth and stomach (Sinha and Kumria, 2001). Based on the degree of esterification, it could be categorized in two forms: low methoxyl pectin (methoxylation ranged between 25% and 50%); high methoxyl pectin (methoxylation (50%e80%). However, low entrapment efficiency and fast release of encapsulated low molecular weight bioactive compounds are the few existing drawbacks of pectin-based carrier agent (Sonia and Sharma, 2012). Therefore, to overcome such limitations an effective combination of pectin with another polymer such as chitosan has been witnessed in past few years. Alvarez et al. (2014) reported that pectin films containing oregano essential oil (OEO) effectively reduced total coliforms, yeast, and mold contamination of storage shrimp and cucumber slices at 4 C by inhibiting quorum sensing (cell to cell communication mechanism).

256

4.4

Functional and Preservative Properties of Phytochemicals

Guar gum

Cyamopsis tetragonolobus is the main source of natural guar gum (a water-soluble polysaccharide). Guar gum has been used as the delivery agent of clove oil (Thimma and Tammishetti, 2003) and tannic acid (Yang et al., 2019). Arfat et al. (2017) studied the potential application of guar gum/AgeCu nanocomposite films as an active food packaging material against Listeria monocytogenes (ATCC 19114), Salmonella enterica sv typhimurium (ATCC 14028). Esfahani et al. (2019) reported that gelatin-gum arabic based nanocarrier efficiently masks the undesirable flavor and odor of incorporated fish oil. The high viscosity, poor hydration, and low thermal stability are some of the current existing limitations of guar gum. However, these limitations could be overcome by depolymerization of guar using acids, enzymes, heat-induced acid hydrolysis, hydrothermal degradation, microwave mediated free radical degradation, ultrasonication, irradiation (Fathi et al., 2014).

4.5

Chitosan

Chitosan (poly[b-(1 / 4)-2-amino-2-deoxy-D-glucopyranose) is a natural biopolymer derived from deacetylation of chitin. The major sources of chitin are the shells of the crustacean group of animals such as crabs, shrimp, and crayfish. Nowadays, chitosan (a natural antimicrobial agent) has been widely used as a delivery agent of essential oils because of its abundant availability, biodegradability, biocompatibility, safety, and costeffectiveness. It dissolves easily in slightly acidic aqueous environment (pH < 6.5).

4.6

Alginate

Alginate is a type of polysaccharide, formed by rotating squares of 1e4 connected a-L-guluronic (G residue), and b-D-mannuronic acid (M residue) is obtained from brown sea alga. Sodium alginate is a water-soluble biopolymer and gellike structure. It has been utilized for encapsulation of various components such as lipid (Strasdat and Bunjes, 2013), lipase (Liu, et al.,2012), and turmeric oil (Lertsutthiwong et al., 2008). Alginate beads could be synthesized by adding the sodium alginate solution into calcium chloride solution leading to the formation of eggbox like configuration due to the interaction of the Caþ2 ions with blocks of G residues (Fathi et al., 2014).

4.7

Carrageenan

Carrageenan is extracted from red seaweeds such as Chondrus crispus, Eucheuma, Gigartina stellata, Iridaea, Hypnea, Solieria, Agardhiella, and Sarconema. It is a natural anionic sulfate polysaccharide and joined by a-1, 3 and b-1,4 glycosidic linkage by alternate units of D-galactose and 3,6-anhydrogalactose. Gundewadi et al. (2018a,b) reported alginate-based nanoencapsulated basil (Ocimum basilicum. L) oil exhibited potent antifungal efficacy against food-spoilage fungi Penicillium chrysogenum and

Application of nanotechnology to boost

257

Aspergillus flavus. In vivo result with model food system okra showed that nanoencapsulated basil oil could be recommended as plant-based antifungal agent to extend the shelflife of okra during postharvest storage.

4.8

Dextrans

Dextrans are synthesized by various countless microorganisms bound to the family Lactobacillaceae, especially from Leuconostoc mesenteries, Leuconostoc dextranicum, and Streptobacterium dextranicum. It is a polysaccharide of bacterial glucan, linked with a-(1e6) and some percentage of a-(1 / 3) linkage. Singh et al. (2018) reported that dextran/nanosoy/glycerol/chitosan-based nanocomposite of Aloe vera and manuka honey improved the antimicrobial (S. aureus), scar prevention, and wound healing properties of the prepared herbal formulation.

4.9

Cyclodextrin

Villiers (1891) first isolated cyclodextrin (a truncated cone-shaped oligosaccharide) from Bacillus amylobacter. It is a cyclic oligosaccharide containing glucopyranose units connected by a (1 / 4) linkage and those consisting of 6, 7, and 8 glucose units are called as a -, b -, and ge cyclodextrin (Takeji Shibatani 1996). All types of CDs (a-CD, b-CD, and g-CD) show diverse abilities to entrap the bioactive molecule (Marques, 2010). They have a lipophilic central core region surrounded by hydrophilic outside surface that makes it as an excellent carrier agent of poorly soluble, temperature sensitive, or chemically labile agents such as antimicrobials (Piercey et al., 2012), antioxidants (Krishnaswamy et al., 2012), essential oils (Prakash et al., 2015), and flavors (Choi et al., 2009). Silva et al. (2019) investigated the antimicrobial properties of coriander essential oil incorporated in dextrin-derived nanosponges (CD-NS). They have reported that a-CD-NS and b-derived-CD-NS could be used as controlled release system for coriander essential oil.

5. Technique used for encapsulation of essential oils Nowadays, a large number of methodologies have been used to encapsulate essential oils such as spray drying, coacervation, liposome, nanoemulsion, and freeze drying. Spray drying technology is one of the most commonly used techniques used for the encapsulation of essential oils due to its speed, relatively low cost, and reproducibility (Yeo et al., 2001). In spray drying technology the desired active components were dissolved in the polymer solution followed by atomization and spraying of the mixture in a warmed air chamber. However, this technique is not suitable for the encapsulation of aromatic or thermolabile bioactive components. Coacervation is one of the most effective techniques of encapsulation of plant-derived products in food industries. The main principle of this technique is the electrostatic attraction between oppositely charged molecules. Due to the electrostatic attraction, liquid coating material is efficiently deposited

258

Functional and Preservative Properties of Phytochemicals

around the core material. The force is derived between plant-derived components and oppositely charged delivery agent. The essential oils/compounds are trapped in the matrix framed by the electrostatic complex of positively charged (chitosan) and negatively charged (gelatin and alginate) biopolymers (complex coacervation). This technique is used for both polar and nonpolar molecules (Fathi et al., 2014). Liposome, the principle of this method is the formation of a membranous structure of liposome colloid particle due to the dispersion of phospholipids in aqueous phase. Emulsification is one of the most common methods of encapsulation; traditionally, it has been achieved by homogenization process. In general, the process involves two major steps such as emulsification of the polymeric solution (polymer þ bioactive compounds þ organic solvent) using suitable emulsifier into an aqueous solution followed by homogenization process, and the second step involves the removal of solvent followed by polymer precipitation. Freeze drying or lyophilization technique is generally applied for the heat-sensitive material and to mask the intense aroma. Heat liable bioactive compounds could be efficiently encapsulated using this technique. The emulsion solutions contain a core material surrounded by the coating material. There is a four-step method in freeze drying, i.e., freezing, sublimation (primary drying), desorption stage (secondary drying), and storage. However, the main drawback of freeze drying is energy intensiveness, long processing time, and open porous structure (due to the ice sublimation). At present, the freeze drying method is a broadly utilized strategy to expel water from nanocapsules without changing their structure and shape. Table 8.4 summarizes the techniques used for the encapsulation of essential oils and their bioactive compounds.

6.

Conclusion

Most of the essential oils possess strong antimicrobial and functional properties. Hence, the use of essential oilsebased ingredients in the food system could enhance the shelflife of food commodities and would have beneficial effect on human health also. Nanotechnology is a promising technological approach to enhance the bioactivity (antimicrobial and functional) of plant-based ingredients in the food system. The application of the nanoencapsulation technology can overcome some of the existing limitations of essential oilebased food ingredients such as protection of essential oils from degradation, increase solubility in aqueous medium, masking the intense aroma, avoiding the negative interactions with food components, and targeted delivery. Nanotechnology is a promising tool for limiting the effective dosage of plant-based bioactive compounds to achieve the preservative and functional effect with increase in bioavailability and bioactivities. However, before the commercialization of nanoencapsulated food ingredients, it is imperative that the safety assessment of nanomaterials should be scrutinized. Hence, detailed investigations and guidelines concerning the effects of these nanomaterials on human and nature health should be led and built up to guarantee safe food for the consumers. Therefore, additional innovative research is needed related to innovative, costeffective, and safe delivery system to enhance the application domain of essential oils at the industrial level.

Nanoencapsulation technique

1

Spray drying

Dispersion, homogenization,atomization, dehydration of the atomized particles

Salvia hispanica,flaxseed oil,Mentha piperita

RodeaGonzalez et al. (2012) Carneiro et al. (2013) Baranauskien_e et al. (2007)

2

Coacervates

Electrostatic attraction between oppositely charged molecules, deposition, solidification of coating

Pimenta dioicalavender oil,orange oil

Dima et al. (2014) Xiao et al. (2014) Jun-xia et al. (2011)

3

Liposome

Formation of membranous structure of liposome colloid particle due to the dispersion of phospholipids in aqueous phase, Microfluidization, ultrasonication,reverse-phase evaporation

Anethum graveolens, Tea tree

Ortan et al. (2009) Biju et al. (2005)

4

Emulsification

Two immiscible liquids are dispersed in each other

Rosemary essential oil

Turasan et al. (2015)

5

Freeze drying

Sublimation (primary drying), desorption stage (secondary drying), and, finally, storage.

Flax oil,Limonene

QuispeCondori et al. (2011) Kaushik and Roos (2007)

Major steps in encapsulation technique

Encapsulated essential oils

References

259

S. N.

Application of nanotechnology to boost

Table 8.4 Various nanoencapsulation techniques, major steps, and encapsulated essential oils.

260

Functional and Preservative Properties of Phytochemicals

References Abdollahi, M., Salehnia, A., Mortazavi, S.H.R., Ebrahimi, M., Shafiee, A., Fouladian, F., Keshavarz, K., Sorouri, S., Khorasani, R., Kazemi, A., 2003. Antioxidant, antidiabetic, antihyperlipidemic, reproduction stimulatory properties and safety of essential oil of Satureja Khuzestanica in rat in vivo: a toxicopharmacological study. Medical Science Monitor 9 (9), BR331eBR335. Adams, R.P., 2007. Identification of Essential Oil Components by Gas Chromatography/Mass Spectrometry. Allured Publishing Corporation, Carol Stream, IL, p. 456. Afoulous, S., Ferhout, H., Raoelison, E.G., Valentin, A., Moukarzel, B., Couderc, F., Bouajila, J., 2013. Chemical composition and anticancer, anti-inflammatory, antioxidant and antimalarial activities of leaves essential oil of Cedrelopsis grevei. Food and Chemical Toxicology 56, 352e362. Akarca, G., 2019. Composition and antibacterial effect on food borne pathogens of Hibiscus surrattensis L. calyces essential oil. Industrial Crops and Products 137, 285e289. Aloui, H., Khwaldia, K., Licciardello, F., Mazzaglia, A., Muratore, G., Hamdi, M., Restuccia, C., 2014. Efficacy of the combined application of chitosan and Locust Bean Gum with different citrus essential oils to control postharvest spoilage caused by Aspergillus flavus in dates. International Journal of Biological Macromolecules 170, 21e28. Alvarez, M.V., Ortega-Ramirez, L.A., Gutierrez-Pacheco, M.M., Bernal-Mercado, A.T., Rodriguez-Garcia, I., Gonzalez-Aguilar, G.A., Ponce, A., Moreira, M., Soura, S.I., AyalaZavala, J.F., 2014. Oregano essential oil-pectin edible films as anti-quorum sensing and food antimicrobial agents. Frontiers in Microbiology 5, 699. Arasu, M.V., Viayaraghavan, P., Ilavenil, S., Al-Dhabi, N.A., Choi, K.C., 2019. Essential oil of four medicinal plants and protective properties in plum fruits against the spoilage bacteria and fungi. Industrial Crops and Products 133, 54e62. Arfat, Y.A., Ejaz, M., Jacob, H., Ahmed, J., 2017. Deciphering the potential of guar gum/Ag-Cu nanocomposite films as an active food packaging material. Carbohydrate Polymers 157, 65e71. Bakkali, F., Averbeck, S., Averbeck, D., Idaomar, M., 2008. Biological effects of essential oilsea review. Food and Chemical Toxicology 46 (2), 446e475.  Baranauskien_e, R., Bylait_e, E., Zukauskait_ e, J., Venskutonis, R.P., 2007. Flavor retention of peppermint (Mentha piperita L.) essential oil spray-dried in modified starches during encapsulation and storage. Journal of Agricultural and Food Chemistry 55 (8), 3027e3036. Benny, I.S., Gunasekar, V., Ponnusami, V., 2014. Review on application of xanthan gum in drug delivery. International Journal PharmTech, Research 6 (4), 1322e1326. Bertella, A., Benlahcen, K., Abouamama, S., Pinto, D.C., Maamar, K., Kihal, M., Silva, A.M., 2018. Artemisia herba-alba Asso. essential oil antibacterial activity and acute toxicity. Industrial Crops and Products 116, 137e143. Beyki, M., Zhaveh, S., Khalili, S.T., Rahmani-Cherati, T., Abollahi, A., Bayat, M., Tabatabaei, M., Mohsenifar, A., 2014. Encapsulation of Mentha piperita essential oils in chitosanecinnamic acid nanogel with enhanced antimicrobial activity against Aspergillus flavus. Industrial Crops and Products 54, 310e319. Biju, S.S., Ahuja, A., Khar, R.K., 2005. Tea tree oil concentration in follicular casts after topical delivery: determination by high-performance thin layer chromatography using a perfused bovine udder model. Journal of Pharmaceutical Sciences 94, 240e245.

Application of nanotechnology to boost

261

Bilia, A.R., Guccione, C., Isacchi, B., Righeschi, C., Firenzuoli, F., Bergonzi, M.C., 2014. Essential oils loaded in nanosystems: a developing strategy for a successful therapeutic approach. Evidence-Based Complementary and Alternative Medicine 2014, 1e14. Bodake, H., Panicker, K., Kailaje, V., Rao, V., 2002. Chemopreventive effect of orange oil on the development of hepatic preneoplastic lesions induced by N-nitrosodiethylamine in rats: an ultrastructural study. Indian Journal of Experimental Biology 40, 245e251. Builders, P.F., Arhewoh, M.I., 2016. Pharmaceutical applications of native starch in conventional drug delivery. Starch Staerke 68 (9e10), 864e873. Burt, S., 2004. Essential oils: their antibacterial properties and potential applications in foodsda review. International journal of food microbiology 94 (3), 223e253. Byrne, R.W., Russon, A.E., 1998. Learning by imitation: a hierarchical approach. Behavioral and Brain Sciences 21 (5), 667e684. Caballero, B., Trugo, L.C., Finglas, P.M., 2003. Encyclopedia of Food Sciences and Nutrition. Academic Press, Amsterdam. Carneiro, H.C., Tonon, R.V., Grosso, C.R., Hubinger, M.D., 2013. Encapsulation efficiency and oxidative stability of flaxseed oil microencapsulated by spray drying using different combinations of wall materials. Journal of Food Engineering 115 (4), 443e451. Celia, C., Trapasso, E., Locatelli, M., Navarra, M., Ventura, C.A., Wolfram, J., Paolino, D., 2013. Anticancer activity of liposomal bergamot essential oil (BEO) on human neuroblastoma cells. Colloids and Surfaces B 112, 548e553. Choi, M.J., Soottitantawat, A., Nuchuchua, O., Min, S.G., Ruktanonchai, U., 2009. Physical and light oxidative properties of eugenol encapsulated by molecular inclusion and emulsionediffusion method. Food Research International 42 (1), 148e156. Cui, H., Zhang, C., Li, C., Lin, L., 2019. Antibacterial mechanism of oregano essential oil. Industrial Crops and Products 139, 111498. Das, S., Chaudhury, A., 2011. Recent advances in lipid nanoparticle formulations with solid matrix for oral drug delivery. AAPS PharmSciTech 12 (1), 62e76. Das, S., Singh, V.K., Dwivedy, A.K., Chaudhari, A.K., Upadhyay, N., Singh, P., Sharma, S., Dubey, N.K., 2019. Encapsulation in chitosan-based nanomatrix as an efficient green technology to boost the antimicrobial, antioxidant and in situ efficacy of Coriandrum sativum essential oil. International Journal of Biological Macromolecules 133, 294e305. Dima, C., Cotarlet, M., Alexe, P., Dima, S., 2014. Microencapsulation of essential oil of pimento [Pimenta dioica (L) Merr.] by chitosan/k-carrageenan complex coacervation method. Innov. Food Science and Emerging Technologies 22, 203e211. Dohi, S., Terasaki, M., Makino, M., 2009. Acetylcholinesterase inhibitory activityand chemical composition of commercial essential oils. Journal of Agricultural and Food Chemistry 57, 4313e4318. El-Soud, N., El-Laithy, N., El-Saeed, G., Wahby, M., Khalil, M., Morsy, F., Shaffie, N., 2011. Antidiabetic activities of Foeniculum vulgare Mill. essential oil in streptozotocin-induced diabetic rats. Open Access Macedonian Journal of Medical Sciences 4 (2), 139e146. Elgadir, M.A., Uddin, M.S., Ferdosh, S., Adam, A., Chowdhury, A.J.K., Sarker, M.Z.I., 2015. Impact of chitosan composites and chitosan nanoparticle composites on various drug delivery systems: a review. Journal of Food and Drug Analysis 23 (4), 619e629. Esfahani, R., Jafari, S.M., Jafarpour, A., Dehnad, D., 2019. Loading of fish oil into nanocarriers prepared through gelatin-gum Arabic complexation. Food Hydrocolloids 90, 291e298. Esmaeili, A., Asgari, A., 2015. In vitro release and biological activities of Carum copticum essential oil (CEO) loaded chitosan nanoparticles. International Journal of Biological Macromolecules 81, 283e290. ˇ

262

Functional and Preservative Properties of Phytochemicals

Fathi, M., Martin, A., McClements, D.J., 2014. Nanoencapsulation of food ingredients using carbohydrate based delivery systems. Trends in Food Science and Technology 39 (1), 18e39. Feyzioglu, G.C., Tornuk, F., 2016. Development of chitosan nanoparticles loaded with summer savory (Satureja hortensis L.) essential oil for antimicrobial and antioxidant delivery applications. Lebensmittel-Wissenschaft und -Technologie- Food Science and Technology 70, 104e110. Fu, Y., Yang, J., Jiang, L., Ren, L., Zhou, J., 2019. Encapsulation of Lutein into starch nanoparticles to improve its dispersity in water and enhance stability of chemical oxidation. Starch Staerke 71 (5e6), 1800248. George, J., Sabapathi, S.N., 2015. Cellulose nanocrystals: synthesis, functional properties, and applications. Nanotechnology, Science and Applications 8, 45e54. Ghaderi-Ghahfarokhi, M., Barzegar, M., Sahari, M.A., Azizi, M.H., 2016. Nanoencapsulation approach to improve antimicrobial and antioxidant activity of thyme essential oil in beef burgers during refrigerated storage. Food and Bioprocess Technology 9 (7), 1187e1201. Giongo, J.L., de Almeida Vaucher, R., Sagrillo, M.R., Santos, R.C.V., Duarte, M.M., Rech, V.C., Gomes, P., 2017. Anti-inflammatory effect of geranium nanoemulsion macrophages induced with soluble protein of Candida albicans. Microbial Pathogenesis 110, 694e702. Gidwani, B., Vyas, A., 2015. A comprehensive review on cyclodextrin-based carriers for delivery of chemotherapeutic cytotoxic anticancer drugs. BioMed Research International 2015, 1e15. Gokmen, V., Mogol, B.A., Lumaga, R.B., Fogliano, V., Kaplun, Z., Shimoni, E., 2011. Development of functional bread containing nanoencapsulated omega-3 fatty acids. Journal of Food Engineering 105 (4), 585e591. Guenther, E., Althausen, D., 1948. The Essential Oils, vol. 1. Van Nostrand, New York, p. 81. Gundewadi, G., Rudra, S.G., Sarkar, D.J., Singh, D., 2018a. Nanoemulsion based alginate organic coating for shelf life extension of okra. Food Packaging and Shelf Life 18, 1e12. Gundewadi, G., Sarkar, D.J., Rudra, S.G., Singh, D., 2018b. Preparation of basil oil nanoemulsion using Sapindus mukorossi pericarp extract: physico-chemical properties and antifungal activity against food spoilage pathogens. Industrial Crops and Products 125, 95e104. Handford, C.E., Dean, M., Henchion, M., Spence, M., Elliott, C.T., Campbell, K., 2014. Implications of nanotechnology for the agri-food industry: opportunities, benefits and risks. Trends in Food Science and Technology 40 (2), 226e241. Hasani, S., Ojagh, S.M., Ghorbani, M., 2018. Nanoencapsulation of lemon essential oil in Chitosan-Hicap system. Part 1: study on its physical and structural characteristics. International Journal of Biological Macromolecules 115, 143e151. Hasheminejad, N., Khodaiyan, F., Safari, M., 2019. Improving the antifungal activity of clove essential oil encapsulated by chitosan nanoparticles. Food Chemistry 275, 113e122. Henderson, C.J., Smith, A.G., Ure, J., Brown, K., Bacon, E.J., Wolf, C.R., 1998. Increased skin tumorigenesis in mice lacking pi class glutathione S-transferases. Proceedings of the National Academy of Sciences 95 (9), 5275e5280. Hosseini, S.F., Zandi, M., Rezaei, M., Farahmandghavi, F., 2013. Two-step method for encapsulation of oregano essential oil in chitosan nanoparticles: preparation, characterization and in vitro release study. Carbohydrate Polymers 95 (1), 50e56. Hu, Y., Zhang, J., Kong, W., Zhao, G., Yang, M., 2017. Mechanisms of antifungal and antiaflatoxigenic properties of essential oil derived from turmeric (Curcuma longa L.) on Aspergillus flavus. Food Chemistry 220, 1e8.

Application of nanotechnology to boost

263

Hyldgaard, M., Mygind, T., Meyer, R.L., 2012. Essential oils in food preservation: mode of action, synergies, and interactions with food matrix components. Frontiers in Microbiology 3, 12. Jain, A.K., Khar, R.K., Ahmed, F.J., Diwan, P.V., 2008. Effective insulin delivery using starch nanoparticles as a potential trans-nasal mucoadhesive carrier. European Journal of Pharmaceutics and Biopharmaceutics 69 (2), 426e435. Jamil, B., Abbasi, R., Abbasi, S., Imran, M., Khan, S.U., Ihsan, A., Javed, S., Bokhari, H., 2016. Encapsulation of cardamom essential oil in chitosan nano-composites: in-vitro efficacy on antibiotic-resistant bacterial pathogens and cytotoxicity studies. Frontiers in Microbiology 7, 1580. Jemaa, M.B., Falleh, H., Serairi, R., Neves, M.A., Snoussi, M., Isoda, H., Ksouri, R., 2018. Nanoencapsulated Thymus capitatus essential oil as natural preservative. Innovative Food Science and Emerging Technologies 45, 92e97. Jun-xia, X., Hai-yan, Y., Jian, Y., 2011. Microencapsulation of sweet orange oil by complex coacervation with soybean protein isolate/gum Arabic. Food Chemistry 125 (4), 1267e1272. Karak, S., Acharya, J., Begum, S., Mazumdar, I., Kundu, R., De, B., 2018. Essential oil of Piper betle L. leaves: chemical composition, anti-acetylcholinesterase, anti-b-glucuronidase and cytotoxic properties. Journal of Applied Research on Medicinal and Aromatic 10, 85e92. Kaushik, V., Roos, Y.H., 2007. Limonene encapsulation in freeze-drying of gum Arabice sucroseegelatin systems. Lebensmittel-Wissenschaft und -Technologie- Food Science and Technology 40 (8), 1381e1391. Khalili, S.T., Mohsenifar, A., Beyki, M., Zhaveh, S., Rahmani-Cherati, T., Abdollahi, A., Tabatabaei, M., 2015. Encapsulation of Thyme essential oils in chitosan-benzoic acid nanogel with enhanced antimicrobial activity against Aspergillus flavus. LebensmittelWissenschaft und -Technologie- Food Science and Technology 60 (1), 502e508. Krishnaswamy, K., Orsat, V., Thangavel, K., 2012. Synthesis and characterization of nanoencapsulated catechin by molecular inclusion with beta-cyclodextrin. Journal of Food Engineering 111 (2), 255e264. Kujur, A., Kiran, S., Dubey, N.K., Prakash, B., 2017. Microencapsulation of Gaultheria procumbens essential oil using chitosan-cinnamic acid microgel: Improvement of antimicrobial activity, stability and mode of action. LWT-Food Science and Technology 86, 132e138. Kujur, A., Yadav, A., Kumar, A., Singh, P.P., Prakash, B., 2019. Nanoencapsulated methyl salicylate as a biorational alternative of synthetic antifungal and aflatoxin B 1 suppressive agents. Environmental Science & Pollution Research 1e11. Kumar, A., Kujur, A., Yadav, A., Pratap, S., Prakash, B., 2019a. Optimization and mechanistic investigations on antifungal and aflatoxin B1 inhibitory potential of nanoencapsulated plant-based bioactive compounds. Industrial Crops and Products 131, 213e223. Kumar, A., Kujur, A., Singh, P.P., Prakash, B., 2019b. Nanoencapsulated plant-based bioactive formulation against food-borne molds and aflatoxin B1 contamination: preparation, characterization and stability evaluation in the food system. Food Chemistry 287, 139e150. Lasram, S., Zemni, H., Hamdi, Z., Chenenaoui, S., Houissa, H., Tounsi, M.S., Ghorbel, A., 2019. Antifungal and antiaflatoxinogenic activities of Carum carvi L., Coriandrum sativum L. seed essential oils and their major terpene component against Aspergillus flavus. Industrial Crops and Products 11e18. Lee, K.Y., Mooney, D.J., 2012. Alginate: properties and biomedical applications. Progress in Polymer Science 37 (1), 106e126.

264

Functional and Preservative Properties of Phytochemicals

Lee, J.S., Kim, E.S., Lee, H.G., 2017. Improving the water solubility and antimicrobial activity of silymarin by nanoencapsulation. Colloids and Surfaces B 154, 171e177. Lertsutthiwong, P., Noomun, K., Jongaroonngamsang, N., Rojsitthisak, P., Nimmannit, U., 2008. Preparation of alginate nanocapsules containing turmeric oil. Carbohydrate Polymers 74 (2), 209e214. Lesjak, M.M., Beara, I.N., Orcic, D.Z., Petar, K.N., Simin, N.Ð., Emilija, S.Ð., MimicaDukic, N.M., 2014. Phytochemical composition and antioxidant, anti-inflammatory and antimicrobial activities of Juniperus macrocarpa Sibth. et Sm. Journal of Functional Foods 7, 257e268. Liakos, I.L., D’autilia, F., Garzoni, A., Bonferoni, C., Scarpellini, A., Brunetti, V., et al, 2016. All natural cellulose acetate-Lemongrass essential oil antimicrobial nanocapsules. International Journal of Pharmaceutics 510 (2), 508e515. Liu, X., Chen, X., Li, Y., Wang, X., Peng, X., Zhu, W., 2012. Preparation of superparamagnetic Fe3O4@ alginate/chitosan nanospheres for Candida rugosa lipase immobilization and utilization of layer-by-layer assembly to enhance the stability of immobilized lipase. ACS Applied Materials & Interfaces 4 (10), 5169e5178. Lopez-Rubio, A., Gavara, R., Lagaron, J.M., 2006. Bioactive packaging: turning foods into healthier foods through biomaterials. Trends in Food Science and Technology 17 (10), 567e575. Lu, W.C., Huang, D.W., Wang, C.C., Yeh, C.H., Tsai, J.C., Huang, Y.T., Li, P.H., 2018. Preparation, characterization, and antimicrobial activity of nanoemulsions incorporating citral essential oil. Journal of Food and Drug Analysis 26 (1), 82e89. Mansour, M., Ginawi, O., El-Hadiyah, T., El-Khatib, A., Al-Shabanah, O., Al-Sawaf, H., 2001. Effects of volatile oil constituents of Nigella sativa on carbon tetrachloride-induced hepatotoxicity in mice: evidence for antioxidant effects of thymoquinone. Research Communications in Molecular Pathology and Pharmacology 110, 239e251. Marques, H.M.C., 2010. A review on cyclodextrin encapsulation of essential oils and volatiles. Flavour and Fragrance Journal 25 (5), 313e326. Mohammadi, A., Hashemi, M., Hosseini, S.M., 2015a. Chitosan nanoparticles loaded with Cinnamomum zeylanicum essential oil enhance the shelf life of cucumber during cold storage. Postharvest Biology and Technology 110, 203e213. Mohammadi, A., Hashemi, M., Hosseini, S.M., 2015b. Nanoencapsulation of Zataria multiflora essential oil preparation and characterization with enhanced antifungal activity for controlling Botrytis cinerea, the causal agent of gray mould disease. Innovative Food Science and Emerging Technologies 28, 73e80. Moraes-Lovison, M., Marostegan, L.F., Peres, M.S., Menezes, I.F., Ghiraldi, M., Rodrigues, R.A., Pinho, S.C., 2017. Nanoemulsions encapsulating oregano essential oil: production, stability, antibacterial activity and incorporation in chicken paté. LebensmittelWissenschaft und -Technologie- Food Science and Technology 77, 233e240. Morita, T., Jinno, K., Kawagishi, H., Arimoto, Y., Suganuma, H., Inakuma, T., Sugiyama, K., 2003. Hepatoprotective effect of myristicin from nutmeg (Myristica fragrans) on lipopolysaccharide/d-galactosamine-induced liver injury. Journal of Agricultural and Food Chemistry 51 (6), 1560e1565. Mudgil, D., Barak, S., Khatkar, B.S., 2014. Guar gum: processing, properties and food applications a review. Journal of Food Science and Technology 51 (3), 409e418. Ngwabebhoh, F.A., Erdagi, S.I., Yildiz, U., 2018. Pickering emulsions stabilized nanocellulosic-based nanoparticles for coumarin and curcumin nanoencapsulations: in vitro release, anticancer and antimicrobial activities. Carbohydrate Polymers 201, 317e328. ˇ

Application of nanotechnology to boost

265

Ortan, A., Campeanu, G., Dinu-Pirv, C., Popesc, L., 2009. Studies concerning the entrapment of Anethum graveolens essential oil in liposomes. Romanian Biotechnological Letters 14, 4411e4417. Otoni, C.G., Pontes, S.F.O., Medeiros, E.A.A., Soares, N. de F.F., 2014. Edible films from methylcellulose and nanoemulsions of clove bud (Syzygium aromaticum) and oregano (Origanum vulgare) essential oils as shelf life extenders for sliced bread. Journal of Agricultural and Food Chemistry 62 (22), 5214e5219. € € urk, G., Ozt€ € urk, A., Pavithra, P.S., Ozbek, H., Ugras¸, S., D€ulger, H., Bayram, I., Tuncer, I., Ozt€ Mehta, A., Verma, R.S., 2018. Induction of apoptosis by essential oil from P. missionis in skin epidermoid cancer cells. Phytomedicine 50, 184e195. Pavithra, P.S., Sreevidya, N., Verma, R.S., 2009. Antibacterial activity and chemical composition of essential oil of Pamburus missionis. Journal of Ethnopharmacology 124 (1), 151e153. Piercey, M.J., Mazzanti, G., Budge, S.M., Delaquis, P.J., Paulson, A.T., Hansen, L.T., 2012. Antimicrobial activity of cyclodextrin entrapped allyl isothiocyanate in a model system and packaged fresh-cut onions. Food Microbiology 30 (1), 213e218. Prakash, B., Kedia, A., Mishra, P.K., Dubey, N.K., 2015. Plant essential oils as food preservatives to control moulds, mycotoxin contamination and oxidative deterioration of agrifood commoditiesePotentials and challenges. Food Control 47, 381e391. Prakash, B., Kujur, A., Yadav, A., Kumar, A., Singh, P.P., Dubey, N.K., 2018. Nanoencapsulation: an efficient technology to boost the antimicrobial potential of plant essential oils in food system. Food Control 89, 1e11. Qiu, C., Chang, R., Yang, J., Ge, S., Xiong, L., Zhao, M., Sun, Q., 2017. Preparation and characterization of essential oil-loaded starch nanoparticles formed by short glucan chains. Food Chemistry 221, 1426e1433. Quispe-Condori, S., Salda~na, M.D., Temelli, F., 2011. Microencapsulation of flax oil with zein using spray and freeze drying. Lebensmittel-Wissenschaft und -Technologie- Food Science and Technology 44 (9), 1880e1887. Rashidi, L., Khosravi-Darani, K., 2011. The applications of nanotechnology in food industry. Critical Reviews in Food Science and Nutrition 51 (8), 723e730. Rassem, H.H., Nour, A.H., Yunus, R.M., 2016. Techniques for extraction of essential oils from plants: a review. Australian Journal of Basic and Applied Sciences 10 (16), 117e127. Ribeiro-Santos, R., Andrade, M., de Melo, N.R., Sanches-Silva, A., 2017. Use of essential oils in active food packaging: recent advances and future trends. Trends in Food Science and Technology 61, 132e140. Risaliti, L., Kehagia, A., Daoultzi, E., Lazari, D., Bergonzi, M.C., Vergkizi-Nikolakaki, S., Bilia, A.R., 2019. Liposomes loaded with Salvia triloba and Rosmarinus officinalis essential oils: in vitro assessment of antioxidant, antiinflammatory and antibacterial activities. Journal of Drug Delivery Science and Technology 51, 493e498. Rodea-Gonzalez, D.A., Cruz-Olivares, J., Roman-Guerrero, A., Rodríguez-Huezo, M.E., Vernon-Carter, E.J., Pérez-Alonso, C., 2012. Spray-dried encapsulation of chia essential oil (Salvia hispanica L.) in whey protein concentrate-polysaccharide matrices. Journal of Food Engineering 111 (1), 102e109. Sarikurkcu, C., Ozer, M.S., Calli, N., Popovic-Djordjevic, J., 2018. Essential oil composition and antioxidant activity of endemic Marrubium parviflorum subsp. oligodon. Industrial Crops and Products 119, 209e213. Sarjono, P.R., Prasetya, N.B.A., Ariestiani, B., Kusuma, A.B., Darmastuti, N.E., Rohman, J.H., 2019. Antioxidant activity from limonene encapsulated by chitosan. IOP Conference Series: Materials Science and Engineering 509, 012113, 1-9 012113.

266

Functional and Preservative Properties of Phytochemicals

Senthilkumar, A., Thangamani, A., Karthishwaran, K., Cheruth, A.J., 2019. Essential oil from the seeds of Moringa peregrina: chemical composition and antioxidant potential. South African Journal of Botany. https://doi.org/10.1016/j.sajb.2019.01.030. Shetta, A., Kegere, J., Mamdouh, W., 2019. Comparative study of encapsulated peppermint and green tea essential oils in chitosan nanoparticles: encapsulation, thermal stability, in-vitro release, antioxidant and antibacterial activities. International Journal of Biological Macromolecules 126, 731e742. Shibatani, T., 1996. Industrial application of immobilized biocatalysts in Japan. Progress in Biotechnology 11, 585e591. Silva, F., Caldera, F., Trotta, F., Nerín, C., Domingues, F.C., 2019. Encapsulation of coriander essential oil in cyclodextrin nanosponges: a new strategy to promote its use in controlledrelease active packaging. Innovative Food Science and Emerging Technologies 56, 102177. Singh, S., Gupta, A., Gupta, B., 2018. Scar free healing mediated by the release of aloe vera and manuka honey from dextran bionanocomposite wound dressings. International Journal of Biological Macromolecules 120, 1581e1590. Singh, V.K., Das, S., Dwivedy, A.K., Rathore, R., Dubey, N.K., 2019. Assessment of chemically characterized nanoencapuslated Ocimum sanctum essential oil against aflatoxigenic fungi contaminating herbal raw materials and its novel mode of action as methyglyoxal inhibitor. Postharvest Biology and Technology 153, 87e95. Sinha, V.R., Kumria, R., 2001. Polysaccharides in colon-specific drug delivery. International Journal of Pharmaceutics 224 (1e2), 19e38. Sonia, T.A., Sharma, C.P., 2012. An overview of natural polymers for oral insulin delivery. Drug Discovery Today 17 (13e14), 784e792. Sotelo-Boyas, M.E., Correa-Pacheco, Z.N., Bautista-Ba~nos, S., Corona-Rangel, M.L., 2017. Physicochemical characterization of chitosan nanoparticles and nanocapsules incorporated with lime essential oil and their antibacterial activity against food-borne pathogens. Lebensmittel-Wissenschaft und -Technologie- Food Science and Technology 77, 15e20. Souza, A.C., Goto, G.E.O., Mainardi, J.A., Coelho, A.C.V., Tadini, C.C., 2013. Cassava starch composite films incorporated with cinnamon essential oil: antimicrobial activity, microstructure, mechanical and barrier properties. Lebensmittel-Wissenschaft und -TechnologieFood Science and Technology 54 (2), 346-3. Srivastava, P., Malviya, R., 2011. Sources of pectin, extraction and its applications in pharmaceutical industry an overview. Indian Journal of Natural Products and Resources 2 (1), 10e18. Stanley, N., 1987. Production, properties and uses of carrageenan. Production and utilization of products from commercial seaweeds. FAO Fisheries Technical Paper 288, 116e146. Strasdat, B., Bunjes, H., 2013. Incorporation of lipid nanoparticles into calcium alginate beads and characterization of the encapsulated particles by differential scanning calorimetry. Food Hydrocolloids 30 (2), 567e575. Sun, M., Nie, S., Pan, X., Zhang, R., Fan, Z., Wang, S., 2014. Quercetin-nanostructured lipid carriers: characteristics and anti-breast cancer activities in vitro. Colloids and Surfaces B 113, 15e24. Thimma, R.T., Tammishetti, S., 2003. Study of complex coacervation of gelatin with sodium carboxymethyl guar gum: microencapsulation of clove oil and sulphamethoxazole. Journal of Microencapsulation 20 (2), 203e210. Tuovinen, L., Ruhanen, E., Kinnarinen, T., R€onkk€o, S., Pelkonen, J., Urtti, A., J€arvinen, K., 2004. Starch acetate microparticles for drug delivery into retinal pigment epithelium-in vitro study. Journal of Controlled Release 98 (3), 407e413.

Application of nanotechnology to boost

267

Turasan, H., Sahin, S., Sumnu, G., 2015. Encapsulation of rosemary essential oil. LebensmittelWissenschaft und -Technologie- Food Science and Technology 64 (1), 112e119. Villiers, A., 1891. Sur la fermentation de la fécule par l’action du ferment butyrique. Comptes rendus de l’Académie des Sciences 112, 536e538. Xiao, Z., Liu, W., Zhu, G., Zhou, R., Niu, Y., 2014. Production and characterization of multinuclear microcapsules encapsulating lavender oil by complex coacervation. Flavour and Fragrance Journal 29 (3), 166e172. Xu, T., Gao, C., Feng, X., Huang, M., Yang, Y., Shen, X., Tang, X., 2019. Cinnamon and clove essential oils to improve physical, thermal and antimicrobial properties of chitosan-gum Arabic polyelectrolyte complexed films. Carbohydrate Polymers 217, 116e125. Yadav, A., Kujur, A., Kumar, A., Singh, P.P., Prakash, B., Dubey, N.K., 2019. Assessing the preservative efficacy of nanoencapsulated mace essential oil against food borne molds, aflatoxin B1 contamination, and free radical generation. Lebensmittel-Wissenschaft und -Technologie- Food Science and Technology 108, 429e436. Yang, W., Zhang, M., Li, X., Jiang, J., Sousa, A.M., Zhao, Q., Liu, L., 2019. Incorporation of tannic acid in food-grade guar gum fibrous mats by electrospinning technique. Polymers 11 (1), 141. Yeo, Y., Baek, N., Park, K., 2001. Microencapsulation methods for delivery of protein drugs. Biotechnology and Bioprocess Engineering 6 (4), 213e230.

Further reading Ghasemi, S., Jafari, S.M., Assadpour, E., Khomeiri, M., 2018. Nanoencapsulation of d-limonene within nanocarriers produced by pectin-whey protein complexes. Food Hydrocolloids 77, 152e162.

This page intentionally left blank

Biotechnology: a tool for synthesis of novel bioactive compounds

9

Sandeep Kumar, Praveena Bhatt, Sarma Mutturi Microbiology and Fermentation Technology Department, CSIR-Central Food Technological Research Institute, Mysuru, Karnataka, India

1. Introduction Food, medical, and agricultural sectors thrive on bioactive natural products. For instance, (i) food rich in phytochemicals (phenolics, vitamins, minerals, etc.) contribute to the functional attributes of well-being (ii) all the antibacterial, antifungal, antiviral, antiparasitic, antitumor, immunomodulators, etc., are derived from bioactive compounds (iii) bioactive compounds also contribute to most of the agrochemicals which are used as fungicide, herbicide, insecticide etc. Bioactive compounds also form the basis of synthesis of chemical analogs and their corresponding derivatives. The present chapter focuses on progress in bioactive compounds derived from microbial sources. David Perlman (1980) has postulated the famous laws of applied microbiology, which include (i) the microbe is always right, your friend, and a sensitive partner; (ii) there are no stupid microbes; (iii) microbes can and will do anything; (iv) microbes are smarter, wiser, and more energetic than chemists, engineers, and others; and (v) if you take care of your microbial friends, they will take care of your
future. Highly revered natural product researcher, Prof. Satoshi Omura describes that the above five laws summarize the approach to finding novel bioactive compounds from the microorganisms (Omura, 2011). Initially, researchers focused on harnessing these bioactive compounds from soil microorganisms, which are cultivable in laboratory. This was the golden era of microorganism-derived antibiotics, where a single genus Streptomyces itself contributed to more than half of the entire antibiotics discovered during 1955e62 (Bérdy, 1974). However, post 1973, there was considerable decrease in the enthusiasm as the researchers were pessimistic about discovering new antibiotics. Many companies and research organizations have withdrawn screening for new antibiotics (Omura, 1992). The key in discovering novel bioactive compounds from the microbes primarily relies on robust screening procedures in order to save time and money. Rapid advancements in genomics and metagenomics, systems biology, and synthetic biology have changed the traditional view of discovering natural products. Several tools are now at disposal for not only screening novel bioactive molecules but also to modify the existing ones (Fischbach and Walsh, 2009).

Functional and Preservative Properties of Phytochemicals. https://doi.org/10.1016/B978-0-12-818593-3.00009-9 Copyright © 2020 Elsevier Inc. All rights reserved.

270

Functional and Preservative Properties of Phytochemicals

The global microbiome is an excellent source for discovering novel bioactive compounds, which can perhaps act as an elixir for the problems encountered by mankind. Hence, researchers started screening bioactive compounds from sources other than soil such as the marine environment (bacteria, algae, sponges). It was also believed that marine environments are not crowded unlike soil, hence the microbiota might have evolved for specific defense mechanisms (via synthesis of bioactive compounds) for their survival (Zhang et al., 2005). There are also renewed interests in isolating extremophiles from both terrestrial and marine sources for screening bioactive compounds (Neifar et al., 2015). These extremophiles include thermophiles, psychrophiles, acidophiles, alkalophiles, halophiles, piezophiles, metalophiles, and radiophiles. Most of these might have evolved to produce niche enzymes and bioactive compounds for their survival at such extreme environments. There are also several reports on screening and identifying several bioactive compounds from cyanobacteria, e.g., family Nostocaceae (Nowruzi et al., 2018). Also recently, with the establishment of public repositories such as human microbiome project (https://hmpdacc.org/), there is scope for immense progress in screening bioactive compounds from microbial flora involved in human health and disease. The present chapter consolidates advancements in biotechnology of bioactive compounds’ research. Efforts were made to summarize the progress in screening, identification, and synthesis strategies for diverse class of bioactive compounds.

2.

Exploration and screening of novel bioactive compounds from microbial sources

According to Monciardini et al. (2014), the two major strategies for increased probability to find novel bioactive compounds are (i) sensitive detection assay and (ii) evaluating unexplored strains. Most of the pharmaceutical companies are uninterested, and lowered the emphasis on discovery of novel antibiotics due to high rediscovery rates (Katz et al., 2016; Hover et al., 2018). For instance, in actinomycetes the rediscovery rates are close to 99% (Handelsman et al., 1998). Majority of the existing antibiotics are derived from laboratory cultivable microorganisms only. However, there exists a microbiome in this world, which remains untapped as it cannot be easily cultivated in the laboratory conditions. Hence, there is a need to exploit this hidden microbiome using culture-independent discovery of bioactive molecules (Hover et al., 2018). Moreover, the biosynthetic gene clusters which are responsible for synthesis of bioactive compounds are usually not expressed in pure cultures (Katz et al., 2016). Therefore, screening such gene clusters directly from the environment becomes highly imperative. A detailed procedure for screening such clusters from environmental DNA (eDNA) which can be expressed in host organism is provided in Brady (2007). An overall pictorial representation of this procedure is provided in Fig. 9.1. Creation of libraries using eDNA is commonly termed as metagenomics, and has vast applications in the fields of ecology, biotechnology, medicine, agriculture, etc.

Biotechnology: a tool for synthesis of novel bioactive compounds

271

Figure 9.1 Steps involved in screening of novel bioactive compounds using cultureindependent strategy. The figure is a pictorial representation of methodology proposed by Brady (2007).

Here, the interest is to exploit metagenomics for the discovery of novel bioactive compounds. There are two clear advantages for generating libraries of gene clusters from eDNA (Handelsman et al., 1998). Firstly, metabolic pathways in bacteria leading to production of bioactive compounds (usually secondary metabolites) are usually clustered, thereby making it highly feasible to create a library for pathways. Secondly the bioactive gene cluster is linked to resistance genes; therefore, the product is not detrimental to the host organism during expression. To harness bioactive compounds from the eDNA, two approaches have been proposed by Katz et al. (2016). The first approach is functional screening, where the eDNA libraries are screened in phenotypic assays as shown in Fig. 9.1. The second approach is called homology screening, which utilizes the already known DNA sequences for screening the gene(s) of interest using eDNA as template. Thus identified genes are later expressed in a host to obtain the compound of interest.

2.1

Functional and homology screening

Successful expression of eDNA into a host bacterium is a critical step toward identification of novel bioactive molecule using functional metagenomics (Iqbal et al., 2016). Escherichia coli has been the most preferred host bacterium for carrying such studies due to faster growth cycle, and established genetics. Screening of some of the bioactive enzymes using functional metagenomics is summarized in Table 9.1. In the case of homology screening PCR and/or colony hybridization is used to screen bioactive molecules belonging to already known gene families. Here the procedure is similar until step no. 7 as shown in Fig. 9.1. However, PCR is carried using degenerate primers for known gene families, where the metagenomic libraries are

272

Functional and Preservative Properties of Phytochemicals

Table 9.1 Some of the enzymes screened using functional metagenomics and gene reporter assaysa. Sl. No.

a

Marker/Reporter assay

Product

Reference

1

5-bromo-4-chloro-3-indolyl caprylate (X-caprylate)

Esterases

Yao et al. (2011)

2

5-bromo-4-chloro-3-indolyl-b-Dgalactopyranoside (X-gal)

b-Galactosidases

Wang et al. (2010)

3

Triglyceride tributyrin

Esterases

Hu et al. (2011)

4

Skim milk

Proteases

Neveu et al. (2011)

5

Carboxymethylcellulose

Cellulases

Pang et al. (2009)

6

Product induced gene expression (PIGEX)

Amidases

Uchiyama and Miyazaki (2010)

7

Substrate induced gene expression (SIGEX)

Attenuators of quorum sensing

Uchiyama et al. (2005)

Adapted from Iqbal et al., (2012).

constructed in step no. 7. The pictorial representation is given in Fig. 9.2. Table 9.2 provides some key studies carried to identify bioactive compounds using PCRbased homology screening metagenomics. Degenerate PCR primers are designed to amplify conserved biosynthetic genes and the amplicons are sequenced to identify genes and gene clusters of interest.

2.2

Other metagenomic surveys

Conventionally metagenomics is applied to soil and marine microbiomes where genes and gene clusters are being identified that can lead to novel bioactive compounds. Apart from these, there exist microbiomes in animals and humans which can also be exploited to identify and map bioactive molecules. A pioneering work has been carried by Hess et al. (2011), where the uncultivable complex cow rumen microbiome was subjected to metagenomic analysis. Here a total of 268 gigabytes of DNA were sequenced and analyzed for identifying putative carbohydrate-active genes. Out of identified 27,755 putative candidates, 90 candidate proteins were expressed out of which 57% was found to be active against cellulosic substrates. The human microbiome project (HMP) with funding from NIH (US) was established in 2008, which generates resources for comprehensive characterization of human microbiome and analysis of its role in human health and disease (https://www. hmpdacc.org/). More than 2200 reference strains isolated from the humans have been sequenced. For further details the articles “A Framework for Human Microbiome Research” (Methé et al., 2012) and “Structure, Function and Diversity of the Healthy Human Microbiome” (Huttenhower et al., 2012) provide the outline of the work

Biotechnology: a tool for synthesis of novel bioactive compounds

273

Figure 9.2 Homology screening. Adapted from Iqbal, H.A., Feng, Z., Brady, S.F., 2012. “Biocatalysts and small molecule products from metagenomic studies,” Current Opinion in Chemical Biology, vol. 16, no.1e2, pp. 109e116 and Katz, M., Hover, B.M., Brady, S.F., 2016. ‘Culture-independent discovery of natural products from soil metagenomes’, Journal of Industrial Microbiology and Biotechnology, vol. 43, no. 2e3, pp. 129e141.

carried by HMP. Human microbiome has been recognized as a potential niche for isolating secondary metabolites having therapeutic activity (Milshteyn et al., 2018). Several animal model studies have proven the link between host-associated bacteria to well-being of the host. Although such studies in human-associated bacteria are still at nascent stage, however, huge impetus is being given by carrying several clinical trials (Marchesi et al., 2016). It is believed that small molecules produced by humanassociated bacteria play a prominent role in both disease incidence and maintaining health (Milshteyn et al., 2018). Gut-microbiome is well recognized to enumerate such links, and several studies and clinical trials are currently being carried. As described earlier, both functional or homology screening procedures can be adapted to human-microbiome to identify genes or gene clusters leading to functional molecules. Lakhdari et al. (2010) used nuclear factor-kB (NF-kB) activation screening from human gut-microbiome fosmid library as described in Fig. 9.1. NF-kB is a transcription factor, which involves in immuno-inflammatory response in the gut. Human stool samples were used as source for creating a metagenomic library; later functional screening was carried using NF-kB-driven GFP reporter to identify a novel long-chain N-acyl amide, commendamide, which activates G-protein-coupled receptors (GPCRs) (Hanus et al., 2014). Several bioinformatic tools such as antiSMASH, eSNaPD, NP.searcher, ClustScan, MutliGeneBlast, ClusterFinder, etc., have been used to characterize novel biosynthetic gene clusters from the human microbiome and to understand the functional

Sl. No.

274

Table 9.2 Primer sets used for functional metagenomics and gene reporter assays. Product/ Gene cluster

Gene

Reference

1

F:GCCGGAATTCATGATCCC GGTCGCGGTCA R:GCCAATGCATAAGCTTCACCGCCCGGCACGCACCGC F:GCCGGAATTCATGAGCGC GAGGTTCCTGG R:GCCAATGCATAAGCTTCAGTCGACGGCGCGCACCAC F:GCCGGAATTCATGAGCAT CAGGACGGTGG R:GCCAATGCATAAGCTTCA GTCGCGTGGTGCACGCAC F:GCCGGAATTCATGACGAG CGAGCTGCTCG R:GCCAATGCATAAGCTTCA GTTCGCCGCGGTCACGAC

b-Ketoacyl synthases (KSb)

Type-II Polyketide synthases

Seow et al. (1997)

2

(First round) F:ATGCTSACSCCSGAGTTCACSGTVCGG R:GCAGTRRTGGAYGCCGTGCCCGAA (Second round) F:CTGTGYGARCTGCTCGGSRTCC R: CGACRCCRCCSAGGAKCAGC

OxyC: Gene coding for oxidative coupling enzyme present in glycopeptide gene cluster

Glycopeptide antibiotics

Banik and Brady (2008)

3

F:ATCATGAATAGAGATATTTTGCGAAC R:TCGGCCGTTCCTTAGTAAGAAGAAGACCAAG F:TTCATGAACCCAACCGCGCTCCAAATTAAG R:GCCGCGGCCGCAAACTTGAAAATGCTTAAAACG F:TTCATGCAACCAACCGCCCTCCAAATTAAG R:AACGGCCGTTAAAATGGCATCGGTGTAGGGTTC

patA patD truD

Pattelin Pattelin Trunkamide

Donia et al. (2011)

4

F: TTC GGS GGX TTC CAG WSX GCS ATG R: TCS AKS AGS GCS AXS GAS TCG TAX CC (X:deoxyinosine)

b-Ketoacyl synthase

Erdacin, Pentacyclic polyketide

King et al. (2009)

Functional and Preservative Properties of Phytochemicals

Primers

F: MGNGARGCNNWNSMNATGGAYCCNCARCAN MG R: GGR TCN CCN ARN SWN GTN CCN GTN CCR TG F:TGC AGG CGG TGT CTA TGG GT R:CAG GGT ATG CGG CCA AAA GT F:ACC GGG GGA TGT GCG TCG TAT TA R:CTG GCT CGT CTC CGG CTT CAA CT

KS, ketosynthase myc genes Psy genes

Polyketide Mycalamide Psymberin

Fisch et al. (2009)

6

F:TGGCATCGT GGGGAAAGGCTG R:GGCGCAGGTGCTGACACGC F: TTAGCCATCGAGAGTTACAGCTC R: AATCGCCGATAGCCATCGCCG F:GACGCCATGGATGCACTGCAC R:TATTGGATGCTCAGCACCGCAC F:GGGCTCAGTTTCCACCCTTATG R:CCGGCGCTGCAGAGCCAGG-

KS1, KS2, KS3, KS4,

Polyketide

Piel (2002)

7

F:CTNCCNTAYGAYGAYCCCGT R:NCKRTGNGCNCCYTTNACCAT F:MGIGARGCIHWISMIATGGAYCCICARCAIMG R: GGRTCICCIARISWIGTICCIGTICCRTG

PKS pathway genes KS1, ketosynthase

Apratoxin (potent cancer cell cytotoxin)

Grindberg et al. (2011)

8

F:GTSATGMTSCAGTACCTSTACGC R:YTCVAGCTGRTAGYCSGG RTG

Chromopyrrolic Acid (CPA) Synthase Gene

Tryptophan dimer gene clusters

Chang et al. (2013)

ketosynthase ketosynthase ketosynthase ketosynthase

Biotechnology: a tool for synthesis of novel bioactive compounds

5

275

276

Functional and Preservative Properties of Phytochemicals

characteristics of the coded metabolites from such clusters (Milshteyn et al., 2018). Several biosynthetic gene clusters (BGCs) (>14,000) were predicted from human microbiome using ClusterFinder algorithm which encodes diverse small molecules (Cimermancic et al., 2014; Milshtey et al., 2018). These BGCs were compared to metagenomic shotgun sequences derived from healthy humans to identify novel classes of ribosomally encoded and posttranslationally modified peptides (RiPPs) known as thiopeptides. Lactobacillus gasseri, a vaginal isolate, produces one such thiopeptide known as lactocillin which is effective against pathogens such as Staphylococcus aureus and Enterococcus faecalis at nonmolar-level (Donia et al., 2014). Microcin colicin V having similar activity has been identified from gut microbiota (Cohen et al., 2018). HMP sequence data is utilized to discover bioactive molecule, humimycin, from BGCs using algorithms and later synthesized chemically (Chu et al., 2016). In another study by Zvanych et al. (2014), pyro-phenylalanine, pyro-leucine, pyroisoleucine, and pyro-tryptophan were isolated from LC-MS studies using L. plantarum culture. Later, animal studies revealed that pro-phenylalanine and pyro-tryptophan decreased IFN-g, thereby inhibiting the inflammatory pathways. Such analytical procedures could unravel the specific functionality of prebiotic organisms. Staphylococcus lugdunensis isolated from nasal samples of healthy subjects was found to synthesize an NRPS-based bioactive compound, lugdunin, which was bactericidal against major pathogens including MRSA (Zipperer et al., 2016). Moreover, lugdunin did not develop resistance against S. aureus. The rationale was, S. aureus, an opportunistic pathogen residing in the nasal cavity, is in contact with other microbiota. Therefore the interaction among host-associated bacteria could be antagonistic to one another (Milshteyn et al., 2018). Above studies suggest the potential nature of human-associated microbiota for discovering novel bioactive compounds.

3.

Synthesis of oligosaccharides and peptides as bioactive compounds

Increasing health awareness in current lifestyle has boosted the demand for dietary carbohydrates. The health promoting effects of nondigestible carbohydrates such as dietary fibers, oligosaccharides, and resistant starch have been well documented (Nacos et al., 2006; Nabarlatz et al., 2007). A prebiotic is a nondigestible food component that has positive effects on beneficiary bacteria (Bifidobacterium, Peptococcaceae, Eubacterium) in the colon, and consequently improves host health (Saad et al., 2013). Among all nondigestible carbohydrates, functional short-chain carbohydrates (oligosaccharides) are gaining popularity in food market (Patel and Goyal, 2011). Oligosaccharides have been commercialized since the 1980s as low-calorie bulking agents. These oligosaccharides get fermented by endogenous bacteria (Bifidobacteria and lactobacilli) to release metabolic substrates, energy, and short-chain carboxylic acids as final products of fermentation (Quigley, 2010). These oligosaccharides are described in four different groups such as lactose oligosaccharides; sucrose oligosaccharides; starch oligosaccharides synthesized using lactose, sucrose, and starch as substrate,

Biotechnology: a tool for synthesis of novel bioactive compounds

277

respectively; and the fourth category comprising other-oligosaccharides using maltose, xylose, galactose, fructose, etc. (Ibrahim, 2018). Functional oligosaccharides have chemical and medicinal benefits such as mild sweetness and texture, are heat stable, hydrolyze only at high acid environments, are highly soluble in water zero, and noncarcinogenic in nature (Crittenden and Playne, 1996; Ibrahim, 2018). Uses of prebiotics include decrease in serum lipids, removal of toxins from the body, lowering the glycemic index, improve mineral absorption, initiate lactose metabolism, maintenance of HDL/LDL ratio, decrease in blood cholesterol, improvement of blood pressure, and decrease in fecal pH (Ibrahim, 2018).

3.1

Synthesis of oligosaccharides using microbial-derived enzymes

To mention/name, few of the functional oligosaccharides which are synthesized by the enzymatic reaction are isomaltooligosaccharide (IMO), fructooligosaccharides (FOS), mannan-oligosaccharides (MOS), galactoligosaccharides (GOS), xylooligosaccharides (XOS), chitosanoligosaccharides (COS), and gentiooligosaccharides (GeOS). Different methods were used for achieving large amount of functional oligosaccharides, including extraction from plant tissues, in-vitro synthesis using physical, chemical, and enzymatic processes (Courtois, 2009; Ibrahim, 2018). Enzymatic synthesis of oligosaccharides has several advantages over physical and chemical synthesis. Enzymatic synthesis follows stereo- and region-selectivity of enzyme catalysis under mild conditions without group manipulation. These enzymes fall into two categories: hydrolases and transglycosidases. Under hydrolysis, enzyme catalyze hydrolysis of starch and breakdown into di, tri, or other oligosaccharides using specific enzymes such as a-amylase, glucoamylase, pullulanase, cyclodextrin glucanotransferase, and branching enzymes. To explain the hydrolysis, glucose moiety in starch is transferred to H2O and produces di, tri, and other small oligosaccharides. Further, the transglycosylation is defined as the transfer of a glucosyl residue to another hydroxyl group to yield functional oligosaccharides (Chen et al., 2010; Heyer and Wendenburg, 2001; Spohner and Czermak, 2016). Several studies have reported production of oligosaccharide using a-glucosidase, fructosyltransferase, and a-galactosidases (Chen et al., 2010; Kato et al., 2002; Spohner and Czermak, 2016; Møller et al., 2001). A comprehensive list of functional oligosaccharides and their composition is provided in Table 9.3. Enzymatic synthesis of the key functional oligosaccharides is provided below.

3.1.1

Fructooligosaccharides (FOS)

The term fructooligosaccharides (FOS) is used for fructose oligomers, which contain one molecule of glucose and 2 to 4 molecules of fructose attached by b-2,1 glycosidic linkages (Madlova et al., 2000). Attention on fructooligosaccharides has increased constantly since finding of beneficial effects in human health (Roberfroid and Delzenne, 1998). FOS can be produced using two schemes: (i) produced from sucrose via transfructosylation activity of b-fructofuranosidase enzyme (Sanchez et al.,

Table 9.3 List of enzyme-substrate combinations to produce functional oligosaccharides, and their composition. 278

Sl. No.

Composition

Enzyme

Enzyme source

Reference

1

Sucrose and inulin

Kestose, nystose, fructosyl nystose.

Inulinase

Aspergillus niger and Kluyveromyces marxianus NRRL Y-7571

Silva et al. (2013)

2

Sucrose

Kestose, 25% nystose, and 2% 1fructorianosyl nystose.

Fructosyltransferase

Aspergillus sp. N74

Sanchez et al. (2008)

3

Sucrose

1-kestose, nystose, and fructosylnystose.

Fructosyltransferase

Aspergillus terreus

Spohner and Czermak (2016)

4

Sucrose

GF2,GF3,GF4

Fructosyltransferase

Aureobasidium pullulans

Yun et al. (1990)

5

Sucrose

1-kestose,Nystose, and fructosylnystose

Fructosyltransferase

Aspergillus niger YZ59

Yang et al. (2016)

6

Sucrose

DP 10

Fructosyltransferase

Aspergillus sydowi IAM 2544

Heyer and Wendenburg (2001)

7

Sucrose

kestose þ nystose

Inulinase

Kluyveromyces marxianus

Santos and Maugeri (2007)

8

Lactose

Trans-galactosylated disaccharide,galactooligosaccharides

b-Galactosidase

Bifidobacterium angulatum

Rabiu et al. (2001)

9

Lactose

60 Galactobiose, allolactose, lactose,and 6’galactosyl lactose

b-Galactosidase

Kluyveromyces lactis

MartínezVillaluenga et al. (2008)

10

Lactose

3OS, 4OS, 5OS, and 6OS

b-Galactosidase

Aspergillus oryzae

Albayrak and Yang (2002)

Functional and Preservative Properties of Phytochemicals

Substrate

Lactose

Galactooligosaccharides

b-Galactosidase

Bifidobacterium bifidum

Møller et al. (2001)

12

Lactose

GOS, glucose, galactose, and lactose

b-Galactosidase

streptococcus thermophilus

Sangwan et al. (2015)

13

Lactose

6-Galactobiose, allolactose, 3galactobiose,4-galactobiose,60 -Ob-galactosyl-lactose,3-Ob-galactosyl-glucose, 60 -O-b-(6galactobiosyl)-lactose, 40 -Ob-galactosyl-lactose, 30 -Ob-galactosyl-lactose

b-Galactosidase

Aspergillus oryzae

Urrutia et al. (2013)

14

Birchwood xylan

Xylobiose and xylotriose

Xylanase

Streptomyces matensis DW67

Yan et al. (2009)

15

Xylose

Xylose, xylobiose, xylotriose, and xylopentaose

Xylanase

Thermoascus aurantiacus

Brienzo et al. (2010)

16

Sugarcane bagasse

Xylobiose and xylotriose

Endoxylanase (Sigma)

Trichoderma viride

Jayapal et al. (2013)

17

Xylose

Xylobiose, xylotriose and xylotetraose

Xylanase and b-xylosidase

Talaromyces thermophilus

Guerfali et al. (2009)

18

Oat spelt xylan

Xylotriose, xylotetraose and Xylopentaose

Xylanase

Paenibacillus sp. NF1

Zheng et al. (2014)

19

Dextran

Cyclodextrans (CIs) CI-7, CI-8, CI9, CI-10, CI-11 and CI-12.

Cyclodextran glucanotransferase

Bacillus circulans T-3040

Funane et al. (2007)

20

Maltose

Glucose, maltose, isomaltose, panose and isomaltotriose.

a-Glucosidase

A. niger

Chen et al. (2010)

21

Maltose

22

Maltose

Aspergillus nidulans

Kato et al. (2002)

Biotechnology: a tool for synthesis of novel bioactive compounds

11

a-Glucosidase a-Glucosidase

279

Glucose, maltose, Isomaltose and panose

Continued

Table 9.3 List of enzyme-substrate combinations to produce functional oligosaccharides, and their composition.dcont’d 280

Substrate

Composition

Enzyme

Enzyme source

Reference

23

Maltose

Glucose, maltose, Isomaltose, panose, etc.

a-Glucosidase(a-G1 and G2)

Aspergillus awamori KT11

Anindyawati et al. (1998)

24

Maltose

Panose

a-Transglucosidase

Talaromyces duponti

Bousquet et al. (1998)

25

Maltose

Glucose, maltose, isomaltose, panose, and isomaltotriose.

a-Glucosidase

Aspergillus niger

Zhao et al. (2017)

26

Raw bananas

Glucose, maltose, isomaltotriose, isomaltotetraose, and maltooligoheptaose

Transglucosidase (Amano)

Aspergillus niger

Chockchaisawasdee and Poosaran (2013)

27

Maltose

Glucose, maltose, and maltotriose

a-Glucosidase

Ferroplasmaacidiphilum Y (DSM 12658)

Ferrer et al. (2005)

28

Maltose

Trehalose and maltooligosaccharides

a-Glucosidase

Chaetomium thermophilum var. coprophilum

Giannesi et al. (2006)

29

Maltose

Glucose, maltose, isomaltose, panose, maltotriose, isomaltotriose

a-Glucosidase (Jiangsu Ruiyang Biotech Co., Ltd)

A. niger

Wang et al. (2017)

30

Maltose

Glucose, maltose, isomaltose, panose, isomaltotriose.

a-Glucosidase

Aspergillus oryzae ZL-1

Wu et al. (2010)

31

Maltose

Maltotriose, 4-O-a-nigerosyl-Dglucose, and 4-O-a-kojibiosyl-Dglucose.

a-Glucosidase

Paecilomyces lilacinus.

Kobayashi et al. (2003)

32

Maltose

Glucose,isomaltose, isomaltotriose, maltose, panose, and maltotriose.

a-Glucosidase

Aspergillus niger

Casa-Villegas et al. (2017)

Functional and Preservative Properties of Phytochemicals

Sl. No.

Maltose

Glucose,isomaltose, maltotriose, maltose, panose, maltotetraose.

Transglucosidase

Aspergillus niger

Mccleary et al. (1989)

34

Maltose

isomaltotriose, isomaltotetraose, isomaltopentaose, and isomaltohexaose.

a-Glucosidase

Microbacterium sp.

Ojha et al. (2015)

35

Maltose

Glucose, maltose, maltotriose,panose; 5, 6-Oa-glucosyl-maltotriose; 6, 6-Oa-isomaltosyl-maltose.

a-Glucosidase

Xanthophyllomyces dendrorhous

Gutiérrez-Alonso et al. (2016)

36

Maltose as donor arbutin, salicin, orpolydatin as an acceptor

AG1 and AG2

a-Glucosidase

Thermoplasma acidophilum

Seo et al. (2011)

37

Solublestarch

Maltopentaose, maltotetraose,maltotriose, and maltose. Isomaltose, trehalose,and b-cyclodextrin

a-Glucosidase(hydrolysis)

Aspergillus niveus

Da Silva et al. (2009)

38

Maltose

Glucose, maltose, isomaltose, panose, maltotriose.

Transglucosidase

Aspergillus niger CCRC 31494

Yan and Chiou (1996)

39

Maltose and glucose

Isomaltose, panose, isomaltotriose, glucose, maltose, maltotriose,and maltotetraose.

a-Glucosidase

A. niger M-1

Zhang et al. (2011)

40

Maltose

isomaltose, panose, isomaltotriose,and tetrasaccharides.

a-Glucosidase

BioQ technologies (China)

Zhang et al. (2010)

Biotechnology: a tool for synthesis of novel bioactive compounds

33

281

282

Functional and Preservative Properties of Phytochemicals

2008; Spohner and Czermak, 2016; Yang et al., 2016), and (ii) controlled enzymatic hydrolysis of the polysaccharide (inulin) using inulinases (Da Silva et al., 2009). FOS production also was observed using Sporotrichum thermophile in high sucrose submerged batch cultivation (Katapodis and Christakopoulos, 2008). The major producer of fructooligosaccharides is Meiji Seika Kaisha (Tokyo, Japan).

3.1.2

Galactooligosaccharides (GOS)

Galactooligosaccharides can be prepared from lactose by transgalactosylation reaction of b-galactosidase from Lactobacillus reuteri, Aspergillus oryzae, Kluyveromyces lactis, Bifidobacterium bifidum, Streptococcus thermophilus (Urrutia et al., 2013; Yanahira et al., 1995; Møller et al., 2001; Rabiu et al., 2001; Sangwan et al., 2015; Martínez-Villaluenga et al., 2008). In an earlier study it was described that a novel b-galactosidase from Bifidobacterium adolescentis preferentially hydrolyze the galactooligosaccharides (Van Laere et al., 2000). GOS synthesis can be achieved in continuous or batch system using membrane reactor (Pocedicova et al., 2010). Continuous production of GOS from lactose was carried out using a ceramic membrane reactor system (Ebrahimi et al., 2010). GOS is commercially manufactured by Snow Brand Milk Products (Tokyo, Japan), Nissin Sugar Manufacturing Company (Tokyo, Japan), and Yakult Honsha (Tokyo, Japan).

3.1.3

Xylooligosaccharides (XOS)

Xylooligosaccharides are oligomers made up of xylose units, and naturally found in wheat bran, barley hulls, gram husk, almond shells, bamboo, corn cob, straw, and brewery spent grains (Katapodis and Christakopoulos, 2008; Vazquez et al., 2000). XOS is produced from xylan using enzymatic hydrolysis (Katapodis and Christakopoulos, 2008). At an industrial scale XOS is produced using lignocellulosic materials such as hardwoods, bagasse, hulls, corn cobs, straws, malt cakes, and bran. Enzymatic synthesis of XOS is carried using xylanases, b-xylosidase, and endoxylanase enzymes (Brienzo et al., 2010; Guerfali et al., 2009; Jayapal et al., 2013). XOS synthesis can also be achieved by the combination of chemical-enzymatic methods from lignocellulosic by treatments with alkali such as NaOH, KOH, and Ca(OH)2 (Brienzo et al., 2010; Vazquez et al., 2000). Industrial products usually contain xylobiose, xylotriose (DP3), and xylotetraose (DP4) (Crittenden and Playne, 1996). Suntory Ltd. (Japan) manufactures XOS commercially.

3.1.4

Isomaltooligosaccharide (IMO)

IMOs are composed of 2e6 glucose units linked together with a (1 / 6) glycosidic bonds, which are naturally present in honey and fermented food products such as soy sauce (Kuriki et al., 1993). IMOs have been produced by the transglucosylation activity of enzymes from microorganisms, e.g., Aspergillus niger, Aspergillus nidulans, Talaromyces duponti, Xanthophyllomyces dendrorhous, and Microbacterium sp. (Bousquet et al., 1998; Duan et al., 1994; Kato et al., 2002; Marín et al., 2006; Ojha et al., 2015). Generally commercial IMO products contain isomaltose, panose

Biotechnology: a tool for synthesis of novel bioactive compounds

283

and isomaltotriose (Pan and Lee, 2005). Production of IMOs begins with hydrolysis of starch using a-amylase (EC 3.2.1.1), and b-amylase (EC 3.2.1.2), pullulanase (EC 3.2.1.41), and then convert to a-(1,6)-linked oligosaccharides using transglucosidases (EC 2.4.1.24) and a-glucosidase (EC 3.2.1.20), and this reaction is called as transglucosylation (Takaku, 1988; Chen et al., 2010; Bousquet et al., 1998). Major manufacturers of IMO are Showa Sangyo (Japan), Hayashibara Shoji Inc. (Japan), Nihon Shokuhin Kako (Japan), and BioNeutra Inc. (Edmonton, Alberta, Canada).

3.2

Bioactive peptides

Proteins are widely acknowledged as an active constituent in the diet (Rizzello et al., 2016). Proteins from animal, plant, fungi, microbes and their products are high sources of bioactive peptides (Abdel-Hamid et al., 2017; Bhat et al., 2015; Carrasco-Castilla et al., 2012; Wang et al., 2017). It has been documented that dietary proteins provide a rich source of bioactive peptides. Bioactive peptides are considered as new group of biologically active regulators that can reduce microbial degradation and oxidation of food. These peptides can be used as functional foods (Haque and Chand, 2008) and nutraceuticals (Moldes et al., 2017) thus increasing the quality of life (Lemes et al., 2016). More than 3000 different bioactive peptides which play a significant role on human health have been catalogued in “Biopep” database (http://www.uwm.edu.pl/ biochemia/index.php/en/biopep). On the basis of mechanism of action, peptides can be categorized as antithrombotic, immunomodulatory, antimicrobial, opioid, mineral binding, antihypertensive, and antioxidative (Sanchez and Vazquez, 2017). Some of the functional biopeptides are compiled in Table 9.4. The most common methods to produce bioactive peptides are (i) enzymatic hydrolysis (Chang et al., 2014; Lassoued et al., 2015), (ii) microbial fermentation (Hayes et al., 2007; Rui et al., 2015; Wang et al., 2015), and (iii) chemical synthesis (Navab et al., 2009; Nguyen et al., 2006; Saito et al., 2003). Enzymatic and microbial fermentationebased functional biopeptides are discussed below.

3.2.1

Enzymatic hydrolysis

Enzymatic hydrolysis is the most efficient and reliable method for the production of the bioactive peptides due to its productivity, scalability, and reaction time. During the enzymatic hydrolysis more than one enzyme can be used to produce the bioactive peptides. Enzymes can be added sequentially or simultaneously depending on the suitable temperature, pH and duration of hydrolysis (Le Gouic et al., 2019; Zhang et al., 2016). These enzymes, essentially proteinases, can be categorized based on the mechanism of action they exhibit as exo or endo proteinases. Exopeptidases release the single amino acid or short peptides from the parental protein, whereas endoproteinases cleave protein and release peptides (Venkatesan et al., 2017). After the hydrolysis, downstream process is carried out to separate digested peptides from the row material (Nimalaratne et al., 2015; Zhang et al., 2016). These can be recovered by cross-flow membrane filtration (Ferri et al., 2017), freeze-drying, desalting (Zhang et al., 2012), ultrafiltration, gel filtration chromatography for desalting and separation on the basis of

Table 9.4 Functional bioactive peptides and their sequence. Amino acid sequence

Function

Reference

1

Antioxidative peptide

CERPTCCEHS

Antioxidative

Zeng et al. (2015)

2

Regulating cell-permeability peptide

NYKKPKLAAAPALLALLVAPLLAVAA

Regulating cell-permeable function

Du et al. (1998)

3

Opioid peptide

YYPG

Opioid

Garg et al. (2018)

4

Iron binding peptide

SVNVPLY

Iron chelating

Eckert E. et al. (2016)

5

VV-hemorphin-7

VVYPWTQRF

Ligand of mu, kappa, and delta opioid receptors

Garreau et al. (1995)

6

VV-hemorphin-5

VVYPWTQ

Ligand of mu, kappa and delta opioid receptors

Zhao and Piot (1997)

7

Antifungal peptide

FPSHTGMSVPPP

Antifungal

Muhialdin et al. (2016)

8

Precursor of vasopressin

CYFQNCPRGG

Precursor of neuropeptide

Hruby et al. (1990)

9

Neuropeptide

YKPR

Neuropeptide

Herman et al. (1980)

10

Tuftsin

TKPR

Immunomodulating peptide

Wieczorek et al. (1994)

11

Celiac toxic calreticulin fragment

YQLLQELCCQHL

Toxic in celiac disease

Karska et al. (1995)

12

Calcium binding peptide

YDT

Calcium-binding

Zhao et al. (2015)

Functional and Preservative Properties of Phytochemicals

Name

284

Sl.No

PSQQQP

Toxic in celiac disease

Cornell (1988)

14

ACE inhibitor

RVCLP

Inhibitor of AngiotensinConverting Enzyme (ACE)

Wu et al. (2015)

15

Precursor of tenecin-1 (35e43)

NGKRVCVCRG

Precursor of antimicrobial peptide

Lee et al. (1998)

16

Renin inhibitor

YA

Inhibitor of Renin

Udenigwe et al. (2012)

17

Antibacterial peptide

GLPGPLGPAGPK

Antibacterial

Ennaas et al. (2015)

18

Orphanin FQ/Nociceptin

FGGFTGARKSARKLANQ

Opioid

Reinscheid et al. (1995)

19

Alpha-amylase inhibitor

QITKPN

Inhibitor of alpha-amylase

Yu et al. (2012)

20

Alpha-glucosidase inhibitor

KLPGF

Inhibitor of alpha-glucosidase

Yu et al. (2012)

21

Dipeptidyl peptidase IV inhibitor (DPP IV inhibitor)

VPPFIQPE

Inhibitor of dipeptidyl peptidase IV

Uenishi et al. (2012)

22

Anticancer peptide

KENPVLSLVNGMF

Anticancer

Quah et al. (2018)

23

Immunostimulating peptide

GLF

Immunostimulating

Berthou et al. (1987)

24

HMG-CoA reductase inhibitor

VGVL

Inhibitor of HMG-CoA reductase

Soares et al. (2015)

25

Zinc-binding peptide

HNAPNPGLPYAA

-

Zhu et al. (2015) Continued

285

Celiac toxic peptide

Biotechnology: a tool for synthesis of novel bioactive compounds

13

Table 9.4 Functional bioactive peptides and their sequence.dcont’d Amino acid sequence

Function

Reference

26

Peptide stimulating GLP-1 secretion

KAAVT

Peptide stimulating GLP-1 secretion

Caron et al. (2016)

27

Precursor of hemolytic peptide

KKLFKKILKFLG

Precursor of hemolytic peptide

Badosa et al. (2009)

28

Precursor of antifungal peptide

KKLFKKILKFLG

Precursor of antifungal peptide

Badosa et al. (2009)

29

Hemolytic peptide

LKLFKKILKVLw

Hemolytic

Badosa et al. (2009)

30

ACE inhibitor - LVV-hemorphin-5

LVVYPWTQ

Inhibitor of AngiotensinConverting Enzyme (ACE)

Zhao and Piot (1997)

31

Neuropeptide

LVAYPWT

Human P2X3 receptor antagonist

Jung et al. (2007)

32

Alpha-amylase inhibitor

DPAQPNYPWTAVLVFRH

Inhibitor of alpha-amylase

Siow and Gan (2016)

33

Antioxidative peptide

FFRSKLLSDGAAAAKGALLPQYW

Antioxidative

Siow and Gan (2016)

34

ACE inhibitor

MAW

Inhibitor of AngiotensinConverting Enzyme (ACE)

Balti et al. (2010)

35

Cytotoxic peptide

KENPVLSLVNGMF

Cytotoxic peptide

Quah et al. (2018)

36

Antioxidative peptide

QYP

Antioxidative

Ohata et al. (2016)

37

Dipeptidyl peptidase IV inhibitor (DPP IV inhibitor)

GPFPILV

Inhibitor of Dipeptidyl Peptidase IV

Zhang et al. (2016)

Functional and Preservative Properties of Phytochemicals

Name

286

Sl.No

LTFPG

Inhibitor of Renin

Aluko et al. (2015)

39

Opioid peptide

YPG

Opioid

Wu et al. (2006)

40

Antilisterial peptide

RHGYM

Antibacterial peptide against L. monocytogenes

Castellano et al. (2016)

41

ACE inhibitor from thornback ray muscle (Raja clavata)

IVGRPR

ACE inhibitor

Lassoued et al. (2016)

42

VV-hemorphin-7

VVYPWTQRF

Inhibitor of Angiotensinconverting enzyme

Zhao et al. (1994)

43

Antioxidative peptide derived from chicken egg white

AEERYP

Antioxidant peptide

Zou et al. (2016)

44

Alpha-glucosidase inhibitor from egg yolk

VTGRFAGHPAAQ

Inhibitor of alpha-glucosidase

Zambrowicz et al. (2015)

45

Antioxidant peptide from chickpea

TETWNPNHPEL

-

Torres-Fuentes et al. (2015)

46

Dipeptidyl peptidase IV inhibitor from egg yolk (DPP IV inhibitor)

YINQMPQKSREA

Inhibitor of Dipeptidyl Peptidase IV (EC 3.4.14.5)

Zambrowicz et al. (2015)

47

ACE inhibitor from dry-cured ham

AAATP

-

Escudero et al. (2013)

48

ACE inhibitor from walnut

WPERPPQIP

-

Liu et al. (2013)

49

Antioxidant peptide from barley (Hordeum vulgare L.)

PQIPEQF

-

Xia et al. (2012)

50

Immunomodulating peptide

VAGTWY

Stimulating proliferation of splenocytes

Jacquot et al. (2010)

287

Renin inhibitor

Biotechnology: a tool for synthesis of novel bioactive compounds

38

288

Functional and Preservative Properties of Phytochemicals

molecular weight of the peptides (Naimah et al., 2018). Commonly used enzymes for the hydrolysis are neutrase (Bacillus amyloliquefaciens), pronase E (Streptomyces griseus), flavourzyme (Aspergillus oryzae), alcalase (Bacillus licheniformis), collagenase (Clostridium histolyticum), papain (Carica papaya), and bromelain (Ananas comosus) (Sanchez and Vazquez, 2017). Some of the milk-derived bioactive peptides were produced by pepsin, trypsin, and chymosin action (Mohanty et al., 2016).

3.2.2

Microbial fermentation

Bioactive peptide synthesis using microbial fermentation involves growth of bacteria, yeast (García-Tejedor et al., 2015; Rai et al., 2016), and fungi (Hou et al., 2014; Lima et al., 2015) using protein as substrates. The actively growing microorganisms produce proteolytic enzymes which hydrolyze parent proteins. Generally, after the growth of microorganism, cells are collected and whole cells were used for hydrolysis of the proteins (Aguilar-Toala et al., 2017; Naimah et al., 2018). The hydrolysis varies from strain to strain, fermentation time, and the type of protein used for hydrolysis. Hydrolyzing capability also depends on the microorganism used (Chen et al., 2014; El-Fattah et al., 2016). For instance, Lactobacillus helveticus, Lactococcus lactis, and Lb. delbrueckii ssp. bulgaricus contain cell wall bound proteinases like endopeptidases, aminopeptidases, dipeptidases and tripeptidases (Christensen et al., 1999). Soyabean fermented products, tempeh and Natto, contain antioxidant peptides, which are produced by the fermentation process by the action of fungal proteases (Wongputtisin et al., 2007). Similarly, use of Aspergillus spp. for the production of Douchi, a soybean fermented product (Sanchez and Vazquez, 2017), Bifidobacterium bifidum MF 20/5, L. helveticus DSM 13,137 (Gonzalez-Gonzalez et al., 2013) and L. helveticus H9 fermentation of milk product are good sources of bioactive peptide (Wang et al., 2015). Pictorial representation of biopeptides is shown in Fig. 9.3.

4.

Bioprobes for qualitative and quantitative detection of bioactive molecules/compounds

Qualitative and quantitative detection of bioactive molecules is integral to microbialbased biotechnological processes involving their synthesis. This section of the chapter describes the role of “bio”sensors in high throughput screening and detection of microbial bioactives. The role of biosensors in the field of discovery, screening, detection and development of bioactive molecules includes among many others; a) detection of known molecules after their synthesis by wild, improved, or novel microbial stains, b) easy label-free screening of microcosms/biocosms for novel bioactives, c) as a complementary/adjunct method for established protocols and bioassays to reduce time and cost. Conventionally, bioactive constituents/molecules are screened using bioassays by bioactivity guided fractionation procedures and later isolated and identified by analytical techniques such as HPLC, GC, GC/MSeMS, etc. This entire process is highly

Biotechnology: a tool for synthesis of novel bioactive compounds

289

Figure 9.3 Graphical representation of synthesis of bioactive peptides.

cumbersome and time-consuming although sensitive. The latter analytical methods also involve several sample prepreparation steps, requirement of trained personnel, and suffer from lack of flexibility and miniaturization. “Bio”sensors on the other hand typically eliminate the need for sample preparation, requirement for skilled manpower, are cost-effective, can be tuned for qualitative as well as quantitative detection platforms, and offer great sensitivity and analysis. Moreover, the most recent

290

Functional and Preservative Properties of Phytochemicals

development in the field of biosensors has been the integration of the biosensing principle with high-throughput screening techniques. This approach enables simultaneous screening, as well as detection of molecules of interest. Undoubtedly, the biggest advantage of using biosensor technology has been its direct use in complex matrices, crude samples and ability for label-free sensing. A biosensor is defined as an analytical device which converts a biological response into a quantifiable and processable signal (Kissinger, 2005). It comprises of a biological or biologically derived sensing element, also called biorecognition element, which is in intimate contact with a physicochemical transducer. The transducer coupled to the biological recognition element converts or transforms the specific “molecular recognition event” between the biomolecule and the analyte (biological signal) into an electrical one (Fig. 9.4). The most important part of the biosensor is the “bio-probe” that is involved in the biorecognition event, which eventually can be converted into a signal in the biosensor device. The biorecognition element of the biosensor participating in the interaction for detection of analyte of interest include biomolecules such as enzymes, antibodies, whole cells, cell receptors, DNA, RNA, etc. The transducer that amplifies and converts the recognition event can generate identifiable signals such as electrochemical, optical, resistive, impedance, piezoelectric, etc. A schematic representation of biosensor classification is given in Fig. 9.5. A biosensor can therefore be classified either based on the biological element used, such as enzyme sensors, immunosensors, aptasensors, whole cell sensors, etc., or based on the transducer such as electrochemical sensors, piezoelectric sensors, optical sensors, etc.

4.1 4.1.1

Biosensors for screening and detection of bioactive molecules Enzyme biosensors

Enzymes are substrate-specific biological molecules that catalyze several chemical reactions. Enzymes as biorecognition elements in biosensors are very versatile and can be designed to detect metabolites or molecules by any of the four mechanisms involved in the process of enzyme catalysis a) the sensor detects the activation/deactivation of the enzyme b) detects the depletion of the substrate c) detects the product formed by enzyme-substrate reaction d) structural modification of enzyme as a result

Figure 9.4 Schema for working of a biosensor.

Biotechnology: a tool for synthesis of novel bioactive compounds

291

Figure 9.5 Classification of biosensors based on bioreceptors and transducing element.

of binding. These catalytic sensors have been widely applied in the field of agriculture, environment, pharmaceuticals, and food processing. Enzyme sensors are amenable to several transduction approaches to detect the analyte and are therefore widely used in comparison to other biosensor types. Detection of bioactive antimicrobial compounds produced by microbes (e.g., antibiotics) using biosensors is widely reported. Among the different transduction principles, fluorescence-based sensors are very popular due to their high sensitivity. In a fluorescence-based assay, Chan et al. (2008) provided a proof of principle for design of a biosensor using a fluorescein-labeled mutant of beta-lactamase (E166Cf), which changed its fluorescence upon binding of beta-lactam to the enzyme and its consequent hydrolysis. In the study, hydrolysis of cefuroxime, penicillin G, and 6-aminopenicillanic acid to E166Cf led to enhancement of fluorescence, while regeneration of the enzyme led to weak signals which could be directly correlated to the concentration of the antibiotic present. The observed results with E166Cf were explained by the authors as a modified structural property of the fluorescein label upon substrate binding. The concept of enzyme inhibition/activation can be very well integrated with the synthesis of target molecules. For example, many researchers have developed biosensors based on acetylcholine esterase inhibition by organochlorine pesticides for the detection of these xenobiotic compounds (Bachmann et al., 2000; Del Carlo et al., 2004; Hildebrandt et al., 2008). Similarly, competitive binding between native microcystin and its fluorescent analog (Myc-Cys-FITC conjugate) with alkaline phosphatase immobilized on optic fiber was used as the biosensing platform to detect microcystin. Both Myc-Cys-FITC conjugate and free unlabeled microcystin were allowed to compete for the limited binding sites provided by the enzyme. The resulting signal was inversely related to the concentration of the unlabeled MC-LR (Sadik and Yan, 2004). An indirect quantification strategy using chloramphenicol acetyltransferase was developed by our group at CFTRI for the detection of chloramphenicol (CAM) (Sharma et al., 2017). This enzyme catalyzes the acetylation of CAM, where CoASH

292

Functional and Preservative Properties of Phytochemicals

Figure 9.6 CoASH synthesis driven phenomenon for indirect detection of chloramphenicol using chloramphenicol acetyltransferase.

is produced as the product. We synthesized gold nanoparticles (AuNPs) using CoASH. Addition of higher quantities of the cofactor led to an increase in absorbance, as well as wavelength shift in extinction spectra of nanoparticles indicating higher synthesis and improved protection of AuNPs (Fig. 9.6). The sensitive detection of CoASH as a consequence of the above observation was directly proportional to CAM concentration. We opine that similar strategies can be designed for detection of new or novel antimicrobial compounds/antibiotics by wild or improved microbial strains using co-factor based enzyme catalysis phenomenon. In another interesting experiment, laccase enzyme was used by us for a fluorescence “turn off” detection of bioactive polyphenols in plant extracts. This optical biosensor, which led to the ultrasensitive detection of polyphenols, was based on the charge transfer phenomenon between quinones (the product formed from laccase catalysis) and quantum dots (QDs) (Fig. 9.7). Quenching of photoluminescence of QDs was directly

Figure 9.7 Laccase-based fluorescence turn off detection of polyphenols using energy transfer phenomenon between quinones and QDs.

Biotechnology: a tool for synthesis of novel bioactive compounds

293

proportional to the quinone concentration formed from polyphenol oxidation by laccase. This system could detect individual and total polyphenols with high sensitivity (LOD-1 ng/mL) (Akshath et al., 2014). A fingerprint pattern was also observed for individual polyphenolic molecules as a result of differential photoluminescence response of QDs.

4.1.2

Immunosensors and nucleic acid sensors

Biosensors that use antigen-antibody (Ag-Ab) interaction as the biosensing mechanism are called immunosensors. Since the interaction between Ag-Ab is highly specific, immunosensors are highly sensitive and selective. In the field of bioactive molecule bioprospecting and discovery using biosensors, the surface plasmon resonance (SPR) technology has been the most promising in recent years. This technology enables both screening assays in complex matrices as well as label-free detection of molecules of interest. SPR has been extensively studied for detection of several bioactive analytes of interest such as antibiotics using antibodies (Abs) and/or aptamers (Apts) (oligonucleotides) as bioprobes. The SPR biosensor is an optical device which is based on surface plasmon transduction phenomenon. It monitors the changes on the surface of the sensor chip as a result of interaction between the bioelement (which is immobilized on the chip) and the detection molecule. The binding interaction causes a local change in refractive index of incident light and a variation of the propagation constant. This change is captured by the detector and correlated to the concentration of the analyte interacting with the bioprobe on the surface (Feriotto et al., 2001; Minnuni and Bilia, 2009; Scarano et al., 2015). The immobilization of bioreceptors (Abs or Apts) to the biosensor chip is achieved using covalent coupling methods such as amine, thiol, aldehyde coupling, etc., or by noncovalent coupling methods employing metal chelation, monoclonal antibody tags, or other affinity tags, such as biotin/streptavidin, etc. (Scarano et al., 2015). Since multibioreceptors specific to different analytes or bioreceptors for multianalytes can be immobilized on the sensor chip, SPR device is used extensively for label-free high throughput screening of biomolecules. For example, Haasnoot et al. (2005) developed a multisulfonamide biosensor immunoassay for the detection of sulfadiazine and sulfamethoxazole. The authors used the SPR to show the improved activity of mutated monoclonal antibodies generated by them against eight sulfonamides. The detection levels for this group of antibiotics improved many folds with the mutants. This technology was proven in real sample analysis (serum and milk) and the biosensor was shown to be robust, sensitive, and selective. Nucleic acids biosensors have mainly attracted attention in clinical diagnostics, forensic study, and gene analysis. They combine ssDNA with a transducer with the former responsible for selectivity and latter for sensitivity. Also called as “genosensors,” these biosensors make use of DNA hybridization event to detect target sequences. Minnuni and Bilia (2009) developed a biosensor for detection of bioactive molecules/fractions from crude complex matrices like plant extracts. The biosensor principle was based on the interaction between immobilized DNA and the molecule in the sample with the ability to intercalate it. This interaction was determined using

294

Functional and Preservative Properties of Phytochemicals

SPR. As a unique step, the authors combined this biosensor assay with the classical fractionating approach and chemical screening methodology in order to obtain a bioactivity-guided fractionation. This type of a biosensor which was used in conjunction to the conventional technique of bioactivity screening resulted in simultaneous analysis of interesting compounds in terms of chemical characteristics, as well as the desired biological activity. Another high throughput screening based on interaction of peptide nucleic acidenano-sized graphene oxide (PNA-NGO) complex which was recently developed by Ryoo et al. (2018) described screening of novel bioactives with application in cancer and miRNA-based therapeutics. The fluorescent PNA-NGO integrated biosensor was designed for the screening of miRNA-21 expression levels in living cells. As is well known, elevated miRNA expression levels are observed in various cancer types including breast, ovarian, and lung cancers. Cellular screening of several molecules including enzyme inhibitors, FDA approved drugs, agonists was carried out by the authors, and it was possible to determine molecules that could suppress both miRNA-21 expression and cell proliferation, enhance miR-21 expression and reduce cell proliferation, suppress miR-21 expression and increase cell proliferation, and enhance both miR-21 expression and cell proliferation. This reported biosensor for screening of miRNA modulators was a huge deviation from reporter plasmid constructebased assays, which are extremely time-consuming and laborious. As discussed earlier, short sequence nucleic acids (oligonucleotides) have also been widely used for detection of bioactive molecules, especially antibacterial compounds. These oligonucleotides referred to as “aptamers” are generated synthetically. Biosensors utilizing aptamers as bioreceptors are called aptasensors. Aptamers are oligonucleotides (DNA, RNA) or peptides that represent an alternative to antibodies as recognition elements in biosensors. The aptamer selection is performed under real matrix conditions, which are particularly useful for developing probes for complex matrices. Aptamers can be modified for immobilization purposes and labeled with reporter molecules, without affecting their affinity. As nucleic acid sequences, aptamers can be subjected to repeated cycles of denaturation and renaturation, making it possible to regenerate the immobilized biocomponent function for repeated uses in a biosensor (Jayasena, 1999; O’Sullivan, 2002). Aptamers can be chemically modified and labeled more easily than antibodies. These modifications facilitate the functionalization of nanoparticles on their surfaces, which increases the sensitivity of these bioprobes for detection purposes. They can be excellent detection tools for diagnosis and for probing live cells. Aptamer-based biosensors for detection of antibiotics have been recently reviewed by Mehlhorn et al. (2018). In the background of growing multidrug resistance, aptasensor technology can offer a paradigm shift in the detection and screening of novel drugs at a much lower cost. Moving a step further, Kim and Lee (2017) described that combination of two different bioreceptor molecules increases sensitivity and selectivity of detection by several folds in a biosensor. Using an Apt-Ab pair in a sandwich assay for tetracycline (TC), detection levels in attomolar range were achieved. In their study, the DNA apt was immobilized on the SPR chip while the Ab was conjugated to gold nanostar (GNS). It was demonstrated that both the affinity probes (aptamer-antibody) could bind simultaneously to TC. The sandwich assay was highly selective and discriminative and demonstrated poor binding to TC

Biotechnology: a tool for synthesis of novel bioactive compounds

295

derivatives namely oxytetracycline (OTC) and chlortetracycline (CTC). The study was also able to establish amplification of SPR detection signals by integrating nanoparticles with the bioreceptor. Such studies can be very useful in the design of sensing platforms where extremely low concentrations of bioactive molecules may be present in the matrix.

4.1.3

Whole cell/cell componentebased sensors

Whole cell/cell componentebased biosensors use whole cells or any cell component such as cell receptors, proteins, lipids. etc., as bioreceptors. Genome-specific bioprospecting using whole cell biosensors can offer huge advantages in the rapid screening of microcosms capable of synthesizing novel bioactive compounds. Urban et al. (2007) reported the design of novel whole cell sensors compatible with highthroughput screening for molecules that inhibit major biosynthetic pathways of microbes namely DNA, RNA, protein, cell wall, and fatty acids. They used Bacillus subtilis promoters fused to the firefly luciferase reporter gene suitable for the cellbased screening. The assay thus combined the advantages of the traditional wholecell screening approaches and the directed rational strategy of target-based assay especially useful in the discovery of antimicrobials. On the other hand, in comparison to whole cell sensors, cell componentebased bioprobes can also be extremely sensitive, fast, accurate, label-free, simple, and quantitative for the purpose of detection of bioactive molecules. They can be suitably designed based on the type of targeteanalyte interaction, opening wide avenues for rapid drug discovery. For instance, bacteriocins play a very important role in the survival of a microbial species in the gut ecology. Many of the beneficial flora of the gut like the Lactobacillus sp. produce bacteriocins. Several of the bacteriocins function as membrane disruptors. This phenomenon was used by Yadav et al. (2017) to develop a vesicle-based assay for the screening of bacteriocin producing lactic acid bacteria using phospholipid/polydiacetylene. The colorimetric assay was rapid, simple, and reliable for high throughput screening of antimicrobial peptide producing microbial strains. Such principles can be extremely useful for screening of molecules produced by the gut microbiome, which impair membrane functions of pathogenic species. In another study with cellular lipids, Yao et al. (2014) immobilized lipid A on an n-octyl bD-glucopyranoside-coated surface to identify antisepsis fractions from Chinese herbal extracts. The affinity-based platform led to the isolation of an active fraction (PSA-I-3), the antisepsis activity of which was demonstrated in both in vitro and in vivo experiments. The first report of a biosensor for detecting oxytetracycline production by Streptomyces rimosus in a soil microcosm was given by Hansen et al. (2001). The work by the authors was an altogether new approach of combining whole cell sensor with fluorescence-activated cell sorter (FACS) analysis. They constructed a tet-R regulated Ptet promoter from Tn10 which was integrated to FACS optimized green fluorescent protein gene, inducible in the presence of tetracycline. The plasmid was harbored by E.coli and oxytetracycline production by S. rimosus could be detected by encounters of single biosensor cells with the antibiotic using FACS. Further studies in similar lines by Sun et al. (2017) was based on secondary metabolite biosynthesis gene cluster

296

Functional and Preservative Properties of Phytochemicals

encoding a metabolite-sensing repressor in place of reporter systems that detect expression of biosynthesis gene alone. The idea of the authors was to use Tet-R-like repressors, which are present either within or in the vicinity of secondary metabolite producing clusters in several Streptomyces. The Tel-R like repressor could bind to both the product of cluster and/or their precursors and hence could be coupled to the expression of the reporter and the production of the secondary metabolite in tandem. They were able to demonstrate the biosensing platform for coelimycin, where the bpsA reporter gene for indigoidine synthetase was placed under control of the promotor/operator regions controlled by the cluster-associated Tet-R-like repressors. Lineage-specific GFP transgenic zebrafish embryonic cells were used as fluorescent biosensor display for screening of small molecules that regulate cell differentiation. Huang et al. (2012), after testing the method with known cell regulators and different cell types, demonstrated its applicability in screening of proangiogenic molecules. Undifferentiated primary cells from flk1-GFP transgenic zebrafish embryos were used as the screening tool and out of several molecules, 11 molecules were shown to have proangiogenic activity. The method was also validated in mammalian cells and in vivo experiments demonstrating the applicability of the simple assay and its extrapolation for several cell types. This approach could be extremely useful especially to target molecules with bioactivity from the gut microbiome. Since bacterial cells (probiotics) and their metabolites have been shown to have proangiogenic activity, it would be worthwhile to explore the possibility of using biosensors for their activity determination.

4.1.4

Biomimetic biosensors and others

A label-free optical biosensor for rapid detection of bacteria was developed using a novel peptide-mimetic compound as the recognition element. An oxidized porous silicon (PSiO2) nanostructure used as the optical transducer was functionalized with a synthetic antimicrobial peptide (K-7a12). K-7a12 mimics the hydrophobicity and charge of natural antimicrobial peptides. Gram-positive and gram-negative bacterial lysates were exposed to the developed biosensor which showed preferential capture of E. coli cell fragments. The biosensor offered significant advantages in comparison with conventional antibody-based assays, in terms of their simple and cost-effective production, while providing numerous possible sequence combinations for designing new detection schemes for bioactive peptides (Tenenbaum and Segal, 2015). In recent times, molecular imprinted polymers (MIPs) are an addition to synthetic mimetic molecules that are based on the principle of lock and key using synthetic chemistry. MIPs are designed and synthetically produced using highly cross-linked polymers with highly specific receptor sites for binding of target molecules. NanoMIP-SPR sensor could detect glycopeptide antibiotic, the antibiotic at nanomolar levels using both direct and competitive assays in SPR device (Altintas, 2018). Metabolite sensors have also gained interest for evolution of bacterial strains and enzymes with high activity. Such systems claim ultrahigh throughput analyses and sorting of individual cells at rates higher than 107 cells/hr (Schallmey et al., 2014). An example of a metabolite sensor by Fraz~ao et al. (2018) monitored the detection

Biotechnology: a tool for synthesis of novel bioactive compounds

297

of intracellular aldehyde with fluorescence-activated cell sorting (FACS) system. The sensor detected aldehydes in E. coli by employing an aldehyde-responsive transcription factor YqhC to drive the expression of the yellow fluorescent reporter protein SYFP2 (Fraz~ao et al., 2018). In the field of discovering new molecules with novel functionalities, a fairly recent advancement has been the low molecular weight “fragment screening libraries” using SPR. Unlike the conventional low molecular weight ligand binding, this technique uses fragment libraries where membrane protein drug targets like G-protein coupled receptors (GPCRs) are immobilized on the SPR surface. This technique has been validated with pharmacological measurements approximate to cell-based methods. A review of GPCR-based screening of fragment libraries with SPR is discussed by Shepherd et al. (2014). The field of biosensors is highly evolving and advancement in technology has enabled it to jump in leaps and bounds. Although, biosensor technology has not seen its full potential and is still taking baby steps, it may not be totally incorrect to say that this interdisciplinary field that transcends both science and technology arena will play an extremely important role in future for discovery of novel molecules of biological origin.

5. Systems biology enabled synthesis of bioactive compounds Apart from microbial-derived bioactive compounds, there exists a vast array of bioactive compounds derived from plant kingdom. However, some of the major concerns for extracting these useful compounds from plants are (i) plant growth is usually constrained by geography and season, (ii) amounts of bioactive compounds synthesized are very little, and (iii) requires several extraction and purification steps. To overcome such problems to an extent, plants were genetically modified. However, the regulations imposed on genetically modified plants and problems encountered during downstream processing of bioactive compounds have not been so encouraging to pursue such studies. Meanwhile, with rapid developments in omic studies, cheaper genome sequencing facilities, high precision gene manipulation techniques, and robust computational tools has evolved newer concepts such as systems and synthetic biology. Metabolic engineering, which deals with the directed improvement of product or cellular properties using recombinant DNA technology, has been used to improve yields and titer of native compounds in microorganisms (Bailey, 1991; Stephanopoulos, 1999). Extension of such studies to synthesize nonnative compounds in a simpler microbial host could be highly rewarding. One such early success story is the production of artemisinin in Saccharomyces cerevisiae by Prof. Jay Keasling and his team at University of California, Berkeley during the period 2003e13. Artemisinin, a sesquiterpene which acts as a potent antimalarial drug, is produced by the plant Artemisia annua. However, the production of plant-derived artemisinin is an inefficient and expensive process. Engineering of S. cerevisiae and the process development for amorphadiene

298

Functional and Preservative Properties of Phytochemicals

(precursor) and artemisinic acid at laboratory scale were developed by Keasling group (Westfall et al., 2012; Paddon et al., 2013). Paddon et al. (2013) have reported production of artermisinic acid in an engineered S. cerevisiae using tools of metabolic engineering and synthetic biolog. Fermentation titers up to 25 g/L of artermisinic acid were achieved. Later, artemisinic acid is converted to artermisinin chemically using singlet oxygen. This success has been highly encouraging and several studies have been attempted, and being carried currently to synthesize nonnative bioactive compounds in microbial hosts. Let us briefly understand the history of metabolic engineering and how it can be helpful in understanding the cellular phenotype. Early definition of metabolic engineering according to Bailey (1991) is “the improvement of cellular activities by manipulations of enzymatic, transport, and regulatory functions of the cell with the use of recombinant DNA technology.” With the rapid progress in molecular, analytical, and computational tools, bringing a directed change inside the cell has become a reality and thus looking the cell in a more rational and holistic perspective has been the key of metabolic engineering (Stephanopoulos, 1999; Nielsen, 2001). Metabolic engineering emphasizes on integrated metabolic pathways of a cell instead of single metabolic reaction. On the other hand, systems biology has developed gradually into a new discipline where computational and mathematical modeling is used for studying biological systems (Nielsen, 2017). Systems of a cell indicate the complex metabolic and signaling networks. Systems biology also uses a holistic approach in contrast to molecular biology, where focus is on subsystems. Metabolic engineering has greatly benefited from systems biology of metabolism, as it is now possible to design cell factories for optimal production of desired biochemical/bioactive compound. The introduction of genome-scale metabolic models (GSMMs) as a bottom-up systems biology approach has enabled to model the metabolic network using stoichiometric information. Here a metabolic network is reconstructed using complete genomic map of the organism where each balanced reaction is specified with substrate(s), product(s), cofactor(s), and enzyme(s) involved. Such a model involving gene-protein relations (GPRs) can link the genotype to metabolic capacity (Nielsen, 2017). The reconstruction of newer GSMMs is on rise as the genome-sequencing projects are increasing at higher rate due to lower costs. At present, more than 277,847 genome-sequencing projects have been carried involving 359,915 organisms including 317,797 bacteria (http://www.gold.jgi.doe.gov). Approximately 85 different genomes have been reconstructed for genome-scale models spanning prokaryotes, archaea, and eukaryotes (http://bigg.ucsd.edu/models). When a metabolic network is represented by a mathematical structure along with certain rules and quantitative parameters, it then enables to predict fluxes of each reaction for the entire network. The metabolic flux is defined as the rate at which a material is processed (turnover of the compound) through a metabolic pathway (Stephanopoulos, 1999). Metabolic fluxes represent cellular regulation at several levels, and thus considered as representation of phenotype of the cell under specific conditions (Nielsen, 2003). When certain cellular constraints are imposed on the metabolic network and cellular fitness goal is maximized, then essentially we compute these in-vivo metabolic fluxes in an in-silico setup. This enables the experimenter to find feasible “in-silico” solutions for “what if” questions such as (i) what

Biotechnology: a tool for synthesis of novel bioactive compounds

299

happens to the cell if the external environment is perturbed (ii) what happens to the phenotype if a specific gene is deleted, overexpressed, or even added heterologously (Durot et al., 2009). So this becomes immensely helpful to also find answers for reverse questions such as (i) what genes to be deleted or overexpressed or to heterologously express in order to maximize a cellular goal. This goal can be anything ranging from expanding the substrate specificity for the cell, improving titer or yield of a specific native or nonnative metabolite, preventing overflow metabolism, tolerance to specific environmental stress, etc. Synthetic DNA on the other hand, which is a key constituent of synthetic biology, has been aiding the metabolic engineering to design segments of DNA, which can serve the goal of metabolic engineering (Stephanopoulos, 2012). Therefore, with these tools tailoring of the microbial strains to improve bioactive compounds’ synthesis (both native and nonnative) has made researchers to look for possibilities beyond classical mutagenesis (nitrosoguanidine, ethyl methane sulfonate, and ultraviolet radiation) for strain improvement. Some of the generic metabolic engineering strategies include (i) improvement of precursor supply (ii) regeneration of cofactors (iii) downregulating competing pathways (iv) overexpression of transcriptional regulators (v) expression of nonnative genes (vi) improving enzyme specificity (Paramasivan and Mutturi, 2017). Application of metabolic engineering and synthetic biology for boosting the bioactive compound research is discussed by citing some examples. Polyketides (PKS) are a diverse class of bioactive molecules which are currently prescribed as immunosuppressants (FK506, rapamycin), hypocholesterolemics (lovastatin, compactin), anticancer agents (doxorubicin), antimicrobials (tetracyclin, erythromycin), animal health products (avermectin, tylosin, monensin), and agrochemicals (spinosyn) (Cummings et al., 2014; McDaniel et al., 2001). There are three different types of PKS: (i) Type 1 PKS, which are found in bacteria and fungi, have multifunctional enzymes possessing different catalytic domains such as ketosynthase (KS), acyl transferase (AT), acyl carrier protein (ACP), ketoreductase (KR), enoyl reductase (ER), dehydratase (DH), and methyltransferase (MT), (ii) Type II PKS are involved in biosynthesis of aromatic polyketides such as oxytetracycline and pradimicin. They have KSa, KSb, ACP, cyclase (CYC), MT, and glycosyltransferase (GT) domains, (iii) Type III PKSd plant-derived, major compounds such as flavanoids, stilbenoids, and curcuminoids belongs to this class. Several novel bioactive polyketides are discovered from microbial sources. However, the production costs are high due to poor titers, yields, and productivity. The production costs for pure compound are usually more than $1000/g (McDaniel et al., 2001). Hence several strain engineering and bioprocess strategies were carried to improve the yields. Heterologous expression involving microbial hosts such as S. coelicolor and S. lividans is widely carried for PKS synthesis. The basic steps involved in synthesis of matured PKS is as follows: (i) minimal PKS module formation with the help of acetyltransferase domains (ACP) using acyl-CoS substrate (ii) action of ketosynthases (KSs) on minimal PKS module to synthesize b-ketointermediates (iii) synthesis of cyclic intermediates with the action of cyclases and aromatases (iv) secondary cyclization and rearrangements and (v) finally post-PKS modifications with the help of aminotransferases, glycosyltransferases, oxidoreductases, etc. Several studies were carried to improve the biosynthesis of actinorhodin,

300

Functional and Preservative Properties of Phytochemicals

frenolicin, erythromycin, picromycin, etc., to obtain titers in the range of 1e100 mg/L culture (McDaniel et al., 2001). Pathway-specific transcriptional regulators are targets for such metabolic engineering studies. In case of genus Streptomyces, which alone contributes to 2/3rd of known antibiotics, it has a family of regulatory proteins known as Streptomyces antibiotic regulatory proteins (SARPs), which regulate the production of polyketide antibiotics such as actinorhodin, daunorubicin, and nogalamycin (Wietzorrek and Bibb, 1997). Overexpression of these specific activators has improved the synthesis of polyketide antibiotics (McDaniel et al., 2001). For instance ActII-ORF4/ PactI activator-promoter system is used to express several polyketide synthases in S. coelicolor and S. lividans. There are also studies where promoters were replaced to have control over the synthesis of polyketides synthases. Also studies were carried to improve the precursor supply. Among the precursors acetyl-CoA, propionyl-CoA, malonyl-CoA, and methyl-malonyl-CoA, the latter has been targeted as it is specific for PKS synthesis. In the studies by Mutka et al. (2006), S. cerevisiae has been engineered to synthesize methyl-malonyl-CoA resulting in production of triketide lactone. Production of plant polyketides (type III PKS) in microbial hosts such as E. coli and S. cerevisiae is discussed in Lussier et al. (2012). Nonnative polyketides such as naringenin, pinocembrin, resveratrol, luteolin, apigenin, flavones, eriodictyol, stilbenes, curcumin, etc., have been synthesized in microbial hosts (Lussier et al., 2012). Wang et al. (2015) have heterologously expressed seven different biosynthetic genes from plants and bacteria to establish a biosynthetic pathway in E. coli to synthesize four phenylpropanoid acids (cinnamic acid, p-coumaric acid, caffeic acid, and ferulic acid), three bioactive natural stilbenoids (resveratrol, piceatannol, and pinosylvin) and three natural curcuminoids (curcumin, bisdemethoxycurcumin, and dicinnamoylmethane) using different combinations of gene expression. Lim et al. (2011) constructed an E. coli strain by heterologously expressing stilbene synthases from different plant species and optimized promoters to synthesize resveratrol to a high titer of 2.3 g/L. Li et al. (2015) describes metabolic engineering of S. cerevisiae for resveratrol production using tyrosine pathway (TAL). Here 4-coumaryl-CoA ligase from Arabidopsis thaliana and resveratrol synthase from Vitis vinifera were expressed in S. cerevisiae; in addition, deregulated the aromatic amino acid biosynthesis and finally with multiple copy integration and fed-batch cultivation of the engineered strain resulted in 531.41 mg/L using ethanol feeding. In another study by the same research group, instead of TAL pathway, phenylalanine pathway (PAL) was chosen where the S. cerevisiae strain was engineered and later cultivated in fed-batch fermentation to obtain final titer of 800 mg/L of resveratrol (Li et al., 2016). Due to their modular architecture, polyketides are also potential targets for synthetic biology (Cummings et al., 2014). All the enzymes involved in PKS synthesis are clustered as BGCs (biosynthetic gene clusters) as discussed earlier. Bringing diversity in the polyketide scaffold using combinatorial approach during such sequential synthesis could generate newer structures with newer functionalities. Protein engineering principles are applied to polyketide biosynthesis to carry combinatorial PKS synthesis. Some of the possibilities include decrease and increase of chain lengths, variation in precursor selection of starter acyl-CoA units, modification of b-keto reduction (Weissman and Leadlay, 2005). Also the nucleotides in BGCs can be replaced with the site

Biotechnology: a tool for synthesis of novel bioactive compounds

301

directed mutagenesis. Xue et al. (1999) heterologously expressed three different plasmids harboring 6-deoxy-erythronolide B synthase genes (eryAI, eryAII, and eryIII) separately in Streptomyces lividans to obtain 6-deoxyerythronolide B (6-dEB, a precursor for erythromycin) at a level similar to that of a strain expressing all three genes in a single plasmid. Later selective mutations on each of the individual plasmids were carried and expressed to obtain a library of more than 50 derivatives of 6-dEB. Manipulation of deoxysugar pathways is another strategy to obtain diverse PKS (Rodriguez and Mcdaniel, 2001). In the study by Petkovic et al. (2003), the acytransferase (AT) domain of module 4 of erythromycin PKS was swapped with module 2 AT domain of rapamycin PKS to alter the substrate specificity. This led to synthesis of 6desmethyl erythromycin D. Deoxysugar glycosides formation during post-PKS modifications contribute to biological activity and hence are targets for combinatorial biosynthesis. For instance, oleandrosyltransferase for 30 -O-rhamnosyl derivatives of erythromycin, mycaminosyltransferase for tylactone synthesis, aminotransferase for picromycin/methymicin synthesis are some of the examples (Rodriguez and Mcdaniel, 2001). Another class of natural bioactive products which are diverse in nature and have immense applications is terpenes. Several studies have been carried to produce nonnative terpenes in microbial systems. E. coli and S. cerevisiae are widely used platforms to design robust cell factories using synthetic and metabolic engineering strategies. One of the early success stories of nonnative terpene in microbial host is taxadiene, precursor for anticancer drug, taxol. Ajikumar et al. (2010) engineered isoprenoid (methylerythritol-phosphate, MEP) pathway in E. coli by expressing taxadiene synthase from Taxus brevifolia yew tree among several other modifications to obtain 1 g/L titer. Paramasivan and Mutturi (2017) provide a comprehensive list of terpene synthesis in S. cerevisiae cell factory. With rapid advancements in whole genome sequencing along with molecular, computational, and analytical tools, the future seems to be highly encouraging for the production of bioactive compounds using microbial hosts.

References Abdel-Hamid, M., Otte, J., De Gobba, C., Osman, A., Hamad, E., 2017. Angiotensin Iconverting enzyme inhibitory activity and antioxidant capacity of bioactive peptides derived from enzymatic hydrolysis of buffalo milk proteins. International Dairy Journal 66, 91e98. Aguilar-Toala, J.E., Santiago-Lopez, L., Peres, C.M., Peres, C., Garcia, H.S., VallejoCordoba, B., Hernandez-Mendoza, A., 2017. Assessment of multifunctional activity of bioactive peptides derived from fermented milk by specific Lactobacillus plantarum strains. Journal of Dairy Science 100 (1), 65e75. Ajikumar, P.K., Xiao, W.H., Tyo, K.E.J., Wang, Y., Simeon, F., Leonard, E., Mucha, O., Phon, T.H., Pfeifer, B., Stephanopoulos, G., 2010. Isoprenoid pathway optimization for taxol precursor overproduction in Escherichia coli. Science 330, 70e74. Akshath, U.S., Shubha, J.R., Praveena, B., Thakur, M.S., 2014. Quantum dots as optical labels for ultrasensitive detection of polyphenols. Biosensors and Bioelectronics 57, 317e323.

302

Functional and Preservative Properties of Phytochemicals

Albayrak, N., Yang, S.T., 2002. ‘Production of galacto-oligosaccharides from lactose by Aspergillus oryzae b-galactosidase immobilized on cotton cloth’. Biotechnology and Bioengineering 77 (1), 8e19. Altintas, Z., 2018. Surface plasmon resonance based sensor for the detection of glycopeptide antibiotics in milk using rationally designed nano MIPs. Scientific Reports 8, 11222. Aluko, R.E., Girgih, A.T., He, R., Malomo, S., Li, H., Offengenden, M., Wu, J., 2015. Structural and functional characterization of yellow field pea seed (Pisum sativum L.) protein-derived antihypertensive peptides. Food Research International 77, 10e16. Anindyawati, T., Ann, Y.G., Ito, K., Iizuka, M., Minamiura, N., 1998. Two kinds of novel a-glucosidases from Aspergillus awamori KT-11: their purifications, properties and specificities. Journal of Fermentation and Bioengineering 85 (5), 465e469. Bachmann, T.T., Leca, B., Vilatte, F., Marty, J.L., Fournier, D., Schmid, R.D., 2000. Improved multianalyte detection of organophosphates and carbamates with disposable multielectrode biosensors using recombinant mutants of Drosophila acetylcholinesterase and artificial neural networks. Biosensors and Bioelectronics 15 (3), 193e201. Badosa, E., Ferré, R., Francés, J., Bardají, E., Feliu, L., Planas, M., Montesinos, E., 2009. Sporicidal activity of synthetic antifungal undecapeptides and control of Penicillium rot of apples. Applied and Environmental Microbiology 75 (17), 5563e5569. Bailey, J.E., 1991. Towards a science of metabolic engineering. Science 252, 1668e1675. Balti, R., Nedjar-Arroume, N., Bougatef, A., Guillochon, D., Nasri, M., 2010. Three novel angiotensin I-converting enzyme (ACE) inhibitory peptides from cuttlefish (Sepia officinalis) using digestive proteases. Food Research International 43 (4), 1136e1143. Banik, J.J., Brady, S.F., 2008. Cloning and characterization of new glycopeptide gene clusters found in an environmental DNA megalibrary. Proceedings of the National Academy of Sciences 105 (45), 17273e17277. Bérdy, J., 1974. Recent developments of antibiotic research and classification of antibiotics according to chemical structure. In: Perlman, D. (Ed.), Advances in Applied Microbiology. Academic, New York, pp. 308e406. Berthou, J., Migliore-Samour, D., Lifchitz, A., Delettré, J., Floc’h, F., Jolles, P., 1987. ‘Immunostimulating properties and three-dimensional structure of two tripeptides from human and cow caseins’. FEBS Letters 218 (1), 55e58. Bhat, Z.F., Kumar, S., Bhat, H.F., 2015. Bioactive peptides from egg: a review. Nutrition & Food Science 45 (2), 190e212. Bousquet, M.P., Willemot, R.M., Monsan, P., Boures, E., 1998. ‘Production, purification, and characterization of thermostable a-transglucosidase from Talaromyces dupontie application to aealkylglucoside synthesis’. Enzyme and Microbial Technology 23 (1e2), 83e90. Brady, S.F., 2007. Construction of soil environmental DNA cosmid libraries and screening for clones that produce biologically active small molecules. Nature Protocols 2 (5), 1297e1305. Brienzo, M., Carvalho, W., Milagres, A.M., 2010. Xylooligosaccharides production from alkalipretreated sugarcane bagasse using xylanases from Thermoascus aurantiacus. Applied Biochemistry and Biotechnology 162 (4), 1195e1205. Caron, J., Cudennec, B., Domenger, D., Belguesmia, Y., Flahaut, C., Kouach, M., Ravallec, R., 2016. Simulated GI digestion of dietary protein: release of new bioactive peptides involved in gut hormone secretion. Food Research International 89, 382e390.  Carrasco-Castilla, J., Hernandez-Alvarez, A.J., Jiménez-Martínez, C., Gutiérrez-L opez, G.F., Davila-Ortiz, G., 2012. Use of proteomics and peptidomics methods in food bioactive peptide science and engineering. Food Engineering Reviews 4 (4), 224e243.

Biotechnology: a tool for synthesis of novel bioactive compounds

303

Casa-Villegas, M., Marín-Navarro, J., Polaina, J., 2017. Synthesis of isomaltooligosaccharides by Saccharomyces cerevisiae cells expressing Aspergillus niger a-glucosidase. ACS Omega 2 (11), 8062e8068. Castellano, P., Mora, L., Escudero, E., Vignolo, G., Aznar, R., Toldra, F., 2016. Antilisterial peptides from Spanish dry-cured hams: purification and identification. Food Microbiology 59, 133e141. Chan, P.H., So, P.K., Ma, D.L., Zhao, Y., Lai, T.S., Chung, W.H., Chan, K.C., Yiu, K.F., Chan, H.W., Siu, F.M., Tsang, C.W., Leung, Y.C., Wong, K.Y., 2008. Fluorophore-labeled beta-lactamase as a biosensor for beta-lactam antibiotics: a study of the biosensing process. Journal of the American Chemical Society 130, 6351e6361. Chang, F., Ternei, M.A., Calle, P.Y., Brady, S.F., 2013. Clusters from the environment. Journal of the American Chemical Society 135, 17906e17912.  Awussi, A.A., Miclo, L., Jardin, J., Jameh, N., Perrin, C., 2014. Use of a Chang, O.K., Roux, E., free form of the Streptococcus thermophilus cell envelope protease PrtS as a tool to produce bioactive peptides. International Dairy Journal 38 (2), 104e115. Chen, D.L., Tong, X., Chen, S.W., Chen, S., Wu, D., Fang, S.G., Chen, J., 2010. Heterologous expression and biochemical characterization of a-glucosidase from Aspergillus niger by Pichia pastroris. Journal of Agricultural and Food Chemistry 58 (8), 4819e4824. Chen, Y., Liu, W., Xue, J., Yang, J., Chen, X., Shao, Y., Zhang, H., 2014. Angiotensinconverting enzyme inhibitory activity of Lactobacillus helveticus strains from traditional fermented dairy foods and antihypertensive effect of fermented milk of strain H9. Journal of Dairy Science 97 (11), 6680e6692. Chockchaisawasdee, S., Poosaran, N., 2013. Production of isomaltooligosaccharides from banana flour. Journal of the Science of Food and Agriculture 93 (1), 180e186. Christensen, J.E., Dudley, E.G., Pederson, J.A., Steele, J.L., 1999. Peptidases and amino acid catabolism in lactic acid bacteria. Antonie Van Leeuwenhoek 76 (1e4), 217e246. Chu, J., Vila-Farres, X., Inoyama, D., Ternei, M., Cohen, L.J., Gordon, E.A., Reddy, B.V.B., Charlop-Powers, Z., Zebroski, H.A., Gallardo-Macias, R., Jaskowski, M., 2016. Discovery of MRSA active antibiotics using primary sequence from the human microbiome. Nature Chemical Biology 12 (12), 1004. Cimermancic, P., Medema, M.H., Claesen, J., Kurita, K., Brown, L.C.W., Mavrommatis, K., Pati, A., Godfrey, P.A., Koehrsen, M., Clardy, J., Birren, B.W., 2014. Insights into secondary metabolism from a global analysis of prokaryotic biosynthetic gene clusters. Cell 158, 412e421. Cohen, L.J., Han, S., Huang, Y.H., Brady, S.F., 2018. Identification of the colicin V bacteriocin gene cluster by functional screening of a human microbiome metagenomic library. ACS Infectious Diseases 4, 27e32. Cornell, H.J., 1988. Amino acid composition of peptides remaining after in vitro digestion of a gliadin sub-fraction with duodenal mucosa from patients with coeliac disease. Clinica Chimica Acta 176 (3), 279e289. Courtois, J., 2009. Oligosaccharides from land plants and algae: production and applications in therapeutics and biotechnology. Current Opinion in Microbiology 12 (3), 261e273. Crittenden, R.A., Playne, M., 1996. Production, properties and applications of food-grade oligosaccharides. Trends in Food Science and Technology 7 (11), 353e361. Cummings, M., Breitling, R., Takano, E., 2014. Steps towards the synthetic biology of polyketide biosynthesis. FEMS Microbiology Letters 351, 116e125. Da Silva, T.M., Michelin, M., de Lima Damasio, A.R., Maller, A., Almeida, F.B.D.R., Ruller, R., Ward, R.J., Rosa, J.C., Jorge, J.A., Terenzi, H.F., de Moraes, M.D.L.T., 2009. Purification

304

Functional and Preservative Properties of Phytochemicals

and biochemical characterization of a novel a-glucosidase from Aspergillus niveus. Antonie van Leeuwenhoek 96 (4), 569e578. Del Carlo, M., Mascini, M., Pepe, A., Diletti, G., Compagnone, D., 2004. Screening of food samples for carbamate and organophosphate pesticides using an electrochemical bioassay. Food Chemistry 84 (4), 651e656. Donia, M.S., Cimermancic, P., Schulze, C.J., Brown, L.C.W., Martin, J., Mitreva, M., Clardy, J., Linington, R.G., Fischbach, M.A., 2014. A systematic analysis of biosynthetic gene clusters in the human microbiome reveals a common family of antibiotics. Cell 158 (6), 1402e1414. Donia, M.S., Ruffner, D.E., Cao, S., Schmidt, E.W., 2011. Accessing the hidden majority of marine natural products through metagenomics. ChemBioChem 12, 1230e1236. Du, C., Yao, S., Rojas, M., Lin, Y.Z., 1998. ‘Conformational and topological requirements of cell-permeable peptide function’. The Journal of Peptide Research 51 (3), 235e243. Duan, K.J., Sheu, D.C., Lin, M.T., Hsueh, H.C., 1994. Reaction mechanism of isomaltooligosaccharides synthesis by a-glucosidase from Aspergillus carbonarious. Biotechnology Letters 16 (11), 1151e1156. Durot, M., Bourguignon, P., Schachter, V., 2009. ‘Genome-scale models of bacterial metabolism : reconstruction and applications’. FEMS Microbiology Reviews 33, 164e190. Ebrahimi, M., Placido, L., Engel, L., Ashaghi, K.S., Czermak, P., 2010. A novel ceramic membrane reactor system for the continuous enzymatic synthesis of oligosaccharides. Desalination 250 (3), 1105e1108. Eckert, E., Lu, L., Unsworth, L.D., Chen, L., Xie, J., Xu, R., 2016. Biophysical and in vitro absorption studies of iron chelating peptide from barley proteins. Journal of Functional Foods 25, 291e301. El-Fattah, A.A., Sakr, S., El-Dieb, S., Elkashef, H., 2016. Angiotensin-converting enzyme inhibition and antioxidant activity of commercial dairy starter cultures. Food Science and Biotechnology 25 (6), 1745e1751. Ennaas, N., Hammami, R., Beaulieu, L., Fliss, I., 2015. Purification and characterization of four antibacterial peptides from protamex hydrolysate of Atlantic mackerel (Scomber scombrus) by-products. Biochemical and Biophysical Research Communications 462 (3), 195e200. Escudero, E., Mora, L., Fraser, P.D., Aristoy, M.C., Arihara, K., Toldra, F., 2013. Purification and identification of antihypertensive peptides in Spanish dry-cured ham. Journal of Proteomics 78, 499e507. Feriotto, G., Corradini, R., Sforza, S., Bianchi, N., Mischiati, C., Marchelli, R., Gambari, R., 2001. Peptide nucleic acids and biosensor technology for real-time detection of the cystic fibrosis W1282X mutation by surface plasmon resonance. Laboratory Investigation 81 (10), 1415. Ferrer, M., Golyshina, O.V., Plou, F.J., Timmis, K.N., Golyshin, P.N., 2005. A novel a-glucosidase from the acidophilic archaeon Ferroplasma acidiphilum strain Y with high transglycosylation activity and an unusual catalytic nucleophile. Biochemical Journal 391 (2), 269e276. Ferri, M., Graen-Heedfeld, J., Bretz, K., Guillon, F., Michelini, E., Calabretta, M.M., Lamborghini, M., Gruarin, N., Roda, A., Kraft, A., Tassoni, A., 2017. Peptide fractions obtained from rice by-products by means of an environment-friendly process show in vitro health-related bioactivities. PloS one 12 (1), e0170954. Fisch, K.M., Gurgui, C., Heycke, N., Sar, SA Van Der, Anderson, S.A., Webb, V.L., Taudien, S., Platzer, M., Rubio, B.K., Robinson, S.J., Crews, P., 2009. Polyketide assembly lines of uncultivated sponge symbionts from structure-based gene targeting. Nature Chemical Biology 5 (7), 494e501.

Biotechnology: a tool for synthesis of novel bioactive compounds

305

Fischbach, M.A., Walsh, C.T., 2009. Antibiotics for emerging pathogens. Science 325 (5944), 1089e1093. Fraz~ao, C., Maton, V., François, J.M., Walther, T., 2018. Front development of a metabolite sensor for high-throughput detection of aldehydes in Escherichia coli. Frontiers in Bioengineering and Biotechnology 6, 118. Funane, K., Terasawa, K., Mizuno, Y., Ono, H., Miyagi, T., Gibu, S., Tokashiki, T., Kawabata, Y., Kim, Y.M., Kimura, A., Kobayashi, M., 2007. A novel cyclic isomaltooligosaccharide (cycloisomaltodecaose, CI-10) produced by Bacillus circulans T3040 displays remarkable inclusion ability compared with cyclodextrins’. Journal of Biotechnology 130 (2), 188e192. García-Tejedor, A., Castello-Ruiz, M., Gimeno-Alca~níz, J.V., Manzanares, P., Salom, J.B., 2015. In vivo antihypertensive mechanism of lactoferrin-derived peptides: reversion of angiotensin I-and angiotensin II-induced hypertension in Wistar rats. Journal of Functional Foods 15, 294e300. Garg, S., Apostolopoulos, V., Nurgali, K., Mishra, V.K., 2018. Evaluation of in silico approach for prediction of presence of opioid peptides in wheat. Journal of Functional Foods 41, 34e40. Garreau, I., Zhao, Q., Pejoan, C., Cupo, A., Piot, J.M., 1995. VV-hemorphin-7 and LVVhemorphin-7 released during in vitro peptic hemoglobin hydrolysis are morphinomimetic peptides. Neuropeptides 28 (4), 243e250. Giannesi, G.C., de Moraes, M.D.L.T., Terenzi, H.F., Jorge, J.A., 2006. A novel a-glucosidase from Chaetomium thermophilum var. coprophilum that converts maltose into trehalose: purification and partial characterisation of the enzyme. Process Biochemistry 41 (8), 1729e1735. Gonzalez-Gonzalez, C., Gibson, T., Jauregi, P., 2013. Novel probiotic-fermented milk with angiotensin I-converting enzyme inhibitory peptides produced by Bifidobacterium bifidum MF 20/5. International Journal of Food Microbiology 167 (2), 131e137. Grindberg, R.V., Ishoey, T., Brinza, D., Esquenazi, E., Coates, R.C., Liu, W., Gerwick, L., Dorrestein, P.C., Pevzner, P., Lasken, R., William, H., 2011. Single cell genome amplification accelerates identification of the apratoxin biosynthetic pathway from a complex microbial assemblage. PLoS One 6 (4), e18565. Guerfali, M., Maalej, I., Gargouri, A., Belghith, H., 2009. Catalytic properties of the immobilized Talaromyces thermophilus b-xylosidase and its use for xylose and xylooligosaccharides production. Journal of Molecular Catalysis B: Enzymatic 57 (1e4), 242e249. Gutiérrez-Alonso, P., Gimeno-Pérez, M., Ramírez-Escudero, M., Plou, F.J., Sanz-Aparicio, J., Fernandez-Lobato, M., 2016. Molecular characterization and heterologous expression of a Xanthophyllomyces dendrorhous a-glucosidase with potential for prebiotics production. Applied Microbiology and Biotechnology 100 (7), 3125e3135. Handelsman, J., Rondon, M.R., Goodman, R.M., Brady, S.F., Clardy, J., Goodman, R.M., 1998. Molecular biological access to the chemistry of unknown soil microbes: a new frontier for natural products. Chemistry and Biology 5 (10), 245e249. Hansen, L.H., Ferrari, B., Sørensen, A.H., veal, D., Sørensen, S.J., 2001. Detection of oxytetracycline production by Streptomyces rimosus in soil microcosms by combining whole-cell biosensors and flow cytometry. Applied and Environmental Microbiology 67, 239e244. Hanus, L., Shohami, E., Bab, I., Mechoulam, R., 2014. N-acyl amino acids and their impact on biological processes. BioFactors 40, 381e388. Haque, E., Chand, R., 2008. Antihypertensive and antimicrobial bioactive peptides from milk proteins. European Food Research and Technology 227 (1), 7e15. Haasnoot, W., Bienenmann-Ploum, M., Lamminm€aki, U., Swanenburg, M., van Rhijn, H., 2005. Application of a multi-sulfonamide biosensor immunoassay for the detection of

306

Functional and Preservative Properties of Phytochemicals

sulfadiazine and sulfamethoxazole residues in broiler serum and its use as a predictor of the levels in edible tissue. Analytica Chimica Acta 552 (1e2), 87e95. Hayes, M., Stanton, C., Fitzgerald, G.F., Ross, R.P., 2007. Putting microbes to work: dairy fermentation, cell factories, and bioactive peptides. Part II: bioactive peptide functions. Biotechnology Journal 2, 435e449. Herman, Z.S., Stachura, Z., Siemion, I.Z., Nawrocka, E., 1980. Analgesic activity of some tuftsin analogs. Naturwissenschaften 67 (12), 613e614. Hess, M., Sczyrba, A., Egan, R., Kim, T.W., Chokhawala, H., Schroth, G., Luo, S., Clark, D.S., Chen, F., Zhang, T., Mackie, R.I., 2011. Metagenomic discovery of bio- mass-degrading genes and genomes from cow rumen. Science 331, 463e467. Heyer, A.G., Wendenburg, R., 2001. Gene cloning and functional characterization by heterologous expression of the fructosyltransferase of Aspergillus sydowi IAM 2544. Applied and Environmental Microbiology 67 (1), 363e370. Hildebrandt, A., Bragos, R., Lacorte, S., Marty, J.L., 2008. Performance of a portable biosensor for the analysis of organophosphorus and carbamate insecticides in water and food. Sensors and Actuators B: Chemical 133 (1), 195e201. Hou, Y., Liu, W., Cheng, Y., Zhou, J., Wu, L., Yang, G., 2014. Production optimization and characterization of immunomodulatory peptides obtained from fermented goat placenta. Food Science and Technology 34 (4), 723e729. Hover, B.M., Kim, S., Katz, M., Charlop-Powers, Z., Owen, J.G., Ternei, M.A., Maniko, J., Estrela, A.B., Molina, H., Park, S., Perlin, D.S., Brady, S.F., 2018. Culture-independent discovery of the malacidins as calcium-dependent antibiotics with activity against multidrug-resistant Gram-positive pathogens. Nature Microbiology 3, 415e422. Hruby, V.J., Chow, M.S., Smith, D.D., 1990. Conformational and structural considerations in oxytocin-receptor binding and biological activity. Annual Review of Pharmacology and Toxicology 30 (1), 501e534. Hu, X.P., Heath, C., Taylor, M.P., Tuffin, M., Cowan, D., 2011. A novel, extremely alkaliphilic and cold-active esterase from Antarctic desert soil. Extremophiles 16 (1), 79e86. Huang, H., Lindgren, A., Wu, X., AiLu, N., Lin, S., 2012. High-Throughput screening for bioactive molecules using primary cell culture of transgenic zebrafish embryos. Cell Reporter 2, 695e704. Huttenhower, C., Gevers, D., Knight, R., Abubucker, S., Badger, J.H., Chinwalla, A.T., Creasy, H.H., Earl, A.M., Fitz Gerald, M.G., Fulton, R.S., Giglio, M.G., 2012. Structure, function and diversity of the healthy human microbiome. Nature 486 (7402), 207. Ibrahim, O.O., 2018. Functional oligo-saccharides: chemicals structure, manufacturing, health benefits, applications and regulations. Journal of Food Chemistry and Nanotechnology 4 (4), 65e76. Iqbal, H.A., Feng, Z., Brady, S.F., 2012. Biocatalysts and small molecule products from metagenomic studies. Current Opinion in Chemical Biology 16 (1e2), 109e116. Iqbal, H.A., Low-Beinart, L., Obiajulu, J.U., Brady, S.F., 2016. Natural product discovery through improved functional metagenomics in Streptomyces. Journal of the American Chemical Society 138 (30), 9341e9344. Jacquot, A., Gauthier, S.F., Drouin, R., Boutin, Y., 2010. Proliferative effects of synthetic peptides from b-lactoglobulin and a-lactalbumin on murine splenocytes. International Dairy Journal 20 (8), 514e521. Jayapal, N., Samanta, A.K., Kolte, A.P., Senani, S., Sridhar, M., Suresh, K.P., Sampath, K.T., 2013. Value addition to sugarcane bagasse: xylan extraction and its process optimization for xylooligosaccharides production. Industrial Crops and Products 42, 14e24.

Biotechnology: a tool for synthesis of novel bioactive compounds

307

Jayasena, S.D., 1999. Aptamers: an emerging class of molecules that rival antibodies in diagnostics. Clinical Chemistry 45, 1628e1650. Jung, K.Y., Moon, H.D., Lee, G.E., Lim, H.H., Park, C.S., Kim, Y.C., 2007. ‘Structure activity relationship studies of spinorphin as a potent and selective human P2X3 receptor antagonist’. Journal of Medicinal Chemistry 50 (18), 4543e4547. Karska, K., Tuckova, L., Steiner, L., Tlaskalovahogenova, H., Michalak, M., 1995. Calreticulinthe potential autoantigen in celiac disease. Biochemical and Biophysical Research Communications 209 (2), 597e605. Katapodis, P., Christakopoulos, P., 2008. Enzymic production of feruloyl xylo-oligosaccharides from corn cobs by a family 10 xylanase from Thermoascus aurantiacus. LWT-Food Science and Technology 41 (7), 1239e1243. Kato, N., Suyama, S., Shirokane, M., Kato, M., Kobayashi, T., Tsukagoshi, N., 2002. Novel a-glucosidase from Aspergillus nidulans with strong transglycosylation activity. Applied and Environmental Microbiology 68 (3), 1250e1256. Katz, M., Hover, B.M., Brady, S.F., 2016. Culture-independent discovery of natural products from soil metagenomes. Journal of Industrial Microbiology and Biotechnology 43 (2e3), 129e141. Kim, S., Lee, H.J., 2017. Gold nanostar enhanced surface plasmon resonance detection of an antibiotic at attomolar concentrations via an aptamer-antibody sandwich assay. Analytical Chemistry 89 (12), 6624e6630. King, R.W., Bauer, J.D., Brady, S.F., 2009. An environmental DNA-derived type II polyketide biosynthetic pathway encodes the biosynthesis of the pentacyclic polyketide. Angewandte Chemie 48, 6257e6261. Kissinger, P.T., 2005. Biosensors-a perspective. Biosensors and Bioelectronics 20 (12), 2512e2516. Kobayashi, I., Tokuda, M., Hashimoto, H., Konda, T., Nakano, H., Kitahata, S., 2003. Purification and characterization of a new type of a-glucosidase from Paecilomyces lilacinus that has transglucosylation activity to produce a-1, 3-and a-1, 2-linked. Bioscience, Biotechnology, and Biochemistry 67 (1), 29e35. Kuriki, T., Yanase, M., Takata, H., Takesada, Y., Imanaka, T., Okada, S., 1993. A new way of producing isomalto-oligosaccharide syrup by using the transglycosylation reaction of neopullulanase. Applied and Environmental Microbiology 59 (4), 953e959. Lakhdari, O., Cultrone, A., Tap, J., Gloux, K., Bernard, F., Ehrlich, S.D., Lefevre, F., Doré, J., Blottiere, H.M., 2010. Functional metagenomics: a high throughput screening method to decipher microbiota-driven NF-kB modulation. PLoS One 5 (10), e13092. Lassoued, I., Mora, L., Barkia, A., Aristoy, M.C., Nasri, M., Toldra, F., 2016. ‘Angiotensin Iconverting enzyme inhibitory peptides FQPSF and LKYPI identified in Bacillus subtilis A26 hydrolysate of thornback ray muscle’. International Journal of Food Science and Technology 51 (7), 1604e1609. Le Gouic, A.V., Harnedy, P.A., FitzGerald, R.J., 2019. ‘Bioactive peptides from fish protein byproducts’. Bioactive Molecules in Food 355e388. Lassoued, I., Mora, L., Barkia, A., Aristoy, M.C., Nasri, M., Toldra, F., 2015. Bioactive peptides identified in thornback ray skin’s gelatin hydrolysates by proteases from Bacillus subtilis and Bacillus amyloliquefaciens. Journal of Proteomics 128, 8e17. Lee, K.H., Hong, S.Y., Oh, J.E., Yoon, J.H., Lee, B.L., Moon, H.M., 1998. Identification and characterization of the antimicrobial peptide corresponding to C-terminal b-sheet domain of tenecin 1, an antibacterial protein of larvae of Tenebrio molitor. Biochemical Journal 334 (1), 99e105.

308

Functional and Preservative Properties of Phytochemicals

Lemes, A., Sala, L., Ores, J., Braga, A., Egea, M., Fernandes, K., 2016. A review of the latest advances in encrypted bioactive peptides from protein-rich waste. International Journal of Molecular Sciences 17 (6), 950. Li, M., Kildegaard, K.R., Chen, Y., Rodriguez, A., Borodina, I., Nielsen, J., 2015. De novo production of resveratrol from glucose or ethanol by engineered Saccharomyces cerevisiae. Metabolic Engineering 32, 1e11. Li, M., Schneider, K., Kristensen, M., Borodina, I., Nielsen, J., 2016. Engineering yeast for highlevel production of stilbenoid antioxidants. Scientific Reports 6, e36827. Lim, C.G., Fowler, Z.L., Hueller, T., Schaffer, S., Koffas, M.A.G., 2011. High-yield resveratrol production in engineered Escherichia coli. Applied and Environmental Microbiology 77 (10), 3451e3460. Lima, C.A., Campos, J.F., Lima Filho, J.L., Converti, A., da Cunha, M.G.C., Porto, A.L., 2015. Antimicrobial and radical scavenging properties of bovine collagen hydrolysates produced by Penicillium aurantiogriseum URM 4622 collagenase. Journal of Food Science and Technology 52 (7), 4459e4466. Liu, M., Du, M., Zhang, Y., Xu, W., Wang, C., Wang, K., Zhang, L., 2013. Purification and identification of an ACE inhibitory peptide from walnut protein. Journal of Agricultural and Food Chemistry 61 (17), 4097e4100. Lussier, F., Colatriano, D., Wiltshire, Z., Page, J.E., Martin, V.J.J., 2012. Engineering microbes for plant polyketide biosynthesis. Computational And Structural Biotechnology Journal 3 (4), e201210020.  Madlova, A., Antosova, M., Barathova, M., Polakovic, M., Stefuca, V., Bales, V., 2000. Biotransformation of sucrose to fructooligosaccharides: the choice of microorganisms and optimization of process conditions. Progress in Biotechnology 17, 151e155. Marchesi, J.R., Adams, D.H., Fava, F., Hermes, G.D.A., Hirschfield, G.M., Hold, G., Quraishi, M.N., Kinross, J., Smidt, H., Tuohy, K.M., Thomas, L.V., Zoetendal, E.G., Hart, A., 2016. The gut microbiota and host health: a new clinical frontier. Gut 65 (2), 330e339. Marín, D., Linde, D., Lobato, M.F., 2006. ‘Purification and biochemical characterization of an a-glucosidase from Xanthophyllomyces dendrorhous’. Yeast 23 (2), 117e125. Martínez-Villaluenga, C., Cardelle-Cobas, A., Corzo, N., Olano, A., Villamiel, M., 2008. Optimization of conditions for galactooligosaccharide synthesis during lactose hydrolysis by b-galactosidase from Kluyveromyces lactis (Lactozym 3000 L HP G). Food Chemistry 107 (1), 258e264. McCleary, B.V., Gibson, T.S., Sheehan, H., Casey, A., Horgan, L., O’Flaherty, J., 1989. Purification, properties, and industrial significance of transglucosidase from Aspergillus niger. Carbohydrate Research 185 (1), 147e162. McDaniel, R., Licari, P., Khosla, C., 2001. Process development and metabolic engineering for the overproduction of natural and unnatural polyketides. In: Metabolic Engineering. Springer, Berlin, Heidelberg, pp. 31e52. Mehlhorn, A., Rahimi, P., Joseph, Y., 2018. Aptamer- based biosensors for antibiotic detection: a review. Biosensors 8, 54e62. Methé, B.A., Nelson, K.E., Pop, M., Creasy, H.H., Giglio, M.G., Huttenhower, C., Gevers, D., Petrosino, J.F., Abubucker, S., Badger, J.H., Chinwalla, A.T., 2012. A framework for human microbiome research. Nature 486 (7402), 215. Milshteyn, A., Colosimo, D.A., Brady, S.F., 2018. Review accessing bioactive natural products from the human microbiome. Cell Host and Microbe 23 (6), 725e736. Minnuni, M., Bilia, A.R., 2009. SPR in drug discovery: searching bioactive compounds in plant extracts. Methods in Molecular Biology 572, 203e218.

Biotechnology: a tool for synthesis of novel bioactive compounds

309

Mohanty, D.P., Mohapatra, S., Misra, S., Sahu, P.S., 2016. ‘Milk derived bioactive peptides and their impact on human healtheA review’. Saudi Journal of Biological Sciences 23 (5), 577e583. Moldes, A.B., Vecino, X., Cruz, J.M., 2017. Nutraceuticals and food additives. In: Current Developments in Biotechnology and Bioengineering. Elsevier, pp. 143e164. Møller, P.L., Jørgensen, F., Hansen, O.C., Madsen, S.M., Stougaard, P., 2001. Intra-and extracellular b-galactosidases from Bifidobacterium bifidum and B. infantis: molecular cloning, heterologous expression, and comparative characterization. Applied and Environmental Microbiology 67 (5), 2276e2283. Monciardini, P., Iorio, M., Maffioli, S., Sosio, M., Donadio, S., 2014. Minireview Discovering new bioactive molecules from microbial sources. Microbial Biotechnology 7 (3), 209e220. Muhialdin, B.J., Hassan, Z., Bakar, F.A., Saari, N., 2016. Identification of antifungal peptides produced by Lactobacillus plantarum IS10 grown in the MRS broth. Food Control 59, 27e30. Mutka, S.C., Bondi, S.M., Carney, J.R., Da Silva, N.A., Kealey, J.T., 2006. Metabolic pathway engineering for complex polyketide biosynthesis in Saccharomyces cerevisiae. FEMS Yeast Research 6, 40e47. Nabarlatz, D., Ebringerova, A., Montane, D., 2007. Autohydrolysis of agricultural by-products for the production of xylo-oligosaccharides. Carbohydrate Polymers 69 (1), 20e28. Nacos, M.K., Katapodis, P., Pappas, C., Daferera, D., Tarantilis, P.A., Christakopoulos, P., Polissiou, M., 2006. ‘Kenaf xylanea source of biologically active acidic oligosaccharides’. Carbohydrate Polymers 66 (1), 126e134. Naimah, A.K., Al-Manhel, A.J.A., Al-Shawi, M.J., 2018. Isolation, purification and characterization of antimicrobial peptides produced from Saccharomyces boulardii. International Journal of Peptide Research and Therapeutics 1e7. Navab, M., Reddy, S.T., Van Lenten, B.J., Anantharamaiah, G.M., Fogelman, A.M., 2009. The role of dysfunctional HDL in atherosclerosis. Journal of Lipid Research 50 (Suppl. ment), S145eS149. Neifar, M., Maktouf, S., Ghorbel, R.E., Jaouani, A., Cherif, A., 2015. Extremophiles as source of novel bioactive compounds with industrial potential. In: Biotechnology of Bioactive Compounds: Sources and Application. Wiley, Hoboken, pp. 245e268. Neveu, J., Regeard, C., DuBow, M.S., 2011. Isolation and characterization of two serine proteases from metagenomic libraries of the Gobi and Death Valley deserts. Applied Microbiology and Biotechnology 91 (3), 635e644. Nguyen, S.D., Jeong, T.S., Kim, M.R., Sok, D.E., 2006. Broad-spectrum antioxidant peptides derived from His residue-containing sequences present in human paraoxonase 1. Free Radical Research 40 (4), 349e358. Nielsen, J., 2001. Metabolic engineering. Applied Microbiology and Biotechnology 55 (3), 263e283. Nielsen, J., 2003. It is all about metabolic fluxes. Journal of Bacteriology 185 (24), 7031e7035. Nielsen, J., 2017. Systems biology of metabolism. Annual Review of Biochemistry 86, 245e275. Nimalaratne, C., Bandara, N., Wu, J., 2015. Purification and characterization of antioxidant peptides from enzymatically hydrolyzed chicken egg white. Food Chemistry 188, 467e472. Nowruzi, B., Haghighat, S., Fahimi, H., Mohammadi, E., 2018. Nostoc cyanobacteria species: a new and rich source of novel bioactive compounds with pharmaceutical potential. Journal of Pharmaceutical Health Services Research 9 (1), 5e12. Ohata, M., Uchida, S., Zhou, L., Arihara, K., 2016. Antioxidant activity of fermented meat sauce and isolation of an associated antioxidant peptide. Food Chemistry 194, 1034e1039.

310

Functional and Preservative Properties of Phytochemicals

Ojha, S., Mishra, S., Chand, S., 2015. Production of isomalto-oligosaccharides by cell bound a-glucosidase of Microbacterium sp. LWT-Food Science and Technology 60 (1), 486e494. Omura, S. (Ed.), 1992. The Search for Bioactive Compounds from Microorganisms. Springer Science & Business Media. Omura, S., 2011. Microbial metabolites: 45 years of wandering, wondering and discovering. Natural Product Updates 67 (35), 6420e6459. O’Sullivan, C.K., 2002. ‘Aptasensorsethe future of biosensing?’. Analytical and Bioanalytical Chemistry 372 (1), 44e48. Paddon, C.J., Westfall, P.J., Pitera, D.J., Benjamin, K., Fisher, K., McPhee, D., Leavell, M.D., Tai, A., Main, A., Eng, D., Polichuk, D.R., Teoh, K.H., Reed, D.W., Treynor, T., Lenihan, J., Fleck, M., Bajad, S., Dang, G., Dengrove, D., Diola, D., Dorin, G., Ellens, K.W., Fickes, S., Galazzo, J., Gaucher, S.P., Geistlinger, T., Henry, R., Hepp, M., Horning, T., Iqbal, T., Jiang, H., Kizer, L., Lieu, B., Melis, D., Moss, N., Regentin, R., Secrest, S., Tsuruta, H., Vazquez, R., Westblade, L.F., Xu, L., Yu, M., Zhang, Y., Zhao, L., Lievense, J., Covello, P.S., Keasling, J.D., Reiling, K.K., Renninger, N.S., Newman, J.D., 2013. High-level semi-synthetic production of the potent antimalarial artemisinin. Nature 496 (7446), 528e532. Pan, Y.C., Lee, W.C., 2005. ‘Production of high-purity isomalto-oligosaccharides syrup by the enzymatic conversion of transglucosidase and fermentation of yeast cells’. Biotechnology and Bioengineering 89 (7), 797e804. Pang, H., Zhang, P., Duan, C.J., Mo, X.C., Tang, J.L., Feng, J.X., 2009. Identification of cellulase genes from the metagenomes of compost soils and functional characterization of one novel endoglucanase. Current Microbiology 58, 404e408. Paramasivan, K., Mutturi, S., 2017. Progress in terpene synthesis strategies through engineering of Saccharomyces cerevisiae. Critical Reviews in Biotechnology 37 (8), 974e989. Patel, S., Goyal, A., 2011. Functional oligosaccharides: production, properties and applications. World Journal of Microbiology and Biotechnology 27 (5), 1119e1128. Perlman, D., 1980. Some problems on the new horizons of applied microbiology. In: Developments in Industrial Microbiology. Proceedings of the 36th General Meeting of the Society for Industrial Microbiology, Arlington, VA. Petkovic, H., Lill, R.E., Sheridan, R.M., Wilkinson, B., Mccormick, E.L., Mcarthur, H.A., Staunton, J., Leadlay, P.F., Kendrew, S.G., 2003. A novel erythromycin, 6-desmethyl erythromycin D, made by substituting an acyltransferase domain of the erythromycin polyketide synthase. The Journal of Antibiotics 56 (6), 543e551. Piel, J., 2002. A polyketide synthase-peptide synthetase gene cluster from an uncultured bacterial symbiont of Paederus beetles. Proceedings of the National Academy of Sciences 99 (22), 14002e1400.  Pocedicova, K., Curda, L., Misun, D., Dryakova, A., Diblíkova, L., 2010. Preparation of galacto-oligosaccharides using membrane reactor. Journal of Food Engineering 99 (4), 479e484. Quah, Y., Ismail, N.I.M., Ooi, J.L.S., Affendi, Y.A., Manan, F.A., Wong, F.C., Chai, T.T., 2018. Identification of novel cytotoxic peptide KENPVLSLVNGMF from marine sponge Xestospongia testudinaria, with characterization of stability in human serum. International Journal of Peptide Research and Therapeutics 24 (1), 189e199. Quigley, E.M., 2010. Prebiotics and probiotics; modifying and mining the microbiota. Pharmacological Research 61 (3), 213e218. Rabiu, B.A., Jay, A.J., Gibson, G.R., Rastall, R.A., 2001. Synthesis and fermentation properties of novel galacto-oligosaccharides by b-galactosidases from Bifidobacterium species. Applied and Environmental Microbiology 67 (6), 2526e2530.

Biotechnology: a tool for synthesis of novel bioactive compounds

311

Rai, A.K., Kumari, R., Sanjukta, S., Sahoo, D., 2016. Production of bioactive protein hydrolysate using the yeasts isolated from soft chhurpi. Bioresource Technology 219, 239e245. Reinscheid, R.K., Nothacker, H.P., Bourson, A., Ardati, A., Henningsen, R.A., Bunzow, J.R., Civelli, O., 1995. Orphanin FQ: a neuropeptide that activates an opioidlike G proteincoupled receptor. Science 270 (5237), 792e794. Rizzello, C.G., Tagliazucchi, D., Babini, E., Rutella, G.S., Saa, D.L.T., Gianotti, A., 2016. Bioactive peptides from vegetable food matrices: research trends and novel biotechnologies for synthesis and recovery. Journal of Functional Foods 27, 549e569. Roberfroid, M.B., Delzenne, N.M., 1998. Dietary fructans. Annual Review of Nutrition 18 (1), 117e143. Rodriguez, E., Mcdaniel, R., 2001. Combinatorial biosynthesis of antimicrobials and other natural products. Current Opinion in Microbiology 4, 526e534. Rui, X., Wen, D., Li, W., Chen, X., Jiang, M., Dong, M., 2015. Enrichment of ACE inhibitory peptides in navy bean (Phaseolus vulgaris) using lactic acid bacteria. Food & Function 6 (2), 622e629. Ryoo, S.R., Yim, Y., Kim, Y.K., Park, I.S., Na, H.K., Lee, J., Jang, H., Won, C., Hong, S., Kim, S.Y., Li, Jeon, N., Song, J.M., Min, D.H., 2018. High-throughput chemical screening to discover new modulators of microRNA expression in living cells by using graphenebased biosensor. Scientific Reports 8, 11413. Saad, N., Delattre, C., Urdaci, M., Schmitter, J.M., Bressollier, P., 2013. An overview of the last advances in probiotic and prebiotic field. LWT-Food Science and Technology 50 (1), 1e16. Sadik, O.A., Yan, F., 2004. Novel fluorescent biosensor for pathogenic toxins using cyclic polypeptide conjugates. Chemical Communications 9, 1136e1137. Saito, K., Jin, D.H., Ogawa, T., Muramoto, K., Hatakeyama, E., Yasuhara, T., Nokihara, K., 2003. Antioxidative properties of tripeptide libraries prepared by the combinatorial chemistry. Journal of Agricultural and Food Chemistry 51 (12), 3668e3674. Sanchez, A., Vazquez, A., 2017. Bioactive peptides: A review. Food Quality and Safety 1 (1), 29e46. Sanchez, O., Guio, F., Garcia, D., Silva, E., Caicedo, L., 2008. Fructooligosaccharides production by Aspergillus sp. N74 in a mechanically agitated airlift reactor. Food and Bioproducts Processing 86 (2), 109e115. Sangwan, V., Tomar, S.K., Ali, B., Singh, R.R., Singh, A.K., 2015. Production of b-galactosidase from streptococcus thermophilus for galactooligosaccharides synthesis’. Journal of Food Science and Technology 52 (7), 4206e4215. Santos, A.M., Maugeri, F., 2007. Synthesis of fructooligosaccharides from sucrose using inulinase from Kluyveromyces marxianus. Food Technology and Biotechnology 45 (2), 181. Scarano, S., Mariani, S., Minunni, M., 2015. SPR-based affinity biosensors as innovative analytical devices. Journal of Lightwave Technology 33 (16), 3374e3384. Schallmey, M., Frunzke, J., Eggeling, L., 2014. Looking for the pick of the bunch: highthroughput screening of producing microorganisms with biosensors. Current Opinion in Biotechnology 26, 148e154. Seo, S.H., Choi, K.H., Hwang, S., Kim, J., Park, C.S., Rho, J.R., Cha, J., 2011. Characterization of the catalytic and kinetic properties of a thermostable Thermoplasma acidophilum a-glucosidase and its transglucosylation reaction with arbutin. Journal of Molecular Catalysis B: Enzymatic 72 (3e4), 305e312. Seow, K., Meurer, G., Gerlitz, M., Wendt-pienkowski, E., Hutchinson, C.R., Davies, J., 1997. ‘A study of iterative type II polyketide synthases , using bacterial genes cloned from soil DNA : a means to access and use genes from uncultured microorganisms’. Journal of Bacteriology 179 (23), 7360e7368.

312

Functional and Preservative Properties of Phytochemicals

Sharma, R., Akshath, U.S., Praveena, Bhatt, KSMS, Raghavarao, 2017. Fluorescent aptaswitch for detection of chloramphenicol-quantification enabled by aptamer immobilization. Proceedia Technology 27, 282e286. Shepherd, C.A., Hopkins, A.L., Navratilova, I., 2014. Fragment screening by SPR and advanced application to GPCRs. Progress in Biophysics and Molecular Biology 116, 113e123. Silva, M.F., Rigo, D., Mossi, V., Golunski, S., de Oliveira Kuhn, G., Di Luccio, M., Dallago, R., de Oliveira, D., Oliveira, J.V., Treichel, H., 2013. ‘Enzymatic synthesis of fructooligosaccharides by inulinases from Aspergillus niger and Kluyveromyces marxianus NRRL Y7571 in aqueouseorganic medium’. Food Chemistry 138 (1), 148e153. Siow, H.L., Gan, C.Y., 2016. ‘Extraction, identification, and structureeactivity relationship of antioxidative and a-amylase inhibitory peptides from cumin seeds (Cuminum cyminum)’. Journal of Functional Foods 22, 1e12. Soares, R., Mendonça, S., de Castro, L.I., Menezes, A., Arêas, J., 2015. Major peptides from amaranth (Amaranthus cruentus) protein inhibit HMG-CoA reductase activity. International Journal of Molecular Sciences 16 (2), 4150e4160. Spohner, S.C., Czermak, P., 2016. Heterologous expression of Aspergillus terreus fructosyltransferase in Kluyveromyces lactis. New biotechnology 33 (4), 473e479. Stephanopoulos, G., 1999. Metabolic fluxes and metabolic engineering. Metabolic Engineering 1 (1), 1e11. Stephanopoulos, G., 2012. Synthetic biology and metabolic engineering. ACS Synthetic Biology 1 (11), 514e525. Sun, Y.Q., Busche, T., R€uckert, C., Paulus, C., Rebets, Y., Novakova, R., Kalinowski, J., Luzhetskyy, A., Kormanec, J., Sekurova, O.N., Zotchev, S.B., 2017. Development of a biosensor concept to detect the production of cluster-specific secondary metabolites. ACS Synthetic Biology 6, 1026e1033. Takaku, H., 1988. Anomalously linked oligosaccharides mixture. In: Handbook of Amylases and Related Enzymes: Their Sources, Isolation Methods, Properties and Applications. The Amylase Research Society of Japan. Tenenbaum, E., Segal, E., 2015. Optical biosensors for bacteria detection by a peptidomimetic antimicrobial compound. Analyst 140 (22), 7726e7733. Torres-Fuentes, C., Contreras, M.M., Recio, I., Alaiz, M., Vioque, J., 2015. Identification and characterization of antioxidant peptides from chickpea protein hydrolysates. Food Chemistry 180, 194e202. Uchiyama, T., Abe, T., Ikemura, T., Watanabe, K., 2005. Substrate-induced gene-expression screening of environmental metagenome libraries for isolation of catabolic genes. Nature Biotechnology 23, 88e93. Uchiyama, T., Miyazaki, K., 2010. Product-induced gene expression, a product-responsive reporter assay used to screen metagenomic libraries for enzyme-encoding genes. Applied and Environmental Microbiology 76, 7029e7035. Udenigwe, C.C., Li, H., Aluko, R.E., 2012. ‘Quantitative structureeactivity relationship modeling of renin-inhibiting dipeptides’. Amino Acids 42 (4), 1379e1386. Uenishi, H., Kabuki, T., Seto, Y., Serizawa, A., Nakajima, H., 2012. Isolation and identification of casein-derived dipeptidyl-peptidase 4 (DPP-4)-inhibitory peptide LPQNIPPL from gouda-type cheese and its effect on plasma glucose in rats. International Dairy Journal 22 (1), 24e30. Urban, A., Eckermann, S., Fast, B., Metzger, S., Gehling, M., Ziegelbauer, K., Helga, R€ubsamen-Waigmann, H., Freiberg, C., 2007. Novel whole-cell antibiotic biosensors for compound discovery. Applied and Environmental Microbiology 73, 6436e6443.

Biotechnology: a tool for synthesis of novel bioactive compounds

313

Urrutia, P., Rodriguez-Colinas, B., Fernandez-Arrojo, L., Ballesteros, A.O., Wilson, L., Illanes, A., Plou, F.J., 2013. Detailed analysis of galactooligosaccharides synthesis with b-galactosidase from Aspergillus oryzae. Journal of Agricultural and Food Chemistry 61 (5), 1081e1087. Van Laere, K.M., Abee, T., Schols, H.A., Beldman, G., Voragen, A.G., 2000. Characterization of a novel b-galactosidase from Bifidobacterium adolescentis DSM 20083 active towards transgalactooligosaccharides. Applied and Environmental Microbiology 66 (4), 1379e1384. Vazquez, M.J., Alonso, J.L., Domınguez, H., Parajo, J.C., 2000. Xylooligosaccharides: manufacture and applications. Trends in Food Science and Technology 11 (11), 387e393. Venkatesan, J., Anil, S., Kim, S.K., Shim, M., 2017. Marine fish proteins and peptides for cosmeceuticals: a review. Marine Drugs 15 (5), 143. Wang, K., Li, G., Yu, S.Q., Zhang, C.T., Liu, Y.H., 2010. A novel metagenomederived betagalactosidase: gene cloning, overexpression, purification and characterization. Applied and Environmental Microbiology 88 (1), 155e165. Wang, J., Li, C., Xue, J., Yang, J., Zhang, Q., Zhang, H., Chen, Y., 2015a. ‘Fermentation characteristics and angiotensin I-converting enzymeeinhibitory activity of Lactobacillus helveticus isolate H9 in cow milk, soy milk, and mare milk’. Journal of Dairy Science 98 (6), 3655e3664. Wang, S., Zhang, S., Xiao, A., Rasmussen, M., Skidmore, C., Zhan, J., 2015b. Metabolic engineering of Escherichia coli for the biosynthesis of various phenylpropanoid derivatives. Metabolic Engineering 29, 153e159. Wang, X., Chen, H., Fu, X., Li, S., Wei, J., 2017. A novel antioxidant and ACE inhibitory peptide from rice bran protein: biochemical characterization and molecular docking study. LWT 75, 93e99. Westfall, P.J., Pitera, D.J., Lenihan, J.R., Eng, D., Woolard, F.X., Regentin, R., Horning, T., Tsuruta, H., Melis, D.J., Owens, A., Fickes, S., Diola, D., Benjamin, K.R., Keasling, J.D., Leavell, M.D., McPhee, D.J., Renninger, N.S., Newman, J.D., Paddon, C.J., 2012. Production of amorphadiene in yeast, and its conversion to dihydroartemisinic acid, precursor to the antimalarial agent artemisinin. Proceedings of the National Academy of Sciences 109 (3), E111eE118. Wieczorek, Z., Zimecki, M., Słon, J.J., Siemion, I.Z., 1994. The immunomodulatory activity of tetra-and tripeptides of tuftsin-kentsin group. Peptides 15 (2), 215e221. Wietzorrek, A., Bibb, M., 1997. ‘A novel family of proteins that regulates antibiotic production in streptomycetes appears to contain an OmpR-like DNA-binding fold’. Molecular Microbiology 25 (6), 1181e1184. Weissman, K.J., Leadlay, P.F., 2005. Combinatorial biosynthesis of reduced polyketides. Nature Reviews Microbiology 3 (12), 925. Wongputtisin, P., Khanongnuch, C., Pongpiachan, P., Lumyong, S., 2007. Antioxidant activity improvement of soybean meal by microbial fermentation. Research Journal of Microbiology 2, 577e583. Wu, J., Aluko, R.E., Nakai, S., 2006. Structural requirements of angiotensin I-converting enzyme inhibitory peptides: quantitative structure activity relationship study of di-and tripeptides. Journal of Agricultural and Food Chemistry 54 (3), 732e738. Wu, K.Y., Huang, S.H., Ding, S., Zhang, Y.K., Chen, G.G., Liang, Z.Q., 2010. Expression, purification and characterization of recombinant a-glucosidase in Pichia pastoris. Folia Microbiologica 55 (6), 582e587. Wu, S., Feng, X., Lan, X., Xu, Y., Liao, D., 2015. Purification and identification of AngiotensinI Converting Enzyme (ACE) inhibitory peptide from lizard fish (Saurida elongata) hydrolysate. Journal of Functional Foods 13, 295e299.

314

Functional and Preservative Properties of Phytochemicals

Xia, Y., Bamdad, F., G€anzle, M., Chen, L., 2012. Fractionation and characterization of antioxidant peptides derived from barley glutelin by enzymatic hydrolysis. Food Chemistry 134 (3), 1509e1518. Xue, Q., Ashley, G., Hutchinson, C.R., Santi, D.V., 1999. A multiplasmid approach to preparing large libraries of polyketides. Proceedings of the National Academy of Sciences 96 (21), 11740e11745. Yadav, M.K., Kumar, V., Singh, B., Tiwari, S.K., 2017. Phospholipid/polydiacetylene vesiclebased colorimetric assay for high-throughput screening of bacteriocins and halocins. Applied Biochemistry and Biotechnology 182 (1), 142e154. Yan, Q., Hao, S., Jiang, Z., Zhai, Q., Chen, W., 2009. Properties of a xylanase from Streptomyces matensis being suitable for xylooligosaccharides production. Journal of Molecular Catalysis B: Enzymatic 58 (1e4), 72e77. Yan, T.R., Chiou, R.D., 1996. Catalytic properties of a transglucosidase from Aspergillus niger CCRC 31494. Biotechnology Letters 18 (5), 553e558. Yanahira, S., Kobayashi, T., Suguri, T., Nakakoshi, M., Miura, S., Ishikawa, H., Nakajima, I., 1995. Formation of oligosaccharides from lactose by Bacillus circulans b-galactosidase. Bioscience, Biotechnology, and Biochemistry 59 (6), 1021e1026. Yang, H., Wang, Y., Zhang, L., Shen, W., 2016. Heterologous expression and enzymatic characterization of fructosyltransferase from Aspergillus niger in Pichia pastoris. New biotechnology 33 (1), 164e170. Yao, J., Fan, X.J., Lu, Y., Liu, Y.H., 2011. Isolation and characterization of a novel tannase from a metagenomic library. Journal of Agricultural and Food Chemistry 59, 3812e3818. Yao, J., Chen, Y., Wang, N., Jiang, D., Zheng, J., 2014. Lipid A-based affinity biosensor for screening anti-sepsis components from herbs. Bioscience Reports 34 (3), e00109. Yu, Z., Yin, Y., Zhao, W., Liu, J., Chen, F., 2012. Anti-diabetic activity peptides from albumin against a-glucosidase and a-amylase. Food Chemistry 135 (3), 2078e2085. Yun, J.W., Jung, K.H., Oh, J.W., Lee, J.H., 1990. Semibatch production of fructooligosaccharides from sucrose by immobilized cells of Aureobasidium pullulans. Applied Biochemistry and Biotechnology 24 (1), 299e308. Zambrowicz, A., Pokora, M., Setner, B., Dąbrowska, A., Szołtysik, M., Babij, K., Szewczuk, Z., Trziszka, T., Lubec, G., Chrzanowska, J., 2015. Multifunctional peptides derived from an egg yolk protein hydrolysate: isolation and characterization. Amino Acids 47 (2), 369e380. Zeng, W.C., Zhang, W.H., He, Q., Shi, B., 2015. Purification and characterization of a novel antioxidant peptide from bovine hair hydrolysates. Process Biochemistry 50 (6), 948e954. Zhang, H., Yokoyama, W.H., Zhang, H., 2012. Concentration-dependent displacement of cholesterol in micelles by hydrophobic rice bran protein hydrolysates. Journal of the Science of Food and Agriculture 92 (7), 1395e1401. Zhang, L., An, R., Wang, J., Sun, N., Zhang, S., Hu, J., Kuai, J., 2005. Exploring novel bioactive compounds from marine microbes. Current Opinion in Microbiology 8, 276e281. Zhang, L., Su, Y., Zheng, Y., Jiang, Z., Shi, J., Zhu, Y., Jiang, Y., 2010. Sandwich-structured enzyme membrane reactor for efficient conversion of maltose into isomaltooligosaccharides. Bioresource Technology 101 (23), 9144e9149. Zhang, Y., Chen, R., Zuo, F., Ma, H., Zhang, Y., Chen, S., 2016. Comparison of dipeptidyl peptidase IV-inhibitory activity of peptides from bovine and caprine milk casein by in silico and in vitro analyses. International Dairy Journal 53, 37e44. Zhang, Y.K., Li, W., Wu, K.Y., Chen, G.G., Liang, Z.Q., 2011. Purification and characterization of an intracellular a-glucosidase with high transglycosylation activity from A. niger M-1. Preparative Biochemistry & Biotechnology 41 (2), 201e217.

Biotechnology: a tool for synthesis of novel bioactive compounds

315

Zhao, Q., Piot, J.M., 1997. Investigation of inhibition angiotensin-converting enzyme (ACE) activity and opioid activity of two hemorphins, LVV-hemorphin-5 and VV-hemorphin-5, isolated from a defined peptic hydrolysate of bovine haemoglobin. Neuropeptides 31 (2), 147e153. Zhao, L., Cai, X., Huang, S., Wang, S., Huang, Y., Hong, J., Rao, P., 2015. Isolation and identification of a whey protein-sourced calcium-binding tripeptide Tyr-Asp-Thr. International Dairy Journal 40, 16e23. Zhao, N., Xu, Y., Wang, K., Zheng, S., 2017. Synthesis of isomalto-oligosaccharides by Pichia pastoris displaying the Aspergillus niger a-glucosidase. Journal of Agricultural and Food Chemistry 65 (43), 9468e9474. Zhao, Q.Y., Sannier, F., Garreau, I., Guillochon, D., Piot, J.M., 1994. Inhibition and inhibition kinetics of angiotensin converting enzyme activity by hemorphins, isolated from a peptic bovine hemoglobin hydrolysate. Biochemical and Biophysical Research Communications 204 (1), 216e223. Zheng, H.C., Sun, M.Z., Meng, L.C., Pei, H.S., Zhang, X.Q., Yan, Z., Zeng, W.H., Zhang, J.S., Hu, J.R., Lu, F.P., Sun, J.S., 2014. Purification and characterization of a thermostable xylanase from Paenibacillus sp. NF1 and its application in xylooligosaccharides production’. Journal of Microbiology and Biotechnology 24 (4), 489e496. Zhu, K.X., Wang, X.P., Guo, X.N., 2015. Isolation and characterization of zinc-chelating peptides from wheat germ protein hydrolysates. Journal of Functional Foods 12, 23e32. Zipperer, A., Konnerth, M.C., Laux, C., Berscheid, A., Janek, D., Weidenmaier, C., Burian, M., Schilling, N.A., Slavetinsky, C., Marschal, M., Willmann, M., 2016. Human commensals producing a novel antibiotic impair pathogen colonization. Nature 535, 511e516. Zou, T.B., He, T.P., Li, H.B., Tang, H.W., Xia, E.Q., 2016. The structure-activity relationship of the antioxidant peptides from natural proteins. Molecules 21 (1), 72. Zvanych, R., Lukenda, N., Kim, J.J., Li, X., Petrof, E.O., Khan, W.I., Magarvey, N.A., 2014. Small molecule immunomodulins from cultures of the human microbiome member Lactobacillus plantarum. Journal of Antibiotics 67, 85e88.

Further reading Minunni, M., Tombellia, S., Mascinia, M., Biliab, A., Bergonzib, M.C., Vincierib, F.F., 2005. An optical DNA-based biosensor for the analysis of bioactive constituents with application in drug and herbal drug screening. Talanta 65 (2), 578e585.

This page intentionally left blank

Prospects of omics technologies and bioinformatics approaches in food science

10

Bhanu Prakash, Prem Pratap Singh, Akshay Kumar, Vishal Gupta Centre of Advanced Study in Botany, Institute of Science, Banaras Hindu University, Varanasi, Uttar Pradesh, India

1. Introduction In today’s world, the consumers’ demands for safe, healthy, and nutritious food products with minimal synthetic preservatives is increasing day by day. As per an estimate by the World Health Organization (2019), approximately 600 million people are suffering from foodborne illnesses worldwide, associated with 420,000 deaths every year (Hoffmann et al., 2017). Thus, ensuring food safety and quality is an emerging task for food scientists, regulatory authorities, and the food industry worldwide. However, before reaching the consumer’s plate food commodities have to travel different stages such as harvesting, transportation, storage, processing, and distribution during which they are prone to attack by a variety of insect pests, microbes, and oxidative deterioration that significantly deteriorate the quality of product and also have a negative effect on consumers’ health. The various intrinsic (bioactive compounds, nutrient, pH, water activity (aw)) and extrinsic factors (gaseous composition, temperature, and microorganisms) of food ecosystem influence the growth of pathogenic microbes. The currently available methods of preservation, identification of biological contaminants, and their associated risks are insufficient, expensive, and have their own limitations. In this context, the recent advances in omics sciences (genomics, transcriptomics, proteomics, and metabolomics) could be used for systematic investigation for the detection, prevention, and control of foodborne microbes, toxins, and to understand the mechanism of action of bioactive compounds at the molecular level. Therefore, in the past few years the foodomics (an integration of different omics technologies), the omics concept in the food science, has been paid considerable attention by the industries and regulatory authorities to overcome the major issues related to food bioactivity, safety, quality, and traceability (Cifuentes, 2017). It provides a holistic overview of overall quality and components present in the food (foodome). The use of foodomics approaches such as genomics, transcriptomics, proteomics, and metabolomics can unveil the molecular mechanism of gene expression, RNA, protein, and metabolites in relation with the bioactivity/safety/quality of food (Cifuentes, 2017). In the past few years, bioinformatics, which deals with the interpretation of biological data using computational approach, has made significant progress in the field of

Functional and Preservative Properties of Phytochemicals. https://doi.org/10.1016/B978-0-12-818593-3.00010-5 Copyright © 2020 Elsevier Inc. All rights reserved.

318

Functional and Preservative Properties of Phytochemicals

food science and nutrition. The bioinformatics tools can successfully manage and interpret the data obtained from “foodomics” technologies in relation to taste, flavor, safety, and food quality (Holton et al., 2013). The information generated through the effective combination of these approaches can explore and characterize the functional genes, proteins, and metabolite products-related response to the biological functioning of specific molecules. Furthermore, it also improves the knowledge about the role of particular food ingredients (preservative and nutritional agent) at molecular level, deciphering their interaction with targeted genes and their effect on proteins and metabolites products that could be helpful for designing effective products that possess preservative and functional potential. Thus, the integration of foodomics approaches and bioinformatics could successfully improve the quality and functionality aspect of food and also provide the mechanistic overview of the possible interaction between food and biological systems. The present chapter provides an overview of various foodomics and bioinformatics approaches in the field of food science. In addition, the role of bioinformatics to investigate the targeted gene related to antimicrobial and functional properties of phytochemicals has also been discussed.

2.

Foodomics: omics in the field of food science and nutrition

In the modern era, the consumers prefer safe and healthy food that not only satisfies hunger but also boosts the body’s health. Therefore, there is a strict need for rapid identification technique of all possible hazardous contaminants present in the food and their negative effect on food ingredients, nutrients, and consumers’ health. Hence, in the past few years, the interest of the scientific community in foodomics (a new discipline of science that studies the functional and nutritional aspect of food through the combined approach of advanced omics technologies) has been considerably increased (Alvarez-Rivera et al., 2018). The omics approaches (genomics, transcriptomics, proteomics, and metabolomics) can provide the information and adequate data to tackle the problem associated with food safety in a rational way. Genomics study deals with the study of the gene, their expression, and function. It can provide detailed genetic information about the biological contaminants present in the food and their shelved products. Due to the advent of modern, cutting-edge genomics technologies, such as next-generation sequencing technologies (whole-genome sequencing), the cost and time required for the study of the microbial genome are reduced. The whole-genome sequencing approach could be used for the inspection, monitoring, rapid identification, and studying outbreak of foodborne pathogens based on a genetic blueprint with the preventive step for the future outbreaks (World Health Organization, 2019). Further, in a way to develop a novel plant-derived pharmaceutical product, investigation of its biosynthetic pathway is equally significant to the exploration of its mechanism of action. Therefore, identification of functional genes involved in the biosynthetic pathway of secondary metabolite product must be elucidated. The genomic study provides the information about the origin, development,

Prospects of omics technologies and bioinformatics approaches in food science

319

chemodiversity of the plant. The recent advancement in sequencing technologies such as high-throughput sequencing, restriction-site associated DNA sequencing, genotyping by sequencing of medicinal plants may elaborate the biosynthetic mechanisms of secondary metabolite production by the plant that could be used as functional and preservative agent (Boutanaev et al., 2015; Hao and Xiao, 2015; Mehta and Hasija, 2018). The molecular mechanism of synthesis of bioactive compound such as ursolic acid, luteolin, apigenin, taxol, oleanolic acid, sitosterol, and eugenol possess anticancer properties related to mutation of amino acid present at the loci of genes in Ocimum tenuiflorum plant, which has been explored by the sequencing of the entire genome (Upadhyay et al., 2015). Ayub et al. (2014) explored the antimicrobial activity of plant peptide (alfalfa snakin-1 (MsSN1)) and characterized the function gene involved in antimicrobial action using the genomics. Alagoz et al. (2016) implemented the CRISPR/Cas9-associated9 (Cas9) endonuclease system, the potent RNA-guided genome editing tool to knock out the 40 OMT2 gene to decipher its role in metabolism and biosynthesis of benzylisoquinoline alkaloids (BIAs) in Papaver somniferum L. Transcriptomics study deals with the study of the transcriptome (the complete set of RNA transcripts produced by the genome). The comparison of transcriptomes allows to decipher the expression of genes responsible for resistance/tolerance against the adverse environmental conditions, synthesis of biologically active compounds, nutrients, toxin production, biofilms formation, and the response of microbes against physical, chemical, or biological stress (Mehta and Hasija, 2018). Different highthroughput techniques such as Serial Analysis of Gene Expression, Massive Parallel Signature Sequencing, RNA-Seq techniques, Next-generation sequencing (NGS) technologies, and Microarray have been used to study the transcribed sequences to understand the biological mechanism related to food spoilage and biofilm formation (Bergholz et al., 2014; Lowe et al., 2017). Visvalingam et al. (2013) studied the transcriptional response of E. coli O157:H7 exposed to the cinnamaldehyde and reported that after initial response to oxidative stress within a short period of time pathogen was able to overcome the antimicrobial effect by converting cinnamaldehyde to cinnamic alcohol. Stasiewicz et al. (2011) reported the change in the transcriptome of Listeria monocytogenes exposed to individual and combined treatment of lactate and diacetate was related to shifting in fermentation pathway and production of acetoin resulting in reduced growth rate. Edmunds et al. (2012) reported that antiinflammatory activity of kiwifruit extract is related to the expression of genes involved in immune signaling pathways and metabolic processes in the colon using microarray technique Agilent (Cy3, Cy5). Valdés et al. (2012) studied the effect of rosemary polyphenols on leukemia cell lines through Affymetrix microarray analysis and reported that extract exhibited both cytotoxic and cytostatic activity (to a lesser extent) against the cell lines K562. The biosynthesis pathway of the gene responsible for the synthesis of medicinally important phytochemicals such as vinblastine, taxol, curcumin, and withanolides has been explored by the study of transcriptomes (Mehta and Hasija, 2018). McLoughlin et al. (2004) reported the genes involved in the antitumor activity of catechins using human HT 29 colon carcinoma cells through high density oligonucleotide microarrays technique. Vaccaro et al. (2017) reported the overexpression of genes in response to a mixture of methyl jasmonate and coronatine, which involve the

320

Functional and Preservative Properties of Phytochemicals

biosynthesis of bietane diterpene (aethiopinone) in Salvia sclarea hairy roots using qRT-PCR and transcriptomic tools. Xu et al. (2015) employed genomic tools, viz. nextgeneration sequencing (NGS) and single molecule real time (SMRT) sequencing along with transcriptomic analysis to elucidate the complete biosynthetic pathway involved in the synthesis of tanshinone compound (antitumor agent) from the root tissues of Salvia miltiorrhiza. Proteomics study deals with the qualitative and quantitative comparison of proteomes (protein in complement to a genome) expressed in a biological system at different environmental conditions at a particular time. The study provides the mechanistic overview on biochemical and physiological changes at the molecular level expressed due to the effect of the biological contaminant and environmental stress (Bendexin et al., 2011). In food science, proteomics approach provides a brief account on protein structure, expression, function, and interaction with other bioactive components in the food matrix (Carbonaro, 2004). The technique could be used as a biomarker for identification of foodborne pathogenic microbes such as bacteria and molds based on their specific proteins and metabolites products. Traditionally, gel electrophoresis (two-dimensional, one-dimensional, and multidimensional gel electrophoresis) and immunoassays have been used by the industries to identify the allergic agent in the food and its authenticity. However, the recent advanced technologies such as mass spectrometric methods, viz. MALDI-TOF and LCeMS can detect the expression of specific protein that give an idea about the quality of product and also the possible contaminant and their effect to the health. Currently, a large number of web tools such as MOWSE, ProFound, MASCOT, FASTA Search Programs, and FindMod are available related to peptide mass mapping, protein and nucleotide database searching and sequencing, posttranslational modification of protein (Carbonaro, 2004). Bovine alpha 1 casein (major cow’s milk allergen), a peptide found in maternal milk, was identified as a possible cause of allergic sensitization in exclusively breastfed infants (Orru et al., 2013). The biological properties of curcumin such as antioxidant, antineoplastic, antiangiogenic, and anticancer and its derivatives have been explored by the expression study of protein (Fang et al., 2011). Manavalan et al. (2012) reported that the neuroprotective capacities of Gastrodia elata Blume (tianma) was related to inhibition of stress-proteins, activation of neuroprotective genes (viz. Nxn, Dbnl, Mobkl3, etc.) using isobaric tags for relative and absolute quantitation (iTRAQ) and LC-MS methods. The peanut allergens (Ara h1 to h8) in food have been detected from the food based on presence of peanut proteins or the DNA fragments encoding peanut allergens using protein/DNA-based methods (Koppelman et al., 1999a,b). Among all omics approaches, the metabolomics study has a significant impact on food safety, since the metabolite production by the organism is influenced by the intrinsic and extrinsic environmental condition that may have a negative effect on overall quality and acceptability of food product. Thus, nowadays food scientists widely use the metabolomic approaches to characterize a large number of toxic metabolite products present in the food. Metabolomics study deals with the quantification of the complete set of metabolites (metabolome) produced inside the cell or biological sample under the different environmental/physiological/genetic modification.

Prospects of omics technologies and bioinformatics approaches in food science

321

Metabolomics study is used to identify and quantify the small molecules (