Emerging Human Viral Diseases, Volume I: Respiratory and Haemorrhagic Fever 9819928192, 9789819928194

Citation preview

Prudhvi Lal Bhukya Suhas T. Mhaske Subash C. Sonkar   Editors

Emerging Human Viral Diseases, Volume I Respiratory and Haemorrhagic Fever

Emerging Human Viral Diseases, Volume I

Prudhvi Lal Bhukya • Suhas T. Mhaske • Subash C. Sonkar Editors

Emerging Human Viral Diseases, Volume I Respiratory and Haemorrhagic Fever

Editors Prudhvi Lal Bhukya Vaccine Testing Laboratory, Rodent Experimentation Facility ICMR-National Animal Facility Resource Facility for Biomedical Research Hyderabad, Telangana, India

Suhas T. Mhaske Vaccine Testing Laboratory, Rodent Experimentation Facility ICMR-National Animal Facility Resource Facility for Biomedical Research Hyderabad, Telangana, India

Subash C. Sonkar Multidisciplinary Research Unit (MRU) Maulana Azad Medical College and Associated Hospitals New Delhi, Delhi, India

ISBN 978-981-99-2819-4 ISBN 978-981-99-2820-0 https://doi.org/10.1007/978-981-99-2820-0

(eBook)

# The Editor(s) (if applicable) and The Author(s), under exclusive license to Springer Nature Singapore Pte Ltd. 2023 This work is subject to copyright. All rights are solely and exclusively licensed by the Publisher, whether the whole or part of the material is concerned, specifically the rights of translation, reprinting, reuse of illustrations, recitation, broadcasting, reproduction on microfilms or in any other physical way, and transmission or information storage and retrieval, electronic adaptation, computer software, or by similar or dissimilar methodology now known or hereafter developed. The use of general descriptive names, registered names, trademarks, service marks, etc. in this publication does not imply, even in the absence of a specific statement, that such names are exempt from the relevant protective laws and regulations and therefore free for general use. The publisher, the authors, and the editors are safe to assume that the advice and information in this book are believed to be true and accurate at the date of publication. Neither the publisher nor the authors or the editors give a warranty, expressed or implied, with respect to the material contained herein or for any errors or omissions that may have been made. The publisher remains neutral with regard to jurisdictional claims in published maps and institutional affiliations. This Springer imprint is published by the registered company Springer Nature Singapore Pte Ltd. The registered company address is: 152 Beach Road, #21-01/04 Gateway East, Singapore 189721, Singapore

I devote this little book to my wife Lavanya, my little daughter Nievi, my teachers, and my Mother and father Bharathi Bhukya and Balaji Bhukya. This book is also dedicated to families of COVID-19 survivor and warriors. Dr. Prudhvi Lal Bhukya

Foreword

One of the most dramatic aspects of infectious agents are emergence and re-emergence of new viral diseases, which often receive widespread attention from the scientific and healthcare community and the lay public. Considering that the discipline of zoonotic virology was established over 110 years ago, it may seem surprising that new virus diseases are still being discovered. How this happens, the mode of transmission, and infection including management is the subject of this book. There are many books and reviews in public domains that listed in the plethora of determinants that can lead to the emergence of infections-causing viruses. In this book, Volume-I is specially given in three different modules and it is characterised as (1) Emerging Respiratory Viral diseases, (2) Haemorrhagic Fever Viral Infections, and (3) Laboratory Diagnosis of Viral Infections. In these three modules, we concentrate on modules-specific determinants that relate to viral pathogenesis, pathobiology, mode of transmission, reservoir, high-risk populations and deal in details with the many societal and environmental factors that can be instrumental in disease emergence. Even in some instances, the “emergence” of a viral disease represents the first identification of the cause of a well-recognised disease. It appears that the emergence of this “new” disease reflected only the newfound ability to identify this etiologic entity, rather than any true change in its occurrence. On occasion, a virus that is already widespread in a population can emerge as a cause of epidemic or endemic disease, due to an increase in the ratio of cases to infections. Such an increase can be caused by either an increase in host susceptibility or enhancement of the virulence of the virus. Although counterintuitive, there are some dramatic instances of such phenomena. Although difficult to document in a rigorous manner, it does appear that new virus diseases of humans (and perhaps of other species) are emerging at an increased tempo, even we can say there are a various number of reasons for this trend and no uniform confounders. One of the most exciting current issues in emerging virology is the emergence of new viral diseases of humans discussed including laboratory diagnostics. As we know emergent viruses are identified using both classical methods of virology and newer genome-based technologies, we discussed in this volume. Even, we emphasise research evidences-based module, as example, reader understand theme like, once a candidate virus has been identified, a causal relationship to a disease requires several lines of evidence. In this module, we also highlighted real-time concern vii

viii

Foreword

being virologist faced and discussed with the case examples like, even though the era of modern virology has been well established for more than 65 years, virus diseases continue to appear or re-emerge. With the experience what we learn during the Ebola pandemic of 2014–2015 highlights the associated dangers and obstacles to control. There are many reasons for the apparent increase in the frequency of emergence of new virus diseases, most of which can be traced to human intervention in global ecosystems. Many Experts Reviews, Guidelines also updated periodically with time and as per requirements as the science of virology evolves. Identifying, analysing, and controlling emerging viruses involve many aspects of virological science. As we know, virus–host interactions play a key role to explain persistence in zoonotic reservoirs, transmission across the species barrier, and establishment in human hosts. Thus, the issues discussed in many other chapters contribute to our understanding of emerging viral diseases. Here in this book and volumes, readers will benefit with understanding of emerging to remerging including uniform SOPs for management of emerging viral infections.

Preface

This book illustrates the relevance of Emerging Human Viral Diseases offering updated research information on recent emerging viral pathogens and their impact on global public health. It provides information on certain infectious human and animal viruses that cause potentially life-threatening respiratory, encephalitis, and haemorrhagic infections. The book also reflects the thorough compilation of the factors contributing to the emergence and re-emergence of viruses, rapid diagnostics, therapeutic and computational bioinformatics tools to combat and clearly understand transmission and emergence of viral pathogens. This book not only summarises the factors favouring the emergence of novel viruses, biosafety measures of public, and healthcare workers but also highlights the global health and economic burden due to emerging viral outbreaks. It offers a piece of valuable information and updates to undergraduates, graduates, medical professionals, clinical researchers, social and basic scientists about preventing, controlling, and biosafety measures in combating emerging novel viral pathogens. This book not only creates an awareness of the emerging virus and the global impact of emerging viral outbreaks but also highlights a comprehensive yet a representative description of a large number of challenges associated with the emerging biological pandemic. We acknowledge ICMRNational Animal Resource Facility for Biomedical Research (ICMR-NARFBR) and all the contributors for all the support. Hyderabad, Telangana, India Hyderabad, Telangana, India New Delhi, Delhi, India

Dr. Prudhvi Lal Bhukya, Ph.D Dr. Suhas T. Mhaske, Ph.D Dr. Subash C. Sonkar, Ph.D

ix

Contents

Part I

Emerging Respiratory Viral Diseases

1

Factors Contributing to the Emergence of Viral Diseases . . . . . . . . Abhranil Gangopadhayya and Prudhvi Lal Bhukya

3

2

An Updated Review on Influenza Viruses . . . . . . . . . . . . . . . . . . . . Unnati Bhalerao, Anil Kumar Mavi, Shivani Manglic, Sakshi, Srijita Chowdhury, Umesh Kumar, and Vishwajeet Rohil

71

3

Avian Influenza: A Potential Threat to Human Health . . . . . . . . . . 107 Mansi Kumari, Anil Kumar Mavi, Umesh Kumar, and Unnati Bhalerao

4

2019 Novel Coronavirus . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 133 Anita Garg Mangla, Neeru Dhamija, and Daman Saluja

5

Severe Acute Respiratory Syndrome Associated Corona Virus [SARS-CoV] . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 157 P. S. Akshay, S. Manasa Veena, Korra Bhanu Teja, and Shilpa J. Tomar

6

Middle East Respiratory Syndrome Coronavirus (MERS-CoV) . . . 189 Aishwarya Bhatta, Sunanda Sahoo, Korra Bhanu Teja, and Shilpa J. Tomar

7

Respiratory Syncytial Virus . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 209 Sonal Mahilkar

8

Human Bocavirus . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 227 Muskan Chakraborty and Prudhvi Lal Bhukya

9

Measles: The Disease That Refuses to Be Vanquished . . . . . . . . . . . 247 Aparna Talekar and Matteo Porotto

Part II 10

Haemorrhagic Fever Viral Infections

Viral Haemorrhagic Fevers . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 279 Abhranil Gangopadhayya and Prudhvi Lal Bhukya xi

xii

Contents

11

Emerging Arboviral Infections . . . . . . . . . . . . . . . . . . . . . . . . . . . . 303 G. Sai Lakshmi, Rizwana Syed, L. Preethi, Prudhvi Lal Bhukya, and Suhas T. Mhaske

12

Dengue Haemorrhagic Fever: A Resurgent Arbovirosis in Humans . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 315 Unnati Bhalerao, L. Preethi, Prudhvi Lal Bhukya, and Suhas T. Mhaske

13

Crimean-Congo Haemorrhagic Fever Virus: A Complete Overview . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 345 Mansi Kumari, Bhupender Sahu, Janvi Sharma, Khalid Umar Fakhri, and Umesh Kumar

14

Ebola Virus Disease: An Emerging Lethal Disease in Africa . . . . . . 355 Arindam Mitra, Rajoni Samadder, Asmita Mukhopadhyay, Moutusi Mistry, and Anusua Roy

15

Hantaviruses as Emergent Zoonoses: A Global Threat . . . . . . . . . . 377 Chayna Singha Mahapatra

16

Kyasanur Forest Disease: A Neglected Zoonotic Disease of India . . 401 Himanshu Kaushal, Shalini Das, Ramesh S. Kartaskar, Mahesh M. Khalipe, and Tushar Chiplunkar

17

An Imminence to Humans and Animals: The Rift Valley Fever Virus . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 419 Aparna Kalyanaraman, L. Preethi, and Prudhvi Lal Bhukya

18

Yellow Fever: An Old Scourge with New Threats . . . . . . . . . . . . . . 443 Nitali Tadkalkar

19

Lassa Fever: An Emerging Immunodeficiency and Oncogenic Viral Infection . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 459 Priya Singh, Anubhuti Sharma, and Prudhvi Lal Bhukya

20

Lujo Hemorrhagic Fever . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 467 Alka and Archana Bharti Sonkar

21

Chapare Hemorrhagic Fever . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 495 Archana Bharti Sonkar and Alka

22

Bas-Congo Tibrovirus . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 515 Jithin S. Sunny, M. Jeevan Kumar, Sambrinath Christopher, Archana Vishwakarma, Ramya Mohandass, and Lilly M. Saleena

Contents

Part III

xiii

Laboratory Diagnosis of Viral Infections

23

Rapid Diagnostic of Emerging Human Viral Pathogens: Lessons Learnt From COVID-19 Pandemic . . . . . . . . . . . . . . . . . . 527 Mansi Chadha, Shivani Sood, Dhirendra Kumar, L. Preethi, and Mahesh Shankar Dhar

24

Novel Diagnostic Methods for Emerging Respiratory Viral Infection . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 565 Sakshi, Anil Kumar Mavi, Srijita Chowdhury, Neelesh Kumar, Pooja Singh, Dheeresh Kumar, L. Preethi, and Umesh Kumar

25

Evolution of Viral Diagnostics: A Peek into Time . . . . . . . . . . . . . . 587 Geetika Arora, Shreya Gupta, and Daman Saluja

Editors and Contributors

About the Editors Prudhvi Lal Bhukya is a Virologist currently serving at Indian Council of Medical Research (ICMR)National Animal Resource Facility for Biomedical Research (NARFBR), Hyderabad, as a Scientist. Presently, he is heading Vaccine Testing Facility at NARFBR. His area of working includes preclinical vaccinology studies, host–viral interaction studies of emerging human viral infections and Prevention and Control of Diseases and the development of tools to prevent outbreaks. He has done his PhD from ICMRNational Institute of Virology–Pune on human hepatitis B virus (HBV). He proved his credentials by working on HBV and HEV with his publication record. He has presented his work in numerous national and international conferences. He has proved his accolades with several publications in International Journals like Journal of General Virology, Journal of Virology, Journal of Travel Medicine, Indian Journal of Medical Microbiology, and Science of Total Environment. He is a wellexperienced manuscript writer and has contributed to several book chapters as an author for publication bodies like Springer Nature, CRC-Press, IntechOpen, IGI Global Publications, etc. His contribution for these books as an Editor will act as catalyst as his comments are really critical and an achievement for the book.

xv

xvi

Editors and Contributors

Suhas T. Mhaske is currently employed as a Scientist at ICMR-NARFBR, Hyderabad. He received both his graduation and post-graduation in Biotechnology from the University of Pune. He has carried out his doctoral research in Osteo-immunology at DBT-National Centre for Cell Science, Pune. Virology, vaccine immunology, stem cells, and tissue engineering are some areas of his scientific interest. He formerly worked in different eminent institutes including ICMR-NIV, SPPU-Institute of Bioinformatics and Biotechnology, and BVDUInteractive Research School for Health Affairs (IRSHA). He has several publications in prestigious international journals, including Science Advances, Journal of Immunology, Frontiers in Public Health, Nanomedicine, Archives of Virology, Infection, etc. and reviewed articles for Frontiers and Journal of Tropical Paediatrics. He has contributed to several book chapters published in Springer Nature and IntechOpen. Subash Chandra Sonkar currently working as a Sr. Scientist at Maulana Azad Medical College and Associated Hospital New Delhi, India. He worked as an ex-Consultant cum Technical Advisor implementation in the National Mental Health Program at Indian Council of Medical Research. And Ex-Principal Investigator on NIH-funded project affiliated with Florida International University in collaboration with Public Health Research Institute of India. He is an internationally renowned translational research professional and an Assay Development Scientist with demonstrated history of working in the field of clinical microbiology of infectious diseases, sexually transmitted infections, public health and research industry, and a molecular biologist per se.

Contributors P. S. Akshay Hepatitis Division, ICMR-National Institute of Virology, Pune, India Alka Department of Pharmaceutical Sciences, Babasaheb Bhimrao Ambedkar University (A Central University), Lucknow, India Geetika Arora Dr. B. R. Ambedkar Center for Biomedical Research, University of Delhi, Delhi, India

Editors and Contributors

xvii

Unnati Bhalerao Department of Biology, Indian Institute of Science Education and Research Pune, Pune, Maharashtra, India Aishwarya Bhatta Indian Institute of Technology, Delhi, India Prudhvi Lal Bhukya Vaccine Testing Laboratory, Rodent Experimentation Facility, ICMR-National Animal Facility Resource Facility for Biomedical Research, Hyderabad, Telangana, India Muskan Chakraborty Department of Microbiology, Deccan Education Society’s Fergusson College, Pune, Maharashtra, India Tushar Chiplunkar Taluka Health Office, Sindhudurg, Maharashtra, India Srijita Chowdhury Department of Biotechnology, Heritage Institute of Technology, Kolkata, West Bengal, India Sambrinath Christopher Department of Biotechnology, SRM Institute of Science and Technology, Kattankulathur, Tamil Nadu, India Shalini Das ICMR-National Institute of Virology, Pune, India Neeru Dhamija Department of Biochemistry, Daulat Ram College, University of Delhi, Delhi, India Khalid Umar Fakhri School of Biosciences, Institute of Management Studies Ghaziabad (University Courses Campus), Ghaziabad, Uttar Pradesh, India Abhranil Gangopadhayya Medical Entomology and Zoology Group, ICMRNational Institute of Virology, Pune, Maharashtra, India Shreya Gupta Dr. B. R. Ambedkar Center for Biomedical Research, University of Delhi, New Delhi, Delhi, India Aparna Kalyanaraman Department of Biotechnology, Dr. M.G.R. Educational and Research Institute, Kattankulathur, Tamil Nadu, India Ramesh S. Kartaskar Taluka Health Office, Sindhudurg, Maharashtra, India Himanshu Kaushal ICMR-National Institute of Virology, Pune, India Mahesh M. Khalipe District Health Office, Sindhudurg, Maharashtra, India Dheeresh Kumar Department of Pulmonary Medicine, Vallabhbhai Patel Chest Institute, University of Delhi, New Delhi, Delhi, India M. Jeevan Kumar Department of Genetic Engineering, SRM Institute of Science and Technology, Kattankulathur, Tamil Nadu, India Neelesh Kumar Department of Biotechnology, Delhi Technological University, New Delhi, Delhi, India

xviii

Editors and Contributors

Umesh Kumar School of Biosciences, Institute of Management Studies Ghaziabad (University Courses Campus), Ghaziabad, Uttar Pradesh, India Department of Biosciences, Jamia Millia Islamia, New Delhi, India Mansi Kumari Dr. D. Y. Patil Biotechnology & Bioinformatics Institute, Pune, Maharashtra, India Chayna Singha Mahapatra Veterinary Microbiology, ICAR-Indian Veterinary Research Institute, Bareilly, Uttar Pradesh, India Sonal Mahilkar Department of Dentistry, Government Medical College and Hospital, Mahasamund, Chhattisgarh, India Anita Garg Mangla Department of Biochemistry, Daulat Ram College, University of Delhi, Delhi, India Shivani Manglic Department of Biotechnology, Jaypee Institute of Information and Technology, Noida, Uttar Pradesh, India Anil Kumar Mavi Department of Pulmonary Medicine, Vallabhbhai Patel Chest Institute University of Delhi, Delhi, India Suhas T. Mhaske Vaccine Testing Laboratory, Rodent Experimentation Facility, ICMR-National Animal Facility Resource Facility for Biomedical Research, Hyderabad, Telangana, India Moutusi Mistry Department of Biological Sciences, School of Life Science and Biotechnology, Adamas University, Kolkata, India Department of Microbiology, Amity Institute of Microbial Technology, Amity University, Noida, India Arindam Mitra Department of Biological Sciences, School of Life Science and Biotechnology, Adamas University, Kolkata, India Ramya Mohandass Department of Genetic Engineering, SRM Institute of Science and Technology, Kattankulathur, Tamil Nadu, India Asmita Mukhopadhyay Department of Biological Sciences, School of Life Science and Biotechnology, Adamas University, Kolkata, India Department of Microbiology, Amity Institute of Microbial Technology, Amity University, Noida, India Matteo Porotto Center for Host-Pathogen Interaction, Department of Pediatrics, Columbia University Vagelos College of Physicians and Surgeons, New York, NY, USA Department of Experimental Medicine, University of Studies of Campania ‘Luigi Vanvitelli’, Naples, Italy L. Preethi Department of Pharmacy Practice, SRM College of Pharmacy, SRM Institute of Science and Technology, Kattankulathur, Chengalpattu, Tamil Nadu, India

Editors and Contributors

xix

Vishwajeet Rohil Department of Biochemistry, Vallabhbhai Patel Chest Institute, University of Delhi, Delhi, India Anusua Roy Department of Biological Sciences, School of Life Science and Biotechnology, Adamas University, Kolkata, India Sunanda Sahoo Indian Institute of Technology, Kharagpur, West Bengal, India Bhupender Sahu School of Biosciences, Institute of Management Studies Ghaziabad (University Courses Campus), Ghaziabad, Uttar Pradesh, India G. Sai Lakshmi Whole Genome Sequencing Lab, CCMB-Siddhartha Medical College, Vijayawada, Andhra Pradesh, India Sakshi School of Biotechnology, Gautam Buddha University, Greater Noida, Uttar Pradesh, India Lilly M. Saleena Department of Biotechnology, SRM Institute of Science and Technology, Kattankulathur, Tamil Nadu, India Daman Saluja Dr. B.R. Ambedkar Centre for Biomedical Research, Delhi School of Public Health, IoE, University of Delhi, Delhi, India Rajoni Samadder Department of Biological Sciences, School of Life Science and Biotechnology, Adamas University, Kolkata, India Department of Applied Microbiology, School of Bioscience and Technology, Vellore Institute of Technology, Vellore, India Anubhuti Sharma IQVIA, Thane, Maharashtra, India Janvi Sharma School of Biosciences, Institute of Management Studies Ghaziabad (University Courses Campus), Ghaziabad, Uttar Pradesh, India Pooja Singh Department of Respiratory Medicine, King George Medical University, Lucknow, Uttar Pradesh, India Priya Singh Department of Hepatology, Post Graduate Institute of Medical Education and Research, Chandigarh, India Archana Bharti Sonkar Department of Pharmaceutical Sciences, Babasaheb Bhimrao Ambedkar University (A Central University), Lucknow, India Jithin S. Sunny Department of Biotechnology, SRM Institute of Science and Technology, Kattankulathur, Tamil Nadu, India Rizwana Syed Department of Virology, Sri Venkateswara University, Tirupati, Andhra Pradesh, India Nitali Tadkalkar Diagnostic Virology Group, ICMR-National Institute of Virology, Pune, India Aparna Talekar Department of Microbiology, St. Xavier’s College, Mumbai, India

xx

Editors and Contributors

Korra Bhanu Teja Hepatitis Division, ICMR-National Institute of Virology, Pune, India Shilpa J. Tomar Hepatitis Division, ICMR-National Institute of Virology, Pune, India S. Manasa Veena Indian Institute of Science, Bengaluru, India Archana Vishwakarma Department of Genetic Engineering, SRM Institute of Science and Technology, Kattankulathur, Tamil Nadu, India

Part I Emerging Respiratory Viral Diseases

1

Factors Contributing to the Emergence of Viral Diseases Abhranil Gangopadhayya and Prudhvi Lal Bhukya

Abstract

Viruses evolve and adapt to conform to brand new hosts and challenges, be it environmental or manmade. These obstacles can either prevent their spillover into human populations or they can conform optimally to cause outbreaks of varying sizes among humans. It is when the outbreaks of these new, or old but poorly identified, diseases reach alarming sizes that they are classified as emerging, and are in need of attention. Specific factors can be blamed for the emergence of viral diseases in particular, which can be grouped into those the virus is intrinsically responsible for and factors that are a product of its host(s) and environments. The former includes examples such as micro- and macro-evolutionary phenomena, adaptation to new hosts, drug resistance development, new vector adaptation, pathogenicity changes and how a virus deals with host immune responses. We as humans are responsible for conforming our environs to our need, or conforming to them, and so, such factors are equally responsible for viral disease emergence. Examples of human factors would include overpopulation, travel and trade, limitations or failures in diagnostics and surveillance, inadequate containment measures, introducing exotic species along with their parasitic viruses, breaches in biosafety measures, bioterror acts, healthcare-related transmission and riskassociated behaviour. The various environmental factors bridge the human and viral ones perfectly and can be enlisted as the locations a virus exists in, human encroachment into and modifications of natural host habitats, socio-economic

A. Gangopadhayya Medical Entomology and Zoology Group, ICMR-National Institute of Virology, Pune, Maharashtra, India P. L. Bhukya (✉) Vaccine Testing Laboratory, Rodent Experimentation Facility, ICMR-National Animal Facility Resource Facility for Biomedical Research, Hyderabad, Telangana, India # The Author(s), under exclusive license to Springer Nature Singapore Pte Ltd. 2023 P. L. Bhukya et al. (eds.), Emerging Human Viral Diseases, Volume I, https://doi.org/10.1007/978-981-99-2820-0_1

3

4

A. Gangopadhayya and P. L. Bhukya

conditions, climate and vector environment changes, and non-human host population diversity and density. Therefore, the factors that determine the emergence of a viral disease and the extent of it are numerous and diverse, which are the topics that will be dealt with in this chapter. It is through the better understanding of these that we can hope to find more efficient ways of combating viral disease emergence moving forward. Keywords

Emerging disease · Viral disease · Outbreak · Epidemic · Spillover · Hosts · Healthcare

1.1

Introduction

For as long as humanity has existed, disease has been a companion in some form or the other. The basic biological needs of parasitic species compel them to utilize the bodies of other organisms for their requirements. Parasitization of organisms was only vaguely understood until some landmarks etched into history furthered the understanding of these diseased conditions, as well as what cause them. Robert Koch gave his postulates that defined the understanding of pathogenic organisms which can cause disease. Later on, these were redefined by Falkow as the molecular Koch’s postulates (Falkow 1988), describing more basic characteristics inherent of a parasitic organism/species. How humans perceive disease has changed over the decades and centuries. It has shifted from more mystical and spiritual bases of explanation to grounded scientific evidences that validate the presence of parasitic species that prey not just on humans, but also other living organisms. From the prokaryotic organisms comprised of bacteria, to the modern human of today, viruses are entities that parasitize a broad range of species. Viruses that parasitize and hijack the virus factory of other, larger viruses have also been discovered (la Scola et al. 2008). When Ivanovsky and Beijernick had first denoted the contagious, infectious fluid that was the first concept of a virus, science probably underwent a paradigm shift. Because it meant that not all parasitic species need to be necessarily alive. They could just as well be particles capable of establishing infection by means that manipulate a cell’s own machinery. This concept of infectious particles being capable of disease manifestation is being further proven in modern science through the discovery and characterization of viroids and prions. Therefore, with these varying realms and domains of infectious entities, their methods of being understood will also have to differ from one to the other. The transmission, pathogenesis, outbreak patterns, among other criteria, of bacterial or fungal diseases are different from the diseases caused by viruses. Effective treatment regimens that were used and are being used for bacterial diseases may now be met with roadblocks due to the emergence of drug-resistant strains of bacteria. Their methods of resistance development will be different from those employed by viruses. Similarly, diseases caused by viruses need not necessarily be so conspicuous, i.e., they may be ongoing at a basal

1

Factors Contributing to the Emergence of Viral Diseases

5

level in a population, as a sort of endemic occurrence, something that could be detectable only with a sufficiently well planned and organized surveillance system. So how does one understand the outbreak and spread of viral disease? Epidemiology has thankfully evolved as a science that tracks and studies the evolving patterns of disease spread throughout populations. Through the assistance of molecular biology, genetics, clinical diagnosis, serology, immunology and several other branches of biological sciences, the patterns of disease spread and emergence are now being adequately understood, and increasingly so over the past few decades. Emergence of a disease refers to the newfound occurrence of the disease for the first time or the sudden surge in the number of disease cases in an area (Johnson 2013). It is important to understand that the way we perceive disease affects how we deal with it. For example, the notion that a disease may not actually affect a person or not be fatal to them can influence the importance we give to studying them and finding ways to cure them. Certain viral diseases that may be limited or endemic to only a small geographic area may thus not be of prime importance to the general public of multiple countries at large. Coronavirus Disease—2019 (COVID-19) was not practically a concern of the general populace of several countries until it started happening in those countries. Only then did the World Health Organization (WHO) declare it as a pandemic, one that has reached incredible proportions. Similarly, several small outbreaks keep happening, those which may not affect a large number of people over large areas, but are devastating enough to warrant research and measures to be taken against them. The Chandipura virus (CHPV), for example, has not affected a relatively large number of individuals as of yet, but is responsible for a high proportion of fatalities in any of its outbreaks (Sudeep et al. 2016). Despite some outbreaks occurring on small scales presently, it may be unpredictable how and when they evolve into large-scale epidemics and, through misfortunate turns of events, into global pandemics. Therefore, the study of disease emergence is specially to develop such an understanding. Given the backdrop of human, environmental and parasite characteristics that humans have studied and understood as of today, there have been significant leaps and bounds in disease emergence study. However, there are still miles for us to tread in the road ahead. Considering the advancements that science and biology as disciplines have undergone in recent times, studying the emergence patterns of diseases have become more and more easier. To delve deep into the study of disease emergence, one needs to not only dissect the pathogen and host specifics involved, but also the anthropogenic factors or causes that are to blame for emergence of any disease. Just how one needs two hands to clap, disease emergence is as much a pathogen-caused effect as it is a human/host-caused effect. And the bridge that seals the gap between these two sides is the environment—a playground for all the bugs, bacteria, viruses, etc. to come and mingle with us humans who go on living each day, eking out our own existence and modifying the environment to varying extents when doing so. One needs to sweep aside the ignorance or concealment of knowledge and acknowledge the criteria that need dealing with to sufficiently understand what disease emergence is all about. Therefore, this chapter highlights some of the basic aspects that one needs to know for starting to understand disease emergence. The

6

A. Gangopadhayya and P. L. Bhukya

chapter also includes some introductory aspects to health and disease in general— concepts that are a pre-requisite for explaining the various factors that are involved in causing disease emergence. So, in order to understand the concepts of disease emergence, let’s begin with what a viral disease is, how disease affects society and what are the various criteria one needs to know to gauge the emergence of a viral disease.

1.1.1

Viruses and Their Host Range

A virus could be called an obligate intracellular parasite. It cannot propagate itself without parasitizing a host cell, which it does by employing various invasion routes. The reason as to why a virus cannot propagate on its own, i.e., why it does not possess the molecular machinery to multiply by itself, is a mystery that investigators are still working on. A diverse array of viruses exists in nature. From the largest ones of the order Megavirales, which include the Mimivirus and Pandoravirus, to the smallest ones of the genus Circovirus, being only 17 nm in diameter, and the Geminivirus, which has paired capsids of 15 nm diameter each. It was through the use of the T2 bacteriophage that Alfred Hershey and Martha Chase were able to delineate the basis of deoxyribonucleic acid (DNA) as the genetic material that is carried on from generation to generation (Hershey and Chase 1952). Through the use of genetic material and protein isolation, Fraenkel-Conrat and Singer were able to reconstitute infectious Tobacco Mosaic virus (TMV) from its constituent protein and genetic material parts (Fraenkel-Conrat and Singer 1964). The first ever vaccine as we know it was developed against the causative agent of smallpox, the Variola virus (VARV), when Edward Jenner used the blood from a milkmaid called Sarah Nelmes, who handled cows infected with Cowpox, originally an equine disease (Riedel 2005). Quite a few landmark biological discoveries have been made on the basis of studying viruses. The importance of exploring the viral domain is enormous, especially due to the significance it holds in changing the scenario of human disease. It is not just the human disease-causing viruses, but plant and bacterial viruses also make intriguing subjects of study, offering insights into the deep vastness of comprehending biology in general. But since viruses do not follow the general pattern of living organisms, the systems involved in their classification, nomenclature and experimentation are somewhat unique. Some of the other landmark happenings in the field of Virology are discussed further. Louis Pasteur developed the first Rabies vaccine in 1885, administering it on a young Joseph Meister (Burrell et al. 2017a). Loeffler and Frosch for the first time ultrafiltered the foot-and-mouth disease virus (FMDV), proving viral aetiology of disease and discovering the first virus. In 1918, the global Haemagglutinin 1 Neuraminidase 1 (H1N1) influenza pandemic began, to go down in history as one of the worst pandemics ever. M. Theiler, in 1931, developed the attenuated vaccine strain of the yellow fever virus (YFV), which forms the basis for vaccine development in some cases to this day. The agglutination of red blood cells (RBCs) by influenza virus particles was first found by G. Hirst in 1941, and the concept of

1

Factors Contributing to the Emergence of Viral Diseases

7

haemagglutination has since become an incredibly important basis for diagnostics and research in haemagglutinating viruses. The live attenuated poliovirus vaccine was developed by Sabin, Cox and Koprowski in 1959. In 1976, the Zaire ebolavirus (ZEBOV) was discovered, which is to this day a cause of deadly, nigh incurable illness. Temin, Baltimore and Dulbecco discovered the interaction between tumour viruses and their host cell, in effect leading to the finding of reverse transcriptase, in 1980. Smallpox was globally eradicated in 1977, a momentous achievement in Virology as well as Public Health. The human immunodeficiency virus 1 (HIV-1) was discovered by Barré-Sinnousi, Montagnier and Chermann in 1983. Chua, Lam, Bellini, Ksiazek, Eaton and colleagues discovered the Nipah henipavirus (NiV) in 1999. The Severe Acute Respiratory Syndrome Coronavirus (SARS-CoV) was discovered after an outbreak in 2003. The global Chikungunya pandemic began in the year 2005. Bats were discovered as the reservoir hosts of Ebola and Marburg viruses in the year 2005 by Leroy, Towner, Swanepoel and others. Zaki, Fouchier and Lipkin discovered the Middle East Respiratory Syndrome-related Coronavirus (MERS-CoV) in 2012. The years 2014 and 2015 saw the beginning of Ebola haemorrhagic fever and global Zika virus (ZIKV) outbreaks, respectively. Therefore, the history of Virology is dotted with some amazing and noteworthy happenings throughout the past century and beyond. Considering these in the context of Public Health and disease emergence, one can gauge how significant the study of emerging disease is, and to what lengths investigators went to make the aforementioned and numerous other discoveries. Now we shall have a look at the general features of viruses.

1.1.1.1 Classifications, Genomic Contents and Morphologies of Viruses Application of a system to designate anything makes it easier to study said thing. Just as with organisms of the Five Kingdoms, viruses have their own unique nomenclature and classification systems. Viral classification systems are of two most commonly used kinds—the International Committee on Taxonomy of Viruses (ICTV) system and the Baltimore system. 1.1.1.2 The ICTV Classification System This system aims to provide a bridge between biology and logic through the usage of taxonomy, which provides a basis for understanding evolutionary relationships among various viruses (Lefkowitz et al. 2018). In order to reconcile the gap and fill it with easily navigable information, the Virology Division of the International Union of Microbiological Societies (IUMS) lets the ICTV frame a system of developing, refining and maintaining a virus repository that is universal. Phylogenies among several categories of viruses can be understood by navigating the ICTV classification system. Seven subcommittees of the committee look after the seven groups—animal DNA viruses and retroviruses, animal double-stranded (ds) ribonucleic acid (RNA) and single-stranded (ss) RNA (negative sense) viruses, animal ssRNA (positive sense) viruses, bacterial viruses, archaeal viruses, fungal and protist viruses and plant viruses. Study groups are assembled under each subcommittee, the chairs of which are appointed by the subcommittee chair, and

8

A. Gangopadhayya and P. L. Bhukya

these groups handle updating of taxonomic information, proposals for new groups and finalization of chapters to be published in ICTV reports. The October 2020 release of ICTV describes the existence of 6 realms, 10 kingdoms, 17 phyla, 2 subphyla, 39 classes, 59 orders, 8 suborders, 189 families, 136 subfamilies, 2224 genera, 70 subgenera, 9110 species. The ICTV was first established as the ICNV, or the International Committee on the Nomenclature of Viruses, in 1966, after which it was given the name ICTV in 1974, with its first report being published in 1971 (Kuhn 2021). Previously, classification used to be on the basis of arbitrary biophysical characteristics, which have now changed to include more universal markers of viral genomes. The ICTV approached classification from the bottom rank upwards. Their initial methods included morphological, biophysical and biochemical properties of viruses, including phenotypic characters of their infection, which were decidedly subjective properties for classification. Thus, groups formed that went only up to the level of family, which remained mostly scattered and unorganized, without any connecting links among each other. A Viral Hallmark Gene (VHG) was found to be the RNA-dependent RNA polymerase (RdRp) for RNA viruses, which began being used to form a monophyletic group. A virus species was defined as “a polythetic class of viruses that constitutes a replicating lineage and occupies a particular ecological niche”, in a vein similar to how organisms of other kingdoms are described for their species. It has been further revised to become “the lowest taxonomic level in the hierarchy approved by the ICTV. A species is a monophyletic group of viruses whose properties can be distinguished from those of other species by multiple criteria”. In 2017, the method was revised to classify viruses based on coding-complete sequences, and so this opened up avenues to include viruses discovered by metagenomic analyses, since it may not be possible to culture or isolate all viruses in the laboratory. This also takes into account the morphologies of viruses, as well as other characteristics like host range, tissue tropism, etc. According to the 2020 ICTV release, there are six realms in total, which are— Adnaviria, Duplodnaviria, Monodnaviria, Riboviria, Ribozyviria and Varidnaviria. Adnaviria consists of the kingdom Zilligvirae. Duplodnaviria is composed of the kingdom Heunggongvirae. Monodnaviria has the kingdoms Loebvirae, Sangervirae, Shotokuvirae and Trapavirae. Riboviria is composed of the kingdoms Orthornavirae and Pararnavirae. Ribozyviria consists of only one family—Kolmioviridae. Varidnaviria is made up of the two kingdoms Bamfordvirae and Helvetiavirae.

1.1.1.3 The Baltimore Classification System In the journal Bacteriological Reviews, in the issue of September 1971, David Baltimore published an article on the “Expression of Animal Virus Genomes” (Baltimore 1971). In it, he described messenger RNA (mRNA) as one of the most crucial grouping criteria for all viruses. Viruses carry out only two main functions— the replication of their genetic material and the expression of their genetic information in a controlled manner. It mentioned how the previous definitions for viral systems were altered because of this concept, but the classification thus obtained was quite meaningful. This system, called the Baltimore Classification system, is a staple

1

Factors Contributing to the Emergence of Viral Diseases

9

of Virology lessons to this day, and is regarded as highly as the ICTV Classification system. Viruses having no Last Universal Common Ancestor (LUCA) specified for them, unlike cellular organisms, had seven trees of life classified according to the Baltimore system. Class I of the Baltimore system is comprised of dsDNA genome containing viruses (Baltimore 1971). Only one strand is transcribed and translated into protein, making it an asymmetric transcription event. While positive and negative strands may be assigned to these genomes, it may be meaningless as different viruses may opt to use different strands for synthesizing different species of mRNA. Class II viruses have a single strand of DNA which has the same polarity as does the mRNA it generates. As of the writing of the 1971 article by Baltimore, no virus had been described producing mRNA opposite in polarity to the ssDNA a virus has. Virions having opposing polarities of ssDNA even among the same species have been characterized, however. dsRNA viruses comprise the Baltimore class III, i.e., those which have asymmetrically synthesized RNA from their dsRNA genome acting as the mRNA. Viruses of this class are known to possess multiple segments of dsRNA each encoding for a different protein. Class IV viruses possess a single RNA strand, the mRNA of which is identical to virion RNA. Families such as Picornaviridae and Togaviridae fall into this category. It was already found back then that for Picornaviridae, the virion RNA and mRNA are identical in size and sequence. A negative sense intermediate is produced first, only after which comes the virion RNA, during genome processing. The viruses of class V have an ssRNA genome with complementary sequence to their mRNA. Information transfer occurs from an ssRNA to its complementary RNA. Rhabdoviruses and myxoviruses are part of this class. Partial replicas of the genome are made in case of some viruses, like the vesicular stomatitis virus (VSV) and Newcastle disease virus (NCDV), while multiple segments are present in some others like the influenza viruses. The class VI consists of ssRNA viruses with DNA intermediates. Back then, the DNA intermediate had not been evidenced to be present intracellularly during viral infection, and so this was only a hypothesis. The findings of RNA-dependent DNA polymerase (reverse transcriptase) and metabolic inhibition studies, among others, hinted strongly towards the DNA intermediate at the time. It was also postulated that the intermediate DNA may give rise asymmetrically to virion RNA and mRNA. Class VII viruses are those which have a partially dsDNA genome. They first transcribe to an RNA intermediate that is reverse-transcribed to the intermediate DNA. This then undergoes asymmetric transcription to produce mRNA that is translated. The classification system is pictorially represented in Fig. 1.1. Therefore, viruses are classifiable into various categories, and depending upon these, we also have differing genome contents of viruses, as described below.

1.1.1.4 Types of Virus Genomes dsDNA genome containing viruses can be of two main kinds—those having linear genomes and those circular genomes. Members of the Polyomaviridae have the smallest circular dsDNA genome, of about 4.5 kilobases (kb) length, while the Pithovirus group has the largest circular dsDNA genome, of about 610 kb. At

10

A. Gangopadhayya and P. L. Bhukya

Fig. 1.1 Schematic representation of the various Baltimore classes of viruses. dsDNA doublestranded deoxyribonucleic acid, ssDNA single-stranded DNA, dsRNA double-stranded ribonucleic acid, ssRNA single-stranded RNA, RT reverse transcriptase, HIV human immunodeficiency virus, mRNA messenger RNA, A adenine, G guanosine cap. (Created with biorender.com)

14.5 kb length, the Salterprovirus genus has the smallest linear dsDNA genome, whereas the Pandoravirus group has the largest linear dsDNA genome at a maximum of 2473 kb. When it comes to ssDNA genome containing viruses, they can also be circular and linear, either unsegmented or multisegmented. Of the circular ssDNA genome viruses, Circoviridae has the smallest, at 1.8 kb minimum, while Spiraviridae have the largest, at 24.9 kb. Geminiviridae has the smallest circular segmented ssDNA genome at about 2.5 kb minimum, while Nanoviridae has the largest, at about 9 kb. The smallest linear ssDNA genome is possessed by the Parvoviridae family, at about 4 kb length, while the largest is possessed by the Microviridae, at about 6.1 kb. The only segmented linear ssDNA genome containing virus family is the Bidnaviridae, at about 12.5 kb length. dsRNA genome containing viruses have only those with linear genomes, either segmented or not. The Totiviridae family has the smallest unsegmented linear dsRNA genome at about 4.6 kb length, while the Edornaviridae family has the largest at about 17.6 kb. Partitiviridae has the smallest segmented dsRNA genome, at about 3.7 kb, while the Reoviridae has the largest, at about 30.5 kb. The genomes of +ssRNA genome containing viruses are only linear, either segmented or not. Narnaviridae has the smallest linear unsegmented +ssRNA genome, at about 2.3 kb size, while the Coronaviridae has the largest, at about 31 kb size. At 4.5 kb size, the Nodaviridae

1

Factors Contributing to the Emergence of Viral Diseases

11

has the smallest segmented linear +ssRNA genome, while the Closteroviridae has the largest segmented linear +ssRNA genome at about 19.3 kb. -ssRNA genome containing viruses have either segmented or unsegmented genomes. The Arenaviridae has the smallest segmented -ssRNA genomes, at about 11 kb length, whereas Tospoviridae has them the largest, at about 17 kb. When it comes to unsegmented linear -ssRNA genomes, Paramyxoviridae has the smallest, at about 15.1 kb, while the Filoviridae has the largest, at about 19.1 kb. Deltavirus has a circular -ssRNA genome of length 1.68 kb. Of the reverse transcribing viruses – Caulimoviridae has an open circular dsDNA genome of about 7–8 kb, Hepadnaviridae has a circular partially dsDNA genome of about 3–3.3 kb in size and Retroviridae has a linear +ssRNA genome of 7–11 kb in length.

1.1.1.5 Morphologies of Virions The most common virion morphology would perhaps be the icosahedral capsid symmetry, with a spherical particle resulting from it if enveloped. Such a virion would be the Dengue virus (DENV), for example. At times, these virions can adopt a pleomorphic shape, such as in case of the Measles morbillivirus (MeV). Even among non-enveloped virions, there are various triangulation numbers adopted by icosahedral virions. Other than icosahedral capsid containing virions, there are those having bacilliform or helical morphologies. The rod-shaped morphology is adopted by the TMV. Bacilliform morphology is adopted by virions such as those of the Ebola haemorrhagic fever virus, the EBOV. A shorter bacilliform morphology that adopts a more bullet-like shape is specific for the Rhabdoviridae family. A twinned icosahedral morphology exists for members of the Geminivirus genus, to sometimes accommodate their bipartite genomes. Among the bacteriophages, there exist three different kinds of morphologies. The Siphoviridae possess a non-enveloped head and a non-contractile tail, which makes them elongated and thus siphon-like, from which their name is earned. The Podoviridae have very short, non-contractile tails, which is the shortest among the three families under Caudovirales. This earns them their name, as they resemble feet. Myoviridae, the third family, have large heads, and long, thick, complex and contractile tails. There are also giant viruses, the virions of which have unique morphologies, such as the amphora-shaped particles of the Pandoraviridae members. Thus, we can see that viruses and their virions come in various shapes and sizes, which makes them structurally complex entities, accordingly being more or less susceptible to sterilization based on presence or absence of lipid envelopes respectively. Representative images of the different kinds of shapes virions take are shown in Fig. 1.2. 1.1.1.6 Kingdoms Parasitized by Viruses Being obligate intracellular parasites, viruses are entities that will invariably need a cellular lifeform to survive. This can range from prokarya such as unicellular bacterium, to the most complex humans and other similar animals. Their range of parasitization is nothing short of unique, as they are able to infect such a variety of organisms, that we can only be in awe. This is a reason why viruses are such an ideal means to carry out molecular biology experiments, wherein we can design them in

12

A. Gangopadhayya and P. L. Bhukya

Fig. 1.2 The various kinds of virion morphologies. EBOV Ebolavirus, CHIKV Chikungunya virus, TMV Tobacco mosaic virus. (Created with biorender.com)

ways so that organisms belonging to specific kingdoms may be experimentally infected, and thus genetic manipulation be carried out. Phagemids are an example of virus usage as molecular tools, which involves bacteriophages being deleted of non-essential or undesired gene segments and stuffed with genetic material that we wish to deliver to a host cell. As such, viruses are a perfect conduit to perform groundbreaking research, as has been proven through discoveries like the HersheyChase experiment to prove DNA as the genetic material and not protein, or the Clustered regularly interspaced short palindromic repeats (CRISPR)-CRISPR associated protein (Cas) system. There exist Archaea-specific viruses, which only infect archaebacteria, those having a cell wall structure uniquely different from bacteria. These viruses possess certain structural flair that is not found in most other viral families, such as bottle- or spindle-shaped viruses, or those bearing two tails (Wirth and Young 2020). An example of such a virus would be the Acidianus-tailed spindle virus (ASTV). Bacterial viruses, more commonly called bacteriophages, or simply phages, are those that infect bacteria, and they are more ubiquitous than we think. An example would be the Lambda phage that infects a particular strain of Escherichia coli (E. coli), which has been and is still used for various experimentation, and also for

1

Factors Contributing to the Emergence of Viral Diseases

13

educational purposes, to this day. Mycoviruses are those which infect fungi specifically, for example, the virus called Cryphonectria parasitica hypovirus 1 (CHV1) (Chun et al. 2020). Viruses of protists infect protozoan species as well as amoeba, examples being giant viruses such as those belonging to the Pandoravirus genus. Plant viruses are quite commonly known, perhaps the most famous being the TMV, the first virus ever discovered. There also exist viruses that infect other viruses, more specifically the giant viruses, and these are called virophages, an example being the Cafeteria roenbergensis virus (CroV) virophage, the Cafeteriavirus-dependent mavirus. Animal viruses are of various kinds, starting from those infecting non-human animals in the wild or part of livestock, to deadly disease-causing ones that we know and talk about every day.

1.1.1.7 Receptor Usage and Successful Infection Leading to Disease Viruses are specific for the organisms they infect due to the permissivity of the organism’s cells which they are supposed to parasitize. These cells must have a suitable environment for the virus to thrive in, and manifest changes that can be resultant in tissue- or organ-level alterations in a body. Sometimes it so happens that there is a specific receptor available only in a certain kind of organism that is not available even in species belonging to closely related genera. These cognate receptors for viral surface ligands either enable a virus to invade a host cell or not. For example, the Poliovirus uses the Poliovirus Receptor (PVR), CD155, to enter its host cells in the alimentary tract. These cells provide a permissible environment, and thus the virus thrives within them. Since many cell types of the body express CD155, the lack of infection in all those cell types implies there may be a phenomenon of tissue tropism involved, and this has been revealed to be the type I interferon (IFN) response generated in some types of tissue (Ida-Hosonuma et al. 2005). Therefore, it is not only about which cells will allow a virus to enter, but also about which will allow their successful replication within them. In some cases, the receptor usage seems to be understood, but not completely. For example, the VSV is proposed to use phosphatidylserine (phoserine) as its receptor (Schlegel et al. 1983). The inconsistency in this explanation is that phoserine is usually on the inner leaflets of cell membranes, and is only externalized during apoptotic conditions. Unless a cell becomes apoptotic, VSV is not supposed to be able to enter. Indeed, the converse has also been proven that phoserine is not the receptor for VSV, and competition of phoserine binding by Annexin V does not influence VSV entry into cells (Coil and Miller 2004). Viral entry into cells is a debated and vaguely understood theme at times, and examples of such can be found even for viruses like SARS-CoV-2. However, in case of the COVID-19 virus, whereas the receptor and co-receptors have been found, the mystery remains in how it evolved to adapt to human angiotensin-converting enzyme 2 (ACE2) usage from the usage of bat ACE2. It has been deduced that closely related coronavirus strains, the SARS-CoV, SARSCoV-2 and RaTG13 (that infects the bat Rhinolophus affinis), can all recognize human ACE2, of which RaTG13 being a bat coronavirus is supposed to be able to recognize bat ACE2 (Shang et al. 2020). Speculation also exists whether there has been an intermediate host between bats and humans such as the pangolin (Manis

14

A. Gangopadhayya and P. L. Bhukya

pentadactyla), meaning there had to have been more mutation events from bat infecting SARS-CoV-2 to human infecting SARS-CoV-2, so that it eventually became able to infect humans. In other conditions, despite infection and cell entry happening, cells or tissues do not show sufficient changes to prove infection. This is crucial especially in case of laboratory experiments wherein cytopathic effect (CPE) has to be observed to record successful virus infection. CPE occurs as a result of cellular changes resulting in inclusion body formation, granularity changes, aggregation of adherent cell monolayers, etc. While most cell lines used in vitro display such changes, some don’t, and these may have differing dynamics of infection from the cell lines that do. For example, the CHPV displays prominent CPE when used to infect Vero cells or Baby Hamster Kidney (BHK) cells, but when used to infect the RAW264.7 macrophage cell line, the CPE is not as prominent. This implies that despite multiple cell types being permissive to infection, the dynamics of infection and morphological changes resulting from it may differ. It may also have implications on how pathogenic changes manifest at the tissue or organ levels. In yet other cases, infection may be successful but not result in severe symptoms of fatality. Such instances are that of self-limiting infections, wherein a disease does occur but it is only acute, never becoming chronic or life-threatening. Examples would be Hepatitis A or E infections, which are self-limiting, because a person’s own immune system can clear out the virus and not allow it to spread to others through the orofaecal route. These infections therefore result in a basal level of immunity developing within individuals of a population and are usually not serious unless in risk group populations such as immunosuppressed individuals or pregnant women. When considering the Ebolavirus, there are strains which can cause fatal disease in humans, such as the Zaire strain of Ebolavirus, ZEBOV. Then there is the Reston strain of the virus, capable of causing mortality in monkeys, but has not caused fatality in humans as of yet. Therefore, different strains or variants of the same viral species may differ in the pathogenic effects in a host and the eventual outcome of it. In certain other cases, infection may indeed take place but only after a prolonged period does signs or symptoms manifest, for example in cases of HIV infection, when acquired immunodeficiency syndrome (AIDS) develops only several years after the initial infection. Again, in some cases, the infected do not develop AIDS at all, or do so very slowly. They are called elite controllers and long-term non-progressors (LTNPs), respectively, from whom gene therapy strategies are being develop to treat other HIV-infected individuals. Therefore, viral infections can manifest in many ways, and their consequences are not always as streamlined as widely thought of.

1.1.2

Disease and Its Impact on Humanity

Needless to say, infectious diseases have a large impact on the lives of humans. Be it plant pathogens that destroy food crops or other kinds of flora, or pathogens infecting animals that we rear for husbandry, they come in all shapes and sizes,

1

Factors Contributing to the Emergence of Viral Diseases

15

causing varying kinds of diseases. As researchers, the aim is always to gauge how much of an impact has occurred on a population due to a disease. This can be measured by the disease burden on a population. There are of course many ways of characterizing a disease, and these are based on some crucial criteria that can be used to understand how severe a disease is. Three of these criteria are morbidity, mortality and disease burden. So, let us try to understand each of these in the context of disease.

1.1.2.1 Morbidity According to the National Institute of Health’s (NIH) National Cancer Institute, morbidity is defined as “having a disease or a symptom of disease, or to the amount of disease within a population. Morbidity also refers to medical problems caused by a treatment”. This implies that the number of diseased individuals caused by a specific illness is what morbidity rate amounts to. Not all infected individuals develop disease, and it is essential to understand that morbidity only takes into account those who have developed disease. Thus, a person with asymptomatic SARS-CoV-2 infection may not be morbid, until they start manifesting signs and symptoms of the infectious disease. Therefore, morbidity refers to the consequences and complications (other than death) that occur due to disease (Morgan and Summer 2008). According to the WHO, there are three factors for morbidity—the people who fell ill, the illnesses or periods of illnesses that befell these people and the durations of these illnesses. Morbidity can be measured by three criteria—the frequency, duration and severity. Frequency includes the incidence and prevalence rates for a particular disease (Sauder 2018). Incidence means the number of new cases of a disease in a particular time period, whereas prevalence means the total number of cases of the disease, including old and new ones, in that time period. The duration or disability rate is the average number of days a case lasts. Severity is the case fatality rate, which ties into the other parameter, mortality. Disease occurrence in a community is widely described using incidence and prevalence rates. There are variations of the measure of incidence, such as the attack rate, where the incidence rate measured as a percentage only applies to a population during a limited period of time, such as epidemics. Secondary attack rate is the number of people actually developing disease from exposure to a primary case within the range of the incubation period of the exposure. Prevalence can similarly be categorized into point prevalence or period prevalence, in which point prevalence means the total number of cases at a point of time and period prevalence means the number of cases throughout a specific period. 1.1.2.2 Mortality It is defined as the nature of being destined to die, which is true for all living beings. Mortality rate refers to “a measure of the frequency of occurrence of death in a defined population during a specified interval”, according to the Centers for Disease Control & Prevention (CDC), USA. The mortality for a defined population over a defined period of time is the ratio of deaths occurring during a given time period to the size of the population among which deaths occurred, multiplied by the

16

A. Gangopadhayya and P. L. Bhukya

population number being estimated from, be it 100, 1000 or 100,000. There are several variations to the mortality rate that is traditionally used, described as follows. Crude death rate has the numerator as total number of deaths during a given time interval, while the denominator is the mid-interval population. Cause-specific death rate has the same denominator, while the numerator becomes number of deaths assigned to a specific cause during a given time interval. Proportionate mortality has the same numerator as cause-specific death rate, with the denominator becoming total number of deaths from all causes during the same interval. Death-to-case ratio once again has the same numerator, with the denominator being number of new cases from the same disease reported during the same interval. Neonatal mortality rate has the numerator being number of deaths among children less than 28 days of age during a given time interval divided by number of live births during the same time interval in the denominator. Postneonatal mortality rate has the numerator being number of deaths among children of 28–364 days age during a given time interval, whereas the denominator is the number of live births during the same time interval. Infant mortality rate has the numerator as the number of deaths among children of less than 1 year age during a given time interval, while the denominator is the number of live births during the same interval. Maternal mortality rate has the numerator as the number of deaths assigned to pregnancy-related reasons during a given time interval, whereas the denominator is the number of live births during the same time interval. For crude death rate, the factor to be multiplied by can be 1000 or 100,000. For cause-specific death rate and maternal mortality rate, the factor is 100,000. For proportionate mortality, the factor is 100 or 1000. For death-to-case ratio, the factor is 100. For neonatal mortality rate, postneonatal mortality rate and infant mortality rate, the factors are all 1000.

1.1.2.3 Disease Burden To put it simply, disease burden can be called the sum of morbidity and mortality, and can be expressed by a term called Disability Adjusted Life Years (DALYs). This was a concept developed in the 1990s, by the Harvard School of Public Health, the World Bank and the WHO. It describes death and loss of health due to diseases, injuries and risk factors for all regions of the world. Burden of disease is, therefore, an addition of two factors, the Years of Life Lost (the number of years a person loses due to dying early from a disease) and the Years of Life lived with Disability (the number of years lived due to disability caused by the disease). These two factors result together in the DALYs. The importance of knowing Burden of Disease lies in the redesigning of development goals and policies to better the people under a government. It is necessary that it is meticulously calculated so that policies aimed at improving global health do not fail. Most of the time, the independent estimation of individual diseased conditions may prove inaccurate and inadequate in properly quantifying the causative factors leading to death. In such scenarios, burden of disease helps by giving a better statistic of the number of people affected in countries at the national or sub-national level. The disabilities described when calculating DALYs can be both physical or mental disabilities. Preventive action can be planned by measuring the burden of disease, and the performance of healthcare systems can

1

Factors Contributing to the Emergence of Viral Diseases

17

be assessed. Action and health gain can be compared, as well as high risk populations identified by making use of DALY estimates. Future need planning can also take place by factoring in healthcare research needs. Therefore, one can understand how Burden of Disease is important as a multifaceted measure of judging the needs of a society, and to see which groups demand the most attention, so that policies can be altered and appropriately implemented.

1.1.2.4 Global Losses Due to Disease Needless to say, disease results in a loss of life and living standards worldwide, which may have been avoidable had the disease been predicted or the extent of damage due to it been limited. The WHO says that the top 10 causes of death accounted for 55% of deaths among the 55.4 million deaths worldwide in 2019. The top 10 causes of death are currently thought to be—ischaemic heart disease, stroke, chronic obstructive pulmonary disease (COPD), lower respiratory infections, neonatal conditions, trachea, bronchus and lung cancers, Alzheimer’s disease and other dementias, diarrhoeal diseases, diabetes mellitus and kidney diseases. Ischaemic heart disease is responsible for 16% of total deaths, and thus is the greatest cause of death. What this means is that there are multifactorial causations of death that are active throughout the world, and most of them are non-communicable. We need to understand and gauge what extents of morbidity and disease are being caused by individual aetiologies. These losses are responsible for not only impacting economy and the smooth running of countries, but also result in psychological distress among close relatives and family members. When considering the cause of DALYs in India solely, the top 10 list goes on like—neonatal conditions, ischaemic heart disease, tuberculosis, diarrhoeal diseases, COPD, stroke, road injury, lower respiratory infections, diabetes mellitus, and iron-deficiency anaemia, starting from the most common to the least common. As can be observed, with neonatal conditions being the leading cause of DALYs in the country, it creates a lot of distress for the families of the neonates, and will continue to cause issues as they grow up. Losses due to disease are therefore not just in terms of materialistic commodities, but also as the overall health of people, be it physical or mental. Let us consider the COVID-19 pandemic. It has been reported from a poll in mid-April 2020 that 64% of households having healthcare workers said stress due to the pandemic resulted in aberrant habits such as loss of sleep, increase in alcohol consumption or substance use and worsening chronic conditions, and this is compared to 56% of people reporting so from all households in general (Young et al. 2021). Therefore, it should suffice to say that people are affected not only physically but also mentally in these conditions of disease, and this is not even limited to those suffering from the disease, but also those in their surroundings or taking care of them. 1.1.2.5 Stresses on Economies It is widely known that there are various determinants of crop failure and destruction throughout the world, especially India, due to pests. Among these pests, there are included viruses, such as those which spread from one crop plant to another through the means of insect vectors or mechanical transmission by farming apparatus.

18

A. Gangopadhayya and P. L. Bhukya

However, such disease also occurs among animal species. A study of 2018–2019 revealed losses to production of shrimp, Penaeus vannamei, due to the White Spot Syndrome virus (WSSV) and the pathogen Enterocytozoon hepatopenaei (EHP) (Patil et al. 2021). It was found that WSSV disease caused the highest losses in production, followed by EHP infection, mixed infections of both, running mortality syndrome and lastly, other diseases. A loss of about Rs. 3977 crores resulted from infections of EHP solely, while that due to WSSV was estimated to be about Rs. 1670 crores. Employment loss due to such disease was estimated to be about US$ 7.07 million, and the annual loss due to disease was found to be about US$ 1.02 billion. Socio-economic impacts far beyond the apparent loss of life occur due to infectious disease (Smith et al. 2019). Since travel and trade have become international occurrences, the outbreak of a disease at a particular area may have far-reaching consequences in the form of shockwaves that end up affecting several involved businesses. Private sector businesses are indirectly but profoundly affected by these events, as they are stakeholders who can provide accounts of how badly infectious disease outbreaks may have affected their livelihoods. Through these examples, one should be able to realize how essential it is to preserve the ecology and the economy with a delicate balance, since even the slightest of disturbances can lead to enormous ripple effects of economic losses. These losses can also indirectly cause the loss of life, as the people suffering lose their means of income and eventually have no other sources to take care of themselves and their families.

1.1.3

What Makes Viral Disease Unique

Despite us knowing a lot on how to combat and bypass viral disease, there is some basic knowledge on viral diseases that is ever important and must be known by the people at large. Unlike bacterial diseases, viral diseases are not caused by living organisms that have their special cellular structures. Some of these essential characteristics are as described further.

1.1.3.1 Koch’s Postulates Robert Koch presented to the world postulates that would determine the ways by which infectious disease are governed. These postulates gave the world criteria on the basis of which disease was defined, and they can be summarized as the following: • The bacteria must be present in every case of the disease. • The bacteria must be isolable from every case of the disease and be growable in pure culture. • The disease must be reproducible when the pure culture is introduced into a healthy host. • The bacteria must be recoverable from the experimentally infected host.

1

Factors Contributing to the Emergence of Viral Diseases

19

However, there emerged cases where culturing of the pathogen became difficult. This is exemplified in cases such as that of Mycobacterium leprae, which causes Hansen’s disease, or leprosy, and in some cases of virus as well, like the Rotavirus, which is difficult to culture in cell lines. It was also found subsequently that not all infectious agents are alive or cellular, which is why the Koch’s postulates were eventually modified into the molecular Koch’s postulates by Falkow in Falkow 1988. These are as follows: • The phenotype associated with disease must be present in all infectious species of a genus or all the infectious strains of a species. The gene causing pathogenic character must be absent from all non-pathogenic species or strains, but present in all pathogenic ones. • Specific inactivation of the gene or factor involved in virulence should result in a marked decrease in the pathogenicity or virulence of the species or strain. The virulence of the organism with the inactivated gene should be less than that of the unaltered organism in an animal model. • Reversion or allelic replacement of the pathogenic gene should result in restoration of pathogenicity. So, reintroduction of the gene in the organism should restore virulence in the animal model. Therefore, the improved Koch’s postulates by the molecular perspective are more suited to pathogenic entities such as viruses and viroids, and even prions. The modern viewpoint of medical science thus needs this kind of consideration for viral diseases. We are at a point in history when molecular determinants of pathogenesis are important for the treatment and experimentation of entities like viruses.

1.1.3.2 Differences with Diseases of Other Aetiologies Viruses are essentially apart from the domains of life that we are familiar with—the Archaea, Prokarya and Eukarya. Due to being so different, and not having cellular structures associated with them, viruses are tricky entities to treat and understand. They are not only smaller than bacteria, at least in regards to human viruses, but are also entirely dependent on host cell machinery for all their life processes. This is what makes targeting viruses for treatment difficult. Because the host cell processes they hijack are none other than the ones we normally use, halting them through the use of conventional medicine will also hamper our body’s own processes, and thus kill our own cells. To avoid this, antivirals have been designed that specifically target the viruses and their biological processes. Examples include the antiretroviral therapeutic agents that are utilized for treating HIV infections as well as Hepatitis B virus (HBV) infections. These antivirals target very specific activities in viral biological processes, for example, entry of the virus into a cell, uncoating of the capsid, transcription of its genetic material, reverse transcription of the genetic material (if the virus has an RNA genome and reverse transcriptase), inhibition of protease activity, assembly of the viral components and egress or budding of the virus from the host cell. Reverse transcriptase inhibitors can fall into either of two categories—nucleotide based (for example, Zidovudine) or non-nucleotide based

20

A. Gangopadhayya and P. L. Bhukya

(for example, Efavirenz). Enfuvirtide is an example of an entry inhibitor antiviral. Amantadine functions by inhibiting uncoating of viruses. Ribavirin is a nucleotide analogue transcription inhibitor. Protease inhibitors are again of a variety, an example among which is Darunavir. Grazoprevir is an assembly inhibitor that functions by binding to the nucleocapsid proteins of viruses. An inhibitor of viral egress is the drug Oseltamivir, which was widely used for the influenza outbreaks that have previously occurred. Other than the mechanisms of treatment, viral infections are also capable of establishing viraemia throughout the body of an infected organism. Additionally, due to being intracellular parasites, the immune system recognition that applies to extracellular pathogens like bacteria will not be applicable to viruses. Being composed of not only DNA-based genomes like fungi, protozoa, or bacteria, viruses have also resulted in the evolution of special immune receptors in our body, such as the Toll-Like Receptor 7 (TLR7), which recognized single-stranded RNA. Thus, we need to understand that viral infections are very different from those of other kinds. While usual microbiology techniques may be used to find the causative organism based on culture characteristics, in case of viruses they have to be isolated or at best detected through techniques like polymerase chain reaction (PCR), which will help in identifying whether any target nucleic acid is present in a sample. Viruses also emerge and transmit through a multitude of ways, which will be dealt with as follows.

1.1.3.3 Transmission and Persistence Viral transmission occurs by the means of vehicles and vectors. Vectors are organisms that have both magnitude of infectious agent within them and specific directions in which they roam, in order to “bite” target species. Perhaps the most common vector known to man is the mosquito, which is laden with parasites of various kinds—not only viruses, but also protozoans such as the Malaria parasite, Plasmodium spp. As such, they are the most researched vector species, and are also the most diverse, with the major genera of virus-laden vectors being the Aedes, Culex and Anopheles. There have been efforts to control the breeding and spread of disease via mosquitoes, with mixed success. There have also been efforts to control the diseases spread, such as using artemisinins for malaria (Meshnick 2002), or the RTS, S vaccine for malaria as well. Wolbachia sp. have also been used as mosquito control measures, as they reduce the mosquitoes’ ability to carry viruses that would otherwise be spread to greater extents. Among other methods, infertile male mosquitoes have been deliberately released into the environment to reduce the rate and number of fertile offsprings produced. These measures have been taken so that diseases spread by mosquitoes can be lessened to an extent. These include Japanese Encephalitis, Zika, Yellow Fever and Dengue, among several others. Mosquitoes are, however, not the only arthropod known to bear viruses as methods of transmission. Sandflies, belonging to the genera Phlebotomus and Sergentomyia, are responsible for transmission of the CHPV in Indian settings. Ticks are responsible for the spread of various kinds of viruses, such as the Tick-borne Encephalitis virus (TBEV), Kyasanur Forest Disease virus (KFDV), Crimean-Congo Haemorrhagic fever

1

Factors Contributing to the Emergence of Viral Diseases

21

orthonairovirus (CCHFV), among several others. Therefore, the animal kingdom provides several vectors for the transmission of many pathogenic agents, among which mosquitoes, sandflies and ticks stand out as the most significant. Other than vectors, however, there are also vehicles of transmission which are equally responsible for the spread of viruses. Vehicles include media such as air droplets, air itself, faecal matter, body fluids such as blood, semen, urine, etc., even the infected tissue of patients or hosts. These are as important as vectors are for the spread of viral diseases. Poor hygiene and sanitation measures usually lead to the rampant spread of infections through these vehicles, which are not even limited to human viruses. Respiratory infections, for example Influenza, are often spread through infected respiratory droplets, which can easily reach uninfected people or remain on fresh surfaces as fomites. When droplets are more than 5–10 micrometre (μm) in size, they are respiratory droplets, whereas those below 5 μm in size are droplet nuclei. Airborne transmission is when infectious particles remain in droplet nuclei, remain so for long periods of time and transmit for greater than 1 m distance. Aerial transmission and airborne transmission are important factors for the transmission of viruses in nosocomial settings as well. Endotracheal intubation, sneezing, bronchoscopy, etc. are phenomena that release copious amounts of infectious material into the air. Skin shedding is a classic way for the transmission of MeV and Mumps virus (MuV). Adenoviruses and enteroviruses, including the Poliovirus, spread through the orofaecal route, through the contaminated faecal matter excreted from infected patients, that somehow enters into drinking water sources. Body fluids are a means by which the ZEBOV and the NiV transmit, while blood and its products are a means by which the HBV and Hepatitis C virus (HCV) transmit. Semen is a vehicle used by the HIV, and so is the case for vaginal fluids. The Human Papilloma virus (HPV) is yet another such pathogen that spreads through skin shedding and venereal routes. The ZEBOV can also spread through the routes of infected urine and breastmilk. Persistence of viral infections also occurs in specific cases, such as in case of HIV. These are cases in which the virus is not fully cleared out from a body, but is rather restricted to certain cell types. In case of HIV, the ideal cell type is the CD4+ T-helper cells, which are destroyed slowly as the virus thrives within them postreactivation. Latency is observed in case of other viruses as well, such as the Herpes viruses, which take root in the peripheral sensory ganglia. Persistence is a characteristic of viruses that not only invade humans, but also mosquito vectors. They can be circulatory persistent or reproductively persistent, either replicating in case of the latter or not in case of the latter. Hepatitis B remains dormant in the liver hepatocytes for a long time before it returns to its active state and causes damage in liver function, which is regarded as decompensated liver function in hepatitis.

1.1.3.4 Mutation and Evolution It is needless to say that, due to the several hundreds of generations of viruses that are propagated within the body of a host, there emerge subtle changes in the genetic content that are carried further. These are mutations, the slight genetic variations that eventually result in some kind of massive phenotypic change that gives us a truly

22

A. Gangopadhayya and P. L. Bhukya

new version of a previously known pathogen. What we are witnessing in real time is the evolution of pathogenic organisms that keep on obtaining new features, may they be useful or not, that eventually accumulate to contribute to the formation of new strains or species. Mutation is a forever ongoing process, born out of the errors that creep into our central dogma processes, be it at the level of replication or transcription. Differences in the genetic content arise due to the error prone polymerases that act on each of our genetic material. It happens in humans as well, but the rate is so slow, at about 10-10 mutations per generation, that the overall effects in the human body are not so pronounced. This is due to both our highly processive and repairprone DNA polymerase enzymes and the other repair enzymes that function due to damages, such as by Ultraviolet (UV) rays. But in bacteria, these repair processes, however efficient, are not enough to correct all the errors that gather up over all the generations spent inside the body of a host. In case of viruses, then, which have even more error-prone polymerases, the possibility of mutations accumulating becomes higher with each generation. Viruses mostly do not have polymerases that are repairprone, whenever they use their own, and when they use host polymerases, the eukaryotic repair mechanisms may correct errors when they appear. However, for most of the RNA genomic viruses that pack their own polymerase enzyme, the error rate is usually quite high, at about 10-5 per generation. At such high error rates, the polymerization will decidedly be prone to a lot of errors, and thus mutations, called for or not, will keep appearing. When mutations that are useful for the virus appear, we see them persisting in the population and contributing to their activities of host infection and propagation. There are examples to better illustrate this. The family Pandoraviridae remains to be the one with the as of yet discovered largest genomes of all viruses. A comparative genomics approach to six pandoraviral species revealed a distribution of genes and gene sets which were expressed together as sets of proteins eventually given rise to by a process called de novo gene creation, as hypothesized by the investigators (Legendre et al. 2018). The enormous size of the genome was alternatively hypothesized to be due to some ancestor that had an even larger gene set and thus a larger genome, or due to horizontal gene transfer between the species and their hosts, along with other parasites of the hosts. However, the most practically feasible of the explanations appeared to be the de novo gene creation hypothesis, despite its shortcomings as a logical hypothesis, due to the elimination of the remaining two methods of gene addition to their genomes. In another study, the human respiratory syncytial virus (RSV) was researched on by using samples from the Buenos Aires area (Trento et al. 2006). A total of 47 samples were tested and it was found by sequencing that there was an exactly 60 nucleotide duplication in these viruses, something that could be tracked back to an ancestor virus of about 1998. The human RSV sequences were compared and it was found that the G gene was the one in which this duplication event was observed. Both the identical stretches seemed to accumulate mutations that were apparent in the more recent viruses that emerged, than the older ones. This particular genotype seemed to have replaced the genotype B viruses that were in circulation in Buenos Aires till that time. What we can understand then that micro-scale evolutionary

1

Factors Contributing to the Emergence of Viral Diseases

23

events keep happening that lead to accumulating mutations and eventually formation of new strains or variants of infectious viruses. A perhaps famous example of the occurrence of mutations in viruses is the presence of variants of the COVID-19 virus, SARS-CoV-2 (Abdool Karim and de Oliveira 2021). What emerged as a single virus from Wuhan in December of 2019 has now become a global plague. There are four kinds of variants of the SARS-CoV2 that are in place. There are Variants being Monitored (VBM), which include the Alpha (B.1.1.7 and Q lineages), Beta (B.1.351 and descendent lineages), Gamma (P.1 and descendent lineages), Epsilon (B.1.427 and B.1.429), Eta (B.1.525), Iota (B.1.526), Kappa (B.1.617.1), 1.617.3, Mu (B.1.621 and B.1.621.1) and Zeta (P.2) variants. The Variants of Concern (VOC) include the Delta (B.1.617.2), Omicron (B.1.1.529) and AY lineages. In addition, there are Variants of Interest (VOI) and Variants of High Consequence (VOHC). All of these have come to be due to the slow mutations that have come up throughout the generations of SARS-CoV2 propagating throughout the world. The more the virus infects and makes more people sick, the more will be the mutations happening in them, because more progeny generations will appear. This is how mutations appear to cause such substantial changes, and it is more due to the adaptive selection processes than the purifying selection ones that give rise to new strains and species with enough evolutionary distance from each other to be counted as from separate clades. Adaptive selection occurs only when the ratio of rates of non-synonymous to synonymous mutations is greater than one, whereas purifying selection is when the ratio is less than one. It is in this way that mutations in viruses give rise to evolution, and this evolution gives rise to the many troubling new strains and species that cause disease.

1.1.3.5 Latency and Reactivation As previously discussed, latency is when a metastable, non-productive infection state is established, which can be reactivated later on to complete the infection cycle (Lieberman 2016). Viral latency can lead to a host of consequences, such as birth defects, errors in immunological response, cancer, neuropathy, cardiovascular disease and chronic inflammation. The mechanisms of latency and reactivation are varied across several families and species that possess it as a strategy in their infection cycles. There exist, however, some commonalities to latency induction and its reactivation among viral families. The study of latency and its associated factors may help us in understanding crucial elements of infection, and eventually allow us to develop strategies of our own to work against these latent viral states. Bacteria are also known to establish latent states in the body, and there could be no better example for this than the Mycobacterium tuberculosis. The bacterium takes refuge in cavernous formations that are developed due to macrophages surrounding the bacteria in the alveoli of lungs (Flynn and Chan 2001). In case of viruses, two classic examples of latency are that of herpesviruses and the HIV. In case of HIV, latency occurs in the T-helper CD4+ cells of the immune system, which results in the slow but certain depletion of the cells from the body (Siliciano and Greene 2011). The HIV can also cause latency in other organs of the body, such as the brain,

24

A. Gangopadhayya and P. L. Bhukya

wherein the astrocytes serve as the main latent reservoir of the virus. Latency reactivating agents (LRAs) are drugs that can reverse the latent condition, for example NFκB stimulators, or histone acetylation agents, or agents that prevent the occlusion or collision of polymerase, such as the HIV Tat protein. In case of the herpesviruses, latency is also a method of prolonging their survival. Sensory neurons are where the herpesvirus establishes latency (Nicoll et al. 2012). The virus enters sensory neurons via nerve termini after productively infecting mucosal epithelial cells. Following this, the virus goes to the neuronal cell bodies and establishes latency. Upon reactivation, the virus can resume its lytic cycle of infection and also be transported back axonally to the periphery. Central to the survival strategy of the virus is the ability to reverse latency periodically and disseminate itself to infect the body’s peripheries. Latency-associated transcripts (LATs) are produced by the virus to regulate the latent states and to regulate the infection cycles of the virus. As such, latency is a chief survival strategy, that is even used in viruses that do not parasitize animals. Virophages, i.e., viruses that parasitize giant viruses in the cells of organisms such as protists, on which the giant viruses parasitize, are inserted within the genomes of the protists, and only when the giant virus comes into the cell of the protist is the virophage reactivated, and thus able to parasitize the giant virus’s replication machinery and cause just the virophage replication to occur, blocking the giant virus’s replication (Fischer and Hackl 2016).

1.1.4

Brief History of Human Viral Disease

Viral diseases have plagued humankind for centuries, if not millennia. Perhaps some of the oldest documentations of viral disease is that of rabies, coming from thousands of years ago. Viruses have long evolved along with humans to come head-to-head in an evolutionary arms race, one which they might just be better equipped to win if not for the leaps and bounds in research that we as humans have made. For very long periods, viral disease has perplexed humans in being effects caused by entities that cannot be easily culturable and thus observed through the microscope. That viruses also pass through the finest of sieves also made them enigmatic entities that were at the earlier times of human history poorly understood by humans. The curiosity with which we have viewed viruses have led us to understand the entities that cause such varied diseases in humans. Viruses are generally known to cause fever within the body, which is the major consequence that can lead to a wipe-out of the entities from the body, i.e., by the elevation of body temperature. Fever can lead to adverse consequences too, however, and it is this malady that has been ascribed various facets to by humans of old days. Many ancient populations have made their own interpretations of disease and how it manifests within people, especially viral disease, and how it produces its symptoms. We can, therefore, try to understand where from the understanding of viral disease in the human population emerged from, as a means of understanding what lens we view it with in modern times.

1

Factors Contributing to the Emergence of Viral Diseases

25

1.1.4.1 First-Ever Viral Disease Cases or Outbreaks Recorded Herpes virus has been recorded to infect human ancestor populations over 80 million years ago (Social history of viruses—Wikipedia n.d.). The common cold and influenza may have infected early hominids as well, who suffered just like the modern man of today suffers from them. The very first viral disease outbreaks recorded happened at about 11,000 years ago, in some Indian populations. They suffered from smallpox, which may have emerged when some rodent poxvirus species crossed the species barrier to infect humans. Sporadic outbreaks probably occurred in each generation, where people either succumbed to the infection or developed immunity to it. When populations settled along the banks of the Nile, at about 9000 years ago, the smallpox disease flourished further because of the constantly large population, and so did other viral diseases like Mumps, Rubella and Polio. It is possible that about 10,000 years ago, when people populated around the Mediterranean basin, there was the emergence of zoonotic diseases that may have crossed over from animals such as pigs, cattle, goats, sheep, horses, camels, cats and dogs. It is further possible that the viruses were not fully adapted to infect humans back then, or the populations weren’t large enough to maintain a chain of transmission. 1.1.4.2 Earliest Epidemics and Pandemics The Antonine plague, which lasted from about 165 AD to 190 AD, was due to either smallpox or measles, and accounted for deaths of 3–6% of the then world population (Antonine Plague—World History Encyclopedia n.d.). The Plague of Justinian lasted from 541 to 549 AD, and broke out over Europe and West Asia (Mordechai et al. 2019). It was due to the bubonic plague, causing deaths of 7–56% of the global population. Between 735 and 737 AD, a smallpox epidemic broke out in Japan, which caused the death of 1% of the global population (Suzuki 2011). Between 1346 and 1353 AD, the Black Death raged on due to bubonic plague, all over Europe, Asia and North Africa, resulting in the death of 17–54% of the world’s population (Wade 2020). The smallpox epidemic of Mexico lasted for 2 years, 1519 and 1520, resulting in the death of 1–2% of the global population (Acuna-Soto et al. 2002). 1.1.4.3 Emergence of Noteworthy Diseases from Key Geographic Locations When the world became more connected by trade and travel, the diseases that were region-locked became spreadable throughout increasing geographical areas. These diseases then became available to spread through populations that were previously not endemic to them. Thus, new zones of endemicity have emerged, which made populations that were possibly already susceptible to the disease easy targets for the newly introduced disease. When the plague bacterium was introduced due to exploration of the “New World” by the Europeans, trade caravans and ships took the plague-carrying rodents across oceans and lands to enable them to infect new prey populations (Crosby 2019). An event occurred in 1977 in America that introduced coccidiodomycosis, caused by Coccidioides immitis, from the southwestern parts of USA, Mexico and South America, to northern California, by

26

A. Gangopadhayya and P. L. Bhukya

means of an unusual wind storm that lifted the soil and deposited it in the new areas (Flynn et al. 1979). Japanese Encephalitis, a well-known illness, was landlocked to Japan towards the end of the nineteenth century, but due to migration of Japanese soldiers, to the eastern parts of China and the farmwater-laden parts of Bangladesh and India, JE became globally distributed. In a way similar to plague, the HIV has increased its transmission area from the Democratic Republic of Congo to areas far abroad, because trade and travel boomed from the areas originally endemic to HIV, in the 1920s (Origin of HIV and AIDS | Avert n.d.). Therefore, geographically locked regions have the potential to introduce new diseases to brand new locations. Another example would be the Reston strain of the Ebolavirus that was found in the USA, which was thankfully a non-fatal strain of the virus that got imported from the Africas (Chapter 9. Ebola Virus Disease | Elsevier Enhanced Reader n.d.).

1.1.4.4 Other Notable Epidemics and Pandemics in Human History The Spanish flu, caused by the H1N1 strain of the Influenza A virus, caused the second largest pandemic, which raged worldwide (The Spanish flu (1918-20): The global impact of the largest influenza pandemic in history—Our World in Data n.d.). It caused between 17 and 100 million deaths, which meant 1–5.4% of the global population at the time. It lasted 3 years, from 1918 to 1920. The HIV/AIDS global epidemic, caused by HIV, has resulted in 36.3 million deaths as of 2020, and has been raging on since 1981 till the present time, globally (A Timeline of HIV and AIDS | HIV.gov n.d.). The Third Plague Pandemic, again caused by the bubonic plague, went on from 1855 to 1960 (Bramanti et al. 2019). The death toll was 12–15 million, as it raged on globally. As of 12 November 2021, the COVID-19 pandemic, caused by SARS-CoV-2, has caused 5.1–20 million deaths worldwide (Coronavirus Death Toll and Trends—Worldometer n.d.). This accounts for 0.07 to 0.25% of the global population, since it has been ongoing worldwide. The Cocoliztli epidemic of 1545–1548 resulted in 5 million to 15 million deaths (Acuna-Soto et al. 2002). This accounted for the loss of 1–3% of the then global population, and mostly raged on in Mexico. A typhus epidemic raged on in Russia from 1918 to 1922, due to the typhus pathogen (Patterson 1993). It resulted in about two to three million deaths, which was 0.1–0.16% of the worldwide population. The influenza pandemic of 1957–1958 was due to the H2N2 strain of the Influenza A virus (1957–1958 Pandemic (H2N2 virus) | Pandemic Influenza (Flu) | CDC n.d.). One to four million deaths were caused due to it, which was 0.03–0.1% of the world’s population, as it raged worldwide. The Hong Kong flu pandemic raged worldwide from 1968 to 1969 (1968 Pandemic (H3N2 virus) | Pandemic Influenza (Flu) | CDC n.d.). It was caused by the H3N2 strain of the Influenza A virus, resulted in one to four million deaths, which was 0.03–0.1% of the world’s population. The Cocoliztli epidemic of 1576 is thought to have caused 2–2.5 million deaths, which was about half of the Mexican population and about 0.4–0.5% of the global population (Acuna-Soto et al. 2004). It raged on from 1576 to 1580 in Mexico. The Persian plague raged on from 1772 to 1773, caused by the bubonic plague (Hashemi Shahraki et al. 2016). About two million deaths resulted in Persia, which was 0.2–0.3% of the global population. The Naples plague was caused by plague, which resulted in 1.25 million deaths in

1

Factors Contributing to the Emergence of Viral Diseases

27

Southern Italy, and raged on from 1656 to 1658 (Scasciamacchia et al. 2012). About 0.2% of the world’s population died from it. The 1629–1631 Italian plague was also due to the bubonic plague, which resulted in about one million deaths, about 0.2% of the global population (Alfani 2013). The worldwide cholera pandemic of 1846–1860 was caused by Vibrio cholerae, resulting in over one million deaths, which was 0.08% of the global population (Pollitzer et al. n.d.). A supposed flu pandemic broke out globally between 1889 and 1890 (King 2020). It is disputed to have been caused by the influenza virus, causing one million deaths, which was 0.07% of the global population.

1.1.4.5 Strategies Developed Against Viral Disease In response to the rising need of controlling disease, be it viral or otherwise, humanity has prepared its own arms to fight back against them. There exist integrated disease surveillance systems which are in place to monitor the outbreak of disease (World Health Organization Geneva Organisation Mondiale De La Santé Genève weekly epidemiological record Relevé épidémiologique hebdomadaire n. d.). Countries conduct disease surveillance to monitor those with a high burden, to detect outbreaks of epidemic-prone disease and to monitor progress against national or international plans to eliminate certain diseases. Surveillance systems that are vertically programmed must be planned to ensure the surveillance and control functions to remain closely linked. However, this has its own drawbacks, including the functioning of several hierarchical bodies that become cluttered in their activity in due time, eventually collecting lots of data. This is why an integrated surveillance system is better prepared, to carry out all surveillance activity as common public service with similar structures, processes and personnel. Specialized surveillance systems are also important, of course, as in case of eradication and elimination programmes, wherein each and every case has to be accounted for. Such a holistic approach can improve the overall system and make it easier for surveillance to be carried out. With regards to emerging diseases in particular, surveillance systems, specifically passive surveillance, can notify whether any new or old disease is increasing by incidence at a particular time or period. Active surveillance can help further to find out the true extent of disease by actively going to the location(s) of outbreak and utilizing appropriate human resource to have the situation investigated. There are surveillance systems in place for year-round monitoring of disease conditions, for example, the FluNet, by the Global Influenza Surveillance and Response System (GISRS) (Global Influenza Surveillance and Response System (GISRS) n.d.). It is a global public health model that allows for global confidence and trust, through effective collaboration by the sharing of viruses, data and benefits by its member states. The GISRS protects against influenza globally by serving as a global mechanism of surveillance, preparedness and response for seasonal, pandemic and zoonotic influenza. It also serves as a global platform for monitoring influenza epidemiology and disease. Novel influenza viruses and other respiratory diseases are also alerted through the GISRS. There are 123 member states of the system.

28

A. Gangopadhayya and P. L. Bhukya

Even in states like India, there exist systems such as the National AIDS Control Organization (NACO) and the Directorate of National Vector Borne Disease Control Programme (NVBDCP). The NACO is a division of the Ministry of Health and Family Welfare, responsible for leading the HIV/AIDS control programme in India. In 1992, the first National AIDS Control Programme was launched, and the NACO was implemented to guide the programme. The NVBDCP on the other hand is for the prevention and control of six vector borne diseases—Malaria, Dengue, Lymphatic Filariasis, Kala-azar, Japanese Encephalitis and Chikungunya—three out of which are viral diseases. It is part of the Directorate General for Health Services, composed of technical experts in the fields of Public Health, Entomology, Toxicology and the parasitological aspects of Vector Borne Diseases. Therefore, we as humans have developed our own systems for defending against the outbreak of emerging diseases.

1.1.4.6 Changes in Human Understanding of Viral Disease Diseases come in all shapes and sizes. It can range from a parasitic illness to an accident-caused malady. While humans have primarily understood disease to be a form of malady treatable by chemotherapeutic agents, a clear distinction must be present between viral disease and the other kinds of diseases. In order to demarcate this properly, several measures are put in place to inform the public at large about such diseases. Every year there are advertisements that turn up on mass media like the Television and newspapers, regarding mosquito-borne viral diseases, especially dengue (Delhi govt launches mass awareness campaign against dengue; check details—The Financial Express n.d.). These advertisements enlighten the general layman about the things to do to prevent the disease and also what to do in case the disease is diagnosed in someone. There are other methods of notifying the public, such as putting up warning signboards in public places like airports, for any disease that may be endemic to an area. Such apply also to diseases spread by ticks, as there may also be seen notifications warning forest travellers about dangerous ticks that could spread some deadly diseases through their bites. Similarly, the same could be done for similar disease-spreading arthropods such as sandflies. Our understanding of the disease needs to be brought about by explaining how fundamentally different the entities are compared to bacteria or other kinds of parasites. There also exist various educational programmes for neglected diseases such as Rabies, which still cause a lot of deaths per year. These programmes and campaigns are important to notify the general public of the risks associated with viral disease, and how they may not be as easily cured as bacterial ones, although resistance has recently developed in both kinds of pathogens.

1.1.5

Most Important Human Viral Diseases at Present

As has always been, some diseases are given more importance than others. This is more so because either awareness for them has been spread more than the others, or they infect more numbers of people than others. Due to these reasons, there have

1

Factors Contributing to the Emergence of Viral Diseases

29

always been programmes and plans that are directed more towards these important diseases. This section deals with some such diseases, and how important they are in the current context. This will help elucidate some of the currently ongoing activities being undertaken to combat the discussed diseases.

1.1.5.1 Diseases of Public Health Importance A public health emergency of international concern refers to an extraordinary event, which is determined to constitute a public health risk to other states through the spread of disease, and to potentially require a co-ordinated response (Health Regulations Third Edition 2005 n.d.). It is the kind of health emergency which prompts response internationally, to ensure that an outbreak does not become a global pandemic of proportions that make it difficult to control in the long run. One good example of such an ongoing malady is the COVID-19 pandemic, which had been declared a public health emergency of international concern on 30 January, 2020. These diseases are capable of causing a major disruption in life worldwide, as we are experiencing in today’s times. This is but one example of diseases that are capable of causing major disruptions worldwide if a pandemic occurs and spreads to multiple countries. According to the WHO, controlling the spread of infectious diseases takes into account some key activities which are imperative to doing so (Chapter 10: Controlling the spread of infectious diseases n.d.). Ethical principles need to be built into infectious disease legislation, and the transmission of infectious disease needs to be actively prevented. There must be some situations that need compulsory treatment, no matter the patient consent, for example, if the patient is unable or unwilling to provide consent. Contact with the infectious people must be limited as well. Diseases of public health importance were formerly referred to as “Reportable Diseases”. These diseases are reportable to the Medical Officer of Health. Among these are diseases that are reportable on the very same day, and some that can be reported on the next working day. Some of the viral diseases that are on this list include the following—AIDS, Chickenpox, primary viral Encephalitis, Hantavirus pulmonary syndrome, Haemorrhagic fevers, viral Hepatitis (A, B or C), Influenza, Measles, acute viral Meningitis, Mumps, COVID-19, MERS, SARS, acute Poliomyelitis, Rabies, Rubella (including Congenital Rubella Syndrome), Smallpox and West Nile virus illness (Printable Diseases of Public Health Significance List | Thunder Bay District Health Unit n.d.). Public health significant diseases are therefore important since these are those which are not only serious but also have an impact on the disease burden in a nation. These are the illnesses which have weightage when it comes to developing and executing policies and mitigating the consequences of disease, whether they may spread from person-to-person or not. 1.1.5.2 Notifiable Diseases Diseases that are required by law to be reported to government authorities are called notifiable diseases (Notifiable disease—Wikipedia n.d.). Monitoring of a disease and early prediction of outbreaks becomes possible through such monitoring. When it

30

A. Gangopadhayya and P. L. Bhukya

comes to livestock, there may arise the need for them to be killed upon completion of the notification. Systems and rules are in place by many governments for notification of diseases, either human or animal. The CDC publishes data and statistics from the National Notifiable Diseases Surveillance System (NNDSS). Under it, there are two separate sections—the infectious diseases list and the non-infectious diseases list. The list for viral diseases includes Arboviral diseases, Dengue virus infections, Hantavirus infection, Hantavirus pulmonary syndrome, Hepatitis, HIV, Influenzaassociated paediatric mortality, Measles, Mumps, Novel Influenza A virus infections, paralytic or non-paralytic Poliomyelitis, Rabies, Rubella, CRS, SARSCoV disease, Smallpox, Varicella morbidity and mortality, Viral haemorrhagic fevers, Yellow fever and Zika virus disease (Weekly statistics from the National Notifiable Diseases Surveillance System (NNDSS) n.d.). Among the non-infectious conditions, there is cancer, elevated lead levels in blood, food or water-borne disease outbreaks, etc. (Fitzgerald et al. 2016). There exists a separate list for notifiable diseases that occur in animals, and this is maintained by the World Organization for Animal Health. Their lists are separate for maladies of multiple species, and those for some specific families of animals, such as cattle, sheep and goat, equine, etc. (Diseases Notifiable to the OIE n.d.). Diseases that are considered notifiable vary from state to state (Nationally Notifiable Diseases | Healthy Water | CDC n.d.). Internationally notifiable diseases are reportable in compliance with the WHO’s International Health Regulations. Statistics of nationally notifiable diseases are collected and compiled from reports to the NNDSS, operated by CDC in collaboration with the Council of State and Territorial Epidemiologists (CSTE).

1.1.5.3 Viruses with Pandemic Potential Pathogens can develop into deadly mediators of global disease if they have the characteristics to spread at such a rate and route, since globalization has connected most parts of the world. Diseases with high transmissibility only need to adapt to the human host at times to be able to cause widespread epidemics. Such viruses are capable of rapid transmission and are usually those that have few to no vaccines or medicines available against them. Viruses such as these include Ebola and Marburg virus disease, Lassa fever, MERS, SARS, Nipah, Zika, Crimean-Congo Haemorrhagic Fever (CCHF), Rift Valley Fever and Monkeypox (10 infectious diseases that could be the next pandemic | Gavi, the Vaccine Alliance n.d.). Additionally, other sources such as the WHO includes Influenza and Yellow Fever among the ones that have the capability of causing epidemics or pandemics (Pandemic and epidemic-prone diseases | OpenWHO n.d.). Diseases that can cause pandemics need to be dealt with effectively by streamlining research towards them, such that effective therapeutic or preventive measures may be ready by the time they actually hit as widespread outbreaks. Viruses that are prone to mutations and may readily evolve to adapt to new hosts and higher transmissibility are further qualified to be pandemic-prone and thus break out into widespread outbreaks.

1

Factors Contributing to the Emergence of Viral Diseases

31

1.1.5.4 Currently Important Viral Diseases and Measures Against Them As mentioned before, there may always be some diseases that take the spotlight by affecting a large number of people in short times, or resulting in a massive number of deaths. These are those that warrant the most public attention, and are thus capable of or have caused large scale outbreaks that can lead to high morbidity and mortality rates. This subsection deals with some viral diseases of high importance at present, and the measures that are being taken against these diseases by national and global authorities. 1.1.5.5 Acquired Immunodeficiency Syndrome (AIDS) AIDS is caused by infection with the HIV, leading eventually to a deteriorated immune system that is no longer able to fend off infections, even opportunistic ones. AIDS is defined by the development of certain cancers, or infections, or other severe long-term clinical manifestations (HIV/AIDS n.d.). It is the most advanced stage of HIV infection, which can take many years to develop if left untreated, although it depends on the person infected. While there is no cure for HIV infection, it has now become a manageable chronic disease, due to increasing access to effective HIV prevention, diagnosis, treatment and care, including those for opportunistic infections. HIV infection has claimed 36.3 million lives globally so far. Around 37.7 million people were found living with HIV at the end of 2020, with over two-thirds residing in the WHO African region. In just 2020, 680,000 people died from HIV-related causes, and 1.5 million people acquired HIV. It is no understatement that HIV is one of the leading viral causes of death worldwide, and strict actions are to be taken to prevent this disease from claiming even more lives than it already has. The Global health sector strategy on HIV for 2016–2021 gave five strategic directions to guide priority actions by countries and the WHO. These include information on focused action, interventions for impact, delivering for equity, financing for sustainability and innovation for acceleration. The Joint United Nations Programme on AIDS (UNAIDS) is co-sponsored by the WHO. It co-ordinates activities against HIV infection, including HIV and tuberculosis (TB) co-infection, and also elimination of mother to child transmission of HIV. There exist voluntary counselling and testing centres (VCTCs) for people suspecting HIV infection to get themselves tested, and where medication against HIV infection is offered free of cost. Measures against the disease have been taken so that its eventual consequences do not weigh so heavy as they did in the past. 1.1.5.6 Haemorrhagic Fevers Diseases that cause profuse bleeding from the body and caused by viruses are called Viral Haemorrhagic Fevers (VHFs). They are caused by several types of viruses, some of which cause mild illness, and others cause major, life-threatening infections (Viral Hemorrhagic Fevers | Johns Hopkins Medicine n.d.). Despite being rare in the United States, VHFs are diseases feared to have potential in bioterrorism acts, and so research is regularly ongoing on them. These diseases are usually spread through rodents or insects such as ticks. Moving into environments having populations of these reservoir species can make a person susceptible to infection by VHFs. Not only

32

A. Gangopadhayya and P. L. Bhukya

exposure to tick bites, but crushing ticks can also make a person susceptible to any VHF virus laden by them. Some of these viruses can also spread by person-to-person transmission. In order to prevent contracting a VHF, the rodent population has to be controlled, their nests and droppings have to be cleared cleanly, insect repellent has to be used, along with proper use of bed nets, insecticides, window screens, etc., long sleeved garments should be worn and areas with recorded outbreaks should be avoided. The Viral Special Pathogens Branch (VSPB) has been formed with the aim of implementing innovative and effective measures to control VHFs in the United States and outside (Viral SpecViral Special Pathogens Branch (VSPB) | DHCPP | NCEZID | CDCial Pathogens Branch n.d.). The group is spearheaded towards understanding dangerous viruses to protect people at greatest risk from them, by performing cutting edge research on them. They have a multifaceted approach towards this, by improving surveillance, enhancement of diagnostic capability, supporting response to outbreaks and post-outbreak analysis, providing technical training to outbreak professionals and healthcare workers, to support the development of health education and risk control measures, to study virus-host ecology, conduct basic research and to advance understanding of how infection leads to severe disease.

1.1.5.7 Viral Hepatitis Hepatitis refers to inflammation of the liver, caused by the its tissues’ reaction to irritation or injury, eventually leading to swelling and pain (Viral Hepatitis n.d.). Several viruses are known to cause it, including the five main Hepatitis-causing viruses—Hepatitis A, B, C, D and E viruses. Hepatitis A virus belongs to the genus Hepatovirus, family Picornaviridae. Hepatitis B virus belongs to the Orthohepadnavirus genus and the family Hepadnaviridae. Hepatitis C virus belongs to the genus Hepacivirus and the family Flaviviridae. Hepatitis D virus belongs to the Deltavirus genus and the Kolmioviridae family. Hepatitis E virus is of the genus Orthohepevirus and the family Hepeviridae. Other than these, there are other viruses that cause Hepatitis, such as the Hepatitis G virus, the Torque teno virus, etc. Hepatitis A and E are usually only acute and resolve on their own, leading to lifelong immunity against them in the patients. They spread through the orofaecal route. Hepatitis B, C and D spread through bodily fluids such as blood, and can lead to chronic, life-threatening ailments. The WHO recommends Hepatitis B vaccination at birth, to avoid parent-to-child transmission of the virus (Prevention and Control of Viral Hepatitis Infection: Framework for Global Action 2012). However, only 27% of the newborns receive the vaccine at birth. The organization aims towards a health systems framework with a public health approach, and under this, the goals of the WHO Viral Hepatitis strategy are: reducing transmission of the agents causing Hepatitis, to improve morbidity and mortality and increase the care received by those suffering from Hepatitis and to reduce the socio-economic impact of those suffering from Hepatitis at individual, community and national levels. The first axis is in raising awareness, promoting partnerships and mobilizing resources. The second axis is in evidence-based policy and data for action. The third axis is in prevention of transmission. And, the fourth axis is in screening, care and treatment.

1

Factors Contributing to the Emergence of Viral Diseases

33

1.1.5.8 Influenza It is a respiratory disease caused by one of the strains of the influenza virus, which belong to four distinct species—Influenza A, B, C and D. Of these, only Influenza A and B viruses cause seasonal epidemics, leading to public health problems (Influenza (Seasonal) n.d.). The Influenza A virus species can be subdivided into various subtypes, each of which are determined by the Haemagglutinin (HA) and Neuraminidase (NA) proteins on the surface of the virions. There are 18 subtypes of the HA protein and 11 subtypes of the NA protein, and it is the combination of these that result in each strain of the virus. However, a strain called the A(H1N1)pdm09, which caused the 2009 pandemic of influenza, has mostly replaced the seasonal H1N1 strain that was in circulation throughout the world. Influenza B viruses are classifiable into lineages, and these are mostly belonging to the Yamagata or the Victoria lineages. Influenza C virus causes mild infections, whereas the Influenza D virus does not cause infection in humans. Influenza activity is monitored by the WHO through the GISRS system, and also monitors the scenario on a monthly basis. It also recommends the seasonal vaccine compositions, based on which vaccine manufacturers across the world in both hemispheres, Northern and Southern, formulate their vaccines. Timings of vaccination campaigns, prevention and control strategies are also suggested through the GISRS. The system publishes all the data it collects in FluNet charts, which are updated in real time, and represent the number of influenza cases detected through testing throughout the year. This system also has a network of laboratories situated all across the world, which act as points for sending the required information to be forwarded to the WHO GISRS. The influenza virus also undergoes periodic mutation events due to reassortment of its genomic segments when multiple strains infect the same host. Examples of such antigenic shift events and their resultant strains are listed in Table 1.1. 1.1.5.9 COVID-19 It is a disease that was declared a pandemic on 11 March 2020 (WHO DirectorGeneral’s opening remarks at the media briefing on COVID-19—11 March 2020 n. d.). It has caused massive loss of life throughout the world, as well as losses on socio-economic fronts. These consequences have morphed COVID-19 into a multifaceted problem through which navigation is being attempted even in the present time. The disease first initiated in the Wuhan region of China, after which it spread worldwide for lack of sufficient containment measures and the highly widespread trade and travel routes worldwide. Each national and state governments under them Table 1.1 List of some pandemic influenza virus strains and their probable strains of origin (Kim et al. 2018) Influenza virus strain Influenza A 1918 (H1N1) Influenza A 1957 (H2N2) Influenza A 1968 (H3N2) Influenza A 2009 (H1N1)

Most likely origin Avian influenza virus strain 1918 (H1N1) strain with HA, NA & PB1 from avian strain Influenza A (H2N2) strain with HA & PB1 from avian strain Avian, human and swine viruses circulating in swine

34

A. Gangopadhayya and P. L. Bhukya

have been given strict safety protocols and measures to follow, prime among which is the order to quarantine populations at large so that they may engage in physical distancing, preventing the virus from being spread. SARS-CoV-2, the causal agent of COVID-19, seems to have originated from bat species belonging to the genus Rhinolophus, that may have jumped species barriers to infect an intermediate host in the pangolin (Manissp.), before crossing over to humans. It is of the same species as the SARS-CoV virus, the causative agent of the SARS outbreak in China in 2002–2003. The virus had long been undergoing mutations to reach the stage it has now, and, through the massive number of infections it has caused worldwide, has resulted in the emergence of several variants of the strain, each with their own set of overlapping and unique mutations. These are being monitored by the Global Initiative on Sharing Avian Influenza Data (GISAID), which has now additionally taken the burden of sharing all COVID-19 variant and lineage data, something that has enabled the surveillance of genomics information on the SARS-CoV-2 virus (GISAID—Initiative n.d.). Other than this, global measures to improve sanitation and overall public health have been strengthened to tackle this pandemic.

1.1.6

Broad Categorization of Factors and How to Solve Them

The emergence of a disease depends on several crucial factors. These are the factors which govern how a disease—viral or otherwise—rises within a population and goes on to affect a vast number of people. Broadly speaking, these factors can be categorized into three kinds. Firstly, come the factors that are inherent to the pathogen itself, i.e., factors of the emergent virus. These traits or characters enable the pathogen to have risen in importance as an agent capable of causing massive disease, due to them elevating the agent from the status of a disease in the background to one that may have gained the ability to infect more numbers of people or a different species of host. Factors that are inherent to the host under discussion, i.e., humans, are responsible for facilitating the emergence of disease agents. These are situations or conditions that have been brought about by humankind, the sort which enables a disease to spread more efficiently or rapidly, and thus infect more people or with worse medical consequences, such as worse clinical outcomes or higher death rates. Lastly, there are factors which are neither inherent to the virus or to the human host, but those which are in effect due to the environment itself. Nature provides a sandbox for pathogens to mutate and evolve, and these newly emergent pathogens, when they come in contact with human hosts due to their lives or livelihoods, cause diseases that may or may not have deadly outcomes. As such, the study of factors responsible for emergence of a disease is multifaceted, and it depends on these factors how emergence plays out. There lies a dear need for studying these factors, because it is the handling of them that will let us shape and deal with an emerging disease and its outbreaks in a timely and efficient manner. Factors are thus going to be discussed by first grouping them into three categories—the viral, human and environmental ones (Fig. 1.3).

1

Factors Contributing to the Emergence of Viral Diseases

35

Fig. 1.3 Pictorial summarization of all the factors to be discussed in this chapter

1.1.7

Viral Factors

1.1.7.1 Evolution In a lot of ways, the exact origins of viruses are still debated. Multiple groups have their own unique interpretations as to how the entities have come to be. Some researchers consider viruses to be the founders of cellular life, some others as parasitic reductive products of ancient cellular microbes and yet others as entities that escaped modern genomes (Nasir et al. 2012). Each interpretation ascribes to viruses distinct properties that govern cellular, molecular and overall biological significances, leading to distinct clinical, epidemiological and ecological consequences. Medium- and large-sized viruses have been shown to co-evolve with cellular ancestors and chose a reductive route of evolution. Research led to the discovery of this cellular co-evolution and a reductive evolution that ultimately led to restricted genomes, giving rise to virions that parasitize cellular life. Thus, viruses can be considered to have a great potential of evolution, one that may outdo the potentials of other organisms. We need to keep in mind that with the short generation times of viruses, these evolutionary activities proceed at a high rate from generation to generation. Even if viruses are not capable of replicating without a host body, it does not prevent them from undergoing crucial and drastic changes to eventually produce a significantly different entity than the one started out with. Changes are reflected within the viral genomes, and these can be both beneficial and

36

A. Gangopadhayya and P. L. Bhukya

detrimental (Stern and Andino 2016). The population size is yet another factor that contributes, combined with the short generation time. Deleterious mutations, however, create problems for a viral population, as it leads to the development of defective genomes, i.e., those which may not give rise to productively infective virions. Rate of mutation, size of a viral population, selection and multiplicity of infection are factors that modulate infection within a host and eventually the evolution of that viral population. These factors are in effect when transmission occurs to a novel susceptible host or as viruses establish infection in new host species as well. Evolution, therefore, is a multifactorial phenomenon, one which can lead to various consequences, both good and bad. Viruses being nearly ubiquitous makes them capable of inhabiting various kinds of host conditions, in a diverse range of hosts. Retroviruses make up nearly half our genomes and led to the development of the mammalian placenta. Viruses give us a clear evidence of the existence of an RNA world. The earliest replicating and evolving entities can be considered to be the ribozymes and the viroids (Moelling and Broecker 2019). These entities hint at information being conveyed through structure and not genetic code. Rickettsia, chloroplasts and mitochondria provide examples of bacteria that lost most of their genes and thus became endosymbionts. Even in vitro, how genes are lost may be traced right from coding RNA to non-coding RNA. This implies that the distinction between living and non-living entities may lie in nothing but an evolutionary continuum. As such, viruses may be considered as entities capable of evolving thoroughly and substantially, in manners that may prove them capable of feats such as adaptation to brand new hosts.

1.1.7.2 Host Range Expansion As evolution drives a viral population, the genotype and thus the phenotypic characteristics of the population keeps changing. The changing characteristics contribute to how the viruses differ in the way they interact with a given host, and also may change the way by which cognate receptors of new hosts are interacted with by the virus. This can be seen in the case of phages as well. Parallel evolution occurs when phage host adaptation takes place, and a phage can infect a brand-new host genotype (Hall et al. 2013). Increasing host range and divergence between populations occurs when a phage adapts to a host that is itself evolving. Through stepwise evolution involving multiple mutations, phage host adaptation occurs. Mutational availability, pleiotropic costs or ecological conditions at times impede the adaptation of phages to new hosts. But the phenomenon cannot be underestimated, and is very important to describe the changing capability of a pathogen in the environment. In a similar vein, experiments have been performed to assess the host adaptation in viruses competent at infecting humans. A civet strain of SARS-CoV had a mutation induced into its Receptor Binding Domain (RBD) within its Spike protein (Sheahan et al. 2008). While its ability to replicate within Vero cells became considerably impaired, the recombinant virus was found to produce two new strains when made to infect Human Airway Epithelial (HAE) cells. The strains showed enhanced growth on HAE cells and delayed brain tumour cells, and were found to be neutralized by a human monoclonal antibody, although

1

Factors Contributing to the Emergence of Viral Diseases

37

the parent virus was found to be eight times more resistant to this neutralization than the new strains. Therefore, such mutations exist that enhance the adaptability of a virus to a new host, and these are applicable to viruses of concern such as the Influenza virus. A study aimed to find mutations in the PA gene of the H5N1 influenza virus clade 2.2.1, which might result in the broadening of host range (Arai et al. 2020). Phylogeny-associated PA mutations were detected in the 2.2.1 virus, and it was found that the progeny 2.2.1.2 virus clade had increased replication in human cells and even in vivo in mice. The mutations increased viral replication competence in human and avian cells better at 33 °C than at 37 °C. Thus, such mutations have a major role in the accommodation to infect poultry and also in the adaptation to infect mammalian cells. This explains, therefore, that certain mutations may give rise to evolution that broadens the host range of a virus. These changes are important to note as the virus can thus infect new hosts, resulting in novel mutations that may result in the new host species, and depending on the population of the new host species, mutations may be aggravated with respect to their occurrence. This also has implications for other factors of the virus and its interaction with the host, changing the dynamics perhaps to the point of speciation.

1.1.7.3 Vector Adaptation A factor which is important in determining the extent of infection by a pathogen is the ability of it to be transmitted by a certain vector species. Vector species can be of various kinds, and among the arthropods, the most common vector species are the mosquitoes and ticks. The ability of a vector to effectively transmit a disease agent from one organism’s body to another is determined by how compatible the agent is with the vector being relied on. These include molecular factors that can decide the compatibility of a vector to its pathogen. Mosquitoes especially undergo adaptation to cope with various environmental stresses such as the use of pesticides, and whether these mutations somehow affect their compatibility with an existing or new pathogen should be something to be investigated. A mite species, the Varroa destructor, has been investigated with regard to its capability to transmit the Deformed Wing virus, a honeybee virus (Wilfert 2021). It is an important honeybee virus that has the potential to spill over into other pollinators and bee-associated insect species. High and low levels of the viral vector were investigated to see if it affects the viral loads and potential competition between two strains of the virus. This study revealed through a complex system that host-pathogen-vector interactions are subject to changes in transmission landscapes, and that these changes can result in altered dynamics between the host/vector and pathogen too. A disease can turn from an emerging one to an endemic through such conditions. An array of conditions may thus turn a situation where a pathogen is restricted to one vector into one where multiple vectors may be opted for. One study highlights how the Chikungunya virus (CHIKV) variant bearing the mutation E1-226V was tested for its genome evolution and fitness trade-offs by serially and alternatively passaging in the BHK-21 cell line and the Aedes aegypti derived Aag-2 cells (Arias-Goeta et al. 2014). The passaging was done for 30 times and then to check for constraints on viral evolution by the alternative passaging, in vitro and in vivo experiments were

38

A. Gangopadhayya and P. L. Bhukya

done for the strains obtained. Amino acid substitutions in the E2 glycoprotein were detected to be the differentiating points between the strains obtained, found especially at the sites for receptor binding. Two substitutions that were found at the positions 64 and 208 of the E2 protein were found to be responsible for lowering dissemination of the variant E1-226V in Ae. aegypti. So, these mutations may also affect the binding of virions to mosquito midgut epithelial cells in case of Ae. aegypti, but not in case of Aedes albopictus. Therefore, it is highly possible that mutative alterations result in changed affinity of a virus to the original vector and cause a shift in the major vector the virus may use. Other studies have pointed towards the alternative methods of vector adaptation by the virus, caused experimentally. The Dengue virus serotype 1 (DENV-1) was experimentally passaged serially in vivo in Ae. albopictus for ten times (Bellone et al. 2020). It was found that the strains obtained had increased infectivity for the Ae. albopictus species in vivo and even in in vitro cell lines obtained from Ae. albopictus. Multiple adaptive mutations in the DENV-1 genome led to this phenotype, including one at the 10,418th position, at the 3′ Untranslated Region (UTR), inside a stem-loop structure necessary for subgenomic flavivirus RNA production. However, it is not just this mutation that solely makes the virus more effective with respect to its transmission efficiency in Ae. albopictus in vivo, as found through reverse genetics. What we may understand from these studies is that it is possible for mutational changes to produce alterations in the genomes of viruses, leading to changes in how they choose vectors. The usage of multiple vector species by a single viral species may also have emerged from an initially single vector the virus had been compatible with. Further research may reveal such trends happening in real time and lead to better prediction of epidemics.

1.1.7.4 Resistance Development to Drugs One major challenge to the tackling of any emerging disease is the development of drug resistance within the pathogen. This can be an inherent property of the pathogen’s genome, caused due to mutations arising within it that confers different sites of action for the drug than initially was. For viral diseases, the proteins of the virus itself are targeted mainly, as the structural or non-structural components of the virus’s proteome make for useful drug targets employable for therapeutic courses of action. Some viral diseases have grown to become major public health concerns due to the resistance to antivirals that have concurrently arisen within them. Three classic examples of this would be the HIV, the Hepatitis B virus (HBV) and Influenza A virus. In case of the HIV, genetic barrier to resistance is a useful factor to consider when determining a regimen for antiretrovirals (ARVs) (Tang and Shafer 2012). So, in case of a regimen, its success depends on the ARVs used and the genetic barrier to resistance. ARV resistance can impair responses in patients with transmitted resistance, initial treatment failure and virological failure. For this reason, genotypic resistance is being tested in individuals so as to design better regimens for therapy. Patients with transmitted drug resistance have the genotypes tested with respect to wild-type viruses, in order to shape virological response. Minority variant viruses with unique mutations may also arise within them, and to tackle these, a protease

1

Factors Contributing to the Emergence of Viral Diseases

39

inhibitor may need to be used, i.e., the drug class with highest genetic barrier to resistance. The HIV, therefore, has an array of resistance development that may occur and pose impediments to the application of ARV regimens. In the case of HBV, some of the concerns coincide with those of HIV, due to similar reverse transcription strategies being used in both. High rate of mutations can occur with HBV and this leads to selection of mutants under the pressure of anti-HBV drug treatment (Ghany and Doo 2009). A high level of resistance has been found in patients on a lamivudine regimen, in about 76% of patients being treated for 5 years or more. Adefovir seems to result in resistance development in about 30% of patients at the end of 5 years, while on the other hand tenofovir and entecavir treatment have resulted in resistance in merely 98] 27,500,000 [26500000–27,700,000] 73 [56–88] 24,900,000 66 [53–79]

HIV human immunodeficiency virus, AIDS acquired immunodeficiency syndrome, ART antiretroviral therapy (AIDSinfo | UNAIDS n.d.)

1

Factors Contributing to the Emergence of Viral Diseases

59

example, the various haemorrhagic fever viruses, prime among which is the EBOV. Since it has become such a large threat for such large groups of people, significant research has been carried out to better understand the pathogen, and has thus brought to light the common pathogenic mechanisms that EBOV and others like the Marburg virus (MARV), RVFV, the Lassa fever virus (LASV), arenaviruses, CCHFV and the YFV share (Geisbert and Jahrling 2004). One important mechanism seems to be the inactivation of immune cells that mount a timely antiviral immune response against these pathogens. The more research is carried out on such novel viruses, the more information we shall have at our perusal if and when epidemics caused by them come to happen. But one must keep this pace of research up if they wish to see adequate generation of data for the purpose of building up future strategies. Publications regarding the SARS-CoV, MERS-CoV and SARS-CoV-2 have inflated in these past years, and these coronaviruses are understudied compared to other emergent viruses. There is always a landslide of publications focusing on a particular virus right after an epidemic, but the numbers wane in subsequent years, which should not ideally be if sufficient information needs to be gathered on novel emergent viruses. A pressing need exists to appropriately survey and monitor the environment for novel pathogens, many of which arise as zoonoses. As mentioned earlier, increased urbanization and changes to niches for a virus’s primary host are what majorly disturb the balance between pathogens and their ecosystem (Howard and Fletcher 2019). Especially in the case of RNA viruses, rapid and unpredictable mutations can lead to selection of new variants in situations of target species evolution, and the immunological or species barriers that come about as a blockade to new host adaptation can thus be easily overcome. Nowadays, mathematical modelling and spatial epidemiology can help in better predicting the emergence of a virus through possible future outbreaks. As humans, we are constantly in the attempt of developing universal strategies to deal with the many kinds of evolving viral pathogens the world over. Such pathogens are likely to arise as zoonoses or via vectors carrying arboviruses over into the human population (Graham and Sullivan 2017). In order to meet the United Nations Sustainable Development Goals, efficient strategies are required to be put in place to better manage emergent viral epidemics. These will, in turn, help in better shaping the Sustainable Development Goals towards eliminating these infectious diseases. Certain technologies have already come into effect for preparing us rapidly for novel pathogens. The Vero cell line has become a widely used and reliable platform for the development of whole virus inactivated vaccines, such as the polio vaccine (Barrett et al. 2017). These cells have been used to produce vaccines for pandemic influenza strains, CHIKV, WNV, Ross river virus, SARS, etc. This particular cell line, having been widely studied and with extensive data available for the cell matrix, makes it an ideal candidate for vaccine production and prone to approval for new viruses. Emerging disease study needs to be not only extensive and in-depth, but also multifaceted. Some estimates place the origin of about 75% novel viral pathogens to be animals, i.e., zoonotic in origin (Pekosz and Glass 2008). Direct or indirect close contact of such carrier animals with human populations often leads to the spillover of new viruses into our communities. While human activities are very important to keep tabs on, inherent pathogenic

60

A. Gangopadhayya and P. L. Bhukya

characteristics like genetic changes also lead to the possibility of them infecting new hosts, and eventually cause localized or global outbreaks.

1.1.11 Conclusion The entire field of emerging disease study depends on the event of the investigator understanding the urgency and importance of it all. While some diseases have become endemic in certain populations, emerging diseases should mostly be controlled and curbed to the best of our abilities. With so much advancement in technology and constantly updating policy-making procedures, we have come to the forefront of our capabilities. While some diseases take years and decades to transform into massive proportions, others may take mere months. Examples of several such diseases will be found in the chapters of this book, and so will mentions of certain illnesses that are yet to cause havoc in the world at large. These pathogens come about in various shapes and forms, hailing from multiple genera and families, capable of causing symptoms in humans that are sometimes common and sometimes differing by the viral species level. We can find several pieces of evidence throughout history of dangerous viral pathogens emerging and laying entire populations to waste. Now, with time, humanity has evolved to better understand its biological enemies—the pathogens that threaten them—and developed itself to combat these threats better. Now, with all this information in our arsenal, and with research advancing by leaps & bounds, the combat against emerging threats can become easier, and actually lead to fruitful results. With this in mind, our understanding of viruses can become more profound, and we may be able to catch up with viral evolution and our own activities that produce an environment ripe for the emergence of novel viral pathogens into the human population.

References 10 infectious diseases that could be the next pandemic | Gavi, the Vaccine Alliance (n.d.). https:// www.gavi.org/vaccineswork/10-infectious-diseases-could-be-next-pandemic. Accessed 29 Nov 2021 1957–1958 Pandemic (H2N2 virus) | Pandemic Influenza (Flu) | CDC (n.d.). https://www.cdc.gov/ flu/pandemic-resources/1957-1958-pandemic.html. Accessed 22 Nov 2021 1968 Pandemic (H3N2 virus) | Pandemic Influenza (Flu) | CDC (n.d.). https://www.cdc.gov/flu/ pandemic-resources/1968-pandemic.html. Accessed 22 Nov 2021 A Timeline of HIV and AIDS | HIV.gov. n.d.. https://www.hiv.gov/hiv-basics/overview/history/ hiv-and-aids-timeline. Accessed 22 Nov 2021 Abdool Karim SS, de Oliveira T (2021) New SARS-CoV-2 variants—clinical, public health, and vaccine implications. N Engl J Med 384(19):1866–1868. https://doi.org/10.1056/ NEJMC2100362/SUPPL_FILE/NEJMC2100362_APPENDIX.PDF Acuna-Soto R, Stahle DW, Cleaveland MK, Therrell MD (2002) Megadrought and megadeath in 16th century Mexico. Emerg Infect Dis 8(4):360–362. https://doi.org/10.3201/EID0804.010175

1

Factors Contributing to the Emergence of Viral Diseases

61

Acuna-Soto R, Stahle DW, Therrell MD, Griffin RD, Cleaveland MK (2004) When half of the population died: the epidemic of hemorrhagic fevers of 1576 in Mexico. FEMS Microbiol Lett 240(1):1–5. https://doi.org/10.1016/J.FEMSLE.2004.09.011 Adelodun B, Ajibade FO, Ighalo JO, Odey G, Ibrahim RG, Kareem KY, Bakare HO, Tiamiyu AGO, Ajibade TF, Abdulkadir TS, Adeniran KA, Choi KS (2021) Assessment of socioeconomic inequality based on virus-contaminated water usage in developing countries: a review. Environ Res 192:110309. https://doi.org/10.1016/J.ENVRES.2020.110309 AIDSinfo | UNAIDS (n.d.). https://aidsinfo.unaids.org/. Accessed 24 July 2022 Alfani G (2013) Plague in seventeenth-century Europe and the decline of Italy: an epidemiological hypothesis. Eur Rev Econ Hist 17(4):408–430. https://doi.org/10.1093/EREH/HET013 Antonine Plague—World History Encyclopedia (n.d.). https://www.worldhistory.org/Antonine_ Plague/. Accessed 21 Nov 2021 Arai Y, Kawashita N, Elgendy EM, Ibrahim MS, Daidoji T, Ono T, Takagi T, Nakaya T, Matsumoto K, Watanabe Y (2020) PA mutations inherited during viral evolution act cooperatively to increase replication of contemporary H5N1 influenza virus with an expanded host range. J Virol 95(1):e01582–e01520. https://doi.org/10.1128/JVI.01582-20/ASSET/ 919562BE-46EF-4041-A91C-96EBB9EB257E/ASSETS/GRAPHIC/JVI.01582-20-F0009. JPEG Arias-Goeta C, Moutailler S, Mousson L, Zouache K, Thiberge JM, Caro V, Rougeon F, Failloux AB (2014) Chikungunya virus adaptation to a mosquito vector correlates with only few point mutations in the viral envelope glycoprotein. Infect Genet Evol 24:116–126. https://doi.org/10. 1016/J.MEEGID.2014.03.015 Arnold MM, Patton JT (2009) Rotavirus antagonism of the innate immune response. Viruses 1(3): 1035–1056. https://doi.org/10.3390/V1031035 Balde C, Lam M, Bah A, Bowong S, Tewa JJ (2019) Theoretical assessment of the impact of environmental contamination on the dynamical transmission of polio. Int J Biomath 12(2): 1950012. https://doi.org/10.1142/S1793524519500128 Baltimore D (1971) Expression of animal virus genomes. Bacteriol Rev 35(3):235–241 Banks J, Speidel ES, Moore E, Plowright L, Piccirillo A, Capua I, Cordioli P, Fioretti A, Alexander DJ (2001) Changes in the haemagglutinin and the neuraminidase genes prior to the emergence of highly pathogenic H7N1 avian influenza viruses in Italy. Arch Virol 146:963–973 Barrett PN, Terpening SJ, Snow D, Cobb RR, Kistner O (2017) Vero cell technology for rapid development of inactivated whole virus vaccines for emerging viral diseases. Expert Rev Vaccines 16(9):883–894. https://doi.org/10.1080/14760584.2017.1357471 Basker P, Kannan P, Porkaipandian RT, Saravanan S, Sridharan S, Kadhiresan M (2013) Study on entomological surveillance and its significance during a dengue outbreak in the district of Tirunelveli in Tamil Nadu, India. Osong Public Health Res Perspect 4(3):152–158. https:// doi.org/10.1016/J.PHRP.2013.04.005 Bellone R, Lequime S, Jupille H, Göertz GP, Aubry F, Mousson L, Piorkowski G, Yen PS, Gabiane G, Vazeille M, Sakuntabhai A, Pijlman GP, de Lamballerie X, Lambrechts L, Failloux AB (2020) Experimental adaptation of dengue virus 1 to Aedes albopictus mosquitoes by in vivo selection. Sci Rep 10(1):1–17. https://doi.org/10.1038/s41598-020-75042-4 Bramanti B, Dean KR, Walløe L, Stenseth NC (2019) The third plague pandemic in Europe. Proc R Soc B 286(1901):20182429. https://doi.org/10.1098/RSPB.2018.2429 Bronze MS, Huycke MM, Machado LJ, Voskuhl GW, Greenfield RA (2002) Viral agents as biological weapons and agents of bioterrorism. Am J Med Sci 323(6):316–325. https://doi. org/10.1097/00000441-200206000-00004 Brown VR, Bevins SN (2017) A review of virulent Newcastle disease viruses in the United States and the role of wild birds in viral persistence and spread. Vet Res 48(1):1–15. https://doi.org/10. 1186/S13567-017-0475-9/FIGURES/3 Buettcher M, Heininger U (2010) Prospective surveillance of nosocomial viral infections during and after hospitalization at a university children’s hospital. Pediatr Infect Dis J 29(10):950–956. https://doi.org/10.1097/INF.0B013E3181E32D97

62

A. Gangopadhayya and P. L. Bhukya

Burrell CJ, Howard CR, Murphy FA (2017a) History and impact of virology. In: Fenner and White’s medical virology. Elsevier. https://doi.org/10.1016/B978-0-12-375156-0.00001-1 Burrell CJ, Howard CR, Murphy FA (2017b) Laboratory diagnosis of virus diseases. In: Fenner and White’s medical virology, vol 9, p 135. https://doi.org/10.1016/B978-0-12-375156-0.00010-2 Calzolari M, Angelini P, Bolzoni L, Bonilauri P, Cagarelli R, Canziani S, Cereda D, Cerioli MP, Chiari M, Galletti G, Moirano G, Tamba M, Torri D, Trogu T, Albieri A, Bellini R, Lelli D (2020) Enhanced West Nile virus circulation in the Emilia-Romagna and Lombardy regions (northern Italy) in 2018 detected by entomological surveillance. Front Vet Sci 7:243. https://doi. org/10.3389/FVETS.2020.00243/BIBTEX Cancellotti FM, Renzi M (1991) Epidemiology and current situation of viral haemorrhagic disease of rabbits and the European brown hare syndrome in Italy. Rev Sci Tech 10(2):409–422. https:// doi.org/10.20506/RST.10.2.558 Carratalà A, Joost S (2019) Population density and water balance influence the global occurrence of hepatitis E epidemics. Sci Rep 9(1):1–10. https://doi.org/10.1038/s41598-019-46475-3 Chapter 10: Controlling the spread of infectious diseases. (n.d.) Chapter 9. Ebola Virus Disease | Elsevier Enhanced Reader (n.d.). https://reader.elsevier.com/ reader/sd/pii/B9780124169753000091?token=996CFD7DF275B1FD3BDBF8F42244 8E79D6D883475E000C88B12B248336891B1AD093F002A9C3030517A65F23E4EE33 ED&originRegion=eu-west-1&originCreation=20211121144903. Accessed 21 Nov 2021 Chun J, Ko Y-H, Kim D-H (2020) Transcriptome analysis of Cryphonectria parasitica infected with Cryphonectria hypovirus 1 (CHV1) reveals distinct genes related to fungal metabolites, virulence, antiviral RNA-silencing, and their regulation. Front Microbiol 11:1711. https://doi.org/ 10.3389/FMICB.2020.01711 Cleaveland S, Appel MGJ, Chalmers WSK, Chillingworth C, Kaare M, Dye C (2000) Serological and demographic evidence for domestic dogs as a source of canine distemper virus infection for Serengeti wildlife. Vet Microbiol 72(3–4):217–227. https://doi.org/10.1016/S0378-1135(99) 00207-2 Coil DA, Miller AD (2004) Phosphatidylserine is not the cell surface receptor for vesicular stomatitis virus. J Virol 78(20):10920–10926. https://doi.org/10.1128/JVI.78.20.10920-10926. 2004 Coronavirus Death Toll and Trends - Worldometer. (n.d.). https://www.worldometers.info/ coronavirus/coronavirus-death-toll/. Accessed 22 Nov 2021 Costa LC, Veiga RV, Oliveira JF, Rodrigues MS, Andrade RFS, Paixão ES, Teixeira MG, da Conceição N Costa M, Cardim LL, Carmo EH, Oliveira WK, Gonçalves JÍK, Fernandes QHRF, Barreto ML, Queiroz ATL, Gräf T (2020) New insights on the Zika virus arrival in the Americas and spatiotemporal reconstruction of the epidemic dynamics in Brazil. Viruses 13(1):12. https:// doi.org/10.3390/V13010012 Crosby AW (2019) The COLUMBIAN exchange. The New World History, pp 427–434. https:// doi.org/10.1525/9780520964297-049/HTML Cruz-Pacheco G, Esteva L, Vargas C (2009) Seasonality and outbreaks in West Nile virus infection. Bull Math Biol 71(6):1378–1393. https://doi.org/10.1007/S11538-009-9406-X Delhi govt launches mass awareness campaign against dengue; check details—The Financial Express (n.d.). https://www.financialexpress.com/lifestyle/health/delhi-govt-launches-massawareness-campaign-against-dengue-check-details/2076154/. Accessed 25 Nov 2021 Diseases Notifiable to the OIE (n.d.). https://web.archive.org/web/20070313233223/http://www. oie.int/eng/maladies/en_classification.htm. Accessed 27 Nov 2021 Elliott RM (2009) Bunyaviruses and climate change. Clin Microbiol Infect 15(6):510–517. https:// doi.org/10.1111/J.1469-0691.2009.02849.X Ergunay K, Gunay F, Erisoz Kasap O, Oter K, Gargari S, Karaoglu T, Tezcan S, Cabalar M, Yildirim Y, Emekdas G, Alten B, Ozkul A (2014) Serological, molecular and entomological surveillance demonstrates widespread circulation of West Nile virus in Turkey. PLoS Negl Trop Dis 8(7):e3028. https://doi.org/10.1371/JOURNAL.PNTD.0003028

1

Factors Contributing to the Emergence of Viral Diseases

63

Falagas ME, Zarkadoulia EA, Pliatsika PA, Panos G (2008) Socioeconomic status (SES) as a determinant of adherence to treatment in HIV infected patients: a systematic review of the literature. Retrovirology 5:13. https://doi.org/10.1186/1742-4690-5-13 Falkow S (1988) Molecular Koch’s postulates applied to microbial pathogenicity. Rev Infect Dis 10:S274–S276 Fischer MG, Hackl T (2016) Host genome integration and giant virus-induced reactivation of the virophage mavirus. Nature 540:288–291. https://doi.org/10.1038/nature20593 Fitzgerald B, MacKenzie, W. R., Rasmussen SA, Leahy MA, Martinroe JC, Spriggs SR, Yang T, Doan QM, King PH, Maitland PD, Starr TM, Yang M, Jones TF, Boulton ML, Caine VA, Daniel KL, Fielding JE, Fleming DW, Halperin WE, . . ., Schaffner W (2016) Morbidity and Mortality Weekly Report-United States Morbidity and Mortality Weekly Report Centers for Disease Control and Prevention MMWR Editorial and Production Staff (Serials) MMWR Editorial Board. https://wonder.cdc.gov Flynn JL, Chan J (2001) Tuberculosis: latency and reactivation. Infect Immun 69(7):4195–4201. https://doi.org/10.1128/IAI.69.7.4195-4201.2001 Flynn NM, Hoeprich PD, Kawachi MM, Lee KK, Lawrence RM, Goldstein E, Jordan GW, Kundargi RS, Wong GA (1979) An unusual outbreak of windborne coccidioidomycosis. N Engl J Med 301(7):358–361. https://doi.org/10.1056/NEJM197908163010705 Fraenkel-Conrat H, Singer B (1964) Reconstitution of tobacco mosaic virus. IV. Inhibition by enzymes and other proteins, and use of polynucleotides. Virology 23:354–362 Franklinos LHV, Jones KE, Redding DW, Abubakar I (2019) The effect of global change on mosquito-borne disease. Lancet Infect Dis 19(9):e302–e312. https://doi.org/10.1016/S14733099(19)30161-6 Geisbert TW, Jahrling PB (2004) Exotic emerging viral diseases: progress and challenges. Nat Med 10(12):S110–S121. https://doi.org/10.1038/nm1142 George DB, Webb CT, Farnsworth ML, O’Shea TJ, Bowen RA, Smith DL, Stanley TR, Ellison LE, Rupprecht CE (2011) Host and viral ecology determine bat rabies seasonality and maintenance. Proc Natl Acad Sci U S A 108(25):10208–10213. https://doi.org/10.1073/PNAS.1010875108 Ghany MG, Doo EC (2009) Antiviral resistance and hepatitis B therapy. Hepatology 49(S5):S174– S184. https://doi.org/10.1002/HEP.22900 GISAID—Initiative (n.d.). https://www.gisaid.org/. Accessed 30 Nov 2021 Global Influenza Surveillance and Response System (GISRS) (n.d.). https://www.who.int/ initiatives/global-influenza-surveillance-and-response-system. Accessed 24 Nov 2021 Gomez CA, Pinsky BA, Liu A, Banaei N (2017) Delayed diagnosis of tuberculous meningitis misdiagnosed as herpes simplex virus-1 encephalitis with the FilmArray syndromic polymerase chain reaction panel. Open Forum Infect Dis 4(1):ofw245. https://doi.org/10.1093/OFID/ OFW245 Graham BS, Sullivan NJ (2017) Emerging viral diseases from a vaccinology perspective: preparing for the next pandemic. Nat Immunol 19(1):20–28. https://doi.org/10.1038/s41590-017-0007-9 Green MS, LeDuc J, Cohen D, Franz DR (2019) Confronting the threat of bioterrorism: realities, challenges, and defensive strategies. Lancet Infect Dis 19(1):e2–e13. https://doi.org/10.1016/ S1473-3099(18)30298-6 Gubler DJ (2011) Dengue, urbanization and globalization: the unholy trinity of the 21st century. Trop Med Health 39(4 Suppl):S3–S11. https://doi.org/10.2149/TMH.2011-S05 Guo F, Bonebrake TC, Gibson L (2018) Land-use change alters host and vector communities and may elevate disease risk. EcoHealth 16(4):647–658. https://doi.org/10.1007/S10393-0181336-3 Hall JPJ, Harrison E, Brockhurst MA (2013) Viral host-adaptation: insights from evolution experiments with phages. Curr Opin Virol 3(5):572–577. https://doi.org/10.1016/J.COVIRO. 2013.07.001 Hashemi Shahraki A, Carniel E, Mostafavi E (2016) Plague in Iran: its history and current status. Epidemiol Health 38:e2016033. https://doi.org/10.4178/EPIH.E2016033 Health Regulations Third Edition 2005 (n.d.)

64

A. Gangopadhayya and P. L. Bhukya

Hellard ME, Hocking JS, Crofts N (2004) The prevalence and the risk behaviours associated with the transmission of hepatitis C virus in Australian correctional facilities. Epidemiol Infect 132(3):409–415. https://doi.org/10.1017/S0950268803001882 Hershey AD, Chase M (1952) Independent functions of viral protein and nucleic acid in growth of bacteriophage. J Gen Physiol 36(1):39–56. https://doi.org/10.1085/jgp.36.1.39 HIV/AIDS (n.d.). https://www.who.int/news-room/fact-sheets/detail/hiv-aids. Accessed 30 Nov 2021 Horimoto T, Rivera E, Pearson J, Senne D, Krauss S, Kawaoka Y, Webster RG (1995) Origin and molecular changes associated with emergence of a highly pathogenic H5N2 influenza virus in Mexico. Virology 213(1):223–230. https://doi.org/10.1006/VIRO.1995.1562 Howard CR, Fletcher NF (2019) Emerging virus diseases: can we ever expect the unexpected? 1. https://doi.org/10.1038/EMI.2012.47 Ida-Hosonuma M, Iwasaki T, Yoshikawa T, Nagata N, Sato Y, Sata T, Yoneyama M, Fujita T, Taya C, Yonekawa H, Koike S (2005) The alpha/Beta interferon response controls tissue tropism and pathogenicity of poliovirus. J Virol 79(7):4460. https://doi.org/10.1128/JVI.79.7. 4460-4469.2005 Influenza (Seasonal) (n.d.). https://www.who.int/news-room/fact-sheets/detail/influenza-(seasonal). Accessed 30 Nov 2021 Johnson N (2013) A short introduction to disease emergence. In: The role of animals in emerging viral diseases. Elsevier. https://doi.org/10.1016/B978-0-12-405191-1.00001-6 Johnson N, Cunningham AF, Fooks AR (2010) The immune response to rabies virus infection and vaccination. Vaccine 28(23):3896–3901. https://doi.org/10.1016/J.VACCINE.2010.03.039 Johnson N, Aréchiga-Ceballos N, Aguilar-Setien A (2014) Vampire bat rabies: ecology, epidemiology and control. Viruses 6(5):1911–1928. https://doi.org/10.3390/V6051911 Kassak K, Mahfoud Z, Kreidieh K, Shamra S, Afifi R, Ramia S, Kassak K, Mahfoud Z, Kreidieh K, Shamra S, Afifi R, Ramia S (2011) Hepatitis B virus and hepatitis C virus infections among female sex workers and men who have sex with men in Lebanon: prevalence, risk behaviour and immune status. Sex Health 8(2):229–233. https://doi.org/10.1071/SH10080 Kaur G, Mehra N (2009) Genetic determinants of HIV-1 infection and progression to AIDS: immune response genes. Tissue Antigens 74(5):373–385. https://doi.org/10.1111/J. 1399-0039.2009.01337.X Khosrawipour V, Lau H, Khosrawipour T, Kocbach P, Ichii H, Bania J, Mikolajczyk A (2020) Failure in initial stage containment of global COVID-19 epicenters. J Med Virol 92(7):863–867. https://doi.org/10.1002/JMV.25883 Kim H, Webster RG, Webby RJ (2018) Influenza virus: dealing with a drifting and shifting pathogen. Viral Immunol 31(2):174–183. https://doi.org/10.1089/VIM.2017.0141/ASSET/ IMAGES/LARGE/FIGURE2.JPEG King A (2020) An uncommon cold. New Scientist 246(3280):32. https://doi.org/10.1016/S02624079(20)30862-9 Kopp A, Gillespie TR, Hobelsberger D, Estrada A, Harper JM, Miller RA, Eckerle I, Müller MA, Podsiadlowski L, Leendertz FH, Drosten C, Junglen S (2013) Provenance and geographic spread of St. Louis encephalitis virus. mBio 4(3):e00322–e00313. https://doi.org/10.1128/ MBIO.00322-13/SUPPL_FILE/MBO003131536SD4.DOC Kuhn JH (2021) Virus taxonomy. In: Encyclopedia of virology, pp 28. https://doi.org/10.1016/ B978-0-12-809633-8.21231-4 Kumar Verma R, Collumbien M (2004) Homosexual activity among rural Indian men: implications for HIV interventions. Res Lett AIDS 18:1845–1856 la Scola B, Desnues C, Pagnier I, Robert C, Barrassi L, Fournous G, Merchat M, Suzan-Monti M, Forterre P, Koonin E (2008) The virophage as a unique parasite of the giant mimivirus. Nature 455(7209):100–104 Laeyendecker O, Brookmeyer R, Oliver AE, Mullis CE, Eaton KP, Mueller AC, Jacobson LP, Margolick JB, Brown J, Rinaldo CR, Quinn TC, Eshleman SH (2012) Factors associated with

1

Factors Contributing to the Emergence of Viral Diseases

65

incorrect identification of recent HIV infection using the BED capture immunoassay. AIDS Res Hum Retroviruses 28(8):816–822. https://doi.org/10.1089/AID.2011.0258 Lefkowitz EJ, Dempsey DM, Hendrickson RC, Orton RJ, Siddell SG, Smith DB (2018) Virus taxonomy: the database of the International Committee on Taxonomy of Viruses (ICTV). Nucleic Acids Res 46(D1):D708–D717. https://doi.org/10.1093/NAR/GKX932 Legendre M, Fabre E, Poirot O, Jeudy S, Lartigue A, Alempic J-M, Beucher L, Philippe N, Bertaux L, Christo-Foroux E, Labadie K, Couté Y, Abergel C, Claverie J-M (2018) Diversity and evolution of the emerging Pandoraviridae family. Nat Commun 9(1):2285. https://doi.org/ 10.1038/s41467-018-04698-4 Lieberman PM (2016) Epigenetics and genetics of viral latency. Cell Host Microbe 19(5):619–628. https://doi.org/10.1016/J.CHOM.2016.04.008 LIST OF VRDLS AND THEIR CONTACT DETAILS. (n.d.) Liu J, Sun Y, Shi W, Tan S, Pan Y, Cui S, Zhang Q, Dou X, Lv Y, Li X, Li X, Chen L, Quan C, Wang Q, Zhao Y, Lv Q, Hua W, Zeng H, Chen Z et al (2017) The first imported case of Rift Valley fever in China reveals a genetic reassortment of different viral lineages. Emerg Microbes Infect 6(1):e4. https://doi.org/10.1038/EMI.2016.136/SUPPL_FILE/TEMI_A_12040101_ SM0004.JPG Luyt CE, Combes A, Nieszkowska A, Trouillet JL, Chastre J (2008) Viral infections in the ICU. Curr Opin Crit Care 14(5):605–608. https://doi.org/10.1097/MCC.0B013E32830F1E12 Marston HD, Folkers GK, Morens DM, Fauci AS (2014) Emerging viral diseases: confronting threats with new technologies. Sci Transl Med 6(253):253ps10. https://doi.org/10.1126/ SCITRANSLMED.3009872 Mayr A (2003) Smallpox vaccination and bioterrorism with pox viruses. Comp Immunol Microbiol Infect Dis 26(5–6):423–430. https://doi.org/10.1016/S0147-9571(03)00025-0 Meshnick SR (2002) Artemisinin: mechanisms of action, resistance and toxicity. Int J Parasitol 32(13):1655–1660. https://doi.org/10.1016/S0020-7519(02)00194-7 Miller JA (1989) Diseases for our future. Bioscience 39(8):509–517. https://doi.org/10.2307/ 1310972 Moelling K, Broecker F (2019) Viruses and evolution—viruses first? A personal perspective. Front Microbiol 10:523. https://doi.org/10.3389/FMICB.2019.00523/BIBTEX Mordechai L, Eisenberg M, Newfield TP, Izdebski A, Kay JE, Poinar H (2019) The Justinianic plague: an inconsequential pandemic? Proc Natl Acad Sci U S A 116(51):25546–25554. https:// doi.org/10.1073/PNAS.1903797116/-/DCSUPPLEMENTAL Morgan RK, Summer R (2008) Chronic obstructive pulmonary disease. International Encyclopedia of Public Health, pp 709–717. https://doi.org/10.1016/B978-012373960-5.00213-6 Moriyama M, Hugentobler WJ, Iwasaki A (2020) Seasonality of respiratory viral infections. Annu Rev Virol 7(1):83–101. https://doi.org/10.1146/ANNUREV-VIROLOGY-012420-022445 Nasir A, Kim KM, Caetano-Anollés G (2012) Viral evolution: primordial cellular origins and late adaptation to parasitism. Mob Genet Elem 2(5):247. https://doi.org/10.4161/MGE.22797 Nationally Notifiable Diseases | Healthy Water | CDC. (n.d.). https://www.cdc.gov/healthywater/ statistics/surveillance/notifiable.html. Accessed 27 Nov 2021 Nicoll MP, Proença JT, Efstathiou S (2012) The molecular basis of herpes simplex virus latency. FEMS Microbiol Rev 36(3):684–705. https://doi.org/10.1111/J.1574-6976.2011.00320.X Niedrig M, Schmitz H, Becker S, Günther S, ter Meulen J, Meyer H, Ellerbrok H, Nitsche A, Gelderblom HR, Drosten C (2004) First international quality assurance study on the rapid detection of viral agents of bioterrorism. J Clin Microbiol 42(4):1753–1755. https://doi.org/10. 1128/JCM.42.4.1753-1755.2004 Norris DE (2004) Mosquito-borne diseases as a consequence of land use change. EcoHealth 1(1): 19–24. https://doi.org/10.1007/S10393-004-0008-7 Notifiable disease—Wikipedia (n.d.). https://en.wikipedia.org/wiki/Notifiable_disease. Accessed 27 Nov 2021 Origin of HIV & AIDS | Avert (n.d.). https://www.avert.org/professionals/history-hiv-aids/origin. Accessed 21 Nov 2021

66

A. Gangopadhayya and P. L. Bhukya

Pandemic and epidemic-prone diseases | OpenWHO. (n.d.). https://openwho.org/courses/ pandemic-epidemic-diseases. Accessed 29 Nov 2021 Patil PK, Geetha R, Ravisankar T, Avunje S, Solanki HG, Abraham TJ, Vinoth SP, Jithendran KP, Alavandi SV, Vijayan KK (2021) Economic loss due to diseases in Indian shrimp farming with special reference to Enterocytozoon hepatopenaei (EHP) and white spot syndrome virus (WSSV). Aquaculture 533(736231). https://doi.org/10.1016/J.AQUACULTURE.2020.736231 Patterson KD (1993) Typhus and its control in Russia, 1870-1940. Med Hist 37(4):361–381. https:// doi.org/10.1017/S0025727300058725 Peccia J, Zulli A, Brackney DE, Grubaugh ND, Kaplan EH, Casanovas-Massana A, Ko AI, Malik AA, Wang D, Wang M, Warren JL, Weinberger DM, Arnold W, Omer SB (2020) Measurement of SARS-CoV-2 RNA in wastewater tracks community infection dynamics. Nat Biotechnol 38(10):1164–1167. https://doi.org/10.1038/s41587-020-0684-z Pedrosa PBS, Cardoso TAO (2011) Viral infections in workers in hospital and research laboratory settings: a comparative review of infection modes and respective biosafety aspects. Int J Infect Dis 15(6):e366–e376. https://doi.org/10.1016/J.IJID.2011.03.005 Pekosz A, Glass GE (2008) Emerging viral diseases. Maryland Med 9(1):11. /pmc/articles/ PMC2496997/ Pillai VS, Krishna G, Veettil MV (2020) Nipah virus: past outbreaks and future containment. Viruses 12(4):465. https://doi.org/10.3390/V12040465 Pollitzer R, Williams Hooper Foundation Group, Swaroop S, Burrows W (n.d.) Statistical studies section. World Health Organization Prevention & Control of Viral Hepatitis Infection: Framework for Global Action (2012) Printable Diseases of Public Health Significance List | Thunder Bay District Health Unit (n.d.). https://www.tbdhu.com/resource/printable-diseases-of-public-health-significance-list. Accessed 26 Nov 2021 Rhodes C (2009) Consequences of failure to apply international standards for laboratory biosafety and biosecurity: the 2007 foot-and-mouth disease outbreak in the UK. Appl Biosafety 14(3): 144–149. https://doi.org/10.1177/153567600901400306 Riedel S (2005) Edward Jenner and the history of smallpox and vaccination. Proc (Bayl Univ Med Cent) 18(1):21–25. https://doi.org/10.1080/08998280.2005.11928028 Rohayem J (2009) Norovirus seasonality and the potential impact of climate change. Clin Microbiol Infect 15(6):524–527. https://doi.org/10.1111/J.1469-0691.2009.02846.X Rosenthal J (2010) Climate change and the geographic distribution of infectious diseases. EcoHealth 6(4):489–495. https://doi.org/10.1007/S10393-010-0314-1 Roy S, Vandenberghe LH, Kryazhimskiy S, Grant R, Calcedo R, Yuan X, Keough M, Sandhu A, Wang Q, Medina-Jaszek CA, Plotkin JB, Wilson JM (2009) Isolation and characterization of adenoviruses persistently shed from the gastrointestinal tract of non-human primates. PLoS Pathog 5(7):e1000503. https://doi.org/10.1371/JOURNAL.PPAT.1000503 Sami SM, Salama II, Elmosalami DM, Abdel-Latif GA, Abdel Hamid AT (2015) Knowledge of and risky behaviours towards hepatitis B virus infection among Egyptian school children. Arab J Gastroenterol 16(3–4):94–98. https://doi.org/10.1016/J.AJG.2015.09.002 Sauder C (2018) Presbyphonia. https://doi.org/10.1044/persp3.SIG3.19 Scasciamacchia S, Serrecchia L, Giangrossi L, Garofolo G, Balestrucci A, Sammartino G, Fasanella A (2012) Plague epidemic in the kingdom of Naples, 1656–1658. Emerg Infect Dis 18(1):186. https://doi.org/10.3201/EID1801.110597 Schlegel R, Tralka TS, Willingham MC, Pastan I (1983) Inhibition of VSV binding and infectivity by phosphatidylserine: is phosphatidylserine a VSV-binding site? Cell 32(2):639. https://doi. org/10.1016/0092-8674(83)90483-X Shang J, Ye G, Shi K, Wan Y, Luo C, Aihara H, Geng Q, Auerbach A, Li F (2020) Structural basis of receptor recognition by SARS-CoV-2. Nature 581(7807):221–224. https://doi.org/10.1038/ s41586-020-2179-y Sheahan T, Rockx B, Donaldson E, Sims A, Pickles R, Corti D, Baric R (2008) Mechanisms of zoonotic severe acute respiratory syndrome coronavirus host range expansion in human airway

1

Factors Contributing to the Emergence of Viral Diseases

67

epithelium. J Virol 82(5):2274–2285. https://doi.org/10.1128/JVI.02041-07/ASSET/708921F312DE-4284-BDC3-6C82EDD6BB49/ASSETS/GRAPHIC/ZJV0050803190007.JPEG Siliciano RF, Greene WC (2011) HIV latency. Cold Spring Harb Perspect Med 1(1):a007096. https://doi.org/10.1101/CSHPERSPECT.A007096 Smith KM, Machalaba CC, Seifman R, Feferholtz Y, Karesh WB (2019) Infectious disease and economics: the case for considering multi-sectoral impacts. One Health 7:100080. https://doi. org/10.1016/J.ONEHLT.2018.100080 Social history of viruses—Wikipedia (n.d.). https://en.wikipedia.org/wiki/Social_history_of_ viruses. Accessed 19 Nov 2021 Solomon T (2003) Exotic and emerging viral encephalitides. Curr Opin Neurol 16(3):411–418 Stephenson EB, Peel AJ, Reid SA, Jansen CC, McCallum H (2018) The non-human reservoirs of Ross River virus: a systematic review of the evidence. Parasites Vectors 11(1):1–13. https://doi. org/10.1186/S13071-018-2733-8/FIGURES/3 Stern A, Andino R (2016) Viral evolution: it is all about mutations. In: Viral pathogenesis: from basics to systems biology, 3rd edn., pp 233–240. https://doi.org/10.1016/B978-0-12-800964-2. 00017-3 Sudeep A, Gurav Y, Bondre V (2016) Changing clinical scenario in Chandipura virus infection. Indian J Med Res 143(6):712. https://doi.org/10.4103/0971-5916.191929 Suzuki A (2011) Smallpox and the epidemiological heritage of modern Japan: towards a total history. Med Hist 55(3):313–318. https://doi.org/10.1017/S0025727300005329 Tang MW, Shafer RW (2012) HIV-1 antiretroviral resistance. Drugs 72(9):e1–e25. https://doi.org/ 10.2165/11633630-000000000-00000 Terzian ACB, Zini N, Sacchetto L, Rocha RF, Parra MCP, del Sarto JL, Dias ACF, Coutinho F, Rayra J, da Silva RA, Costa VV, Fernandes NCCDA, Réssio R, Díaz-Delgado J, Guerra J, Cunha MS, Catão-Dias JL, Bittar C, Reis AFN et al (2018) Evidence of natural Zika virus infection in neotropical non-human primates in Brazil. Sci Rep 8(1):1–15. https://doi.org/10. 1038/s41598-018-34423-6 The Spanish flu (1918-20): The global impact of the largest influenza pandemic in history—Our World in Data (n.d.). https://ourworldindata.org/spanish-flu-largest-influenza-pandemic-inhistory. Accessed 22 Nov 2021 Trento A, Viegas M, Galiano M, Videla C, Carballal G, Mistchenko AS, Melero JA (2006) Natural history of human respiratory syncytial virus inferred from phylogenetic analysis of the attachment (G) glycoprotein with a 60-nucleotide duplication. J Virol 80(2):975–984. https://doi.org/ 10.1128/JVI.80.2.975-984.2006/ASSET/E1B805F6-248A-4066-8633-5F58B7289266/ ASSETS/GRAPHIC/ZJV0010672790006.JPEG Uno N, Ross TM (2018) Dengue virus and the host innate immune response. Emerg Microbes Infect 7(1):167. https://doi.org/10.1038/S41426-018-0168-0 Valenti WM, Menegus MA, Hall CB, Pincus PH, Douglas RG (1980) Nosocomial viral infections: I. Epidemiology and significance. Infect Control Hosp Epidemiol 1(1):33–37. https://doi.org/10. 1017/S0195941700052371 van den Broecke B, Mariën J, Sabuni CA, Mnyone L, Massawe AW, Matthysen E, Leirs H (2019) Relationship between population density and viral infection: a role for personality? Ecol Evol 9(18):10213–10224. https://doi.org/10.1002/ECE3.5541 van der Vries E, Schutten M, Fraaij P, Boucher C, Osterhaus A (2013) Influenza virus resistance to antiviral therapy. Adv Pharmacol 67:217–246. https://doi.org/10.1016/B978-0-12-405880-4. 00006-8 van Elden LJR, van Kraaij MGJ, Nijhuis M, Hendriksen KAW, Dekker AW, Rozenberg-Arska M, van Loon AM (2002) Polymerase chain reaction is more sensitive than viral culture and antigen testing for the detection of respiratory viruses in adults with hematological cancer and pneumonia. Clin Infect Dis 34(2):177–183. https://doi.org/10.1086/338238/2/34-2-177-TBL003.GIF van Voris LP, Belshe RB, Shaffer JL (1982) Nosocomial influenza B virus infection in the elderly. Ann Intern Med 96(2):153–158. https://doi.org/10.7326/0003-4819-96-2-153

68

A. Gangopadhayya and P. L. Bhukya

Viral Hemorrhagic Fevers | Johns Hopkins Medicine (n.d.). https://www.hopkinsmedicine.org/ health/conditions-and-diseases/viral-hemorrhagic-fevers. Accessed 30 Nov 2021 Viral Hepatitis (n.d.). https://my.clevelandclinic.org/health/diseases/4245-hepatitis-viral-hepatitisa-b%2D%2Dc. Accessed 30 Nov 2021 Viral SpecViral Special Pathogens Branch (VSPB) | DHCPP | NCEZID | CDCial Pathogens Branch (n.d.). https://www.cdc.gov/ncezid/dhcpp/vspb/. Accessed 30 Nov 2021 Vogt RL, LaRue D, Klaucke DN, Jillson DA (2011) Comparison of an active and passive surveillance system of primary care providers for hepatitis, measles, rubella, and salmonellosis in Vermont. Am J Public Health 73(7):795–797. https://doi.org/10.2105/AJPH.73.7.795 Wade L (2020) From black death to fatal flu, past pandemics show why people on the margins suffer most. Science. https://doi.org/10.1126/SCIENCE.ABC7832 Walsh JF, Molyneux DH, Birley MH (1993) Deforestation: effects on vector-borne disease. Parasitology 106(S1):S55–S75. https://doi.org/10.1017/S0031182000086121 Weaver SC (2005) Host range, amplification and arboviral disease emergence. Arch Virol Suppl 19: 33–44. https://doi.org/10.1007/3-211-29981-5_4/COVER/ Weekly statistics from the National Notifiable Diseases Surveillance System (NNDSS) (n.d.). https://wonder.cdc.gov/nndss/nndss_weekly_tables_menu.asp. Accessed 27 Nov 2021 Weiskopf D, Angelo MA, de Azeredo EL, Sidney J, Greenbaum JA, Fernando AN, Broadwater A, Kolla R v, de Silva AD, de Silva AM, Mattia KA, Doranz BJ, Grey HM, Shresta S, Peters B, Sette A (2013) Comprehensive analysis of dengue virus-specific responses supports an HLA-linked protective role for CD8+ T cells. Proc Natl Acad Sci U S A 110(22):E2046. https://doi.org/10.1073/PNAS.1305227110 Whiteman A, Loaiza JR, Yee DA, Poh KC, Watkins AS, Lucas KJ, Rapp TJ, Kline L, Ahmed A, Chen S, Delmelle E, Oguzie JU (2020) Do socioeconomic factors drive Aedes mosquito vectors and their arboviral diseases? A systematic review of dengue, chikungunya, yellow fever, and Zika virus. One Health 11:100188. https://doi.org/10.1016/J.ONEHLT.2020.100188 WHO Director-General’s opening remarks at the media briefing on COVID-19—11 March 2020 (n.d.). https://www.who.int/director-general/speeches/detail/who-director-general-s-openingremarks-at-the-media-briefing-on-covid-19%2D%2D-11-march-2020. Accessed 30 Nov 2021 Wilfert L (2021) Viral adaptations to vector-borne transmission can result in complex host–vector– pathogen interactions. J Anim Ecol 90(10):2230–2233. https://doi.org/10.1111/1365-2656. 13570 Wirth J, Young M (2020) The intriguing world of archaeal viruses. PLoS Pathog 16(8):e1008574. https://doi.org/10.1371/JOURNAL.PPAT.1008574 World Health Organization Geneva Organisation Mondiale De La Santé Genève weekly epidemiological record Relevé épidémiologique hebdomadaire (n.d.). http://www.who.int/. Accessed 24 Nov 2021 Yadav PD, Patil S, Jadhav SM, Nyayanit DA, Kumar V, Jain S, Sampath J, Mourya DT, Cherian SS (2020) Phylogeography of Kyasanur Forest disease virus in India (1957–2017) reveals evolution and spread in the Western Ghats region. Sci Rep 10(1):1–12. https://doi.org/10.1038/ s41598-020-58242-w Yerly S, Quadri R, Negro F, Barbe KP, Cheseaux JJ, Burgisser P, Siegrist CA, Perrin L (2001) Nosocomial outbreak of multiple bloodborne viral infections. J Infect Dis 184(3):369–372. https://doi.org/10.1086/322036

1

Factors Contributing to the Emergence of Viral Diseases

69

Young KP, Kolcz DL, O’Sullivan DM, Ferrand J, Fried J, Robinson K (2021) Health care workers’ mental health and quality of life during COVID-19: results from a mid-pandemic, national survey. Psychiatr Serv 72(2):122–128. https://doi.org/10.1176/APPI.PS.202000424 Yu X, Chen N, Wang L, Wu J, Zhou Z, Ni J, Li X, Zhai X, Shi J, Tian K (2012) New genomic characteristics of highly pathogenic porcine reproductive and respiratory syndrome viruses do not lead to significant changes in pathogenicity. Vet Microbiol 158(3–4):291–299. https://doi. org/10.1016/J.VETMIC.2012.02.036 Zgambo M, Kalembo FW, Mbakaya BC (2018) Risky behaviours and their correlates among adolescents living with HIV in sub-Saharan Africa: a systematic review. Reprod Health 15(1): 1–12. https://doi.org/10.1186/S12978-018-0614-4/FIGURES/1 수산과학연구소전남대학교, 수산생물방역과국립수산과학원, 수산해양종?정보과국립수 산과학원, 수산생명의학과전남대학교, 수산생명의학과김위식부경대학교, 에분제사티 샤, Kim WS, Kim SR, Park MA, Lee JS, Avunje S, Kim DH, Oh MJ (2013) Changes in fish viral disease outbreaks in the coastal area of Korea due to increasing water temperature, an impact of climate change. Korean J Fish Aquatic Sci 46(5):582–588. https://doi.org/10.5657/ KFAS.2013.0582

2

An Updated Review on Influenza Viruses Unnati Bhalerao, Anil Kumar Mavi, Shivani Manglic, Sakshi, Srijita Chowdhury, Umesh Kumar, and Vishwajeet Rohil

Abstract

Influenza virus is a highly contagious respiratory virus also known as seasonal flu. This virus belongs to the Orthomyxoviridae family and its genome is composed of eight negative-sense RNA segments. The virus has two major surface proteins, hemagglutinin (HA) responsible for virus entry and neuraminidase (NA) release from host cells. Influenza virus infection has wide range of symptoms, from mild to severe, and results in complications such as pneumonia and respiratory failure, commonly associated with persons having compromised immune systems. The virus is transmitted through respiratory droplets released by

U. Bhalerao Department of Biology, Indian Institute of Science Education and Research Pune, Pune, Maharashtra, India A. K. Mavi Department of Pulmonary Medicine, Vallabhbhai Patel Chest Institute, University of Delhi, Delhi, India S. Manglic Department of Biotechnology, Jaypee Institute of Information and Technology, Noida, Uttar Pradesh, India Sakshi School of Biotechnology, Gautam Buddha University, Greater Noida, Uttar Pradesh, India S. Chowdhury Department of Biotechnology, Heritage Institute of Technology, Kolkata, West Bengal, India U. Kumar (✉) School of Biosciences, Institute of Management Studies Ghaziabad (University Courses Campus), Ghaziabad, Uttar Pradesh, India V. Rohil Department of Biochemistry, Vallabhbhai Patel Chest Institute, University of Delhi, Delhi, India # The Author(s), under exclusive license to Springer Nature Singapore Pte Ltd. 2023 P. L. Bhukya et al. (eds.), Emerging Human Viral Diseases, Volume I, https://doi.org/10.1007/978-981-99-2820-0_2

71

72

U. Bhalerao et al.

infected individuals when they cough, sneeze, or talk. The virus undergoes frequent antigenic changes, which make it difficult to develop effective vaccines that provide long-lasting immunity. Antiviral medications, such as neuraminidase inhibitors, are available to treat influenza virus infections, but their effectiveness is limited. Influenza virus remains a significant public health threat, with the potential to cause epidemics and pandemics that can have serious global impacts. This review article is focused on better understanding the virus pathogenesis and developing more effective interventions to prevent and treat influenza virus infections. Keywords

Emerging disease · Influenza viruses · Viral disease · Outbreak · Epidemic · Hosts · Healthcare

2.1

Introduction

Influenza has been one of the oldest and most prevalent illnesses to ever afflict humans. Since Influenza viruses (IVs) continue to pose a serious hazard to both humans and animals, the etiological agent is still of utmost importance. The Influenza A virus (IAV) is clinically the most significant among IVs (A, B, C, and D), causing major epidemics in humans and domestic animals (Zhou et al. 2022; Pleschka 2012). It is entirely possible that humans have been exposed to Influenza since the beginning of domestication and urbanization, when animal to human transmission would have been made much more likely by the concentration of human and animal populations in close proximity. Proof of the almost eternal existence of Influenza as a disease among humans and animals has also been touched upon Hippocrates who first described Influenza-like symptoms in ancient Greece in 412 BC (Potter et al. 2001). Although the first reports of an outbreak of an illness resembling Influenza were made in 1173–74, the first actual epidemic was only documented in 1694 (Lina 2008). Five Influenza pandemics have impacted the entire world since 1900. The Spanish Influenza epidemic of 1918 was the most severe pandemic ever documented in human history. A global H1N1 strain of IV that impacted one third of the global population and killed an estimated 500 million humans was the causal (Johnson and Mueller 2002). The second pandemic, which was brought on by the H2N2 subtype, occurred in 1957 (Johnson and Mueller 2002). The 1968 “Hong Kong Influenza,” brought on by an H3N2 subtype, was the third pandemic (Johnson and Mueller 2002). This was followed by the “Russian Influenza” of 1977—brought on by an H1N1 strain that looks to be nearly identical to the H1N1 type circulating before 1950. Therefore, this was a rather mild pandemic that primarily affected children and young humans owing to the pre-existing immunity in the older age groups (Kilbourne 2006). A pandemic of Influenza brought on once more by the H1N1 virus was reported in April 2009 (Neumann and Kawaoka 2011). The pandemic H1N1pdm09 virus first appeared in North America as a result of a triple reassortant between an avian, swine, human IV, and a Eurasian swine

2

An Updated Review on Influenza Viruses

73

Influenza virus (Neumann et al. 2009). The younger population, pregnant women, and those with chronic conditions were particularly susceptible to the severe illness brought on by the H1N1pdm09 virus. Due to a lack of cross-reactive antibodies against the H1N1 virus, which was prevalent between 1918 and 1943, young humans were also more afflicted (Manicassamy et al. 2010). Currently, it is widely known that this virus circulates as a seasonal strain in humans (Adeola et al. 2017) and has also been detected among swine populations in different parts of the world, including North America (Nelson et al. 2015a, b), the Caribbean (Pérez et al. 2015), Europe (Simon et al. 2014), South America (Schaefer et al. 2011), Australia/Oceania (Deng et al. 2012), and Asia (Takemae et al. 2017). Moreover, genetic reassortments between H1N1pdm09 and other IV has been observed to occur, especially in swine population in different parts of the world (Pérez et al. 2015; Vijaykrishna et al. 2010). Each year, there are Influenza epidemics that result in a sizable number of hospitalizations and worse fatalities. According to estimates from the World Health Organization (WHO), annually, Influenza epidemics result in roughly 600,000 fatalities and five million cases of serious illness worldwide (Iuliano et al. 2018). Antigenic drift, a gradual accumulation of mutations caused by a viral RNA polymerase that is prone to errors and enables mutants to evade the host adaptive immune response, is the cause of seasonal epidemics. Antigenic shift events, which can result in the transmission or reassortment of the IV strains from non-human species to humans, cause global Influenza spread with a significantly higher mortality rate due to infection and a sheer lack of cross-protection against this zoonotic virus, thereby causing occasional pandemics around the world (Furuse and Oshitani 2016). Future pandemics are unavoidable in the modern world due to population expansion that is happening quickly due to increased globalization. Therefore, in order to create and develop novel antiviral therapies and improve our readiness for a pandemic, it is essential to understand the molecular biology of the virus.

2.2

Epidemiology

According to Caini et al. (2019), Influenza is a highly contagious viral disease that is prevalent globally and has a high morbidity and fatality rate during annual epidemics and pandemics. Type IV or Influenza B virus are responsible for the majority of human infections (IBV). While type B has only infrequently been linked to localized epidemics, type A has been linked to global epidemics and pandemics (LagaceWiens et al. 2010). A human population gets infected by IVs on an annual basis by 5–10%; these rates can be noticeably greater in specific regions or age groups, as well as when new IVs infect a population that has sufficient immune responses to neutralize these new viruses. Upper respiratory tract infections and their related consequences are more common in the very young and the very elderly, as well as in those with chronic illnesses or compromised immune systems (Iuliano et al. 2018). Patients have a high viral load in respiratory secretions during the initial stage of illness, and the incubation period for infections caused is brief (mean 2 days,

74

U. Bhalerao et al.

range 1–5 days) (Zhou et al. 2022; Lee et al. 2009). According to Neumann and Kawaoka (2015), there are three main methods in which the virus spreads among humans: through direct contact with infected humans, fomites, and inhaled aerosols. However, the most effective method of transmission is through aerosol droplets. Speaking, singing, and even regular breathing can all produce some aerosol, but sneezing and coughing make a lot more. Different sized particles are formed in aerosol form. Within a few meters, larger drops fall to the ground and only those nearby get infected. According to Teunis et al. (2010), droplets between 1 and 4 microns in diameter have the ability to travel great distances, stay suspended in the air for extended periods of time, and even reach the lower respiratory tract. After aerosolization, the IV maintains its infectiousness for 24 h or more in environments with low relative humidity (17–24%) but only for an hour in environments with high relative humidity. Viruses can maintain their infectiousness on nonporous hard surfaces for up to 24–48 h, with low relative humidity and low UV exposure (typical winter circumstances) again favoring virus survival. On the other side, nasal secretions of the infected are to blame for transmission through contaminated objects or direct contact. According to earlier research, up to 60% of common home items contain Influenza virus RNA. Another potential method of spreading infectious viruses is by leaving them on paper currency for several weeks (Regea 2017). Infections caused by IVs can also be zoonotic, or spread from one species to another, particularly from animals (birds, swine) to humans (Goneau et al. 2018; Borkenhagen et al. 2019). These occurrences are comparatively uncommon, and novel viruses are typically not very good at spreading from humans to humans. But given the high human population density and year-round virus circulation, this phenomenon attracts particular attention in southern China where there is close proximity among human, pig, and bird (wild and domestic) populations, which favors genetic reassortment of viruses from different species or the emergence of drift variants (Mostafa et al. 2018). In accordance with the foregoing, it is significant to note that genetic plasticity and adaptation in a wide range of animal and human hosts continue to be the driving forces behind the emergence of new IV strains that can infect humans with a growing level of efficacy, leading to widespread pandemics. According to Pleschka (2012) and Petrova and Russell (2018), the epidemiology of human IV is characterized by their continual antigenic change to evade the host immune response. Epidemiologically, there are two types of human IV infections: epidemics and pandemics. Annual seasonal epidemics can fluctuate in strength throughout the year and can be localized. These epidemics spread quickly and infect millions of humans worldwide, posing a serious threat to public health and financial burden. An Influenza pandemic, on the other hand, is a widespread global outbreak of the illness that may have disastrous consequences and cause millions of deaths (Moghadami 2017). Although there are reports of IV infections throughout the year, Influenza activity changes each year in temperate regions, with peak prevalence occurring in the winter and early spring. Epidemics can happen year-round in tropical areas, generally during the rainy season. Lower temperatures frequently

2

An Updated Review on Influenza Viruses

75

result in lower air humidity in winter, which appears to be the primary reason for increased seasonal Influenza transmission in temperate regions. The virus also survives longer on surfaces at colder temperatures, and aerosol virus transmission is highest in cold environments (Shaman et al. 2017). Pandemics, as opposed to epidemics, are outbreaks that rapidly afflict a huge section of the population across a wide geographic area. The severe form of Influenza often kills a considerable number of humans and affects 20–40% of the global population (Madhav et al. 2018). Influenza pandemics happen when a new animal strain can be spread to humans through zoonotic transmission as a result of an antigenic shift caused by genetic reassortment or adaptation to a new host. The most significant animals involved in the establishment of pandemic strains with effective inter-human transmission include swine, poultry, and wild birds (Neumann et al. 2009). According to the viral makeup, the severity of a pandemic may vary, as cytotoxic T-lymphocyte responses that focus on relatively conserved internal proteins may give protection. Therefore, if the pandemic virus arises through genetic reassortment and by gaining internal gene segments from a previously circulating human IV, a mild pandemic may occur (McMichael 2018; Sridhar et al. 2013). Therefore, foretelling the genetic composition of the upcoming pandemic IV would offer very pertinent knowledge that may be used to get ready for or stop other pandemics.

2.2.1

Host Range of Influenza Viruses

Wild birds have long been thought of as IV reservoirs. The main natural reservoir of IV among wild birds is found in wetland and aquatic habitats, specifically in Charadriiformes (especially gulls, terns, and waders) and Anseriformes (especially ducks, geese, and swans). Currently, these wild waterbirds have been found to harbor 9 NA subtypes (N1–N9) and 16 HA subtypes (H1–H16) of IV. Rarely, IV escapes from these reservoirs for waterfowl, surmounts a number of host-related obstacles, and crosses to chickens or different mammalian species, including humans. This can lead to sporadic infections, epidemics of disease, or pandemics (Neumann and Kawaoka 2015). IV epidemiology is distinguished by its broad host range. Humans, swine, birds, dogs, horses, cats, ferrets, bats, camels, marine creatures, camels, and mink have all been kept separate from them. IVs have occasionally been found in tigers and leopards as well. Additionally, IVs are frequently transmitted among humans, poultry, and swine (Borkenhagen et al. 2019; Zhang et al. 2020). Swine in particular may serve as a transitional host for the development of novel IVs that can infect humans (Zhang et al. 2020; Ma et al. 2009). While it is infrequent in certain cases, interspecies transmission of IV occurs and is considerable between humans and swine and poultry and swine (Borkenhagen et al. 2019). In this respect, host-receptor specificities, which have an effect on the transmission of disease and its severity, are greatly influenced by HA and NA glycoproteins. When it comes to their coupling to galactose, the HA will bind residues with either a 2-3 or 2-6 branching preference. Mammalian viruses prefer 2-6-SA residues, but avian strains of IV prefer 2-3-SA residues (Xiong et al. 2014;

76

U. Bhalerao et al.

de Vries et al. 2020). Previous research has shown that the anatomic distribution of SA residues varies between species of birds and mammals as well as within either family. In contrast to the human upper respiratory tract, where 2-6-SA residues predominate, the lower respiratory tract epithelial cells, bronchi, bronchioles, and type II pneumocytes are the principal locations of the 2-3-SA receptors in humans (Costa et al. 2012). However, the upper and lower respiratory tracts of swine both exhibit 2-6- and 2-3-SA residues. Previous research reveals that the virulence and transmissibility of IV are influenced by the affinity of HA for SA receptors. According to Kong et al. (2016), preference for 2-6 receptors, for instance, promotes dissemination, but preference for 2-3 receptors, which results in greater tropism for the lower respiratory tract, affects illness severity in humans. On the other hand, gallinaceous poultry species can carry both 2-3- and 2-6-SAs throughout both their intestinal and respiratory tracts, in contrast to the wild aquatic birds, which mostly have 2-3-SA receptors in their intestinal and respiratory tracts (Costa et al. 2012). Given this, adaptive changes in domesticated poultry may cause wild ducks to choose HS receivers that resemble humans instead of HA recipients. Accordingly, it has been demonstrated that certain strains of the H9N2, H5N1, and H7 subtypes that have been obtained from poultry have a higher sensitivity for human 2-6-SA residues. Changes in the SA receptor-binding domain of HA can alter the preferred binding of the 2-3 and 2-6 bound residues, changing the host range and severity of the disease. In this regard, severe clinical cases in humans were linked to the HA1 mutation D222G in H1N1pdm09. The effect of this mutation on receptor binding was later demonstrated, yielding dual selectivity for 2-3 and 2-6 types (Kilander et al. 2010). NA, in addition to HA, is critical for virus replication and potential hostspecific virus adaptation (de Vries et al. 2020). The infectivity of humans, gallinaceous birds, and waterfowl appears to be affected differently by the length of NA stalks. Longer stalks are more typical in waterfowl like ducks, but short stalks are more usually connected with gallinaceous birds and humans (Matsuoka et al. 2009; Hoffmann et al. 2012). Mutations that cause deletions in the stalk region are what cause variation in stalk length. A fatal human case of avian Influenza A H7N7 has been linked to further mutations in NA (Fouchier et al. 2004). According to reports (de Wit et al. 2010), the alterations seen in NA inhibited the development of viral aggregates that increased the effectiveness of replication in the human respiratory tract. Nevertheless, not all IVs have sufficient stem length or other NA alterations to control disease severity. Because of this, an H1N1pdm09 having the short-stemmed NA of an H5N1 generated through adaptation in chickens replicated inefficiently in human respiratory cells and was ineffectively transmitted by respiratory droplet across ferrets (Blumenkrantz et al. 2013). New viruses that might bind to the mucosa of the human respiratory tract and reproduce more effectively than either of the parental strains can be produced by fusing the surface glycoproteins of zoonotic IVs with the replicative genes of core human viruses (Goneau et al. 2018). As a result, the creation of new reassortants that will replicate effectively in humans and produce pandemics is most likely to occur in hosts that support the transmission and efficient replication of both zoonotic and human viruses (Ciminski et al. 2021). Swine are an example of such hosts and have historically been referred to as “mixing vessels” for

2

An Updated Review on Influenza Viruses

77

the generation of new reassortant strains of IV since they carry the 2-3 and 2-6 receptors (Neumann et al. 2009). The existence of both receptors in turkeys and quail, as well as the observed accumulation of adaptive mutations for efficient transmission in gallinaceous birds, suggests that these species may play a substantial role in human adaptation to avian Influenza, perhaps even more so than swine.

2.3

Organization of Influenza Virus

2.3.1

Classification

The Orthomyxoviridae family, which consists of seven different genera, is made up of negative, single-sense, segmented RNA genome viruses known as IV viruses. The Influenza viruses are divided into four subtypes: Influenza types A, B, C, and D, as well as the Thogotovirus, Isavirus, and Quaranjavirus. While Isavirus primarily affects the fish population, notably salmon, Thogotovirus, and Quaranjavirus are transmitted by ticks and can infect a wide range of mammalian species, including humans (Pleschka 2012). IV, IBV, Influenza C virus (ICV), and Influenza D virus (IDV) are the only species or types of each IV genus, respectively. These four genera can be distinguished from one another by antigenic variations in their nucleoproteins and matrix proteins, as well as by permissive species and illness severity. Mammals are susceptible to all IV strains. IVs infect a significantly wider host range than IBV, which only infects humans, seals, and ferrets, ICV, which infects humans, dogs, and swine, and IDV, which infects cattle (Borkenhagen et al. 2019). Based on the different alterations of the two main surface glycoproteins, HA and NA, only IV can be categorized according to its serological subtype (Bouvier and Palese 2008). IV has so far been associated with 18 HA (H1–H18) and 11 NA (N1–N11) reports, although more cases are predicted to surface in the upcoming years (Subbarao 2019). Two variants (H17N10, H18N11) were found to only infect bats in previous years, indicating viral spread to different hosts (Mehle 2014; Tong et al. 2012, 2013). IV nomenclature is based on a common WHO scheme created in the 1980s. The following details are used by this system in chronological order: the virus type, the species isolated (for non-humans), the isolation site, the number of isolations, the isolation year, and the IV HA and NA subtypes were all listed by Bouvier and Palese (2008).

2.3.2

Morphology and Virion Structure

IVs are 80–120 nm in diameter and have spherical or filamentous morphologies. Clinical isolates of IV tend to be filamentous, but laboratory-adapted IVs are typically spherical or elliptical in shape (Bouvier and Palese 2008). The filamentous form of IV is lost throughout the adaption phase in eggs. Each particle is surrounded by a lipid membrane that forms during budding and release from the host cell plasma membrane (Seladi-Schulman et al. 2013). The viral ion channel protein M2 as well

78

U. Bhalerao et al.

as the viral glycoproteins HA and NA are both present on the particle surface. NA protein forms a tetramer and has a characteristic mushroom shape, while HA is a rod-shaped protein that exists as a trimer. The virions are rather unstable in the environment, and heat, dryness, pH extremes, and detergents inactivate IV. Each of the eight solitary, negative-sense strands of the viral RNA (vRNA) genome is present in the virion interior as one copy per strand. Each NP protein monomer covers 20–24 vRNA nucleotides, and many copies of the protein are used to encapsulate each segment. Additionally, one copy of the viral-encoded polymerase complex made up of the PB2, PB1, and PA proteins is linked to each individual segment. The viral ribonucleoprotein (vRNP) is made up of the vRNA, NP protein, and trimeric viral polymerase (Dadonaite et al. 2019). The viral M1 protein, which sits below the envelope and binds the IV to the vRNP, surrounds the eight segments of the IV. The viral NS2 protein and, more recently, the NS1 protein have also been demonstrated to be integrated into the virion in low copy numbers (Mostafa et al. 2018).

2.3.3

Genome Structure and Organization

According to Dadonaite et al. (2019), viruses belonging to the Orthomyxoviridae family are distinguished by having genomes composed of single-stranded negativesense RNA segments. The vRNAs can be between 0.9 and 2.3 kb in size, but their entire genomes are only about 13.5 kb (Hutchinson et al. 2014). The eight distinct segments (PB2, PB1, PA, HA, NP, NA, M1, M2, and NS1) are numbered in decreasing order of length and are labeled as follows: PB2, PB1, PB1-F2, PA, HA, NP, NA, M1, M2, NS1, NEP/NS2, PB1-N40, PA-X, PA-N155, PA-N182, M42, and NS3. These segments encode at least 17 genes.

2.3.4

Viral Proteins

The genomes of influenza viruses consist of eight RNA segments which code for structural and non-structural proteins (Table 2.1). RNA segment 1 codes for the PB2 protein, which is the main protein of the IV. The capture mechanism is carried out by this enzymatic protein, which is a component of the RNA-dependent RNA polymerase (RdRp). It binds to the 5′ cap structure of the host eukaryotic messenger RNA (mRNA) and uses this structure as a primer to start viral transcription (Acheson 2011; Graef et al. 2010). On the other hand, it has been proposed that PB2 may be involved in regulating the effectiveness of viral replication in different hosts. In this context, it has been determined that lysine (K) at position 627 causes preferred amplification in mammalian species while the amino acid (aa) glutamic acid (E) at this position aids virus replication in avian species (Hatta et al. 2001). Through its association with the mitochondrial antiviral signaling protein (MAVS), PB2 may also have an impact on IV virulence by preventing interferon (IFN) expression. Research has shown that PB2

2

An Updated Review on Influenza Viruses

79

Table 2.1 Proteins encoded by the genome of Influenza viruses Segment 1

Encoded protein PB2 (Polymerase basic)

2

PB1 (Polymerase basic)

3 4

PA (Polymerase acidic) HA (Hemagglutinin)

5

NP (Nucleoprotein)

6

NA (Neuraminidase)

7

M1 (Matrix protein)

8

M2 (Ion channel) NS1 (Non-structural protein 1) NEP (Nuclear export protein, also called NS2)

Function of protein Polymerase subunit responsible for mRNA cap recognition Polymerase subunit responsible for RNA elongation, also has endonuclease activity Polymerase subunit with protease activity Surface glycoprotein and major antigen that plays a role in receptor binding and fusion RNA binding protein that facilitates nuclear import of viral RNA Surface glycoprotein with sialidase activity to aid viral release Interacts with vRNP and regulates nuclear export of RNA and viral budding Role in virus uncoating and assembly Interferon antagonist which regulates host gene expression Nuclear export of viral RNA

accumulates in the mitochondria as well as the nucleus, which supports this involvement (Graef et al. 2010). PB1 protein and a smaller 87-aa protein called PB1-F2 were the first two proteins found to be encoded by RNA segment 2 (Hoffmann et al. 2012). However, a third protein, PB1-N40, was shown to be a shortened version of PB1 that lacks its N-terminus (Wise et al. 2009). The second subunit of the polymerase within the RdRp with a nuclease function is the PB1 protein (Acheson 2011). The other protein encoded by RNA segment 2, PB1-F2, is translated by a second reading frame in an ORF orientation of +1. Only a few IV strains contain the little non-structural protein known as PB1-F2 (Kamal et al. 2017). Numerous molecular actions for PB1-F2 have been noted, the majority of which are connected to the protein’s C-terminus. The understanding of the function of PB1-F2 in actual infection is made more difficult by the inconsistent PB1-F2 activity between viral strains, various cell types, and hosts. Additionally, recent research has revealed that PB1-F2 boosts viral polymerase activity, controls NLRP3 inflammasome activation, suppresses the RIG-I signaling pathway, and promotes viral pathogenicity (Leymarie et al. 2017; Cheung et al. 2020). An N-terminally shortened version of PB1 called PB1-N40 is 718 amino acids long. Despite divergent theories about the function of PB1-N40, studies have agreed that while PB1-N40 expression is necessary for virus replication both in vitro and in vivo, it is not necessary for IV survivability. In order for IV to sustain its viral fitness, PB1-N40 is crucial for regulating the balanced expression of PB1 and PB1-F2 (Tauber et al. 2012). The smallest subunit of the RdRp, the PA protein, is encoded by RNA segment 3 and has a length of 716 amino acids. Three more proteins, PA-X, PA-N155, and PA-N182, can also be translated by this segment (Vasin et al. 2014). Although the precise role

80

U. Bhalerao et al.

of PA is still unknown, it is thought to be crucial for transcription and replication by ensuring that the vRNA is correctly assembled and packaged into IV virions. The 191 amino acid N-terminal domain of PA is fused with the 61 amino acid C-terminal domain created by the second reading frame of a +1 ORF, known as the X-ORF, to create PA-X (Jagger et al. 2012). Indicating its significance for the viral life cycle, the X domain of PA-X has been found to be substantially conserved across all IV strains and all host species (Shi et al. 2012). Through the degradation of host mRNA, PA-X is also implicated in altering how the host reacts to viral infection. According to Jagger et al. (2012), it has the ability to cut off host cell gene expression in order to reduce the mounted antiviral response. It can also alter host ribosome functioning from translating host mRNA to viral mRNA. As a result of ribosomal scanning, the other two proteins PA-N155 and PA182 that are encoded by RNA segment 3 are translated in-frame (Muramoto et al. 2013). One of the main glycoproteins that can be seen on the external surface of the virus is encoded by RNA segment 4 and is called HA (Wu and Wilson 2020). IV can attach to cells by interacting with and binding to SA receptors on the host cell surface thanks to HA (Bouvier and Palese 2008); IV can enter the cytoplasm and continue its replication cycle through HA-mediated fusion of the viral envelope with the host endosomal membrane; and IV is the primary antigen against which the immune system produces neutralizing antibodies (Wu and Wilson 2020). Cleavage of the HA single polypeptide precursor, HA0, is required for IV to spread. In addition to being necessary for infectivity, cleavage of HA0 also controls pathogenicity and tissue tropism (Leymarie et al. 2017). The N-terminus of HA0 makes up HA1, while the C-terminus makes up HA2. In a homotrimer formation, HA1 and HA2 make up the globular head and stalk domain of HA. The creation of a universal vaccine has strongly considered the fact that, in contrast to the globular head, the stalk domain is substantially conserved across many IV subtypes (Kirkpatrick et al. 2018). The NP, which serves to bind and encapsulate freshly generated vRNA, is encoded by RNA segment 5. RNA synthesis is switched from being produced as mRNA through transcription to being produced as cRNA and vRNA through genome replication by NP. Additionally, NP interacts with the cellular factor importin through a nuclear localization signal (NLS) to play a significant role in the import of nucleocapsids from the cytoplasm to the nucleus (Acheson 2011). In the active trimeric form of HA, each of the monomers get arranged so as to form a cleavage site and a receptor binding site. The NA protein, a membrane glycoprotein tetramer with a mushroom form that penetrates and protrudes from the viral envelope, is encoded by segment 6 of the RNA. The functional NA protein is made up of four identical monomers that are about 470 amino acids in size. An N-terminal sequence, a transmembrane domain, and a peduncular domain of varying length that culminates in the globular head domain containing the enzyme’s active site make up each monomer’s four structural components. According to the subtype, the length and sequence of NA protein’s stalk can differ (McAuley et al. 2019). In order for newly budded virions to disseminate to neighboring cells, NA primarily functions to release them from the cell by cleaving the SA receptors. Fascinatingly, NA might possibly be involved in the virus’s entry into host cells (McAuley et al. 2019). The main way that NA is

2

An Updated Review on Influenza Viruses

81

known to increase infectivity is by decreasing the development of virus aggregates by removing SA residues from the viral membrane. To stop the budded virus from spreading and infecting nearby cells, a number of antibodies and NA inhibitors, including oseltamivir and zanamivir, work (Bouvier and Palese 2008; McAuley et al. 2019). The monomer shows a six-bladed β-sheet helix arrangement. The active site is located in the center surrounded by antigenic sites. Four monomers make up the active protein, one of which is colored (Li et al. 2012). The M1 and M2 proteins are two proteins encoded by RNA segment 7. The M2 protein in IV is transcribed via RNA splicing, whereas the M1 protein is transcribed from RNA segment 7 (Piasecka et al. 2020). Through its interaction with NEP, the M1 protein participates in the nuclear export of vRNA and is assumed to be important for the assembly and recruitment of several proteins at the plasma membrane (Dadonaite et al. 2019). The various stages of the replication cycle depend on the M2 protein, an ion channel that traverses the lipid bilayer membrane (Rossman and Lamb 2009). The M2 protein is a tiny 97-aa protein that exists as a tetramer and is made up of a transmembrane domain, a brief periplasmic region, and a cytoplasmic tail. In comparison to HA, the M2 protein is less abundant (1:10–100), and its major job is to permit protons to pass through the viral membrane in order to maintain the proper pH for viral entrance, replication, and maturation. The anti-Influenza medications amantadine and rimantadine both primarily target the M2 protein (Rossman and Lamb 2009). These medications prevent the proton channels from working, which prevents the release of nucleocapsids and the spread of infection. It is interesting to note that the M2 protein has a conserved area made up of a HisXXX-Trp motif that is crucial for its functionality (with X being any aa). In order to maintain the proper pH, this motif acts as a proton gate, regulating the flow of protons through the channel (Cady et al. 2009). The leaky ribosomal scanning-produced M42 protein is another protein that is encoded by RNA segment 7 (Wise et al. 2009). When the M2 protein is not present or not functioning properly, this protein can step in (Vasin et al. 2014). Alternative splicing of RNA segment 8 results in the encoding of at least two non-structural proteins, NS1 and NEP/NS2 (Vasin et al. 2014). The NS1 protein, which is a wellknown IFN antagonist, has 230 amino acids and is expressed collinearly. Its molecular weight is approximately 26 kDa (Bouvier and Palese 2008). NS1 has three different domains: a C-terminal tail, an RNA-binding domain (RBD) at the N-terminus, and an effector domain (ED) in the middle. Each domain engages with several cellular components and adds to NS1’s multifunctional characteristics (Lin et al. 2007; Hao et al. 2020). The cytoplasmic and nucleic sensor retinoic acid-inducible gene-I (RIG-I), which prevents the IFN response factor-3 (IRF3) from producing IFNs and, consequently, the antiviral response, has also been linked to the NS1 protein’s role in reducing the innate cellular antiviral response (Akarsu et al. 2003). Due to its function in the nuclear export of vRNP complexes, NS2 is often referred to as nuclear export protein (NEP). The majority of sequenced IV strains share this protein. It consists of an amphipathic C-terminal domain with two helices and an N-terminal domain with

82

U. Bhalerao et al.

two nuclear export signals (NES) (Akarsu et al. 2003). The CRM1-NS2-M1-vRNP nuclear-export complex is formed when the NES in NS2’s N terminus connects with chromosomal region maintenance 1 (CRM1) and the M1 protein at the C terminus attaches to it. Although NS2 has not yet been discovered to be linked to the endomembrane necessary for vRNP trafficking, it has been noted that NS2 interacts with the F1Fo ATPase linked to the plasma membrane (Gorai et al. 2012). Influenza virion production and budding are facilitated by the interaction of NS2 with F1Fo ATPase. Additionally, it was discovered that a mutation in NS2 caused aberrant replication while also producing faulty interfering particles (Odagiri and Tobita 1990; Odagiri et al. 1994). Only a few IV strains express the protein NS3 (Vasin et al. 2014; Hao et al. 2020). This protein is the result of a D125G mutation that makes NS1 have a third new donor splice site, enabling the expression of NS3 (Selman et al. 2012). Interestingly, it has been discovered that this particular mutation has a replicative gain-of-function, with viruses that have just transitioned to a new species obtaining this protein.

2.3.5

Life Cycle of Influenza A Virus

IVs have been demonstrated to proliferate in alveolar macrophages and dendritic cells (DCs), in addition to the epithelial cells of the respiratory and gastrointestinal tracts (Edinger et al. 2014). In tissue culture, the IV life cycle can be completed in 8–10 h. Numerous interactions between the virus and the host cell take place during infection and may control pathogenesis, immune response, and host range restriction (Cauldwell et al. 2014; Matsuoka et al. 2013; Meischel et al. 2020).

2.3.6

Virus Attachment and Entry to Host Cell Surface Receptors

By attaching the viral membrane glycoprotein HA to SAs on cellular glycoproteins on the cell membrane surface, IV starts an infection and enters the host cell (Matsuoka et al. 2013; Hamilton et al. 2012; Zmora et al. 2014). In addition to SA, IV may bind to or enter a cell through several receptors, including the epidermal growth factor receptor (EGFR) (Eierhoff et al. 2010), mannose binding lectins (Reading et al. 2000; Upham et al. 2010), and DC-specific intercellular adhesion molecule-3-grabbing non-integrin (DC-SIGN) (Edinger et al. 2014; Londrigan et al. 2011; Wang et al. 2008). By using receptor-mediated endocytosis, the virus can internalize target cells once it has attached (Zmora et al. 2014; Gillespie et al. 2016). However, caveolae-dependent, macropinocytosis-dependent, caveolae-independent, and clathrin-independent routes have also been reported (Edinger et al. 2014; De Vries et al. 2011). Clathrin-mediated endocytosis is the most frequently recognized paradigm for IV entrance. The virus then enters the perinuclear area via early and late endosomes. The pH of endosomes falls as they mature, and the acidic environment causes HA to alter shape (Leikina et al. 2002; White and Wilson 1987). In order to expose the fusion peptide (Garcia et al. 2015; Wiley and Skehel 1987; Zhirnov et al.

2

An Updated Review on Influenza Viruses

83

2002), HA is split into two subunits (HA1 and HA2) by host cell proteases (Mohan et al. 2021; Mordstein et al. 2008; Müller et al. 2012). There is a fair amount of sequence variability at the HA protein’s proteolytic cleavage sites between different viral subtypes. However, ubiquitously expressed subtilisin-like proteases cleave the multi-basic cleavage sites that are characteristic of highly pathogenic avian IV, considerably increasing the likelihood of successful HA cleavage in a variety of host species and tissues (Böttcher-Friebertshäuser et al. 2014; Stieneke-Gröber et al. 1992; Taubenberger and Kash 2010). The fusion peptide then attaches to endosomal membranes, allowing the virus and endosome to fuse (Hamilton et al. 2012; Stegmann 2000; Russell 2014). By pumping protons and K+ ions into the virus, the M2 ion channel is activated by the acidity of the endosomes to acidify the virus (Nieto-Torres et al. 2015; Luo 2012; Pinto and Lamb 2006). The uncoating of the capsid and the dissociation of viral ribonucleoproteins (vRNP) are made easier by the acidity, which also encourages the depolymerization of M1 (Stauffer et al. 2014; Martin and Helenius 1991). Influenza virus enters the cell by endocytosis. The vRNPs is transported to the nucleus, where it is transcribed into mRNA or replication. The mRNA is translated into the various viral proteins in the cytoplasm, where these proteins assemble at the plasma membrane with the newly synthesized vRNP to create progeny virions (Te Velthuis and Fodor 2016).

2.3.7

Replicating Their Genome

IV transcription and replication take place in the nucleus of the host cell. The nuclear localization sequence 1 (NLS1) and nuclear localization sequence 2 (NLS2) discovered in the NP transport the vRNPs to the nucleus (Te Velthuis and Fodor 2016; Wu et al. 2007). The transcription of the negative-sense vRNA into viral mRNA is started by RdRp after it enters the nucleus by binding to the 5′ caps of the host pre-mRNA (Neumann et al. 2000; Reich et al. 2014). As a template for the translation of viral proteins, the viral mRNA is then delivered to the cytoplasm by the NXF1 pathway (York and Fodor 2013; Gales et al. 2020). In order to produce more vRNAs, a complementary positive-sense cRNA is first synthesized and employed as a template during the second round of replication (Te Velthuis and Fodor 2016). It is believed that the 22–27 nt short negative-sense viral RNAs (svRNAs), which are located at the 5′ end of each viral RNA segment, control the change from transcription to replication (Perez et al. 2010).

2.3.8

Assembly, Maturation, and Release

The RNP-M1-NEP/NS2 complexes are responsible for transporting the freshly synthesized RNPs to the cytoplasm. Except for M2, all three of the integral membrane proteins—HA, NA, and M2—are folded and glycosylated. HA is put together as a trimer, while NA and M2 are put together as tetramers (Ohkura et al. 2014). Through their transmembrane domains, mature proteins bind to the membrane. The

84

U. Bhalerao et al.

assembly of the virus particles is aided by the M1 protein’s concentration underneath the membrane and subsequent connection with RNP and NEP/NS2 (Rossman and Lamb 2011). On the other hand, each of the eight vRNA segments is autonomously incorporated thanks to distinctive “packaging signals” found in the 5′ and 3′ coding and non-coding regions (Rossman and Lamb 2011; Hutchinson et al. 2010). The mature viral particle is encased in the plasma membrane, which curves outward until both ends merge at the base of the bud (York and Fodor 2013). The developing viral particles are covered in SA, which interacts with HA to keep them attached to the cell membrane. Nascent virions are discharged because NA’s enzymatic activity limits their accumulation on the cell surface (McAuley et al. 2019; Rossman and Lamb 2011).

2.3.9

Propagation and Assay in In Vitro and In Vivo Laboratory Models

In swine, IVs were first discovered in 1930; in humans, they were discovered 3 years later (Shope 1931). The only reactors in which IV could be cultivated for a number of decades were chicken eggs that had been embryonated. Some IV and IBV strains must first be pre-isolated in the amniotic cavity and then modified to grow in the allantoic cavity, whereas the majority of avian strains and many human IV strains can be isolated by direct inoculation into the allantoic cavity of embryonated hen eggs. On the other hand, the cell culture technique is typically utilized for initial isolation and laboratory investigation of IV from human and animal biological samples, whereas embryonated eggs are mostly employed for large-scale viral generation. At the moment, the most popular canine kidney cell tissue cultures (Madin-Darby—MDCK) used for virus isolation (Govorkova et al. 1999; Tobita et al. 1975). The research of IV’s etiology and the assessment of specific subtypes’ zoonotic potential both benefit greatly from the use of animal models. The choice of animal model is essential to ensuring that the outcomes are as similar to those anticipated in humans. Swine, mice, rats, guinea pigs, ferrets, non-human primates, and guinea swine are the most often used animal models (Belser et al. 2011). Ferrets have been used frequently as a model organism for IV transmission since it was initially proposed in 1933 (Smith et al. 1933). It has been discovered that ferrets are inherently vulnerable to IV infection without prior adaption. Additionally, IV in ferrets also exhibits clinical signs that are comparable to those in humans (Belser et al. 2011).

2.4

Influenza Virus Evolution and Possible Emergence and Reemergence Risks

The mutation rate in the IV RNA polymerase can be up to ten times higher than in the viral DNA genome because it lacks error-correcting function. More than one point mutation may be introduced during each round of replication, and these

2

An Updated Review on Influenza Viruses

85

alterations may have a neutral, adverse, or beneficial impact on the survivability of the virus (White and Lowen 2018). The so-called antigenic drift in HA and NA glycoproteins is the most obvious manifestation of these slow alterations brought on by positive selection. The emergence of viral variations that are no longer recognized and neutralized by the antibodies produced against the original strain can result from gradual changes in the antigenicity of these two proteins, resulting in epidemics. These variants frequently replace these dominant strains within a short period of time with the new antigenic variants. Although HA and NA exhibit this phenomenon the greatest, other genes also go through these slow alterations (Lowen 2018). Additionally, genetic drift generates distinct viral offspring known as viral quasispecies, which may aid in adaptability and the crossing of species barriers (Murcia et al. 2012; Munoz et al. 2016). Human-adaptive mutations in animal-associated IV may randomly collect at low levels in viral quasispecies and circulate within animal populations, then rapidly proliferate after transmission to a human host, according to studies using ultra-deep sequencing (Jonges et al. 2011, 2014). Recombination is another method IV uses to evolve. Non-homologous recombination, which occurs between two RNA fragments (Suarez et al. 2004; Orlich et al. 1994), and homologous recombination, which involves the switching of templates and is frequently thought to be absent or rare (Boni et al. 2008), are the two main mechanisms by which genetic recombination creates genetic diversity. Though it is an uncommon occurrence, it is interesting to note that recombination has been suggested as a possible cause for the H7N9 IV pandemic in China (Chen et al. 2016). Recombination appears to be crucial for the evolution of diverse H5N1 viruses, according to evidence (Luo et al. 2015). As a result, recombination occasionally causes a lower pathogenic strain to become a highly pathogenic strain.

2.5

Pathogenesis in Humans

The peak virus titer and the degree of inflammation that goes along with it are both determined by the first stage of pathogenesis, which lasts between 1 and 3 days. Depending on these two factors, the virus may be controlled during the second phase, or it may cause severe illness, acute respiratory distress syndrome, and even death. Influenza pathogenesis is influenced by viral and host variables, which together dictate the clinical course and outcome. A crucial component of immunity against infection and illness is T and B cell immunity against IV. The clinical course and outcome of the disease are also influenced by other host characteristics, such as age, sex, the microbiota, and genetic diversity (Gounder and Boon 2019). Gene reassortment results in much more dramatic alterations to the genome composition. When a cell is infected with two different genomic variants of IV, this event is known as the rearrangement of viral gene segments. Genomic reassortment, which is essential to IV biology (Lowen 2017, 2018; Steel and Lowen 2014), typically occurs in animal species that are susceptible to infection by strains with distinct etiologies, such as avian and human strains. The most common example of this type of reactor is swine; following the exchange of genetic

86

U. Bhalerao et al.

segments, new strains with significantly altered characteristics may be created in the population (Ma et al. 2009). Antigenic shift is the phrase used to describe the reassortment of HA or NA gene segments. According to the implication (Reperant et al. 2015), significant antigenic alterations to these two most antigenic proteins may cause the sudden appearance of novel strains that are not recognized by human or animal immune systems and could lead to pandemics. The pig is particularly significant as a mixing vessel for genetic reassortment and development of IVs because it has receptors for both avian and mammalian IVs (Ma et al. 2009). Reassortment is therefore important for evolution because it produces new genomic constellations. However, while most of these constellations will be harmful, some may make it easier to adapt to new hosts, evade host immune responses, and develop antiviral resistance, which could result in the emergence of novel IV with pandemic potential (Wille and Holmes 2020). Pathological alterations are brought on by IV infection throughout the respiratory tract, but most noticeably in the lower respiratory tract. The progression of changes in the respiratory epithelial cells suggests that the tracheal bronchial epithelium is where uncomplicated Influenza first manifests itself as acute and diffuse inflammation of the larynx, trachea, and bronchi (Ampomah et al. 2018; Talbot 2017). The main location of virus infection is the ciliated columnar epithelial cells, according to histological studies on nasal exudate cells and tracheal biopsies. The cytoplasm becomes vacuolated, the nucleus degenerates, and ciliation is lost roughly 24 h after the onset of symptoms. Necrotic cells begin to separate as a result, and the ciliated epithelium desquamates to a basal layer that is only one cell thick. The infiltration of neutrophils and mononuclear cells as a result of this layer’s increased sensitivity and inability to hold mucus causes submucosal edema and hyperemia, which are directly associated to the majority of the respiratory symptoms noted. During the initial phases of IV infection, the epithelium is mostly damaged by apoptosis and necroptosis of infected epithelial cells (Klomp et al. 2021). The alveoli’s walls thicken with edema and infiltration as the infection develops into viral pneumonia and are lined with connective tissue. The interstitial pneumonitis that results impairs the transfer of oxygen from the lung to the blood. Notably, patients infected with the A(H1N1)pdm09 virus have already been reported to have diffuse alveolar damage, hemorrhagic interstitial pneumonitis, and peribronchiolar and perivascular lymphocytic infiltrates (Shieh et al. 2010; Gill et al. 2010). Finally, between the third and fifth day after the onset of symptoms, focal signals of mitotic activity start to emerge in the basal cell layer, which marks the beginning of the regeneration of epithelial tissue. It may take up to a month to fully repair the damage to the epithelium, with the start of reparative processes commencing concurrently with the final stages of tissue deterioration (Klomp et al. 2021).

2

An Updated Review on Influenza Viruses

2.5.1

87

Host Viral Interaction

Pattern recognition receptors (PRRs) like endosomal toll-like receptor 7 (TLR7) or cytosolic retinoic acid-inducible gene-I (RIG-I) are able to recognize the single stranded RNA (ssRNA) of IV upon entry into the host (Ampomah et al. 2018). Through a series of signaling cascades, this triggers antiviral host responses that prevent virus replication by producing type I IFN. IFN regulatory factor-3 (IRF-3) and IRF-7, two virus-induced transcription factors, play crucial roles in the production of type-I IFN. In addition, proinflammatory mediators like IL-1, IL-6, IL-18, IL-12, TNFα, and chemokines like CCL5 (RANTES), CXCL8, CXCL10, and CCL2 (MCP-1) can be produced when PRRs are activated (Fukuyama and Kawaoka 2011). Alveolar epithelial cells that are infected by macrophages can undergo apoptosis, which causes localized tissue damage and lung inflammation. The production of a variety of inflammatory cytokines and chemokines by the macrophage can also help to enhance viral clearance through the phagocytosis of viral particles that have been collectin-opsonized or infected apoptotic cells (Herold et al. 2015). The airway and alveolar epithelium undergo apoptosis and occasionally necrosis as a result of activation of the intrinsic apoptotic pathway, which are well-known symptoms of IV-induced acute respiratory distress syndrome (ARDS). IV, however, has evolved to subvert these innate immune responses. The major viral interferon antagonist, NS1 protein is a multifunctional virulence factor that can inhibit activation of RIG-I, hence regulating host cytosolic antiviral responses (Ma et al. 2020; Ayllon and García-Sastre 2015). Additionally, it has been shown that during infection, viral PB1/PA can block early IFN induction (Liedmann et al. 2014). The production of IFN and IFN-stimulated genes is inhibited in infected epithelial cells as a result of PB1-F2’s inhibition of RIG-I/MAVS-induced IRF3 activation (Leymarie et al. 2017; Cheung et al. 2020; Dudek et al. 2011). Recent research focused on the function of oxidative stress (OS) and microRNA (miRNA) in the development of IV. Different amounts of OS are induced by host-IV interactions by upsetting the equilibrium between reactive oxygen species (ROS) and antioxidant components. As ROS can both increase and decrease the expression of miRNA during IV infection, it is suggested that miRNA may regulate the expression of ROS. One of the elements that has been shown to express itself differently after IV infection is miRNA. While some miRNAs modulate viral replication and gene expression, others directly control host immune responses. These viral pathogeneses and miRNA expressions are also connected to the production of ROS, another important host factor that regulates the ratio of antioxidants to oxidants in order to maintain cell homeostasis. Numerous miRNA expressions are regulated by ROS, and ROS production in response to IV infection is also modulated by miRNA expression. IV pathogenesis is thus aided by this relationship between miRNA expression and ROS production (Haque et al. 2020).

88

2.5.2

U. Bhalerao et al.

Immune Responses to Influenza A Virus Infection

Both innate and adaptive immunological responses are triggered by the host immune response to an IV infection. The faster innate response includes a number of elements that can obstruct IV infection and viral multiplication. Adaptive immunity, on the other hand, possesses antigen specificity and memory and is efficient in preventing repeated IV infections. However, IVs can frequently elude host immunity through several methods and create a proper infection.

2.5.2.1 Innate Immune Response to IVs Infection The initial line of defense for the host against HIV infection is innate immunity, which also sets off pro-inflammatory reactions. The host’s innate defenses against IVs are strengthened by a number of factors, including physical barriers (mucus and collectins), PRRs (pattern recognition receptors) chemicals, and various host cells (target epithelial cells and immunological effector cells). While mucus and collectins work to stop IVs from infecting target cells, multiple PRRs can be activated during IV infection, suggesting that type I and III IFNs will thereafter be expressed (Chen et al. 2018). Pathogen recognition receptors, or PRRs, are receptors that identify non-self-preserving structures in IV-infected cells and these structures are called pathogen-associated molecular patterns (PAMPs). RIG-I, the melanoma differentiation-associated gene 5 (MDA-5), the toll-like receptors (TLR3, TLR7, and TLR8), and NLRs, namely NRLRP3 and NRLRP5, are examples of PRRs that have been described so far to identify IVs. In IV-infected cells, the cytosolic receptors RIG-I and MDA-5 can recognize viral single-stranded RNAs and IV transcriptional intermediates. Once recognized, both bind to MAVS and start a signaling cascade that starts at the outer mitochondrial membrane (Shope 1931) and finishes with the activation of transcription factors (IRF3, IFR7, and NF-B). IRF3 and IRF7 then stimulate the synthesis of type I and III IFNs, NF-κB, and the expression of proinflammatory cytokines such IL-6, tumor necrosis factoralpha (TNF-alpha), and IL-1 (Hiscott et al. 2006; Pichlmair et al. 2006). According to Takeshita et al. (2006), Toll-like receptors are PRRs that can detect PAMPs either externally at the cell surface or internally in endosomes or lysosomes. TLR3, TLR7, and TLR8 in particular can detect IV chemicals during virus replication. After being activated by recognition, TLR3 and TLR7 mediate a downstream signaling that activates IRF3, IRF7, or NF-B, causing the generation of type I IFN and pro-inflammatory cytokines such as RIG-I and MDA-5 pathways (Lund et al. 2004). Except for their ability to identify ssRNA in humans and the consequent generation of IL-12 by monocytes and macrophages, little is known regarding the function of TLR8 in sensing IVs (Ablasser et al. 2009). According to what has been stated, activating PRRs causes the production of type I IFNs and type III IFNs (Wang et al. 2008). On the other hand, monocytes and alveolar macrophages help prevent the transmission of AIV by opsonophagocytosing AIV particles and/or phagocytosing apoptotic infected cells, they also release proinflammatory cytokines including TNF-alpha and IL-6. Cytotoxic lymphocytes known as natural killer (NK) cells

2

An Updated Review on Influenza Viruses

89

may cause the attack and lysis of AIV-infected cells. Additionally, after contracting IV, DCs can pick up viral antigens and use cytosolic proteasomes to break them down into tiny peptides. They then provide them to memory and naive T cells. Major histocompatibility complex (MHC) class I molecules on DCs deliver virus-derived antigens, activating CD4+ T helper (Th) cells. In contrast, specialized CD8+ cytotoxic T lymphocytes recognize viral antigens when MHC class II molecules are present (CTL) (Chen et al. 2018).

2.5.2.2 Adaptive Immune Response to IVs Infection Adaptive immune responses are specific to pathogen and consists of humoral (virusspecific antibodies) and cellular (T cells) immunity. 2.5.2.2.1 Humoral Immunity to IVs Specific antibodies are produced against the virus antigen as a result of IV infection. The humoral immune system targets antigens expressed on the surface of viruses, including HA, NA, and M2 (Padilla-Quirarte et al. 2019). In order to stop the infection with IVs, antibodies made against the HA-globular portion can attach to the HA receptor-binding site (RBS) (by blocking the RBS). Additionally, HA-specific antibodies support antibody-dependent cell toxicity (ADCC). However, these antibodies are useless when IVs have head region alterations (Doud et al. 2018). According to Fox et al. (2018), the antibodies produced against the HA stem portion can either neutralize IVs or not (such as ADCC antibodies). HA-stem epitopes are proposed as promising universal vaccination candidates due to the highly conserved epitopes consolidating the HA-stem section and because they are not under intense immunological pressure. However, some characteristics of the conserved portions of the HA-stem part distinguish them into two phylogenetically distinct groups: Group 1 (H1, H2, H5, H6, H8, H9, H11, H12, H13, and H16 subtypes) and Group 2 (H3, H4, H7, H10, H14, and H15), which provide a non-equivalent protective efficacy (Wu and Wilson 2017). Additionally, M2 and NP-specific antibodies can be created, and although they are non-neutralizing, they may help guard against various IVs by cytolyzing the virus by activating the complement cascade (El Bakkouri et al. 2011). 2.5.2.2.2 Adaptive Cellular Immunity to IVs IV infection activates both the cytotoxic CD8+ and helper CD4+ T cells. Naive helper CD4+ T cells can develop either Th1 or Th2 phenotypes after activation (Ingulli et al. 1997; Lukens et al. 2009). The Th1 cell subgroup engages in cellmediated immunity, mostly generates IFN-α and IL-2, and may promote CD8+ T cell differentiation into CTLs (Shu et al. 1995; Stuber et al. 1996). Kreijtz et al. (2011) claim that Th2 type cells release IL-4 and IL-13, both of which are primarily responsible for inducing B cell responses. This strongly encourages the generation of long-lived plasma cells, affinity maturation, and switching between antibody classes. Antigen-presenting cells (APCs) that recognize IV epitopes with MHC class I molecules facilitate the development of naive CD8+ T cells into cytotoxic cells,

90

U. Bhalerao et al.

which then drain to the lymph nodes (van de Sandt et al. 2012). Upon detecting IV-infected cells, CD8+ T cells get activated, then these go to the infection site, and kill infected cells by secreting cytotoxic granules containing perforin and granzymes (e.g., GrA and GrB). It has been discovered that this particular sensitivity of CTL cells is primarily focused on conserved IV epitopes and that they can be reactivated in response to secondary IV infection. Consequently, their response is classified as having a heterosubtypic nature (Grant et al. 2016). Th17 and T regs, which regulate and/or govern the cellular immune response, are other cell subsets that can be activated in response to IVs (van de Sandt et al. 2012). Th17 cells release IL-6 to encourage T helper responses. By reducing heightened innate and adaptive immune responses to IVs, T regs help regulate lung inflammation during an IV infection (Campbell and Koch 2011). Also, according to Yu and Vinuesa (2010), another subpopulation known as T follicular helper (Tfh) cells is thought to be responsible for effector CD4+ T cell Th2 responses (antibody switch, affinity maturation, and long-lived plasma cell production) (Yu and Vinuesa 2010).

2.6

Clinical Manifestations

Seasonal flu symptoms can range from being asymptomatic to symptoms ranging from fever, headache, cough, sore throat, nasal congestion, sneezing, to body aches, as well as more severe manifestations in serious cases. The pathogenicity of the virus, a person’s age and genetic composition, as well as whether or not they have any underlying immune-compromising disorders, all affect how severe an infection is.

2.6.1

Uncomplicated Influenza

Uncomplicated Influenza infections can manifest in a variety of ways, from afebrile respiratory diseases resembling the common cold to illnesses where systemic symptoms are more prevalent than respiratory symptoms (Shieh et al. 2010). The patient may experience fever during the first few days, but it progressively goes away and passes. The calf muscle, paravertebral muscles, and back muscles all exhibit myalgia. Additionally, Liu et al. (2015) noted a dry cough, runny nose, and sore throat.

2.6.2

Complications of Influenza

Influenza complications can be categorized as pulmonary or non-pulmonary. Pneumonia is the most significant and frequently accompanies Influenza, particularly in high-risk individuals. When caused by primary pneumonia, pneumonia can continue with the acute Influenza symptoms or, after a few days, it can develop as a mixed viral and bacterial infection (secondary pneumonia) (Liu et al. 2015). Less often

2

An Updated Review on Influenza Viruses

91

occurring extrapulmonary Influenza complications are more common during larger, more severe epidemics. These include transversal myelitis, encephalitis, myocarditis, pericarditis, myositis (more prevalent with IBV infection), and Guillain-Barré syndrome. Pneumonia and the worsening of long-term cardiopulmonary problems are the main killers. Eighty to ninety percent of Influenza-associated mortality occurs in individuals that are 65 years or older (Mancinelli et al. 2015).

2.7

Diagnostics and Therapeutics Approaches

Influenza is generally diagnosed clinically and based on signs and symptoms. However, the diagnosis of Influenza in clinical and public health laboratories aids in patient care and provides information on outbreaks and surveillance for public health policies and guidelines. Traditional methods, serological methods, nucleic acid tests (NAT), and bio-sensing technologies are four categories of detection techniques that differ in sensitivity and specificity for different specimen types. Real-time PCR is a recommended standard test by the WHO, despite the fact that there are other detection methods available. Nasopharyngeal swab samples are typically the most accurate samples for IV diagnosis. For virological surveillance, virus culture is a conventional technique that is crucial. Mammalian cells, primarily MDCK, or embryonated eggs are employed to propagate the IV in order to recover it from clinical samples. The best clinical specimens for viral isolation include bronchoalveolar lavages, nasal and throat swabs, and nasopharyngeal aspirates (Vemula et al. 2016). Antibody responses to the IV are often diagnosed using serological methods. These tests include the ELISA (enzyme-linked immunosorbent assay), Western blotting, immunodiffusion test, single radial hemolysis, hemagglutination inhibition assay, viral neutralization assay or microneutralization, complement fixation, and virus neutralization (Li et al. 2017). Due to the intricacy of sample collection, such as matched serum samples, these tests are not frequently advised (Ravina et al. 2021). IV detection in humans can be accomplished using a variety of NATs, including the rapid Influenza test, nucleic acid sequence-based amplification (NASBA), and reverse transcriptase PCR (RT-PCR) including real-time PCR and multiplex PCR. Most of these processes are more precise and sensitive than a serological test, and they take between 2 and 4 h to complete the detection (Vemula et al. 2016). RT-PCR testing is often more sensitive than rapid antigen testing, which can detect viral genetic material and produce results in 15–20 min (normally between 50 and 70% less sensitive). Currently, there are two different kinds of rapid diagnostic tests for Influenza: those that either detect both IAV and IBV without differentiating between the two viral types. The most accurate approach for detecting Influenza is RT-PCR. The results are highly specific and sensitive (Ravina et al. 2021) because they can identify viral genomes that are present at concentrations below the threshold for virus isolation. This procedure involves removing the vRNA from the sample, using an enzyme called reverse transcriptase to convert the RNA into single-stranded complementary

92

U. Bhalerao et al.

DNA (sscDNA), amplifying the result, and then detecting the fluorescence signal. Contrarily, a number of multiplex RT-PCR assays have been created for the simultaneous detection of different IV strains, as this technique’s main benefit is its inexpensive cost and 1- to 8-h reaction time requirement (Lee et al. 2001; Wang et al. 2017; Cui et al. 2016). The most recent innovation in the identification and detection of the virus is biosensing approaches (Wang et al. 2011). A typical biosensor is made up of three basic parts: an optical, electrical, or thermal signaltransducing component, an amplification/processing element, and a biological component (protein, DNA, RNA, antibody/antigen, and cells). There have been reports of several sensor types for detecting various diseases. Aptamers, which are synthetic oligonucleotides or proteins folded into three dimensions and capable of specific non-covalent target binding as well as target differentiation using a single functional group, are now used in the development of sensors. High binding affinity and specificity are features of the aptamer. Through repeated rounds of selection and an amplification technique using an in vitro genetic selection strategy, aptamers can be produced from nucleic acids (Ravina et al. 2021).

2.8

Treatments

Antiviral medications with both preventive and therapeutic purposes are among the treatments for Influenza. The very first antiviral for influenza was amantadine and it was licensed in 1966 for influenza A only, since it was ineffective against influenza B. In 1994, a derivative of amantadine, called rimantadine, was approved by the FDA for treating influenza A, but it was established soon after that this drug was associated with serious side effects (Mamelund 2011). In 1989, the first neuraminidase inhibitor, zanamivir (Relenza), was commercially developed (Mamelund 2011). Another neuraminidase inhibitor, oseltamivir (Tamiflu), was used extensively in 2005 and 2006 during the H5N1 avian influenza epidemic of South-East Asia. With the evolution influenza viruses, antivirals and therapeutic strategies will continue to be modified and improved to effectively reduce the morbidity and mortality associated with influenza (Mamelund 2011). Currently, only two kinds of antiInfluenza medications—NA inhibitors and M2 channel inhibitors (rimantadine and amantadine)—have received clinical use approval (zanamivir and oseltamivir). The more quickly after infection that these medications are given, the more effectively they can lessen the disease severity. But both classes of medication resistance in IV strains have been discovered (Hussain et al. 2017). The adamantanes (inhibitors) bind to M2 channel pore and block proton conductance, thereby inhibiting vRNP release and IV replication (Cady et al. 2010). However, due to their toxicity, lack of activity against IBV, and rapid emergence of drug resistance, their use in clinical practice is restricted (Pinto and Lamb 2006). Anti-Influenza medications now in use are class NA inhibitors (zanamivir and oseltamivir). Since NA are transition state structural analogues that compete with cell surface SA-viral NA contacts and so block the enzymatic activity initiating the release of the freshly generated IV particles, they specifically target the IV surface

2

An Updated Review on Influenza Viruses

93

protein to perform their antiviral function. However, like M2, IV possesses some altered amino acids in the vicinity of NA active site resistant NA inhibitors, including E119V, I222V, H274Y, R292K, and N294S (Gubareva et al. 2000). Due to its function in controlling IV replication and transcription as well as the existence of highly conserved RNA polymerases among various strains, research has concentrated on the IV RNA polymerase as a potential therapeutic target (Müller et al. 2012). Ribavirin and favipiravir are two other possible antiviral medications that show antiviral activity (Pagadala 2019). The nucleoside chemical ribavirin works by competitively inhibiting IMP dehydrogenase, which lowers the amount of GTP in cells and, as a result, the ability of viral RNA polymerase to replicate IV. In a mouse model of H1N1, the medicine in combination with oseltamivir was found to be more efficacious than the drug alone (Ilyushina et al. 2008). The antiInfluenza drug favipiravir has received approval in Japan and has good antiviral effectiveness against vRNA (Shiraki and Daikoku 2020).

2.9

Prevention and Control

The best prevention method suggested by the WHO for at-risk populations is vaccination. However, there were no vaccines or antivirals against influenza until the second half of the twenty-first century, and the only preventive measures included quarantine and isolation, and the use of masks to reduce transmission, and other measures involved supportive care to the infected to reduce symptoms only (Mamelund 2011). The Soviet scientist A.A. Smorodintseff made the first attempt to vaccinate people with a live influenza vaccine in 1936. The virus lost its virulence due to repeated passaging in embryonated eggs and caused mild fever in vaccinees, but they were protected against reinfection. An influenza vaccine was developed in 1942–1943 and it was a killed bivalent vaccine which contained purified antigens against Influenza A and B viruses (Mamelund 2011). In 1945, the first inactivated influenza vaccine developed using embryonated chicken eggs, by Thomas Francis, Jr. and Jonas Salk, was licensed for use in civilian populations after demonstration of efficacy in military recruits (Webster et al. 1992). However, in 1947, researchers realized that changes in the antigenic composition of circulating influenza viruses had rendered existing vaccines ineffective, highlighting the need for continuous surveillance and characterization of circulating flu viruses. In 1978, the first trivalent (three-component), egg-cultured flu vaccine was created, containing two influenza A strains (H1N1 and H3N2) and one influenza B strain, which were the most common strains in circulation at the time. After the establishment of WHO Influenza centers, FluNet, a web-based flu surveillance tool was launched in 1997 by WHO for tracking the movement of flu viruses globally with country-wise data updated weekly and made publicly available. The WHO also published a pandemic planning framework in 1999 to emphasize the need to enhance influenza surveillance, vaccine production and distribution, antiviral drugs, influenza research, and emergency preparedness.

94

U. Bhalerao et al.

Fig. 2.1 Types of Influenza vaccines (Created with BioRender.com)

In June 2003, the first nasal spray flu vaccine was licensed, and in 2007 the Food and Drug Administration (FDA) approved the first US vaccine for the avian influenza A(H5N1) virus. In October 2009, the first monovalent vaccine was licensed and administered against the H1N1 pandemic virus. In 2012, cell culture-based vaccines become available as opposed to those derived from embryonated eggs, and in the same year WHO made the first vaccine composition recommendation for a quadrivalent vaccine. Inactivated (IIV) and live attenuated Influenza vaccines (LAIV) are the two types of Influenza vaccinations currently on the market (Lopez and Legge 2020). The different types of vaccines that have been developed are highlighted upon in Fig. 2.1. Trivalent (TIVs) and quadrivalent (QIVs) are Influenza vaccinations that contain antigens from Influenza A subtypes H1N1 and H3N2, as well as one of the two Influenza B subtypes (containing strains of H1N1, H3N2). QIVs have been shown to reduce morbidity, mortality, and the requirement for medical care when compared to trivalent immunization. There are LAIV and IIV versions of the QIV and TIV vaccines. In order to forecast viral strains that may spread and be included in the vaccine, the WHO international monitoring system monitors the identification of the circulating strains (Lee et al. 2012). Influenza vaccinations offer strain-specific immunity. The seasonal vaccines generate antibodies that are neutralizing to the globular HA heads of the viral strains. These antibodies are unable to neutralize the mismatched HA that is not a part of the IV strains in the vaccine. Every year, the

2

An Updated Review on Influenza Viruses

95

vaccination must be revised to account for the most recent strains (Lopez and Legge 2020).

2.9.1

IIV

IIV is an umbrella name encompassing vaccinations in which the IV virus is produced in cell culture or embryonated chicken eggs (the bulk of vaccines made), which are subsequently purified and chemically inactivated, usually using formaldehyde or a detergent that obliterates the virus envelope. However, some recent IIV vaccinations contained HA protein created using recombinant technology or cell lines (Lopez and Legge 2020). The immunogenicity of the three types of IIV vaccinations—whole-virion vaccines (WIV), split-virion vaccines, and subunit vaccines—varies. During the 3–6 months it takes to develop a vaccine, a pandemic strain might spread over the world, or antigenic drifts could occur in seasonal strains already in circulation (Sridhar et al. 2013).

2.9.2

LAIV

Creating an LAIV is based on the fundamental idea of stimulating both cellular and humoral immune responses. As a result, LAIVs provide a larger immune response to the attenuated, temperature-sensitive, and cold-adapted IAV or IBV strain and longer protection than inactivated vaccines. LAIVs are administered intranasally (aerosolization of 0.25 mL each nostril) to simulate natural infection. Due to the limited viral replication in the upper respiratory tract, these cold-adapted strains can successfully proliferate between 25 and 33 °C. As a result, the body is prompted to create high amounts of sIgA and cellular immune response, providing strong crossprotection. These LAV and wild strains could, however, be subject to the possibility of gene reassortment (Rodriguez et al. 2019; Holzer et al. 2019). Targeting the conserved portion of the HA glycoprotein stem may be the most viable new strategy for a universal immunization because there are numerous obstacles to using traditional vaccines. The two basic methods for developing a universal vaccine involve sequential injections of HA head regions with varying diversity but preserved stalk regions. In early-stage trials, candidates for a universal vaccination have demonstrated promise for evoking a favorable immunological response (Bernstein et al. 2020). Studies are still needed to assess the safety of the vaccine, antibody response durability, and clinical comparability with currently available immunizations. Furthermore, the benefits of a universal vaccine might not be enough to make up for the weakened immune system of the elderly. The main areas of investigation in the field of universal immunizations right now include the stem region of HA2, chimeric HA, M2e, NP, and T/B cell epitopes (Sun et al. 2020).

96

2.10

U. Bhalerao et al.

Future Perspective

Since Influenza pandemics have occurred for more than a thousand years, novel IVs will probably continue to develop in the future for efficient human adaptation and pandemic transmission. A few of the key elements in preventing IV infection include the ability of IV subtypes to cross the species barrier, their antiviral drug resistance, their inability to predict the next pandemic virus, their low likelihood of accurately matching the circulating and vaccine viruses, and the expensive nature of vaccination. In this context, the virus is metaphorically used to represent a pathogen that frequently spreads from animals to humans and causes severe illness in the human population. Swine are essential to the ecology of IVs because they are susceptible to human, avian, and swine IV infections. As a result, during possible pandemics, they play a crucial host role in the creation of novel viruses through genetic reassortment. Since IVs evolve within their host species, improving IV monitoring at the animalhuman interface is a critical public health concern. For the spread to occur, there must be contact between the ecology, humans, and animals. Because of the expansion in poultry and swine populations brought on by the expanding global human population, the prevalence of zoonotic IV diseases in human populations are more likely to increase. As these viruses continue to change, particularly in terms of virulence, resistance, and ecology, it is necessary to work closely together adopting a “One Health” strategy. Influenza emphasizes the value of One Health, which brings together experts in animal, human, and environmental health to address connected issues. Examples of recent zoonoses with substantial worldwide effects include disease caused by the pandemic H1N1pdm09 virus and circulating avian H5N1, H9N2, or the more recent H7N9 viruses. The expansion and ongoing support of partnerships between human and animal health professionals at the clinical, diagnostic laboratory, public health, research, and training levels are necessary for the management and prevention of Influenza and other emerging infectious illnesses. The “One Health” approach created to lessen and manage the three dangers may directly benefit human health. The revision and use of such an approach will also have a substantial impact on identifying risk factors, assessing risk, and taking preventative measures. The fact that animal viruses or virus reassortants carrying animal virus genes were to blame for all previous human pandemics emphasizes the necessity for a “One Health” approach that merges veterinary and human care to combat Influenza.

References Ablasser A, Poeck H, Anz D, Berger M, Schlee M, Kim S, Bourquin C, Goutagny N, Jiang Z, Fitzgerald KA, Rothenfusser S, Endres S, Hartmann G, Hornung V (2009) Selection of molecular structure and delivery of RNA oligonucleotides to activate TLR7 versus TLR8 and to induce high amounts of IL-12p70 in primary human monocytes. J Immunol 182(11): 6824–6833. https://doi.org/10.4049/JIMMUNOL.0803001 Acheson NH (2011) Fundamentals of molecular virology, 2nd edn. John Wiley & Sons, Inc.

2

An Updated Review on Influenza Viruses

97

Adeola OA, Olugasa BO, Emikpe BO (2017) Molecular detection of influenza A (H1N1) pdm09 viruses with M genes from human pandemic strains among Nigerian pigs, 2013–2015: implications and associated risk factors. Epidemiol Infect 145(16):3345–3360 Akarsu H, Burmeister WP, Petosa C, Petit I, Müller CW, Ruigrok RW, Baudin F (2003) Crystal structure of the M1 protein-binding domain of the influenza A virus nuclear export protein (NEP/NS2). EMBO J 22(18):4646–4655 Ampomah PB, Kong WT, Zharkova O, Chua SCJH, Perumal Samy R, Lim LH (2018) Annexins in influenza virus replication and pathogenesis. Front Pharmacol 9:1282 Ayllon J, García-Sastre A (2015) The NS1 protein: a multitasking virulence factor. Curr Top Microbiol Immunol 386:73–107 Belser JA, Katz JM, Tumpey TM (2011) The ferret as a model organism to study influenza A virus infection. Dis Model Mech 4(5):575–579 Bernstein DI, Guptill J, Naficy A, Nachbagauer R, Berlanda-Scorza F, Feser J et al (2020) Immunogenicity of chimeric haemagglutinin-based, universal influenza virus vaccine candidates: interim results of a randomised, placebo-controlled, phase 1 clinical trial. Lancet Infect Dis 20(1):80–91 Blumenkrantz D, Roberts KL, Shelton H, Lycett S, Barclay WS (2013) The short stalk length of highly pathogenic avian influenza H5N1 virus neuraminidase limits transmission of pandemic H1N1 virus in ferrets. J Virol 87(19):10539–10551 Boni MF, Zhou Y, Taubenberger JK, Holmes EC (2008) Homologous recombination is very rare or absent in human influenza A virus. J Virol 82(10):4807–4811 Borkenhagen LK, Salman MD, Ma MJ, Gray GC (2019) Animal influenza virus infections in humans: a commentary. Int J Infect Dis 88:113–119 Böttcher-Friebertshäuser E, Garten W, Matrosovich M, Klenk HD (2014) The hemagglutinin: a determinant of pathogenicity. Curr Top Microbiol Immunol 385:3–34 Bouvier NM, Palese P (2008) The biology of influenza viruses. Vaccine 26:D49–D53 Cady SD, Luo W, Hu F, Hong M (2009) Structure and function of the influenza A M2 proton channel. Biochemistry 48(31):7356–7364 Cady SD, Schmidt-Rohr K, Wang J, Soto CS, DeGrado WF, Hong M (2010) Structure of the amantadine binding site of influenza M2 proton channels in lipid bilayers. Nature 463(7281): 689–692 Caini S, Kusznierz G, Garate VV, Wangchuk S, Thapa B, de Paula Júnior FJ et al (2019) The epidemiological signature of influenza B virus and its B/Victoria and B/Yamagata lineages in the 21st century. PLoS One 14(9):e0222381 Campbell DJ, Koch MA (2011) Treg cells: patrolling a dangerous neighborhood. Nat Med 17(8): 929–930 Cauldwell AV, Long JS, Moncorge O, Barclay WS (2014) Viral determinants of influenza A virus host range. J Gen Virol 95(6):1193–1210 Chen L, Sun L, Li R, Chen Y, Zhang Z, Xiong C et al (2016) Is a highly pathogenic avian influenza virus H5N1 fragment recombined in PB1 the key for the epidemic of the novel AIV H7N9 in China, 2013? Int J Infect Dis 43:85–89 Chen X, Liu S, Goraya MU, Maarouf M, Huang S, Chen JL (2018) Host immune response to influenza A virus infection. Front Immunol 9:320 Cheung PHH, Ye ZW, Lee TWT, Chen H, Chan CP, Jin DY (2020) PB1-F2 protein of highly pathogenic influenza A (H7N9) virus selectively suppresses RNA-induced NLRP3 inflammasome activation through inhibition of MAVS-NLRP3 interaction. J Leucocyte Biol 108(5):1655–1663 Ciminski K, Chase GP, Beer M, Schwemmle M (2021) Influenza a viruses: understanding human host determinants. Trends Mol Med 27(2):104–112 Costa T, Chaves AJ, Valle R, Darji A, van Riel D, Kuiken T et al (2012) Distribution patterns of influenza virus receptors and viral attachment patterns in the respiratory and intestinal tracts of seven avian species. Vet Res 43(1):1–13

98

U. Bhalerao et al.

Cui D, Zhao D, Xie G, Yang X, Huo Z, Zheng S et al (2016) Simultaneous detection of influenza A subtypes of H3N2 virus, pandemic (H1N1) 2009 virus and reassortant avian H7N9 virus in humans by multiplex one-step real-time RT-PCR assay. Springerplus 5(1):1–8 Dadonaite B, Gilbertson B, Knight ML, Trifkovic S, Rockman S, Laederach A et al (2019) The structure of the influenza A virus genome. Nat Microbiol 4(11):1781–1789 De Vries E, Tscherne DM, Wienholts MJ, Cobos-Jiménez V, Scholte F, García-Sastre A et al (2011) Dissection of the influenza A virus endocytic routes reveals macropinocytosis as an alternative entry pathway. PLoS Pathog 7(3):e1001329 de Vries E, Du W, Guo H, de Haan CA (2020) Influenza A virus hemagglutinin–neuraminidase– receptor balance: preserving virus motility. Trends Microbiol 28(1):57–67 de Wit E, Munster VJ, van Riel D, Beyer WE, Rimmelzwaan GF, Kuiken T et al (2010) Molecular determinants of adaptation of highly pathogenic avian influenza H7N7 viruses to efficient replication in the human host. J Virol 84(3):1597–1606 Deng YM, Iannello P, Smith I, Watson J, Barr IG, Daniels P et al (2012) Transmission of influenza A (H1N1) 2009 pandemic viruses in Australian swine. Influenza Other Respir Viruses 6(3):e42– e47 Doud MB, Lee JM, Bloom JD (2018) How single mutations affect viral escape from broad and narrow antibodies to H1 influenza hemagglutinin. Nat Commun 9(1):1–12 Dudek SE, Wixler L, Nordhoff C, Nordmann A, Anhlan D, Wixler V, Ludwig S (2011) The influenza virus PB1-F2 protein has interferon antagonistic activity. Biol Chem 392(12): 1135–1144 Edinger TO, Pohl MO, Stertz S (2014) Entry of influenza A virus: host factors and antiviral targets. J Gen Virol 95(2):263–277 Eierhoff T, Hrincius ER, Rescher U, Ludwig S, Ehrhardt C (2010) The epidermal growth factor receptor (EGFR) promotes uptake of influenza A viruses (IAV) into host cells. PLoS Pathog 6(9):e1001099 El Bakkouri K, Descamps F, De Filette M, Smet A, Festjens E, Birkett A et al (2011) Universal vaccine based on ectodomain of matrix protein 2 of influenza A: Fc receptors and alveolar macrophages mediate protection. J Immunol 186(2):1022–1031 Fouchier RA, Schneeberger PM, Rozendaal FW, Broekman JM, Kemink SA, Munster V et al (2004) Avian influenza A virus (H7N7) associated with human conjunctivitis and a fatal case of acute respiratory distress syndrome. Proc Natl Acad Sci U S A 101(5):1356–1361 Fox A, Quinn KM, Subbarao K (2018) Extending the breadth of influenza vaccines: status and prospects for a universal vaccine. Drugs 78(13):1297–1308 Fukuyama S, Kawaoka Y (2011) The pathogenesis of influenza virus infections: the contributions of virus and host factors. Curr Opin Immunol 23(4):481–486 Furuse Y, Oshitani H (2016) Mechanisms of replacement of circulating viruses by seasonal and pandemic influenza A viruses. Int J Infect Dis 51:6–14 Gales JP, Kubina J, Geldreich A, Dimitrova M (2020) Strength in diversity: nuclear export of viral RNAs. Viruses 12(9):1014 Garcia NK, Guttman M, Ebner JL, Lee KK (2015) Dynamic changes during acid-induced activation of influenza hemagglutinin. Structure 23(4):665–676 Gill JR, Sheng ZM, Ely SF, Guinee DG Jr, Beasley MB, Suh J et al (2010) Pulmonary pathologic findings of fatal 2009 pandemic influenza A/H1N1 viral infections. Arch Pathol Lab Med 134(2):235–243 Gillespie L, Roosendahl P, Ng WC, Brooks AG, Reading PC, Londrigan SL (2016) Endocytic function is critical for influenza A virus infection via DC-SIGN and L-SIGN. Sci Rep 6(1):1–11 Goneau LW, Mehta K, Wong J, L’Huillier AG, Gubbay JB (2018) Zoonotic influenza and human health—part 1: virology and epidemiology of zoonotic influenzas. Curr Infect Dis Rep 20:1–12 Gorai T, Goto H, Noda T, Watanabe T, Kozuka-Hata H, Oyama M et al (2012) F1Fo-ATPase, F-type proton-translocating ATPase, at the plasma membrane is critical for efficient influenza virus budding. Proc Natl Acad Sci U S A 109(12):4615–4620

2

An Updated Review on Influenza Viruses

99

Gounder AP, Boon A (2019) Influenza pathogenesis: the effect of host factors on severity of disease. J Immunol 202(2):341–350 Govorkova EA, Kodihalli S, Alymova IV, Fanget B, Webster RG (1999) Growth and immunogenicity of influenza viruses cultivated in Vero or MDCK cells and in embryonated chicken eggs. Dev Biol Stand 98:39–51 Graef KM, Vreede FT, Lau YF, McCall AW, Carr SM, Subbarao K, Fodor E (2010) The PB2 subunit of the influenza virus RNA polymerase affects virulence by interacting with the mitochondrial antiviral signaling protein and inhibiting expression of beta interferon. J Virol 84(17):8433–8445 Grant EJ, Quiñones-Parra SM, Clemens EB, Kedzierska K (2016) Human influenza viruses and CD8+ T cell responses. Curr Opin Virol 16:132–142 Gubareva LV, Kaiser L, Hayden FG (2000) Influenza virus neuraminidase inhibitors. Lancet (London, England) 355(9206):827–835. https://doi.org/10.1016/S0140-6736(99)11433-8 Hamilton BS, Whittaker GR, Daniel S (2012) Influenza virus-mediated membrane fusion: determinants of hemagglutinin fusogenic activity and experimental approaches for assessing virus fusion. Viruses 4(7):1144–1168 Hao W, Wang L, Li S (2020) Roles of the non-structural proteins of influenza A virus. Pathogens 9(10):812 Haque MM, Murale DP, Lee JS (2020) Role of microRNA and oxidative stress in influenza A virus pathogenesis. Int J Mol Sci 21(23):8962 Hatta M, Gao P, Halfmann P, Kawaoka Y (2001) Molecular basis for high virulence of Hong Kong H5N1 influenza A viruses. Science 293(5536):1840–1842 Herold S, Becker C, Ridge KM, Budinger GS (2015) Influenza virus-induced lung injury: pathogenesis and implications for treatment. Eur Respir J 45(5):1463–1478 Hiscott J, Lin R, Nakhaei P, Paz S (2006) MasterCARD: a priceless link to innate immunity. Trends Mol Med 12(2):53–56 Hoffmann TW, Munier S, Larcher T, Soubieux D, Ledevin M, Esnault E et al (2012) Length variations in the NA stalk of an H7N1 influenza virus have opposite effects on viral excretion in chickens and ducks. J Virol 86(1):584–588 Holzer B, Morgan SB, Martini V, Sharma R, Clark B, Chiu C et al (2019) Immunogenicity and protective efficacy of seasonal human live attenuated cold-adapted influenza virus vaccine in pigs. Front Immunol 10:2625 Hussain M, Galvin HD, Haw TY, Nutsford AN, Husain M (2017) Drug resistance in influenza A virus: the epidemiology and management. Infect Drug Resist 10:121–134 Hutchinson EC, von Kirchbach JC, Gog JR, Digard P (2010) Genome packaging in influenza A virus. J Gen Virol 91(2):313–328 Hutchinson EC, Charles PD, Hester SS, Thomas B, Trudgian D, Martínez-Alonso M, Fodor E (2014) Conserved and host-specific features of influenza virion architecture. Nat Commun 5(1): 1–11 Ilyushina NA, Hay A, Yilmaz N, Boon AC, Webster RG, Govorkova EA (2008) Oseltamivirribavirin combination therapy for highly pathogenic H5N1 influenza virus infection in mice. Antimicrob Agents Chemother 52(11):3889–3897 Ingulli E, Mondino A, Khoruts A, Jenkins MK (1997) In vivo detection of dendritic cell antigen presentation to CD4+ T cells. J Exp Med 185(12):2133–2141 Iuliano AD, Roguski KM, Chang HH, Muscatello DJ, Palekar R, Tempia S et al (2018) Estimates of global seasonal influenza-associated respiratory mortality: a modelling study. Lancet 391(10127):1285–1300 Jagger BW, Wise HM, Kash JC, Walters KA, Wills NM, Xiao YL et al (2012) An overlapping protein-coding region in influenza A virus segment 3 modulates the host response. Science 337(6091):199–204 Johnson NP, Mueller J (2002) Updating the accounts: global mortality of the 1918-1920 “Spanish” influenza pandemic. Bull Hist Med 76:105–115

100

U. Bhalerao et al.

Jonges M, Bataille A, Enserink R, Meijer A, Fouchier RA, Stegeman A et al (2011) Comparative analysis of avian influenza virus diversity in poultry and humans during a highly pathogenic avian influenza A (H7N7) virus outbreak. J Virol 85(20):10598–10604 Jonges M, Welkers MR, Jeeninga RE, Meijer A, Schneeberger P, Fouchier RA et al (2014) Emergence of the virulence-associated PB2 E627K substitution in a fatal human case of highly pathogenic avian influenza virus A (H7N7) infection as determined by Illumina ultra-deep sequencing. J Virol 88(3):1694–1702 Kamal RP, Alymova IV, York IA (2017) Evolution and virulence of influenza A virus protein PB1-F2. Int J Mol Sci 19(1):96 Kilander A, Rykkvin R, Dudman SG, Hungnes O (2010) Observed association between the HA1 mutation D222G in the 2009 pandemic influenza A (H1N1) virus and severe clinical outcome, Norway 2009-2010. Eurosurveillance 15(9):19498 Kilbourne ED (2006) Influenza pandemics of the 20th century. Emerg Infect Dis 12(1):9 Kirkpatrick E, Qiu X, Wilson PC, Bahl J, Krammer F (2018) The influenza virus hemagglutinin head evolves faster than the stalk domain. Sci Rep 8(1):1–14 Klomp M, Ghosh S, Mohammed S, Nadeem Khan M (2021) From virus to inflammation, how influenza promotes lung damage. J Leukoc Biol 110(1):115–122 Kong W, Liu Q, Sun Y, Wang Y, Gao H, Liu L et al (2016) Transmission and pathogenicity of novel reassortants derived from Eurasian avian-like and 2009 pandemic H1N1 influenza viruses in mice and Guinea pigs. Sci Rep 6(1):27067 Kreijtz JHCM, Fouchier RAM, Rimmelzwaan GF (2011) Immune responses to influenza virus infection. Virus Res 162(1–2):19–30 Lagace-Wiens PR, Rubinstein E, Gumel A (2010) Influenza epidemiology—past, present, and future. Crit Care Med 38:e1–e9 Lee N, Chan PK, Hui DS, Rainer TH, Wong E, Choi KW et al (2009) Viral loads and duration of viral shedding in adult patients hospitalized with influenza. J Infect Dis 200(4):492–500 Lee MS, Chang PC, Shien JH, Cheng MC, Shieh HK (2001) Identification and subtyping of avian influenza viruses by reverse transcription-PCR. J Virol Methods 97(1–2):13–22 Lee BY, Bartsch SM, Willig AM (2012) The economic value of a quadrivalent versus trivalent influenza vaccine. Vaccine 30(52):7443–7446 Leikina E, Ramos C, Markovic I, Zimmerberg J, Chernomordik LV (2002) Reversible stages of the low-pH-triggered conformational change in influenza virus hemagglutinin. EMBO J 21(21): 5701–5710 Leymarie O, Meyer L, Tafforeau L, Lotteau V, Costa BD, Delmas B et al (2017) Influenza virus protein PB1-F2 interacts with CALCOCO2 (NDP52) to modulate innate immune response. J Gen Virol 98(6):1196–1208 Li Q, Sun X, Li Z, Liu Y, Vavricka CJ, Qi J, Gao GF (2012) Structural and functional characterization of neuraminidase-like molecule N10 derived from bat influenza A virus. Proc Natl Acad Sci U S A 109(46):18897–18902 Li ZN, Weber KM, Limmer RA, Horne BJ, Stevens J, Schwerzmann J et al (2017) Evaluation of multiplex assay platforms for detection of influenza hemagglutinin subtype specific antibody responses. J Virol Methods 243:61–67 Liedmann S, Hrincius ER, Guy C, Anhlan D, Dierkes R, Carter R et al (2014) Viral suppressors of the RIG-I-mediated interferon response are pre-packaged in influenza virions. Nat Commun 5 (1):1–8 Lin D, Lan J, Zhang Z (2007) Structure and function of the NS1 protein of influenza A virus. Acta Biochim Biophys Sin 39(3):155–162 Lina B (2008) History of influenza pandemics. In: Paleomicrobiology: past human infections, pp 199–211 Liu W, Peng L, Liu H, Hua S (2015) Pulmonary function and clinical manifestations of patients infected with mild influenza A virus subtype H1N1: a one- year follow-up. PLoS One 10(7): e0133698

2

An Updated Review on Influenza Viruses

101

Londrigan SL, Turville SG, Tate MD, Deng YM, Brooks AG, Reading PC (2011) N-linked glycosylation facilitates sialic acid-independent attachment and entry of influenza A viruses into cells expressing DC-SIGN or L-SIGN. J Virol 85(6):2990–3000 Lopez CE, Legge KL (2020) Influenza A virus vaccination: immunity, protection, and recent advances toward a universal vaccine. Vaccine 8(3):434 Lowen AC (2017) Constraints, drivers, and implications of influenza A virus reassortment. Annu Rev Virol 4(1):105–121. https://doi.org/10.1146/annurev-virology-101416-041726 Lowen AC (2018) It’s in the mix: reassortment of segmented viral genomes. PLoS Pathog 14(9): e1007200 Lukens MV, Kruijsen D, Coenjaerts FE, Kimpen JL, van Bleek GM (2009) Respiratory syncytial virus-induced activation and migration of respiratory dendritic cells and subsequent antigen presentation in the lung-draining lymph node. J Virol 83(14):7235–7243 Lund JM, Alexopoulou L, Sato A, Karow M, Adams NC, Gale NW et al (2004) Recognition of single-stranded RNA viruses by Toll-like receptor 7. Proc Natl Acad Sci U S A 101(15): 5598–5603 Luo Y, Li L, Austermann-Busch S, Dong M, Xu J, Shao L et al (2015) Enhanced expression of the Erns protein of classical swine fever virus in yeast and its application in an indirect enzymelinked immunosorbent assay for antibody differentiation of infected from vaccinated animals. J Virol Methods 222:22–27 Ma W, Lager KM, Vincent AL, Janke BH, Gramer MR, Richt JA (2009) The role of swine in the generation of novel influenza viruses. Zoonoses Public Health 56(6–7):326–337 Ma J, Wu R, Xu G, Cheng Y, Wang Z, Wang HA et al (2020) Acetylation at K108 of the NS1 protein is important for the replication and virulence of influenza virus. Vet Res 51:1–10 Madhav N, Oppenheim B, Gallivan M, Mulembakani P, Rubin E, Wolfe N (2018) Pandemics: risks, impacts, and mitigation Mamelund S-E (2011) Geography may explain adult mortality from the 1918–20 influenza pandemic. Epidemics 3(1):46–60, ISSN 1755-4365. https://doi.org/10.1016/j.epidem.2011.02.001 Mancinelli L, Onori M, Concato C, Sorge R, Chiavelli S, Coltella L et al (2015) Clinical features of children hospitalized with influenza A and B infections during the 2012–2013 influenza season in Italy. BMC Infect Dis 16(1):1–8 Manicassamy B, Medina RA, Hai R, Tsibane T, Stertz S, Nistal-Villan E et al (2010) Protection of mice against lethal challenge with 2009 H1N1 influenza A virus by 1918-like and classical swine H1N1 based vaccines. PLoS Pathog 6(1):e1000745 Martin KELSEY, Helenius A (1991) Transport of incoming influenza virus nucleocapsids into the nucleus. J Virol 65(1):232–244 Matsuoka Y, Swayne DE, Thomas C, Rameix-Welti MA, Naffakh N, Warnes C et al (2009) Neuraminidase stalk length and additional glycosylation of the hemagglutinin influence the virulence of influenza H5N1 viruses for mice. J Virol 83(9):4704–4708 Matsuoka Y, Matsumae H, Katoh M, Eisfeld AJ, Neumann G, Hase T et al (2013) A comprehensive map of the influenza A virus replication cycle. BMC Syst Biol 7:1–18 McAuley JL, Gilbertson BP, Trifkovic S, Brown LE, McKimm-Breschkin JL (2019) Influenza virus neuraminidase structure and functions. Front Microbiol 10:39 McMichael AJ (2018) Legacy of the influenza pandemic 1918: the host T cell response. Biomed J 41(4):242–248 Mehle A (2014) Unusual influenza A viruses in bats. Viruses 6(9):3438–3449 Meischel T, Villalon-Letelier F, Saunders PM, Reading PC, Londrigan SL (2020) Influenza A virus interactions with macrophages: lessons from epithelial cells. Cell Microbiol 22(5):e13170 Moghadami M (2017) A narrative review of influenza: a seasonal and pandemic disease. Iran J Med Sci 42(1):2 Mohan H, Narang J, Pundir S, Pundir CS (2021) A changing trend in diagnostic methods of Influenza A (H3N2) virus in human: a review. 3 Biotech 11:1–13

102

U. Bhalerao et al.

Mordstein M, Kochs G, Dumoutier L, Renauld JC, Paludan SR, Klucher K, Staeheli P (2008) Interferon-λ contributes to innate immunity of mice against influenza A virus but not against hepatotropic viruses. PLoS Pathog 4(9):e1000151 Mostafa A, Abdelwhab EM, Mettenleiter TC, Pleschka S (2018) Zoonotic potential of influenza A viruses: a comprehensive overview. Viruses 10(9):497. https://doi.org/10.3390/v10090497 Müller KH, Kakkola L, Nagaraj AS, Cheltsov AV, Anastasina M, Kainov DE (2012) Emerging cellular targets for influenza antiviral agents. Trends Pharmacol Sci 33(2):89–99 Munoz O, De Nardi M, van der Meulen K, Van Reeth K, Koopmans M, Harris K et al (2016) Genetic adaptation of influenza A viruses in domestic animals and their potential role in interspecies transmission: a literature review. EcoHealth 13:171–198 Muramoto Y, Noda T, Kawakami E, Akkina R, Kawaoka Y (2013) Identification of novel influenza A virus proteins translated from PA mRNA. J Virol 87(5):2455–2462 Murcia PR, Hughes J, Battista P, Lloyd L, Baillie GJ, Ramirez-Gonzalez RH et al (2012) Evolution of an Eurasian avian-like influenza virus in naive and vaccinated pigs. PLoS Pathog 8(5): e1002730 Nelson M, Viboud C, Vincent A et al (2015a) Global migration of influenza A viruses in swine. Nat Commun 6:6696. https://doi.org/10.1038/ncomms7696 Nelson MI, Stratton J, Killian ML, Janas-Martindale A, Vincent AL (2015b) Continual reintroduction of human pandemic H1N1 influenza A viruses into swine in the United States, 2009 to 2014. J Virol 89(12):6218–6226 Neumann G, Kawaoka Y (2011) The first influenza pandemic of the new millennium. Influenza Other Respir Viruses 5:157–166. https://doi.org/10.1111/j.1750-2659.2011.00231.x Neumann G, Kawaoka Y (2015) Transmission of influenza A viruses. Virology 479–480:234–246. https://doi.org/10.1016/j.virol.2015.03.009 Neumann G, Hughes MT, Kawaoka Y (2000) Influenza A virus NS2 protein mediates vRNP nuclear export through NES-independent interaction with hCRM1. EMBO J 19(24):6751–6758 Neumann G, Noda T, Kawaoka Y (2009) Emergence and pandemic potential of swine-origin H1N1 influenza virus. Nature 459(7249):931–939 Nieto-Torres JL, Verdiá-Báguena C, Castaño-Rodriguez C, Aguilella VM, Enjuanes L (2015) Relevance of viroporin ion channel activity on viral replication and pathogenesis. Viruses 7(7):3552–3573 Odagiri T, Tobita K (1990) Mutation in NS2, a nonstructural protein of influenza A virus, extragenically causes aberrant replication and expression of the PA gene and leads to generation of defective interfering particles. Proc Natl Acad Sci U S A 87(15):5988–5992 Odagiri T, Tominaga K, Tobita K, Ohta S (1994) An amino acid change in the non-structural NS2 protein of an influenza A virus mutant is responsible for the generation of defective interfering (DI) particles by amplifying DI RNAs and suppressing complementary RNA synthesis. J Gen Virol 75(1):43–53 Ohkura T, Momose F, Ichikawa R, Takeuchi K, Morikawa Y (2014) Influenza A virus hemagglutinin and neuraminidase mutually accelerate their apical targeting through clustering of lipid rafts. J Virol 88(17):10039–10055 Orlich M, Gottwald H, Rott R (1994) Nonhomologous recombination between the hemagglutinin gene and the nucleoprotein gene of an influenza virus. Virology 204(1):462–465 Padilla-Quirarte HO, Lopez-Guerrero DV, Gutierrez-Xicotencatl L, Esquivel-Guadarrama F (2019) Protective antibodies against influenza proteins. Front Immunol 10:1677 Pagadala NS (2019) AZT acts as an anti-influenza nucleotide triphosphate targeting the catalytic site of A/PR/8/34/H1N1 RNA dependent RNA polymerase. J Comput Aided Mol Des 33(4): 387–404 Perez JT, Varble A, Sachidanandam R, Zlatev I, Manoharan M, García-Sastre A, tenOever BR (2010) Influenza A virus-generated small RNAs regulate the switch from transcription to replication. Proc Natl Acad Sci U S A 107(25):11525–11530 Pérez LJ, Perera CL, Coronado L, Rios L, Vega A, Frías MT, Ganges L, Núñez JI, de Arce HD (2015) Molecular epidemiology study of swine influenza virus revealing a reassorted virus

2

An Updated Review on Influenza Viruses

103

H1N1 in swine farms in Cuba. Prev Vet Med 119(3–4):172–178. https://doi.org/10.1016/j. prevetmed.2015.02.013 Petrova VN, Russell CA (2018) The evolution of seasonal influenza viruses. Nat Rev Microbiol 16(1):47–60 Piasecka J, Jarmolowicz A, Kierzek E (2020) Organization of the influenza a virus genomic rna in the viral replication cycle—structure, interactions, and implications for the emergence of new strains. Pathogens 9(11):951 Pichlmair A, Schulz O, Tan CP, Naslund TI, Liljestrom P, Weber F, Reis e Sousa, C. (2006) RIG-Imediated antiviral responses to single-stranded RNA bearing 5′-phosphates. Science 314(5801): 997–1001 Pinto LH, Lamb RA (2006) The M2 proton channels of influenza A and B viruses. J Biol Chem 281(14):8997–9000 Pleschka S (2012) Overview of influenza viruses. Swine influenza:1–20 Potter CW et al (2001) A history of influenza. J Appl Microbiol 91(4):572–579 Ravina, Manjeet, Mohan H, Narang J, Pundir S, Pundir CS (2021) A changing trend in diagnostic methods of Influenza A (H3N2) virus in human: a review. 3 Biotech 11(2):87. https://doi.org/10. 1007/s13205-021-02642-w Reading PC, Miller JL, Anders EM (2000) Involvement of the mannose receptor in infection of macrophages by influenza virus. J Virol 74(11):5190–5197 Regea G (2017) Review on influenza virus and its prevention and control. J Vet Med Res 4:1089 Reich S, Guilligay D, Pflug A, Malet H, Berger I, Crépin T et al (2014) Structural insight into cap-snatching and RNA synthesis by influenza polymerase. Nature 516(7531):361–366 Reperant LA, Grenfell BT, Osterhaus AD (2015) Quantifying the risk of pandemic influenza virus evolution by mutation and re-assortment. Vaccine 33(49):6955–6966 Rodriguez L, Blanco-Lobo P, Reilly EC, Maehigashi T, Nogales A, Smith A et al (2019) Comparative study of the temperature sensitive, cold adapted and attenuated mutations present in the master donor viruses of the two commercial human live attenuated influenza vaccines. Viruses 11(10):928 Rossman JS, Lamb RA (2009) Autophagy, apoptosis, and the influenza virus M2 protein. Cell Host Microbe 6(4):299–300 Rossman JS, Lamb RA (2011) Influenza virus assembly and budding. Virology 411(2):229–236 Russell CJ (2014) Acid-induced membrane fusion by the hemagglutinin protein and its role in influenza virus biology. Influenza Pathogenesis Control I:93–116 Schaefer R, Zanella JR, Brentano L, Vincent AL, Ritterbusch GA, Silveira S et al (2011) Isolation and characterization of a pandemic H1N1 influenza virus in pigs in Brazil. Pesqui Vet Bras 31(9):761–767 Seladi-Schulman J, Steel J, Lowen AC (2013) Spherical influenza viruses have a fitness advantage in embryonated eggs, while filament-producing strains are selected in vivo. J Virol 87(24): 13343–13353 Selman M, Dankar SK, Forbes NE, Jia JJ, Brown EG (2012) Adaptive mutation in influenza A virus non-structural gene is linked to host switching and induces a novel protein by alternative splicing. Emerg Microbes Infect 1(1):e42 Shaman J, Kandula S, Yang W, Karspeck A (2017) The use of ambient humidity conditions to improve influenza forecast. PLoS Comput Biol 13(11):e1005844 Shi M, Jagger BW, Wise HM, Digard P, Holmes EC, Taubenberger JK (2012) Evolutionary conservation of the PA-X open reading frame in segment 3 of influenza A virus. J Virol 86(22):12411–12413 Shieh WJ, Blau DM, Denison AM, DeLeon-Carnes M, Adem P, Bhatnagar J et al (2010) 2009 pandemic influenza A (H1N1): pathology and pathogenesis of 100 fatal cases in the United States. Am J Pathol 177(1):166–175 Shiraki K, Daikoku T (2020) Favipiravir, an anti-influenza drug against life-threatening RNA virus infections. Pharmacol Ther 209:107512

104

U. Bhalerao et al.

Shope RE (1931) Swine influenza: III. Filtration experiments and etiology. J Exp Med 54(3): 373–385 Shu U, Kiniwa M, Wu CY, Maliszewski C, Vezzio N, Hakimi J et al (1995) Activated T cells induce interleukin-12 production by monocytes via CD40-CD40 ligand interaction. Eur J Immunol 25(4):1125–1128 Simon G, Larsen LE, Dürrwald R, Foni E, Harder T, Van Reeth K et al (2014) European surveillance network for influenza in pigs: surveillance programs, diagnostic tools and Swine influenza virus subtypes identified in 14 European countries from 2010 to 2013. PLoS One 9(12):e115815 Smith W, Andrewes CH, Laidlaw PP (1933) A virus obtained from influenza patients. Lancet 222: 66–68 Sridhar S, Begom S, Bermingham A, Hoschler K, Adamson W, Carman W et al (2013) Cellular immune correlates of protection against symptomatic pandemic influenza. Nat Med 19(10): 1305–1312 Stauffer S, Feng Y, Nebioglu F, Heilig R, Picotti P, Helenius A (2014) Stepwise priming by acidic pH and a high K+ concentration is required for efficient uncoating of influenza A virus cores after penetration. J Virol 88(22):13029–13046 Steel J, Lowen AC (2014) Influenza A virus reassortment. Influenza Pathogenesis Control I:377–401 Stegmann T (2000) Membrane fusion mechanisms: the influenza hemagglutinin paradigm and its implications for intracellular fusion. Traffic 1(8):598–604 Stieneke-Gröber A, Vey M, Angliker H, Shaw E, Thomas G, Roberts C et al (1992) Influenza virus hemagglutinin with multibasic cleavage site is activated by furin, a subtilisin-like endoprotease. EMBO J 11(7):2407–2414 Stuber E, Strober W, Neurath M (1996) Blocking the CD40L-CD40 interaction in vivo specifically prevents the priming of T helper 1 cells through the inhibition of interleukin 12 secretion. J Exp Med 183(2):693–698 Suarez DL, Senne DA, Banks J, Brown IH, Essen SC, Lee CW et al (2004) Recombination resulting in virulence shift in avian influenza outbreak, Chile. Emerg Infect Dis 10(4):693 Subbarao K (2019) The critical interspecies transmission barrier at the animal–human interface. Trop Med Infect Dis 4(2):72 Sun W, Luo T, Liu W, Li J (2020) Progress in the development of universal influenza vaccines. Viruses 12(9):1033 Takemae N, Tsunekuni R, Sharshov K, Tanikawa T, Uchida Y, Ito H, Soda K, Usui T, Sobolev I, Shestopalov A, Yamaguchi T, Mine J, Ito T, Saito T (2017) Five distinct reassortants of H5N6 highly pathogenic avian influenza A viruses affected Japan during the winter of 2016–2017. Virology 512:8–20. https://doi.org/10.1016/j.virol.2017.08.035 Takeshita F, Tanaka T, Matsuda T, Tozuka M, Kobiyama K, Saha S et al (2006) Toll-like receptor adaptor molecules enhance DNA-raised adaptive immune responses against influenza and tumors through activation of innate immunity. J Virol 80(13):6218–6224 Talbot HK (2017) Influenza in older adults. Infect Dis Clin 31(4):757–766 Taubenberger JK, Kash JC (2010) Influenza virus evolution, host adaptation, and pandemic formation. Cell Host Microbe 7(6):440–451 Tauber S, Ligertwood Y, Quigg-Nicol M, Dutia BM, Elliott RM (2012) Behaviour of influenza A viruses differentially expressing segment 2 gene products in vitro and in vivo. J Gen Virol 93 (4):840–849 Te Velthuis AJ, Fodor E (2016) Influenza virus RNA polymerase: insights into the mechanisms of viral RNA synthesis. Nat Rev Microbiol 14(8):479–493 Teunis PF, Brienen N, Kretzschmar ME (2010) High infectivity and pathogenicity of influenza A virus via aerosol and droplet transmission. Epidemics 2(4):215–222 Tobita KSUGIURA, Sugiura A, Enomoto C, Furuyama M (1975) Plaque assay and primary isolation of influenza A viruses in an established line of canine kidney cells (MDCK) in the presence of trypsin. Med Microbiol Immunol 162:9–14

2

An Updated Review on Influenza Viruses

105

Tong S, Li Y, Rivailler P, Conrardy C, Castillo DAA, Chen LM et al (2012) A distinct lineage of influenza A virus from bats. Proc Natl Acad Sci 109(11):4269–4274 Tong S, Zhu X, Li Y, Shi M, Zhang J, Bourgeois M et al (2013) New world bats harbor diverse influenza A viruses. PLoS Pathog 9(10):e1003657 Upham JP, Pickett D, Irimura T, Anders EM, Reading PC (2010) Macrophage receptors for influenza A virus: role of the macrophage galactose-type lectin and mannose receptor in viral entry. J Virol 84(8):3730–3737 Van de Sandt CE, Kreijtz JH, Rimmelzwaan GF (2012) Evasion of influenza A viruses from innate and adaptive immune responses. Viruses 4(9):1438–1476 Vasin AV, Temkina OA, Egorov VV, Klotchenko SA, Plotnikova MA, Kiselev OI (2014) Molecular mechanisms enhancing the proteome of influenza A viruses: an overview of recently discovered proteins. Virus Res 185:53–63 Vemula SV, Zhao J, Liu J, Wang X, Biswas S, Hewlett I (2016) Current approaches for diagnosis of influenza virus infections in humans. Viruses 8(4):96 Vijaykrishna D, Poon LLM, Zhu HC, Ma SK, Li OTW, Cheung CL et al (2010) Reassortment of pandemic H1N1/2009 influenza A virus in swine. Science 328(5985):1529–1529 Wang SF, Huang JC, Lee YM, Liu SJ, Chan YJ, Chau YP et al (2008) DC-SIGN mediates avian H5N1 influenza virus infection in cis and in trans. Biochem Biophys Res Commun 373(4): 561–566 Wang R, Schwartzman LM, Memoli MJ, Taubenberger JK (2011) Detection of seasonal H3N2 influenza A virus by type-specific TaqMan minor groove binder probe assay. Diagn Microbiol Infect Dis 70(2):281–284 Wang C, Wang Q, Hu J, Sun H, Pu J, Liu J, Sun Y (2017) A multiplex RT-PCR assay for detection and differentiation of avian-origin Canine H3N2, equine-origin H3N8, human-origin H3N2, and H1N1/2009 Canine influenza viruses. PLoS One 12(1):e0170374 Webster RG, Bean WJ, Gorman OT, Chambers TM, Kawaoka Y (1992) Evolution and ecology of influenza A viruses. Microbiol Rev 56(1):152–179 White MC, Lowen AC (2018) Implications of segment mismatch for influenza A virus evolution. J Gen Virol 99(1):3 White JM, Wilson IA (1987) Anti-peptide antibodies detect steps in a protein conformational change: low-pH activation of the influenza virus hemagglutinin. J Cell Biol 105(6):2887–2896 Wiley DC, Skehel JJ (1987) The structure and function of the hemagglutinin membrane glycoprotein of influenza virus. Annu Rev Biochem 56(1):365–394 Wille M, Holmes EC (2020) The ecology and evolution of influenza viruses. Cold Spring Harb Perspect Med 10(7):a038489 Wise HM, Foeglein A, Sun J, Dalton RM, Patel S, Howard W et al (2009) A complicated message: identification of a novel PB1-related protein translated from influenza A virus segment 2 mRNA. J Virol 83(16):8021–8031 Wu NC, Wilson IA (2017) A perspective on the structural and functional constraints for immune evasion: insights from influenza virus. J Mol Biol 429(17):2694–2709 Wu NC, Wilson IA (2020) Influenza hemagglutinin structures and antibody recognition. Cold Spring Harb Perspect Med 10(8):a038778 Wu WW, Sun YHB, Panté N (2007) Nuclear import of influenza A viral ribonucleoprotein complexes is mediated by two nuclear localization sequences on viral nucleoprotein. Virol J 4(1):1–12 Xiong X, McCauley JW, Steinhauer DA (2014) Receptor binding properties of the influenza virus hemagglutinin as a determinant of host range. Influenza Pathogenesis Control I:63–91 York A, Fodor E (2013) Biogenesis, assembly, and export of viral messenger ribonucleoproteins in the influenza A virus infected cell. RNA Biol 10(8):1274–1282 Yu D, Vinuesa CG (2010) The elusive identity of T follicular helper cells. Trends Immunol 31(10): 377–383

106

U. Bhalerao et al.

Zhang X, Cunningham FL, Li L, Hanson-Dorr K, Liu L, Waters K et al (2020) Tissue tropisms of avian influenza A viruses affect their spillovers from wild birds to pigs. J Virol 94(24):e00847– e00820 Zhirnov OP, Ikizler MR, Wright PF (2002) Cleavage of influenza a virus hemagglutinin in human respiratory epithelium is cell associated and sensitive to exogenous antiproteases. J Virol 76(17):8682–8689 Zhou L, Li J, Shi D, Xu L, Huang SX (2022) Predicting influenza epidemic for United States. Int J Environ Health Res 32(6):1231–1237 Zmora P, Blazejewska P, Moldenhauer AS, Welsch K, Nehlmeier I, Wu Q et al (2014) DESC1 and MSPL activate influenza A viruses and emerging coronaviruses for host cell entry. J Virol 88(20):12087–12097

3

Avian Influenza: A Potential Threat to Human Health Mansi Kumari, Anil Kumar Mavi, Umesh Kumar, and Unnati Bhalerao

Abstract

Throughout history, emerging viral infections have posed a threat to humanity. Avian influenza viruses (AIVs) are relatively more diverse and can take up the form of novel strains more easily than other specialized human viruses. Looking to the future, the emergence of more highly pathogenic strains should be expected. In order to prevent outbreaks in these populations, it is crucial to get an accurate diagnosis. Additionally, biosecurity precautions and vaccination of domestic poultry are also likely to be key interventions. A future human avian influenza pandemic will undoubtedly be less likely as a result of surveillance programed in avian, human, and other domestic animal populations, as well as avian influenza management in domestic bird populations. Several aspects of AI and AIVs that cause illness in humans are summarized in this chapter, with a focus on the history of the disease, the structure of infectious agents, epidemiology, potential risk of emergence and re-emergence, pathogenesis in humans, clinical manifestations, diagnostics, as well as infection prevention and control measures.

M. Kumari Dr. D. Y. Patil Biotechnology & Bioinformatics Institute, Pune, Maharashtra, India A. K. Mavi Department of Pulmonary Medicine, Vallabhbhai Patel Chest Institute University of Delhi, Delhi, India U. Kumar School of Biosciences, IMS Ghaziabad (University Courses Campus), NH-09, Ghaziabad, Uttar Pradesh, India U. Bhalerao (✉) Department of Biology, Indian Institute of Science Education and Research Pune, Pune, Maharashtra, India # The Author(s), under exclusive license to Springer Nature Singapore Pte Ltd. 2023 P. L. Bhukya et al. (eds.), Emerging Human Viral Diseases, Volume I, https://doi.org/10.1007/978-981-99-2820-0_3

107

108

M. Kumari et al.

Keywords

Avian influenza · Pandemic · Bird flu · Zoonosis

3.1

Introduction

Bird flu, also known as avian influenza (AI), is a highly contagious viral disease of birds brought on by influenza virus type A strains that are present all over the world. It was in domestic birds in Italy that this illness was first identified more than a century ago. Early in the 20th century, a fowl disease swept over Europe, most likely through the trade of domestic birds. The disease-causing pathogen was identified in 1955 as an IAV, and its connection to human influenza viruses was established (Ligon 2005; McFee et al. 2006; Schafer 1995; WHO 2005). AIVs infect mammalian species, such as rats, mice, weasels, ferrets, pigs, cats, tigers, dogs, and horses, as well as humans, though less frequently. AI also affects wild birds. Wild waterfowls, gulls, and shorebirds are the virus’ natural reservoirs. These bird species have most likely borne AIVs in the past without showing any symptoms; this is the ideal condition for the virus and host adaptation. These migratory, highly active birds have a reputation for transporting infections over long areas. These birds can pass large virus loads in their feces while still being healthy. The OIE’s Manual of Diagnostic Tests and Vaccines for Terrestrial Animals now defines “avian influenza” as an illness of poultry brought on by low-pathogenicity H5 and H7 subtypes and any highly pathogenic influenza A virus. The majority of H5 and H7 subtype viruses that have been isolated from birds have a low pathogenicity in poultry. Since there is a chance that the H5 and H7 LPAI will mutate and become extremely pathogenic, all H5/H7 LPAI viruses in poultry are notifiable and require mandatory restriction measures (OIE 2018). AIVs were thought to be extremely unusual finds in humans and largely non-dangerous to birds until a few years ago. However, the first human cases only started to surface in the 1990s. In 1997, the first instances of direct avian virus transmission from poultry to people were well documented. In Hong Kong, there was a sizable outbreak of HPAI H5N1 virus infections in poultry. Then 18 human instances were found, resulting in 6 fatalities (Chan 2002). Since this initial incident, AIVs have been found in domestic and wild birds in nations throughout Africa, Asia, Europe, and the Middle East (Chan 2002), and new AIVs have arisen that can have mild to fatal effects on people. The highest pandemic alert, known as AH9N2, was issued in 1999. While it is true that most infections and diseases in humans have been caused by the AH5 virus, there are other AIVs that have also been responsible for human illness, including the H5N6 and others like the H6N1, H7N2, H7N3, H7N4, H7N7, H7N9, H9N2, H10N7, and H10N8. These viruses have infected humans across the species barrier, causing illnesses that range from being asymptomatic to lethal (Chen et al. 2014;

3

Avian Influenza: A Potential Threat to Human Health

109

Parry 2013; Qi et al. 2014; Shi et al. 2013; To et al. 2014). Although all of these AIV subtypes have resulted in zoonotic infections, the H5N1 and H7N9 virus subtypes have had the most impact, both in terms of numbers and the severity of sickness (Timothy et al. 2019).

3.2

Organization of Infectious Agents

3.2.1

Classification

AIVs are members of the Orthomyxoviridae family, which includes the influenza virus A genus. Based on variations in their nucleoprotein and matrix protein antigens, the influenza viruses that make up this family are categorized as types A, B, C, or D. AIVs fall under category A (King et al. 2012). The AIVs are classified according to their pathogenicity in chickens into LPAI and HPAI strains. An intravenous pathogenicity index (IVPI) in chickens is used for biological pathotype characterization by experimental infection; alternatively, the sequence of an endoproteolytic cleavage site (CS) in the HA protein (HACS) can be used as a molecular marker of pathogenicity. LPAI viruses are maintained in wild aquatic birds almost asymptomatically. The medical symptoms of body weight loss and/or a modest decline in egg production in layers chicken are two effects of the LPAI virus in domestic poultry (Swayne and Suarez 2000). Unlike the LPAI virus, the HPAI virus phenotype is only seen in H5Nx, H7Nx, and H9N2 subtypes, which have a multibasic cleavage site in their HA protein and can cause up to 100% mortality in some bird species (Steinhauer 1999) (Alexander 2000; Chen et al. 1998).

3.2.2

Morphology and Virion Structure

All influenza A viruses (IAVs) have helical symmetry and are either spherical (100 nm in diameter) or filamentous (typically more than 300 nm in length) when observed under an electron microscope (Chu et al. 1949; Fenner 2011; Szewczyk et al. 2014; Vincent et al. 2008). They have spikes that are between 10 nm and 14 nm in length and 100 nm in diameter. These spikes are composed of HA and NA proteins in a 4:1 ratio (McHardy and Adams 2009).

3.2.3

Genome Structure and Organization

The viral RNA (vRNA) genome of AIVs is segmented, single-stranded (-ss), negative sense, and contains eight vRNA segments that each encode at least ten viral proteins. At least one structural protein is encoded by each genomic segment, including the following: polymerase basic protein 2 (PB2), polymerase basic protein 1 (PB1), polymerase acidic protein (PA), hemagglutinin (HA), nucleoprotein (NP), neuraminidase (NA), matrix proteins (M1 and M2), and non-structural proteins (NS1

110

M. Kumari et al.

and NS2 or nuclear export protein (NEP), segment 8) (Shaw and Palese 2013. Diagram of the influenza virus, the virus proteins haemagglutinin (HA), neuraminidase (NA), and matrix (M2) are inserted into the lipid bilayer. Under the viral envelope, the M1 protein is found. The ribonucleoprotein complex (RNP) is made up of the nucleoprotein and three polymerase proteins, which are linked to each of the eight single-stranded RNA segments (1-PB2, 2-PB1, 3-PA, 4-HA, 5-NP, 6-NA, 7-M, and 8-NS) (WHO 2011)

3.2.4

Viral Proteins

The surface glycoproteins HA and NA, which are vital to the biology of influenza virus, are used to categorize all IAVs. While the NA protein takes up a tetrameric form with a mushroom-like shape and protrudes 13.5 nm from the viral surface, the HA protein forms a trimer (Shaw and Palese 2013; Skehel and Wiley 2000; Wilson et al. 1981). While NA, a type II integral membrane glycoprotein with sialidase enzymatic activity, is involved in the last stage of the replication cycle and aids in the release of mature virions, HA aids viral attachment to the cell surface by binding to sialic acid (SA) residues in cell membrane glycoproteins, causing viral fusion and entry (Fields et al. 2001; Takeda et al. 2003). HA and NA’s co-evolutionary adaption enables them to carry out the complementary roles of SA binding (by HA) and SA removal (by NA). IAV subtyping is made possible by the antigenic variety of HA and NA. Additionally, the M2 integral tetrameric membrane protein with ion channel function is found in tiny quantities in the AIV envelope (Pinto et al. 1992). The inner surface of the envelope is supported by the M1 protein. Furthermore, the NEP/NS2 protein is consistently present in influenza virions and is found in trace levels (Hutchinson et al. 2014). The viral core is made up of the eight vRNA segments, which together with the NP and the PB2, PB1, and PA subunits of the RNA-dependent RNA polymerase (RdRp) make up the biologically active replication/transcription units of the influenza virus known as viral ribonucleoprotein (vRNP) complexes (Shaw and Palese 2013). The vRNP of IAVs is made up of the RNA-dependent RNA polymerase (RdRp) subunits (PB2, PB1, and PA), which appear with a globular head coupled to rod-shaped structures of the vRNAs folded on the NP protein. It is a complex genomic entity with unique structure and function among RNA viruses. The invention of in vitro reconstitution of recombinant vRNPs that represent effective replicons allowed for detailed comprehension of the vRNP structure/function to deduce the mechanisms of RNA replication and transcription, the intracellular trafficking of the viral genome, selective packaging of the vRNPs, and viral gene reassortment. In order to explore the effects of specific adaptive genetic modifications and viral segments reassortment of zoonotic potential, this also led to the development of minigenome tests and other reverse genetic systems for IAV (Fodor et al. 1999; Neumann et al. 1999; Pleschka et al. 1996).

3

Avian Influenza: A Potential Threat to Human Health

3.3

111

Replicative Cycle of AIVs

The virus attaches to SA residues on glycoproteins or glycolipids on the cell surface, and internalization is facilitated by endocytosis in clathrin-coated vesicles. The release of the genome in the cytoplasm of the host cell is caused by endosomal acidity (Lamb and Krug 2001). A viral RNA polymerase complex that is active in the nucleus of the host cell is responsible for the transcription of the negativestranded RNA into either messenger RNA (mRNA), which directs the synthesis of viral proteins, or complementary RNA (cRNA), which acts as a template for the synthesis of the viral RNA (vRNA) (Arruda et al. 2006). Multiple cellular compartments are involved in the assembly and packaging of vRNAs into infectious virions. M1 viral protein binding to RNPs promotes nuclear export. Nucleocapsid assembly in close proximity to the cytoplasmic membrane is followed by budding through the cell surface. Only viruses with all of their genomic segments present are contagious (Lamb and Krug 2001).

3.4

Epidemiology

3.4.1

Geographical Distribution

AIVs are widespread in the world and are very certainly present in all wild aquatic birds. In any nation, pathogenic strains could suddenly appear at any time and spread disease to domestic chickens. In reality, outbreaks have happened sporadically on every continent (Uyeki and Peiris 2019).

3.4.2

Origin and Spread of AIVs Infecting Humans

Since the first H5N1 pandemic in 1997 in Hong Kong, sporadic human infections with AIVs of various subtypes have been discovered more often. Six people died as a result of the 18 H5N1 virus cases that were found during this pandemic (Chan 2002). The slaughter of all chickens in Hong Kong’s markets and farms in December 1997 put an end to the initial incident. The H5N1 virus persisted in spreading and changing among chickens in the larger area. There were two confirmed cases and one probable case of the zoonotic disease in 2003, which resulted in two fatalities (Peiris et al. 2004). By 2004, the H5N1 virus had spread through the trade in poultry to harm poultry in ten Asian nations (Webster et al. 2006). By 2005, the virus had also become established in wild migrating birds and had spread to poultry in Central Asia, South Asia, the Middle East, and some regions of Africa as a result of bird migration. Although these poultry outbreaks were regularly and effectively contained in certain nations (such as Malaysia and Japan), they developed enzootic inside poultry in other nations, developing into genetically varied and antigenically different clades that resulted in zoonotic illness (Webster et al. 2006). Since

112

M. Kumari et al.

November 2003, there have been 861 human cases and 455 human deaths caused by the H5N1 virus reported from 17 countries as of May 2019. The cumulative case fatality proportion among reported H5N1 cases has remained above 50%, despite the fact that few cases have been reported globally since 2016 (WHO 2019a, b). Since January 2003, four countries in the Western Pacific Region have reported a total of 239 instances of human infection with the avian influenza A (H5N1) virus. A case fatality rate (CFR) of 56% was achieved by these patients, 134 of which were fatal. With an onset date of October 13, 2020, the most recent case was reported from Lao PDR (one case, no death). Since 2013, the reassortment of H5N1 viruses of clade 2.3.4.4 and other AIVs has produced H5N6, H5N8, and other similar subtypes. H5N6 is now the predominant H5 lineage virus in circulation in China, and it occasionally causes zoonotic illness (Claes et al. 2016). WHO received a single new report from China detailing a human infection with the avian influenza A (H5N6) virus. A 50-year-old man from Hechi, in the province of Guangxi, presented with symptoms on February 16, 2021, and was admitted to the hospital that day because of acute pneumonia. On March 2, 2021, the patient passed away. As of the time of reporting, there was no suspicion of any more instances among the patient’s contacts. Since 2014, China has submitted 30 laboratory-confirmed instances of human infection with the influenza A (H5N6) virus to the World Health Organization, including eight deaths that were reported at the time of IHR notification. The National IHR Focal Point for the Russian Federation notified WHO on February 18, 2021, of the discovery of avian influenza A (H5N8) in seven clinical samples from humans. These are among the initial instances of proof of avian influenza A (H5N8) in humans that have been documented. Workers at poultry farms who took part in a response operation to contain an avian influenza A (H5N8) outbreak discovered in Astrakhan Oblast in the Russian Federation provided positive clinical specimens. For the entire time of the follow-up, the cases remained asymptomatic (several weeks). No one who was closely associated with these situations and was being medically watched for symptoms of the disease (Anonymous n.d.). In 2003, a zoonotic sickness affecting 89 persons in the Netherlands with one case of fatal pneumonia in a veterinarian was linked to an epidemic of the HPAI H7N7 virus in poultry. Limited human-to-human transmission to family members of those who were directly exposed to sick chickens was shown to occur (Koopmans et al. 2004). In the early spring of 2013, a new H7N9 virus produced zoonotic illness in eastern China (Gao et al. 2013b). Through September 2017, China had six epidemics of human instances of the H7N9 virus infection (1564 laboratory-confirmed cases and 612 fatalities). Since 2013, there have been 1568 H7N9 virus infections obtained in China that have been verified by a lab as of May 2019. H7N9, an LPAI virus, spread to numerous Chinese regions while causing little to no sickness in poultry. In 2016, the H7N9 virus, which was causing illness in poultry, developed characteristics of an HPAI virus. This resulted in the introduction of a bivalent H5N1/H7N9 vaccination program in poultry in China, which has significantly decreased zoonotic H7N9 disease since 2017 and decreased virus activity in poultry (Wu et al. 2019; WHO 2019a, b). In 2018, there were just two H7N9 cases recorded; one case was detected in the early spring of 2019 (Yu et al. 2019). No new cases of human infection with

3

Avian Influenza: A Potential Threat to Human Health

113

the avian influenza A(H7N9) virus were reported to WHO in the Western Pacific Region between March 12 and March 18, 2021. A total of 1568 laboratoryconfirmed human infections had been reported as of March 18, 2021. Thirty-three of them had the HPAI A(H7N9) virus, which bears mutations in the HA gene that change its pathogenicity from low to high in poultry. The 33 cases came from Taiwan, China, Guangxi, Guangdong, Hunan, Shaanxi, Hebei, Henan, Fujian, Yunnan, and Inner Mongolia (the case had a travel history to Guangdong). No evidence of the HPAI A(H7N9) virus increasing the virus’s pathogenicity or capacity for transmission to humans has been found (source). As new information becomes available, WHO will perform additional risk assessments while continuing to examine the epidemiological situation. The quantity and geographic distribution of avian influenza A(H7N9) virus infections in humans during the fifth pandemic wave (1 October 2016 to 30 September 2017) were bigger than the waves before and after it. In the affected area and possibly surrounding areas, additional sporadic human infections with the avian influenza A(H7N9) virus are anticipated. There is no proof that the avian influenza A(H7N9) virus is continuously transmitted from person to person. A(H7N9) virus infections in people are unusual, and it is important to watch changes in the virus and how it transmits to humans carefully in order to spot any potential dangers to the public health. 50 instances of human infection with avian influenza A(H9N2) have been reported from China since December 2015, and nine cases of avian influenza A(H9N2) have been reported from China thus far in 2021 (WHO 2021).

3.4.3

Exposure Risk Factors

High levels of virus are excreted by infected birds in their feces, as well as in nasal and ocular secretions. The virus is disseminated from flock to flock once it has been introduced, using the normal techniques such as the movement of diseased birds, contaminated equipment, egg flats, feed trucks, and service workers, to name a few. In a flock, the disease often spreads quickly by direct touch, although occasionally the distribution is unpredictable. Viral instillation into the conjunctival sac, nares, or trachea can easily infect birds. Once those birds are infected, they can infect humans and spread the disease. The majority of AIV virus infections in humans have been associated with recent close or direct contact with domestic poultry, including backyard poultry farming or going to a live poultry market. Carcasses from poultry supplied from endemic areas have been found to contain live AIVs. Despite the fact that cooking renders viruses infective, contamination from the carcass prior to cooking may be a factor in some cases of zoonotic AIV infection that have no prior history of direct contact with live chickens (Anonymous 2018; Li et al. 2014; Mao et al. 2017; Zhou et al. 2016).

114

3.4.4

M. Kumari et al.

Host Risk Factors

One host risk factor that has been researched in cases of HPAI H5N1 virus infection in humans is age. The media claimed that among the hospitalized patients, the average age of LPAI H7N9 virus infection is much younger. Age may also affect how serious a condition is. According to reports, the H7N9 virus infection is related to deadly consequences in people who are older than 60 years old (Cheng et al. 2015; Sha et al. 2016). Children under the age of five had the lowest case fatality rate among individuals with H5N1 virus infection (Oner et al. 2012). Young children who had H7N9 virus infections had only minor symptoms (Li et al. 2014). Children have contracted the H9N2 virus most frequently, and patients in China, Hong Kong, Egypt, and Bangladesh have mostly experienced mild to moderate illness as a result of these infections (Cheng et al. 2011). Contrary to H5N1 virus infection, having a chronic medical condition (such as obesity, chronic obstructive pulmonary disease, or immunosuppression) increases your likelihood of developing severe H7N9 disease (Li et al. 2015a; Zhou et al. 2016). From 2013 to 2017, each outbreak in China had clusters of H7N9 infections that were connected epidemiologically. In several different nations, clusters of H5N1 cases have also been discovered. A hereditary predisposition to zoonotic H5N1 sickness has been suggested by the presence of small clusters of cases that primarily affect the blood relatives of the affected individuals (Horby et al. 2010).

3.5

Biosafety Measures (Handling of Virus)

Biosafety, which prioritizes both ecosystem and human health, is the prevention of widespread loss of biological integrity. These preventive measures include stringent criteria to follow and conducting routine reviews of biosafety in lab environments. Biosafety is used to guard against dangerous events. Emerging virus-related diseases pose a serious hazard to worldwide public health. Despite increased awareness of containment and safety measures, handling dangerous viruses continues to be a leading cause of illness and fatality among lab workers. Applying appropriate biosafety principles and procedures can reduce the risk of harm associated with working with these infectious organisms. Well-trained employees who are knowledgeable and aware of biohazards, who are aware of the many modes of transmission, and who are professionals in managing safe laboratory practices are the major elements to the prevention of laboratory-acquired infection. The respiratory tissues or secretions of infected humans, animals, or birds can contain the HPAI viruses. These viruses can also be discovered in the cloacae and intestines of affected avian species. By handling virus-infected samples with aspiration, dispension, mixing, centrifugation, or other methods, laboratory workers run the danger of breathing the virus from aerosols released by infected animals. These laboratory persons might also contract the virus directly by touching their mucous membranes with viruscontaminated gloves after handling infected animals' tissues, excrement, or other

3

Avian Influenza: A Potential Threat to Human Health

115

secretions. The likelihood of laboratory staff infection makes additional vigilance necessary while working with HPAI viruses in laboratories. The use of proper tools, personal protective equipment (PPE), procedures, and a sufficient level of training should minimize risks to laboratory workers (Dubov et al. 2016). It is advised to use BSL3 protocols and practices with suitable facilities. For the safe handling of HPAI viruses that have the potential to infect humans, powered air-purifying respirators (PAPR) or high-efficiency particulate air (HEPA)-filtered respirators are required (Artika and Ma’roef 2017). The use of accepted microbiological methods and practices is the most crucial component of containment. Researchers working with developing viruses must be aware of the risks and proficient in the procedures and techniques required to handle pathogenic viruses securely. Personal protection, which is essential to preventing laboratory employees’ exposure to and infection by new viruses, is a component of safety measures and procedures. The following are some suggested personal safety measures: (1) doing laboratory work while donning coveralls, gowns, or uniforms; (2) washing hands after handling infectious items before leaving the laboratory working spaces; (3) donning adequate gloves for any procedures that could involve direct or unintentional contact with potentially biohazardous materials and removing gloves aseptically after usage; (4) failing to cover one’s eyes and face when necessary by using face shields, safety glasses, or filtering facepiece masks; (5) failing to wear protective laboratory attire outside of the lab; (6) avoiding open-toed shoes in laboratories; storing human foods or beverages in the lab; (7) not storing old protective laboratory gear in the same compartments as street clothing; (8) refraining from eating, drinking, smoking, applying cosmetics, and handling contact lenses in the laboratory (WHO 2004). The use of vaccines could boost one's level of personal defense (BMBL 2009). Biosafety cabinets (BSC), sealed containers, and other engineering controls are examples of safety equipment meant to prevent or minimize exposure to newly developing viruses. The BSC serves as the primary safety device for containing infectious droplets or aerosols produced by various manipulation techniques. Additionally, personal protection gear may be included in safety equipment. Another piece of safety equipment that serves as the main barrier for viral containment is the enclosed centrifuge cup, which is designed to limit the emission of aerosols during centrifugation (BMBL 2009). When exposures in the lab cannot be completely prevented, PPE is an efficient control measure (Sargent and Gallo 2003). PPE is typically utilized while handling emerging viruses. Examples include impermeable gloves, coats, gowns, disposable coverall suits, long-sleeved shoe covers, boots, face masks, eye protection, or goggles, and respirators (Dubov et al. 2016). In diagnostic and research settings where aerosols present a high risk of worker infection by emerging viruses, the use of respirators is a crucial concern. The use of a respirator that fits properly is essential to ensuring adequate personal protection. The type of respirator and how it is worn properly have an impact on how well it performs. Because employees frequently cannot attain proper protection with their respirators, a respirator fit test is crucial

116

M. Kumari et al.

(Pauli et al. 2014). For developing viruses to stop spreading across the lab environment, proper disinfection is crucial.

3.6

Potential Risk of Emergence and Re-Emergence

Antigenic alterations that can happen during influenza virus replication can keep the virus circulating in human populations. Because the viral polymerase lacks the ability to perform proofreading, the accumulation of point mutations during transcription of the viral genes results in antigenic drift, which are small changes. Such modifications, especially those in the HA and NA genes, have the potential to produce novel influenza virus strains. These novel strains have the potential to produce widespread symptomatic infections if left unchecked by the lack of considerable protective immunity in the community (Al Faress et al. 2005). The acquisition of wholly new gene segments through genetic reassortment between two virus strains that are concurrently infecting the same host leads to more dramatic modifications, known as antigenic shift. Due to the lack of considerable past protective immunity in the new hosts, this may lead to the creation of novel influenza virus subtypes with higher pathogenicity. Antigenic shift is less common and unpredictable than antigenic drift, which happens continuously. Since an antigenic shift causes a new influenza virus to evolve, the majority (or maybe the entire world's population) won't have any antibodies to it. A new strain of a virus has the potential to spread globally and start a pandemic if it can infect people and sustain human-to-human transmission chains that result in widespread outbreaks in communities. Important examples of new influenza subtypes resulting from antigenic shifts have had a devastating impact on influenza pandemics throughout human history (Ghedin et al. 2005). Infection outbreaks with a high mortality rate have been documented (WHO) (WHO 2006). One such incident involved a highly pathogenic H5N1 reassortant AIV (Guan et al. 2002) and prompted widespread concern, prompting responses from health authorities and the media on a global scale.

3.7

Pathogenesis in Humans

3.7.1

Host Viral Interaction and Immune Response

HA starts the infection process of influenza viruses by attaching to the cell surface 2,6-linked SA and/or 2,3-linked SA receptors. The binding specificity to SA receptors of HA contributes to the host tropism and transmission of influenza viruses because the two types of SA receptors are distributed differently in different animals (de Graaf and Fouchier 2014). Conjunctivitis in people with infections from the H7N2, H7N3, and H7N7 viruses has been documented. Some AIVs A(H7) have a preference for ocular receptors (Belser et al. 2018). H7N9 virus has affinity for 2,6-linked SA receptors

3

Avian Influenza: A Potential Threat to Human Health

117

in the upper respiratory tract, but preferentially binds to 2,3-linked SA receptors in the lower respiratory tract (Gu et al. 2007). H5N1 virus infects ciliated and nonciliated tracheal epithelial cells with tropism for 2,3-linked SA receptors in the lower respiratory tract. Studies conducted in vitro and in vivo show that the H5N1, H5N6, and H7N9 viruses cause inflammatory mediators (Li et al. 2016). Experimental data from seriously ill patients show that viral respiratory tract infection causes a dysregulated proinflammatory cytokine and chemokine response that leads to multiorgan dysfunction and inflammatory pulmonary damage (Guo et al. 2015; Wang et al. 2014). Compared to H7N9 and seasonal influenza, the H5N1 virus causes higher amounts of proinflammatory cytokines and chemokines. As demonstrated in mice and ferrets, viruses and endothelial cell infections may also be responsible for pulmonary vascular leakage and viral pneumonia (Hui et al. 2018; Tundup et al. 2017). Most H5N1 patients normally produce a strong neutralizing antibody response 14 or more days following the commencement of the acute illness (Katz et al. 1999). Although specific hemagglutination inhibition and neutralizing antibody titers in four H5N1 survivors of severe sickness increased from 15 days after illness onset and decreased by 5 to 12 months, titers were still detectable for 3–4 years after onset (Kitphati et al. 2009). One to two months after illness, neutralizing antibody titers peaked at one to two months and then began to decline by ten to twelve months, according to a follow-up study of 11 H5N1 patients who survived severe disease. By three weeks after the illness, all patients had neutralizing antibody titers of 1:80 or higher (Buchy et al. 2010). A seroprotective titer of neutralizing antibodies (1:40) was observed substantially earlier (median, 10.5 days) in survivors than in fatal cases (median, 14 days) in the majority of critically sick H7N9 patients during the acute illness (Zhang et al. 2013). Various kinetics and diminishing antibody titers after recovery, though still detectable at one year following sickness, have been observed in other studies of H7N9 survivors (Ma et al. 2018). According to reports, T-cell (CD81/CD41 T-cell memory) responses are crucial for illness recovery (Zhao et al. 2018).

3.7.2

Virulence and Persistence

IAVs are the most virulent of the four influenza virus types, and because of genetic drift and shift, they have the ability to both create epidemics and pandemics. Compared to other influenza kinds, these viruses have a higher degree of antigenic diversity and can mutate more quickly (Fields et al. 2001; Hause et al. 2014). Additionally, they are able to easily adapt to humans and cause zoonotic illnesses. This facilitates a prolonged human-to-human transmission that favors the formation of novel strains that may be more virulent. IAV virulence’s molecular underpinnings have been extensively researched. Genetic alterations are commonly added when influenza viruses infect humans across the species barrier. A multibasic cleavage site (MBCS) was introduced in the HA of several H5 and H7 viruses, which results in their highly pathogenic

118

M. Kumari et al.

behavior due to systemic virus replication in these hosts, which is principally responsible for the high mortality of AIVs in poultry. Although the HPAI H5N1 virus can also infect and kill a variety of mammalian species, the relationship between HA cleavability and systemic virus replication in mammalian influenza viruses is less clear than it is in poultry. When the HA protein connects to SA receptors on the host cell, the influenza virus begins to replicate. AIVs bind to 2,3-linked SA (2,3-SA) receptors, which are widely distributed on epithelial cells in the human lower respiratory tract and the digestive tract of birds. According to structural analyses, the receptor-binding domain (RBD) controls the majority of the virus’s receptor specificity. Amino acid changes in the RBD also affect the virus's host range, cell and tissue tropism, and virulence. In the HA of HPAI H5N1 viruses, mutations have been described that changed the binding preference from α2,3-SA to α2,6-SA (Chutinimitkul et al. 2010). The majority of these amino-acid substitutions was located in or near the RBD. Several H5N1 strains with enhanced affinity for human-type α2,6-SA receptors have been described in Indonesia. In Egypt, new sub lineages of HPAI H5N1 viruses have emerged in local bird populations that displayed enhanced α2,6SA binding, but retained binding affinity for α2,3-SA and were associated with increased attachment to cells of the human lower respiratory tract (Watanabe et al. 2011). The unique H7N9 virus’s receptor binding preference was characterized, and it was discovered that the virus can bind to both avian and human receptors (van Riel et al. 2013). The mammalian adaption mutation Q226L is linked to the affinity for human receptors. However, since not all H7N9 isolates have this amino-acid alteration, additional mutations could also play a role in the affinity for the human receptor. The 1918 H1N1 virus, the avian H5N1 and H7N9 viruses, and their dual receptor binding may, at least in part, be to blame for the increased severity of sickness in humans. These influenza viruses were able to infect type II pneumocytes, which are primarily composed of avian type 2,3-SA receptors and line the lower respiratory tract, bronchi, bronchioles, and other epithelial cells (Shinya et al. 2006). It makes sense that the pandemic potential of the avian H5N1 and H7N9 viruses would increase while their pathogenicity would decrease as they developed increased affinities for 2,6-SA receptors and lost affinities for 2,3-SA. Changes in the glycosylation patterns of HA, in addition to RBD substitutions, can impact the host range and pathogenicity of influenza viruses. Since HA binds to SA and NA cleaves SA off the host cell surface, a balance between the activities of the HA and NA surface glycoproteins is essential for viral multiplication and transmission (Wagner et al. 2002). The activity of either binding or cleavage can change, which can impact virus replication. A HPAI H7N7 virus outbreak in poultry in the Netherlands in 2003 resulted in 89 instances of conjunctivitis in humans and the death of one person. Upon sequencing of the virus from the case that resulted in fatality, the sequence was compared to the sequence of a virus isolated from a patient with conjunctivitis, and four amino-acid substitutions in the NA gene were identified (Fouchier et al. 2004). These mutations were associated with an increased NA activity, resulting in

3

Avian Influenza: A Potential Threat to Human Health

119

more efficient replication in mammalian cells, probably through the prevention of viral aggregation (de Wit et al. 2010). It has been established that the influenza virus polymerase proteins, in particular basic polymerase 2 (PB2), are critical for virus adaptation to mammalian species. Since avian and human influenza viruses require various importins, interspecies transmission necessitates the viral polymerase adapting to these importins, which are responsible for translocating the viral ribonucleoprotein complex to the nucleus (Gabriel et al. 2011). It has been demonstrated that a number of amino-acid changes, including E627K, D701N, and G590S/Q591R, can make up for AIVs’ ineffective polymerase activity in mammalian cells (Mehle and Doudna 2009; Subbarao et al. 1993). The most well-studied mammalian adaption mutation is the E627K substitution. This substitution was discovered in a fatal human instance of infection with the HPAI H7N7 virus and is associated with increased virulence of human HPAI H5N1 virus isolates (de Wit et al. 2010). In the absence of E627K, the D701N mutation in PB2 was found to boost virulence and extend the host range of the avian H5N1 virus to mammalian hosts (Steel et al. 2009). In mammalian cells, the D701N change improved the binding of PB2 to importin-a1, which increased the transit of PB2 into the nucleus (Gabriel et al. 2008). While D701N in PB2 and other unidentified virulence determinants appear to be involved in the high pathogenicity of clade 1 H5N1 viruses, it has been demonstrated that E627K in PB2 is a significant virulence determinant for clade 2.3.4 H5N1 viruses (Le et al. 2010). Networks of poultry production that allow for the continuous exchange of AIVs between affiliated farms or marketplaces enhance the maintenance of virulent strains. Such networks are presumably in favor of the HPAI virus (H5N1) being prevalent in Southeast Asia (Fang et al. 2008). Multispecies live animal marketplaces are excellent instances of how people have intentionally made a dynamic system where a wide diversity of AIVs may be produced and maintained, providing better prospects for genetic reassortments (Vijaykrishna et al. 2008). The volume, speed, and geographic reach of modern human population connectivity through transportation have all expanded over the past century, but especially during the last several decades when it comes to the spread of viruses. In Southeast Asia, chicken production has greatly increased over the past 20 years, along with the regional and global trade that goes along with it. AIVs can spread and persist in domestic bird populations across continents after they have adapted to intensive farming practices. The poultry trade (legal, unregulated, and illicit) seems to have been the main method for the HPAI virus (H5N1) to spread from Asia to Europe and Africa, and this conclusion seems to be the most likely scenario for this (GauthierClerc et al. 2007).

3.7.3

Clinical Manifestations

The clinical spectrum of an AIV infection is broad and is dependent on the particular virus and host characteristics. It can range from asymptomatic, mild focal illness

120

M. Kumari et al.

(conjunctivitis), uncomplicated upper respiratory illness, to fulminant pneumonitis with multiorgan failure and sepsis, which can have fatal consequences. Although the incubation period for most AIVs in humans is poorly understood, it is thought to last three to five days after contact with infected poultry for H5N1 virus infections (Cowling et al. 2013; Huai et al. 2008; Virlogeux et al. 2015; Virlogeux et al. 2016), with a wider range in clusters with limited human-to-human H5N1 virus transmission (Kandun et al. 2006). Fever or feverishness is typically present in the early stages of H5N1, H5N6, or H7N9 virus infections, along with cough, malaise, myalgia, headache, and sore throat (Bi et al. 2019). There are many different types of gastrointestinal symptoms, including nausea, vomiting, and diarrhea. H5N1 influenza appears to be more likely than seasonal influenza to cause watery diarrhea without blood. Although conjunctivitis is unusual, the disease frequently presents as a rapid escalation of pneumonia with respiratory failure developing over several days (Gao et al. 2013a; Kandun et al. 2006; Bi et al. 2019). Fever and diarrhea before the development of lower respiratory tract illness or encephalitis symptoms are examples of unusual presentations (de Jong et al. 2005). Severe pneumonia is characterized by dyspnea, breathlessness, tachypnea, a productive cough, and chest pain. About five to seven days after the start of their sickness, a lot of people with H5N1, H5N6, or H7N9 virus infections have sought medical attention with severe pneumonia and hypoxemia (Bi et al. 2019; Lai et al. 2016; Li et al. 2014; Zhou et al. 2018).

3.8

Diagnostics

A suspected case of avian influenza A virus infection is associated with the history of either (1) recent poultry exposure in a virus enzootic region, in particular, travelling to a market where live poultry are sold or slaughtered, small farms, or inside/outside homes (where poultry are raised), or (2) recent close exposure to a symptomatic person with suspected or confirmed avian influenza A virus infection (e.g., viruses in which limited human-to-human transmission has been reported, namely, H5N1, H7N7, and H7N9). For specialized testing for seasonal and avian influenza, the diagnosis necessitates the acquisition of suitable respiratory specimens, ideally from the lower respiratory tract when available. A throat swab specimen has a greater load for detecting the H5N1 virus in individuals without severe lower respiratory tract disease, even though a nasopharyngeal specimen may be sufficient for detecting some avian influenza A viruses linked to upper respiratory symptoms. For hospitalized patients, the likelihood of identifying avian influenza A virus infection can be increased by collecting respiratory specimens from a variety of respiratory locations, including sputum. An endotracheal aspirate or bronchoalveolar lavage specimen should be obtained for testing from severely sick patients with respiratory failure who are receiving invasive mechanical ventilation. Commonly produced influenza tests, including molecular assays, that are used in clinical settings can identify influenza A and B viruses but cannot tell the difference

3

Avian Influenza: A Potential Threat to Human Health

121

between seasonal influenza A viruses that are circulating among people and zoonotically transmitted viruses. As a result, respiratory samples must be forwarded to a public health lab for specialized testing for avian influenza A virus subtypes by reverse transcriptase polymerase chain reaction (e.g., H5, H7, H9) and other investigations, such as genetic sequencing. Reverse transcriptase polymerase chain reaction techniques are more accurate at identifying avian influenza A virus infection than antigen detection procedures. A retrospective diagnosis can be made by serologic testing of paired acute and convalescent sera, but this procedure needs to be done at a specialized public health or research laboratory (Timothy et al. 2019). The detection of influenza viruses in humans has also been done using a variety of diagnostic methods, such as virus isolation, nucleic acid amplification testing, quick diagnostic testing based on immunochromatography, etc. Here, we examine numerous methods that are either already in use or being researched for the diagnosis of influenza infections in people.

3.8.1

Virus Isolation Using Cell Culture Approaches

Viral Culture: The most common method for diagnosing influenza is viral propagation of viruses from clinical samples in mammalian cells or embryonated eggs. The viral culture method, which was first used to diagnose viral infections in the 1940s, is regarded as a gold standard. The majority of the time, established cell lines like Madin Darby canine kidney (MDCK), A549, mink lung epithelial cell line (Mv1Lu), rhesus monkey kidney (LLC MK2), and buffalo green monkey kidney (BGMK), as well as primary cell lines like rhesus monkey kidney (RhMK) or African green monkey kidney, are used for influenza virus isolation using this method. Viral culture is sometimes employed in conjunction with NAAT testing in laboratories. Shell Viral Culture (SVC). Since the early 1990s, SVC, another method of viral culture, has been used for clinical diagnosis of influenza virus infections. This method involves growing mammalian cells in tiny 1-dram or shell vials, propagating the virus, and then labelling the cells with fluorescent monoclonal antibodies that are specific to the influenza virus. Direct Fluorescent Antibody Test (DFA): The immunofluorescent antibody test (IFA), usually referred to as the DFA test, is a commonly used antigen-based test for the diagnosis of influenza virus infections. This method, in use since the early 1960s, involves directly labelling respiratory epithelial cells obtained from nasopharyngeal swabs or nasopharyngeal aspirates with fluorescently tagged influenza virus-specific antibodies (Leonardi et al. 2010).

3.8.1.1 Serological Assays Hemagglutination inhibition assay (HAI), microneutralization or virus neutralization assay (VN), single radial hemolysis (SRH), complement fixation assay, enzymelinked immunoabsorbant assay (ELISA), and western blotting are the methods most frequently used to identify influenza virus-specific antibody responses.

122

M. Kumari et al.

This test is based on the capacity of HA-specific antibodies to stop the influenza virus from attaching to erythrocytes taken from chicken, turkey, humans, horses, or guinea pigs (about four hemagglutinating units). Although this assay is straightforward and affordable, it has been demonstrated to have poor sensitivity for identifying avian influenza A viruses, particularly those of the H5N1 subtype, limiting its applicability for virus detection (Stephenson et al. 2009). Detecting antibody titers of either seasonal or avian influenza A virus strains is typically done using the VN test, a method for measuring the induction of virusspecific antibodies after spontaneous infection or vaccination. This strategy is based on viruses’ capacity to be neutralized by antibodies, preventing viral infection of cells. Although the VN assay is more sensitive than the HAI assay, its usage for routine diagnostic purposes is limited since certified BSL2+ and BSL3 facilities must utilize infectious viruses (Stephenson et al. 2009). This method of measuring antibody responses to the internal proteins NP and M of the influenza virus is based on immunodiffusion and is employed after vaccination or infection. HAI, VN, and EIA tests have taken the place of complement fixation due to their higher sensitivity (Haaheim 1977). Rapid Influenza Diagnostic Tests (RIDTs): This immunodiffusion-based technique is used after immunization or infection to measure antibody responses to the internal proteins NP and M of the influenza virus. Complement fixation has been replaced by the more sensitive HAI, VN, and EIA tests (Haaheim 1977). But none of the RIDTs can tell apart the many influenza A subtypes. The prevalence of influenza viruses that are circulating in the population affects how well RIDTs perform (Cruz et al. 2010).

3.8.2

Nucleic Acid-Based Tests (NATs)

The field of infectious illness diagnosis underwent a revolution when Kary Mullis created the polymerase chain reaction (PCR) method in 1983. Instead of viral antigens or antibodies, NAT (sometimes referred to as NAAT) assays, which are based on PCR, find virus-specific DNA or RNA sequences or genetic material. These assays can discover viruses far sooner in clinical samples than antigen-based serological testing because they are much more sensitive. The diagnosis of influenza virus infections in people is presently done using a range of various NATs.

3.8.2.1 Reverse Transcriptase Polymerase Chain Reaction (RT-PCR) RT-PCR is the most established yet effective NAT method for identifying influenza viruses in the majority of diagnostic labs worldwide. Regarded as the gold standard for diagnosing influenza. 3.8.2.2 Loop-Mediated Isothermal Amplification-Based Assay (LAMP) Poon et al. reported 100% test sensitivity for the detection of seasonal influenza A viruses from subtypes H1N1 and H3N2 in clinical samples using the LAMP-based approach (Poon et al. 2005). The assay had a ten copies per response analytical

3

Avian Influenza: A Potential Threat to Human Health

123

sensitivity. Furthermore, compared to an RT-PCR-based test, a real-time reverse transcription LAMP-based assay (RT-LAMP) during the 2009 H1N1 pandemic revealed a sensitivity of 97.8% with 100% specificity for the pandemic virus (Kubo et al. 2010). With sensitivity comparable to RT-PCR-based assays, LAMPbased techniques have been successfully employed to detect influenza viruses from clinical samples. With sensitivity levels that are comparable to or even higher than RT-PCR-based methods, LAMP-based assays have also been successfully assessed for the detection of highly pathogenic avian influenza A viruses from subtypes H5N1, H7N7, and H7N9 (Nakauchi et al. 2014).

3.8.2.3 Microarray-Based Approaches Approaches based on microarrays have proven to be effective resources for the identification and subtyping of influenza viruses. Approaches based on microarrays have proven to be effective resources for the identification and subtyping of influenza viruses. For instance, it has been demonstrated that the FluChip microarray, a low-density DNA microarray, can quickly identify H1N1, H3N2, and H5N1 strains (Townsend et al. 2006). In the absence of RT-PCR amplification processes, a nanoparticle-based genomic microarray assay (nanomicroarray) has been developed that specifically identifies H5N1 viral nucleic acid and simultaneously enables subtype identification of influenza A virus. The test specificity and hybridization efficiency of the nanomicroarray technology are both quite good. The approach is straightforward and makes use of many oligonucleotides created specifically to target conserved sections from the complete genome of genes encoding for influenza A and B viruses’ M, HA, and NA. The nanomicroarray assay can be used to identify influenza A and B viruses as well as distinguish between seasonal influenza and other influenza A virus subtypes (H5N1 and pH1N1). 3.8.2.4 Nucleic Acid Sequencing Approaches For the entire genome sequencing of influenza viruses, Sanger sequencing has been routinely used. Additionally, Sanger sequencing has been used to identify influenza viruses that are resistant to antiviral medications.

3.9

Sequencing of the Next Generation (NGS)

Several manufacturer-specific platforms that employ various sequencing techniques, reagents, and bioinformatics tools make up the NGS technology. Pyrosequencing, a high-throughput sequencing-by-synthesis technique that tracks the real-time release of pyrophosphate after dNTPs are incorporated into a developing strand of nascent DNA, was created by Roche 454 Life Sciences (Branford, CT, US). Several organizations have examined this sequencing platform as a diagnostic tool in the study of influenza, primarily for the discovery of genetic markers of medication resistance among circulating influenza A viruses. The first researchers to use this platform were Bright and colleagues, who looked at the prevalence of adamantine resistance among seasonal influenza A viruses from subtypes H1N1, H1N2, and

124

M. Kumari et al.

H3N2, isolated globally from 1994 to 2005 (Bright et al. 2005). The NGS platforms from Illumina employ several sequencing-by-synthesis techniques based on bridge amplification or amplification of nucleic acid fragments on solid substrates. Rutvisuttinunt et al. obtained entire genome sequencing data from influenza virus isolates using an Illumina MiSeq sequencer (San Diego, CA, USA), and they simultaneously identified seasonal influenza A H3N2, p H1N1, and influenza B viruses (Rutvisuttinunt et al. 2013). Without using virus culture, Ren et al. sequenced the entire genome of the recently discovered influenza A H7N9 strain using an Illumina/Solexa GAII sequencer (Ren et al. 2013).

3.10

Infection Prevention and Control Measures

To lower the risk of infection in humans, infection control and AIV circulation prevention in poultry are crucial. Programs for surveillance of animal influenza viruses having zoonotic potential aid in the early identification of hazards to humans. However, it’s possible that avian species lack evident clinical signs of influenza infections, making it more difficult to identify epidemics early and to effectively contain them (Li et al. 2019). In order to prevent and control the spread of the zoonotic influenza virus, non-pharmaceutical measures have been put in place. These include a reduction in the number of markets for live birds and a reduction in human-bird interactions in breeding facilities. Employees who work with birds must wear protective personal equipment and be isolated if there is any suspicion of contamination. Animal facilities must also undergo routine disinfection. Antiviral medications and vaccinations, particularly those for poultry, are examples of pharmaceutical measures. In addition to providing clinical protection for poultry, vaccination attempts to reduce virus shedding and, as a result, the amount of virus in the environment and at the interface between poultry and humans (Sims 2013). Animal immunization can lower the likelihood that zoonotic AIVs will infect humans. Nevertheless, AIV infections can happen even in birds that have received vaccinations, and they are usually linked to vaccines that have obvious antigenic mismatches (Kandeil et al. 2018), or they can be the result of the novel introduction of an exotic strain or clade (Dharmayanti et al. 2014). Therefore, the antigenic mismatch could lead to an endemic state as a result of delayed disease recognition and diagnosis, leading in additional infection transmission among the populations with inadequate vaccination rates (Loving et al. 2013). Selecting a representative and genetically stable prepandemic candidate vaccination strain is difficult as a result. In order to create candidate vaccines for pandemic preparedness, reference laboratories and the WHO analyze the viral antigenicity of strains that are circulating in avian species. Candidate vaccines against the H5, H7, and H9 influenza viruses are now available (WHO 2020). Priority should be given to creating a vaccine that can protect against all influenza virus subtypes. Antiviral medications are crucial in humans for starting interventions as soon as feasible to lower the likelihood of transmission from symptomatic individuals to

3

Avian Influenza: A Potential Threat to Human Health

125

close contacts, including medical staff. Antivirals will be urgently required if a zoonotic AIV for which vaccinations have not yet been developed infects humans. For patients admitted to the hospital with influenza-like illness and people at high risk of developing influenza-related complications, it is ideal to prescribe the currently available antiviral drugs to manage IAV infection within 48 h of symptom start. Stockpiling anti-influenza medications is one of the crucial preventive and therapeutic measures that could aid in the fight against epidemic and pandemic infection with zoonotic strains (McNicholl and McNicholl 2001). Numerous diverse strategies are now being investigated in experimental, pre-clinical work, or are in various phases of clinical trials. Here, we concentrated on four kinds of antiviral medications that target various viral or cellular components and are either approved for usage in the European Union and the United States or are accessible in some nations for the prophylaxis and treatment of influenza virus infections (Koszalka et al. 2017; Paules and Subbarao 2017). The first group consists of adamantanes, the second of neuraminidase inhibitors, the third of membrane fusion inhibitors (China, Russia), and the fourth of RNA-dependent RNA polymerase inhibitors (Japan). Additionally, numerous anti-influenza medications are undergoing late-stage clinical testing (Li et al. 2015b). A small number of FDA-approved or conditionally/regionally permitted antiinfluenza medications are available as a preventive measure, despite extensive testing for new antiviral treatments against influenza viruses. Therefore, it is imperative to better understand the origins of rapidly developing IAVs, increase surveillance operations, and intensify research to track and comprehend these adversaries. In order to effectively combat the high-consequence zoonotic AIVs, the One Health concept—a coordinated effort of several specialized experts across animal, human, and environmental health to improve animal and human health—must be put into practice. Clinical management is crucial when it comes to diseased persons. The risk of transmission in patients with AIV infection associated with severe and deadly illness must be reduced by the use of infection prevention and control strategies as well as prompt isolation (e.g., H5N1, H5N6, H7N9, and H10N8 viruses). The Centers for Disease Control and Prevention advise placing patients with suspected AIV infection associated with severe illness in a negative pressure respiratory isolation room and implementing standard, contact (including goggles) and airborne precautions for healthcare workers while delivering care (A.a 2019). The World Health Organization advises wearing personal protective equipment (medical mask, eye protection, gown, and gloves), practicing proper hand hygiene, using an airborne precaution room that is adequately ventilated (12 air changes per hour with controlled airflow), and using a respirator when performing aerosol-generating procedures (WHO 2014).

126

3.11

M. Kumari et al.

Future Perspective

The threat of a novel human pandemic is still present today, even though it is unknown if viruses that are currently circulating or any new viruses will cause a pandemic in the future. This is especially true given the diversity of AIVs and those with zoonotic origins that have caused human infections. More HPAI strains are anticipated to emerge. In addition, it appears very likely that HPAI H5 will continue to circulate and diversify, especially for clade 2.3.4.4, because it does not always cause severe clinical signs in its wild hosts and is therefore capable of silent spread. Experience teaches us that this has historically happened somewhere in the world about once or twice per decade. A prompt epidemic could quickly turn into a pandemic due to increased international trade.

References A.a (2019). https://www.cdc.gov/flu/avianflu/novel-flu-infection-control.htm. Interim guidance for infection control within healthcare settings when caring for confirmed cases, probable cases, and cases under investigation for infection with novel Influenza A viruses associated with severe disease. Centers for Disease Control and Prevention Al Faress S, Cartet G, Ferraris O (2005) Divergent genetic evolution of hemagglutinin in influenza A H1N1 and A H1N2 subtypes isolated in the south-France since the winter of 2001-2002. J Clin Virol 33(3):230–236 Alexander DJ (2000) A review of avian influenza in different bird species. Vet Microbiol 74:3–13 Anonymous (2018). http://www.who.int/es/newsroom/factsheets/detail/influenza (avianandotherzoonotic) Anonymous (n.d.). https://www.who.int/csr/don/26-feb-2021-influenza-a-russian-federation/en/ Arruda E, Cintra OAL, Hayden FG (2006) Respiratory tract viral infections. Elsevier Churchill Livingstone, Philadelphia, PA Artika M, Ma’roef CN (2017) Laboratory biosafety for handling emerging viruses. I. Asian Pac J Trop Biomed 7:483–491 Belser JA, Lash RR, Garg S (2018) The eyes have it: influenza virus infection beyond the respiratory tract. Lancet Infect Dis 18(7):220–227 Bi Y, Tan S, Yang Y (2019) Clinical and immunological characteristics of human infections with H5N6 avian influenza virus. Clin Infect Dis 68(7):1100–1109 BMBL (2009) Department of Health and Human Services: Public Health Service, Centers for Disease Control and Prevention, National Institutes of Health, US., 5th ed, Biosafety in microbiological and biomedical laboratories Bright RA, Medina MJ, Xu X, Perez-Oronoz G, Wallis TR, Davis XM, Povinelli L, Cox NJ, Klimov AI (2005) Incidence of adamantane resistance among influenza A (H3N2) viruses isolated worldwide from 1994 to 2005: a cause for concern. Lancet 366:1175–1181 Buchy P, Vong S, Chu S (2010) Kinetics of neutralizing antibodies in patients naturally infected by H5N1 virus. PLoS One 5(5):e10864 Chan P (2002) Outbreak of avian influenza A(H5N1). Clin Infect Dis 34(Suppl 2):S58–S64 Chen J, Lee KH, Steinhauer DA, Stevens DJ, Skehel JJ, Wiley DC (1998) Structure of the hemagglutinin precursor cleavage site, a determinant of influenza pathogenicity and the origin of the labile conformation. Cell 95:409–417 Chen H, Yuan H, Gao R, Zhang J, Wang DX, Fan G, Yang F, Li X, Zhou J (2014) Clinical and epidemiological characteristics of a fatal case of avian influenza A H10N8 virus infection: a descriptive study. Lancet 383:714–721

3

Avian Influenza: A Potential Threat to Human Health

127

Cheng VC, Chan JF, Wen X (2011) Infection of immunocompromised patients by avian H9N2 influenza A virus. J Infect 62(5):394–399 Cheng QL, Ding H, Sun Z (2015) Retrospective study of risk factors for mortality in human avian influenza A(H7N9) cases in Zhejiang Province, China, March 2013 to June 2014. Int J Infect Dis 39:95–101 Chu CM, Dawson IM, Elford WJ (1949) Filamentous forms associated with newly isolated influenza virus. Lancet 1(6554):602 Chutinimitkul S, van Riel D, Munster VJ (2010) In vitro assessment of attachment pattern and replication efficiency of H5N1 influenza A viruses with altered receptor specificity. J Virol 84: 6825–6833 Claes F, Morzaria SP, Donis RO (2016) Emergence and dissemination of clade 2.3.4.4 H5Nx influenza viruses-how is the Asian HPAI H5 lineage maintained. Curr Opin Virol 16:158–163 Cowling BJ, Jin L, Lau EH (2013) Comparative epidemiology of human infections with avian influenza A H7N9 and H5N1 viruses in China: a population-based study of laboratoryconfirmed cases. Lancet 382(9887):129–137 Cruz AT, Demmler-Harrison GJ, Caviness AC, Buffone GJ, Revell PA (2010) Performance of a rapid influenza test in children during the H1N1 2009 influenza a outbreak. Pediatrics 125: e645–e650 Dharmayanti NL, Hartawan R, Pudjiatmoko Wibawa H, Hardiman Balish A, Donis R, Davis CT, Samaan G (2014) Genetic characterization of clade 2.3.2.1 avian influenza A(H5N1) viruses, Indonesia, 2012. Emerg Infect Dis 20:671–674 Dubov A, Appleton JH, Campbell S (2016) Ebola virus preparedness: emerging viruses and ethics in laboratory medicine. Arch Pathol Lab Med 140:171–180 Fang L, de Vlas SJ, Liang S, Looman CWN, Gong P, Xu B (2008) Environmental factors contributing to the spread of H5N1 avian influenza in mainland China. PLoS One 3:e2268 Fenner F (2011) Orthomyxoviridae. Vet. Virol Fields BN, Knipe DM, Howley PM, Griffin DE (2001) Fields virology, 4th edn. Lippincott Williams and Wilkins, Philadelphia Fodor E, Devenish L, Engelhardt OG, Palese P, Brownlee GG, Garcia-Sastre (1999) Rescue of influenza A virus from recombinant DNA. J Virol 73:9679–9682 Fouchier RA, Schneeberger PM, Rozendaal FW (2004) Avian influenza A virus (H7N7) associated with human conjunctivitis and a fatal case of acute respiratory distress syndrome. Proc Natl Acad Sci U S A 101:1356–1361 Gabriel G, Herwig A, Klenk H (2008) Interaction of polymerase subunit PB2 and NP with importin alpha1 is a determinant of host range of influenza A virus. PLoS Pathog 4:e11 Gabriel G, Klingel K, Otte A (2011) Differential use of importin-alpha isoforms governs cell tropism and host adaptation of influenza virus. Nat Commun 2:156 Gao HN, Lu HZ, Cao B (2013a) Clinical findings in 111 cases of influenza A (H7N9) virus infection. N Engl J Med 368(24):2277–2285 Gao R, Cao B, Hu Y (2013b) Human infection with a novel avian-origin influenza A (H7N9) virus. N Engl J Med 368(20):1888–1897 Gauthier-Clerc M, Lebarbenchon C, Thomas F (2007) Recent expansion of highly pathogenic avian influenza H5N1: a critical review. Ibis 149:202–214 Ghedin E, Sengamalay NA, Shumway M (2005) Large-scale sequencing of human influenza reveals the dynamic nature of viral genome evolution. Nature 437:1162–1166 de Graaf M, Fouchier RA (2014) Role of receptor binding specificity in influenza A virus transmission and pathogenesis. EMBO J 33:823–841 Gu J, Xie Z, Gao Z (2007) H5N1 infection of the respiratory tract and beyond: a molecular pathology study. Lancet 370(9593):1137–1145 Guan Y, Peiris M, Kong KF (2002) H5N1 influenza viruses isolated from geese in southeastern China: evidence for genetic reassortment and interspecies transmission to ducks. Virology 292(1):16–23

128

M. Kumari et al.

Guo J, Huang F, Liu J (2015) The serum profile of hypercytokinemia factors identified in H7N9infected patients can predict fatal outcomes. Sci Rep 5 Haaheim R (1977) Single-radial-complement-fixation: a new immunodiffusion technique. 2. Assay of the antibody response to the internal antigens (MP and NP) of influenza A virus in human sera after vaccination and infection. Dev Biol Stand 39:481–484 Hause BM, Collin EA, Liu R, Huang B, Sheng Z, Lu W, Wang D, Nelson EA, Li F (2014) Characterization of a novel influenza virus in cattle and swine: proposal for a new genus in the Orthomyxoviridae family. MBio 5(2):e00031 Horby P, Sudoyo H, Viprakasit V (2010) What is the evidence of a role for host genetics in susceptibility to influenza A/H5N1? Epidemiol Infect 138(11):1550–1558 Huai Y, Xiang N, Zhou L (2008) Incubation period for human cases of avian influenza A (H5N1) infection. China Emerg Infect Dis 14(11):1819–1821 Hui KPY, Ching RHH, Chan SKH (2018) Tropism, replication competence, and innate immune responses of influenza virus: an analysis of human airway organoids and ex-vivo bronchus cultures. Lancet Respir Med 6(11):846–854 Hutchinson EC, Charles PD, Hester SS, Thomas B, Trudgian D, Martínez-Alonso M, Fodor E (2014) Conserved and host-specific features of influenza virion architecture. Nat Commun 5: 4816. https://doi.org/10.1038/ncomms5816 de Jong MD, Bach VC, Phan TQ (2005) Fatal avian influenza A (H5N1) in a child presenting with diarrhea followed by coma. N Engl J Med 352(7):686–691 Kandeil A, Sabir JSM, Abdelaal A, Mattar EH, El-Taweel AN, Sabir MJ, Khalil AA, Webby R, Kayali G, Ali MA (2018) Efficacy of commercial vaccines against newly emerging avian influenza H5N8 virus in Egypt. Scientific Reports 8:9697 Kandun IN, Wibisono H, Sedyaningsih ER (2006) Three Indonesian clusters of H5N1 virus infection in 2005. N Engl J Med 355(21):2186–2194 Katz JM, Lim W, Bridges CB (1999) Antibody response in individuals infected with avian influenza A (H5N1) viruses and detection of anti-H5 antibody among household and social contacts. J Infect Dis 180(6):1763–1770 King A, Adams MJ, Carstens EB, Lefkowitz EJ (2012) Virus taxonomy: ninth report of the international committee on taxonomy of viruses. Elsevier, Amsterdam, The Netherlands, pp 749–761 Kitphati R, Pooruk P, Lerdsamran H (2009) Kinetics and longevity of antibody response to influenza A H5N1 virus infection in humans. Clin Vaccine Immunol 16(7):978–981 Koopmans M, Wilbrink B, Conyn M (2004) Transmission of H7N7 avian influenza A virus to human beings during a large outbreak in commercial poultry farms in The Netherlands. Lancet 363(9409):587–593 Koszalka P, Tilmanis D, Hurt AC (2017) Influenza antivirals currently in late-phase clinical trial. Influenza Other Respir Viruses 11:240–246 Kubo T, Agoh M, Mai le Q, Fukushima K, Nishimura H, Yamaguchi A, Hirano M, Yoshikawa A, Hasebe F, Kohno S (2010) Development of a reverse transcription-loop-mediated isothermal amplification assay for detection of pandemic (H1N1) 2009 virus as a novel molecular method for diagnosis of pandemic influenza in resource-limited settings. J Clin Microbiol 48:728–735 Lai S, Qin Y, Cowling BJ (2016) Global epidemiology of avian influenza A H5N1 virus infection in humans, 1997-2015: a systematic review of individual case data. Lancet Infect Dis 16(7):e108 Lamb RA, Krug RM (2001) Orthomyxoviridae: the viruses and their replication. Lippincott Williams & Wilkins, Philadelphia, PA Le QM, Ito M, Muramoto Y (2010) Pathogenicity of highly pathogenic avian H5N1 influenza A viruses isolated from humans between 2003 and 2008 in northern Vietnam. J Gen Virol 91: 2485–2490 Leonardi GP, Mitrache I, Pigal A, Freedman LJ (2010) Public hospital-based laboratory experience during an outbreak of pandemic influenza A (H1N1) virus infections. Clin Microbiol 48:1189– 1194

3

Avian Influenza: A Potential Threat to Human Health

129

Li Q, Zhou L, Zhou M (2014) Epidemiology of human infections with avian influenza A(H7N9) virus in China. N Engl J Med 370(6):520–532 Li J, Chen J, Yang G (2015a) Case-control study of risk factors for human infection with avian influenza A(H7N9) virus in Shanghai, China, 2013. Epidemiol Infect 143(9):1826–1832 Li TC, Chan MC, Lee N (2015b) Clinical implications of antiviral resistance in influenza. Viruses 7: 4929–4944 Li K, Liu H, Yang Z (2016) Clinical and epidemiological characteristics of a patient infected with H5N6 avian influenza A virus. J Clin Virol 82:20–26 Li YT, Linster M, Mendenhall IH, Su YCF, Smith GJD (2019) Avian influenza viruses in humans: lessons from past outbreaks. Br Med Bull 132:81–95 Ligon B (2005) Avian influenza virus H5N1: a review of its history and information regarding its potential to cause the next pandemic. Semin Pediatr Infect Dis 16:326–335 Loving CL, Lager KM, Vincent AL, Brockmeier SL, Gauger PC, Anderson TK, Kitikoon P, Perez DR, Kehrli ME (2013) Efficacy in pigs of inactivated and live attenuated influenza virus vaccines against infection and transmission of an emerging H3N2 similar to the 2011–2012 H3N2v. J Virol 87:9895–9903 Ma MJ, Liu C, Wu MN (2018) Influenza A(H7N9) virus antibody responses in survivors 1 year after infection, China, 2017. Emerg Infect Dis 24(4):663–672 Mao X, Wu J, Lau EHY (2017) Monitoring avian influenza viruses from chicken carcasses sold at markets, China, 2016. Emerg Infect Dis 23(10):1714–1717 McFee RB, Bush LM, Boehm K (2006) Avian influenza: critical considerations for the primary care physician. Johns Hopkins Adv Stud Med 6(10):431–440 McHardy AC, Adams B (2009) The role of genomics in tracking the evolution of influenza A virus. PLoS Pathog 5:e1000566 McNicholl IR, McNicholl JJ (2001) Neuraminidase inhibitors: zanamivir and oseltamivir. Ann Pharmacother 35:57–70 Mehle A, Doudna JA (2009) Adaptive strategies of the influenza virus polymerase for replication in humans. Proc Natl Acad Sci U S A 106:21,312–21,316 Nakauchi M, Takayama I, Takahashi H, Tashiro M, Kageyama T (2014) Development of a reverse transcription loop-mediated isothermal amplification assay for the rapid diagnosis of avian influenza A (H7N9) virus infection. J Virol Methods 204:101–104 Neumann G, Watanabe T, Ito H, Watanabe S, Goto H, Gao P, Hughes M, Perez DR, Donis R, Hoffmann E (1999) Generation of influenza A viruses entirely from cloned cDNAs. Proc NatlAcad Sci USA 96:9345–9350 OIE (2018) Manual Terrestre de la OIE 2018 Oner AF, Dogan N, Gasimov V (2012) H5N1 avian influenza in children. Clin Infect Dis 55(1): 26–32 Parry J (2013) H7N9 avian flu infects humans for the first time. BMJ 346 Paules C, Subbarao K (2017) Influenza. Lancet 390:697–708 Pauli U, Karlen S, Summermatter K (2014) The importance of fit-testing particulate filtering facepiece respirators! Appl Biosaf 19:184–192 Peiris JS, Yu W, Leung CW (2004) Re-emergence of fatal human influenza A subtype H5N1 disease. Lancet 363:617–619 Pinto LH, Holsinger LJ, Lamb RA (1992) Influenza virus M2 protein has ion channel activity. Cell 69:517–528 Pleschka S, Jaskunas R, Engelhardt OG, Zurcher T, Palese P, Garcia- Sastre A (1996) A plasmidbased reverse genetics system for influenza a virus. J Virol 70:4188–4192 Poon LL, Leung CS, Chan KH, Lee JH, Yuen KY, Guan Y, Peiris JSJ (2005) Detection of human influenza A viruses by loop- mediated isothermal amplification. Clin Microbiol 43:427–430 Qi W, Zhou X, Shi W, Huang L, Xia W, Liu D, Li H, Chen S, Lei F, Cao L (2014) Genesis of the novel human-infecting influenza a(h10n8) virus and potential genetic diversity of the virus in poultry, China. Eur Surveill 19:20841

130

M. Kumari et al.

Ren X, Yang F, Hu Y, Zhang T, Liu L, Dong J, Sun L, Zhu Y, Xiao Y, Li L et al (2013) Full genome of influenza A (H7N9) virus derived by direct sequencing without culture. Emergy Infect Dis 19:1881–1884 van Riel D, Leijten LM, de Graaf M (2013) Novel avian-origin influenza A (H7N9) virus attaches to epithelium in both upper and lower respiratory tract of humans. Am J Pathol 183:1137–1143 Rutvisuttinunt W, Chinnawirotpisan P, Simasathien S, Shrestha SK, Yoon IK, Klungthong C, Fernandez S (2013) Simultaneous and complete genome sequencing of influenza A and B with high coverage by Illumina MiSeq platform. J Virol Methods 193:394–404 Sargent EV, Gallo F (2003) Use of personal protective equipment for respiratory protection. ILAR J 44:62–65 Schafer W (1995) Vergleichende seroimmunologische Untersuchungen über die Viren der Influenza und klassischen Geflügelpest [Comparative sero-immunological studies on the viruses of influenza and classical avian influenza]. Zeitschr Naturforsch 10 Sha J, Chen X, Ren Y (2016) Differences in the epidemiology and virology of mild, severe and fatal human infections with avian influenza a (H7N9) virus. Arch Viro 161(5):1239–1259 Shaw ML, Palese P (2013) Orthomyxoviridae, 6th edn. Lippincott Williams & Wilkins, Philadelphia, PA Shi W, Shi Y, Wu Y, Liu D, Gao GF (2013) Origin and molecular characterization of the humaninfecting h6n1 influenza virus in Taiwan. Protein Cell 4:846–853 Shinya K, Ebina M, Yamada S, Ono M, Kasai N, Kawaoka Y (2006) Avian flu: influenza virus receptors in the human airway. Nature 440:435–436 Sims LD (2013) Intervention strategies to reduce the risk of zoonotic infection with avian influenza viruses: scientific basis, challenges and knowledge gaps. Influenza Other Respir Viruses 7:15– 25 Skehel JJ, Wiley DC (2000) Receptor binding and membrane fusion in virus entry: the influenza hemagglutinin. Annu Rev Biochem 69:531–569 Steel J, Lowen AC, Mubareka S, Palese P (2009) Transmission of influenza virus in a mammalian host is increased by PB2 amino acids 627K or 627E/701N. PLoS Pathol 5 Steinhauer DA (1999) Role of hemagglutinin cleavage for the pathogenicity of influenza virus. Virology 258:1–20 Stephenson I, Heath A, Major D, Newman RW, Hoschler K, Junzi W, Katz JM, Weir JP, Zambon MC, Wood JM (2009) Reproducibility of serologic assays for influenza virus A (H5N1). Emergy Infect Dis 15:1252–1259 Subbarao EK, London W, Murphy BR (1993) A single amino acid in the PB2 gene of influenza A virus is a determinant of host range. J Virol 67:1761–1764 Swayne DE, Suarez DL (2000) Highly pathogenic avian influenza. Rev Sci Tech 19:463–482 Szewczyk B, Bie’nkowska-Szewczyk K, Król E (2014) Introduction to molecular biology of influenza a viruses. Acta Biochim Pol 61:397–401 Takeda M, Leser GP, Russell CJ (2003) Influenza virus hemagglutinin concentrates in lipid raft microdomains for efficient viral fusion. Proc Natl Acad Sci U S A 100(25):14610 Timothy M, Uyeki, Malik P (2019) Novel avian influenza A virus infections of humans. Infect Dis Clin N Am 33:907–932 To KK, Tsang AK, Chan JF, Cheng VC, Chen H, Yuen KY (2014) Emergence in China of human disease due to avian influenza a(h10n8)—cause for concern? J Infect 68:205–215 Townsend MB, Dawson ED, Mehlmann M, Smagala JA, Dankbar DM, Moore CL, Smith CB, Cox NJ, Kuchta RD, Rowlen KL (2006) Experimental evaluation of the FluChip diagnostic microarray for influenza virus surveillance. J Clin Microbiol 44:2863–2871 Tundup S, Kandasamy M, Perez JT (2017) Endothelial cell tropism is a determinant of H5N1 pathogenesis in mammalian species. PLoS Pathog 13(3):e1006270 Uyeki TM, Peiris M (2019) Novel avian influenza a virus infections of humans. Infect Dis Clin N Am 33:907–932 Vijaykrishna D, Bahl J, Riley S, Duan L, Zhang JX, Chen H (2008) Evolutionary dynamics and emergence of panzootic H5N1 influenza viruses. PLoS Pathog 4:e1000161

3

Avian Influenza: A Potential Threat to Human Health

131

Vincent AL, Ma W, Lager KM, Janke BH, Richt JA (2008) Swine influenza viruses: a North American perspective. Virus Res 72 Virlogeux V, Li M, Tsang TK (2015) Estimating the distribution of the incubation periods of human avian influenza A(H7N9) virus infections. Am J Epidemiol 182(8):723–729 Virlogeux V, Yang J, Fang V (2016) Association between the severity of influenza A(H7N9) virus infections and length of the incubation period. JPLoS One 11(2) Wagner R, Matrosovich M, Klenk HD (2002) Functional balance between haemagglutinin and neuraminidase in influenza virus infections. Rev Med Virol 12:159–166 Wang Z, Zhang A, Y, W. (2014) Early hypercytokinemia is associated with interferon-induced transmembrane protein-3 dysfunction and predictive of fatal H7N9 infection. Proc Natl Acad Sci U S A 111(2):769–774 Watanabe Y, Ibrahim MS, Ellakany HF (2011) Acquisition of human-type receptor binding specificity by new H5N1 influenza virus sublineages during their emergence in birds in Egypt. PLoS Pathog 7 Webster RG, Peiris M, Chen H (2006) H5N1 outbreaks and enzootic influenza. Emerg Infect Dis 12(1):3–8 WHO (2004) Laboratory biosafety manual, 3rd edn. World Health Organization, Geneva WHO (2005) Avian influenza: assessing the pandemic threat WHO (2006) Cumulative number of confirmed human cases of avian influenza A/(H5N1) reported to WHO. Accessed 10 April 2007 WHO (2011) Source WHO Global Influenza Surveillance Network Manual for the laboratory diagnosis and virological surveillance of influenza WHO (2014) Infection prevention and control of epidemic-and pandemic prone acute respiratory infections in health care, WHO Guidelines. Patients should wear a medical mask when outside of isolation rooms WHO (2019a) Cumulative number of confirmed human cases of avian influenza A(H5N1) reported to WHO WHO (2019b) Influenza at the human-animal interface. Summary and assessment WHO (2020) Antigenic and genetic characteristics of zoonotic influenza A viruses and development of candidate vaccine viruses for pandemic preparedness. World Health Organization WHO (2021) Avian influenza weekly. in 2021, W.H.O.W.P.R.M. (ed.) Wilson IA, Skehel JJ, Wiley DC (1981) Structure of the haemagglutinin membrane glycoprotein of influenza virus at 3 a resolution. Nature 289:366–373 de Wit E, Munster VJ, van Riel D (2010) Molecular determinants of adaptation of highly pathogenic avian influenza H7N7 viruses to efficient replication in the human host. J Virol 84:1597–1606 Wu J, Ke C, Lau EHY (2019) Influenza H5/H7 virus vaccination in poultry and reduction of zoonotic infections, Guangdong Province, China, 2017-18. Emerg Infect Dis 25:116 Yu D, Xiang G, Zhu W, Lei X, Li B, Meng Y, Yang L, Jiao H, Li X, Huang W, Wei H, Zhang Y et al (2019) The re-emergence of highly pathogenic avian influenza H7N9 viruses in humans in mainland China, 2019. Euro Surveill 24(21):190073. https://doi.org/10.2807/1560-7917.ES. 2019.24.21.1900273 Zhang YH, Zhao Y, Li N, Peng YC, Giannoulatou E, Jin RH, Yan HP, Wu H, Liu JH, Liu N, Wang DY, Shu YL, Ho LP, Kellam P, McMichael A, Dong T (2013) Interferon-induced transmembrane protein-3 genetic variant rs12252-C is associated with severe influenza in Chinese individuals. Nat Commun 4:1418. https://doi.org/10.1038/ncomms2433. PMID: 23361009; PMCID: PMC3562464 Zhao N, Wang S, Li H, Liu S, Li M, Luo J, Su W, He H (2018) Influence of Novel Highly Pathogenic Avian Influenza A (H5N1) Virus Infection on Migrating Whooper Swans Fecal Microbiota. Front Cell Infect Microbiol 8:46. https://doi.org/10.3389/fcimb.2018.00046 Zhou L, Ren R, Ou J, Kang M, Wang X, Havers F, Huo X, Liu X, Sun Q, He Y, Liu B, Wu S, Wang Y, Sui H, Zhang Y, Tang S, Chang C, Xiang L, Wang D, Zhao S et al (2016) Risk factors for

132

M. Kumari et al.

influenza A(H7N9) disease in China, a matched case control study, October 2014 to April 2015. Open Forum Infect Dis 3(3):ofw182. https://doi.org/10.1093/ofid/ofw182 Zhou L, Chen E, Bao C, Xiang N, Wu J, Wu S, Shi J, Wang X, Zheng Y, Zhang Y, Ren R, Greene CM, Havers F, Iuliano AD, Song Y, Li C, Chen T, Wang Y, Li D, Ni D et al (2018) Clusters of human infection and humanto-human transmission of avian influenza A(H7N9) virus, 2013– 2017. Emerg Infect Dis 24(2):397–400. https://doi.org/10.3201/eid2402.171565

4

2019 Novel Coronavirus Anita Garg Mangla, Neeru Dhamija, and Daman Saluja

Abstract

COVID-19 is a viral infection that originated in the Wuhan province of China and subsequently exponentially spread worldwide in 230 countries and regions from all 7 continents. Consequently, it was declared a pandemic on March 11, 2020, by the WHO. As of June 30, 2022, this novel coronavirus strain has caused infection in about 551.95 million and the death of about 6.35 million people worldwide. This new strain also belongs to the large family of viruses, Coronaviridae, and closely resembles SARS-CoV. These viruses are characterized by the presence of four important structural proteins: nucleocapsid (N), spikes (S), membrane (M), and envelope (E). All the four proteins are encoded by the ssRNA viral genome. Genomic characterization has shown that COVID-19 is of zoonotic origin, and “zoonotic spillover” is suggestive for the emergence of the same in humans. The virus is highly contagious and easily transmittable through close contact with infected patients due to the presence of viral particles in respiratory droplets. In infected persons, clinical symptoms range from milder ones such as non-productive cough, fever, myalgia, and shortness of breath to more severe ones such as pneumonia, severe acute respiratory syndrome, kidney failure, and death. Considerable studies have been done to comprehend the host-pathogen interactions and host-immune response during infection, leading to the progression of the delivery of vaccines for emergency use. In addition, studies are being Anita Garg Mangla and Neeru Dhamija contributed equally to the work and must be regarded as the first author. A. G. Mangla · N. Dhamija Department of Biochemistry, Daulat Ram College, University of Delhi, Delhi, India D. Saluja (✉) Dr. B.R. Ambedkar Centre for Biomedical Research, Delhi School of Public Health, IoE, University of Delhi, Delhi, India # The Author(s), under exclusive license to Springer Nature Singapore Pte Ltd. 2023 P. L. Bhukya et al. (eds.), Emerging Human Viral Diseases, Volume I, https://doi.org/10.1007/978-981-99-2820-0_4

133

134

A. G. Mangla et al.

done to understand the role of repurposing drugs, supportive therapy, and use of complementary and alternative medicines in the management of COVID-19 and its sequelae. Globally, countries, governments, and private organizations have come forward to work together during this pandemic so as to generate public awareness to combat viral infection and its spread. Keywords

COVID19 · SARS CoV-2 · Novel coronavirus · Genome · Treatment

4.1

Introduction

One of the viral families that has been linked to disease in both people and animals is the coronavirus family. A number of coronaviruses have previously been linked to a number of illnesses, including the common cold and more severe conditions like Middle East Respiratory Syndrome (MERS) and Severe Acute Respiratory Syndrome (SARS). Based on taxonomy, phylogeny, and recognized practice, the International Committee on Taxonomy of Viruses (ICTV) named the virus SARSCoV-2 (https://doi.org/10.1038/s41564-020-0695-z). The SARS Coronavirus 2, also known as SARS-COV-2, is a brand-new variant of the coronavirus that has never before infected a human. Since its initial discovery in December 2019 in Wuhan, Hubei, China, this most current coronavirus has rapidly spread to more than 230 countries worldwide as of late February 2020 (Wu et al. 2020c). After the influenza pandemic of 1918, COVID-19 is the fifth epidemic. The World Health Organization elevated COVID-19 to the highest level globally on February 28. On March 11, 2020, the WHO subsequently proclaimed COVID-19 to be a pandemic. It is believed that 50 million, 1.5 million, 1 million, and 300,000 persons died from the Spanish flu (H1N1) in 1918, Asian flu (H2N2) in 1957, Hong Kong flu (H3N2) in 1968, and H1N1 flu (H1N1) in 2009, respectively (Johnson and Mueller 2002; Kain and Fowler 2019; Simonsen et al. 1998; Viboud et al. 2016) (Fig. 4.1).

4.2

Epidemiology

For centuries, pandemics caused by infectious diseases and pathogens have posed a major threat to human existence as they have led to devastating effects. Millions of lives were lost throughout the past pandemics, according to epidemiological analyses of these outbreaks. According to the WHO, epidemiology is as follows: “Epidemiology is the study of the distribution and determinants of health-related states or events (including disease) and the application of this study to the control of diseases and other health problems. To carry out epidemiological studies number of various methods can be used: surveillance and descriptive studies can be used to

4

2019 Novel Coronavirus

135

Fig. 4.1 Timeline of past four pandemics and ongoing COVID-19

study the distribution and analytical studies are used to study determinants.” Two coronavirus epidemics have previously occurred in the world: both the severe acute respiratory syndrome (SARS)-CoV and the Middle East respiratory syndrome (MERS)-CoV have been identified and were reportedly transmitted from dromedary camels or bats (main hosts), respectively, to humans (Fig. 4.2) (Guan et al. 2003; Drosten et al. 2014; Cui et al. 2019). Based on the genome sequence, SARS-CoV may have evolved from the same animal as the Himalayan palm civet virus, which it is related to (Guan et al. 2003). SARS-CoV was recently thought to have intermediate hosts, including civets, with bats serving as the natural host (Cui et al. 2019). There is strong evidence that death in COVID-19 patients is correlated with age, sex, and comorbidity with lifestyle diseases. Male patients under 50 years old or with concomitant conditions were shown to have a considerably higher probability of

136

A. G. Mangla et al.

Fig. 4.2 SARS-CoV, MERS-CoV, and other coronavirus outbreaks have all previously happened in 2002 and 2012, respectively. SARS CoV and MERS-CoV are mostly carried by bats and camels, respectively. It has been discovered that SARS CoV uses civets as an intermediary host. Humans are the final hosts for both outbreaks. Aerosols, inhalation, or touching the eyes, nose, and mouth with infected hands can all result in human-to-human transmission

dying. It is hypothesized that because the male sex hormone appears to upregulate the production of angiotensin-converting enzyme 2 (ACE2), males may be more susceptible to COVID-19 infection and have less favorable clinical results (La Vignera et al. 2020). Additionally, because the ACE-2 gene is located on the X chromosome, women may be heterozygous, whereas men would undoubtedly be homozygous (Gemmati et al. 2020). Besides ACE2 receptors, natural immunity also decreases with age, making older people more prone to getting infected (Leng and Goldstein 2010).

4.3

Emergence and Spread

Guangdong Province, China, reported the first case of SARS (2002) as an instance of atypical pneumonia. By February 12, 2003, 305 cases had already been reported. It spread to various countries and surpassed a total of 8000 cases globally by May 23, 2003 (Guan et al. 2003; Cui et al. 2019). The cases started to decline by the end of May 2003. The cases of MERS-CoV (2012) started in the month of September 2012 in the United Kingdom. It wasn’t until May 2013 that the Middle East respiratory syndrome coronavirus received its official name. It continued to spread worldwide: Saudi Arabia (UAE), the Republic of Korea, China, the Philippines, and Qatar (Cui et al. 2019). Twenty-seven countries have reported cases of MERS since 2012. MERS and SARS have been vastly outpaced by the current COVID-19

4

2019 Novel Coronavirus

137

pandemic outbreak in terms of both the number of affected individuals and the geographic scope of the epidemic locations. It was created in Wuhan City, in the Chinese province of Hubei. Without any exposure to this market, on December 1, 2019, the first COVID-19 infection among humans was documented (CDC n.d.; WHO n.d.-b) About 55% of affected cases were connected to China’s Huanan Seafood Wholesale Market prior to January 1, 2020. By mid-January 2020, COVID-19 had expanded to other Chinese provinces as a result of the Spring Festival travel season. The first and second confirmed COVID-19 infections outside of China occurred on January 13 and 16, 2020, in Thailand and Japan, respectively, and were related to the Huanan Seafood Wholesale Market. By January 25, 2020, reports of 2062 confirmed cases have come in from China, Thailand, Japan, Macau, Malaysia, Australia, Singapore, France, Taiwan, the United States, and South Korea. The number of cases had sharply increased by the 30th of January, with reports coming from more than 18 nations. The outbreak was subsequently deemed a Public Health Emergency of International Concern by WHO as a result (WHO n.d.-c). Around 150 countries and territories were already afflicted by the pandemic by March 2020, with the main outbreaks occurring in Italy, central China, Iran, France, South Korea, and Germany (WHO n.d.-a). The WHO declared COVID-19 a pandemic on March 11, 2020, as a result of its rapid global spread and the spike in infected cases. On March 13, 2020, the WHO reported that Europe had become the pandemic’s new epicenter as a result of the huge increase in confirmed cases (WHO n.d.-d). As of today, June 30, 2022, there are approximately 551.95 million confirmed instances of COVID-19 infection worldwide, with 6.35 million fatalities.

4.4

Classification, Structure, Morphology, and Organization

COVID-19 is a positive-sense single-stranded RNA (+ssRNA) virus that belongs to the genus Coronavirus and family Coronaviridae and has a genome size of less than 30 kb. With a virion size of 70–90 nm, COVID-19 shares similarities with the structure of the SARS-CoV. The genomic sequencing of COVID-19 showed that it had 79% in common with the SARS-CoV and 50% with the MERS-CoV. (Lu et al. 2020). The viral genome consists of 6–11 open reading frames (ORFs) that can encode polyproteins with 9680 amino acids (Guo et al. 2020). A large polyprotein (pplab) that is encoded by two-thirds of the 5′ genome creates 16 nonstructural proteins after being cleaved by proteases (nsps). These nsps have highly conserved amino acid sequences, with COVID-19’s nsps sharing 85% commonality with the SARS-CoV nsps (Chan et al. 2020). The viral nsps comprise two cysteine proteases that are important in the replication and transcription of COVID-19, specifically, RNA-dependent RNA polymerase (nsp12), papain-like protease (nsp3), helicase (nsp13), and chymotrypsin-like and 3C-like or primary protease (nsp5) (Chan et al. 2020). Additionally, from the 5′ to the 3′ direction, six functional open reading frames (ORFs) code for the replicate (ORF1a/ORF1b); Fig. 4.3 shows the proteins as spike (S), envelope (E), membrane (M), and nucleocapsid (N). Each protein is the same length as its SARS-CoV homolog. It’s interesting to note that, aside from the S

138

A. G. Mangla et al.

Fig. 4.3 (a) The SARS-CoV2 structure. SARS-genome CoV-2’s arrangement is in (b). The coronavirus is about 9680 amino acids in size. (b) It has 6–11 open reading frames (ORFs). Sixteen non-structural proteins are encoded by ORF1a. Different ORFs are used to encode the proteins spike glycoprotein (S), membrane protein (M), nucleocapsid protein (N), envelope protein (E), and auxiliary proteins

gene, COVID-19’s other four structural genes and SARS-share CoV’s more than 90% of the same amino acid sequences (Lu et al. 2020). While M and E proteins are necessary for virus morphogenesis, assembly, and budding, the N protein serves to retain the RNA genome in place. M, S, and E proteins are also the primary components of the viral envelope (Wu et al. 2020a, 2020b). High levels of glycosylation and the S1 and S2 functional components are present in spike proteins (V’kovski et al. 2021). The spike protein’s S1 subunit is crucial for attachment, while the S2 subunit is in charge of the virus’s fusion with the host cell membrane (Wang et al. 2020c), SARS-CoV-2, being a retrovirus, mutates rapidly over time. These mutations help the virus evolve. Globally, researchers have been examining the emergence of particular variants of interest (VOIs) and variants of concern (VOCs). The countries will benefit from this as they develop policies to deal with the variation and its prevention. The SARS-CoV2 variants known as VOIs have genetic alterations that impact the virus’s transmissibility, the severity of the disease, immunological and diagnostic evasion, and significantly increase the risk of community transmission (https://www.who.int/en/activities/tracking-SARS-CoV-2-variants/). Epsilon, Zeta, Eta, Theta, Iota, Kappa, Lambda, and Mu were recognized as VOIs. According to the WHO, VOCs are VOIs that indicate a decline in the efficacy of social and public health measures as well as enhanced transmissibility or virulence. VOCs may not be as effective as currently available treatments, vaccinations, and diagnostics. These

4

2019 Novel Coronavirus

139

VOCs were assigned the following names by the WHO: alpha (B.1.1.7), beta (B.1.351), gamma (P.1), delta (B.1.617.2), and omicron (B.1.1.529) (https://www. who.int/en/activities/tracking-SARS-CoV-2-variants/).

4.5

Viral Proteins and Life Cycle

Because it has a high affinity for the ACE 2 receptors found in human cells, COVID19 leverages this property as its means of entry into the host cells and starting the infection process (https://www.who.int/en/activities/tracking-SARS-CoV-2variants/, Xu et al. 2020b). The widespread expression of the ACE2 receptor in a variety of tissues, which was also shown for SARS-CoV, is blamed for the extrapulmonary spread of COVID-19. Studies have shown that the COVID-19 spike protein has a stronger affinity for the ACE2 receptor than the SARS-CoV spike protein, by a factor of roughly 10 (Wrapp et al. 2020). The spike protein undergoes a conformational shift upon contact, which causes the viral envelope protein to fuse with the host cell membrane. As a result, the virion enters through the endosomal pathway (Coutard et al. 2020; Matsuyama and Taguchi 2009). Once the virus has entered the host cell, viral genomic (+ssRNA) replication begins to produce a number of full-length copies of the negative sense genome, which serve as templates for the synthesis of fresh positive sense genomic RNA. Furthermore, it is noted that discontinuous transcription during this process also results in the production of numerous copies of subgenomic RNA. These freshly created genomes go through ribosomal frameshifting-enhanced translation to produce the polyproteins pp1a and pp1b, which are subsequently post-translationally broken into smaller proteins by viral proteinases. Finally, new viral particles are created through the interaction and assembly of viral RNA and proteins in the endoplasmic reticulum and Golgi complex, which are then ejected from cells by exocytosis (Hoffmann et al. 2020) (Fig. 4.4).

4.6

Pathogenesis in Humans

4.6.1

Host Viral Interaction

Using the host (human) ACE2 receptor, COVID-19 attaches to spike protein S on the cell membrane and invades the host cell (Yan et al. 2020). As a result of binding, the virion is pinched into the host cell. Furin, a significant enzyme found in host cells, is essential for COVID-19 entrance and activation (Walls et al. 2020). Furin’s active site is not encountered by MERS-CoV and SARS-CoV during entry into the host cells and may be accountable for the severity of disease seen with COVID-19 (Walls et al. 2020). Expression of furin is also seen in several other organs, such as lungs, liver, and small intestine, and maybe this is responsible for the potential infection seen in various multiple organs and possibly affects the transmission and stability of the virus in the host cell.

140

A. G. Mangla et al.

Fig. 4.4 SARS-CoV2 replication in human host cells. The virus’ spike glycoprotein attaches to ACE2 receptors found on the cell surface. Viral RNA sheds its protective coating during internalization into the host cell and undergoes translation to produce the proteins pp1a and pp1b. Smaller proteins are formed from these polyproteins. Copies of both genomic and subgenomic RNA are produced. At the ER, virion assembly happens. Endocytosis allows viruses to leave the cells and reproduce

4.7

Host Immune Response

Innate and adaptive immune responses are both part of the host’s defense against the virus. Complement, coagulation fibrinolysis systems, soluble proteins including MBL (mannose-binding lectin), interferons (IFN), acute phase proteins, and chemokines are only a few of the humoral components of the host’s anti-viral innate immunity. Additionally, by acting cytotoxically on target cells, generating cytokines, and further eliciting an adaptive response, innate lymphoid cells (ILSs), gamma delta T cells, and natural killer (NK) cells play crucial roles in limiting the early spread of viral infection. The complex virulence and pathogenicity of COVID19 are associated with viral-induced activation of the cytoplasmic NOD-like receptor family, pyrin domain-containing 3 (NLRP3) inflammasome. When inflammasome macrophages are activated, epithelial cells and possibly even endothelial cells release pro-inflammatory cytokines, interleukins IL-1 and IL-18, which contribute to the pathogenic inflammation responsible for the severity of COVID-19 symptoms

4

2019 Novel Coronavirus

141

Fig. 4.5 Immune reaction to SARS-CoV2. Cell lysis results from the virus replicating after infecting the epithelium. The viral antigens are presented to cytotoxic (CD8+) T cells by the epithelial cells thanks to MHC class I. Perforin and granzymes, which are produced by both cytotoxic T cells and natural killer cells and are cytotoxic to virally infected cells. Dendritic cells (DC) subject CD4 T helper cells to viral antigens in order to stimulate differentiation. Direct interaction of B cells with viral particles causes them to transform into plasma cells, which trigger the production of virus-specific antibodies

(Deftereos et al. 2020; Shneider et al. 2020). In addition, a significant number of proinflammatory cytokines are crucial in initiating virus-induced inflammation. TLR3, TLR7, TLR8, and TLR9 are toll-like receptors that can detect viral RNA and activate the NF-B pathway (Conti et al. 2020). Among other innate immune signaling pathways, Nsp13, Nsp15, and open reading frame (ORF)9b target the interferon (IFN) pathway, whereas Nsp13 and Orf9c through COVID-19 target the NF-B pathway. In addition to natural defenses, infection with COVID-19 involves T and B cells as well as an immune response that produces antiviral neutralizing antibodies (Fig. 4.5). Similar to COVID-19, antigen-presenting cells, mostly dendritic cells and macrophages, convey viral peptides to CD8+ cytotoxic T cells via class I MHC proteins (Jansen et al. 2019) and CD4+ T cells via class II MHC proteins. Once activated, CD8+ T cells proliferate to become effector and memory T cells that are specific to the virus, which then kill the virus-infected tissue cells. By identifying the virus and being activated, B cells can either interact with CD4+ T cells directly or indirectly. The major virus-specific antibody response is visible within the first week after symptoms start to manifest, and the predominate isotype is IgM. IgG isotype antibodies come after this. Some studies on patients with severe COVID-19 cases have shown lymphopenia in T cells with a slightly different profile of decreased memory T cells and cytotoxic CD8+ T cells. As the illness advanced in these patients, lymphocytes steadily reduced (Bermejo-Martin et al. 2020). In turn, increased CD8+ T cell cytotoxicity and excessive T cell activation, caused by an

142

A. G. Mangla et al.

Fig. 4.6 Immunological characteristics of COVID-19

increase in T-helper (Th)17, were responsible for severe immunological damage (Xu et al. 2020c). Additionally, COVID-19 severity and treatment effectiveness may be independently predicted by lymphopenia in CD8+ T cells (Wang et al. 2020b). In addition to lymphopenia, eosinopenia was seen in more than 50% of individuals with COVID-19 infection who were hospitalized (Bermejo-Martin et al. 2020). As a result, it was also hypothesized that eosinopenia would be useful for diagnosis or could be a sign of the severity of a condition (Li et al. 2020; Du et al. 2020). Acutephase proteins are possible diagnostic markers and are crucial for both human and animal disease prognosis prediction (Perez 2019; Herbinger et al. 2016). According to the overall analysis of COVID-19, greater illness severity and mortality are correlated with high levels of acute phase reactants (Zhou et al. 2020). Cytokine storms are produced by the activation of a variety of lymphocytes, including B cells, T cells, and NK cells, as well as myeloid cells, including macrophages, dendritic cells, neutrophils, monocytes, and resident tissue cells, including epithelial and endothelial cells (Behrens and Koretzky 2017). According to a number of studies, “cytokine storm syndrome,” which is generated by the virus, is the cause of mortality in COVID-19 (Ruan et al. 2020). (Fig. 4.6).

4

2019 Novel Coronavirus

4.8

143

Clinical Manifestations

COVID-19 infections can range in severity from mild to moderate to severe to deadly. The usual signs are a dry cough, fever, and exhaustion (Xu et al. 2020a; Chen et al. 2020b). Additionally, some patients experienced headaches, diarrhea, sore throats, conjunctivitis, and loss of taste or smell (Wu and McGoogan 2020; Han et al. 2020; Pan et al. 2020). In severe situations, there may be shortness of breath or trouble breathing, loss of speech or movement, intense chest pressure, or both. When compared to patients who acquire severe pneumonia in the second week, followed by cytokine storm, ARDS, multi-organ failure, and disseminated intravascular coagulation (DIC) in the third week of the illness, patients with mild cases recover in roughly a week (Flowchart 4.1). Clinical data from hospitalized patients have shown elevated levels of pro-inflammatory cytokines like interleukins like IL-2, IL-7, and IL-10, granulocyte colony-stimulating factor, MCP-1, IP-10, Macrophage inflammatory protein 1 alpha, and TNF-alfa. Also, increased levels of ferritin and IL-6 were found to be fatal for patients, indicating that mortality may be due to virally induced hyperinflammation (Guan et al. 2020). Patients with a mild version of the illness have a fever and tolerable levels of circulating cytokines, but in patients with a severe form of the illness, it becomes a tissue-damaging storm. Some critically ill individuals experience life-threatening acute respiratory distress syndrome (ARDS) within eight to nine days after the disease’s beginning (Guan et al. 2020; Huang et al. 2020; Wang et al. 2020a). Acute hypoxemic respiratory failure, bilateral alveolar opacities on chest radiographs, and decreased lung compliance are all symptoms of immediate inflammatory lung damage (ARDS). It can progress to severe SARS (Fig. 4.7) (Fan et al. 2018). Elderly individuals and those with concomitant conditions such as hypertension, coronary artery disease, diabetes, bronchitis, and central nervous system ischemia disease are more likely to develop ARDS (Wujtewicz et al. 2020). A few examples of clinical symptoms include a high

Flowchart 4.1 There are three stages of clinical COVID-19 infection. After showing signs of a minor upper respiratory infection, pneumonia and inflammation are seen. Sepsis, DIC, ARDS, and multi-organ failure are all symptoms of the third-stage cytokine storm

144

A. G. Mangla et al.

Fig. 4.7 Characteristics of severe COVID-19

fever, lymphopenia, neutrophilia, elevated end organ-associated indices, high levels of hs-CRP, serum ferritin, and coagulation function-related indicators (PT and D-dimer) (Wu et al. 2020a, 2020b).

4.9

SARS CoV2 Long Covid/Post-Acute Sequelae

As per the WHO, long Covid refers to coronavirus symptoms that persist or return 3 months after a person becomes ill from the SARS CoV2 infection. It has been demonstrated that patients who survived COVID-19’s initial phase had significant health losses affecting both pulmonary and extrapulmonary organs (Al-Aly et al. 2021). Symptoms can include cardiovascular, gastrointestinal, mental health, coagulation and hematologic, metabolic, pulmonary disorders musculoskeletal, and fatigue (Al-Aly et al. 2022) (Fig. 4.8). Also, hospitalized patients were more at risk, with ICU admissions carrying the highest risk (Al-Aly et al. 2022). Antidepressant, anxiolytic, antihypertensive, pain relievers (including opioid and non-opioid), antihyperlipidemic, and oral hypoglycemic medications, as well as insulin, all carry a higher risk of incident use (Al-Aly et al. 2021). Several cardiovascular disorders,

4

2019 Novel Coronavirus

145

Fig. 4.8 Symptoms experienced with long COVID

such as myocarditis, dysrhythmias, pericarditis, ischemic and non-ischemic heart disease, heart failure, and thromboembolic sickness, are more likely to occur in some patients with long-term COVID-19, according to studies (Xie et al. 2022). More and more data indicate that the virus can enter the central and peripheral nervous systems, causing inflammation and a number of neurological symptoms (Ahmad et al. 2022). Memory loss, sensory disorientation, excruciating headaches, and stroke are some symptoms. The early phases of neurodegenerative diseases like Alzheimer’s and Parkinson’s, which involve amyloid deposits in the brain, are particularly prone to these neurological symptoms. Since there is currently little evidence to support intervention to treat long-lasting COVID symptoms, the focus of treatment is on relieving symptoms, supporting self-management, and finding strategies to aid those who are suffering through rehabilitation.

4.10

Diagnostic and Therapeutic Approaches

The COVID-19 RT-qPCR test is the gold standard test for the quantitative and qualitative detection of SARS-CoV2 nucleic acids in upper and lower respiratory samples from suspected COVID-19 patients during the first week of symptoms (nasopharyngeal or oropharyngeal swabs, sputum, and lower respiratory tract aspirates) (Watson et al. 2020; Padhye 2021). To describe the appearance of infection, its consequences, and risk factors, further laboratory tests are also employed. CBC, ferritin, D-dimer, CRP, procalcitonin, lactic dehydrogenase (LDH), prothrombin time, amyloid serum protein A, and serum glutamate pyruvate

146

A. G. Mangla et al.

Table 4.1 Diagnosis of COVID-19 infection at various stages (Azkur et al. 2020) PCR +

IgM -

IgG -

+ + +

+ + -

+ +

-

+

-

-

-

+

-

+

+

Clinical significance Incubation period of infection before the symptom develop Early days of infection False negative results in antibody assay Early stage of infection ~5–7 d after the start of symptoms Active phase of infection Late phase or recurrent infection IgG may be false negative Early stage of infection IgG may be false-negative RT-PCR result may be false negative Past Infection Recovered PCR-negative patients Cross-reactivity with other coronaviruses Recovery stage of infection Early infection with false-negative RT-PCR

transaminase are a few of these (SGPT), understanding the prognosis and progression of disease from mild to moderate to severe requires knowledge of the levels of creatine kinase (CK), urea, and creatinine (Vabret et al. 2020; Azkur et al. 2020; Kermali et al. 2020; Chen et al. 2020a). In the early stages of infection, an increase in virus-specific IgM is found, and in the later stages, an increase in virus-specific IgG is seen (Dong et al. 2020). Table 4.1 displays the results of RT-qPCR as well as the inference for the same IgM and IgG isotype-specific antibody results in patient samples (Table 4.1).

4.10.1 Antiviral and Prevention Approaches for COVID-19 Are Based On (a) Inhibiting viral genome replication by either preventing viral entry in the host cells or suppressing the replication. Many previously developed antiviral medications have been repurposed to treat COVID-19 infection. (b) Treatment of lung damage, extrahepatic damage, and respiratory distress syndrome as a manifestation of viral infection. (c) Injecting the plasma of recovered patients to provide preformed antiviral antibodies to the infected patient. (d) Priming the immune system and generating memory against virus by vaccination. SARS-CoV2-infected individuals have been categorized under following categories by the WHO depending upon the severity of the symptoms (https://apps.who.int/iris/ bitstream/handle/10665/352285/WHO-2019-nCoV-therapeutics-2022.2-eng.pdf? sequence=1&isAllowed=y)

4

2019 Novel Coronavirus

147

• Patients with critical illnesses, such as sepsis, septic shock, or respiratory failure. In such patients, life-sustaining therapy such as invasive or non-invasive mechanical ventilation is necessary. • Severe illness: Such patients have SpO2 less than 90% or severe respiratory distress or signs of pneumonia. • Non-severe sickness: lack of any COVID-19 criterion for critical or severe disease. Various drugs have been approved by the WHO for use in these categories (https://apps.who.int/iris/bitstream/handle/10665/352285/WHO-2019-nCoV-thera peutics-2022.2-eng.pdf?sequence=1&isAllowed=y). Nirmatrelvir inhibits SARSCoV2 protease, preventing cleavage of the viral polyprotein. Ritonavir is an HIV protease inhibitor. In order to reduce the likelihood of hospitalization in patients with a non-severe COVID-19 infection, it is advised that both of these medications be used concurrently. Molnupiravir is an antiviral repurposed drug intended for use against influenza. It retains the activity against alpha and beta variants of SARSCoV2 in vivo. Baricitinib is suggested for patients with severe infections. It is a non-specific JAK inhibitor. Sotrovimab is a human monoclonal antibody against the conserved epitope of the SARS-CoV2 spike protein. Convalescent plasma is endogenously produced by neutralizing antibodies from previously infected but recovered patients and is recommended for use in patients with active infection. Casirivimabimdevimab is neutralizing monoclonal antibodies and are recommended for patients with all types, severe, critical, and non-severe infections. The SARS-CoV-2 spike protein is recognized by the antibodies. Antiparasitic medication ivermectin, originally developed to treat helminth infections, has been repurposed and has been shown to have direct antiviral activity against SARS-CoV2 in vitro. The WHO advises against using chloroquine or hydroxychloroquine. Ivermectin and hydroxychloroquine were the drugs of choice in the second wave of covid. However, these drugs were recommended against as per the WHO’s current living guideline published on April 22, 2022. Lopinavir or Ritonavir are not recommended for use in patients with any degree of disease severity and any duration of symptoms (Table 4.2).

4.11

Vaccination

Vaccines for COVID-19 may help in preventing the disease and reducing the severity of the infection. With global efforts, the vaccines for SARS-CoV-2 were launched as early as beginning of 2021. However, the limited clinical trials carried out before approval of vaccines for masses and the appearance of side effects, concerns regarding long-term safety, and efficacy shook the confidence of people worldwide and led to hesitancy in getting vaccinated (Jetly et al. 2022). As of July 2022, 217 vaccine candidates for COVID-19 have been developed, with some approved while others are currently under trials (https://covid19.trackvaccines.org/ vaccines/). Some of the vaccines approved and used for mass vaccination in various

148

A. G. Mangla et al.

Table 4.2 COVID-19 patient treatment approaches based on the severity of symptoms, according to the tenth living WHO guideline released on April 22, 2022 Drug Nirmatrelvirritonavir

Category Patients with non-severe COVID19 are most at risk of being admitted to the hospital

Remdesivir

Conditional recommendation for patients with the highest risk of hospitalization Conditional to those at highest risk of hospitalization • People that lack COVID-19 vaccination • Older age • Immunosuppression • Chronic disease like diabetes Recommended strongly for patients with severe or critical COVID-19 • To be administered along with corticosteroids • Not to be given along with IL6 blockers like tocilizumab or sarilumab Conditional recommendation To be used only if baricitinib or IL6 receptor blockers are not available Conditional recommendation for patients with non-severe COVID-19

Molnupiravir

Baricitinib

Ruxolitinib and tofacitinib Sotrovimab

Convalescent plasma Casirivimabimdevimab Tocilizumab or sarilumab Ivermectin Hydroxychloroquine Lopanavir/ritonavir Systemic corticosteroids

WHO recommends against treatment with convalescent plasma Conditional recommendation for those who are at very high risk of hospitalization Strongly advised for patients with serious or severe COVID-19 Recommended only in research settings

Mechanism of action Inhibits SARS-CoV2 protease, preventing cleavage of the viral polyprotein Ritonavir is an HIV protease inhibitor Inhibits viral RNA synthesis

Repurposed drug

Alternative to IL6 blockers Janus kinase inhibitor

Janus kinase inhibitor

Single human monoclonal antibody that inhibits the entry of virus in host cells Passive immunity to the infected person Neutralizing monoclonal antibody Monoclonal antibodies function as IL-6 receptor blockers Direct antiviral effect against SARS-CoV2 in vitro

For patients with severe or critical conditions, all are strongly advised COVID-19

countries are listed in Table 4.3, while Table 4.4 enlists the vaccines approved by the DGCI, India, or that are currently under trials in India (https://vaccine.icmr.org.in/ covid-19-vaccine).

4

2019 Novel Coronavirus

149

Table 4.3 Leading vaccines for mass vaccination program Name of the vaccine mRNA-1273 BNT162b2 COVAXIN AZD1222 (Covishield in India) Gam-COVID-Vac (sputnik V)

Manufacturer and country Moderna TX, Inc. (America) Pfizer, Inc. (America) and BioNTech (Germany) Bharat biotech and ICMR-NIV are working together Oxford/AstraZeneca (England), serum Institute of India Gamaleya research institute (Russia)

Type of vaccine mRNA mRNA Inactivated vaccine Non-replicating viral vector Non-replicating viral vector

Although vaccination is one of the most promising methods to reduce/stop the SARS-CoV-2 infection transmission cycle, the appearance of side effects and breakthrough infections after the first dose of vaccination were observed throughout the world. The adverse events following immunization were correlated more with the females and to younger age (18–40 years) the breakthrough infection depicted a more significant correlation with the higher age group (>60 years), gender (male), and presence of comorbidities (Arora et al. 2022). In spite of all this, vaccination has reduced the incidence, hospitalization, illness severity, and deaths related to Covid19 sickness.

4.12

Prevention and Control

Effective health responses by the government and medical professionals, along with precautionary measures, and the public are mandatory for the prevention of the COVID-19 infection from spreading. As the virus is highly contagious, transmission of the virus from person to person is quite important. Furthermore, super-spreading events can take place in large public gatherings. COVID-appropriate behavior should be followed to prevent the spreading of the disease, and the following points should be kept in mind (Fig. 4.9): (a) Good hand hygiene: Avoid shaking hands; wash your hands thoroughly with soap and water for at least 20 seconds before touching your eyes, mouth, or nose. (b) Use masks, protective clothing, and cover your mouth and nose when you cough or sneeze to practice good respiratory hygiene. (c) Maintaining social distancing: Restricted public contact and avoid social gatherings. (d) Maintaining good immunity: Consuming nutritious diet and vitamins, especially C and E, maintaining a normal body weight and doing yoga and exercise to improve lung efficiency.

150

A. G. Mangla et al.

Table 4.4 COVID-19 vaccines under trials or approved for mass vaccination program in India Name of the vaccine COVAXIN

Manufacturer and country Bharat biotech in collaboration with ICMRNIV

Type of vaccine Inactivated vaccine

Covishield

Serum Institute of India (SII) and ICMR

Non replicating viral vector

ZyCoV-D

Zydus Cadila

Plasmid DNA vaccine

Sputnik V

Dr Reddys laboratories limited and sputnik LLC

Gam-COVIDVac combined vector vaccine

Biological E’s novel Covid-19 vaccine BBV154 intranasal vaccine

Biological E. limited

COVOVAX

ICMR and SII

HGCO19

Gennova biopharmaceuticals limited Biological E. limited, Baylor College of Medicine, Dynavax technologies, Texas Children’s Hospital Center for Vaccine Development

CORBEVAX

4.13

Bharat biotech

Adenoviral vector COVID-19 vaccine (BBV154) Nanoparticle vaccine

mRNA based vaccine Protein subunit COVID-19 vaccine

Current status Phase III human trials completed and listed under WHO emergency use listing (EUL) Approved by DCGI for restricted use in emergency situation; received WHO EUL Phase III human clinical research currently underway; restricted use permitted by DCGI in emergency situations Ongoing phase II human clinical trial; approved by DCGI for restricted use in emergency situation Ongoing phase I/II human clinical trial

Ongoing phase I human clinical trial

Ongoing phase III human clinical trial; approved by DCGI for restricted use in emergency situation (in adults) Ongoing phase I/II human clinical trial DCGI approval for restricted use in emergency situation (for adults)

Future Perspective

With high morbidity and mortality worldwide, SARS-CoV2 and associated illnesses have become one of the major health and economic burdens of the century. The key to managing the current pandemic scenario is a global strategy to lessen the burden

4

2019 Novel Coronavirus

151

Fig. 4.9 Various hygiene practices that should be followed for personal safety and for containment of the spread of infection. Consumption of vitamin supplements boosts up immunity

of COVID-19, unity among states, and quick communication of reliable scientific knowledge. Three areas of global endeavor are required to contain the pandemic: additional scientific study, public education about COVID proper conduct, and clinical care for those who have been exposed. The WHO, governments, doctors, scientists, patient organizations, economists, pharmacists, the pharmaceutical sector, and legislators must all work together to accomplish this. Although we currently lack comprehensive knowledge of host-pathogen interactions and immunopathology, our understanding of the disease is quickly developing. Much of the data gathered in the past 31 months indicates clearly that immunotherapeutic interventions are required to control the inflammatory response, immunological dysregulation, and methods to stop viral reproduction and survival processes are all needed. The ongoing global vaccination drive resulting in mass vaccination so as to achieve herd immunity is another important feature. To control this pandemic, all the stakeholders need to align their actions towards the WHO director’s fourth and final strategy area, which is “to innovate and learn.”

References Ahmad SA, Mohammed SH, Abdulla BA, Salih BK, Hassan MN, Salih AM et al (2022) Post COVID–19 neurological disorders; a single center experience; a case series. Ann Med Surg 76: 103508 Al-Aly Z, Xie Y, Bowe B (2021) High-dimensional characterization of post-acute sequelae of COVID-19. Nature 594(7862):259–264 Al-Aly Z, Bowe B, Xie Y (2022) Long COVID after breakthrough SARS-CoV-2 infection. Nat Med 28:1–7

152

A. G. Mangla et al.

Arora G, Taneja J, Bhardwaj P, Goyal S, Naidu K, Yadav SK et al (2022) Adverse events and breakthrough infections associated with COVID-19 vaccination in the Indian population. J Med Virol 94(7):3147–3154 Azkur AK, Akdis M, Azkur D, Sokolowska M, van de Veen W, Brüggen MC et al (2020) Immune response to SARS-CoV-2 and mechanisms of immunopathological changes in COVID-19. Allergy 75(7):1564–1581 Behrens EM, Koretzky GA (2017) Cytokine storm syndrome: looking toward the precision medicine era. Arthritis Rheumatol 69(6):1135–1143 Bermejo-Martin JF, Almansa R, Menéndez R, Mendez R, Kelvin DJ, Torres A (2020) Lymphopenic community acquired pneumonia as signature of severe COVID-19 infection. J Infect 80(5):e23–e24 CDC (n.d.) Coronavirus disease 2019 (COVID-19) Situation Summary. https://www.cdc.gov/ coronavirus/2019-nCoV/summary.html#risk-assessment Chan JFW, Kok KH, Zhu Z, Chu H, To KKW, Yuan S, Yuen KY (2020) Genomic characterization of the 2019 novel human-pathogenic coronavirus isolated from a patient with atypical pneumonia after visiting Wuhan. Emerg Microb Infect 9(1):221–236 Chen G, Wu DI, Guo W, Cao Y, Huang D, Wang H et al (2020a) Clinical and immunological features of severe and moderate coronavirus disease 2019. J Clin Invest 130(5):2620–2629 Chen N, Zhou M, Dong X, Qu J, Gong F, Han Y et al (2020b) Epidemiological and clinical characteristics of 99 cases of 2019 novel coronavirus pneumonia in Wuhan, China: a descriptive study. Lancet 395(10223):507–513 Conti P, Ronconi G, Caraffa AL, Gallenga CE, Ross R, Frydas I, Kritas SK (2020) Induction of pro-inflammatory cytokines (IL-1 and IL-6) and lung inflammation by Coronavirus-19 (COVI19 or SARS-CoV-2): anti-inflammatory strategies. J Biol Regul Homeost Agents 34(2): 327–331 Coutard B, Valle C, De Lamballerie X, Canard B, Seidah NG, Decroly E (2020) The spike glycoprotein of the new coronavirus 2019-nCoV contains a furin-like cleavage site absent in CoV of the same clade. Antivir Res 176:104742 Cui J, Li F, Shi ZL (2019) Origin and evolution of pathogenic coronaviruses. Nat Rev Microbiol 17(3):181–192 Deftereos SG, Siasos G, Giannopoulos G, Vrachatis DA, Angelidis C, Giotaki SG et al (2020) The Greek study in the effects of colchicine in COvid-19 complications prevention (GRECCO-19 study): rationale and study design. Hell J Cardiol 61(1):42–45 Dong X, Cao YY, Lu XX, Zhang JJ, Du H, Yan YQ et al (2020) Eleven faces of coronavirus disease 2019. Allergy 75(7):1699–1709 Drosten C, Meyer B, Müller MA, Corman VM, Al-Masri M, Hossain R et al (2014) Transmission of MERS-coronavirus in household contacts. N Engl J Med 371(9):828–835 Du Y, Tu L, Zhu P, Mu M, Wang R, Yang P et al (2020) Clinical features of 85 fatal cases of COVID-19 from Wuhan. A retrospective observational study. Am J Respir Crit Care Med 201(11):1372–1379 Fan E, Brodie D, Slutsky AS (2018) Acute respiratory distress syndrome: advances in diagnosis and treatment. JAMA 319(7):698–710 Gemmati D, Bramanti B, Serino ML, Secchiero P, Zauli G, Tisato V (2020) COVID-19 and individual genetic susceptibility/receptivity: role of ACE1/ACE2 genes, immunity, inflammation and coagulation. Might the double X-chromosome in females be protective against SARSCoV-2 compared to the single X-chromosome in males? Int J Mol Sci 21(10):3474 Guan Y, Zheng BJ, He YQ, Liu XL, Zhuang ZX, Cheung CL et al (2003) Isolation and characterization of viruses related to the SARS coronavirus from animals in southern China. Science 302(5643):276–278 Guan WJ, Ni ZY, Hu Y, Liang WH, Ou CQ, He JX et al (2020) Clinical characteristics of coronavirus disease 2019 in China. N Engl J Med 382(18):1708–1720

4

2019 Novel Coronavirus

153

Guo YR, Cao QD, Hong ZS, Tan YY, Chen SD, Jin HJ et al (2020) The origin, transmission and clinical therapies on coronavirus disease 2019 (COVID-19) outbreak–an update on the status. Mil Med Res 7(1):1–10 Han C, Duan C, Zhang S, Spiegel B, Shi H, Wang W et al (2020) Digestive symptoms in COVID19 patients with mild disease severity: clinical presentation, stool viral RNA testing, and outcomes. Am J Gastroenterol 115:916 Herbinger KH, Hanus I, Schunk M, Beissner M, von Sonnenburg F, Löscher T et al (2016) Elevated values of C-reactive protein induced by imported infectious diseases: a controlled crosssectional study of 11,079 diseased german travelers returning from the tropics and subtropics. Am J Trop Med Hygiene 95(4):938 Hoffmann M, Kleine-Weber H, Schroeder S, Krüger N, Herrler T, Erichsen S et al (2020) SARSCoV-2 cell entry depends on ACE2 and TMPRSS2 and is blocked by a clinically proven protease inhibitor. Cell 181(2):271–280 Huang C, Wang Y, Li X, Ren L, Zhao J, Hu Y et al (2020) Clinical features of patients infected with 2019 novel coronavirus in Wuhan, China. Lancet 395(10223):497–506 Jansen JM, Gerlach T, Elbahesh H, Rimmelzwaan GF, Saletti G (2019) Influenza virus-specific CD4+ and CD8+ T cell-mediated immunity induced by infection and vaccination. J Clin Virol 119:44–52 Jetly S, Bhardwaj P, Arora G, Saluja D, Yadav SK, Naidu KP, Taneja J (2022) Hesitancy and acceptance of COVID-19 vaccination amidst the second wave of pandemic in India: a general population study. Asia Pacific J Public Health:446 Johnson NP, Mueller J (2002) Updating the accounts: global mortality of the 1918-1920" Spanish" influenza pandemic. Bull Hist Med 76:105–115 Kain T, Fowler R (2019) Preparing intensive care for the next pandemic influenza. Crit Care 23(1): 1–9 Kermali M, Khalsa RK, Pillai K, Ismail Z, Harky A (2020) The role of biomarkers in diagnosis of COVID-19–A systematic review. Life Sci 254:117788 La Vignera S, Cannarella R, Condorelli RA, Torre F, Aversa A, Calogero AE (2020) Sex-specific SARS-CoV-2 mortality: among hormone-modulated ACE2 expression, risk of venous thromboembolism and hypovitaminosis D. Int J Mol Sci 21(8):2948 Leng J, Goldstein DR (2010) Impact of aging on viral infections. Microbes Infect 12(14–15): 1120–1124 Li YX, Wu W, Yang T, Zhou W, Fu YM, Feng QM, Ye JM (2020) Characteristics of peripheral blood leukocyte differential counts in patients with COVID-19. Zhonghua Nei Ke Za Zhi 59(5): 372–374 Lu R, Zhao X, Li J, Niu P, Yang B, Wu H et al (2020) Genomic characterisation and epidemiology of 2019 novel coronavirus: implications for virus origins and receptor binding. Lancet 395(10224):565–574 Matsuyama S, Taguchi F (2009) Two-step conformational changes in a coronavirus envelope glycoprotein mediated by receptor binding and proteolysis. J Virol 83(21):11,133–11,141 Padhye NS (2021) Reconstructed diagnostic sensitivity and specificity of the RT-PCR test for COVID-19. MedRxiv:2020–2004 Pan L, Mu MI, Yang P, Sun Y, Wang R, Yan J et al (2020) Clinical characteristics of COVID-19 patients with digestive symptoms in Hubei, China: a descriptive, cross-sectional, multicenter study. Am J Gastroenterol 115:766 Perez L (2019) Acute phase protein response to viral infection and vaccination. Arch Biochem Biophys 671:196–202 Ruan Q, Yang K, Wang W, Jiang L, Song J (2020) Clinical predictors of mortality due to COVID19 based on an analysis of data of 150 patients from Wuhan, China. Intensive Care Med 46(5): 846–848 Shneider A, Kudriavtsev A, Vakhrusheva A (2020) Can melatonin reduce the severity of COVID19 pandemic? Int Rev Immunol 39(4):153–162

154

A. G. Mangla et al.

Simonsen L, Clarke MJ, Schonberger LB, Arden NH, Cox NJ, Fukuda K (1998) Pandemic versus epidemic influenza mortality: a pattern of changing age distribution. J Infect Dis 178(1):53–60 V’kovski P, Kratzel A, Steiner S, Stalder H, Thiel V (2021) Coronavirus biology and replication: implications for SARS-CoV-2. Nat Rev Microbiol 19(3):155–170 Vabret N, Britton GJ, Gruber C, Hegde S, Kim J, Kuksin M et al (2020) Immunology of COVID19: current state of the science. Immunity 52(6):910–941 Viboud C, Simonsen L, Fuentes R, Flores J, Miller MA, Chowell G (2016) Global mortality impact of the 1957–1959 influenza pandemic. J Infect Dis 213(5):738–745 Walls AC, Park YJ, Tortorici MA, Wall A, McGuire AT, Veesler D (2020) Structure, function, and antigenicity of the SARS-CoV-2 spike glycoprotein. Cell 181(2):281–292 Wang D, Hu B, Hu C, Zhu F, Liu X, Zhang J et al (2020a) Clinical characteristics of 138 hospitalized patients with 2019 novel coronavirus–infected pneumonia in Wuhan, China. JAMA 323(11):1061–1069 Wang F, Nie J, Wang H, Zhao Q, Xiong Y, Deng L et al (2020b) Characteristics of peripheral lymphocyte subset alteration in COVID-19 pneumonia. J Infect Dis 221(11):1762–1769 Wang Q, Zhang Y, Wu L, Niu S, Song C, Zhang Z et al (2020c) Structural and functional basis of SARS-CoV-2 entry by using human ACE2. Cell 181(4):894–904 Watson J, Whiting PF, Brush JE (2020) Interpreting a covid-19 test result. BMJ 369 WHO (n.d.-a) Coronavirus disease (COVID-2019) situation reports. https://www.who.int/docs/ default-source/coronaviruse/situation%E2%80%8Ereports/20200304-sitrep-44-COVID19.pdf? sfvrsn=783b4c9d_2%E2%80%8E WHO (n.d.-b) Coronavirus disease (COVID-2019) situation reports-48. https://www.who.int/docs/ default-source/coronaviruse/situation-reports/20200308-sitrep-48-COVID-19.pdf?sfvrsn=1 6f7ccef_4 WHO (n.d.-c). Rolling updates on coronavirus disease (COVID-19). https://www.who.int/ emergencies/diseases/novel-coronavirus-2019/events-as-they-happen WHO (n.d.-d). WHO director-general’s opening remarks at the media briefing on COVID-1911March2020. https://www.who.int/dg/speeches/detail/who-director-general-s-openingremarks-at-the- media-briefing-on-COVID-19%2D%2D-11-march-2020 Wrapp D, Wang N, Corbett KS, Goldsmith JA, Hsieh CL, Abiona O et al (2020) Cryo-EM structure of the 2019-nCoV spike in the prefusion conformation. Science 367(6483):1260–1263 Wu Z, McGoogan JM (2020) Characteristics of and important lessons from the coronavirus disease 2019 (COVID-19) outbreak in China: summary of a report of 72 314 cases from the Chinese Center for Disease Control and Prevention. JAMA 323(13):1239–1242 Wu C, Chen X, Cai Y, Zhou X, Xu S, Huang H et al (2020a) Risk factors associated with acute respiratory distress syndrome and death in patients with coronavirus disease 2019 pneumonia in Wuhan, China. JAMA Internal Med 180(7):934–943 Wu C, Liu Y, Yang Y, Zhang P, Zhong W, Wang Y et al (2020b) Analysis of therapeutic targets for SARS-CoV-2 and discovery of potential drugs by computational methods. Acta Pharm Sin B 10(5):766–788 Wu F, Zhao S, Yu B, Chen YM, Wang W, Song ZG et al (2020c) A new coronavirus associated with human respiratory disease in China. Nature 579(7798):265–269 Wujtewicz M, Dylczyk-Sommer A, Aszkiełowicz A, Zdanowski S, Piwowarczyk S, Owczuk R (2020) COVID-19–what should anaethesiologists and intensivists know about it? Anaesthesiol Intensive Ther 52(1):34–41 Xie Y, Xu E, Bowe B, Al-Aly Z (2022) Long-term cardiovascular outcomes of COVID-19. Nat Med 28(3):583–590 Xu XW, Wu XX, Jiang XG, Xu KJ, Ying LJ, Ma CL et al (2020a) Clinical findings in a group of patients infected with the 2019 novel coronavirus (SARS-Cov-2) outside of Wuhan, China: retrospective case series. BMJ 368

4

2019 Novel Coronavirus

155

Xu X, Chen P, Wang J, Feng J, Zhou H, Li X et al (2020b) Evolution of the novel coronavirus from the ongoing Wuhan outbreak and modeling of its spike protein for risk of human transmission. Sci China Life Sci 63(3):457–460 Xu Z, Shi L, Wang Y, Zhang J, Huang L, Zhang C et al (2020c) Pathological findings of COVID-19 associated with acute respiratory distress syndrome. Lancet Respir Med 8(4):420–422 Yan R, Zhang Y, Li Y, Xia L, Guo Y, Zhou Q (2020) Structural basis for the recognition of SARSCoV-2 by full-length human ACE2. Science 367(6485):1444–1448 Zhou F, Yu T, Du R, Fan G, Liu Y, Liu Z et al (2020) Clinical course and risk factors for mortality of adult inpatients with COVID-19 in Wuhan, China: a retrospective cohort study. Lancet 395(10229):1054–1062

5

Severe Acute Respiratory Syndrome Associated Corona Virus [SARS-CoV] P. S. Akshay, S. Manasa Veena, Korra Bhanu Teja, and Shilpa J. Tomar

Abstract

An outbreak of “severe atypical pneumonia” in Guangdong province, southern China, during late 2002, subsequently spreading to neighboring nations and rapidly worldwide, alarmed populations across the globe. The disease was named “severe acute respiratory syndrome (SARS)” and was transmissible from person to person through droplets, especially causing clusters in healthcare workers. The epidemic had a high mortality rate and morbidity due to the highly pathogenic and transmissible virus with a large RNA genome. The disease is distinguished primarily by the debilitation of the lower respiratory tract. The complexity of SARS-CoV pathogenesis is characterized by the alveolar damage caused by epithelial cell disruption and disbandment of the virus to different organs. Similar to other coronaviruses like MERS-CoV, SARS-CoV is thought to have originated in bats. The virus belongs to the order Nidovirales, family Coronaviridae, with a 29.8 kb long positive sense ssRNA genome. The high recombination rate and versatile RNA polymerase of the SARS-CoV virus, combined with the pervasiveness and diversity of Coronaviridae, fathom the emergence of the epidemic. According to the WHO, 8098 individuals across the world became infected, with 774 deaths reported, a mortality rate of 9.6%, during the 2003 outbreak. After an intensive global public health intervention to combat the viral epidemic, a potential pandemic was contained, and the virus was no longer a public health danger after 2004. With no specific medications or vaccines available to combat the virus, the flare-up was curbed through vigilant suspicion

P. S. Akshay · K. B. Teja · S. J. Tomar (✉) Hepatitis Division, ICMR-National Institute of Virology, Pune, India S. M. Veena Indian Institute of Science, Bengaluru, India # The Author(s), under exclusive license to Springer Nature Singapore Pte Ltd. 2023 P. L. Bhukya et al. (eds.), Emerging Human Viral Diseases, Volume I, https://doi.org/10.1007/978-981-99-2820-0_5

157

158

P. S. Akshay et al.

of infection, isolation of affected individuals, contact tracing, and stringent outbreak containment procedures. Keywords

SARS · Coronaviridae · Outbreak

5.1

Introduction

Coronaviruses are a group of viruses previously known to cause self-limiting, mild respiratory and intestinal diseases (Masters and Perlman 2013), until an atypical pneumonia outbreak emerged during 2002–2003 in Guangdong province of southern China (Cui et al. 2019). Increased outbreaks in clusters manifested by pneumonia and lower respiratory tract infections resistant to conventional antibiotic treatment were documented, and the causative agent was unknown. Extensive research by medical researchers across the globe to identify and contain the epidemic subsequently led to the discovery and isolation of the causative agent SARS-CoV, an abbreviation of severe acute respiratory syndrome-associated coronavirus. SARSCoV belongs to the family Coronaviridae (Zhong 2004) but varies significantly from other coronaviruses in genome characterization (Marra et al. 2003) and severity of the disease. The Coronaviridae family gets its name from the crown-like spikes that cover the virus’s surface (Li 2016). There are several species of vertebrates, including humans and birds, that are susceptible to coronavirus infection (Weiss and Leibowitz 2011). There are seven known human coronaviruses (HCoV) that have been discovered since the mid-1960s (Su et al. 2016). HCoVs 229E, NL63, HKU1, and NL63 are most commonly associated with mild upper respiratory infections in adults. About 15–29% of the respiratory infections in humans with low virulence were 229E and OC43, according to one study. Coronavirus is thought to be responsible for 15% of all adult-onset colds, according to another epidemiological study (Greenberg 2016; Liu et al. 2021). SARS-CoV has a typical coronaviral genomic structure, which has a positive sense of single-stranded RNA (Brown and Tetro 2003). Hemagglutinin esterase is absent from the SARS-CoV genome, which is a trait prevalent in group 2 coronaviruses (Belouzard et al. 2012). SARS has a complicated pathophysiology, with several mechanisms contributing to severe lung injury and viral spread to various other organs. The epithelial cells that line the respiratory system are the target of the SARS coronavirus, which leads to widespread destruction of the alveoli. During the course of disease, a number of different organs and cells may become infected. These include the neurons of the brain, the tubular epithelial cells of the kidneys, and the mucosal cells of the intestines. In addition, indirect injury may occur in certain organs. Understanding the disease’s pathogenesis has been aided by extensive research (Gu and Korteweg 2007).

5

Severe Acute Respiratory Syndrome Associated Corona Virus [SARS-CoV]

5.2

159

Brief History and Discovery

First of its kind in the twenty-first century, severe acute respiratory syndrome (SARS) is a deadly disease with an unusually high probability of spreading, especially in healthcare facilities such as hospitals and clinics, with disastrous effects on those who provide medical care (Zhao 2019). The global spread of the disease was facilitated by the tremendous growth of international air travel in recent decades (Lam et al. 2003). Increased reporting of atypical pneumonia resistant to traditional antibiotic treatment across Guangdong province, China, which was associated with disease clusters in hospitals and families, became a matter of concern. The practitioners of Guangzhou termed the unknown disease as “infectious atypical pneumonia” (Liang 2015). The Department of Health, China informed the World Health Organization (WHO) on February 11, 2003, about an unknown severe pneumonia in Guangdong which infected 305 people and caused the death of 5 patients. Most of the infected persons were healthcare workers. Researchers put their effort to identify the etiological agent that caused the disease manifesting as severe lower respiratory tract infection (Ahmad et al. 2009; Xu et al. 2004). Isolation of chlamydia from the patients led to speculations but was dropped, due to the resistance to effective antibiotic therapy. The investigation further led to the identification of adenoviruses and Influenza A from the suspected patients. Pathogens like Mycoplasma pneumoniae, Chlamydia psittaci, human influenza A and B viruses, etc. were isolated from patients presenting with severe pneumonia in Hongkong. Pneumonia and associated diseases are majorly caused by these pathogens, but the unusual clinical presentation of the patients with atypical pneumonia was not explained by this. These individuals did not yield any positive results from the preliminary microbiological examinations for recognized respiratory infections (Heymann 2005). Dr Carlo Urbani, an epidemiologist in a French hospital in Hanoi with the WHO, was responsible for describing and reporting the outbreak in Hanoi as well as naming the disease severe acute respiratory syndrome (SARS) (Peiris and Poon 2008). An etiologic link between SARS and the novel coronavirus has been established through virus isolation from the nasopharyngeal and oropharyngeal samples of the patient and further confirmation of the viral etiological agent by indicating other SARS patients and their serologic response to the virus. The first definite clusters of this new disease to become apparent outside of Guangdong province were these two clusters in Hanoi and Hong Kong. Subsequently, the World Health Organization broadcasted a global alert and offered a tentative case definition of the condition, which they named severe acute respiratory syndrome (SARS). In a short period of time, other cases were reported from Toronto and Singapore, and the WHO issued a travel advisory recommending against traveling to impacted regions unless it is absolutely necessary (Khan et al. 1999). There has been a synergetic global attempt to combat the imminent emerging infectious illnesses with the discovery of this novel virus through clinical, epidemiologic, and laboratory research. The disease was termed as severe acute respiratory syndrome (SARS) by the World Health

160

P. S. Akshay et al.

Organization and the Centers for Disease Control and Prevention based on the clinical manifestations of the disease (Christian et al. 2004; Peiris et al. 2003). Electron microscopy and RT-PCR for the amplification of portions of viral RNA replicase that possessed homology with other coronaviruses were used. However, the coronavirus that was shown to be associated with SARS was genetically unique from any and all other coronaviruses that are currently known. A pan-viral microarray was used to hybridize the entire nucleic acid that was extracted from the virus-infected Vero cells. Consequently, barely a few weeks after the SARS virus had spread beyond Guangdong province, three separate laboratories had detected a novel coronavirus from individuals who had developed SARS in Hong Kong, Vietnam, or Singapore (Peiris 2005). RT-PCR using initial genome sequences of the viral replicase gene, antibody responses demonstrated by indirect immunofluorescence and enzyme immunoassays, and virus isolation in cell culture; all provided the tools needed to look for viral infection among patients with suspected SARS. These findings revealed that a unique virus had been isolated from the infected patients in pure culture and was continuously detected but not in the controls (Peiris 2005; Yang and Rothman 2004). Using viral culture, RT-PCR, and electron microscopy, the SARS coronavirus was identified in the bronchoalveolar lavage and lung biopsies taken from individuals diagnosed with SARS (Stöhr 2003). Fifteen years later, viral RNA and protein were also demonstrated to be present in the lung tissue through the use of in situ hybridization and immunohistology (Wang et al. 2018). RT-PCR for rapid disease diagnosis was developed using the original gene fragments produced by differential display PCR. Koch’s postulates for the viral cause of SARS by this novel coronavirus were confirmed in a primate model. And on April 12, 2003, the whole genome of the virus was sequenced and made publicly available to all researchers over the Internet (Olsen et al. 2003). One of the most astonishing achievements in medical history is the rapid development in determining the etiological agent of SARS. The comprehensive understanding of a pandemic microbe’s full genome took only two months after it was discovered, dramatically speeding up research on SARS pathogenesis, diagnostics, antivirals, and vaccines (Peiris 2005).

5.3

Epidemiology

5.3.1

Geographical Distribution

An outbreak of a novel coronavirus causing severe acute respiratory syndrome began in the Guangdong province of southern China in mid-November 2002. In the course of the SARS epidemic, which lasted from November 2002 until July 2003, there were reportedly a total of 8098 cases from 29 different nations or administrative regions spread over 5 continents, with 774 of these cases resulting in fatalities (Xiao et al. 2020). Following the conclusion of the outbreak in July 2003, lab-acquired illnesses were recorded in Singapore and Taiwan in 2003 and 2004, with one of these infections resulting in limited community transmission that was

5

Severe Acute Respiratory Syndrome Associated Corona Virus [SARS-CoV]

161

once again handled by public health measures following the epidemic in July 2003. Newly identified zoonotic transmission occurred in live-animal markets from December 2003 to January 2004, producing mild illness but no human-to-human transfer, according to the Guangdong Provincial Health Department (Heymann 2005; Peiris 2005). The disease, caused by an unknown etiological agent, was spread internationally by superspreading events that led to cases in numerous countries. International air travels accelerated the epidemic to a global pandemic (Fig. 5.1). The transmission of SARS occurs through close interpersonal contact, the exchange of respiratory aerosols, or through contact with fomite (Yadav and Saxena 2020). SARS-CoV has been found in the tears, feces, and urine of people who have been infected with the disease (So et al. 2004).

5.4

Demographics of SARS-CoV Infection

The viral outburst among the individuals was mostly from hospitals and within family. During the 2002–2003 SARS outbreak, the disease affected individuals of different age groups, but the median age of infected individuals was below 45 years. A significant number of infected persons were health care providers, specifically 22.8% of all infections in Guangdong, China, and 22% in Hong Kong. Forty-three percent of total cases in Canada and 41% of total cases in Singapore were reported among hospital workers. SARS has been linked to an increase in severity with the patients’ ages. Patients with SARS in Hong Kong aged 0–24, 25–44, 45–64, or >65 years died at a rate of 0%, 6%, 15%, and 52%, respectively (Chan-Yeung and Xu 2003). When compared to males, higher levels of ACE-2 expression in young females were found to correspond with higher rates of SARS-CoV infection. The disparities in infectious manifestation between the sexes are probably due to differences in immunity, but hormonal differences may also be at play. Hormones regulate the gene expression by binding with intracellular receptors. In addition, males and females have distinct differences in the production of sex hormones as well as the receptor density found on immune cells. In lung tissue, estrogen has been demonstrated to be both anti-inflammatory and protective during acute respiratory distress syndrome (ARDS) (Channappanavar et al. 2017). Furthermore, ACE-2 functions as a receptor for the entry of SARS-CoV and SARS-CoV2 viruses. It also works to block the RAAS, which when unchecked can have inflammatory effects. Females have a high expression of ACE-2 and elderly have a low expression of ACE-2 in comparison to males in studies conducted on animals (Channappanavar et al. 2017; Gupte et al. 2012; Ha et al. 2021; Hamming et al. 2004; Hofmann and Pöhlmann 2004; Xudong et al. 2006).

Fig. 5.1 Geographical distribution of SARS-CoV cases during the outbreak in 2003. The disease originated in southern China, formed multiple clusters across the nation, and further spread to other parts of the world. China accounted for the highest number of infected people, followed by Hong Kong, Taiwan, Canada, and Singapore according to WHO. Image created using mapchart.net

1-5

5000+ 1001-5000 301-1000 101-300 51-100 6-50

No of SARS Cases

162 P. S. Akshay et al.

5

Severe Acute Respiratory Syndrome Associated Corona Virus [SARS-CoV]

5.5

163

Origin of Infection and Diversity

When the SARS pandemic first started, practically all of the early index patients had been exposed to animals prior to becoming ill with the disease. Following the discovery of the virus that causes SARS, animal handlers in a market and masked palm civets (Paguma larvata) were both found to have SARS-CoV and/or antiSARS-CoV antibodies. (Abdelrahman et al. 2020; Benvenuto et al. 2020; Lau et al. 2010). However, more recent research using civets taken in the wild as well as those raised in captivity has shown that the SARS-CoV strains that were discovered from market civets were passed on from other animal intermediate hosts. A novel coronavirus identified to be associated with humans in horseshoe bats (genus Rhinolophus) was reported independently by two separate research groups in 2005, pointing to the possibility that civets are merely intermediary hosts for SARS-CoV and the natural host of the virus is bat. These coronaviruses were given the names SARS-related viruses (SARSr-CoVs) or SARS-like coronaviruses (Cui et al. 2019; Wang et al. 2006). Thereafter, a number of SARSr-CoVs were isolated from bats across various countries in different continents, which had a phylogenetic lineage with SARS-CoV. Bats from all around China, Europe, Africa, and Southeast Asia have been found to have SARSr-CoV phylogenetically related coronaviruses. The geographic distribution of SARSr-CoVs is broad, and bats may have been infected with them for a very long time. Bat populations in Yunnan province, China, were found to be infected with a wide range of SARSr-CoVs throughout the course of a five-year study. The SARSr-CoVs at this location are the most genetically diverse in China, and it is a biodiversity hot zone. Despite 19 years of research, a conspicuous predecessor of SARS-CoV in bat species has not been detected. SARS-CoV is assumed to be evolved from the RNA genome recombination of unidentified cave bat-associated viruses or bat SARSr-CoV. Some studies clearly abetted the theory that the WIV16, civet SARS-CoV strain, and Rf4092 were created through the recombination of these two bat viruses (Hu et al. 2017). In the animal kingdom, the most closely related SARS-CoV strains were found in bat SARSr-CoV strain 20 and WIV16 and are most likely the result of recombination. The two recombination breakpoints, S and ORF8, are where the receptorbinding domain (RBD) is encoded and ORF8 is where an auxiliary protein is encoded (Cui et al. 2019; Hu et al. 2017; Lau et al. 2013). Bat SARSr-CoVs have a wide range of genetic variation, making it likely that new strains will emerge in the future due to the coronaviruses’ frequent recombination and close coexistence. It is hypothesized that the recombination of coronaviruses in bats resulted in the creation of the SARS-CoV’s ancestor, which was then transferred to civet populations in captivity or another mammal via fecal-oral transmission in Yunnan province during the epidemic of SARS. Infected market civets in the Guangdong market transmitted the virus, which then underwent further changes before infecting people (Cui et al. 2019.; Dhama et al. 2020; Fan et al. 2019; Ravelomanantsoa et al. 2020).

164

5.6

P. S. Akshay et al.

The 2003 SARS Pandemic

SARS-CoV may have become an endemic respiratory virus had it not been for the intensive international and worldwide public health activities that were launched in 2003. Governments and those working in public health cooperated extraordinarily well with one another and communicated frequently in order to stem the epidemic’s spread. A nephrologist from southern China, aged 64 years, who traveled to Hong Kong was the index patient who started subsequent outbreaks of SARS-CoV infection in Hong Kong, Singapore, and Toronto from February 21, 2003. While staying or visiting friends on the same level of the Hotel M, where the physician had stayed, 16 hotel guests and visitors became sick with the disease that the physician had brought with him. These tourists carried the infection to 29 nations and areas through international air travel (Benvenuto et al. 2020; Hui et al. 2014; Peiris et al. 2003; Zeng et al. 2018). There were a total of 8098 cases in July 2003, when the epidemic ended, with a fatality rate of 9.6% (774 cases) (Shetty and Shetty 2009; Zizza et al. 2021). The patterns of transmission in communities for endemic HCoVs and SARS-CoV are quite distinct from one another. Despite the fact that the vast majority of instances did not in any way transmit illness, a handful was responsible for explosive outbreaks, which are referred to as “superspreading occurrences.” It has been determined that in a lot of these instances, the entire epidemiological background, as opposed to the characteristics of the specific index patient, was the critical factor in the occurrence of these superspreading episodes. Within a few days, Hong Kong’s Amoy Gardens apartment complex saw the infection spread to over 300 people as a result of one index case, who had diarrhea as well as a mild respiratory illness at the time. This unusual transmission event occurred as a result of one person having both of these symptoms at the same time. It is suspected that a malfunction in the sewage system caused the aerosolization of infectious fecal matter, which subsequently propagated through this housing complex via the airborne route to impact a significant number of additional inhabitants (Abdullah et al. 2003; Li et al. 2005a, b; Peiris et al. 2003; Peiris 2005; Salzberger et al. 2021; Yu et al. 2004; Zhong et al. 2003). A single case might cause anywhere from 2.0 to 3.0 additional cases, which is a figure that is comparable to that which is estimated for pandemic influenza (Andreasen et al. 2008; Breban et al. 2013; Petersen et al. 2020). The fact that most cases of transmission occurred in the later stages of the disease, often after day 5 of symptoms, contributed to the efficacy of public health efforts in preventing the spread of the virus. This opened up a window of opportunity for case diagnosis and isolation prior to the point of maximal transmissibility, which made it possible for public health measures to halt transmission in the community. As control measures begin to take effect, the transmissibility coefficient decreases over time, as was observed with the successful eradication of SARS-CoV in 2003 (Bell et al. 2003; Breban et al. 2013; Chan-Yeung and Xu 2003).

5

Severe Acute Respiratory Syndrome Associated Corona Virus [SARS-CoV]

5.7

165

Bio-safety Measures

Biosafety is critical when working with infectious organisms in laboratories. Work involving the handling of viral cultures, e.g., virus isolation, production of viral antigens, and handling of infectious SARS-CoV at high concentrations like concentrating virus by ultracentrifugation should adhere to biosafety level 3 work procedures and BSL 3 containment. These recommendations can also be found on the WHO website. BSL-2 laboratories can perform routine serology on patients suspected of having SARS (Filtering Face Pieces 3 or N 95 grade breathing masks). Heat inactivation at 56 °C for 30 min is advised since SARS-CoV has been found in plasma. SARS-CoV infectivity in serum is reduced by 104-fold with this pre-treatment, which does not alter antibody detection. Diagnostic procedures that do not require replication of SARS-CoV can be conducted in a BSL2 containment area with BSL3 work practices, such as extracting viral RNA from the clinical samples for RT-PCR and performing immunofluorescence tests on serum and aliquoting clinical specimens. In order to achieve biosafety, it is necessary to combine well-designed facilities with well-defined and appropriate standard operating procedures, training, and medical supervision. Each link in the chain plays an equal and important role in the overall success or failure to prevent acquiring laboratory-associated infections (CDC and Ncird 2004).

5.8

Potential Risk of Emergence and Re-emergence

The comprehensive procedures of case discovery, infection control precautions, contact tracing, and quarantine that were done by many nations engaged in the worldwide outbreak of SARS contributed greatly to the disappearance of the disease in June 2003. Because of the virus’s limited rate of spread, this achievement was made possible. When symptomatic individuals were identified within five days of illness, just a few subsequent cases were observed. The proportion of asymptomatic cases and the infectiousness of those who are infected determine whether SARS can return from a human “reservoir.” Persistent infection in the general population is improbable due to the rarity of asymptomatic infection. In theory, though, it might be reintroduced from an animal stockpile. Because of the seasonality of the precursor virus in animals and the seasonal fluctuations in the dietary and cultural patterns of people who consume exotic wild game foods, a resurgence of SARS-CoV is likely to come from an animal source. Another element that may affect how well-isolated cases of zoonotic transmission might start self-sustaining chains of human transmission is the seasonality. As with most respiratory viruses, including the conventional coronaviruses, the SARS coronavirus has yet to be proven to be transmitted in humans by cooler weather (World Health Organization 2006). The re-emergence of SARS in Guangdong in December 2003 and January 2004, with four people in the community contracting the disease from an animal source, indicates a chance of a

166

P. S. Akshay et al.

potential risk of re-emergence, provided there is no functional vaccine available for this yet (Cheng et al. 2007).

5.9

Structural Organization of SARS-CoV

5.9.1

Classification

Coronaviruses are distinguished by their spike proteins that form crown-like structures on their surface. They belong to the order Nidovirales, family Coronaviridae, and alpha(α), beta(β), gamma(γ), and delta(δ) are the four identified genera of coronaviruses. Gamma coronaviruses infect avian species, alpha coronaviruses and beta coronaviruses cause disease in mammals, whereas delta coronaviruses infect both avian and mammalian species. SARS-CoV belongs to beta coronaviruses. Human coronavirus NL63 (HCoV-NL63), porcine respiratory coronavirus (PRCV), porcine epidemic diarrhea virus (PEDV), and pig transmissible gastroenteritis coronavirus (TGEV) are examples of alphacoronaviruses. Human coronavirus OC43, MERS-CoV, bovine coronavirus (BCoV), SARS-CoV, bat coronavirus HKU4, SARS-CoV-2, and mouse hepatitis coronavirus (MHV) are all examples of beta coronaviruses. Porcine deltacoronavirus (PdCV) and avian infectious bronchitis coronavirus (IBV) are examples of gamma- and deltacoronaviruses, respectively (Enjuanes et al. 2006; Fehr and Perlman 2015; Li 2016; Liu et al. 2021; Masters and Perlman 2013; Woo et al. 2009; Zeng et al. 2018) (Fig. 5.2). In immunocompetent hosts, the upper respiratory disorders caused by the four human coronaviruses (HCoV-OC43, HCoV-NL63, HKU1, and HCoV-229E) are mild infections. However, several of these viruses create severe infections in vulnerable populations like aged individuals, neonates, and young children (Liu et al. 2021). SARS-CoV 2, MERS-CoV, and SARS-CoV cause severe respiratory distress in patients in contradictory to other human coronaviruses. Their transmissibility and severity lead to a pandemic. Among the coronaviridae, seven known coronaviruses can cause disease in humans, including the SARS-CoV, HKU1, OC43, SARS-CoV2, and MERS-CoV (betacoronaviruses) as well as the alphacoronaviruses NL63 and 229E (Fig. 5.3) (Liu et al. 2021; Woo et al. 2009; Zeng et al. 2018).

Fig. 5.2 Phylogenetic tree of human coronaviruses. Cladogram made using clustalw

5

Severe Acute Respiratory Syndrome Associated Corona Virus [SARS-CoV]

167

Fig. 5.3 Virion structure of SARS-CoV. The virus has a 29.7 kb encapsidated positive-stranded RNA genome. The virus uses spike protein to interact with the ACE-2 receptor for host cell entry. Image created using Biorender.com

5.9.2

Morphology and Virion Structure

An RNA positive-stranded virus, SARS-CoV is categorized in the family of Coronaviridae and the genus Beta coronavirus as a lineage B member in the family (Torres et al. 2007). Virions of coronaviruses are typically spherical and sometimes pleiomorphic, and their diameter ranges from roughly 80–120 nanometers. Trimeric spike (S) glycoprotein trimers that form a typical fringe of enormous (ca. 20 nm) petal-shaped surface projections, which can be seen by standard negative-staining electron microscopy. In comparison to conventional biological membranes, the envelope is unusually thick (7.8 ± 0.7 nm) (average thickness ca. 4 nm). The loosely twisted helix that is the nucleocapsid appears to be securely folded to create an apparent 4 nm gap between the core and the envelope, a compact core (Chang et al. 2014; Perlman and Netland 2009; Surjit et al. 2004). Figure 5.3 shows the SARS-CoV gene order: 5′-replicase, spike, envelope, membrane, and nucleocapsid-3′. Fourteen open reading frames (ORFs) can be found in the Urbani strain genome. Twenty-four potential non-structural and accessory proteins are anticipated to be encoded by ten of the open reading frames

168

P. S. Akshay et al.

following post-translational processing (Brown and Tetro 2003). Additionally, in the 3′ proximal section of the genome, four open reading frames encoding the four structural proteins S (spike), E (envelope), M (membrane), and nucleocapsid (N) are situated downstream of the replication gene. The homodimeric hemagglutininesterase (HE) glycoprotein is found on the surface of Group A betacoronaviruses (Fig. 5.3), which is 5–7 nm long. Cryo-electron tomography has revealed that coronavirions are uniformly sized and spherical (with an envelope outer diameter of 85.5 nm) (Christian et al. 2004; Ng et al. 2016; Brown and Tetro 2003; Fehr and Perlman 2015; Forster et al. 2020; Graham et al. 2013; Ksiazek et al. 2003).

5.10

Genome Structure and Organization

The genome of the giant positive-stranded RNA virus consists of 29,727 nucleotides (~30 kb), which also contain 41% guanine and cytosine. Genes ORF1a and ORF1b, which constitute two-thirds of this virus’s genome, have been arranged in their original gene order, which is based on 5′-replicase (rep). Two large polypeptides, pp1a and pp1ab, are produced by the rep genes ORF1a and ORF1b, respectively (790 kDa). Each of the four open reading frames (ORFs) downstream of the rep gene encodes a different structural spike glycoprotein (S), envelope protein (E), membrane protein (M), and nucleocapsid protein (N) (Abdelrahman et al. 2020; McBride and Fielding 2012; Song et al. 2019). The RNA from the genome is used to translate the rep genes, whereas the mRNA from the subgenomic regions is used to translate all of the other viral proteins. Additional genes encoded by the SARS-CoV genome range in length from 39 to 274 amino acids and are known. Several structural proteins and SARS-CoV rep genes share some sequence similarities with other coronaviruses, but accessory proteins show little or no similarity to those seen in any other coronaviruses (Chung et al. 2019; McBride and Fielding 2012).

5.10.1 Propagation and Assay in In Vitro and In Vivo Laboratory Models Vero E6 cells, from an African green monkey, are a kidney cell line shows high expression of ACE-2 receptors, have been demonstrated to get infected by the SARS-CoV (Ksiazek et al. 2003), and are the sole in vitro SARS-CoV infection model. The main challenge to developing a safe SARS vaccine for human use, which can mimic the clinical manifestations, stems from a lack of ideal animal models (Li and Xu 2010). For SARS, the development of animal models was essential for the creation of potent antiviral medications and vaccinations against SARS-CoV. Intratracheal inoculation of cynomolgus macaques with SARS-CoV causes infection, according to the available evidence (Fouchier et al. 2003; Peiris 2005; Rowe et al. 2004; Kuiken et al. 2003). Golden Syrian hamsters, ferrets, mice, cats, and African green monkeys are among the other animal models. The replication of viruses in the respiratory tracts is supported by these animal models. Hamsters and

5

Severe Acute Respiratory Syndrome Associated Corona Virus [SARS-CoV]

169

ferrets both develop significant lung infection. SARS-CoV is transmitted to noninfected animals in cages by infected ferrets and cats (Buchholz et al. 2004; Bukreyev et al. 2004; Martina et al. 2003; Rowe et al. 2004; Subbarao et al. 2004). The disease pathology in these model animals is different from the normal human disease in regards to how long it takes to achieve peak disease pathology and viral load since the disease pathology is self-limiting and rarely leads to a fatal end, as with SARS. These models also don’t adequately simulate a human disease’s intestinal component. However, for problems that are important to the creation of medicines and vaccines, these models are the only ones that are currently available. If their limits are acknowledged, they may offer helpful information (Peiris 2005).

5.11

Viral Proteins and Life Cycle

The structural proteins that the ORFs encode are: 1. Spike (S) protein is a glycoprotein, measuring 180/90 kDa, involved in receptor binding and fusion with the host cell. 2. Envelope (E) protein, 8 kDa in size, is a multifunctional viroporins with varied functions like structural stability and in inflammatory responses in cytokine storm (DeDiego et al. 2007). 3. The most prevalent protein in each coronavirus virion, membrane protein (M), has a mass of 23 kDa and is one of the most constrained and conserved structural proteins of all viruses (Cagliani et al. 2020). Its main role is in the assembly of newly produced viral particles. 4. The 50-60 kDa nucleocapsid (N) protein has various functions like: (a) compacting the nucleic acid in the viral particle by forming dynamic but stable complexes with the genomic RNA; (b) interactions with the structural membrane (M) protein, promoting membrane envelop folding and virion assembly; and (c) interactions with the non-structural protein, nsp3 (Wong and Saier 2021). Other non-structural and accessory proteins have roles in viral activity and its propagation. Replicase proteins are required for the creation of replicase complexes, the processing of polyproteins, and virus replication. Inhibition of type I interferon activity and apoptosis depends on the M protein and other ORFs (Li and Xu 2010). Through the process of fusion, the host cell is infected by enveloped viruses, which is facilitated by membrane proteins and their receptors on the host cell surfaces.

5.12

ACE-2 Receptor

The Spike (S) protein uses the exopeptidase activity of angiotensin-converting enzyme 2 (ACE-2) to initiate fusion (Hofmann and Pöhlmann 2004). ACE-2 is present on all human epithelial cells, including the mucosa lining of oral and nasal

170

P. S. Akshay et al.

cavities, nasopharynx, lungs, gastrointestinal tract, lymph nodes, spleen, thymus, liver, kidney, bone marrow, and also the brain, due to which a systematic infection may arise during the pathogenesis of the disease (Hamming et al. 2004). The endosomal pathway is predominant (Lakadamyali et al. 2004), despite the fact that both endosomal and non-endosomal methods for viral entry and genome release are recognized. Viral RNA expressing non-structural proteins (nsps) is translated upon the shedding of the N protein from the genome. These proteins are translocated to the perinuclear spaces and endoplasmic reticulum (ER), also reverse transcription of additional transcripts is done. Convoluted membranes (CMs), double membrane spherules (DMSs) are formed by nsps by membrane rearrangements. Structural protein production and post translational modifications occur in the ER and Golgi which is then followed by the encapsidation of the viral genome by N proteins. Viral structural proteins are created and subjected to the post-translational modification in the ER/Golgi. Nucleocapsid proteins enclose viral DNA and lipid envelopes made up of spike, membrane, and envelope proteins surround the encapsulated genomes. Multiple linked double membrane vesicles (DMVs) that contain dsRNA and spread across the perinuclear region are involved membrane rearrangements. The Golgi produces a huge number of virions with lysosomal virion-containing cisternae (LVCVs) connected to their membranes (Fig. 5.4). Mature CoV virions bud from ER-Golgi intermediate compartments. CoV progeny viruses are removed via lysosomal exocytosis (Wong and Saier 2021).

5.13

Pathology, Pathogenesis, and Host Viral Interactions in Humans

The target site for viral entry and infection are the epithelial cells of the respiratory tract, leading to damage of the alveoli and spreading from the lungs to various organs in the body like the lymphatic nodes and spleen, digestive system, nerve cells in the brain, urinogenital tract, hormonal glands, heart, and bone marrow over the course of illness, as indicated in Fig. 5.5. The following table summarizes the pathological conditions in various organs (Table 5.1). SARS virus is known to infect monocytes and T cells and leads to their apoptosis, which may be caused due to inhibition of the Bcl-xL protein, which is anti-apoptotic. Apoptosis of various other cells is observed in in vivo studies, like pneumocytes, epithelial cells, thyroid gland cells, spermatogenetic cells, hepatocytes, and lymphocytes (Chau et al. 2004; He et al. 2006; Xu et al. 2006; Wei et al. 2007). Several studies have indicated that the infection of immune cells can lead to increased spreading to various organs (Ding et al. 2004; Gu et al. 2005). Chemokines secreted by the infected pneumocytic epithelial cells facilitate the migration of monocytes and neutrophils. Similarly, dendritic cell infection causes the migration of immune cell types, such as activated T cells, resulting in the recruitment of macrophages (Cheung et al. 2005; Law et al. 2005). Due to immune cell accumulation, pro-inflammatory cytokines and chemokines levels get raised, including this

5

Severe Acute Respiratory Syndrome Associated Corona Virus [SARS-CoV]

171

Fig 5.4 Life cycle of SARS-CoV. Image created using Biorender.com

and other factors, leading to lung damage in a severe manner, as noted in SARS patients.

5.14

Host Immune Response

5.14.1 Innate Immune Response Researchers have looked at interferons, dendritic cells, mannose-binding lectin (MBL), and macrophages in relation to the innate immune system’s function in SARS-CoV infection. SARS-CoV is not able to significantly increase the expression of interferon-related genes in infected macrophages, infected dendritic cells, or

172

P. S. Akshay et al.

Fig. 5.5 Mechanisms that contribute to pathogenesis of SARS. Image created using Biorender. com Table 5.1 Summarizing the histopathological features of SARS-CoV in various organs and tissues. Source: (Gu and Korteweg 2007) Organs/Tissues Respiratory tract

Spleen and lymph nodes Urogenital tract Central nervous system Skeletal muscles Adrenal gland Thyroid gland Testes Heart

Histopathological features Diffuse alveolar damage (DAD) with different degrees of acute exudative features like edema, hyaline membrane formation, fibrosis, macrophagic/ mixed cellular infiltration, multinuclear giant cells, atypical reactive pneumocytes, and vascular injury Lymphocyte depletion and splenic white pulp atrophy Acute tubular necrosis in the kidneys Edema and degeneration of the neurons Atrophy and necrosis of myofibers and some regenerative myofibers Infiltration and necrosis of monocytes and lymphocytes Follicular epithelial cell destruction and cells undergoing apoptosis Destruction of germ cells, apoptosis of spermatogenic cells Atrophy and edema of myocardial fibers

peripheral blood mononuclear cells (PBMCs) in contrast to other viruses (Cheung et al. 2005; Law et al. 2005). SARS-CoV induces both phenotypic and functional maturation of dendritic cells in vitro, leading to a modest cytokine output and an improved T-cell-stimulatory capacity. The lungs may experience cytotoxic action from activated T cells, which would accelerate pulmonary damage. Lack of MBL appears to be a major factor in SARS-CoV pathogenesis. Independent of a particular antibody response, the serum protein MBL can attach to the ligands of many viruses

5

Severe Acute Respiratory Syndrome Associated Corona Virus [SARS-CoV]

173

and mark them for immune destruction (Medzhitov and Janeway 2000). In vitro, MBL can bind to SARS-CoV and prevent it from being contagious. Patients with SARS have been found to have both reduced MBL serum levels and the haplotypes related to MBL deficiency (Ip et al. 2005).

5.14.2 Adaptive Immunity It has been discovered that structural proteins, especially S protein, contain the majority of the antigenic peptides, as opposed to non-structural proteins. The spike (S) protein, nucleocapsid (N) protein, and most abundant membrane (M) protein function as immunogens, and activate both cellular and humoral immunity (Lu et al. 2015; Du et al. 2009; Leung et al. 2004; Lin et al. 2003; Woo et al. 2004; He et al. 2005; Liu et al. 2010). IgG and neutralizing antibodies reach their peak at 4 months, after which they gradually decline (Liu et al. 2006). T-cells specific to SARS-CoV are critical for the identification and clearance of contaminated cells, especially in the lungs of affected people, according to laboratory research on clinical patients (Gu et al. 2005). One proposal is related to the case of mice infected with SARSCoV, wherein it was observed that a stronger CTL response leads to protection against infection, an aspect that requires further study is for the response of the memory T-cell adequacy for protection against reinfection (Channappanavar et al. 2014; Chen et al. 2010; Zhao et al. 2010).

5.14.3 Autoimmunity The pathophysiology of SARS-CoV may possibly involve autoimmunity. SARS patients have been found to have autoantibodies against pulmonary endothelial and epithelial cells. Both systemic vasculitis and cytotoxic damage to epithelial cells of the pulmonary tract could be brought on by these autoantibodies, both of which are frequently found in SARS autopsies (Yang et al. 2005a, b). The emergence of crossreactive antibodies against particular SARS-CoV epitopes may contribute in some measure to autoimmune disease. Indeed, pulmonary epithelial cells and IgG antibodies directed against spike protein domain 2 have been discovered to interact with each other. Autoantigens exposure brought on by cytokine-induced organ harm is another mechanism that could explain autoimmunity (Yang et al. 2005b).

5.14.4 Persistence of SARS-CoV For the first time, Li et al. in 2006 (Li et al. 2006) demonstrated that recovered patients continue to exhibit robust and consistent binding, neutralizing antibody, and Cytotoxic T lymphocytes (CTL) responses across the course of the research conducted for a two-year time period, with a mild reduction occurring one year following the onset of symptoms. Ng et al. 2016, in their study, have shown that

174

P. S. Akshay et al.

three SARS-recovered people still had memory T cells specific to SARS, 9 and 11 years after the initial infection. The structural S, N, and M proteins of the SARSCoV were targets of all memory T cells found.

5.14.5 Phases of Disease SARS can be considered a triphasic disease. This includes a viral replicative phase, hyper immune response phase, and pulmonary destructive phase. Patients experienced fever, chills, and myalgia during the onset of the disease and were presented with less or no respiratory symptoms. This represents the viral infection and replicative phase. The viral replication is followed by the cell disruption and release of pathogens into the bloodstream. This activates the immune responses, mainly cytokine secretion, in the bloodstream. Few patients recover without proceeding to the second phase, but 70% of the infected individuals proceed to the hyper immune active phase (Sung and Yuen 2005). Despite the fact that these cytokines are intended to eliminate the virus, they may drive cellular proliferation in the lungs. Shortness of breath and coughing are among the first respiratory symptoms that patients experience; chest radiographs reveal several regions of consolidation in both lungs. This stage of the sickness is crucial. The lung may sustain irreversible damage if the “cytokine storm” does not dissipate naturally or under therapeutic treatment. The patient will enter the pulmonary destruction phase sometime between the third and subsequent weeks of treatment. On chest radiographs, the lungs will have a ground-glass appearance; arterial blood oxygenation will decrease; and the requirement for supplemental oxygen will rise. Patients will eventually require positive pressure ventilation because oxygen therapy will no longer be able to maintain a satisfactory oxygenation saturation level (Cherry and Krogstad 2004; David S.C. Hui and Sung 2003; David Shu Cheong Hui et al. 2003; Li and Ng 2005; Silva et al. 2020).

5.15

Clinical Manifestations

Fever accompanied by headache, chills, rigidity, muscle aches, fatigue, diarrhea, cough, breathlessness, pneumonia, lymphopenia, neutropenia, thrombocytopenia, and increased alanine aminotransferase, serum lactate dehydrogenase, and creatine kinase activity are some of the clinical and laboratory symptoms (Li and Xu 2010). In all the patients, it was observed that the serum levels of C-reactive protein (CRP), IL-8, IL-6, and TNF-alpha were increased. In comparison to the patients who lived, the deceased often had higher peak serum TNF-alpha levels. The rapid rise of the inflammatory cytokines IL-6, IL-8, and TNF-alpha may contribute to the onset of the acute respiratory distress syndrome (ARDS) associated with SARS. Pulmonary infiltration advancement is related to the timing of inflammatory cytokine and an increase in CRP in SARS patients. Patients who succumb to SARS typically have greater peak serum TNF-alpha levels than those who survive (Sheng et al. 2005).

5

Severe Acute Respiratory Syndrome Associated Corona Virus [SARS-CoV]

5.16

175

Diagnostics and Therapeutics Approaches

The reverse transcription polymerase chain reaction (RT-PCR), the immunofluorescence assay (IFA), and the enzyme-linked immunosorbent assay (ELISA) of N protein are the three main diagnostic techniques for SARS-CoV (Bhatnagar et al. 2008). In the initial week of sickness, RT-PCR detection rates for SARS-CoV are often poor. On day 14 of sickness, the positivity rates for nasopharyngeal aspirate, urine, and stool samples have been found to be 68%, 42%, and 97%, respectively, although it may take 28 days for serology for confirmation to attain a detection rate over 90% (Hui et al. 2003). With real-time RT-PCR, a quantitative method for measuring SARS-CoV RNA in blood samples has recently been established (Ng et al. 2003).

5.16.1 Anti-virals No specific antivirals have been demonstrated to be helpful for any coronaviral infections, and supportive treatment is the core of therapeutic care, where the symptoms of the syndrome are treated. SARS patients have received a variety of treatments due to the disease’s clinical severity and the lack of earlier research. There was widespread use of intravenous or oral ribavirin and large dosages of corticosteroids during the outbreak of 2002–2003, with many patients receiving both treatments. Ribavirin, lopinavir, and type I interferon were reported to suppress SARS-CoV replication in vitro in a systematic evaluation of SARS therapy. Trials involving convalescent plasma or intravenous immunoglobulin were inconclusive when it came to convalescent plasma (IVIG), type I IFN (RIVA), and lopinavir/ ritonavir (LOPI). As a result of corticosteroid medication, there was an increase in the length of viral shedding. Pegylated IFN was effective in treating macaques, and an early human clinical trial with IFN-alfacon1 found that it may have some positive effects (Chu et al. 2004; Cinatl et al. 2003b; Keyaerts et al. 2004; Lai 2005; Loutfy et al. 2003; Peiris 2005; Stockman et al. 2006; Sung et al. 2004; Totura and Bavari 2019). Respiratory infections causing acute respiratory distress syndrome (ARDS), such as SARS-CoV and MERS, necessitate a low-tidal-volume breathing strategy to prevent damage to the lungs. Unless a patient has refractory shock or another clinical justification for corticosteroids, it is generally best to avoid using them in viral pneumonia that leads to ARDS. SARS patients in a retrospective cohort study who had taken corticosteroids experienced worse outcomes and had their virusshedding time extended (Badraoui et al. 2020; De Wit et al. 2016; Malhotra 2007; Wheeler and Bernard 2007).

5.16.2 Vaccines An effective vaccination against SARS-CoV is not yet available. Numerous conformational epitopes in the spike glycoprotein’s S1 region trigger powerful neutralizing

176

P. S. Akshay et al.

antibodies. It has been demonstrated that attenuation of virus by genetic engineering or SARS-CoV spike (S) glycoprotein encoding viral vector vaccine to be effective in inducing immunity (Bhatnagar et al. 2008). Antibodies that neutralize the spike glycoprotein of coronaviruses are found to be effective as the receptor-binding epitope is used as the target. After the 2003 outbreak, research on the development of a SARS-CoV vaccine was started, but funding dwindled when no new cases were reported. It appears that antibody is both sufficient and necessary for conferring protection against SARS, according to animal research on vaccine-induced protection, adoptive transfer, and T-cell depletion. To investigate the efficacy of subunit, whole-virus inactivated vaccinations, live-virus vaccines, and DNA vaccines numerous animal models were used. Many of these modalities have shown promising results. Human SARS-CoV, used for the development of the vaccine, has a wide range of antigenic variation as well as a lack of cross-neutralization with precursor SARS-CoV-like viruses identified in small animals (e.g., civets and bats), which are potential sources of any fresh SARS outbreak. Monoclonal antibodies can protect against both human and animal (palm civet) coronaviruses, but not against bat coronaviruses, which could be a source of SARS re-emergence. As with the vaccine for feline peritonitis virus, there is the possibility of paradoxical illness amplification with coronavirus vaccines (Badgujar et al. 2020; Jiang et al. 2005; Yen Der Li et al. 2020). Vaccine-induced immunopathology was not observed in most of the vaccinations investigated; however, there were a few cases. Some SARS-CoV vaccinations induced Th2-mediated immunopathology in the lungs of macaques, ferrets, and mice when challenged with SARS-CoV, being more pronounced in vaccines that included solely the N protein (Jiang et al. 2005; Tseng et al. 2012).

5.17

Prevention and Control of SARS-CoV Disease

The government of Guangdong and the Dept. of public health, China, in 2004 undertook the following measures to control the spread of the virus: (i) Strict regulation of the wildlife market: This included a ban on the breeding, marketing, shipping, and butchering of small wild mammals and their food processing in general and civet cats in particular. (ii) Early identification, early disclosure, early isolation, and early management of suspected SARS-CoV-infected patients (Zhong 2004). Suspected patients should be handled in rooms with negative pressure and isolated wherever possible. Antibiotics with atypical covers (such as newer macrolides or levofloxacin) are indicated for the treatment of community-acquired pneumonia at the time of admission. Nebulization, bronchoscopy, chest physiotherapy, and gastroscopy are all examples of treatments that call for extremely stringent safety measures to be performed. Ribavirin therapy is not suggested until it has been evaluated in the context of randomized controlled trials. Both oseltamivir phosphate,

5

Severe Acute Respiratory Syndrome Associated Corona Virus [SARS-CoV]

177

which is an inhibitor of neuraminidase, and human immunoglobulins are found to be ineffective in treating the virus. The lopinavir-ritonavir co-formulation, when combined with ribavirin, can reduce mortality, but this hypothesis needs to be tested further before it can be accepted as fact. In vitro tests with interferon alpha have shown encouraging results (Chu et al. 2004; Cinatl et al. 2003a; Han et al. 2021; Lai 2005; Leong et al. 2004; Stockman et al. 2006; Tan and Jin 2020; Totura and Bavari 2019; Van Vonderen et al. 2003). After the patients have been fever-free for more than 48 h, cough and chest radiographs have begun to improve, and blood counts and biochemistry have begun to normalize, they are eligible for discharge from the hospital. Upon being released from the hospital, the patients should be instructed to take their temperature twice a day and to remain inside for a minimum of 14 days. They should also be cautioned to avoid contact with other people and to report to the hospital for a follow-up examination after a week has passed. After three weeks have passed, another viral serology test should be performed. It is important that individuals who had close contact with the affected person receive education about it and are monitored for at least ten days. In addition to this, they should be encouraged to self-isolate at home. It is possible to keep a daily check on these individuals through the use of a procedure called telephonic surveillance (ChanYeung and Xu 2003; Khan et al. 1999; Mann et al. 2020; Park et al. 2004; Peiris et al. 2003; Poon et al. 2004).

5.18

Future Perspective

The data on disease, receptor binding, and genetic evolution suggest the sequential recombination of SARSr-CoVs in bat, resulting in the evolution of SARS-CoV (Wang et al. 2018). Recombination most likely occurred in the Guangdong bat population prior to the SARS-CoV being introduced there by civet or mammals in Yunnan that are infected (Ge et al. 2013; Li et al. 2005a, b; Yang et al. 2016). The SARS-CoV went through quick changes in ORF8 and S, and it propagated among palm civets in the live-animal market. Spill overs to humans occurred independently of one another (Cui et al. 2019). Antibodies against the SARSr-CoV nucleocapsid were identified in people who live near bat caves, according to a recent serological investigation, and they never had any associated symptoms or manifestations of SARS. This demonstrates that the transmission of SARS-CoV from infected material to human by prolonged contact causing infection (Wang et al. 2018). It’s possible that the MERS coronavirus followed a similar course of events. Since the disease first appeared in 2012, various bat species were identified to be carrying MERSr-CoVs, HKU4, and HKU5 viruses (Anthony et al. 2017; Lau et al. 2013; Luo et al. 2018; Memish et al. 2013; Wang et al. 2014; Yang et al. 2014a, b). The ORF1ab of these viruses is extremely close to the ORF1ab of the MERS-CoV, yet the S proteins of these viruses are very different from one another. Certain bat MERSr-CoVs as well as HKU used DPP4 as a receptor for cellular entry like MERS-CoV (Cui et al. 2019).

178

P. S. Akshay et al.

Recombination, adaptive mutation, and increased plasticity in receptor-mediated cell entry due to the multitudinous coronaviruses carried by bat species demonstrate the frequent transmission of coronaviruses among the species, especially from bats to other animals. This includes the possibility of human transmission (Cui et al. 2019). At the moment, there is neither a clinical treatment nor a method of prevention that is accessible for any human coronavirus except SARS-CoV2. Considering RBDs of bat SARSr-CoVs and SARS-CoV are identical to one another, anti-SARSCoV techniques that are currently under progress, including vaccinations based on RBD or anti-RBD antibodies, ought to be tried on bat SARSr-CoVs (Menachery et al. 2015, 2016; Zeng et al. 2017). The pathogenesis and reproduction mechanisms of these bat viruses are also poorly understood. It is imperative that future studies utilize in vitro infection, reverse genetics, in vivo infection, and virus isolation experiments to discover more about the biological features of these viruses. Natural host-to-human transmission of viruses is mostly the result of human activity, such as the adoption of modern farming techniques and the growth of urbanization. Therefore, viral zoonosis prevention needs to emphasize on maintaining impediment between the human population and the natural virus repertoire (Cui et al. 2019).

References Abdelrahman Z, Li M, Wang X (2020) Comparative review of SARS-CoV-2, SARS-CoV, MERSCoV, and influenza A respiratory viruses. Front Immunol 11:552909. https://doi.org/10.3389/ FIMMU.2020.552909/FULL Abdullah ASM, Tomlinson B, Cockram CS, Thomas GN (2003) Lessons from the severe acute respiratory syndrome outbreak in Hong Kong. Emerg Infect Dis 9(9):1042–1045. https://doi. org/10.3201/eid0909.030366 Ahmad A, Krumkamp R, Reintjes R (2009) Controlling SARS: a review on China’s response compared with other SARS-affected countries. Tropical Med Int Health 14(Suppl 1):36. https:// doi.org/10.1111/J.1365-3156.2008.02146.X Andreasen V, Viboud C, Simonsen L (2008) Epidemiologic characterization of the 1918 influenza pandemic summer wave in Copenhagen: implications for pandemic control strategies. J Infect Dis 197(2):270. https://doi.org/10.1086/524065 Anthony SJ, Gilardi K, Menachery VD, Goldstein T, Ssebide B, Mbabazi R, Navarrete-Macias I, Liang E, Wells H, Hicks A, Petrosov A, Byarugaba DK, Debbink K, Dinnon KH, Scobey T, Randell SH, Yount BL, Cranfield M, Johnson CK et al (2017) Further evidence for bats as the evolutionary source of middle east respiratory syndrome coronavirus. MBio 8(2). https://doi. org/10.1128/MBIO.00373-17 Badgujar KC, Badgujar VC, Badgujar SB (2020) Vaccine development against coronavirus (2003 to present): an overview, recent advances, current scenario, opportunities and challenges. Diabetes Metab lic Syndrome 14(5):1361. https://doi.org/10.1016/J.DSX.2020.07.022 Badraoui R, Alrashedi MM, El-May MV, Bardakci F (2020) Acute respiratory distress syndrome: a life threatening associated complication of SARS-CoV-2 infection inducing COVID-19. J Biomol Struct Dyn 39(17):1. https://doi.org/10.1080/07391102.2020.1803139 Bell DM, Aguilera X, De Salud M, Chile S, Anderson R, Steffen R, Prasad L, Su I-J, Lai SK, Jesuthasan E, Merianos A, Roth C (2003) Health Organization Working Group on prevention of international and community transmission of SARS 1 POLICY REVIEW 1900 emerging infectious diseases, 10(11). www.cdc.gov/eid.

5

Severe Acute Respiratory Syndrome Associated Corona Virus [SARS-CoV]

179

Belouzard S, Millet JK, Licitra BN, Whittaker GR (2012) Mechanisms of coronavirus cell entry mediated by the viral spike protein. Viruses 4(6):1011. https://doi.org/10.3390/V4061011 Benvenuto D, Giovanetti M, Ciccozzi A, Spoto S, Angeletti S, Ciccozzi M (2020) The 2019-new coronavirus epidemic: Evidence for virus evolution. J Med Virol 92(4):455–459. https://doi.org/ 10.1002/JMV.25688 Bhatnagar PK, Das D, Suresh MR (2008) Molecular targets for diagnostics and therapeutics of severe acute respiratory syndrome (SARS-CoV). J Pharm Pharm Sci 11(2):1s. https://doi.org/ 10.18433/J3J019 Breban R, Riou J, Fontanet A (2013) Interhuman transmissibility of Middle East respiratory syndrome coronavirus: estimation of pandemic risk. Lancet (London, England) 382(9893): 694. https://doi.org/10.1016/S0140-6736(13)61492-0 Brown EG, Tetro JA (2003) Comparative analysis of the SARS coronavirus genome: a good start to a long journey. Lancet (London, England) 361(9371):1756–1757. https://doi.org/10.1016/ S0140-6736(03)13444-7 Buchholz UJ, Bukreyev A, Yang L, Lamirande EW, Murphy BR, Subbarao K, Collins PL (2004) Contributions of the structural proteins of severe respiratory syndrome coronavirus to protective immunity. Proc Natl Acad Sci U S A 101(26):9804–9809. https://doi.org/10.1073/PNAS. 0403492101 Bukreyev A, Lamirande E, Buchholz U et al (2004) Mucosal immunisation of African green monkeys (Cercopithecus aethiops) with an attenuated parainfluenza virus expressing the SARS coronavirus spike protein for the prevention of SARS. Lancet 363:2122–2127. https:// www.sciencedirect.com/science/article/pii/S014067360416501X. Accessed 21 July 2022 Cagliani R, Forni D, Clerici M, Sironi M (2020) Computational inference of selection underlying the evolution of the novel coronavirus, severe acute respiratory syndrome coronavirus 2. Am Soc Microbiol 94(12) https://doi.org/10.1128/JVI.00411-20 CDC, Ncird (2004) Supplement F: laboratory guidance—appendix F5—laboratory biosafety guidelines for handling and processing specimens associated with SARS-CoV. www.cdc.gov/ od/ohs/biosfty/bmbl4/bmbl4s3.htm. Accessed 25 July 2022 Chang CK, Hou MH, Chang CF, Hsiao CD, Huang TH (2014) The SARS coronavirus nucleocapsid protein—forms and functions. Antivir Res 103(1):39. https://doi.org/10.1016/J.ANTIVIRAL. 2013.12.009 Channappanavar R, Fett C, Zhao J, Meyerholz DK, Perlman S (2014) Virus-specific memory CD8 T cells provide substantial protection from lethal severe acute respiratory syndrome coronavirus infection. J Virol 88(19):11034–11044 Channappanavar R, Fett C, Mack M, Ten Eyck PP, Meyerholz DK, Perlman S (2017) Sex-based differences in susceptibility to SARS-CoV infection. J Immunol (Baltimore, MD 1950) 198(10): 4046. https://doi.org/10.4049/JIMMUNOL.1601896 Chan-Yeung M, Xu R (2003) SARS: epidemiology. Respirology 8:S9–S14. https://doi.org/10. 1046/J.1440-1843.2003.00518.X Chau TN, Lee KC, Yao H, Tsang TY, Chow TC, Yeung YC, Choi KW, Tso YK, Lau T, Lai ST, Lai CL (2004) SARS-associated viral hepatitis caused by a novel coronavirus: report of three cases. Hepatology 39(2):302–310. https://doi.org/10.1002/HEP.20111 Chen J, Lau YF, Lamirande EW, Paddock CD, Bartlett JH, Zaki SR, Subbarao K (2010) Cellular immune responses to severe acute respiratory syndrome coronavirus (SARS-CoV) infection in senescent BALB/c mice: CD4+ T cells are important in control of SARS-CoV infection. J Virol 84(3):1289–1301 Cheng VCC, Lau SKP, Woo PCY, Kwok YY (2007) Severe acute respiratory syndrome coronavirus as an agent of emerging and reemerging infection. Clin Microbiol Rev 20(4):660. https://doi. org/10.1128/CMR.00023-07 Cherry JD, Krogstad P (2004) SARS: the first pandemic of the 21st century. Pediatr Res 56(1):1–5. https://doi.org/10.1203/01.pdr.0000129184.87042.fc Cheung CY, Poon LLM, Ng IHY, Luk W, Sia S-F, Wu MHS, Chan K-H, Yuen K-Y, Gordon S, Guan Y, Peiris JSM (2005) Cytokine responses in severe acute respiratory syndrome

180

P. S. Akshay et al.

coronavirus-infected macrophages in vitro: possible relevance to pathogenesis. J Virol 79(12): 7819–7826. https://doi.org/10.1128/JVI.79.12.7819-7826.2005 Christian MD, Poutanen SM, Loutfy MR, Muller MP, Low DE (2004) Severe acute respiratory syndrome. Clin Infect Dis 38(10):1420–1427. https://doi.org/10.1086/420743 Chu CM, Cheng CC, Hung FN, Wong MML, Chan H, Chan S, Kao YT, Poon LLM, Wong LP, Guan Y, Peiris JSM, Yuen Y, Yuen KY (2004) Role of lopinavir/ritonavir in the treatment of SARS: initial virological and clinical findings. Thorax 59:252–256. https://doi.org/10.1136/ thorax.2003.012658 Chung YS, Kim JM, Kim HM, Park KR, Lee A, Lee NJ, Kim MS, Kim JS, Kim CK, Lee JI, Kang C (2019) Genetic characterization of middle east respiratory syndrome coronavirus, South Korea, 2018. Emerg Infect Dis 25(5):958–962. https://doi.org/10.3201/EID2505.181534 Cinatl J, Morgenstern B, Bauer G, Chandra P, Rabenau H, Doerr HW (2003a) Glycyrrhizin, an active component of liquorice roots, and replication of SARS-associated coronavirus. Lancet 361(9374):2045–2046. https://doi.org/10.1016/S0140-6736(03)13615-X Cinatl J, Morgenstern B, Bauer G, Chandra P, Rabenau H, Doerr HW (2003b) Treatment of SARS with human interferons. Lancet 362(9380):293–294. https://doi.org/10.1016/S0140-6736(03) 13973-6 Cui J, Li F, Shi Z-L (2019) Origin and evolution of pathogenic coronaviruses. Nat Rev Microbiol 17:181–192. https://doi.org/10.1038/s41579-018-0118-9 De Wit E, Van Doremalen N, Falzarano D, Munster VJ (2016) SARS and MERS: recent insights into emerging coronaviruses. Nat Rev Microbiol 14(8):523–534. https://doi.org/10.1038/ nrmicro.2016.81 DeDiego ML, Álvarez E, Almazán F, Rejas MT, Lamirande E, Roberts A, Shieh W-J, Zaki SR, Subbarao K, Enjuanes L (2007) A severe acute respiratory syndrome coronavirus that lacks the e gene is attenuated in vitro and in vivo. J Virol 81(4):1701–1713. https://doi.org/10.1128/JVI. 01467-06 Der Li Y, Chi WY, Su JH, Ferrall L, Hung CF, Wu TC (2020) Coronavirus vaccine development: from SARS and MERS to COVID-19. J Biomed Sci 27(1):1–23. https://doi.org/10.1186/ S12929-020-00695-2 Dhama K, Patel SK, Sharun K, Pathak M, Tiwari R, Yatoo MI, Malik YS, Sah R, Rabaan AA, Panwar PK, Singh KP, Michalak I, Chaicumpa W, Martinez-Pulgarin DF, Bonilla-Aldana DK, Rodriguez-Morales AJ (2020) SARS-CoV-2 jumping the species barrier: Zoonotic lessons from SARS, MERS and recent advances to combat this pandemic virus. Travel Med Infect Dis 37: 101830. https://doi.org/10.1016/J.TMAID.2020.101830 Ding Y, He L, Zhang Q, Huang Z, Che X, Hou J, Wang H, Shen H, Qiu L, Li Z, Geng J, Cai J, Han H, Li X, Kang W, Weng D, Liang P, Jiang S (2004) Organ distribution of severe acute respiratory syndrome (SARS) associated coronavirus (SARS-CoV) in SARS patients: implications for pathogenesis virus transmission pathways. J Pathol 203(2):622–630. https:// doi.org/10.1002/PATH.1560 Du L, Zhao G, Li L, He Y, Zhou Y, Zheng BJ, Jiang S (2009) Antigenicity and immunogenicity of SARS-CoV S protein receptor-binding domain stably expressed in CHO cells. Biochem Biophys Res Commun 384(4):486–490 Enjuanes L, Almazán F, Sola I, Zuñiga S (2006) Biochemical aspects of coronavirus replication and virus-host interaction. Annu Rev Microbiol 60:211–230. https://doi.org/10.1146/ANNUREV. MICRO.60.080805.142157 Fan Y, Zhao K, Shi ZL, Zhou P (2019) Bat coronaviruses in China. Viruses 11(3). https://doi.org/ 10.3390/V11030210 Fehr AR, Perlman S (2015) Coronaviruses: an overview of their replication and pathogenesis. Coronaviruses 1282:1. https://doi.org/10.1007/978-1-4939-2438-7_1 Forster P, Forster L, Renfrew C, Forster M (2020) Phylogenetic network analysis of SARS-CoV2 genomes. Proc Natl Acad Sci U S A 117(17):9241–9243. https://doi.org/10.1073/PNAS. 2004999117/SUPPL_FILE/PNAS.2004999117.SD01.XLSX

5

Severe Acute Respiratory Syndrome Associated Corona Virus [SARS-CoV]

181

Fouchier RAM, Kuiken T, Schutten M, Van Amerongen G, Van Doornum GJJ, Van Den Hoogen BG, Peiris M, Lim W, Stöhr K, Osterhaus ADME (2003) Koch’s postulates fulfilled for SARS virus. Nature 423(6937):240–240 Ge XY, Li JL, Yang XL, Chmura AA, Zhu G, Epstein JH, Mazet JK, Hu B, Zhang W, Peng C, Zhang YJ, Luo CM, Tan B, Wang N, Zhu Y, Crameri G, Zhang SY, Wang LF, Daszak P, Shi ZL (2013) Isolation and characterization of a bat SARS-like coronavirus that uses the ACE-2 receptor. Nature 503(7477):535–538. https://doi.org/10.1038/NATURE12711 Graham RL, Donaldson EF, Baric RS (2013) A decade after SARS: strategies for controlling emerging coronaviruses. Nat Rev Microbiol 11(12):836–848. https://doi.org/10.1038/ nrmicro3143 Greenberg SB (2016) Update on human rhinovirus and coronavirus infections. Semin Respir Crit Care Med 37:555–571. https://doi.org/10.1055/s-0036-1584797 Gu J, Korteweg C (2007) Pathology and pathogenesis of severe acute respiratory syndrome. Am J Pathol 170(4):1136. https://doi.org/10.2353/AJPATH.2007.061088 Gu J, Gong E, Zhang B, Zheng J, Gao Z, Zhong Y et al (2005) Multiple organ infection and the pathogenesis of SARS. J Exp Med 202(3):415–424 Gupte M, Thatcher SE, Boustany-Kari CM, Shoemaker R, Yiannikouris F, Zhang X, Karounos M, Cassis LA (2012) Angiotensin converting enzyme 2 contributes to sex differences in the development of obesity hypertension in C57BL/6 mice. Arterioscler Thromb Vasc Biol 32(6): 1392–1399. https://doi.org/10.1161/ATVBAHA.112.248559 Ha F, John A, Zumwalt M (2021) Gender/sex, race/ethnicity, similarities/differences among SARSCoV, MERS-CoV, and COVID-19 patients. Southwest Respir Crit Care Chronicles 9(37):9–23. https://doi.org/10.12746/SWRCCC.V9I37.795 Hamming I, Timens W, Bulthuis MLC, Lely AT, Navis GJ, van Goor H (2004) Tissue distribution of ACE-2 protein, the functional receptor for SARS coronavirus. A first step in understanding SARS pathogenesis. J Pathol 203(2):631–637. https://doi.org/10.1002/PATH.1570 Han YJ, Lee KH, Yoon S, Nam SW, Ryu S, Seong D, Kim JS, Lee JY, Yang JW, Lee J, Koyanagi A, Hong SH, Dragioti E, Radua J, Smith L, Oh H, Ghayda RA, Kronbichler A, Effenberger M et al (2021) Treatment of severe acute respiratory syndrome (SARS), Middle East respiratory syndrome (MERS), and coronavirus disease 2019 (COVID-19): a systematic review of in vitro, in vivo, and clinical trials. Theranostics 11(3):1207–1231. https://doi.org/10. 7150/THNO.48342 He Y, Zhou Y, Siddiqui P, Niu J, Jiang S (2005) Identification of immunodominant epitopes on the membrane protein of the severe acute respiratory syndrome-associated coronavirus. J Clin Microbiol 43(8):3718–3726 He L, Ding Y, Zhang Q, Che X, He Y, Shen H, Wang H, Li Z, Zhao L, Geng J, Deng Y, Yang L, Li J, Cai J, Qiu L, Wen K, Xu X, Jiang S (2006) Expression of elevated levels of pro-inflammatory cytokines in SARS-CoV-infected ACE-2+ cells in SARS patients: Relation to the acute lung injury and pathogenesis of SARS. J Pathol 210(3):288–297. https://doi.org/10. 1002/PATH.2067 Heymann DL (2005) Chapter 2: SARS: A Global Perspective. Severe acute respiratory syndrome: a clinical guide, 286. file://C:/Users/blanca/Downloads/ Severe_Acute_Respiratory_Syndrome_A_Clinical_Guide_----_(2. _SARS_A_Global_Perspective).pdf Hofmann H, Pöhlmann S (2004) Cellular entry of the SARS coronavirus. Trends Microbiol 12(10): 466–472. https://doi.org/10.1016/J.TIM.2004.08.008 Hu B, Zeng LP, Yang XL, Ge XY, Zhang W, Li B, Xie JZ, Shen XR, Zhang YZ, Wang N, Luo DS, Zheng XS, Wang MN, Daszak P, Wang LF, Cui J, Shi ZL (2017) Discovery of a rich gene pool of bat SARS-related coronaviruses provides new insights into the origin of SARS coronavirus. PLoS Pathog 13(11). https://doi.org/10.1371/JOURNAL.PPAT.1006698 Hui DSC, Sung JJY (2003) Severe acute respiratory syndrome. Chest 124(1):12. https://doi.org/10. 1378/CHEST.124.1.12

182

P. S. Akshay et al.

Hui DSC, Wong PC, Wang C (2003) SARS: clinical features and diagnosis. Respirology 8:S20– S24. https://doi.org/10.1046/J.1440-1843.2003.00520.X Hui DS, Memish ZA, Zumla A (2014) Severe acute respiratory syndrome vs. The Middle East respiratory syndrome. Curr Opin Pulm Med 20(3):233–241. https://doi.org/10.1097/MCP. 0000000000000046 Ip WE, Chan KH, Law HK, Tso GH, Kong EK, Wong WH et al (2005) Mannose-binding lectin in severe acute respiratory syndrome coronavirus infection. J Infect Dis 191(10):1697–1704 Jiang S, He Y, Liu S (2005) SARS vaccine development. Emerg Infect Dis 11(7):1016. https://doi. org/10.3201/EID1107.050219 Keyaerts E, Vijgen L, Maes P, Neyts J, Van Ranst M (2004) In vitro inhibition of severe acute respiratory syndrome coronavirus by chloroquine. Biochem Biophys Res Commun 323(1):264. https://doi.org/10.1016/J.BBRC.2004.08.085 Khan AS, Tshioko FK, Heymann DL, Le Guenno B, Nabeth P, Kerstiëns B, Fleerackers Y, Kilmarx PH, Rodier GR, Nkuku O, Rollin PE, Sanchez A, Zaki SR, Swanepoel R, Tomori O, Nichol ST, Peters CJ, Muyembe-Tamfum JJ, Ksiazek TG (1999) The reemergence of Ebola hemorrhagic fever, Democratic Republic of the Congo, 1995. Commission de Lutte contre les Epidémies à Kikwit. J Infect Dis 179(Suppl 1). https://doi.org/10.1086/514306 Ksiazek TG, Erdman D, Goldsmith CS, Zaki SR, Peret T, Emery S, Tong S, Urbani C, Comer JA, Lim W, Rollin PE, Dowell SF, Ling A-E, Humphrey CD, Shieh W-J, Guarner J, Paddock CD, Rota P, Fields B et al (2003) A novel coronavirus associated with severe acute respiratory syndrome. N Engl J Med 348(20):1953–1966. https://doi.org/10.1056/NEJMOA030781 Kuiken T, Fouchier R, Lancet MS-T et al (2003) Newly discovered coronavirus as the primary cause of severe acute respiratory syndrome. Lancet 362:263–270. https://www.sciencedirect. com/science/article/pii/S0140673603139670. Accessed 21 July 2022 Lai ST (2005) Treatment of severe acute respiratory syndrome. Eur J Clin Microbiol Infect Dis 24(9):583. https://doi.org/10.1007/S10096-005-0004-Z Lakadamyali M, Rust MJ, Zhuang X (2004) Endocytosis of influenza viruses. Microbes Infect 6(10):929–936. https://doi.org/10.1016/J.MICINF.2004.05.002 Lam WK, Zhong NS, Tan WC (2003) Overview on SARS in Asia and the World. Respirology (Carlton, Vic) 8(Suppl 1):S2. https://doi.org/10.1046/J.1440-1843.2003.00516.X Lau SKP, Li KSM, Huang Y, Shek C-T, Tse H, Wang M, Choi GKY, Xu H, Lam CSF, Guo R, Chan K-H, Zheng B-J, Woo PCY, Yuen K-Y (2010) Ecoepidemiology and complete genome comparison of different strains of severe acute respiratory syndrome-related rhinolophus bat coronavirus in china reveal bats as a reservoir for acute, self-limiting infection that allows recombination events. J Virol 84(6):2808–2819. https://doi.org/10.1128/JVI.02219-09 Lau SKP, Li KSM, Tsang AKL, Lam CSF, Ahmed S, Chen H, Chan K-H, Woo PCY, Yuen K-Y (2013) Genetic characterization of betacoronavirus lineage C viruses in bats reveals marked sequence divergence in the spike protein of pipistrellus bat coronavirus HKU5 in Japanese pipistrelle: implications for the origin of the novel Middle East respiratory syndrome coronavirus. J Virol 87(15):8638–8650. https://doi.org/10.1128/JVI.01055-13 Law HK, Cheung CY, Ng HY, Sia SF, Chan YO, Luk W et al (2005) Chemokine up-regulation in SARS-coronavirus–infected, monocyte-derived human dendritic cells. Blood 106(7): 2366–2374 Leong HN, Ang B, Earnest A, Teoh C, Xu W, Leo YS (2004) Investigational use of ribavirin in the treatment of severe acute respiratory syndrome, Singapore, 2003. Trop Med Int Health 9(8): 923–927. https://doi.org/10.1111/J.1365-3156.2004.01281.X Leung DTM, Chi Hang TF, Chun Hung M, Sheung Chan PK, Cheung JLK, Niu H et al (2004) Antibody response of patients with severe acute respiratory syndrome (SARS) targets the viral nucleocapsid. J Infect Dis 190(2):379–386 Li F (2016) Structure, function, and evolution of coronavirus spike proteins. Annu Rev Virol 3: 237–261. https://doi.org/10.1146/ANNUREV-VIROLOGY-110615-042301 Li AM, Ng PC (2005) Severe acute respiratory syndrome (SARS) in neonates and children. Arch Dis Child Fetal Neonatal Ed 90(6):F461–F465. https://doi.org/10.1136/ADC.2005.075309

5

Severe Acute Respiratory Syndrome Associated Corona Virus [SARS-CoV]

183

Li CKF, Xu X (2010) Host immune responses to SARS coronavirus in humans. Mol Biol SARSCoronavirus 259–278. https://doi.org/10.1007/978-3-642-03683-5_16/FIGURES/1_16 Li W, Shi Z, Yu M, Ren W, Smith C, Epstein JH, Wang H, Crameri G, Hu Z, Zhang H, Zhang J, McEachern J, Field H, Daszak P, Eaton BT, Zhang S, Wang LF (2005a) Bats are natural reservoirs of SARS-like coronaviruses. Science 310(5748):676–679. https://doi.org/10.1126/ SCIENCE.1118391 Li Y, Duan S, Yu ITS, Wong TW (2005b) Multi-zone modeling of probable SARS virus transmission by airflow between flats in Block E, Amoy Gardens. Indoor Air 15(2):96–111. https://doi. org/10.1111/J.1600-0668.2004.00318.X Li T, Xie J, He Y, Fan H, Baril L, Qiu Z, Han Y, Xu W, Zhang W, You H, Zuo Y, Fang Q, Yu J, Chen Z, Zhang L (2006) Long-term persistence of robust antibody and cytotoxic T cell responses in recovered patients infected with SARS coronavirus. PLoS One 1(1):e24. https:// doi.org/10.1371/JOURNAL.PONE.0000024 Liang L (2015) Infectious atypical pneumonia. Radiol Infect Dis 1:415–450. https://doi.org/10. 1007/978-94-017-9882-2_20/FIGURES/38 Lin Y, Shen X, Yang RF, Li YX, Ji YY, He YY et al (2003) Identification of an epitope of SARScoronavirus nucleocapsid protein. Cell Res 13(3):141–145 Liu W, Fontanet A, Zhang PH, Zhan L, Xin ZT, Baril L et al (2006) Two-year prospective study of the humoral immune response of patients with severe acute respiratory syndrome. J Infect Dis 193(6):792–795 Liu J, Wu P, Gao F, Qi J, Kawana-Tachikawa A, Xie J et al (2010) Novel immunodominant peptide presentation strategy: a featured HLA-A* 2402-restricted cytotoxic T-lymphocyte epitope stabilized by intrachain hydrogen bonds from severe acute respiratory syndrome coronavirus nucleocapsid protein. J Virol 84(22):11849–11857 Liu DX, Liang JQ, Fung TS (2021) Human coronavirus-229E,-OC43,-NL63, and-HKU1 (Coronaviridae). Encyclopedia Virol:428–440. https://doi.org/10.1016/B978-0-12-809633-8. 21501-X Loutfy MR, Blatt LM, Siminovitch KA, Ward S, Wolff B, Lho H, Pham DH, Deif H, LaMere EA, Chang M, Kain KC, Farcas GA, Ferguson P, Latchford M, Levy G, Dennis JW, Lai EKY, Fish EN (2003) Interferon Alfacon-1 plus corticosteroids in severe acute respiratory syndrome: a preliminary study. JAMA 290(24):3222–3228. https://doi.org/10.1001/JAMA.290.24.3222 Lu G, Wang Q, Gao GF (2015) Bat-to-human: spike features determining ‘host jump’of coronaviruses SARS-CoV, MERS-CoV, and beyond. Trends Microbiol 23(8):468–478 Luo C-M, Wang N, Yang X-L, Liu H-Z, Zhang W, Li B, Hu B, Peng C, Geng Q-B, Zhu G-J, Li F, Shi Z-L (2018) Discovery of novel bat coronaviruses in south china that use the same receptor as middle east respiratory syndrome coronavirus. J Virol 92(13). https://doi.org/10.1128/JVI. 00116-18 Malhotra A (2007) Low-tidal-volume ventilation in the acute respiratory distress syndrome. N Engl J Med 357:1113–1120 Mann R, Perisetti A, Gajendran M, Gandhi Z, Umapathy C, Goyal H (2020) Clinical characteristics, diagnosis, and treatment of major coronavirus outbreaks. Front Med 7:766. https://doi.org/10. 3389/FMED.2020.581521/BIBTEX Marra MA, Jones SJM, Astell CR, Holt RA, Brooks-Wilson A, Butterfield YSN, Khattra J, Asano JK, Barber SA, Chan SY, Cloutier A, Coughlin SM, Freeman D, Girn N, Griffith OL, Leach SR, Mayo M, McDonald H, Montgomery SB et al (2003) The Genome sequence of the SARS-associated coronavirus. Science (New York, NY) 300(5624):1399–1404. https://doi. org/10.1126/SCIENCE.1085953 Martina B, Haagmans B, Kuiken T (2003) SARS virus infection of cats and ferrets. Nature 425:915. Accessed https://www.nature.com/articles/425915a?ref=blog&ref=blog&ref=blog. 21 July 2022 Masters PS, Perlman (2013) Coronaviridae. In: Knipe DM, Howley PM (eds) Fields biology, vol 2. Lippincott Williams & Wilkins, pp 825–858. https://www.umassmed.edu/globalassets/

184

P. S. Akshay et al.

ambros-lab/meetings/rna-biology-club-2019_20/masters-and-perlman-2013-in-fieldsvirology_1.pdf McBride R, Fielding BC (2012) The Role of Severe Acute Respiratory Syndrome (SARS)coronavirus accessory proteins in virus pathogenesis. Viruses 4(11):2902. https://doi.org/10. 3390/V4112902 Medzhitov R, Janeway CJ (2000) Innate immunity. N Engl J Med 343(5):338–344. https://doi.org/ 10.1056/NEJM200008033430506 Memish Z, Mishra N, Olival K et al (2013) Middle East respiratory syndrome coronavirus in bats, Saudi Arabia. Emerg Infect Dis 19:1819–1823. https://www.ncbi.nlm.nih.gov/pmc/articles/ PMC3837665/. Accessed 6 July 2022 Menachery V, Yount B, Debbink K (2015) A SARS-like cluster of circulating bat coronaviruses shows potential for human emergence. Nat Med. https://www.nature.com/articles/nm.3985? fbcldi=lwAROiTTfDIT-uxNFPtvQHxFrF6QaF1hKE1Ey2TPrEi17XfFUIbpUIAosDc. Accessed 6 July 2022 Menachery VD, Yount BL, Sims AC, Debbink K, Agnihothram SS, Gralinski LE, Graham RL, Scobey T, Plante JA, Royal SR, Swanstrom J, Sheahan TP, Pickles RJ, Corti D, Randell SH, Lanzavecchia A, Marasco WA, Baric RS (2016) SARS-like WIV1-CoV poised for human emergence. Proc Natl Acad Sci U S A 113(11):3048–3053. https://doi.org/10.1073/PNAS. 1517719113 Ng EKO, Hui DS, Chan KCA, Hung ECW, Chiu RWK, Lee N, Wu A, Chim SSC, Tong YK, Sung JJY, Tam JS, Lo YMD (2003) Quantitative analysis and prognostic implication of SARS coronavirus RNA in the plasma and serum of patients with severe acute respiratory syndrome. Clin Chem 49(12):1976–1980. https://doi.org/10.1373/CLINCHEM.2003.024125 Ng OW, Chia A, Tan AT, Jadi RS, Leong HN, Bertoletti A, Tan YJ (2016) Memory T cell responses targeting the SARS coronavirus persist up to 11 years post-infection. Vaccine 34(17):2008–2014. https://doi.org/10.1016/J.VACCINE.2016.02.063 Olsen SJ, Chang H-L, Cheung TY-Y, Tang AF-Y, Fisk TL, Ooi SP-L, Kuo H-W, Jiang DD-S, Chen K-T, Lando J, Hsu K-H, Chen T-J, Dowell SF (2003) Transmission of the severe acute respiratory syndrome on aircraft. New Engl J Med 349(25):2416–2422. https://doi.org/10.1056/ NEJMOA031349 Park BJ, Peck AJ, Kuehnert MJ, Newbern C, Smelser C, Comer JA, Jernigan D, Mcdonald LC (2004) Lack of SARS transmission among healthcare workers, United States. Emerg Infect Dis 10(2):217–224. www.cdc.gov/eid Peiris M (2005) Severe acute respiratory syndrome. pp 263. https://books.google.com/books/about/ Severe_Acute_Respiratory_Syndrome.html?id=WgJDONxLz8MC Peiris JSM, Poon LLM (2008) Severe acute respiratory syndrome (SARS). Encyclopedia Virol 552. https://doi.org/10.1016/B978-012374410-4.00780-9 Peiris JSM, Yuen KY, Osterhaus ADME, Stöhr K (2003) The severe acute respiratory syndrome. N Engl J Med 349(25):2431–2441. https://doi.org/10.1056/NEJMRA032498 Perlman S, Netland J (2009) Coronaviruses post-SARS: update on replication and pathogenesis. Nat Rev Microbiol 7(6):439. https://doi.org/10.1038/NRMICRO2147 Petersen E, Koopmans M, Go U, Hamer DH, Petrosillo N, Castelli F, Storgaard M, Al Khalili S, Simonsen L (2020) Comparing SARS-CoV-2 with SARS-CoV and influenza pandemics. Lancet Infect Dis 20(9):e238. https://doi.org/10.1016/S1473-3099(20)30484-9 Poon L, Guan Y, Nicholls J et al (2004) The aetiology, origins, and diagnosis of severe acute respiratory syndrome. Lancet Infect Dis 4:663–671. https://www.sciencedirect.com/science/ article/pii/S1473309904011727. Accessed 7 July 2022 Ravelomanantsoa NAF, Guth S, Andrianiaina A, Andry S, Gentles A, Ranaivoson HC, Brook CE (2020) The zoonotic potential of bat-borne coronaviruses. Emerg Top Life Sci 4(4):365–381. https://doi.org/10.1042/ETLS20200097 Rowe T, Gao G, Hogan RJ, Crystal RG, Voss TG, Grant RL, Bell P, Kobinger GP, Wivel NA, Wilson JM (2004) Macaque model for severe acute respiratory syndrome. J Virol 78(20): 11401–11404. https://doi.org/10.1128/JVI.78.20.11401-11404.2004

5

Severe Acute Respiratory Syndrome Associated Corona Virus [SARS-CoV]

185

Salzberger B, Buder F, Lampl B, Ehrenstein B, Hitzenbichler F, Holzmann T, Schmidt B, Hanses F (2021) Epidemiology of SARS-CoV-2. Infection 49(2):233–239. https://doi.org/10.1007/ S15010-020-01531-3 Sheng WH, Chiang BL, Chang SC, Ho HN, Wang JT, Chen YC et al (2005) Clinical manifestations and inflammatory cytokine responses in patients with severe acute respiratory syndrome. J Formos Med Assoc 104(10):715–723 NP Shetty, & SP Shetty (2009). Epidemiology of disease in the tropics. Manson’s Trop Dis, 19–34. doi: https://doi.org/10.1016/B978-1-4160-4470-3.50007-0 Silva MTT, Lima M, Araujo AQC (2020) SARS-CoV-2: should we be concerned about the nervous system? Am J Trop Med Hyg 103(3):993–998. https://doi.org/10.4269/AJTMH.20-0447 So RCH, Ko J, Yuan YWY, Lam JJ, Louie L (2004) Severe acute respiratory syndrome and sport facts and fallacies. Sports Med 34(15):1023–1033 Song Z, Xu Y, Bao L, Zhang L, Yu P, Qu Y, Zhu H, Zhao W, Han Y, Qin C (2019) From SARS to MERS, thrusting coronaviruses into the spotlight. Viruses 11(1). https://doi.org/10.3390/ V11010059 Stockman LJ, Bellamy R, Garner P (2006) SARS: systematic review of treatment effects. PLoS Med 3(9):1525–1531. https://doi.org/10.1371/JOURNAL.PMED.0030343 Stöhr K (2003) A multicentre collaboration to investigate the cause of severe acute respiratory syndrome. Lancet (London, England) 361(9370):1730–1733. https://doi.org/10.1016/S01406736(03)13376-4 Su S, Wong G, Shi W, Liu J, Lai ACK, Zhou J, Liu W, Bi Y, Gao GF (2016) Epidemiology, genetic recombination, and pathogenesis of coronaviruses. Trends Microbiol 24(6):490–502. https:// doi.org/10.1016/J.TIM.2016.03.003 Subbarao K, McAuliffe J, Vogel L, Fahle G, Fischer S, Tatti K, Packard M, Shieh W-J, Zaki S, Murphy B (2004) Prior infection and passive transfer of neutralizing antibody prevent replication of severe acute respiratory syndrome coronavirus in the respiratory tract of mice. J Virol 78(7):3572–3577. https://doi.org/10.1128/JVI.78.7.3572-3577.2004 Sung JY, Yuen KY (2005) Clinical presentation of the disease in adults. Severe Acute Respir Syndrome:21–29 Sung JJY, Wu A, Joynt GM, Yuen Y, Lee N, Chan PKS, Cockram CS, Ahuja AT, Yu LM, Wong VW (2004) Severe acute respiratory syndrome: report of treatment and outcome after a major outbreak. Thorax 59:414–420. https://doi.org/10.1136/thx.2003.014076 Surjit M, Liu B, Kumar P, Chow VTK, Lal SK (2004) The nucleocapsid protein of the SARS coronavirus is capable of self-association through a C-terminal 209 amino acid interaction domain. Biochem Biophys Res Commun 317(4):1030. https://doi.org/10.1016/J.BBRC.2004. 03.154 Tan Q, Jin Y (2020) Ostavimir is ineffective against COVID-19: in silico assessment, in vitro and retrospective study. MedRxiv:2020.05.15.20102392. https://doi.org/10.1101/2020.05.15. 20102392 Torres J, Maheswari U, Parthasarathy K, Ng L, Liu DX, Gong X (2007) Conductance and amantadine binding of a pore formed by a lysine-flanked transmembrane domain of SARS coronavirus envelope protein. Protein Sci 16(9):2065–2071. https://doi.org/10.1110/PS. 062730007 Totura AL, Bavari S (2019) Broad-spectrum coronavirus antiviral drug discovery. Expert Opin Drug Discovery 14(4):397–412. https://doi.org/10.1080/17460441.2019.1581171 Tseng CT, Sbrana E, Iwata-Yoshikawa N, Newman PC, Garron T, Atmar RL, Peters CJ, Couch RB (2012) Immunization with SARS coronavirus vaccines leads to pulmonary immunopathology on challenge with the SARS virus. PLoS One 7(4). https://doi.org/10.1371/JOURNAL.PONE. 0035421 Van Vonderen M, Bos J et al (2003) Ribavirin in the treatment of severe acute respiratory syndrome (SARS). Neth J Med 61:238–241. https://njmonline.nl/getpdf.php?t=a&id=25 Wang LF, Shi Z, Zhang S, Field H, Daszak P, Eaton BT (2006) Review of bats and SARS. Emerg Infect Dis 12(12):1834. https://doi.org/10.3201/EID1212.060401

186

P. S. Akshay et al.

Wang Q, Qi J, Yuan Y, Xuan Y, Han P, Wan Y et al (2014) Bat origins of MERS-CoV supported by bat coronavirus HKU4 usage of human receptor CD26. 16:328–337. https://www.sciencedirect. com/science/article/pii/S1931312814003011. Accessed 6 July 2022 Wang N, Li SY, Yang XL, Huang HM, Zhang YJ, Guo H, Luo CM, Miller M, Zhu G, Chmura AA, Hagan E, Zhou JH, Zhang YZ, Wang LF, Daszak P, Shi ZL (2018) Serological evidence of bat SARS-related coronavirus infection in humans, China. Virol Sin 33(1):104–107. https://doi.org/ 10.1007/S12250-018-0012-7 Wei L, Sun S, Xu CH, Zhang J, Xu Y, Zhu H et al (2007) Pathology of the thyroid in severe acute respiratory syndrome. Hum Pathol 38(1):95–102 Weiss SR, Leibowitz JL (2011) Coronavirus pathogenesis. Adv Virus Res 81:85–164. https://doi. org/10.1016/B978-0-12-385885-6.00009-2 Wheeler AP, Bernard GR (2007) Acute lung injury and the acute respiratory distress syndrome: a clinical review. Lancet 369(9572):1553–1564. https://doi.org/10.1016/S0140-6736(07)60604-7 Wong NA, Saier MH (2021) The SARS-coronavirus infection cycle: a survey of viral membrane proteins, their functional interactions and pathogenesis. Int J Mol Sci 22(3):1–63. https://doi. org/10.3390/IJMS22031308 Woo PC, Lau SK, Wong BH, Tsoi HW, Fung AM, Chan KH et al (2004) Detection of specific antibodies to severe acute respiratory syndrome (SARS) coronavirus nucleocapsid protein for serodiagnosis of SARS coronavirus pneumonia. J Clin Microbiol 42(5):2306–2309 Woo PCY, Lau SKP, Yip CCY, Huang Y, Yuen KY (2009) More and more coronaviruses: human coronavirus HKU1. Viruses 1(1):57–71. https://doi.org/10.3390/V1010057 World Health Organization (2006) In: World Health Organization Western Pacific Region (ed) SARS : how a global epidemic was stopped. Regional Office for the Western Pacific Xiao J, Fang M, Chen Q, He B (2020) SARS, MERS and COVID-19 among healthcare workers: a narrative review. J Infect Public Health 13(6):843–848. https://doi.org/10.1016/J.JIPH.2020. 05.019 Xu RH, He JF, Evans MR, Peng GW, Field HE, Yu DW, Lee CK, Luo HM, Lin WS, Lin P, Li LH, Liang WJ, Lin JY, Schnur A (2004) Epidemiologic clues to SARS origin in China. Emerg Infect Dis 10(6):1030. https://doi.org/10.3201/EID1006.030852 Xu J, Qi L, Chi X, Yang J, Wei X, Gong E et al (2006) Orchitis: a complication of severe acute respiratory syndrome (SARS). Biol Reprod 74(2):410–416 Xudong X, Junzhu C, Xingxiang W, Furong Z, Yanrong L (2006) Age- and gender-related difference of ACE-2 expression in rat lung. Life Sci 78(19):2166. https://doi.org/10.1016/J. LFS.2005.09.038 Yadav T, Saxena SK (2020) Transmission cycle of SARS-CoV and SARS-CoV-2. Coronavirus Dis 2019 (COVID-19):33–42. https://doi.org/10.1007/978-981-15-4814-7_4 Yang S, Rothman RE (2004) PCR-based diagnostics for infectious diseases: uses, limitations, and future applications in acute-care settings. Lancet Infect Dis 4(6):337. https://doi.org/10.1016/ S1473-3099(04)01044-8 Yang YH, Huang YH, Chuang YH, Peng CM, Wang LC, Lin YT, Chiang BL (2005a) Autoantibodies against human epithelial cells and endothelial cells after severe acute respiratory syndrome (SARS)-associated coronavirus infection. J Med Virol 77(1):1–7. https://doi.org/10. 1002/JMV.20407 Yang Y, Xiong Z, Zhang S, Yan Y, Nguyen J, Ng B et al (2005b) Bcl-xL inhibits T-cell apoptosis induced by expression of SARS coronavirus E protein in the absence of growth factors. Biochem J 392(1):135–143 Yang L, Wu Z, Ren X, Yang F et al (2014a) MERS–related betacoronavirus in Vespertilio superans bats, China. Emerg Infect Dis 20:1260–1262. https://www.ncbi.nlm.nih.gov/pmc/articles/ PMC4073873/. Accessed 6 July 2022 Yang Y, Du L, Liu C, Wang L, Ma C, Tang J, Baric RS, Jiang S, Li F (2014b) Receptor usage and cell entry of bat coronavirus HKU4 provide insight into bat-to-human transmission of MERS coronavirus. Proc Natl Acad Sci U S A 111(34):12516–12521. https://doi.org/10.1073/PNAS. 1405889111

5

Severe Acute Respiratory Syndrome Associated Corona Virus [SARS-CoV]

187

Yang X-L, Hu B, Wang B, Wang M-N, Zhang Q, Zhang W, Wu L-J, Ge X-Y, Zhang Y-Z, Daszak P, Wang L-F, Shi Z-L (2016) Isolation and characterization of a novel bat coronavirus closely related to the direct progenitor of severe acute respiratory syndrome coronavirus. J Virol 90(6):3253–3256. https://doi.org/10.1128/JVI.02582-15 Yu ITS, Li Y, Wong TW, Tam W, Chan AT, Lee JHW, Leung DYC, Ho T (2004) Evidence of airborne transmission of the severe acute respiratory syndrome virus. N Engl J Med 350(17): 1731–1739. https://doi.org/10.1056/nejmoa032867 Zeng L, Ge X, Peng C, Tai W, Jiang S et al (2017) Cross-neutralization of SARS coronavirusspecific antibodies against bat SARS-like coronaviruses. Sci China Life Sci 60(12):1399–1402. https://doi.org/10.1007/s11427-017-9189-3 Zeng ZQ, Chen DH, Tan WP, Qiu SY, Xu D, Liang HX, Chen MX, Li X, Lin ZS, Liu WK, Zhou R (2018) Epidemiology and clinical characteristics of human coronaviruses OC43, 229E, NL63, and HKU1: a study of hospitalized children with acute respiratory tract infection in Guangzhou, China. Eur J Clin Microbiol Infect Dis 37(2):363–369. https://doi.org/10.1007/S10096-0173144-Z Zhao G-P (2019) SARS molecular epidemiology: a Chinese fairy tale of controlling an emerging zoonotic disease in the genomics era. doi: https://doi.org/10.1098/rstb.2007.2034 Zhao J, Zhao J, Perlman S (2010) T cell responses are required for protection from clinical disease and for virus clearance in severe acute respiratory syndrome coronavirus-infected mice. J Virol 84(18):9318–9325 Zhong N (2004) Management and prevention of SARS in China. Philos Trans R Soc Lond B Biol Sci 359(1447):1115–1116. https://doi.org/10.1098/RSTB.2004.1491 Zhong NS, Zheng BJ, Li YM, Poon LLM, Xie ZH, Chan KH, Li PH, Tan SY, Chang Q, Xie JP, Liu XQ, Xu J, Li DX, Yuen KY, Peiris JSM, Guan Y (2003) Epidemiology and cause of severe acute respiratory syndrome (SARS) in Guangdong, People’s Republic of China, in February, 2003. Lancet 362(9393):1353–1358. https://doi.org/10.1016/S0140-6736(03)14630-2 Zizza, A., Recchia, V., Aloisi, A., & Guido, M. (2021). Clinical features of COVID-19 and SARS epidemics. A literature review. J Prevent Med Hyg, 62(1), E13–E13. doi: 10.15167/2421-4248/ JPMH2021.62.1.1680

6

Middle East Respiratory Syndrome Coronavirus (MERS-CoV) Aishwarya Bhatta, Sunanda Sahoo, Korra Bhanu Teja, and Shilpa J. Tomar

Abstract

Ten years after the severe SARS-CoV outbreak in 2002, another lethal coronavirus outbreak was reported in Middle Eastern countries. Based on the epidemiology and pathogenesis, this coronavirus species was named Middle East respiratory syndrome coronavirus (MERS-CoV) and was proposed to have a zoonotic origin. The most alarming cases of human-to-human transmission of MERS-CoV were observed in clinical settings, i.e., from patients to healthcare professionals. Notably, MERS-CoV causes severe acute respiratory tract infections similar to SARS-CoV; however, the mortality rates associated with MERS are much higher. This can be attributed to the distinctive immune response generated on infection with this virus. The clinical manifestation of MERS in patients can range from no symptoms to mild or severe symptoms, thereby making it difficult to diagnose and treat. Despite having comparatively low transmissibility, MERS-COV has spread to many countries, including South Korea and the United States. The virus can rapidly evolve and thus holds the potential of starting another epidemic. This chapter comprehensively illustrates the epidemiology, structural organization, and pathophysiology of MERS-CoV and the relevant detection methods for its effective clinical diagnosis. It also provides insight into the current disease management strategies and the therapeutic measures adopted to combat the future emerging threats of MERS-CoV.

A. Bhatta Indian Institute of Technology, Delhi, India S. Sahoo Indian Institute of Technology, Kharagpur, West Bengal, India K. B. Teja · S. J. Tomar (✉) ICMR-Hepatitis Division, ICMR-National Institute of Virology, Pune, India # The Author(s), under exclusive license to Springer Nature Singapore Pte Ltd. 2023 P. L. Bhukya et al. (eds.), Emerging Human Viral Diseases, Volume I, https://doi.org/10.1007/978-981-99-2820-0_6

189

190

A. Bhatta et al.

Keywords

MERS-CoV · SARS-CoV · Zoonotic · Epidemic · Coronaviruses · Bat viruses

6.1

Introduction

Coronaviruses have a long history of causing respiratory infections in humans. However, they were not a major public concern until 2003, when the SARS-CoV outbreak occurred, causing a global crisis. In 2012, after almost 10 years since the devastating SARS-CoV outbreak, a novel coronavirus called MERS-CoV emerged in the Arabian Peninsula. Since then, over 2600 cases of MERS-CoV infection and 858 known deaths have been documented in 27 countries, including Saudi Arabia. MERS-CoV infects the lower respiratory tract, similar to SARS-CoV, resulting in acute respiratory distress syndrome (ARDS), septic shock, and multiple organ failure. Although the virus has low transmissibility, the case fatality rate (CFR) of MERS-CoV is reported to be around 35%, which is the highest among all coronaviruses (Zhang et al. 2021). Several studies have established that MERSCoV spreads to humans as a result of direct contact with infected monotropic camels (dromedaries) or their bodily fluids. In most of the reported MERS-CoV cases, patients either have an immediate history of travel to the Arabian Peninsula or direct or indirect contact with camels. Notably, the role played by camels as intermediate reservoirs of MERS-CoV is crucial and has been confirmed by several serological studies (Reusken et al. 2013). The human-to-human transmission of the virus is via infectious droplets (respiratory route) and prolonged close contact, majorly observed in healthcare settings. Molecular epidemiology markers link MERS-CoV to bats; however, there are no reports of direct transmission of the virus from infected bats to humans (Alfaraj et al. 2019). MERS-CoV is a lineage C betacoronavirus belonging to the Coronaviridae family, whose members are known to survive in unfavorable environmental conditions by forming aerosols (van Boheemen et al. 2012; van Doremalen et al. 2013). This attribute of the virus highly strengthens its potential to cause an outbreak or epidemic.

6.2

History and Discovery

In September 2012, Dr. Ali Mohamed Zaki reportedly isolated the novel betacoronavirus from the sputum sample of a patient in Jeddah, Saudi Arabia. The virus isolate was further sent for confirmation to Erasmus Medical Center, Rotterdam, Netherlands (WHO: Probe into Deadly Coronavirus Delayed by Sample Dispute | CTV News, n.d.). To identify the viral strain, a pan-coronavirus RT-PCR assay was performed that produced fragments of the desired length, screening positive for a coronavirus. Further characterization of the viral genome was performed using a combination of random amplification, deep sequencing, and Sanger sequencing approaches. The virus displayed cytopathic effects in Vero and

6

Middle East Respiratory Syndrome Coronavirus (MERS-CoV)

191

LLC-MK2 cell lines in the laboratory and the cell supernatant was used for genomic characterization (van Boheemen et al., 2012). Initially, the various isolates of MERS-CoV were given different names, such as HCoV-EMC, human betacoronavirus 2c England-Qatar, human beta coronavirus 2c Jordan-N3, betacoronavirus England 1, etc., which seemed to create confusion. This issue of non-uniformity in the virus nomenclature was addressed by the Coronavirus Study Group (CSG) of the International Committee on Taxonomy of Viruses (ICTV). The CSG recommended the name Middle East Coronavirus (MERS-CoV), which has since been used for formal and informal communications to signify this new genus (de Groot et al., 2013). MERS-CoV was first identified as a novel strain of coronavirus using RT-PCR and genome sequencing techniques. Since then, many diagnostic tools and technologies have emerged, but RT-PCR remains the gold standard test for the diagnosis and confirmation of MERS-CoV (van Boheemen et al., 2012). Currently, no licensed vaccine or specific medication is at our disposal to treat MERS-CoV infection; hence, awareness and prevention are our most reliable weapons in this battle.

6.3

Epidemiology

The first laboratory-confirmed case of MERS-CoV in humans was reported in a 60-year-old male in Jeddah, Saudi Arabia, in June 2012. The patient presented with acute pneumonia and subsequently developed acute respiratory distress syndrome (ARDS) and multiple organ dysfunction syndrome (MODS), which resulted in respiratory and renal failure (Zaki et al., 2012). Retrospectively, it was found that in April 2012, several pneumonia cases of unknown etiology occurred in a hospital’s healthcare unit in Zarqa, Jordan. On analyzing the stored samples of the patients, it was confirmed that they had been infected with the same strain of novel coronavirus. These were the earliest known cases of MERS-CoV infection confirmed with RT-PCR (Communicable Disease Threats Report, 29 April–5 May 2012, Week 1 8, 2012). Soon after, another case of a patient who had tested MERS-CoV positive after traveling to the Middle East was documented in London and confirmed by the United Kingdom Health Protection Agency (HPA) (HPA—Acute Respiratory Illness Associated with a New Virus Identified in the UK, 2014). Subsequently, several new cases of virus transmission due to travel were reported from Tunisia, France, Germany, Italy, and Korea. To aid a better understanding of the disease prevalence, the data corresponding to MERS-CoV infection and death cases are distributed over age, sex, and location. The available epidemiological data suggests that MERS-CoV is strongly associated with the Middle East, and most of the cases reported in other countries could be traced back to the Arabian Peninsula (Fig. 6.1). Till March 2022, a total of 2589 MERS cases have been confirmed by laboratories, out of which 893 were the reported fatalities, resulting in a case fatality rate (CFR) of 34.5%. Among the reported cases, around 84% of the MERS-CoV cases were reported from Saudi Arabia. Three areas, including Eastern Province, Riyadh, and Makkah, were gravely

192

A. Bhatta et al.

Fig. 6.1 Country-wise distribution of MERS-CoV cases reported between June 2012 and January 2020 (CSR, n.d.). Image created using MapChart

affected in Saudi Arabia, where the virus is primarily transmitted. As per the World Health Organization, such a high mortality rate could be an overestimation, as mild cases of MERS tend to go unnoticed in the initial years of surveillance . Saudi Arabia, South Korea, and the UAE are the top countries where the maximum number of MERS cases have been recorded. The proportion of male deaths has been reported to be greater than female deaths, irrespective of the geographical location. This data may correlate with the fact that men have much more frequent contact with dromedaries than women. Among both the genders, the age bracket of 50–59 years is at the most risk of acquiring virus infection as primary cases, whereas the age group of 30–39 years usually presents secondary cases, i.e., cases of interhuman transmission (WHO_MERS_RA_15.1_eng.pdf, n.d.). MERSCoV infection cases also show season-based variation and peak in the spring, with seasonal prevalence in the months of April and May (Al-Ahmadi et al., 2019). Comparing the occupation-related risk based on the data from Saudi Arabia and South Korea, about 16% of the infected population comprises healthcare workers (HCWs) (Mackay and Arden, 2015).

6.4

Potential Risk of Emergence and Re-emergence

In a span of 20 years, from 2002 to 2022, the world has already experienced three catastrophic coronavirus outbreaks, causing great havoc due to their unpredictable occurrence at random geographical locations. Based on the mortality rate, potential to cause an epidemic, and available medical interventions, the World Health Organization (WHO) listed MERS-CoV as a category C priority pathogen (Al-Ahmadi et al., 2019). MERS-CoV outbreaks are prevalent to date despite major scientific advances and a rise in public awareness.

6

Middle East Respiratory Syndrome Coronavirus (MERS-CoV)

193

The recent MERS-CoV outbreak in the Republic of Korea is a strong reminder that the virus has high emergence potential even outside Saudi Arabia (Cowling et al., 2015). MERS-CoV, similar to other coronaviruses, is an RNA virus that can undergo rapid evolution and hence poses an ongoing and continuous threat to global human health (van Boheemen et al., 2012). Analyzing the risk factors associated with MERS CoV outbreaks will help us prepare better for the next viral outbreak. Studies from the previous outbreaks have established that there are several drivers of virus emergence and reemergence. MERS-CoV has RNA as genetic material, which is susceptible to error-prone replication and rapid mutation (Fehr and Perlman, 2015). Also, MERS-CoV spreads via the respiratory route through droplets and can survive and multiply in harsh conditions. These characteristics help the virus evolve rapidly, thrive in an unfavorable environment, and cause severe outbreaks. Other than the viral factors, several other humanly, environmental, and ecological factors influence the emergence and re-emergence of the viral pathogen. As MERSCoV has a zoonotic origin and is known to circulate in bats and camels, the role of animal-human interactions in the virus’s re-emergence is crucial. An active disease surveillance system for wild and domestic animals can minimize the risk of virus spillovers to humans. Moreover, global efforts are required to legislate strong laws against the illegal trade of animals. Several other determinants, such as migration and urbanization, health care system, and ecological factors, contribute to the reemergence of viral pathogens (Cowling et al. 2015; Emerging and Re-emerging Viral Diseases: The Case of Coronavirus Disease-19, n.d.). To prevent and contain the spread of MERS-CoV, it is essential to identify, study, and analyze all these contributing factors.

6.5

Structural and Molecular Organization of MERS-CoV

6.5.1

Taxonomy and Classification

The MERS-CoV belongs to the betacoronavirus lineage 2c subgroup. It is a member of the Coronavirinae subfamily of the Coronaviridae family, classified under the order Nidovirales. MERS-CoV is the first known human-infecting lineage C betacoronavirus. The detailed taxonomic classification of the Middle East Respiratory Syndrome Coronavirus (MERS-CoV) is provided in Table 6.1 (Taxonomy, n. d.): MERS is an enzootic disease, and it is transmitted to humans from animals. The initial moniker given to the etiologic agent of MERS was Human Coronavirus— Erasmus Medical Center (hCoV-EMC), as its identity was first established through sequencing at Erasmus Medical Center in Rotterdam, Netherlands (WHO: Probe into Deadly Coronavirus Delayed by Sample Dispute | CTV News, n.d.). The viral pathogen was evidenced to be first transmitted to humans from camels (Memish et al., 2014). It shares many genetic similarities to the bat coronaviruses HKU4 and HKU5; hence, it is suspected to have originated from bats (Cotten et al., 2013). Earlier, the various isolates of the viral pathogen were denoted by a variety of names,

194

A. Bhatta et al.

Table 6.1 MERS-CoV classification into taxonomic categories

Realm Kingdom Phylum Class Order Sub-order Family Sub-family Genus Sub-genus

Riboviria Orthornavirae Pisuviricota Pisoniviricetes Nidovirales Cornidovirineae Coronaviridae Coronavirinae Betacoronavirus Merbecovirus

Fig. 6.2 Two-dimensional representation of MERS-CoV virion. Image created using BioRender

with the novel coronavirus (nCoV) being the most commonly used name (de Groot et al., 2013). Finally, the International Committee on Taxonomy of Viruses (ICTV) agreed on the name MERS-CoV and classified it as a species under lineage C betacoronavirus in the family Coronaviridae of the order Nidovirales (Taxonomy, n.d.).

6.6

Morphology and Virion Structure

As a member of the Coronaviridae family, MERS-CoV has an enveloped helical capsid structure with a + ve sense ss RNA genome. The whole virion envelope diameter is approximately 125 nm (Fehr and Perlman, 2015). The virion structure (Fig. 6.2) comprises a helically symmetrical nucleocapsid encapsulated by envelope protein with club-shaped spikes on its surface, as seen by negative stain electron microscopy (CDC, 2019b).

6

Middle East Respiratory Syndrome Coronavirus (MERS-CoV)

6.6.1

195

Genome Structure and Organization

MERS-CoV carries a polycistronic positive-strand RNA, which is approximately 30 kb in length. Three-fourths of the genome’s 5′ proximal end is occupied by the two replicase open reading frames ORF1a and ORF1b. These ORFs are translated to form the polyproteins pp1a and pp1ab, which are then cleaved into 16 nonstructural proteins (NSP 1–16) (Gorbalenya et al., 2006; Ziebuhr et al., 2000). Towards the downstream of these ORFs, the structural genes, i.e., spike (S), envelope (E), membrane (M), and nucleocapsid (N), are arranged interspaced by some other ORFs. Typically, the genome of MERS-CoV is organized as 5′-UTR-ORF1ab (translated into ORF1a and ORF1b), S, ORF3, ORF4 (a and b), E, ORF5, E, M, N, ORF8b-UTR-Poly A-3′, as shown in Fig. 6.3 (Ba Abduallah and Hemida, 2020). The position of nonstructural proteins (NSP 1–16), structural proteins (S, E, M, and N), and accessory proteins (ORF 3, ORF 4a, ORF 4b, ORF 5, and ORF 8b) in the genome of MERS CoV is tabulated below (Table 6.2).

6.6.2

Viral Proteins and Life Cycle

The MERS-CoV genome encodes 4 structural proteins and 16 nonstructural proteins. The size and function of the proteins are discussed below.

6.6.2.1 Spike Protein (S) Similar to other coronaviruses, MERS-CoV also contains spike proteins on its surface, which are oligomers of the 180–200 kDa S glycoprotein. The spike protein generally helps in virus binding to the receptor protein, fusion of cells, and the entry of the pathogen into the host. The S glycoprotein, which is a type I membrane glycoprotein, has a globular S1 domain at the N-terminus, a membrane-proximal S2 domain, and a transmembrane (TM) domain (Masters-and-perlman-2013-in-fieldsvirology_1.pdf, n.d.). The receptor binding domain (RBD) is found in the S1 subunit, whereas the primary membrane fusion unit is found in the S2 subunit and is composed of the heptad repeats H1 and H2 (Xia et al., 2014). S1 and S2 proteins are typically present on the viral surface as a trimeric structure. During viral fusion, two repeat sections in S2, HR1 and HR2, heptad in structure, form a 6-helix bundle (6-HB) fusion core, revealing a hydrophobic fusion peptide that is injected into the

Fig. 6.3 Schematic representation of the MERS-CoV genome. Image created using BioRender

196 Table 6.2 The position of structural and nonstructural genes in MERS-CoV genome

A. Bhatta et al.

Coding genes ORF 1ab

S gene ORF 3 ORF 4a ORF 4b ORF 5 E gene M gene N gene ORF 8a

NSP1 NSP2 NSP3 NSP4 NSP5 NSP6 NSP7 NSP8 NSP9 NSP10 NSP11 NSP12 NSP13 NSP14 NSP15 NSP16

Position in the genome (base) 279 to 857 858 to 2837 2838 to 8498 8499 to 10,019 10,020 to 10,937 10,938 to 11,813 11,814 to 12,062 12,063 to 12,659 12,660 to 12,989 12,990 to 13,409 13,410 to 13,451 13,410 to 16,207 16,208 to 18,001 18,002 to 19,573 19,574 to 20,602 20,603 to 21,511 21,456 to 25,517 25,532 to 25,843 25,852 to 26,181 26,093 to 26,833 26,840 to 27,514 27,590 to 27,838 27,853 to 28,512 28,566 to 29,807 28,762 to 29,100

host membrane. This brings the viral and host membranes in close contact and facilitates fusion (Du et al., 2017).

6.6.2.2 Envelope Protein (E) The envelope (E) protein is a tiny structural protein of MERS-CoV that is only 82 amino acids long and has, at the minimum, one putative transmembrane helix. CoV E protein is required in viral assembly, intracellular trafficking, and viral budding (Surya et al., 2015). It is predicted to have ion channel activity; however, its precise role during infection is unknown. 6.6.2.3 Membrane Protein (M) The usual length of a membrane protein is 219 amino acids. By associating with the nucleocapsid (N) protein, the membrane (M) protein of MERS-CoV aids in the viral assembly process, which includes the formation of the viral core and envelope (Liu et al., 2010).

6

Middle East Respiratory Syndrome Coronavirus (MERS-CoV)

197

6.6.2.4 Nucleocapsid (N) The nucleocapsid (N) protein of MERS-CoV is a large 46 kDa, phosphorylated protein composed of 413 amino acid residues. The nucleocapsid is formed by the binding of N protein to the RNA and is required for viral assembly, genome replication, and post-translational modification (Lin et al., 2017). 6.6.2.4.1 Accessory Proteins (APs) MERS-CoV contains a vast array of genes that encode a wide range of accessory proteins (dORF: ORF3, ORF4a, ORF4b, and ORF5). Even between coronaviruses of the same group, there is a difference in the quantity and sequence of these proteins, resulting in host shift and hCoV development (Forni et al., 2017). Multiple mechanisms, such as antagonizing IFN and altering protein kinase R (PKR) and NF kappa B pathway, can be used by accessory proteins to elicit a hostile response (Millet and Whittaker, 2015; Rabouw et al., 2016; Yang et al., 2013). 6.6.2.4.2 Nonstructural Proteins (NSPs) ORF1a and ORF1b, found at the 5′-terminus of the CoV genome, encode polyproteins 1a and 1ab, which are further sliced into 16 nonstructural proteins. These NSPs are important drug targets as they are involved in viral replication and transcription (Zumla et al., 2016).

6.7

MERS-CoV Life Cycle

MERS-CoV gains entry into the host cell by using the spike protein to bind with the host DPP4 receptor, which is the common receptor for lineage C betacoronaviruses. The viral genome is released into the host cytoplasm following membrane fusion. The translation of ORF 1a and ORF 1b of the MERS-CoV genome results in pp1a and pp1ab proteins. Subsequently, these proteins undergo co-translational and posttranslational processing by viral proteases like PLpro and Mpro to form nonstructural proteins. The NSPs form replication-transcription complexes (RTCs), which are connected to endoplasmic reticulum-derived double-membrane vesicles (DMVs). The genomic RNA of MERS CoV has transcription regulatory sequences (TRS), which are essentially adenylate uridylate (AU)-rich sequences. During RNA synthesis, subgenomic RNA (sgRNA) is synthesized for transcription if TRSs are recognized by RTCs; otherwise, full-length template RNA is prepared for replication. The nucleocapsid (N) proteins in the cytoplasm encapsulate the newly synthesized genomic RNAs, which are then transported to the ER-Golgi intermediate compartment (ERGIC) for assembly. The spike (S), membrane (M), and envelope (E) proteins move through the rough ER (RER) membrane and are transported to the ERGIC, where they join the N proteins and get assembled into viral particles. Mature budded vesicles from the Golgi bodies carry the mature virus particles and transport them to the cell surface for membrane fusion and viral release (Durai et al., 2015) (Fig. 6.4).

198

A. Bhatta et al.

Fig. 6.4 A diagrammatic representation of the life cycle of MERS-CoV. Image created using BioRender

6.8

MERS CoV Pathogenesis

6.8.1

Host Viral Interaction

A series of interactions happen between the virus and host cell components on the molecular level. To enter cells, MERS-CoV binds to a large ectopeptidase called dipeptidyl peptidase 4 (DPP4). Although DPP4 is not prevalent in the nasal cavity and upper airway, it is abundantly expressed in distal airway epithelial cells, pneumocytes in the lung alveoli, non-ciliated bronchial epithelial cells, endothelial cells, and certain hemopoietic cells (Raj et al., 2013). MERS-CoV takes entry into the host cells by attaching its S protein to the DPP4 receptor on the host cell (Yuan et al., 2017). The receptor binding region of the S1 subunit interacts with the host cellular receptor DPP4. Contrarily, the S2 subunit has two sections, heptad repeats

6

Middle East Respiratory Syndrome Coronavirus (MERS-CoV)

199

1 and 2 (HR1 and HR2), which rearrange to form a hexa-helical bundle to allow membrane fusion. The viral membranes also have E and M proteins, which play a role in viral assembly, budding, and intracellular trafficking (Memish et al., 2020). Several viral components, including viral proteins and nucleic acids, are generated inside the host cell and interact with the host cell components in various phases of the virus life cycle.

6.8.2

Host Immune Response

In the acute phase of MERS CoV infection, most patients with severe or moderate disease have substantial virus-specific CD8 T-cell responses, while other adaptive immune responses develop later in the disease course (Shin et al., 2019). MERSCoV infects activated human T cells and macrophages and causes a delay in cytokine responses, which hampers virus clearance and efficient immune response generation (Lau et al., 2013; Zhou et al., 2014). Clinical observations made over a period of 2 years indicate that pathogen-specific antibody responses were temporary and lower in patients with mild symptoms of MERS compared to the individuals who had severe symptoms (Drosten et al., 2014; Zhao et al., 2017).

6.8.3

Virulence

MERS-CoV has a high affinity for bronchial non-ciliated epithelial cells. The viral pathogen inhibits host bronchial IFN synthesis (Coleman et al., 2014). Most of the adaptive actions in this course are mediated by NSP3, which decreases the IFN response by de-esterification and deubiquitination (Báez-Santos et al., 2015). Other than NSP3, NSP16 also helps the virus in evading cellular innate immune responses by inhibiting viral translation using the IFN-induced protein with tetratricopeptide repeats 1 (IFIT-1) (Menachery et al., 2014). CoV NSP1 is also a key virulence factor as it effectively degrades the targeted mRNA of the host. Studies have also shown that the mRNA degradation activity of MERS-CoV NSP1 is distinct from its translational inhibitory effect (Terada et al., 2017).

6.9

Clinical Manifestations

MERS-CoV incubation period is reported to be 5.2 days, which is more than that of SARS-CoV. The first stage of the clinical sickness is vague, with a temperature and a moderate, nonproductive cough that lasts several days. Acute kidney injury (AKI) is a distinctive complication associated with MERS. In severe cases, progressive pneumonia is followed by multiorgan failure and death. The case fatality risk (CFR) is exceptionally high and ranges from 30% to 60% (Al-Tawfiq and Memish, 2015; Assiri et al., 2013).

200

6.9.1

A. Bhatta et al.

Clinical Symptoms

The pathogenicity of MERS-CoV varies depending on the host. It has the greatest pathogenic potential of all coronaviruses, particularly in human beings. MERS-CoV infection has an extensive range of clinical manifestations, ranging from no symptoms (~80% of cases) to a flu-like illness, pneumonia, and acute respiratory distress syndrome (ARDS) (Mohd et al., 2016). The initial symptoms include fever, chills, breathlessness, headache, a nonproductive cough, sore throat, muscle pain, and cramping (Alfaraj et al., 2019; Drosten et al., 2013). Coryza, nausea, vomiting, vertigo, diarrhea, and pneumonia are also common symptoms (Memish et al., 2020). In extreme cases, the virus also affects the kidneys and liver of the patient (Arabi et al., 2014).

6.9.2

Laboratory Diagnosis

Although multiple techniques have been employed for the diagnosis of MERS-CoV, the molecular approach remains the best available choice. Molecular techniques are frequently used for detecting active infections due to their high sensitivity and specificity (CDC, 2019a). Various laboratory tests available for MERS-CoV diagnosis are described below.

6.9.2.1 Molecular Assays Among the various types of molecular techniques, two commonly performed assays, namely RT-PCR and RT-LAMP, are discussed below. 6.9.2.1.1 Real-Time Polymerase Chain Reaction (RT-PCR) Assay Targeting upE and ORF 1b Genes

RT-PCR assays are the gold standard tests for the detection of viral load. Two different targets are currently accepted for MERS-CoV detection using RT-PCR (Corman et al., 2012). The target region can either be upstream of the E gene (upE) or within the Open Reading Frame 1b (ORF 1b). The upE targeting RT-PCR is used for screening of MERS-CoV, whereas the ORF 1b targeting RT-PCR is reserved for the confirmational test. Targeting MERS-CoV Nucleocapsid Gene

Due to the relatively high amount of N gene sub-genomic mRNA produced during virus replication, real-time reverse transcriptase polymerase chain reaction (rRT-PCR) tests targeting the MERS-CoV N gene provide greater diagnostic sensitivity. To improve sensitivity for specimen screening, three regions, N1, N2, and N3, of the N gene are selected. N2 assay is coupled with upE testing for virus detection, while the N3 assay is used for positive test confirmation (Lu et al., 2014).

6

Middle East Respiratory Syndrome Coronavirus (MERS-CoV)

201

6.9.2.1.2 Reverse Transcription Loop-Mediated Isothermal Amplification (RT-LAMP) The RT-LAMP assay is used to detect amplicons by visualizing magnesium pyrophosphate precipitate or fluorescence signals with the naked eye and without the use of any specialized instruments (Nagamine et al., 2002; Notomi et al., 2000). RT-LAMP assay requires at least six different sequences (F1, F2, F3, B3, B2, and B1) that are targeted by at least four distinct primer sets. Two loop primers (LF and LB) are utilized to improve amplification. For MERS-CoV detection, F3, B3, FIP (F1c + F2), BIP (B1c + B2), LF, and LB are used as primers, which improve amplification sensitivity (Shirato et al., 2014). The MERS-CoV RT-LAMP assay may detect as few as 3.4 copies of MERS-CoV RNA and is highly selective, with no cross-reaction with other respiratory viruses.

6.9.2.2 Serological Tests There are mainly three conditions under which laboratories might want to perform MERS-CoV serological testing: Case 1: Defining a sporadic MERS-CoV case for reporting purposes under the International Health Regulations (IHR) in the rare cases where a Nucleic Acid Amplification Test (NAAT) is not an option Case 2: Investigation of an ongoing outbreak Case 3: Serological surveys, including retrospective assessments of outbreaks (WHO-MERS-LAB-15.1-Rev1-2018-eng.pdf, n.d.) Serological tests are mostly performed to confirm past infection; hence, they are useful in epidemiological serosurvey studies (CDC, 2019a). There are several types of serological assays proposed for the detection of MERS-CoV. The most accepted and commonly available serological tests are ELISA and IFA-based assays. 6.9.2.2.1 Enzyme-Linked Immunosorbent Assay (ELISA) Antigen capture ELISA can provide good sensitivity and specificity for MERS-CoV diagnosis even in the early phase of the disease. The antigen capture ELISA, also known as the sandwich ELISA, employs a capture or primary and a detection or secondary antibody. In this assay, the nucleocapsid protein (NP) is chosen as the target for producing antibodies to detect MERS-CoV. If the sample contains MERSCoV peptides (particularly nucleocapsid protein), it will bind to the coated antibody and be arrested on the microtiter plate. Even tiny amounts of the viral peptide can be trapped in the well if the capture antibody is coated at a high concentration. The non-bound proteins are washed away prior to the addition of the second antibody. The secondary monoclonal antibody (mAb) identifies and binds to a different epitope of the MERS-CoV NP and is coupled with the horseradish peroxidase enzyme for detection. The use of two mAbs in an ELISA makes the assay highly sensitive for MERS-CoV NP (Fung et al., 2019).

202

A. Bhatta et al.

6.9.2.2.2 Immunofluorescent Assay (IFA) In comparison to EIA, IFA gives additional information for result interpretation through signal localization within cells. The false-positive response is therefore avoided. 6.9.2.2.3 Rapid Immunochromatographic Assay (RIA) Rapid immunochromatographic assays are designed for quick and simple disease diagnosis in dromedary camels. This technique relies on highly specific monoclonal antibodies to identify the MERS-CoV nucleocapsid protein (Song et al., 2015).

6.10

Diagnostics and Therapeutics

The clinical manifestations of MERS-CoV might range extensively from one case to another. The affected patients may present symptoms of respiratory illness such as dyspnea, cough, and fever or remain asymptomatic despite being infected (Arabi et al., 2017). Radiological tests like chest X-ray and computed tomography (CT) scans generally report pneumonia and ground-glass opacities but are not conclusive for MERS-CoV (Widagdo et al., 2017). Among the molecular diagnostic techniques, q RT-PCR (real-time reverse transcriptase-PCR) is the primary and gold standard test for detecting MERS-CoV in the acute phase of infection by virtue of its high specificity and sensitivity. Based on the official guidelines for MERS-CoV detection, RT-qPCR targets two different regions: an upstream region of the envelope gene (upE; the first line screening) and another region within the open reading frame (ORF)1a, along with sequencing of either the nucleocapsid (N) gene or the RNA-dependent RNA polymerase (RdRP) gene for infection confirmation (CDC, 2019a). However, RT-PCR has a long turnaround time (TAT) and requires trained technicians and an advanced lab setup. Hence, it becomes quite difficult to perform an RT-PCR test in less developed countries having poor infrastructure, fragile healthcare systems, and limited resources. Over the last decade, significant advancements have been achieved in medical technology to facilitate the quick, simple, and cost-effective detection of viral pathogens. In particular, the convergence of nanotechnology and biotechnology has led to the development of modern diagnostic tools such as nanosensors and rapid diagnostic assays. These modern technologies are widely used in developed and underdeveloped countries for the timely and inexpensive detection of MERSCoV. Rapid diagnostic tools designed on the principle of RT-PCR aid in the early detection of MERS-CoV and are more convenient to use. Biosensors are low-cost analytical device that offers a variety of advantages over RT-PCR. They facilitate point-of care-testing (POCT) and have played a significant role in detecting the recent cases of MERS-CoV outbreaks. However, the currently available biosensors are less sensitive and specific than RT-PCR. Other than biosensors, several serologybased immunodiagnostic tests such as ELISA, IFA, and neutralization assays are readily used for the qualitative determination of MERS-CoV antigen and antibody (Ezhilan et al., 2021). But these tests are not confirmatory as they have lower

6

Middle East Respiratory Syndrome Coronavirus (MERS-CoV)

203

sensitivity and higher chances of cross-reactivity. The antibody tests for MERS-CoV are mostly used for retrospective diagnosis, whereas RT-PCR remains the gold standard to date. From a therapeutic point of view, there is a desperate need for effective vaccines against MERS-CoV. The vaccines developed so far have not reached the clinical trial stage, and additionally, there is no specific antiviral agent against MERS-CoV. Thus, supportive treatment is given, and broad-spectrum antibiotics, antivirals, and antifungal agents may be used alone or in combination to prevent secondary infection in the patients (Sharif-Yakan and Kanj, 2014).

6.11

Prevention and Control

The WHO in 2004 issued guidelines for the prevention of the re-emergence of novel coronavirus strains. The guidelines included developing modern diagnostic tools, establishing national contingency plans, preparing global and national risk assessment matrices, promoting scientific discoveries, and supporting international collaborations. However, MERS-CoV infection continues to occur and spread at a global level (Docea et al., 2020). To prevent the transmission of this deadly virus, it is crucial to aggressively follow the standard infection control procedures and protocols. At present, identification and isolation of suspects, contact tracing, and creating awareness of health and hygiene practices are the basic control measures against MERS-CoV. Additionally, disease surveillance in camels at the epicenters helps limit the cross-transmission of the virus. Though there is no vaccine for humans, camels can be vaccinated to avoid secondary transmission of MERSCoV. Since no therapeutics or vaccines are available for MERS-CoV, adopting prophylactic strategies is our best line of defense against the virus. The high-risk groups, i.e., immunocompromised patients, children, older people with comorbidities, etc., should avoid any sort of direct or indirect contact with camels. It has been scientifically proven that early diagnosis, mandatory quarantine, and proper use and disposal of personal protective equipment (PPE) reduce the risk of virus transmission during the early stages of the outbreak (Baharoon and Memish, 2019). MERS-CoV outbreaks have necessitated the availability of accurate diagnostic tools and therapeutic measures. Hospitals and healthcare centers are hotspots for the transmission of MERS-CoV, so it must be ensured that such places are furnished with rapid diagnostic tools, and other resources such as PPE kits and well-trained staff are fairly recruited (Madani et al., 2014). It is important to learn from our past experiences and adopt these essential precautionary measures to avert the spread of MERS-CoV.

6.12

Future Perspective

Regardless of the scientific progress made since the emergence of MERS-CoV, several questions concerning the pathogenesis and treatment options remain unanswered. Identifying the viral and host determinants is the first step toward developing

204

A. Bhatta et al.

effective therapeutics and vaccines against MERS. Moreover, awareness must be created among common people as well as physicians regarding the preventive measures and symptoms of MERS-CoV. Active measures such as regular surveillance and contact tracing should be taken to identify asymptomatic cases. To prevent future outbreaks, it is essential to continuously monitor the circulating MERS-CoV strains for novel mutations. Recent studies have examined the possible therapeutic role of convalescent plasma, monoclonal antibodies, intravenous immunoglobulin (IVIG), antimicrobial peptides, and repurposing of existing drugs (Hansda et al., 2022; Mustafa et al., 2018). Nevertheless, larger clinical trials are required to prove their potential as an anti-MERS-CoV modality. New diagnostic tools are being developed; however, they require a larger number of samples for validation. Considering the epidemic potential of MERS-CoV, we should aim for better healthcare infrastructure, public health monitoring facilities, surveillance, and research and development in the near future.

References Al-Ahmadi K, Alahmadi S, Al-Zahrani A (2019) Spatiotemporal clustering of Middle East respiratory syndrome coronavirus (MERS-CoV) incidence in Saudi Arabia, 2012–2019. Int J Environ Res Public Health 16(14):2520. https://doi.org/10.3390/ijerph16142520 Alfaraj SH, Al-Tawfiq JA, Assiri AY, Alzahrani NA, Alanazi AA, Memish ZA (2019) Clinical predictors of mortality of Middle East respiratory syndrome coronavirus (MERS-CoV) infection: a cohort study. Travel Med Infect Dis 29:48–50. https://doi.org/10.1016/j.tmaid.2019. 03.004 Al-Tawfiq JA, Memish ZA (2015) Managing MERS-CoV in the healthcare setting. Hosp Pract 43(3):158–163. https://doi.org/10.1080/21548331.2015.1074029 Arabi YM, Arifi AA, Balkhy HH, Najm H, Aldawood AS, Ghabashi A, Hawa H, Alothman A, Khaldi A, Al Raiy B (2014) Clinical course and outcomes of critically ill patients with Middle East respiratory syndrome coronavirus infection. Ann Intern Med 160(6):389–397. https://doi. org/10.7326/M13-2486 Arabi YM, Balkhy HH, Hayden FG, Bouchama A, Luke T, Baillie JK, Al-Omari A, Hajeer AH, Senga M, Denison MR, Nguyen-Van-Tam JS, Shindo N, Bermingham A, Chappell JD, Van Kerkhove MD, Fowler RA (2017) Middle East respiratory syndrome. N Engl J Med 376(6): 584–594. https://doi.org/10.1056/NEJMsr1408795 Assiri A, Al-Tawfiq JA, Al-Rabeeah AA, Al-Rabiah FA, Al-Hajjar S, Al-Barrak A, Flemban H, Al-Nassir WN, Balkhy HH, Al-Hakeem RF, Makhdoom HQ, Zumla AI, Memish ZA (2013) Epidemiological, demographic, and clinical characteristics of 47 cases of Middle East respiratory syndrome coronavirus disease from Saudi Arabia: a descriptive study. Lancet Infect Dis 13(9):752–761. https://doi.org/10.1016/S1473-3099(13)70204-4 Ba Abduallah MM, Hemida MG (2020) Comparative analysis of the genome structure and organization of the Middle East respiratory syndrome coronavirus (MERS-CoV) 2012 to 2019 revealing evidence for virus strain barcoding, zoonotic transmission, and selection pressure. Rev Med Virol 31:e2150. https://doi.org/10.1002/rmv.2150 Báez-Santos YM, St. John SE, Mesecar AD (2015) The SARS-coronavirus papain-like protease: structure, function and inhibition by designed antiviral compounds. Antivir Res 115:21–38. https://doi.org/10.1016/j.antiviral.2014.12.015 Baharoon S, Memish ZA (2019) MERS-CoV as an emerging respiratory illness: A review of prevention methods. Travel Med Infect Dis 32:101520. https://doi.org/10.1016/j.tmaid.2019. 101520

6

Middle East Respiratory Syndrome Coronavirus (MERS-CoV)

205

van Boheemen S, de Graaf M, Lauber C, Bestebroer TM, Raj VS, Zaki AM, Osterhaus ADME, Haagmans BL, Gorbalenya AE, Snijder EJ, Fouchier RAM (2012) Genomic characterization of a newly discovered coronavirus associated with acute respiratory distress syndrome in humans. MBio 3(6):e00473–e00412. https://doi.org/10.1128/mBio.00473-12 CDC (2019a) Laboratory testing for MERS-CoV. Centers for Disease Control and Prevention. https://www.cdc.gov/coronavirus/mers/lab/lab-testing.html CDC (2019b) MERS-CoV photos. Centers for Disease Control and Prevention. https://www.cdc. gov/coronavirus/mers/photos.html Coleman CM, Matthews KL, Goicochea L, Frieman MB (2014) Wild-type and innate immunedeficient mice are not susceptible to the Middle East respiratory syndrome coronavirus. J Gen Virol 95(Pt 2):408–412. https://doi.org/10.1099/vir.0.060640-0 Communicable Disease Threats Report, 29 April–5 May 2012, Week 18 (2012). https://www.ecdc. europa.eu/en/publications-data/communicable-disease-threats-report-29-april-5-may-2012week-18 Corman VM, Eckerle I, Bleicker T, Zaki A, Landt O, Eschbach-Bludau M, van Boheemen S, Gopal R, Ballhause M, Bestebroer TM, Muth D, Müller MA, Drexler JF, Zambon M, Osterhaus AD, Fouchier RM, Drosten C (2012) Detection of a novel human coronavirus by real-time reverse-transcription polymerase chain reaction. Eur Secur 17(39):20285. https://doi.org/10. 2807/ese.17.39.20285-en Cotten M, Lam TT, Watson SJ, Palser AL, Petrova V, Grant P, Pybus OG, Rambaut A, Guan Y, Pillay D, Kellam P, Nastouli E (2013) Full-genome deep sequencing and phylogenetic analysis of novel human Betacoronavirus. Emerg Infect Dis 19(5):736–742. https://doi.org/10.3201/ eid1905.130057 Cowling BJ, Park M, Fang VJ, Wu P, Leung GM, Wu JT (2015) Preliminary epidemiological assessment of MERS-CoV outbreak in South Korea, May to June 2015. Euro Surveill 20(25): 7–13. https://doi.org/10.2807/1560-7917.es2015.20.25.21163 CSR (n.d.) MERS situation update, January 2020. World Health Organization—Regional Office for the Eastern Mediterranean. http://www.emro.who.int/pandemic-epidemic-diseases/mers-cov/ mers-situation-update-january-2020.html. Accessed 24 Feb 2023 Docea AO, Tsatsakis A, Albulescu D, Cristea O, Zlatian O, Vinceti M, Moschos SA, Tsoukalas D, Goumenou M, Drakoulis N, Dumanov JM, Tutelyan VA, Onischenko GG, Aschner M, Spandidos DA, Calina D (2020) A new threat from an old enemy: re-emergence of coronavirus (review). Int J Mol Med 45(6):1631–1643. https://doi.org/10.3892/ijmm.2020.4555 van Doremalen N, Bushmaker T, Munster VJ (2013) Stability of Middle East respiratory syndrome coronavirus (MERS-CoV) under different environmental conditions. Euro Surveill 18(38): 20,590. https://doi.org/10.2807/1560-7917.es2013.18.38.20590 Drosten C, Seilmaier M, Corman VM, Hartmann W, Scheible G, Sack S, Guggemos W, Kallies R et al (2013) Clinical features and virological analysis of a case of Middle East respiratory syndrome coronavirus infection. Lancet Infect Dis 13(9):745–751. https://doi.org/10.1016/ S1473-3099(13)70154-3 Drosten C, Meyer B, Müller MA, Corman VM, Al-Masri M, Hossain R, Madani H, Sieberg A, Bosch BJ, Lattwein E, Alhakeem RF, Assiri AM, Hajomar W, Albarrak AM, Al-Tawfiq JA, Zumla AI, Memish ZA (2014) Transmission of MERS-coronavirus in household contacts. N Engl J Med 371(9):828–835. https://doi.org/10.1056/NEJMoa1405858 Du L, Yang Y, Zhou Y, Lu L, Li F, Jiang S (2017) MERS-CoV spike protein: a key target for antivirals. Expert Opin Ther Targets 21(2):131–143. https://doi.org/10.1080/14728222.2017. 1271415 Durai P, Batool M, Shah M, Choi S (2015) Middle East respiratory syndrome coronavirus: transmission, virology and therapeutic targeting to aid in outbreak control. Exp Mol Med 47(8):Article 8. https://doi.org/10.1038/emm.2015.76 Emerging and Re-Emerging Viral Diseases: The Case of Coronavirus Disease-19 (n.d.). https:// journals.indexcopernicus.com/search/article?articleId=2967173. Accessed 24 Feb 2023

206

A. Bhatta et al.

Ezhilan M, Suresh I, Nesakumar N (2021) SARS-CoV, MERS-CoV and SARS-CoV-2: A diagnostic challenge. Measurement 168:108335. https://doi.org/10.1016/j.measurement.2020. 108335 Fehr AR, Perlman S (2015) Coronaviruses: an overview of their replication and pathogenesis. Methods Mol Biol (Clifton, N.J.) 1282:1–23. https://doi.org/10.1007/978-1-4939-2438-7_1 Forni D, Cagliani R, Clerici M, Sironi M (2017) Molecular evolution of human coronavirus genomes. Trends Microbiol 25(1):35–48. https://doi.org/10.1016/j.tim.2016.09.001 Fung J, Lau SKP, Woo PCY (2019) Antigen capture enzyme-linked immunosorbent assay for detecting Middle East respiratory syndrome coronavirus in humans. MERS Coronavirus 2099: 89–97. https://doi.org/10.1007/978-1-0716-0211-9_7 Gorbalenya AE, Enjuanes L, Ziebuhr J, Snijder EJ (2006) Nidovirales: evolving the largest RNA virus genome. Virus Res 117(1):17–37. https://doi.org/10.1016/j.virusres.2006.01.017 de Groot RJ, Baker SC, Baric RS, Brown CS, Drosten C, Enjuanes L, Fouchier RAM, Galiano M, Gorbalenya AE, Memish ZA, Perlman S, Poon LLM, Snijder EJ, Stephens GM, Woo PCY, Zaki AM, Zambon M, Ziebuhr J (2013) Middle East respiratory syndrome coronavirus (MERSCoV): announcement of the coronavirus study group. J Virol 87(14):7790–7792. https://doi.org/ 10.1128/JVI.01244-13 Hansda A, Biswas D, Bhatta A, Chakravorty N, Mukherjee G (2022) Plasma therapy: a passive resistance against the deadliest. Hum Vaccin Immunother 18(2):2006026. https://doi.org/10. 1080/21645515.2021.2006026 HPA—Acute Respiratory Illness Associated with a New Virus Identified in the UK (2014). https:// web.archive.org/web/20140201164125/http:/www.hpa.org.uk/NewsCentre/National PressReleases/2012PressReleases/120923acuterespiratoryillnessidentified Lau SKP, Lau CCY, Chan K-H, Li CPY, Chen H, Jin D-Y, Chan JFW, Woo PCY, Yuen K-Y (2013) Delayed induction of proinflammatory cytokines and suppression of innate antiviral response by the novel Middle East respiratory syndrome coronavirus: implications for pathogenesis and treatment. J Gen Virol 94(Pt 12):2679–2690. https://doi.org/10.1099/vir.0. 055533-0 Lin S-C, Ho C-T, Chuo W-H, Li S, Wang TT, Lin C-C (2017) Effective inhibition of MERS-CoV infection by resveratrol. BMC Infect Dis 17(1):144. https://doi.org/10.1186/s12879-017-2253-8 Liu J, Sun Y, Qi J, Chu F, Wu H, Gao F, Li T, Yan J, Gao GF (2010) The membrane protein of severe acute respiratory syndrome coronavirus acts as a dominant immunogen revealed by a clustering region of novel functionally and structurally defined cytotoxic T-lymphocyte epitopes. J Infect Dis 202(8):1171–1180. https://doi.org/10.1086/656315 Lu X, Whitaker B, Sakthivel SKK, Kamili S, Rose LE, Lowe L, Mohareb E, Elassal EM, Al-sanouri T, Haddadin A, Erdman DD (2014) Real-time reverse transcription-PCR assay panel for Middle East respiratory syndrome coronavirus. J Clin Microbiol 52(1):67–75. https://doi.org/10.1128/JCM.02533-13 Mackay IM, Arden KE (2015) MERS coronavirus: diagnostics, epidemiology and transmission. Virol J 12(1):222. https://doi.org/10.1186/s12985-015-0439-5 Madani TA, Althaqafi AO, Alraddadi BM (2014) Infection prevention and control guidelines for patients with Middle East respiratory syndrome coronavirus (MERS-CoV) infection. Saudi Med J 35(8):897–913 Masters-and-perlman-2013-in-fields-virology_1.pdf (n.d.). https://www.umassmed.edu/ globalassets/ambros-lab/meetings/rna-biology-club-2019_20/masters-and-perlman-2013-infields-virology_1.pdf. Accessed 23 Feb 2023 Memish ZA, Cotten M, Meyer B, Watson SJ, Alsahafi AJ, Al Rabeeah AA, Corman VM, Sieberg A, Makhdoom HQ, Assiri A, Al Masri M, Aldabbagh S, Bosch B-J, Beer M, Müller MA, Kellam P, Drosten C (2014) Human infection with MERS coronavirus after exposure to infected camels, Saudi Arabia, 2013. Emerg Infect Dis 20(6):1012–1015. https://doi.org/10. 3201/eid2006.140402 Memish ZA, Perlman S, Van Kerkhove MD, Zumla A (2020) Middle East respiratory syndrome. Lancet 395(10229):1063–1077. https://doi.org/10.1016/S0140-6736(19)33221-0

6

Middle East Respiratory Syndrome Coronavirus (MERS-CoV)

207

Menachery VD, Debbink K, Baric RS (2014) Coronavirus non-structural protein 16: evasion, attenuation, and possible treatments. Virus Res 194:191–199. https://doi.org/10.1016/j. virusres.2014.09.009 Millet JK, Whittaker GR (2015) Host cell proteases: critical determinants of coronavirus tropism and pathogenesis. Virus Res 202:120–134. https://doi.org/10.1016/j.virusres.2014.11.021 Mohd HA, Memish ZA, Alfaraj SH, McClish D, Altuwaijri T, Alanazi MS, Aloqiel SA, Alenzi AM, Bafaqeeh F, Mohamed AM, Aldosari K, Ghazal S (2016) Predictors of MERS-CoV infection: a large case control study of patients presenting with ILI at a MERS-CoV referral hospital in Saudi Arabia. Travel Med Infect Dis 14(5):464–470. https://doi.org/10.1016/j.tmaid. 2016.09.008 Mustafa S, Balkhy H, Gabere MN (2018) Current treatment options and the role of peptides as potential therapeutic components for Middle East respiratory syndrome (MERS): a review. J Infect Public Health 11(1):9–17. https://doi.org/10.1016/j.jiph.2017.08.009 Nagamine K, Hase T, Notomi T (2002) Accelerated reaction by loop-mediated isothermal amplification using loop primers. Mol Cell Probes 16(3):223–229. https://doi.org/10.1006/mcpr.2002. 0415 Notomi T, Okayama H, Masubuchi H, Yonekawa T, Watanabe K, Amino N, Hase T (2000) Loopmediated isothermal amplification of DNA. Nucleic Acids Res 28(12):E63. https://doi.org/10. 1093/nar/28.12.e63 Rabouw HH, Langereis MA, Knaap RCM, Dalebout TJ, Canton J, Sola I, Enjuanes L, Bredenbeek PJ, Kikkert M, de Groot RJ, van Kuppeveld FJM (2016) Middle East respiratory coronavirus accessory protein 4a inhibits PKR-mediated antiviral stress responses. PLoS Pathog 12(10): e1005982. https://doi.org/10.1371/journal.ppat.1005982 Raj VS, Mou H, Smits SL, Dekkers DHW, Müller MA, Dijkman R, Muth D, Demmers JAA, Zaki A, Fouchier RAM, Thiel V, Drosten C, Rottier PJM, Osterhaus ADME, Bosch BJ, Haagmans BL (2013) Dipeptidyl peptidase 4 is a functional receptor for the emerging human coronavirus-EMC. Nature 495(7440):Article 7440. https://doi.org/10.1038/nature12005 Reusken CBEM, Haagmans BL, Müller MA, Gutierrez C, Godeke G-J, Meyer B, Muth D et al (2013) Middle East respiratory syndrome coronavirus neutralising serum antibodies in dromedary camels: A comparative serological study. Lancet Infect Dis 13(10):859–866. https://doi. org/10.1016/S1473-3099(13)70164-6 Sharif-Yakan A, Kanj SS (2014) Emergence of MERS-CoV in the Middle East: origins, transmission, treatment, and perspectives. PLoS Pathog 10(12):e1004457. https://doi.org/10.1371/ journal.ppat.1004457 Shin H-S, Kim Y, Kim G, Lee JY, Jeong I, Joh J-S, Kim H, Chang E, Sim SY, Park J-S, Lim D-G (2019) Immune responses to Middle East respiratory syndrome coronavirus during the acute and convalescent phases of human infection. Clin Infect Dis 68(6):984–992. https://doi.org/10. 1093/cid/ciy595 Shirato K, Yano T, Senba S, Akachi S, Kobayashi T, Nishinaka T, Notomi T, Matsuyama S (2014) Detection of Middle East respiratory syndrome coronavirus using reverse transcription loopmediated isothermal amplification (RT-LAMP). Virol J 11(1):139. https://doi.org/10.1186/ 1743-422X-11-139 Song D, Ha G, Serhan W, Eltahir Y, Yusof M, Hashem F, Elsayed E, Marzoug B, Abdelazim A, Al Muhairi S (2015) Development and validation of a rapid Immunochromatographic assay for detection of Middle East respiratory syndrome coronavirus antigen in dromedary camels. J Clin Microbiol 53(4):1178–1182. https://doi.org/10.1128/JCM.03096-14 Surya W, Li Y, Verdià-Bàguena C, Aguilella VM, Torres J (2015) MERS coronavirus envelope protein has a single transmembrane domain that forms pentameric ion channels. Virus Res 201: 61–66. https://doi.org/10.1016/j.virusres.2015.02.023 Taxonomy (n.d.). https://talk.ictvonline.org/taxonomy/. Accessed 18 June 2022 Terada Y, Kawachi K, Matsuura Y, Kamitani W (2017) MERS coronavirus nsp1 participates in an efficient propagation through a specific interaction with viral RNA. Virology 511:95–105. https://doi.org/10.1016/j.virol.2017.08.026

208

A. Bhatta et al.

WHO (n.d.) Probe into deadly coronavirus delayed by sample dispute | CTV News. https://www. ctvnews.ca/health/who-probe-into-deadly-coronavirus-delayed-by-sample-dispute-1.1293405. Accessed 22 Feb 2023 WHO_MERS_RA_15.1_eng.pdf (n.d.). https://apps.who.int/iris/bitstream/handle/10665/179184/ WHO_MERS_RA_15.1_eng.pdf;jsessionid=E454DA976B928CFADA9B9F92F25444EB? sequence=2. Accessed 24 Feb 2023 WHO-MERS-LAB-15.1-Rev1-2018-eng.pdf (n.d.). https://apps.who.int/iris/bitstream/handle/10 665/259952/WHO-MERS-LAB-15.1-Rev1-2018-eng.pdf?sequence=1&isAllowed=y. Accessed 5 July 2022 Widagdo W, Okba NMA, Stalin Raj V, Haagmans BL (2017) MERS-coronavirus: from discovery to intervention. One Health 3:11–16. https://doi.org/10.1016/j.onehlt.2016.12.001 Xia S, Liu Q, Wang Q, Sun Z, Su S, Du L, Ying T, Lu L, Jiang S (2014) Middle East respiratory syndrome coronavirus (MERS-CoV) entry inhibitors targeting spike protein. Virus Res 194: 200–210. https://doi.org/10.1016/j.virusres.2014.10.007 Yang Y, Zhang L, Geng H, Deng Y, Huang B, Guo Y, Zhao Z, Tan W (2013) The structural and accessory proteins M, ORF 4a, ORF 4b, and ORF 5 of Middle East respiratory syndrome coronavirus (MERS-CoV) are potent interferon antagonists. Protein Cell 4(12):951–961. https:// doi.org/10.1007/s13238-013-3096-8 Yuan Y, Cao D, Zhang Y, Ma J, Qi J, Wang Q, Lu G, Wu Y, Yan J, Shi Y, Zhang X, Gao GF (2017) Cryo-EM structures of MERS-CoV and SARS-CoV spike glycoproteins reveal the dynamic receptor binding domains. Nature. Communications 8(1):Article 1. https://doi.org/10.1038/ ncomms15092 Zaki AM, van Boheemen S, Bestebroer TM, Osterhaus ADME, Fouchier RAM (2012) Isolation of a novel coronavirus from a man with pneumonia in Saudi Arabia. N Engl J Med 367(19): 1814–1820. https://doi.org/10.1056/NEJMoa1211721 Zhang AR, Shi WQ, Liu K, Li XL, Liu MJ et al (2021) Epidemiology and evolution of Middle East respiratory syndrome coronavirus, 2012-2020. Infect Dis Poverty 10(1). https://doi.org/10. 1186/s40249-021-00853-0 Zhao J, Alshukairi AN, Baharoon SA, Ahmed WA, Bokhari AA, Nehdi AM, Layqah LA, Alghamdi MG, Al Gethamy MM, Dada AM, Khalid I, Boujelal M, Al Johani SM, Vogel L, Subbarao K, Mangalam A, Wu C, Ten Eyck P, Perlman S, Zhao J (2017) Recovery from the Middle East respiratory syndrome is associated with antibody and T-cell responses. Sci Immunol 2(14):eaan5393. https://doi.org/10.1126/sciimmunol.aan5393 Zhou J, Chu H, Li C, Wong BH-Y, Cheng Z-S, Poon VK-M, Sun T, Lau CC-Y, Wong KK-Y, Chan JY-W, Chan JF-W, To KK-W, Chan K-H, Zheng B-J, Yuen K-Y (2014) Active replication of Middle East respiratory syndrome coronavirus and aberrant induction of inflammatory cytokines and chemokines in human macrophages: implications for pathogenesis. J Infect Dis 209(9):1331–1342. https://doi.org/10.1093/infdis/jit504 Ziebuhr J, Snijder EJ, Gorbalenya AEY (2000) Virus-encoded proteinases and proteolytic processing in the Nidovirales. J Gen Virol 81(4):853–879. https://doi.org/10.1099/0022-131781-4-853 Zumla A, Chan JFW, Azhar EI, Hui DSC, Yuen K-Y (2016) Coronaviruses—drug discovery and therapeutic options. Nat Rev Drug Discov 15(5):Article 5. https://doi.org/10.1038/nrd.2015.37

7

Respiratory Syncytial Virus Sonal Mahilkar

Abstract

Every year, millions of people are infected by the respiratory syncytial virus (RSV). Respiratory syncytial virus widely infects children as well as adults, but children under the age of two are more likely to develop severe respiratory symptoms. RSV has a high morbidity rate and is a cause of mortality, especially in infants. In most cases, treatment mainly consists of supportive measures, as there is no definitive treatment available to date. Most of the cases resolve without any complications under supportive care. Palivizumab is a drug that is used as a prophylactic measure in children and high-risk populations which has been proven to decrease the rate of hospitalizations and duration of stay. Immunocompromised individuals are usually at high risk for contracting the infection, for whom prophylactic drugs can be used. As there is no vaccine available currently, the treatment protocol primarily relies on providing supportive care; however, the ongoing attempts to develop a vaccine against RSV might reduce the infection rate as well as the burden on the healthcare system in the future. Keywords

RSV · Diagnosis · Clinical manifestation

S. Mahilkar (✉) Department of Dentistry, Government Medical College and Hospital, Mahasamund, Chhattisgarh, India # The Author(s), under exclusive license to Springer Nature Singapore Pte Ltd. 2023 P. L. Bhukya et al. (eds.), Emerging Human Viral Diseases, Volume I, https://doi.org/10.1007/978-981-99-2820-0_7

209

210

7.1

S. Mahilkar

Introduction

Respiratory syncytial virus (RSV) was identified around 70 years ago and is established as one of the most common etiologic agents which cause acute respiratory tract infections, particularly in infants, children, and also young adults globally. In 1956, Morris and colleagues discovered the human respiratory syncytial virus, which was isolated from chimpanzees in a laboratory, exhibiting the symptoms of an upper respiratory infection such as cold, runny nose, and restlessness. They gave the agent the name “chimpanzee coryza agent” (CCA) (Morris et al. 1956). Further studies on the individuals suffering from upper respiratory tract illness reported that the agent is similar to the CCA, and two strains were identified. Chanock et al. (1957) named this agent “respiratory syncytial virus” based on the syncytia formation in the cell culture and the similarities in the symptoms caused by the agents that were recovered from humans and those recovered from symptomatic chimpanzees.

7.2

Epidemiology

RSV-induced acute respiratory tract infections account for approximately 34 million hospitalizations in children below 5 years, while around 66,000–199,000 children died due to the RSV-induced lower respiratory tract infections (Nair et al. 2010). RSV is the main etiologic agent of severe lower respiratory tract infections such as pneumonia, bronchitis, and tracheobronchitis in infants and children. RSV also considerably impacts the older adult population and immunocompromised individuals (Branche and Falsey 2015).

7.2.1

Geographic Distribution and Seasonality

RSV infection shows a predictable pattern of annual outbreaks and is a major etiologic agent causing both upper and lower respiratory tract disease, especially in children and high-risk adults. Globally, RSV seasonality varies considerably. RSV epidemic hit temperate climate zones particularly during winter or spring, whereas the arctic and tropical zones experience an irregular pattern of RSV epidemic (Tang and Loh 2014). In tropical climates, seasonality is attributed to a decrease in temperature, while in more tropical regions, the outbreak of the disease occurs during rainy and warmer weather (Tran et al. 2016).

7.2.2

Risk Population

7.2.2.1 Infants and Children In the first few months of life, the risk of RSV infection increases due to the declining levels of the maternal antibodies and immature pulmonary system; at this period, approximately 20% of the infants contracting RSV infection develop lower

7

Respiratory Syncytial Virus

211

respiratory symptoms, leading to the bronchitis and pneumonia leading to hospitalization. Premature infants and infants with low birth weight, children born with congenital heart disease, and immunocompromised children are more at risk for RSV infection-related mortality (Meissner et al. 1999).

7.2.2.2 Elderly population RSV significantly impacts elderly individuals in which 10–50% of the cases result in hospitalization, with a mortality rate of more than 10%. RSV infection may exacerbate the preexisting cardiac and respiratory system conditions such as congestive heart failure and chronic obstructive pulmonary diseases. Age-related diminished immune system activity and aging in general are contributing factors for RSV susceptibility (Meissner 2003). Other at-risk individuals are those with cystic fibrosis, immunodeficiency disorders, individuals with HIV infection, and organ transplant recipients (Meissner 2003).

7.3

Structural Organization of Respiratory Syncytial Virus

RSV was reclassified in 2016 as a member of the Pneumoviridae family, genus Orthopneumoviridae. Previously, the taxon Pneumoviridae belonged to the Paramyxoviridae subfamily (Griffiths et al. 2017). RSV is a medium-sized virus with a size ranging from 120 to 300 nm. It is a pleomorphic, negative sense, non-segmented, single-stranded RNA virus. Its genome contains about 15,200 nucleotides and encodes a total of 11 proteins: 9 structural proteins, which are matrix protein (M), phosphoprotein (P), large protein (L), fusion protein (F), small hydrophobic protein (SH), attachment glycoprotein (G), nucleoprotein (N), M2–1, M2–2, and 2 non-structural proteins, NS1 and NS2 (Table 7.1) (Nam and Ison 2019). RSV’s primary target has been identified to be airway epithelial cells. G, SH, and F are the transmembrane glycoproteins found on the envelope of the respiratory syncytial virus. RSV attachment and its entry into the host cell are regulated by transmembrane glycoproteins G and F (Zhang et al. 2002). G protein is responsible for the attachment to the membrane of the host cell as well as RSV immune modulation and is expressed in two forms: soluble form (Gs) and membrane bound form (Gm) (Shingai et al. 2008). When the attachment to the host cell is complete, the F protein, after undergoing conformational changes, causes fusion of the viral envelope with the membrane of the host cell, facilitating entry (Gilman et al. 2019). The receptors present on the host cells that interact with virus are identified as CX3 chemokine receptor 1 (CX3CR1), DC-SIGN, and heparan sulfate proteoglycans (HGPGs) (Malhotra et al. 2003). The CX3C motif present on the G protein binds with CX3CR1 present on the host cell. Any mutation of the CX3C motif or inhibition of the formation of the G-CX3CR1 complex due to anti-CX3CR1 antibody interaction has shown to decrease in the RSV infectivity (Boyoglu-Barnum et al. 2017). Nucleolin was recently discovered to be a functional RSV fusion receptor (Mastrangelo and Hegele 2013). Studies on RSV-infected mice have shown lower RSV titers by using specific Si RNA to silence lung nucleolin, which

212

S. Mahilkar

Table 7.1 Viral proteins and their functions (Adapted from: Griffiths et al. (2017)) Location of protein in virion Transmembrane surface proteins

Protein name Glycoprotein (G) Fusion protein (F)

Inner envelope face Ribonucleocapsid

Regulatory proteins Nonstructural proteins

Small hydrophobic protein (SH) Matrix protein (M) Nucleoprotein (N) Phosphoprotein (P) “Large” protein (L) M2–1 M2–2 NS-1 NS-2

Function Attachment of the virus to ciliated cells of the host airway Fusion of membranes of host cell and RSV; formation of syncytium Viroporin and ion channel formation

Additional information F and G glycoproteins facilitate viral attachment and entry into the host cell and neutralize antibodies during the infection

Mediate fusion of cells

Assembly RNA-binding Phosphorylation RNA-dependent RNA polymerase Transcription processivity factor Regulate transcription and RNA replication Plays a role in evading the innate immune system

Plays a role in genome transcription, RNA replication, and particle budding

Act by inhibiting apoptosis and Type I IFN signaling

indicates that nucleolin is a functional cellular receptor for RSV (Tayyari et al. 2011). SH protein increases the host cell permeability of the membrane by forming pentameric ion channels in the host cell (Gan et al. 2012). Numerous studies have shown that deleting SH in RSV causes viral attenuation. Despite the fact that humoral immune responses target all three RSV surface proteins (F, G, and SH), (Fig. 7.1). The development of an RSV vaccine is mainly focused in F protein, which is similar in all RSV strains (Whitehead et al. 1999). Three main viral proteins, which are absolutely necessary for RSV genome replication: nucleoprotein (N), phosphoprotein (P), and large protein (L), (Grosfeld et al. 1995). N forms an intertwined helical structure by binding itself with viral DNA; this structure protects the viral RNA from cellular nuclease enzymes and also from recognition by the innate immune system (Tawar et al. 2009). Large protein (L) is a single protein that has three different enzymatic domains. These domains are RNA-dependent RNA polymerization (RdRp), cap addition (cap), and cap methylation (MT), which play roles in replicating the viral genome and transcription of mRNA, cap the mRNA5’ end, and methylation of the cap, respectively (Bakker et al. 2013). RSV P is a polymerase factor that plays an important role in the regulation of viral RNA replication and transcription. P binds L to the nucleoprotein-RNA

7

Respiratory Syncytial Virus G (attachment) protein

213 Negative strand RNA genome

SH protein

F (fusion) protein

M (matrix) protein N, P and L nucleocapsid proteins

Fig. 7.1 Structural organization of Respiratory Syncytial Virus (Adapted from: Hacking and Hull 2002)

complex, and it also prevents nascent N interactions with the host RNAs. It mediates transcription of viral RNA by recruiting protein M2–1 to the site and by facilitating the enzyme cellular phosphatase PP1 to the inclusion bodies (Richard et al. 2018). Because of the dynamic nature of RSV P, the exact molecular mechanisms by which P harmonizes the activities of various viral components are unknown (Pereira et al. 2017).

7.3.1

Propagation of Respiratory Syncytial Virus

7.3.1.1 In Vitro Models To observe the interaction between different types of respiratory tract cells and RSV, various in vitro cell cultures have been developed. In most of these models, immortalized cell lines are used. These single-cell systems are useful for studying mechanisms of direct infection and replication of viral cells at the cellular level; however, these models fail to provide insight into the processes undergoing at the multicellular tissue level (Ferreira Lopes et al. 2017). Newer in vitro systems are being developed using primary epithelial cells. Primary epithelia cells can be obtained from surgical materials or brushing, such as from the nose and throat, or they can be cultured in the laboratory. To increase the understanding of the process of host-virus interaction occurring at tissue level, a newer 3D culture system, such as airway organoids from stem cells has been developed. However, this technique is still in its developing stage and is time-consuming and expensive (Swain et al. 2010). A few in vitro models are:

214

S. Mahilkar

1. Primary Respiratory Epithelial Cells: These are harvested from respiratory tissues of different anatomical parts mainly during surgical procedures, such as lung transplantation or surgical tissue resection, or can also be obtained from cadavers. Other non-surgical methods are from nasal and bronchial brushing (Müller et al. 2013). Primary respiratory epithelial cells can be undifferentiated as well as differentiated. Undifferentiated primary respiratory epithelial cells are easier to isolate. To obtain the primary epithelial cells, the tissue specimens from the surgical procedures such as lung transplants and biopsies are dissociated using various protease enzymes to form a uniform cellular suspension. Gowers et al. 2018). The tissues from the brushing can be cultured directly. Due to the lack of polarization and the absence ciliated cells and goblet cells, primary epithelial cells do not represent important airway characteristics (Gowers et al. 2018). Differentiated Primary Respiratory Epithelial Cells Although more difficult to culture, these cells more appropriately represent the respiratory tract than their undifferentiated epithelial cells. To isolate differentiated epithelial cells, in the transwell system, medium is removed from the apical compartment after the uniform monolayer has formed, which results in the formation of an air-liquid interface (ALI). When different specific growth factors are added to this interface, differentiation of the cells over a 3–4-week period is induced (Villenave et al. 2013). Finally, a polarized, pseudostratified respiratory epithelium with basal cells, ciliated cells, and goblet cells or club cells is formed based on the anatomical location of the obtained specimen (Broadbent et al. 2016). These differentiated epithelial cells are anatomically similar to human respiratory tracts, but they do not have continuous airflow, blood circulation, and immune cells as the respiratory tract in the human respiratory system (Dvorak et al. 2011). 2. Stem Cell-Based Models: Stem cell (SC)-based models overcome disadvantage over primary respiratory epithelial cells, which have a limited lifespan. Organoid culture is a newer technology first introduced in 2009 (Sato et al. 2009). SCs have the capability to differentiate into organoids. Organoid is a three-dimensional culture that is capable of self-reorganization. Due to the novelty of the technique, only a few studies with AO and respiratory viruses have been conducted so far. However, these studies show great possibilities for understanding virus-host interaction mechanisms and drug screening using a SCs-based model (Sato et al. 2009).

7.3.1.2 In Vivo Animal Models There are currently no approved vaccines available against severe human RSV infection, and developing safe and effective vaccines has been a laborious task, and to overcome this disease, ongoing biomedical research is required. RSV is a difficult pathogen to study because of this virus specificity to the human host and no single animal model represents all aspects of the pathologic process of RSV. Depending on the viral or pathologic aspect to be studied, different animal models may be used to study human RSV. The murine model has been the most widely used model for biomedical studies, and it has played a vital role in the development of vaccines and therapeutic protocols against human RSV (Altamirano-Lagos et al.

7

Respiratory Syncytial Virus

215

2019). The murine model is most notable for its use as a first model in developing vaccines or targeted therapies such as monoclonal antibodies. However, possibilities of using other rodents, mustelids, ruminants, and non-human primates have been probed as alternative models for studying hRSV (Altamirano-Lagos et al. 2019). The following table (Table 7.2) lists the different models used for the RSV study with their advantages and disadvantages.

7.3.2

Replication of Respiratory Syncytial Virus

RSV infects primarily airway epithelial cells lining the upper and lower respiratory tracts. Epithelial cells are the first to appear as the defense against the pathogens and also at the site of the inflammation (Schmidt et al. 2001). The virus rarely infects other tissues in immunocompetent individuals. The virus’s entry into the host cell is the first crucial step in the process of infection. Following the entry, the virus replicates and exits the cell, either through fusing with neighboring cells or through rupture of the host cell membrane. Because targeting the viral entry mechanism into the host cell and preventing it is the main mechanism for anti-viral therapies, most research inspected the functions of the major surface glycoproteins G and F. The fact that only antibodies to these proteins confer effective humoral immunity emphasizes their significance (Schmidt et al. 2001). The G protein mediates RSV attachment to the host cells. The F protein is responsible for fusion, at which point the viral envelope is fused into the host cell membrane and the viral nucleocapsid is released into the cytoplasm. RSV mRNA is accumulated until approximately 15 h after infection, and then it remains unchanged, allowing replication of RNA followed by viral assembly. This transition from transcription of RNA to genomic RNA production is regulated by the M2–2 gene. The M protein and membrane-bound G protein interact in the Golgi complex via a six-amino acid motif in the G protein’s cytoplasmic end. The F and G proteins are likely to interact via their cytoplasmic domains. Other proteins N, P, L, and M2–1 proteins form cytoplasmic inclusions and react with the M protein via M2–1 (Ghildyal et al. 2009). These interactions show that the M proteins play an important role in coordinating the interaction of the envelope proteins F and G with the nucleocapsid proteins N, P, and M2–1 (Hacking and Hull 2002).

7.4

Pathogenesis of Respiratory Syncytial Virus in Humans

The traditional view of infection pathogenesis holds that the manifestations of the signs and symptoms of the disease are due to the replication of the pathogenic agent and cytotoxicity. While these mechanisms may play a role in the development of bronchiolitis, much research is concentrated on the immunological and non-immunological host responses to RSV infection and the role they play in the pathogenesis of disease. Various observations indicate that immune response mechanisms may be important in determining the severity of the RSV-induced

216

S. Mahilkar

Table 7.2 In vivo models for respiratory syncytial virus propagation Animal models Cattle – Bovine RSV

Mice

Cotton rats

Ferrets

Lambs

Chimpanzees

Advantages – exhibits respiratory signs and symptoms – anatomical similarities allow closely resembling lung function testing and interpretation – similar viral antigenic properties, used for studying vaccine development

– various inbred strains and transgenic lines are present – small size allows easy handling and housing, – low maintenance cost – proper sample size is easy to achieve – comparison of result possible due to extensive lab use – permissive – more immunological similarities to humans as compared to inbred mice – availability of genetic and immunological molecular tools – inbred animals are easily available – convenient to handle and sample – highly susceptible to infection

– anatomical similarities allow predictable lung function testing and interpretation – large size and docility permit repeated and convenient sampling – permissive replication of human RSV – anatomical, physiological, and genetic similarities to humans

Disadvantages – heterologous – limited molecular tools available for studying immunologic and genetic properties – requires a bigger space for housing – requires veterinary maintenance. – prone to naturally occurring co-infections – respiratory system difference – different immune system – natural viral replication is less

– expert handling is needed – limited molecular tools available for studying immunologic and genetic properties – absence of transgenic lines – do not exhibit clinical signs and symptoms – absence of clinical symptoms – requires specialized and costly housing, maintenance – limited molecular tools available for studying immunologic and genetic properties – inbred animals are not commercially available – requires specialized housing, caring, and maintenance – limited molecular tools for studying immunologic and genetic properties – requires large space for housing – specialized veterinary maintenance – ethical and emotional challenges – inbred strains are not available; limited immunological tools and reagents – costly maintenance, large housing space

7

Respiratory Syncytial Virus

217

symptoms in children. In humans, the immune response to RSV infection can be divided into innate and adaptive immune responses.

7.4.1

Innate Immunity

It is the primitive response that aids in the early stages of the host’s defense when activated upon contracting foreign organisms. Through the release of cytokines, the innate immune response causes the recruitment of effector molecules and phagocytic cells to the site of insult by foreign organisms. It has a fast onset, is not dependent on clonal expansion, and has no immune memory. The first innate defense mechanism in the lung is pulmonary surfactant. It is composed of a layer of phospholipids (mostly lecithin and sphingomyelin) and various surfactant proteins. Surfactant protein A, B, and D concentrations in bronchoalveolar lavage from RSV-infected ventilated infants are often decreased (Kerr and Paton 1999). Surfactant protein A belongs to the collectin family, which is a group of structurally related proteins responsible for binding surface oligosaccharides on a variety of pathogens and regulating a variety of innate immune response activities such as opsonization and activation of the complement system. Surfactant protein A has been shown in vitro to neutralize RSV by attaching itself to the F protein but not to the G protein (Ghildyal et al. 1999). Pattern recognition receptors allow host cells to recognize microbial products. CD14 and Toll-like receptor 4 (TLR4) are two important pattern recognition receptors that are involved in eliciting innate responses to various components of Gram-negative and Gram-positive bacteria, mycobacteria, spirochetes, and yeast and viruses. Evidence from numerous researches on monocytic cells indicates that the RSV F protein stimulates CD14 and TLR4 receptors and triggers innate immune response. Thus, the immune response to several bacterial, fungal, and viral pathogens, including RSV, is initiated by a common receptor pathway, and phagocytic cells such as neutrophils and macrophages, eosinophils, and natural killer cells form active cellular components of the innate response during RSV infection (KurtJones et al. 2000).

7.4.2

Adaptive Immunity

The adaptive immune response is characterized by immunological memory and is activated by the interaction of a specific selection of lymphocytes with antigenspecific receptors. Adaptive immunity is classified as either humoral or cellmediated. The humoral response is primarily involved in protective immunity during RSV infection, whereas the cell-mediated response promotes clearance of RSV.

7.4.2.1 Cell Mediated Immunity to RSV Within ten days of infection with a primary RSV, a cellular immune response is developed in infants (Chiba et al. 1989). Cytotoxic T lymphocytes (CTL) from

218

S. Mahilkar

humans recognize the proteins N, SH, F, M, M2, and NS2 but not the G protein. It has been proposed that in mouse models, the failure of the G protein to elicit a CTL response is a key player in disease pathogenesis (Srikiatkhachorn and Braciale 1997). Both CD4 and CD8 T cells are sensitized to possess antiviral activity via passive transfer. In mice infected with RSV, both cell types help to reduce pulmonary hypertension and virus shedding, but these cells also result in the increased damage to the lungs (Alwan et al. 1992). Animal experiments studying the effects of a formalin-inactivated vaccine provided additional understanding of the role of CTL in the pathogenesis in the RSV infection. Mice immunized with the vaccine have activated CD4 T cells with cytokine expression patterns consistent with a T helper type two (Th2) phenotype, whereas natural infection induces cytokine expression consistent with a T helper type one (Th1) phenotype. These findings indicated that the formalin-inactivated vaccine created an imbalance in cytokines homeostasis environment, favoring Th2 allergy-related responses over Th1 delayed hypersensitivity-related responses (Graham et al. 1993). This proved to be an appealing model for explaining recurrent wheezing after bronchiolitis induced by RSV, as well as allergy-related bronchiolitis cellular events such as activation of eosinophil and the circulation of RSV-specific immunoglobulin E (Welliver et al. 1981). The distinction between Th2 and Th1 CD4 cell subgroups was first studied and described in mice; this difference between the two groups may be less marked in humans (Krug et al. 1996). Furthermore, in humans, there have been conflicting observations on Th2 and Th1 cytokine profiles in cases of RSV-induced bronchiolitis, and recent evidences indicate that the severity of the disease is due to chemokines production rather than Th2 cytokine levels (Garofalo et al. 2001).

7.4.2.2 Humoral Immunity to RSV Although the humoral response does not actively affect the path of a primary infection after its onset, there is strong evidence that acquired antibodies protect against subsequent infections. Breastfed infants have high titers of these acquired antibodies and are less likely to experience a severe form of bronchiolitis, also passive immunization with RSV-specific IgG has been effective in reducing hospitalizations due to RSV infection (IMpact-RSV Study Group 1998).

7.5

Clinical Manifestation

RSV infection is usually contracted either by inoculation of the eyes or nose by large aerosol particles or by direct contact resulting in replication of the virus in the nasopharynx, the incubation period is usually 4 to 5 days, and in most cases followed by spread to the lower respiratory tract over the next several days (Hall 2001). The most common symptoms experienced are rhinorrhea, cough, and a low-grade fever. Symptoms of the lower respiratory airway infection are commonly seen in infants suffering from mild RSV disease. Bronchiolitis (inflammation of the bronchioles) is marked by the clinical symptoms such as increased resistance, trapping of air, and

7

Respiratory Syncytial Virus

219

wheezing. The development of subsequent pneumonia is responsible for the frequent hypoxia found in infants suffering from RSV infection (McNamara and Smyth 2002). RSV in a preterm infant can cause difficulty in feeding, apnea, irritability, restlessness, or lethargy. Apnea is the main cause of up to 20% of hospitalizations in RSV-positive infants, most of whom are preterm or young neonates (Bruhn et al. 1977). Infants with persistent symptoms like clear rhinorrhea, cough, sneezing, fever, apnea, wheezing, pharyngitis, or respiratory distress should be examined carefully. Coughing and wheezing affect 50% of infected children. Congestion, cough, and fever are common cold symptoms in older children and adults. Severe disease in any child is defined by the American Academy of Paediatrics (AAP) as “signs and symptoms associated with poor feeding and respiratory distress characterized by tachypnoea, nasal flaring, and hypoxemia.” Adults with RSV frequently experience wheezing and rhinorrhea (AAP 2006).

7.5.1

Histological Finding

Infection is normally limited to the respiratory epithelium’s superficial cells. Infection in the lower airway primarily affects ciliated cells of the small bronchioles and type 1 pneumocytes present in the alveoli. Other cells, such as non-ciliated epithelium and intraepithelial dendritic cells (DCs), are most likely infected, but basal cells appear to be immune (Johnson et al. 2007). Common pathological findings are epithelial cell necrosis, bronchiolar epithelium proliferation, the presence of monocyte and T cell infiltrates mainly present in bronchiolar and pulmonary arterioles, and neutrophils infiltration in vascular structures and small airways. Viral infiltration and tissue destruction are seen more as concentrated, isolated patches than diffuse areas (Collins and Graham 2008). There are numerous signs of airway obstruction caused by epithelial cell sloughing, mucus secretion, and immune cell accumulation. Syncytia formation is occasionally seen in the bronchiolar epithelium, but it is uncommon. However, presence of syncytium formation and giant-cell pneumonia are prominent symptoms of infection in people who have severe T-cell deficiency (Collins and Graham 2008).

7.5.2

Laboratory Diagnosis

A specific diagnosis of RSV infection is based on the detection of the presence of the virus and its components, such as viral antigens or virus-specific nucleic acid sequences, in respiratory secretions. The type and quality of clinical specimens have a significant impact on the sensitivity and specificity of all currently available viral detection assays. Nasopharyngeal swab specimens appear to be less sensitive than nasal washes or aspirates for the detection of RSV (DeByle et al. 2012). Currently available laboratory methods for RSV detection are mainly the isolation of viruses in tissue cultures, viral antigen detection using direct or indirect

220

S. Mahilkar

immunofluorescent (IF) staining (DFA/IFA) or enzyme-linked immunosorbent assays (EIAs), and by using amplification assays to detect viral nucleic acids, primarily reverse transcription polymerase chain reaction (RT-PCR) (PopowKraupp and Aberle 2011).

7.6

Therapeutic Approaches

Currently, no effective treatment for RSV infections is available, and RSV-specific antiviral therapeutic agents are still under development. Symptomatic treatment is given in cases of mild RSV infections, whereas individuals exhibiting severe disease symptoms, such as bronchiolitis, necessitate supportive measures to maintain oxygen levels, hydration, and nutrition (Popow-Kraupp and Aberle 2011). Ribavirin is the only antiviral drug approved for the treatment of RSV; however, due to its high cost, questionable overall efficacy, potential toxicity, and difficult route of administration has limited its use only in immunocompromised patients experiencing a severe form of RSV infection (Ralston et al. 2014). Children with acute bronchiolitis are frequently given beta-adrenergic drugs, corticosteroids, and hypertonic saline. They are usually unsuccessful and should not be used routinely in severe cases of RSV infection. Some rare complications due to RSV infection include bacterial superinfection and otitis media. Systemic antibiotics are not usually recommended during RSV infection but may be prescribed if a high risk of bacterial superinfection is suspected (WHO 2018).

7.7

Prevention

Prevention of the infection remains the most effective strategy I controlling the RSV infection since there is no definitive treatment available. Practicing and maintaining basic hygiene measures such as frequent hand washing, avoiding going to crowded places, avoiding tobacco smoke are usually guidelines provided by the CDC and AAP. The isolation of infected individuals, raising awareness among caregivers by providing education on the transmission of RSV, and hygiene reinforcement can help decrease the chances of nosocomial transmission of RSV (Chatterjee et al. 2021). At present, Palivizumab is the only drug approved for the prevention of RSV infection in high-risk children (Goldstein et al. 2017). Palivizumab, a humanized monoclonal immunoglobulin G-1 directed against an epitope on the RSV F glycoprotein, is manufactured using recombinant DNA technology. Palivizumab is not a derivative of human immune globulin and is derived by mixing human and murine amino acid sequences (95% human +5% murine). It was found to be 50 to 100 times more in potency than the similar concentrations of RSV-IGIV against type A and type B RSV isolates in vitro (Johnson et al. 1997).

7

Respiratory Syncytial Virus

7.8

Future Perspective

7.8.1

Respiratory Syncytial Virus Vaccine

221

Over the years, research on RSV and the pathogenesis of RSV disease has provided an understanding of the biological phenomenon occurring during the RSV infection process, yet, several critical aspects are not fully understood such as host cell receptor interacting with the virus, stages of the replication cycle of virus that are most susceptible to intervention, effective host response during infection, viral factors that regulate the inflammation. Exploring these aspects may prove critical in the development of new treatments as well as effective and safer vaccines. Given the enormous disease burden and related costs of treating RSV in the healthcare systems around the world, researches are being conducted to develop an effective vaccine. Infants, school-age children, high-risk populations like pregnant women, and elderly people are the primary target populations for vaccination. A variety of vaccine approaches, including live-attenuated/chimeric, wholeinactivated, particle-based, subunit, nucleic acid, and gene-based vectors, are being considered (Barr et al. 2019). Ongoing researches aim develop long-acting monoclonal antibodies (mAbs) exclusively for infants that can be given to prevent infection during the entire RSV season. Mazur and colleagues have recently reviewed these vaccines and mAbs (Mazur et al. 2018). A phase III clinical trial of an RSV maternal vaccine (NCT02624947) underwent recently; however, it did not meet its aim of preventing lower respiratory tract infection caused by RSV. The vaccine showed 44% efficacy against hospitalizations due to RSV and 48% against RSV infection-induced severe hypoxemia (Barr et al. 2019).

7.8.2

Respiratory Syncytial Virus Therapeutics

Ribavirin, IVIG, and palivizumab are the three most commonly tested and used antiviral drugs against RSV. None of the three have proven to be definitively effective and beneficial treatments, so the quest to find an effective therapeutic agent persists. Currently, there are about 14 anti-viral agents under clinical trials (phase I and II only) for the treatment of RSV, with 5 of them targeting pediatric patients so far (Nicholson and Munoz 2018). Novel therapeutic molecules targeting viral RNA polymerases, F proteins, nucleocapsid mRNA, and nucleoproteins have been explored, which are fusion inhibitors, non-fusion inhibitors, polymerase inhibitors, antibodies, nucleoside analogues, small-interfacing RNAs, and a benzodiazepine. (Nicholson and Munoz 2018).

222

7.9

S. Mahilkar

Conclusion

Every year, millions of children are infected with RSV. Patients’ mainstay therapy continues to be supportive care, which includes nutrition, hydration, nasal secretion clearance, and, if necessary, oxygen. To prevent RSV transmission, good basic hygiene techniques and isolation should be used. Palivizumab should be administered to those who have risk factors and meet the inclusion criteria. Ribavirin and palivizumab could be used to treat immunocompromised patients. The development of effective and safe vaccines may reduce the financial burden of RSV infection on the healthcare system worldwide.

References Altamirano-Lagos MJ, Díaz FE, Mansilla MA, Rivera-Pérez D, Soto D, McGill JL et al (2019) Current animal models for understanding the pathology caused by the respiratory syncytial virus. Front Microbiol 10:873. https://doi.org/10.3389/fmicb.2019.00873 Alwan WH, Record FM, Openshaw PJM (1992) CD4+ T cells clear virus but augment disease in mice infected with respiratory syncytial virus. Comparison with the effects of CD8+ T cells. Clin Exp Immunol 88(3):527–536 American Academy of Pediatrics Subcommittee on Diagnosis and Management of Bronchiolitis (2006) Diagnosis and managementf bronchiolitis. Pediatrics 118:1774–1793 Bakker SE, Duquerroy S, Galloux M, Loney C, Conner E, Eléouët JF et al (2013) The respiratory syncytial virus nucleoprotein–RNA complex forms a left-handed helical nucleocapsid. J Gen Virol 94(Pt 8):1734 Barr R, Green CA, Sande CJ, Drysdale SB (2019) Respiratory syncytial virus: diagnosis, prevention and management. Ther Adv Infect Dis 6:2049936119865798 Boyoglu-Barnum S, Todd SO, Meng J, Barnum TR, Chirkova T, Haynes LM et al (2017) Mutating the CX3C motif in the G protein should make a live respiratory syncytial virus vaccine safer and more effective. J Virol 91(10):e02059–e02016. https://doi.org/10.1128/JVI.02059-16 Branche AR, Falsey AR (2015) Respiratory syncytial virus infection in older adults: an underrecognized problem. Drugs Aging 32(4):261–269 Broadbent L, Villenave R, Guo-Parke H, Douglas I, Shields MD, Power UF (2016) In vitro modeling of RSV infection and cytopathogenesis in well-differentiated human primary airway epithelial cells (WD-PAECs). In Human respiratory syncytial virus. Humana Press, New York, NY, pp 119–139. doi: https://doi.org/10.1007/978-1-4939-3687-8_9 Bruhn FW, Mokrohisky ST, McIntosh K (1977) Apnea associated with respiratory syncytial virus infection in young infants. J Pediatr 90(3):382–386 Chanock R, Roizman B, Myers R (1957) Recovery from infants with respiratory illness of a virus related to chimpanzee coryza agent (CCA). I Isolation, properties and characterization. Am J Hyg 66(3):281–290 Chatterjee A, Mavunda K, Krilov LR (2021) Current state of respiratory syncytial virus disease and management. Infect Dis Ther 10(1):5–16 Chiba Y, Higashidate Y, Suga K, Honjo K, Tsutsumi H, Ogra PL (1989) Development of cellmediated cytotoxic immunity to respiratory syncytial virus in human infants following naturally acquired infection. J Med Virol 28(3):133–139 Collins PL, Graham BS (2008) Viral and host factors in human respiratory syncytial virus pathogenesis. J Virol 82(5):2040–2055 DeByle C, Bulkow L, Miernyk K, Chikoyak L, Hummel KB, Hennessy T, Singleton R (2012) Comparison of nasopharyngeal flocked swabs and nasopharyngeal wash collection methods for

7

Respiratory Syncytial Virus

223

respiratory virus detection in hospitalized children using real-time polymerase chain reaction. J Virol Methods 185(1):89–93 Dvorak A, Tilley AE, Shaykhiev R, Wang R, Crystal RG (2011) Do airway epithelium air–liquid cultures represent the in vivo airway epithelium transcriptome? Am J Respir Cell Mol Biol 44(4):465–473. https://doi.org/10.1165/rcmb.2009-0453OC Ferreira Lopes S, Vacher G, Ciarlo E, Savova-Bianchi D, Roger T, Niculita-Hirzel H (2017) Primary and immortalized human respiratory cells display different patterns of cytotoxicity and cytokine release upon exposure to Deoxynivalenol, Nivalenol and Fusarenon-X. Toxins (Basel) 9(11):337. https://doi.org/10.3390/toxins9110337 Gan SW, Tan E, Lin X, Yu D, Wang J, Tan GMY et al (2012) The small hydrophobic protein of the human respiratory syncytial virus forms pentameric ion channels. J Biol Chem 287(29): 24671–24689. https://doi.org/10.1074/jbc.M111.332791 Garofalo RP, Patti J, Hintz KA, Hill V, Ogra PL, Welliver RC (2001) Macrophage inflammatory protein-1α (not T helper type 2 cytokines) is associated with severe forms of respiratory syncytial virus bronchiolitis. J Infect Dis 184(4):393–399 Ghildyal R, Hartley C, Varrasso A, Meanger J, Voelker DR, Anders EM, Mills J (1999) Surfactant protein A binds to the fusion glycoprotein of respiratory syncytial virus and neutralizes virion infectivity. J Infect Dis 180(6):2009–2013 Ghildyal R, Ho A, Dias M, Soegiyono L, Bardin PG, Tran KC, Teng MN, Jans DA (2009) The respiratory syncytial virus matrix protein possesses a Crm1-mediated nuclear export mechanism. J Virol 83(11):5353–5362 Gilman MS, Furmanova-Hollenstein P, Pascual G, Van’t Wout A, Langedijk JP, McLellan JS (2019) Transient opening of trimeric prefusion RSV F proteins. Nat Commun 10(1):1–13. https://doi.org/10.1038/s41467-019-09807-5 Goldstein M, Phillips R, DeVincenzo JP, Krilov LR, Merritt TA, Yogev R et al (2017) National Perinatal Association 2018 respiratory syncytial virus (RSV) prevention clinical practice guideline: an evidence-based interdisciplinary collaboration. Neonatol Today 12(10):1–14 Gowers KH, Hynds RE, Thakrar RM, Carroll B, Birchall MA, Janes SM (2018) Optimized isolation and expansion of human airway epithelial basal cells from endobronchial biopsy samples. J Tissue Eng Regen Med 12(1):e313–e317. https://doi.org/10.1002/term.2466 Graham BS, Henderson GS, Tang YW, Lu XIATAO, Neuzil KM, Colley DG (1993) Priming immunization determines T helper cytokine mRNA expression patterns in lungs of mice challenged with respiratory syncytial virus. J Immunol 151(4):2032–2040 Griffiths C, Drews SJ, Marchant DJ (2017) Respiratory syncytial virus: infection, detection, and new options for prevention and treatment. Clin Microbiol Rev 30(1):277–319 Grosfeld H, Hill MG, Collins PL (1995) RNA replication by respiratory syncytial virus (RSV) is directed by the N, P, and L proteins; transcription also occurs under these conditions but requires RSV superinfection for efficient synthesis of full-length mRNA. J Virol 69(9):5677–5686 Hacking D, Hull J (2002) Respiratory syncytial virus—viral biology and the host response. J Infect 45(1):18–24 Hall CB (2001) Respiratory syncytial virus and parainfluenza virus. N Engl J Med 344(25): 1917–1928 IMpact-RSV Study Group (1998) Palivizumab, a humanized respiratory syncytial virus monoclonal antibody, reduces hospitalization from respiratory syncytial virus infection in high-risk infants. Pediatrics 102(3):531–537 Johnson S, Oliver C, Prince GA, Hemming VG, Pfarr DS, Wang SC et al (1997) Development of a humanized monoclonal antibody (MEDI-493) with potent in vitro and in vivo activity against respiratory syncytial virus. J Infect Dis 176(5):1215–1224 Johnson JE, Gonzales RA, Olson SJ, Wright PF, Graham BS (2007) The histopathology of fatal untreated human respiratory syncytial virus infection. Mod Pathol 20(1):108–119 Kerr MH, Paton JY (1999) Surfactant protein levels in severe respiratory syncytial virus infection. Am J Respir Crit Care Med 159(4):1115–1118

224

S. Mahilkar

Krug N, Madden J, Redington AE, Lackie P, Djukanovic R, Schauer U et al (1996) T-cell cytokine profile evaluated at the single cell level in BAL and blood in allergic asthma. Am J Respir Cell Mol Biol 14(4):319–326 Kurt-Jones EA, Popova L, Kwinn L, Haynes LM, Jones LP, Tripp RA et al (2000) Pattern recognition receptors TLR4 and CD14 mediate response to respiratory syncytial virus. Nat Immunol 1(5):398–401 Malhotra R, Ward M, Bright H, Priest R, Foster MR, Hurle M et al (2003) Isolation and characterisation of potential respiratory syncytial virus receptor (s) on epithelial cells. Microbes Infect 5(2):123–133 Mastrangelo P, Hegele RG (2013) RSV fusion: time for a new model. Viruses 5(3):873–885. https://doi.org/10.3390/v5030873 Mazur NI, Higgins D, Nunes MC, Melero JA, Langedijk AC, Horsley N et al (2018) The respiratory syncytial virus vaccine landscape: lessons from the graveyard and promising candidates. Lancet Infect Dis 18(10):e295–e311 McNamara PS, Smyth RL (2002) The pathogenesis of respiratory syncytial virus disease in childhood. Br Med Bull 61(1):13–28 Meissner HC (2003) Selected populations at increased risk from respiratory syncytial virus infection. Pediatr Infect Dis J 22(2):S40–S45 Meissner HC, Welliver RC, Chartrand SA, Law BJ, Weisman LE, Dorkin HL, Rodriguez WJ (1999) Immunoprophylaxis with palivizumab, a humanized respiratory syncytial virus monoclonal antibody, for prevention of respiratory syncytial virus infection in high risk infants: a consensus opinion. Pediatr Infect Dis J 18(3):223–231 Morris JA, Blount RE Jr, Savage R (1956) Recovery of cytopathogenic agent from chimpanzees with goryza. Proc Soc Exp Biol Med 92(3):544–549 Müller L, Brighton LE, Carson JL, Fischer WA II, Jaspers I (2013) Culturing of human nasal epithelial cells at the air liquid interface. J Vis Exp 80:e50646. https://doi.org/10.3791/50646 Nair H, Nokes DJ, Gessner BD, Dherani M, Madhi SA, Singleton RJ et al (2010) Global burden of acute lower respiratory infections due to respiratory syncytial virus in young children: a systematic review and meta-analysis. Lancet 375(9725):1545–1555 Nam HH, Ison MG (2019) Respiratory syncytial virus infection in adults. BMJ 366:l5021 Nicholson EG, Munoz FM (2018) A review of therapeutics in clinical development for respiratory syncytial virus and influenza in children. Clin Ther 40(8):1268–1281 Pereira N, Cardone C, Lassoued S, Galloux M, Fix J, Assrir N et al (2017) New insights into structural disorder in human respiratory syncytial virus phosphoprotein and implications for binding of protein partners. J Biol Chem 292(6):2120–2131 Popow-Kraupp T, Aberle JH (2011) Suppl 2: diagnosis of respiratory syncytial virus infection. Open Microbiol J 5:128 Ralston SL, Lieberthal AS, Meissner HC, Alverson BK, Baley JE, Gadomski AM et al (2014) Clinical practice guideline: the diagnosis, management, and prevention of bronchiolitis. Pediatrics 134(5):e1474–e1502 Richard CA, Rincheval V, Lassoued S, Fix J, Cardone C, Esneau C et al (2018) RSV hijacks cellular protein phosphatase 1 to regulate M2-1 phosphorylation and viral transcription. PLoS Pathog 14(3):e1006920 Sato T, Vries RG, Snippert HJ, Van De Wetering M, Barker N, Stange DE et al (2009) Single Lgr5 stem cells build crypt-villus structures in vitro without a mesenchymal niche. Nature 459(7244): 262–265. https://doi.org/10.1038/nature07935 Schmidt AC, Couch RB, Galasso GJ, Hayden FG, Mills J, Murphy BR, Chanock RM (2001) Current research on respiratory viral infections: third international symposium. Antivir Res 50(3):157 Shingai M, Azuma M, Ebihara T, Sasai M, Funami K, Ayata M et al (2008) Soluble G protein of respiratory syncytial virus inhibits toll-like receptor 3/4-mediated IFN-beta induction. Int Immunol 20(9):1169–1180. https://doi.org/10.1093/intimm/dxn074

7

Respiratory Syncytial Virus

225

Srikiatkhachorn A, Braciale TJ (1997) Virus-specific CD8+ T lymphocytes downregulate T helper cell type 2 cytokine secretion and pulmonary eosinophilia during experimental murine respiratory syncytial virus infection. J Exp Med 186(3):421–432 Swain RJ, Kemp SJ, Goldstraw P, Tetley TD, Stevens MM (2010) Assessment of cell line models of primary human cells by Raman spectral phenotyping. Biophys J 98(8):1703–1711. https:// doi.org/10.1016/j.bpj.2009.12.4289 Tang JW, Loh TP (2014) Correlations between climate factors and incidence—a contributor to RSV seasonality. Rev Med Virol 24(1):15–34. Available from: 10.1002/rmv.1771 Tawar RG, Duquerroy S, Vonrhein C, Varela PF, Damier-Piolle L, Castagné N et al (2009) Crystal structure of a nucleocapsid-like nucleoprotein-RNA complex of respiratory syncytial virus. Science 326(5957):1279–1283 Tayyari F, Marchant D, Moraes TJ, Duan W, Mastrangelo P, Hegele RG (2011) Identification of nucleolin as a cellular receptor for human respiratory syncytial virus. Nat Med 17(9): 1132–1135. https://doi.org/10.1038/nm.2444 Tran DN, Trinh QD, Pham NT, Vu MP, Ha MT, Nguyen TQ, Okitsu S, Hayakawa S, Mizuguchi M, Ushijima H (2016) Clinical and epidemiological characteristics of acute respiratory virus infections in Vietnamese children. Epidemiol Infect 144(3):527–536. https://doi.org/10.1017/ S095026881500134X Villenave R, Shields MD, Power UF (2013) Respiratory syncytial virus interaction with human airway epithelium. Trends Microbiol 21(5):238–244. https://doi.org/10.1016/j.tim.2013.02.004 Welliver RC, Wong DT, Sun M, Middleton E Jr, Vaughan RS, Ogra PL (1981) The development of respiratory syncytial virus-specific IgE and the release of histamine in nasopharyngeal secretions after infection. N Engl J Med 305(15):841–846 Whitehead SS, Bukreyev A, Teng MN, Firestone CY et al (1999) Recombinant respiratory syncytial virus bearing a deletion of either the NS2 or SH gene is attenuated in chimpanzees. J Virol 73(4):3438–3442 World Health Organization. (2018). The immunological basis for immunization series: module 3 Zhang L, Peeples ME, Boucher RC, Collins PL, Pickles RJ (2002) Respiratory syncytial virus infection of human airway epithelial cells is polarized, specific to ciliated cells, and without obvious cytopathology. J Virol 76(11):5654–5666. https://doi.org/10.1128/jvi.76.11. 5654-5666.2002

8

Human Bocavirus Muskan Chakraborty and Prudhvi Lal Bhukya

Abstract

The Human Bocavirus (HBoV) was identified in Sweden over 10 years ago as a non-enveloped virus with linear ssDNA and was grouped under Parvoviridae. Since then, three novel viruses related to the first identified human Bocavirus, HBoV1, have been isolated, called HBoV2, HBoV3, and HBoV4. It is found in the nasopharyngeal aspirates of infants with severe respiratory infections and stool samples from patients suffering from gastroenteritis. Viruses such as the human rhinovirus, adenovirus, norovirus, rotavirus, and various bacterial respiratory and gastroenteritis pathogens have been detected along with the HBoV, showing a higher incidence of co-infections, which may be attributed to its ability to persist and reactivate. HBoV can infect several sites of the body, particularly the lymphatic tissue. The transmission of this virus can occur throughout the year, although it is more dominant during the winter and spring months. The most prevalent clinical symptom of patients infected with HBoV is bronchiolitis, pneumonia, the common cold, aggravation of asthma, croup, rhinorrhea, and fever. The DNA of the virus has also been found in the serum and urine of children suffering from acute infections, suggesting the prevalence of systemic infections. HBoV pathogenicity is still to be thoroughly studied, primarily because of the dearth of suitable animal models for replicating the virus. More advanced diagnostic strategies are required for further research on HBoV and to understand its association with disease.

M. Chakraborty Pierian India Pvt. Ltd., Pune, Maharashtra, India P. L. Bhukya (✉) Vaccine Testing Laboratory, Rodent Experimentation Facility, ICMR-National Animal Facility Resource Facility for Biomedical Research, Hyderabad, Telangana, India # The Author(s), under exclusive license to Springer Nature Singapore Pte Ltd. 2023 P. L. Bhukya et al. (eds.), Emerging Human Viral Diseases, Volume I, https://doi.org/10.1007/978-981-99-2820-0_8

227

228

M. Chakraborty and P. L. Bhukya

Keywords

Human bocavirus · Parvoviruses · Respiratory tract infection · Gastrointestinal illness · HBoV · Respiratory virus · Co-infections

8.1

Introduction

Allander et al., in September 2005, at the Karolinska University Laboratory, Stockholm, identified a novel parvovirus in the nasopharyngeal wash specimens of infants suffering from LRTIs using a technique of molecular virus screening (Allander 2005). It was named the Human Bocavirus (HBoV), compiled from the bovine parvovirus (Ungulate bocaparvovirus 1) and minute virus of canines (Carnivore bocaparvovirus 1), which infect cattle and dogs, respectively. HBoV-1 was discovered during the first couple of years of this century, along with a series of other viruses. This was made possible by new and advanced detection methods that used molecular processes to lessen the number of respiratory infections that arose due to inefficient and inaccurate laboratory detection techniques. Since its discovery, a plethora of clinical research and case studies have been published (Schildgen 2018a, b). HBoV1 is the second known species belonging to Parvoviridae that are pathogens in humans and is one of the most frequently detected in respiratory samples (Allander 2005; Ricour 2008). By 2010, three more viruses, HBoV2, HBoV3, and HBoV4, similar to HBoV1, had been isolated from stool samples from children suffering from gastrointestinal illnesses (Schildgen 2018a, b; Anonymous n.d.-a, n.d.-b). HBoV2 was initially identified in stool samples from infants of Pakistani descent suffering from flaccid paralysis (Kapoor 2009), whereas the first account of HBoV3 was from Australia (Arthur 2009) and that of HBoV4 was from Nigeria, Tunisia, and the United States (Kapoor 2010). However, there has been little evidence of their pathogenicity (Schildgen 2018a, b). The clinical presentations associated with HBoV depend on its genotype (Schildgen 2012). According to seroprevalence studies in humans, the most frequently infecting species of HBoV are, in ascending order, HBoV4, HBoV3, HBoV2, and HBoV1 (Hao 2015).

8.2

Epidemiology

HBoV infection is prevalent worldwide, involving respiratory and GI tract infections in populations in Africa, the Americas, Asia, Australia, and Europe. HBoVs also prevail in rivers and sewage water (Söderlund-Venermo 2019), being quite stable in the environment (Hamza 2017). The global prevalence of HBoV was studied from 2005 to 2016 and was estimated at 6.3% in respiratory tract infections (RTI) and 5.9% in GI tract infections. For RTIs, an average of lesser than 2% had been in the reports for Cambodia (1.6%), Kenya (1.8%), Kuwait (1.9%), Senegal (1.0%), and

8

Human Bocavirus

229

Fig. 8.1 Representation of the possible zoonotic transference of animal bocaviruses to humans

the Philippines (1.0%). Contrarily, these infections were found to be highly prevalent in Egypt (56.8%), Hungary (29.8%), and Nicaragua (33.3%). As for gastrointestinal infections, Mexico (1.3%) and Russia (1.4%) had a lower prevalence, whereas infections were highly prevalent in Bangladesh (63.0%), Nigeria (29.2%), and Tunisia (58.3%) (Guido 2016). It may be possible that HBoV originated zoonotically. Based on the terminal sequences, it was observed that it contains highly conserved genomic structures from the Carnivore bocaparvovirus 1 and the Ungulate bocaparvovirus 1 (Fig. 8.1) (Schildgen 2018a, b). Phylogenetic studies of the amino acid alignments of HBoV led to a finding that it occurs as a single lineage with slightly different genotypes. Its genetic variability is low, with the highest genetic variability being within the 285-bp portion of viral proteins 1 and 2, while lower variability was observed in the NS1 and NP-1 genes (Schildgen 2008). The diversity within the species of HBoV 2–4 is considerably higher than that within HBoV1 a (Anonymous 2011; Schildgen 2012). HBoV2, HBoV3, and HBoV4 are approximately 10% divergent from each other, whereas HBoV1 is observed to be more divergent (~20%). Thus, HBoV1 may have initially been an enteric pathogen, which later evolved into a respiratory one (Kapoor 2010; Schildgen 2012). HBoVs seem to recombine frequently amongst each other, being derived from the recombination of two different subtypes (Schildgen 2013). Detailed

230

M. Chakraborty and P. L. Bhukya

genomic analyses reveal a high possibility of HBoV3 being a product of recombination involving HBoV1 and 4 (Cheng 2011; Schildgen 2012). Viral transmission and infection may happen throughout the year. Cases are mainly observed during the fall, winter, and spring months, as that is the time when most viral respiratory tract infections occur, and seldom during the summer months (Guido 2016) (Lee 2019). However, the peak “respiratory season” is seen to vary from year to year and region to region. Therefore, it is difficult to conclude the seasonality of this considerably novel virus. According to the University of Bonn’s data, a large number of the case studies performed in areas with temperate weather have observed a greater number of HBoV-positive samples in the winter and spring (Schildgen 2008). Until now, an infection caused by this virus is associated with seasonal outbreaks, as is the case with most viruses infecting the respiratory tract, and it may be inferred that HBoV is an endemic virus (Allander 2008). Even though the precise course of transmission of HBoV is unidentified, it is assumed that its spread happens by smear or droplet contaminations, aerosols, contact with infectious sputum, and entry via the nose or mouth, like in the case of the majority of “common cold viruses.” It’s also transmitted through the GI route, as HBoV is shed in stool and urine (Schildgen 2018a, b). In most cases, HBoV1 is identified in the upper airways. However, clinical presentations and positive BAL samples suggest its capability of infecting the LRTI to the bronchioles (Ison 2017). Human bocavirus causes infections in about 40% of 18–23 months old children and almost all children older than 2 years (Allander 2008). Most have antibodies against HBoV1 by the time they are 6, while most adults show detectable HBoV1 antibodies, suggesting that there may be protective immunity post-infection (Fry et al. 2007). In a study carried out in Cleveland, Ohio, HBoV was found to infect both infant and adult patients at similar rates, where the age of the adult population ranged from 20 to 86 years (Schildgen 2008). According to one carried out in Korea between January 2010 and December 2017, 41.1% of the subjects who tested positive for HBoV were above 65 years of age, the mean age being 57 ± 19 years (Lee 2019). In another study carried out exclusively in adults, 52.4% presented HBoV infection without co-infection, which demonstrates that HBoV may be a real etiological disease-causing agent in adults (Lee 2019). Human bocavirus infections can lead to substantial morbidity and mortality. HBoV1 is primarily linked to pediatric respiratory illness, with gastrointestinal symptoms being observed often. It has also been linked to a systemic infection, causing a brief viremia, inducing specific antibodies. HBoV2 has specifically been linked to GI tract diseases. HBoV2, 3, and 4 have not been detected in blood yet (Schildgen 2012). Adults from Thailand have been observed to have HBoVassociated pneumonia that could also lead to hospital admission (Schildgen 2008) (Fry et al. 2007). The overall mortality rate due to HBoV infection along with co-infection, in the seven-year study conducted in Korea, was 21.1%. As for HBoV mono-infections, the overall mortality rate was 20.6% (Schildgen 2013). In another study performed in South Korea, HBoV caused 0.5% of serious pneumonia cases in adults. More deaths were linked to co-infections (83.3%) and compromised immunity (80.0%) (Choi 2021). HBoV1 infection may also cause acute

8

Human Bocavirus

231

bronchiolitis, as observed in a 17-month-old boy from Latvia (Ziemele 2019). Although the virus mostly infects the pediatric population, Ahmad Al Bishawi et al. reported the case of a young woman who was pregnant and showed symptoms of severe pneumonia. The woman tested positive for HBoV and needed intensive care support. The situation was made more complex by dilated cardiomyopathy, death of the fetus, and multiorgan failure. Therefore, along with severe pneumonia, there could be a causal relationship between the HBoV infection and the other lifethreatening complications (Al Bishawi 2021). It has been hypothesized that the virus, similar to the human hepatitis B virus, may be able to induce fibrosis, followed by triggering cancer genesis in its target organs (Schildgen 2018a, b). However, because it has commonly been found to be associated with other pathogens, it is unclear if it is solely responsible for the disease, whether it contributes to something more severe, or is just a harmless passenger (Burrell 2017). Due to this, the exact prevalence, seasonality, and severity of the primary HBoV infection are still unclear.

8.3

The Potential Risk of Emergence and Re-emergence

Emerging infectious diseases, as per the CDC, are diseases whose “incidence in humans has increased in the past two decades or that is expected to have an increased incidence in the near future.” Such diseases are not bound by any regional, national, or international borders and consist of: • Novel infections due to variations or evolution of already present organisms; • Already identified infections transmitted to new locations or populations; • Formerly unidentified infections appearing in zones going through an ecological transformation; • Old infections emerging once again because of antimicrobial resistance; • Infections caused by novel pathogens. Altered virus transmission due to deforestation, changes in the environment and ecology, the development of agriculture, commerce, and technology, migration and travel, the adaptation of microbes, illegal animal trade, and the failure and inadequacies of community health infrastructures are some of the reasons to explain the emergence and re-emergence of viral infections. With viral detection techniques becoming more developed and sensitive, reports of HBoV infections have increased significantly. Presumably, HBoV has been prevalent for a considerable time among us humans instead of being an actual novel virus. Several scientists consider the human bocavirus as an “emerging viral pathogen” since it is associated with infections but not yet established to be their cause, alone or along with other viruses. Hence, as per definition, it is an emerging pathogen that has been reported globally as a potential cause of GI tract illnesses and respiratory infection epidemics (Schildgen 2010). However, more research is required to understand its risk of emergence or re-emergence.

232

M. Chakraborty and P. L. Bhukya

8.4

Organization of Infectious Agents (Structural and Molecular)

8.4.1

Classification

Parvoviridae includes the subfamilies Parvovirinae (infecting vertebrates) and Densovirinae (infecting insects). Presently, Parvovirinae comprises eight genera: Amdoparvovirus, Aveparvovirus, Bocaparvovirus, Copiparvovirus, Dependoparvovirus, Erythroparvovirus, Protoparvovirus, and Tetraparvovirus. According to ICTV, human bocavirus belongs to group II—ssDNA viruses. Its genotypes cause infections exclusively in vertebrates and hence belong to the family Parvoviridae (Allander 2005; Anonymous 2005). Since HBoV shared genomic structures and amino acid sequences with the bovine parvovirus (Ungulate bocaparvovirus 1) and minute virus of canines (Carnivore bocaparvovirus 1), it was grouped as a bocavirus. Before its identification, the human parvovirus B19 (B19V), belonging to Erythroparvovirus, had been the lone virus in the family that could infect humans, causing the fifth disease, hydrops fetalis, and aplastic anemia (Schildgen 2008).

8.4.2

Morphology and Virion Structure

Human bocaviruses are small, icosahedral viruses that do not contain an envelope. Their diameter ranges from 18 nm to 26 nm, and they possess a linear ssDNA, which could be negative or positive sense. Predominantly, negative-sense DNA is packaged (about 90–95%) [2]. The length of the genome is about 5 kilobases, with its terminal sequences (32–52 nucleotides) playing a crucial part in viral replication (Anonymous 2016). The molecular mass of the virus particle (Mr) is about 5.5–6.2 × 106, and they possess a buoyant density of 1.39–1.43 g/cm3 in caesium chloride. The virion is made up of around 80% protein and 20% DNA (Anonymous 2005). The human bocavirus genome is packed into a T = 1 icosahedral capsid. The capsid is constructed from 60 copies of 6 viral proteins (VPs), VP1–VP6. VP1, VP2, and VP3 share the C terminus. The characteristic N-terminus of VP1 (VP1u) consists of a conserved phospholipase A2 (PLA2) motif, indispensable for the virus to be able to infect. It is necessary for the membrane modification and to escape the endosomal/lysosomal pathway while the viral particle is making its way to the nucleus to replicate its genome and establish a successful infection (Gurda 2010; Mietzsch n.d.). This mechanism is understood to target the tight junctions of human airway epithelial cells, which act as obstacles to infection and tissue injury caused by infectious and foreign agents (Mietzsch 2017). VP1 usually comprises about five copies per capsid (Gurda 2010). The HBoV capsid demonstrates various surface structural characteristics common to other vertebrate parvoviruses (Gurda 2010):

8

Human Bocavirus

233

• A depression at every icosahedral twofold axis; • A big, trimeric protuberance at the threefold axis or surrounding each axis; • A channel at every fivefold axis, with a small, pentameric arrangement at the outside, surrounded by a canyon-like section. These features have been observed to be the closest to those of B19. One distinguishing feature of HBoV is a narrower and shallower twofold axis depression. The threefold area includes major immunodominant epitopes (SöderlundVenermo 2019). X-ray crystallography studies demonstrate that the VPs consist of a conserved, eight-stranded, β-barrel motif (βB to βI), which makes up the capsid core. The wall of the depression at each icosahedral twofold axis is formed by a conserved α-helix (αA). The capsid surface is formed by elaborate loops present between the strands, which code for vital roles, such as tissue tropism and pathogenicity. The loops are termed after the β strands amidst which they are present. For instance, the GH loop is present amid βG and βH. Another α helix (αB) in the EF surface loop is present exclusively in the bocavirus VPs. (Gurda 2010; Mietzsch n.d.). The outer span of the HBoV capsid is 215 Å at the deepest points of the depression and canyon and 280 Å at the tip of the protuberance (Gurda 2010). The capsid carries factors that assist in endosomal trafficking, recognize the host cell, assemble the capsid, package the genome, and recognize antibodies (Mietzsch 2017). Among the HBoV strains, HBoV3 and HBoV4 bear more pronounced threefold protrusions as compared to HBoV1, giving the capsid a “spikier” form. This happens because of the presence of a larger loop caused by an insertion of two amino acids. The sequence of VP3 is approximately 78% to 91% identical amongst HBoV1, HBoV3, and HBoV4. HBoV3 and HBoV4 are the most alike (91% similarity). If we look at the structure, the main chains of HBoV1 and HBoV4 are the most different, although only slightly. The sequence and structure of β barrel and αA helix are found to be conserved in HBoV1, 3, and 4 (Mietzsch 2017). The amino acid sequence of HBoV VPs is 42% similar to that of the corresponding VPs of the bovine parvovirus and 43% similar to that of the canine minute virus (Gurda 2010). Most differences are found in the variable regions (VR)—VR-I, VR-II, VR-III, VR-IV, VR-V, and VR-VIIIB. More difference is observed in VR-III, VR-V, and VR-VIIIB in the case of HBoV1, whereas in HBoV4, more divergence is found at VR-II and VR-IV. These differences lead to localized surface variations among the viruses. HBoV1’s divergence at VR-III is due to the four extra amino acids present at the apical point of the EF loop. This may suggest a probable function of this region in the varied tropism of HBoVs, making HBoV1 a strain that causes RTIs, and HBoV3 and HBoV4, a GI tract-infecting strain. Similarities in this region in HBoV3 and HBoV4 may suggest why both cause GI tract infection (Mietzsch 2017). VR-I, VR-III, VR-VII, and VR-IX together make the two/fivefold wall. This wall lies amidst the depressions and is required for the recognition of antibodies of specific strains of HBoV1. There are five DE loops at the apex along with VR-II, which forms the fivefold axis channel. They are proposed to be the portals that allow

234

M. Chakraborty and P. L. Bhukya

VP1u to be externalized, genomic DNA to be packaged, and also in viral un-coating. VR-II forms an antibody that can cross-react, and it recognizes HBoV1, HBoV2, and HBoV4. On the other hand, residues within VR-III form the HBoV1-specific antigenic region. The VR-IV is a component of the threefold protrusions. The loop that corresponds to VR-V is a part of the protrusion around the threefold axis. It displays considerable variations at the sequence and structural level amongst the viruses and forms an HBoV1-specific antibody. Further, VR-VI, VR-VII, and VR-VIII, which present sideways to the threefold protrusions, have comparable structures amongst the HBoVs. These regions also have a responsibility in HBoV1 infectivity and antigenic reactivity. In the case of VR-VIIIB, the HI loop is found at the base of the depression around the fivefold channel. It is here that the HBoV1 configuration is the most structurally deviant, and it forms a part of an antibody produced against HBoV1, which is cross-reactive with HBoV2 and HBoV4. However, this role is yet to be established. Lastly, VR-IX, at the capsid’s twofold axis, is alike in structure in all the HBoVs, with a few sequence variations (Mietzsch 2017).

8.4.3

Genome Structure and Organization

The human bocavirus genome has three ORFs. HBoV uses one transcription initiation site and two termination sites (Söderlund-Venermo 2019). There are two palindromic sequences at the 3′ and 5′ terminals of the negative-sense genome of the virus, the left-end hairpin (LEH) and the right-end hairpin (REH), respectively. The first ORF is at the 5′ end, and it encodes for NS1, NS2, NS3, and NS4, which are non-structural proteins (Gurda 2010) (Wang 2017). They are 100, 66, 69, and 34 kDa, respectively (Wang 2017). The NS1 is a DNA-binding protein involved in DNA replication, DNA packaging, gene transcription, and regulatory activities like transactivation or induction of apoptosis, and it also may play roles in virus-host interactions (Anonymous n.d.-a, n.d.-b; Kang 2018). NS2 has been found to play a vital function in the multiplication of the virus in HAE-ALI (human bronchial airway epithelium cultured at an air-liquid interface) cultures. The NS2 protein consists of the origin binding/endonuclease and transactivation domain of NS1. The NS3 and NS4 proteins contain helicase and transactivation, and transactivation domain of NS1, respectively. The endonuclease of NS2 could be essential for the HBoV1 DNA duplication in cells that are not dividing (Shen 2015). The second ORF codes for NP1, another non-structural, nuclear phosphoprotein, unique to the bocaviruses (Gurda 2010). The structural and non-structural proteins’ ORFs are found on one DNA strand. The ORF that codes for NP1 is present downstream of that coding for NS1 and just upstream of the middle polyadenylation site. It is important for the multiplication of the DNA of the virus, splicing of viral mRNAs, and read-through of the internal polyadenylation site. This allows the RNA transcripts, which encode for the capsid, to be expressed (Burrell et al. 2016). The role of the other small NS proteins (NS2, NS3, and NS4), along with other HBoV proteins, remains rather uncertain.

8

Human Bocavirus

235

The 3′ end ORF codes for the capsid VPs, VP1, VP2, and VP3. VP3 lies collinearly with VP1 and VP2. The non-canonical start codon GUG is translated into VP2. The NP1 gene is present in a reading frame alternatively to VP1, overlapping its beginning by 13 nucleotides. The bocavirus-encoded small RNA (BocaSR), a viral non-coding RNA of 140 nucleotides, is expressed from the 3′ non-coding region, present ahead of the VP ORF. It synchronizes the VP expression and controls the multiplication of genetic material of the virus in the nucleus (Wang 2017). The genomic organization of HBoV-2 and HBoV-3 is similar to that of HBoV1. Their NS1, NP1, and VP proteins are 80% and 90%, 70% and 80%, and 80% and 80% identical, respectively, to the corresponding proteins in HBoV1 (Anonymous 2010). NS1 is the most highly conserved, showing the least genetic variation among the HBoV subtypes. Hence, NS1 is targeted to detect HBoV, while VP1/VP2 is utilized for phylogenetic analysis since it forms the variable region showing high genetic variation (Kang 2018).

8.4.4

Propagation and Assay in In Vitro and In Vivo Laboratory Models

For a productive infection, the human bocavirus requires actively dividing cells. However, HBoV1 can remarkably replicate in a non-dividing, terminally differentiated HAE-ALI culture. It has been the sole in vitro culture wherein the virus has been able to establish a successful disease using the cellular DNA damage response, as the culture medium imitates the conditions of the lower respiratory airways in humans (Söderlund-Venermo 2019). Cell lines from human epithelium or primary airway epithelial capable of division do not sustain substantial HBoV1 infection (Wang 2017). Unfortunately, the HAE-ALI cultures are error-prone, expensive, requiring a highly specialized laboratory (Schildgen 2018a, b). Studies on HBoV still depend on case studies and cell culture studies because, until now, no suitable animal model has been found for in vivo culturing. Preliminary data suggest that ferrets could be a probable host to study virus-host interactions and immunizations since they have shown promising results as a representative for gene therapy with HBoV capsid-based vectors (Schildgen 2018a, b). The HBoV virion follows clathrin-mediated endocytosis to gain access to the host’s cells after it gets attached to the host’s receptors. It enters the cytoplasm via host endosomal membrane permeabilization. This is followed by microtubular transport of the virion and penetration of its ssDNA into the nucleus (Anonymous n.d.-a, n.d.-b). The HBoV replication model claims that the virus replicates via the “rolling hairpin” model that seems to be derived from the “rolling-circle” replication method. The replication is unidirectional, following a single-strand displacement technique. It uses the self-priming hairpin telomeres of the virus and polymerases, ligases, and other replication factors of the host. The annealed 3′ hairpin terminus serves as a primer for the host polymerase to elongate the complementary strand to the

236

M. Chakraborty and P. L. Bhukya

remaining genome of the virus, resulting in a dsDNA. This initial replicative form has one covalently closed left-terminal sequence and is ligated together to close the right terminal. Then, NS1 is required to unwind the covalently closed duplex at the origin of replication, present next to the right hairpin. The resultant gap at the 3′ end in the parental strand is sealed with the transferred sequence as a template. NS1 covalently binds to the free 5′ genomic end, with an 18–26-nucleotide-long tether. It is necessary for the hairpin’s unfolding and dislocation. This dislocation substitutes the original hairpin sequence with its inverted complement at every cycle of multiplication. This forms two alternating hairpin structures—“flip” and “flop.” The rolling-hairpin process forms multimeric DNA concatemers in a head-to-head or tail-to-tail fashion, implying that the intermediates develop extensive mirror-like sequences (Schildgen 2012). The presence of head-to-head monomers has been established in HBoV1, HBoV2, and HBoV3, but the existence of the concatemeric intermediates has not been proved yet (Anonymous 2016). Afterwards, individual ssDNA genomes are excised from the replication complex by “junction resolution.” This newly produced ssDNA can be transformed again to dsDNA to further act as a template for transcription or multiplication, or it can be encapsidated to produce new virions released by cell lysis (Dijkman 2009). The transcription of the dsDNA produces viral mRNAs upon the entry of the host cell in the S phase, which is followed by translation to produce viral proteins (Anonymous n.d.-a, n.d.-b). The chief site for HBoV1 to replicate seems to be the respiratory tract, wherein it is found most commonly and in the greatest amount. Since HBoV1 has been detected in serum, it may suggest a systemic infection. Further studies to comprehend the mechanism of replication and propagation of HBoV will provide us with more clarity on its pathogenic role.

8.4.5

Life Cycle

The course of infection of HBoV and its life cycle is still not fully understood. It has been proposed that sialic acids function as the cell surface receptor in HBoV. However, since it has been difficult to cultivate the virus, it could be possible that there are requirements for other receptors as well (Dijkman 2009). HBoV-1 infections usually begin in the upper respiratory tract. In 2014, Proenca-Modena and colleagues showed that hypertrophic adenoid is the chief infection site (25.3%), followed by nasopharyngeal secretions (10.5%), tonsils (7.2%), and peripheral blood (1.5%). The tonsils are where the virus tends to persist, as theorized by Clement and his team. HBoV-1 could also be a pneumo-enteric pathogen, with the infection initiating in the respiratory tract prior to its dispersion to the intestinal tract (Netshikweta 2020). The virus particles enter through the nasopharyngeal space and go forward to infect the lung. Consequently, the virus commences a downstream infection because of the swallowing of the infectious secretions that pass into the GI tract. The virus could actively replicate here, leading to GI tract infection (Fig. 8.2). It may also be accompanied by a true viremia (Schildgen 2018a, b).

8

Human Bocavirus

237

Fig. 8.2 Schematic overview of the life cycle of HBoV. (Created with BioRender. com)

HBoV can dodge the host endosomal system, which is reliant on the phospholipase A2 domain in the VP1, but its mechanism is not clearly understood (Weston 2019).

8.5

Pathogenesis in Humans

8.5.1

Host–Virus Interaction and Host Immune Response

Owing to the scarcity of animal models for the cultivation of the human bocavirus, there is very little known about its interaction with the host. Virus replication and productive infection are the outcomes of virus-host interaction. As a virus acts as a cellular parasite, it takes advantage of the host transcription, translation, and replication machinery as well as the cellular metabolism for successful amplification. HAE infected with HBoV, whether at a lower or higher multiplicity of infection (MOI), show symptoms of respiratory tract injury such as a disrupted tight junction barrier, cilia loss, and a hypertrophic epithelial cell. On the contrary, the host cells sense the incoming virus infection, limit its replication, and spread innate immune and stress responses. In a study involving patients positive for HBoV and suffering from acute pneumonia, it showed that HBoV is capable of inducing an antibody response and seroconversion, hinting against the idea that it’s merely a bystander or a harmless

238

M. Chakraborty and P. L. Bhukya

passenger in respiratory tract infections (Schildgen 2010) (Söderlund-Venermo 2010). In the host, T-helper (Th) cells are required for protection against the virus, as they produce cytokines, as well as boost B cell and cytotoxic T cell production. The immunologic reaction to HBoV begins with an IgM response accompanied by the production of IgG (Schildgen 2018a, b). The TNF-α (NF-κB activator) levels, interleukin (IL)-6, and IL-8 (modulated by NF-κB) are significantly upregulated in the serum upon infection, which is imperative to fight the infection. Elevated levels of IFN-γ, IL-2, and IL-4 were demonstrated in the NPA of HBoV-positive children suffering from acute bronchiolitis when contrasted with the asymptomatic controls. According to other studies, HBoV1 produces IFN-γ against HBoV VP2 virus-like particles (VLPs), IL-10, and IL-13 (Th2 cells) in CD4+ T cells. This suggests that HBoV can stimulate the formation of Th1 and Th2 cytokines; however, their mechanisms have not been identified (Schildgen 2018a, b). A study performed by Liu, Q., Zhang, Z., Zheng, Z. et al. suggested a possible way by which HBoV may evade host innate immunological responses. All proteins of HBoV constrain TNF-α-induced NF-κB promoter activity. NS1 and NS1-70, which consist of all the domains of NS1 except for the C terminus (Shen 2015) of HBoV, act as antagonists of NF-κB. This further suppresses NF-κB by being bound to the DNA-binding domain of p65 upon stimulation of TNF-α. This inhibition may facilitate HBoV multiplication and pathogenesis. The NP1 protein doesn’t allow IRF3 to bind to the interferon (IFN)-β promoter as it interacts with the DNA-binding domain of IRF-3, leading to lower IFNs being produced. Such negative regulation of the IFN pathway is necessary to prevent the host from producing excess IFNs, excess production of which can harm the host by causing cell apoptosis or autoimmunity (Hu 2021). VP2 prevents the proteasome-dependent RIG-I from being degraded when it interacts with RNF125, a down-regulator of the IFN pathway, leading to an increased amount of IFN-β being produced at the mRNA and protein levels. (Hu 2021). The factors that positively regulate the IFN pathway are the primary targets of viruses against the host’s innate immunity. It may be concluded that HBoV evades the IFN response via NP1 at the initial phase of infection and via VP2 during the later phases. NS3 and NS4 may regulate the host’s innate immune reaction, which warrants further investigation (Shen 2015). Remarkably, the human bocavirus can utilize the immune response of its host to make it favorable for its survival, replication, and persistence.

8.5.2

Virulence and Persistence

HBoV1 can be detected in the upper respiratory tract of the infected for weeks and even months (Huang 2012; Guido 2016). It can also persist in pediatric palatine and adenoid tonsils, suggesting that the organs of the lymphatic system could be the source of viral spread. HBoV1 DNA can persist in the germinal centers (GCs) of the lymphatic system but not in the tonsillar epithelium. Predominantly, naive, activated, and memory B cells and monocytes are found to harbor the viral DNA. (Xu 2021).

8

Human Bocavirus

239

However, the exact mechanism behind this persistence is not known. It has been hypothesized that this may be because of continuous duplication and shedding, passive existence post-primary infection, or repeated mucosal infection. Research performed in HAE cultures demonstrates that the virus can multiply, accompanied with shedding from the apical and basolateral surfaces, for over 20 days (Huang 2012; Guido 2016). In immunocompetent individuals, shedding could happen for a minimum of six months post-primary infection (Ison 2017), supporting the idea of viral shedding being a long-term process. It is possible that through the course of its infection, HBoV can persist in the host as they can form extra-chromosomal closed circular episomes, which can be found in all the genotypes, for long-term expression and replication (Huang 2012; Guido 2016). However, the mechanism underlying this feature requires further investigation. Furthermore, the upregulation of IFN expression by VP2 may also facilitate persistence (Hu 2021). This persistence also contributes to the high occurrences (up to 83%) of co-infections with other respiratory microbes (Choi 2021; Ison 2017). Nevertheless, as compared to the pathogen B19V, HBoV1 doesn’t appear to remain in host cells for many years (Huang 2012).

8.6

Clinical Manifestations

8.6.1

Clinical Symptoms

The symptoms of HBoV-1 respiratory infection can’t be told apart from those of other RTIs and can only be detected by molecular assays. It can cause symptomless to minor upper RTIs and also grave and fatal lower RTIs in all age groups (Schildgen 2018a, b). According to Allander et al., 49 of 259 (19%) children admitted for severe wheezing in Finland tested positive for HBoV, and this may imply that HBoV infection mainly manifests as wheezing (Anonymous 2008). Research has associated HBoV1 positivity with the common cold, asthma, severe wheezing, bronchiolitis, pneumonia, acute otitis media, and bronchitis (Schildgen 2008). It causes severe pneumonia in the elderly, immunocompromised patients, and patients with underlying pulmonary disease; however,, the clinical presentation and burden of the infection in adults have not been completely explained (Choi 2021; Lee 2019). The virus also seems to cause long-term lung disease and aggravates indications by initiating fibrotic lung diseases (Schildgen 2018a, b). Several patients have exhibited gastrointestinal manifestations upon HBoV infection, as well. Maggi et al. identified viral DNA in the stool of a six-month-old boy who was suffering from diarrhea and bronchopneumonia. The specimens were negative for rotavirus, adenovirus, astrovirus, calicivirus 1, and calicivirus 2 antigens. The subjects’ respiratory specimens also showed HBoV positivity (Schildgen 2008). In a study carried out in Bangladesh, most children suffering from AGE and positive for HBoV presented with diarrhea (100%), vomiting (57%), aching abdomen (33%), dehydration (28%), and fever (9%) (Sharif 2020). Research linked HBoV1 genetic material in serum, cerebrospinal fluid (CSF), or stool to Kawasaki disease, but it was not validated by any other study (Ison 2017).

240

8.6.2

M. Chakraborty and P. L. Bhukya

Serology and Histological Approaches

It can be inferred from seroprevalence studies that HBoV is predominantly a virus in the pediatric population. However, maternal antibodies may be passed on to the fetus, providing a certain degree of protection against infections in infants. Recently, in a study conducted in Japan by Endo et al., anti-HBoV antibodies were found in 71.1% (145 of 204) of the serum samples collected from people ranging in age from 0 months to 41 years. The prevalence was least (5.6%) in the ages of 6–8 months and maximum in those above 6 years of age (94.1% to 100%). The correlation between higher antibody occurrence and lower viral incidence in subjects over the age of 6 is consistent, suggesting the possibility of protective immunity post-infection. Antibodies were detected in infants up to 6 months as well. A possible explanation for this could be perinatal transmission, i.e., the transference of antibodies from the mother to the fetus via the placenta, chiefly in the third trimester (Anonymous 2008). Furthermore, those aged 5–9 years showed a higher seropositive rate of 96.4% as compared to those aged 2–4 years (64.2%) (Guido 2016). As per the research conducted at the University of Bonn, most of the HBoVpositive patients (10/11) with no co-infections showed symptoms severe enough to undergo a chest radiograph, and 80% of them had visible abnormalities. Central bronchopneumonia was the most prevalent diagnosis, and 18% were diagnosed with segmental/lobar pneumonia. Newborns and infants have also been diagnosed with HBoV-positive central pneumonia and interstitial and lobar pneumonia (Anonymous 2008).

8.7

Diagnostics

Diagnosis of HBoV is performed by molecular and serologic approaches. Differentiated HAE cells do support the culturing of HBoV; however, these are not commonly available in all laboratories. Its diagnosis depends upon the detection of the genomic material of the virus, which can be found in human NPA, bronchoalveolar, serum, stool, and urine samples (Zaghloul 2011). Presently, the infection cannot be diagnosed by isolating the virus in tissue culture (Peltola 2013). Assays that could be used include PCR, real-time PCR, ELISA, and enzyme immunoassay (EIA) using recombinant VP2 or VLP capsid proteins (Guido 2016). Various PCR amplification techniques, utilizing different sets of primers specific for the NS, NP, or VP genes, or based on nucleic acids, have been described. These are incorporated in various commercial multiplex respiratory virus PCR kits. These include the Luminex RVP (Luminex Molecular Diagnostics, Toronto, Canada) and RespiFinder (Pathofinder, Maastricht, the Netherlands), to name a few. As mentioned previously, the NP1 and NS1 proteins are usually the targets in PCR. Type-specific or nonspecific primers and sequencing of the PCR product can be utilized to differentiate between the HBoV genotypes. RT-PCR is more advantageous than the conventional PCR, being more precise and quicker, but it can be limiting since it requires expensive oligoprobes. Quantitative PCR can help judge

8

Human Bocavirus

241

the clinical significance of the viral genome detected, with high viral loads correlating with acute infections, less co-infections, and severe ailment, and vice versa. However, PCR is not an optimum technique of diagnosis as the virus could be shed for over several months after the acute infection, being persistent in some tissues. An accurate diagnosis requires active multiplication to be validated. This can be proven by detecting a peripheral blood viremia or spliced viral RNA transcripts that are prevalent solely while active replication of the virus (Schildgen 2018a, b; Peltola 2013; Guido 2016). Apart from using PCR to detect viral DNA, recent research also illustrates how HBoV-specific IgG and IgM-antibodies could be detected in the serum against its VP2 with the help of western blot or immunofluorescence assays (Zaghloul 2011). Serological methods can detect specific antibodies by utilizing recombinant capsid antigens or VLPs (Peltola 2013). ELISA and EIA are consistent, qualitative, and quantitative that can be employed for IgG affinity detection as well. It uses recombined VP2 or VLP capsid proteins. The VLP is obtained from a baculovirus vector infected insect cell line, and it can produce rabbit anti-HBoV antisera, which finds application in developing an ELISA test. The IgG avidity test helps distinguish between primary and secondary infections or immune activations, which can be highly specific. According to some studies, children who are already immune to HBoV2 also demonstrate cross-reactivity with HBoV1. Antibodies toward HBoV2, 3, and 4 from past infections may cross-react with HBoV1. Hence, for accurate detection of serological responses to HBoV1, the HBoV2, 3, and 4 reactive antibodies should be completely depleted (Peltola 2013). Again, however, considering the extremely high persistence of human bocaviruses, the clinical interpretation of the serological tests could be equally complex as that of the PCR results (Guido 2016). Lately, the development of a rapid antigen test could be a major advancement in HBoV diagnosis (Schildgen 2018a, b). Due to the limitations of the diagnostic methods available, adopting two tests to diagnose HBoV infection is highly recommended (Ison 2017). Acute infection could be accurately diagnosed using PCR for detecting viral DNA in serum and by using quantitative PCR for respiratory tract samples. IgM or a diagnostic IgG reaction could simultaneously be detected in paired serum samples. Extremely elevated copy numbers of the virus (>104 HBoV1 genomes/mL of NPA) detected by PCR could denote recent illness. PCR and serological methods can also be used to detect HBoV2, 3, and 4; however, viral load and the severity of illness have not been correlated (Peltola 2013). Zaghloul performed ELISA to verify if IgM antibodies are present in serum and qualitative PCR of NPA in children. Both were extremely sensitive and precise, but PCR was comparatively more sensitive than ELISA (100% vs. 81.8%) but showed lower specificity (78% vs. 100%) (Guido 2016).

242

8.8

M. Chakraborty and P. L. Bhukya

Therapy, Prevention, and Control

To this point, there has been little research on the persistence of HBoV or the efficacy of commonly used hospital-grade disinfectants on the survival of the virus (Schildgen 2008). Mature virions can endure lipid solvents, pH levels of 3–9 or, for some species, temperatures of 56 °C for a minimum of 60 minutes. Viral inactivation could be achieved with formalin, β-propiolactone, hydroxylamine, oxidizing agents, or UV (Anonymous 2005). It is already known that other parvoviruses can resist disinfectant treatment to a great extent. Further research on HBoV would be necessary, requiring a virus-specific culture medium or animal model for infection (Schildgen 2008). The high occurrence of pneumonia could justify the usage of antimicrobial chemotherapy for HBoV-positive patients. (Schildgen 2008). The antivirals prescribed currently are the ones found to be effective against other similar RTIs. Research that compares such antivirals in HBoV-positive subjects is not yet available. Supportive measures to alleviate the symptoms resulting from an HBoV infection are the only available therapy. Pulsed, high-dose glucocorticoid therapy might benefit those suffering from severe HBoV-associated pulmonary disease (Obenaus n.d.). There has been a case report in which the patient, suffering from an HHV-6 co-infection, post treatment with Cidofovir, was free of the virus (Streiter 2011). Appropriate isolation and treatment suggested by a medical professional should be practiced by patients with confirmed HBoV infections (Ison 2017). At present, there is no vaccine available for the prophylaxis or treatment of HBoV. The only way to prevent and control currently is personal care and maintenance of cleanliness and hygiene. Hand washing at regular intervals and whenever needed, especially before meals, practicing proper sneezing and coughing etiquette, following a healthy, balanced diet along with an exercise routine, and keeping your surroundings clean are essential to keep one fit and away from all diseases and infections. Developing a quick and precise HBoV diagnostic technique could lessen the incorrect and usually ineffective usage of antibiotics in such subjects (Schildgen 2008). Extensive research about HBoV will help develop an appropriate treatment plan.

8.9

Conclusion and Future Perspectives

The human bocavirus, despite being recently identified, has piqued as much curiosity as the other better-characterized viruses in the family. HBoV1 has also come into the limelight as a gene delivery vector, as it is able to cause infection in polarized human airway epithelia and possesses a 5.5 kb genome packaging capacity (Yu 2021). Several fronts of HBoV’s biology, such as taxonomy, phylogeny, associations with different viruses and pathogens, epidemiology, and how it interacts with human cells, to name a few, remain obscure. Understanding these aspects is mandatory to assess if the virus is a harmless passenger or a true pathogen (Guido 2016). The

8

Human Bocavirus

243

experimental validation of Koch’s modified postulates has not been possible yet because of the unavailability of any suitable animal model or a cell culture medium. The accurate diagnosis of HBoV requires further attention as there is increasing evidence showing that it could be linked to severe viral respiratory infections, at times with life-threatening complications. Moreover, evidences of HBoV’s contribution to persistent infection of the airways, causing lung cancer or fibrosis, have also been found. Therefore, it is imperative to analyze its long-term effects and identify the mechanisms of its tenacity and resistance. The unavailability of diagnostic assays separating persistence and reactivation of HBoV from primary infections is a limiting factor (Guido 2016). There have been studies to identify the antigenic epitopes on the surface of the virus, that could contribute to the advancement in vaccine or antibody-based therapies. Elaborate research on the structure and molecular mechanisms of the virion will help scientists develop effective and specific antivirals to treat HBoV infection. As per recent in vitro research, HBoV VP2 VLPs have proven to be potent immunogens, capable of inducing strong humoral and cellular immune reactions, showing potential as candidate proteins for the formulation of a vaccine. According to newer data, creating a non-replicating infectious HBoV1 mutant could also contribute to vaccine development (Guido 2016; Deng 2014; Shen 2015; Schildgen 2018a, b, 2008). Nevertheless, more studies on the development of cell lines and animal models to support the culturing of the virus are required to better comprehend the natural course of HBoV infection. Infectious clones and easier procedures of culturing should be developed. The functions of many HBoV proteins require to be studied and understood better. Commercial diagnostic test kits and methods need advancements as well. In-depth research to understand disease pathogenesis and progression will be necessary to fathom the immunity in the populations it infects, characterized by children, the elderly, or the immunocompromised patients, who respond to HBoV infection. The respiratory viruses, which are the most prevalent and common cause of human diseases, continue to astonish researchers despite years of investigation.

References Al Bishawi A (2021) Bocavirus infection in a young pregnant woman: a case report and literature review. Am J Case Reports 22(1):1–5 Allander T (2005) Cloning of a human parvovirus by molecular screening of respiratory tract samples. Proc Natl Acad Sci U S A 102(36):12891–12896 Allander T (2008) Human bocavirus. J Clin Virol 41(1):29–33 Anonymous (2005) The single stranded DNA viruses. In Virus taxonomy: eighth report of the international committee on taxonomy of viruses. s.l.:s.n., pp 277–369. Anonymous (2008) Human bocavirus: passenger or pathogen in acute respiratory tract infections? Clin Microbiol Rev 21(2):291–304 Anonymous (2010) Human bocavirus capsid structure: insights into the structural repertoire of the parvoviridae. J Virol 84(12):5880–5889

244

M. Chakraborty and P. L. Bhukya

Anonymous (2011) Phylogenetic and recombination analysis of human bocavirus 2. BMC Infect Dis 11 Anonymous (2016) Human bocavirus: current knowledge and future challenges. World J Gastroenterol 22(39):8684–8697 Anonymous (n.d.-a) Elsevier reference collection in biomedical sciences | ScienceDirect. [Online]. https://www.sciencedirect.com/referencework/9780128012383/biomedical-sciences Anonymous (n.d.-b) Genus: bocaparvovirus—parvoviridae—ssDNA Viruses—ICTV. [Online]. Arthur JL (2009) A novel bocavirus associated with acute gastroenteritis in Australian children. PLoS Pathog 5(4):e1000391 Burrell CJ (2017) Parvoviruses. In: s.l.:Elsevier, pp. 289–296. Burrell CJ, Howard CR, Murphy FA (2016) Fenner and White’s medical virology. s.l.:s.n. Cheng W (2011) Phylogenetic and recombination analysis of human bocavirus 2. BMC Infect Dis 11:50 Choi SH (2021) Severe human bocavirus-associated pneumonia in adults at a referral hospital, Seoul, South Korea. Emerg Infect Dis 27(1):226–228 Deng ZH (2014) Immunogenicity of recombinant human bocavirus-1,2 VP2 gene virus-like particles in mice. Immunology 142(1):58–66 Dijkman R (2009) Human bocavirus can be cultured in differentiated human airway epithelial cells. J Virol 83(15):7739–7748 Fry AM et al (2007) Human bocavirus: a novel parvovirus epidemiologically associated with pneumonia requiring hospitalization in Thailand. J Infect Dis 195(7):1038–1045 Guido M (2016) Human bocavirus: current knowledge and future challenges. World J Gastroenterol 22(39):8684–8697 Gurda BL (2010) Human bocavirus capsid structure: insights into the structural repertoire of the parvoviridae. J Virol 84(12):5880–5889 Hamza H (2017) Relative abundance of human bocaviruses in urban sewage in Greater Cairo, Egypt. Food Environ Virol 9(3):304–313 Hao Y (2015) Seroepidemiology of human bocaviruses 1 and 2 in China. PloS One 10(4) Hu, Q., 2021. Inducible gene-I -acid mediated ubiquitination of retinoic -125 pathway by inhibiting ring finger protein β human bocavirus VP2 upregulates IFN. Huang Q (2012) Establishment of a reverse genetics system for studying human bocavirus in human airway epithelia. PLoS Pathog 8(8):1002899 Ison MG (2017) Noninfluenza respiratory viruses. In: Infectious diseases. s.l.:s.n., pp. 1472–1482.e5. Kang LH (2018) Whole-genome sequencing analysis of human bocavirus detected in South Korea. Epidemiol Infect 146(7):839–847 Kapoor A (2009) A newly identified bocavirus species in human stool. J Infect Dis 199(2):196–200 Kapoor A (2010) Human bocaviruses are highly diverse, dispersed, recombination prone, and prevalent in enteric infections. J Infect Dis 201(11):1633–1643 Lee HN (2019) Human bocavirus infection in adults: clinical features and radiological findings. Korean J Radiol 20(7):1226–1235 Mietzsch M (2017) Structural insights into human bocaparvoviruses. J Virol 91(11) Netshikweta R (2020) Molecular epidemiology of human bocavirus infection in hospitalized children with acute gastroenteritis in South Africa, 2009–2015. J Med Virol 92(8):1124–1132 Obenaus M (n.d.) Early view high-dose glucocorticoid treatment of near-fatal Bocavirus lung infection results in rapid recovery Peltola V (2013) Human bocavirus infections. Pediatr Infect Dis J 32(2):178–179 Ricour C (2008) Human bocavirus, a newly discovered parvovirus of the respiratory tract. Acta Clin Belgica 63(5):329–334 Schildgen O (2008) Human bocavirus: passenger or pathogen in acute respiratory tract infections? Clin Microbiol Rev 21(2):291–304 Schildgen O (2010) Human bocavirus: increasing evidence for virulence. Pediatr Pulmonol 45: 118–119

8

Human Bocavirus

245

Schildgen O (2012) Genomic features of the human bocaviruses. Future Virol 7(1):31–39 Schildgen O (2013) Human bocavirus: lessons learned to date. Pathogens 2(1):1–12 Schildgen O (2018a) The role of the human bocavirus (HBoV) in respiratory infections. Adv Tech Diagn Microbiol 2:281–301 Schildgen V (2018b) Human bocavirus infection of permanent cells differentiated to air-liquid interface cultures activates transcription of pathways involved in tumorigenesis. Cancer 10(11): 410 Sharif N (2020) Molecular and epidemiological trends of human bocavirus and adenovirus in children with acute gastroenteritis in Bangladesh during 2015 to 2019. J Med Virol 92(12): 3194–3201 Shen W (2015) Identification and functional analysis of novel nonstructural proteins of human bocavirus 1. J Virol 89(19):10,097–10,109 Söderlund-Venermo M (2010) Serologically verified human bocavirus pneumonia in children. Pediatr Pulmonol 45(2):120–126 Streiter M (2011) Does human bocavirus infection depend on helper viruses? A challenging case report. Virol J 8:417 Wang Z (2017) Parvovirus expresses a small noncoding RNA that plays an essential role in virus replication. J Virol 91(8) Weston S (2019) Respiratory viruses. In Encyclopedia of microbiology. s.l.:s.n., pp 85–101 Xu M (2021) Persistence of human bocavirus 1 in tonsillar germinal centers and antibodydependent enhancement of infection. MBio 12(1):1–15 Yu JC (2021) Characterization of the GBoV1 capsid and its antibody interactions. Viruses 13(2): 330 Zaghloul MZ (2011) Human bocavirus (HBoV) in children with respiratory tract infection by enzyme linked immunosorbent assay (ELISA) and qualitative polymerase chain reaction (PCR). Virol J 8(1):1–5 Ziemele I (2019) Acute human bocavirus 1 infection in child with life-threatening bilateral bronchiolitis and right-sided pneumonia: a case report. J Med Case Reports 13(1):290

9

Measles: The Disease That Refuses to Be Vanquished Aparna Talekar and Matteo Porotto

Abstract

Measles is one of the most contagious diseases, marked by its high R0 value. Although the current vaccine provides lifelong immunity, several misconceptions have caused a recent fall in vaccination levels. This has led to a resurgence in measles infections worldwide. Transmitted via a respiratory route, the virus infects dendritic cells early on and later spreads to T and B cells in the lymphoid organs before spreading systemically. This stage is marked by lymphopenia and immunological amnesia, resulting in opportunistic infections for up to two years after a measles infection. This has been attributed to the loss of memory T cells due to the viral infection. A rare, progressive, fatal central nervous system (CNS) complication occurs in 1 in 10,000 cases and is known as subacute sclerosing panencephalitis (SSPE). SSPE incidence is as high as 1:400 when infection occurs in children younger than a year. Immunocompromised people are at risk of another CNS manifestation (measles inclusion body encephalitis, MIBE). There is no standard treatment for measles. Ribavirin inhibits the replication of the virus in vitro but is ineffective in vivo. These factors have led to a renewed interest in the mechanism of transmission and antiviral therapy for the CNS complications associated with the measles virus.

A. Talekar (✉) Department of Microbiology, St. Xavier’s College, Mumbai, India e-mail: [email protected] M. Porotto Center for Host-Pathogen Interaction, Department of Pediatrics, Columbia University Vagelos College of Physicians and Surgeons, New York, NY, USA Department of Experimental Medicine, University of Studies of Campania ‘Luigi Vanvitelli’, Naples, Italy # The Author(s), under exclusive license to Springer Nature Singapore Pte Ltd. 2023 P. L. Bhukya et al. (eds.), Emerging Human Viral Diseases, Volume I, https://doi.org/10.1007/978-981-99-2820-0_9

247

248

A. Talekar and M. Porotto

Keywords

Immune amnesia · CNS infection · Viral persistence

9.1

Introduction

Measles, the most infectious viral disease known to mankind, has been known for several centuries, and despite the existence of a very effective vaccine since the early 1960s, it has not been eliminated from the human population. Unlike many other respiratory viruses, it does not remain localized in the respiratory system but attacks the unlikeliest cells, such as macrophages, B cells, and T cells. After achieving a systemic spread, it returns to the respiratory tract, where it began, and exits via the respiratory epithelial cells using a completely different receptor than in the immune cells. This interesting journey leaves the host in an immunocompromised state with respect to other infections. In addition, the virus can also persist to cause a few different types of severe neurological consequences. It is therefore not surprising that the measles and rubella initiative is still one of the major priorities of the World Health Organization (WHO). Brief history: Measles was first described as early as the ninth century AD by the Persian doctor Abu Bakr Mohammad Ibn Zakariya Al-Razi (Ghafouri et al. 2019). The early 16th-century victory of the Spanish conquistadors over the Inca population has been attributed in part to the decimation of the native population by diseases like measles (Oldstone 2000). In 1757, Scottish physician Francis Home showed measles transmission through blood and also attempted vaccination efforts, which unfortunately did not succeed (Enders 1961). The measles virus (MeV) was first isolated and propagated in the tissue culture by Enders and Peebles in 1954 (Enders and Peebles 1954). Enders also led the first attenuation efforts to generate the live vaccine. Eventually, in 1963, a live-attenuated vaccine against measles became available (Enders 1963). The number of measles cases dropped precipitously after this. The “measles and rubella initiative” was launched by the WHO along with organizations, such as UNICEF and American Red Cross. In 2016, the Americas were declared measles-free. For other WHO regions, a few individual countries but not entire regions have also been declared measles-free.

9.2

Epidemiology

Geographical distribution/demographics: Measles predominates in the developing world. The countries with the highest number of reported measles cases are represented in Fig. 9.1.

9

Measles: The Disease That Refuses to Be Vanquished

249

1212

1 1275

867 5604

82290 10000

82290

1000

25

100 10 0

Fig. 9.1 Number of reported measles cases in 2020: As per the global health network of the WHO. The five countries with the highest number of cases have been marked with the number of cases

Fig. 9.2 The number of cases of measles: The data obtained from the WHO global health network records show reported cases of measles year-wise. There is a large reduction in cases early due to the vaccine; however, the number of cases has risen in the past few years due to the reduction in vaccination coverage

9.2.1

Age, Mortality, and Morbidity

Measles is considered to be a childhood disease, affecting children below five years of age. However, recent epidemics have shown that people of all age groups are affected by measles (Makarenko et al. 2022). A study showed that measles infection was higher among males compared to females across all age groups (Green et al. 2022). Measles is one of the most infectious communicable diseases. The number of measles cases has been on the rise in the last few years (Fig. 9.2). In 2019, 873,000 measles cases were reported worldwide.

250

9.2.2

A. Talekar and M. Porotto

Origin of Infection and Diversity

MeV belongs to the paramyxoviridae family. There are 24 recorded genotypes of MeV (A, B1–B3, C1–C2, D1–D11, E, F, G1–G3, and H1–H2), belonging to 8 different clades classified based on the guidelines from the WHO (Beaty and Lee 2016). These different genotypes of MeV have been identified based on the 450 nt sequence corresponding to the 150 amino acids at the carboxy-terminal end of the N protein of the virus per the WHO standards (Rota et al. 2011; World Health Organization 2013). Neither the severity of the disease nor the clinical findings have any correlation with the measles genotype (Kühne et al. 2006). Measles has a substitution rate/base/year on the order of 10-4 to 10-5, which is low compared to other RNA viruses such as retroviruses. This characteristic low rate is not shared by all other paramyxoviridae family members (Beaty and Lee 2016). Although the neurovirulent SSPE strains show a lot of difference from strains causing acute infections, the rates of substitution in these were also comparable to the acute strains (Woelk et al. 2002). Unlike the many genotypes recorded, all MeV isolates belong to a single serotype. Spread of disease (epidemics, sporadic, pandemics, etc.): Measles has the highest R0 of all viruses. It is usually quoted as 12–18 but can vary from this number in different citations (Guerra et al. 2017). Although the introduction of the vaccine lowered the numbers worldwide, many regions, such as southeast Asia, continue to face problems with measles elimination. Even Europe had high incidence rates in countries such as Romania, Ukraine, and Greece attributed to low vaccination coverage (Leong and Wilder-Smith 2019). Biosafety measures (handling of virus): MeV is a biosafety level 2 (BSL-2) agent. It belongs to risk group 2. This is because there is an effective preventive measure available against the measles virus (Pawar et al. 2022).

9.3

Potential Risk of Emergence and Re-Emergence

Health Protection Agency UK and WHO collaborated to initiate a database called the MeaNS project. This collects MeV sequence information from GenBank and has helped with global tracking of the disease (Rota et al. 2011). One of the most recent outbreaks of measles was recorded in Mexico, with 176 laboratory-confirmed cases up to June 2020 (Solórzano-Santos et al. 2020). Measles causes outbreaks in many developing nations, and sporadic cases continue to be reported in unvaccinated individuals in regions where vaccination coverage is low, like Afghanistan (Newsdesk 2021). In recent years, countries such as the Democratic Republic of the Congo, Nigeria, Samoa, Ukraine, and Madagascar have also seen measles outbreaks. Most of these outbreaks have been associated with lower vaccine coverage due to a variety of reasons, including antivaccine tendencies and internal political conflicts leading to the collapse of healthcare systems. In the period from November 2021 to April 2022 alone, there were 17,794 cases of measles in Nigeria alone, as per WHO provisional estimates (CDCGlobal 2022). Since the introduction

9

Measles: The Disease That Refuses to Be Vanquished

251

of the vaccine, the case numbers have drastically decreased. However, the risk of re-emergence is very high because of the level of herd immunity required for the virus is high. The recent COVID-19 pandemic has led to reduced vaccination coverage, which has serious implications for the resurgence of the measles virus (Gambrell et al. 2022).

9.4

Organization of Infectious Agents (Structural and Molecular)

9.4.1

Classification

The species Measles morbillivirus is placed in the Morbillivirus genus of the family paramyxoviridae. In fact, the typical member listed for the family is the measles virus Ichinose B95a. The family includes negative-strand RNA viruses that have a large size and their host range includes mammals, birds, reptiles, and fish (Rima et al. 2019). The virus was renamed as Measles morbillivirus in 2016 and is named as such in the tenth report of the ICTV (International Committee on Taxonomy of Viruses) (Van Regenmortel 2019). Realm: Riboviria Kingdom: Orthornavirae Phylum: Negarnaviricota Subphylum: Haploviricotina Class: Monjiviricetes Order: Mononegavirales Family: Paramyxoviridae Subfamily: Orthoparamyxovirinae Genus: Morbillivirus Species: Measles morbillivirus

9.4.2

Morphology and Virion Structure

MeV is a pleomorphic enveloped virus with a size ranging from 50 to 510 nm (Liljeroos et al. 2011). There are two multimeric surface glycoproteins present on the viral membrane: the hemagglutinin (H) and the fusion (F) protein (Plemper et al. 2011). Inside the envelope, the nucleocapsid is surrounded by the matrix protein (M), which probably associates with the membrane and glycoproteins as well (Liljeroos et al. 2011; Ke et al. 2018). The MeV nucleocapsid consists of the negative-stranded RNA wrapped with the protein N. Along with these are the large polymerase L and the phosphoprotein (P) (Fig. 9.3) (Griffin 2013). Genome structure and organization: The measles virus genome is a single strand of negative-sense RNA. At 15,984 nt, the length of the MeV genome is in the middle of the range of paramyxovirus genome lengths (14,000–18,000 nt) (Jack et al. 2005; Rima and Duprex 2009; Bankamp et al. 2014). The 3′ end of the genome shows a

252

A. Talekar and M. Porotto

Fig. 9.3 Measles virus (MeV) structure: The virus structure shows an envelope with the two surface glycoproteins, H and F, enclosing the nucleocapsid made of RNA coated with the N protein. Associated with the N protein are the polymerase L and phosphoprotein P

leader sequence. The genome codes for six structural (N, P, M, F, H, and L) and two non-structural (C and V) proteins. The order of the genes is as follows: 3’-N-P/C/VM-F-H-L-5′. Each gene is separated from the next by three nucleotides. Each gene is flanked by untranslated regions (UTR) at the 3′ and 5′ ends (Rima and Duprex 2009; Beaty and Lee 2016).

9.4.3

Propagation and Assay in In vitro and In vivo Laboratory Models

Nonhuman primates (NHPs) are the only known natural hosts of measles other than humans. Most experiments that employ NHPs have used cynomolgus or rhesus macaques, but several other old-world monkeys and even new monkeys (squirrel monkeys, marmosets, and tamarins) have been used as models for measles infection (Delpeut et al. 2017). Natural infection may also occur through human-to-primate transmission, as shown by laboratory facility infections or seroprevalence in natural settings (Willy et al. 1999; Jones-Engel et al. 2006). Wildtype (WT) MeV strains use CD150 as the entry receptor. Unmodified mice do not get infected with MeV as the virus glycoprotein H cannot bind to mouse CD150 (Fukuhara et al. 2019). Still, there have been many attempts to mimic the disease in a mouse model by generating transgenic mouse lines expressing host cell receptors of human origin. Predominantly CD46- and CD150-expressing mice have been generated (Sellin and Horvat 2009). In mice, CD46 expression is seen only in the testis (Kemper et al. 2001). Human CD46 isoforms have been expressed from different promoters, such as

9

Measles: The Disease That Refuses to Be Vanquished

253

Hydroxymethylglutaryl coenzyme A reductase (HMGCR) and neuronal specific receptor (NSR), in transgenic mice and they have been generated on a variety of immunologically deficient backgrounds. These have been intensively studied for MeV pathogenesis, immune suppression, neuronal transmission, and the role of CD46 in infection. Most of these mouse models are susceptible only after an intracranial inoculation (Sellin and Horvat 2009). One exception is the genomic CD46-expressing mouse on the type I interferon receptor (IFNR KO) background, which can be infected via the natural intranasal route, resulting in a respiratory disease (Mrkic et al. 1998). The CD150 of mouse origin is not used by MeV for entry. Transgenic mice expressing CD150 under different promoters have been used to study wild-type viral infection in mice (Sellin and Horvat 2009). To explore the role of infection in lymphocytes, expression of CD150 under the control of Lck was used in a transgenic setting. These mice showed infection of T cells after intraperitoneal (i.p.) infection and immunosuppression, characteristic of measles infection (Hahm et al. 2003). CD150 has also been expressed under the control of the CD11c promoter, which restricts the CD150 expression on dendritic cells (DCs), but these mice show a low percentage of DC infection in vivo. In vitro, the infected DCs show inhibition of T-cell activation and immunosuppression via STAT2 (but not STAT1) (Hahm et al. 2004; Hahm et al. 2005). Genomic CD150 has been expressed with human or mouse CD150 promoters in a transgenic setting to mimic expression patterns in vivo. A pan-cell expression using the HMGCR promotor was also made. Some of these transgenic mice were also crossed with IFNR KO mice. A mouse model that could mimic the human host in terms of expression of both receptors was generated with the transgenic CD46-CD150 mouse. This model matched the expression pattern seen in humans but was not susceptible to the measles virus (Sellin and Horvat 2009). This showed that the lack of receptor was not the only factor that restricted measles infection in mouse models. In fact, many studies have shown that host factors such as type I interferon play a major role in restricting measles infection in mouse models (Mura et al. 2018). An alternate rodent model used has been the cotton rat. In cotton rats, MeV has been shown to use the SLAM/CD150 receptor just as in humans and to cause a respiratory illness after intranasal delivery (Niewiesk 1999; Carsillo et al. 2014). As in the case of humans, a primary measles infection protects against reinfection with measles but leads to a loss of immune response against other antigens (Niewiesk et al. 1997). MeV causes many CNS-related complications. Brain organoids have been useful systems to study these complications for many viruses. Still, organoid cultures have some drawbacks, such as the absence of a blood-brain barrier (Depla et al. 2022). Canine distemper virus (CDV) is studied as a surrogate system for the measles virus due to its similarity to the measles life cycle and larger host range at the same time (Rendon-Marin et al. 2019).

254

9.4.4

A. Talekar and M. Porotto

Viral Proteins and Life Cycle

9.4.4.1 Hemagglutinin (H) Glycoprotein MeV H is a type II glycoprotein with its N terminus extending out of the membrane. MeV H binds to multiple cellular receptors. The wildtype virus binds to signaling lymphocyte-activation molecule-1 (SLAM-1) or CD150 on immune cells and also nectin-4 (also known as PVRL4 or Poliovirus receptor like-4) on epithelial cells (Tatsuo et al. 2000; Noyce et al. 2011; Mühlebach et al. 2011). In addition, vaccine or laboratory strains, such as the Edmonston strain of the virus, can also bind to a ubiquitously expressed molecule: CD46 (Naniche et al. 1993; Dörig et al. 1993). The viral attachment protein has been well characterized with crystal structures available not only for the glycoprotein head domain alone but also cocrystallized with its receptors (Colf et al. 2007; Santiago et al. 2010; Hashiguchi et al. 2011b). Although the MeV H protein does not display neuraminidase activity, it does show the six-blade β-propeller fold characteristic of the attachment proteins of paramyxoviridae family members. Binding to the cellular receptor occurs at the side of the β-propeller fold, unlike other attachment proteins of paramyxoviridae family members, which bind to their receptors using the top pocket. The binding sites for the three receptors and various monoclonal antibodies against the H protein show considerable overlap, which has implications for vaccine effectivity (Hashiguchi et al. 2011a). MeV H exists as a tetramer (dimer of dimers) in fusion complexes (Brindley and Plemper 2010). Cysteine residues at positions 139 and 154 mediate disulfide bond formation to allow dimerization (Plemper et al. 2000). Of the five putative glycosylation sites on MeV H, four are used (168, 187, 200, and 215). Mutating the asparagine residues at these sites has variable effects on the antigenicity and folding. Loss of multiple glycosylation sites showed more pronounced effects (Hu et al. 1994). The stalk region of the MeV H has not been crystallized. However, mutation studies indicate that the stalk interacts with the MeV F protein. Among the paramyxoviridae family members, there is considerable conservation in the way that attachment and fusion proteins interact and function, as shown by a variety of chimeric protein studies (Lee et al. 2008; Talekar et al. 2013). 9.4.4.2 Fusion (F) Glycoprotein The MeV F protein is a type I glycoprotein that exists as a trimer. It is synthesized in the endoplasmic reticulum as a single continuous polypeptide denoted as F0. During its travel to the plasma membrane, it undergoes cleavage to give two subunits, F1 and F2, which remain connected through a disulfide bridge (Scheid and Choppin 1977; Griffin 2013). The cleavage occurs in the trans-Golgi network and is mediated by furin, a subtilisin-like protease that requires calcium for its activity (Watanabe et al. 1995). This cleavage occurs at a multibasic site R-R-H-K-R in the F0 protein and is shared by other morbilliviruses (Morrison 2003). Other structurally important regions of the F protein include a hydrophobic fusion peptide (FP) at the N-terminus of the F2 segment and heptad repeat regions at the N (HRN) and C (HRC) termini. The FP is inserted into the cell membrane while the HRC and HRN form (during the

9

Measles: The Disease That Refuses to Be Vanquished

255

fusion process) a six-helix bundle (6-HB) (Hashiguchi et al. 2018). The F2 peptide also contains a third heptad repeat domain that affects the fusogenicity of the virus (Plemper and Compans 2003). MeV F is N-glycosylated at three different sites. Mutation of the arginine residues at one or more of these sites has been shown to affect the expression, processing, transport, and/or fusion capabilities of the protein (Alkhatib et al. 1994). The F proteins arising from SSPE or MIBE strains are found to be more fusogenic with many substitutions (Watanabe et al. 2013; Angius et al. 2019). These substitutions were shown to allow recombinant virus to infect and propagate in neurons without fusogenic pathology. The substitutions showed severe cytopathology but low titers in other cells, indicating that these mutations allowed an adaptation for neurovirulence (Watanabe et al. 2015).

9.4.4.3 P, C, and V Proteins The phosphoprotein (P) of MeV serves as a cofactor for the polymerase protein. The protein has been shown to have many distinct domains with many roles. The P protein interacts with both the nucleoprotein and the polymerase (Guseva et al. 2019). Interaction with the nucleoprotein is through two separate domains of the P protein. The C terminus of the protein forms a three helical domain known as the XD domain, while the rest of the protein is essentially disordered. The protein also contains a coiled-coil oligomerization domain, which allows tetramerization of the protein recently shown to have an effect on gene expression (Communie et al. 2013; Bloyet et al. 2019). The XD domain of the P protein (PXD) binds to the tail domain of the N protein (NTAIL). The strength of this interaction determines the rate of viral transcription. This seems particularly important for initiating transcription at the beginning of each gene on the viral RNA (Bloyet et al. 2016). Another point of interaction between the P and the N proteins is the N-terminus of the P protein (PNT) and the CORE domain of the N protein (NCORE). This has been shown to recruit the polymerase (L) protein to the 3′ end of the nucleocapsid (Brunel et al. 2014). This binding also acts as a chaperon for the newly synthesized N protein so that it does not bind to host RNA or get translocated into the nucleus (Huber et al. 1991). The phosphoprotein gene codes for the two other protein products: C and V (Fig. 9.4). The P/C/V gene is 1655 nt long. The P gene is translated from position 60 nt to 1582 nt to give a 507aa protein. Similarly, the V protein (299aa) is initiated at position 60 nt, giving an identical 231aa sequence at the N terminus of each protein. However, for the V protein, there is a co-transcriptional addition of G after 752 nt, giving a completely different C terminal region of 68aa (Bellini et al. 1985; Cattaneo et al. 1989). The C protein is initiated at position 82 nt to give a frameshifted 186aa-long protein with an overlapping reading frame from 82 nt to 642 nt. To probe the overall effect of C and V proteins on infection, C- and V-mutant viruses were used for infection and showed lower titers in cell culture of human origin and transgenic mouse model (Patterson et al. 2000; Shaffer et al. 2003). In a CD46 transgenic mouse model for CNS disease, the mutant viruses exhibited milder symptoms, showed a lower death rate, and needed a higher infectious dose. V protein seemed particularly responsible for the transcription rate and CNS spread (Patterson et al. 2000). In the case of the C protein, the effects were found to be due

256 nt position in the genome nt position in the gene

A. Talekar and M. Porotto

1748 1 60 82

642 752

952

3402 1655 1583

P/C/V gene P/C/V mRNA 507aa

P protein 299aa

V protein C protein

186aa

Fig. 9.4 Alternative processing of the P/C/V gene: The P/C/V gene, the mRNA, and the three alternate proteins (P, C, and V) are shown as indicated. The nucleotide position in the genome and for the gene is indicated above the schematic. The length of the proteins is indicated by the number of amino acids on the right. For the V protein, the blue region indicates an identical N terminus with the P protein, whereas the green region indicates an entirely different C terminus as a result of the cotranscriptional insertion of a G residue indicated by a black arrow in the mRNA arrow after position 752 nt of the gene

to the production of higher numbers of defective interfering (DI) particles that are recognized by the RIG-I-like receptors of the immune system (Runge et al. 2014; Pfaller et al. 2015). A role in RNA processivity was predicted for the C protein based on these results. The C protein also controls viral transcription and genome synthesis (Bankamp et al. 2005). Recent evidence suggests that the C protein binds to the ribonucleoprotein and may have a larger role to play in keeping the polymerase on its template for a longer time (Pfaller et al. 2020). C protein also plays a role in directly evading immune response by inhibiting the interferon pathway and lowering the ability of the infected cell to respond to interferon (Shaffer et al. 2003). C protein has also been implicated in inhibiting apoptosis, possibly through an effect on PKR (Toth et al. 2009; Bhattacharjee et al. 2019). V protein is also known to inhibit type I/II interferon pathways. Several researchers have shown this to be the result of the ability of the V protein to interact with STAT1/2 transcription factors and prevent their nuclear translocation or prevent their phosphorylation (Takeuchi et al. 2003a; Devaux et al. 2007; Ramachandran et al. 2008; Nagano et al. 2020).

9.4.4.4 M Protein The M protein is thought to be associated with both the cell membrane (Riedl et al. 2002) as well as the cytoplasmic tails of the glycoproteins H and F (Cathomen et al. 1998; Tahara et al. 2007). Early research thus indicated that the M protein coats the inner leaflet of the viral lipid envelope. However, the protein also interacts with the nucleocapsid and thus influences the assembly of the virus (Iwasaki et al. 2009). Later electron cryotomographic studies have led to suggestions that the M protein

9

Measles: The Disease That Refuses to Be Vanquished

257

coats the nucleocapsid in the cytoplasm and interacts with the viral envelope only while budding (Liljeroos et al. 2011). More recently, similar studies done with whole cells to investigate native states of proteins suggest a model where M forms a lattice mainly with F glycoprotein to promote assembly, where it interacts with both glycoproteins and ribonucleoprotein (RNP) (Ke et al. 2018). M protein is found in the nucleus early in the infection and plays a role in shutting down host cell transcription (Suryanarayana et al. 1994; Yu et al. 2016) while enhancing viral transcription and genome synthesis (Reuter et al. 2006). M protein has also been altered in SSPE and MIBE strains and is thus thought to be involved for these CNS pathologies (Cattaneo et al. 1988a; Cattaneo et al. 1988b; Kweder et al. 2015).

9.4.4.5 N Protein During the formation of the nucleocapsid structure, each N protein binds to six successive RNA nucleotides. As a result, for paramyxoviridae family members, replication is only efficient if the total number of nucleotides in the RNA is divisible by 6 (Calain and Roux 1993; Kolakofsky et al. 1998). The paramyxovirus nucleoprotein consists of two major domains: the N-terminal domain NCORE and the C-terminal domain NTAIL. Near atomic structure of artificial nucleocapsid for measles has shown that each N binds to the previous N molecule in the nucleocapsid helix via its C-terminal domain while associating with the next N molecule via its N-terminal domain (Gutsche et al. 2015). The N-terminal domain NTAIL escapes out of the helix and contributes to the flexibility of this structure (Guseva et al. 2019). Both the NCORE and NTAIL domains interact with the phosphoprotein domains as described for the phosphoprotein. The P protein binds to the newly formed N protein so that the N protein does not bind to cellular RNA (Guseva et al. 2019). Many crystallographic and electron microscopic studies have been done with ribonucleoprotein rings that form from short RNAs and the N protein. These are amenable to studies due to their rigid nature but are not biologically active (Desfosses et al. 2011). The NTAIL region of the protein has been reported to mediate immune reaction by interacting with IRF-3 to induce the RANTES gene (Colombo et al. 2009). Different domains of the N protein have also been implicated in apoptosis and cell cycle arrest (Laine et al. 2005). 9.4.4.6 L Protein The L gene codes for the large polymerase of the measles protein (247kD) through a single open reading frame (Blumberg et al. 1988). The L proteins of paramyxoviruses show the catalytic functions of an RdRp (RNA-dependent RNA polymerase), a PRNTase (poly-ribonucleotidyltransferase), and an mTase (methyltransferase). Additionally, it has a CTD (C-terminal domain) and a domain that connects the RdRp and PRNTase with the rest of the protein (Abdella et al. 2020). L protein domains from different viruses were not able to transcomplement even though they could oligomerize (Dochow et al. 2012).

258

9.4.5

A. Talekar and M. Porotto

Life Cycle of the Virus

9.4.5.1 Host Cell Receptors and Cell Tropism Measles virus H protein has been shown to bind to a variety of cellular receptors. The Edmonston and Halle laboratory strains of the virus were shown to bind to CD46 or membrane cofactor protein (MCP), a receptor present on almost all human cells (Naniche et al. 1993; Dörig et al. 1993). This receptor is shared by some other viruses, such as human herpes virus 6, and is used even by the bacterium Neisseria meningitidis for attachment via pilus (Santoro et al. 1999; Källström et al. 2001). The region of CD46 required for binding to MeV H is deleted in many monkey species, which explains why some of them cannot be infected by the laboratory strains (Riley et al. 2002). A second receptor was postulated to explain the cell tropism and host range of the WT MeV strains. This was eventually shown to be CD150 or SLAM, a member of the signaling lymphocyte activation molecule family (Tatsuo et al. 2000; Hsu et al. 2001). Unlike CD46, CD150 shows a more restricted expression, mainly in cells of the immune system, such as activated T, B, monocytes, dendritic cells, and natural killer (NK) cells (Wang et al. 2001; Farina et al. 2004). Most of these are targets of WT MeV. The affinity of WT MeV H for CD150 is comparable to the affinity of Edmonston H for CD46 (Navaratnarajah et al. 2008). However, binding to these receptors could not explain infection of primary cells of epithelial origin in the cell culture, such as small airway epithelial cells (SAEC), cell lines such as lung adenocarcinoma, or cells in vivo such as tracheal cells late in infection, as none of these cells expressed either of the aforementioned receptors (Takeuchi et al. 2003b; Takeda et al. 2007; Leonard et al. 2008). The use of a third receptor by MeV was hypothesized by many researchers and was eventually identified simultaneously by two different groups as Nectin-4 or PVRL4 (Noyce et al. 2011; Mühlebach et al. 2011). MeV-H binds with Nectin-4 with higher affinity than the other two receptors, with a Kd of 20 nM (Mühlebach et al. 2011). Nectin-4 has been shown to be important for epithelial cell infection as the virus exits the host (Frenzke et al. 2013). Both CD150 and Nectin-4 are also used by other members of the morbillivirus genus, such as peste des petits ruminants virus (PPRV), canine distemper virus (CDV), and phocine distemper virus (Lin and Richardson 2016). 9.4.5.2 Viral Entry Immune cells are thought to be the initial target of MeV, while epithelial cells are targeted at a later stage. MeV enters cells by attaching to one of its receptors. MeV H is thought to exist in two different conformations. Two different groups have proposed two different strategies to explain how this conformational change may allow activation of MeV F and viral entry. The MeV F protein inserts its fusion peptide into the host cell membrane and bends to form a six-helix bundle from the two heptad repeat regions HRN and HRC. This bending can be inhibited by peptides derived from the heptad repeat regions (Lambert et al. 1996). This mediates fusion between the cell membrane and viral envelope, delivering the viral nucleocapsid into the host cell (Bovier et al. 2021).

9

Measles: The Disease That Refuses to Be Vanquished

259

9.4.5.3 Viral Protein Synthesis and Replication The virus shares the steps of replication with all other members of the paramyxoviridae family. It has a negative-sense RNA and thus carries a copy of viral polymerase L in the viral particle along with the associated N and P proteins. Virus replication occurs in distinct sites in the cytoplasm, mostly in perinuclear areas (Ludlow et al. 2005). The negative-sense RNA is replicated to a positive-sense strand which serves as mRNA for protein synthesis as well as template for more negative-sense strands to be packaged in newly formed virion particles. The viral genome is a continuous strand with six different genes. Most of the viral genome remains associated with the N protein during transcription, likely dissociating from the genome for only short stretches as the polymerase moves along (Noton and Fearns 2015). The genome is transcribed by a start-stop mechanism to produce subgenomic positive-stranded RNAs that act as mRNAs. The transcription is performed by the viral RNA dependent RNA polymerase: the large protein L. A 55 nucleotide leader sequence is transcribed first which regulates host cell transcription and may regulate immune response (Ray et al. 1991). Then, the first gene N is initiated at the 3′ end and transcription ends at the stop codon for gene N. The next gene P is transcribed by re-initiation at the 3′ end of the P gene. As noted earlier, the P gene can give three different gene products. Each gene is initiated separately with the efficiency going down with each gene sequentially. This leads to smaller amounts of gene products for the genes that come later in the order (Whelan et al. 2004; Dutch 2008). The subgenomic RNAs are capped by the L protein itself. Studies with vesicular stomatitis virus (VSV) previously suggested that negativestrand RNA viruses may follow a capping mechanism distinct from eukaryotes (Ogino and Banerjee 2011). However, recently, at least two morbilliviruses, PPRV and RPV, have been shown to use conventional mechanism capping (Ansari et al. 2019). The subgenomic RNAs accrue linearly for about 6 h after infection and exponentially for the next 18 hours corresponding to the synthesis of new copies of the L protein (Plumet et al. 2005). The genomic RNA synthesis requires the transcription of the entire length of the negative genome into a positive strand known as the antigenomic RNA. The 3′ end of the genome has the trailer sequence, which is transcribed as a promoter in the positive-stranded complement. This promoter allows transcription of the entire negative-stranded genome copies. Unlike the subgenomic RNAs, the genomic and antigenomic RNAs are not capped. The genomic RNA, transcribed from the complete positive-strand antigenome, is made with the leader sequence that acts as an encapsidation signal (Castaneda and Wong 1990). Accumulation of N protein is thought to allow the switch from subgenomic RNA and protein synthesis to replication (Plumet et al. 2005). 9.4.5.4 Assembly and Exit of the Virus The measles glycoproteins are transported via the endoplasmic reticulum (ER) to the host cell membrane. The MeV H and F have been shown to interact with each other in the ER, unlike the binding and fusion proteins of some other viruses such as parainfluenza 5 (PIV5) (Plemper et al. 2001). The viral genome is encapsidated by the N protein and associates with the L and P proteins. The M protein promotes

260

A. Talekar and M. Porotto

assembly through interaction with nucleoprotein as well as the glycoproteins on the membranes. The virus is released from the apical surface of the polarized epithelial cells. However, MeV H and F are not transported in a polarized manner and are found even on the basolateral surface (Maisner et al. 1998). Lipid rafts are shown to be sites for measles assembly. Proteins such as M protein are also seen to be associated with the lipid rafts when associated with the genome, even in the absence of the H and F glycoproteins (Manié et al. 2000; Vincent et al. 2000). Of the two glycoproteins, F seems to have an innate ability to partition into lipid rafts, whereas H probably goes to the lipid rafts via its association with the F glycoprotein (Vincent et al. 2000). Actin cytoskeleton is also involved with virus budding (Bohn et al. 1986; Dietzel et al. 2013). Unlike many other viruses, MeV does not use the endosomal sorting machinery of the ESCRT (endosomal sorting complexes required for transport) proteins (Salditt et al. 2010). Microtubules and actin cytoskeleton are both needed for the assembly and exit of the virus (Nakatsu et al. 2013; Dietzel et al. 2013). MeV shuts off host protein synthesis via the binding of viral N protein to cellular factor needed for cap-dependent translation and phosphorylation of certain initiation factors (Sato et al. 2007; Inoue et al. 2009). However, the viral mRNA continues to be synthesized under the influence of the autoantigen La, which binds to the 5’-UTR as shown, at least for the N gene (Inoue et al. 2011).

9.5

Pathogenesis in Humans

9.5.1

Host Range

Humans and some non-human primates (NHPs) are the only natural hosts for the measles virus. While non-human primates can be experimentally inoculated to produce a measles-like disease, mouse models do not show infection unless modified in some way (van Binnendijk et al. 1995; Griffin 2013).

9.5.2

Disease Course

The disease course is shown in Fig. 9.5. Measles enters its host cells via the respiratory route by airborne droplets. The virus uses CD150 receptor-positive cells for initial entry into the host cells and not the nectin-4 receptor, as shown with studies using viruses that are blind to either receptor in NHP models (Leonard et al. 2008; Frenzke et al. 2013). The early targets of the virus include macrophages and dendritic cells (DCs), which are CD11c+ myeloid cells (de Swart et al. 2007). Entry of MeV into DCs requires adhesion of the glycosylations on MeV glycoproteins with DC-SIGN (DC-specific intercellular adhesion molecule 3-grabbing nonintegrin). This interaction alone, however, does not mediate entry (de Witte et al. 2006). An alternative route of entry may be through the conjunctiva (Laksono et al. 2016). One to two days post infection, the virus reaches bronchus associated lymphoid tissue (BALT) and, later, lymph nodes. Once the virus reaches

9

Measles: The Disease That Refuses to Be Vanquished

261

Fig. 9.5 Course of the disease: The virus enters the lungs and infects CD150-bearing myeloid cells. These cells carry the virus to BALT (Bronchus associated lymphoid tissue) and other secondary lymphoid organs to infect T and B cells among others. The virus reaches systemic circulation before exiting through the respiratory epithelium using the nectin-4 receptor

BALT and lymph nodes, it undergoes a huge increase in numbers by replication in T and B cells (de Swart et al. 2007; Lemon et al. 2011). Lymphoid organs are the primary sites of measles amplification (de Vries et al. 2012). Infection of T cells happens via direct contact with infected DCs through a synapse that shows selective redistribution of certain cellular proteins (Koethe et al. 2012). This is followed by a systemic spread of the virus to various organs like the liver, kidney, gastrointestinal tract, and skin. MeV spreads systemically. The virus has been shown to cause a productive infection of endothelial cells, leading to the release of progeny virions on both sides of the endothelial barrier (Dittmar et al. 2008). The virus then uses a completely different receptor, nectin-4, to infect respiratory epithelial cells through the basolateral surface. This allows the shedding of the virus through the apical surface, ensuring dissemination of the virus to new hosts (Noyce and Richardson 2012).

9.5.3

Host Factors Involved

Other than the host cell receptors CD46, CD150, and nectin-4, host factors include SHC binding and spindle associated 1 (SHCBP1), HSP72, kinases such as casein

262

A. Talekar and M. Porotto

kinase II, and cytoskeletal elements such as actin and tubulin (Delpeut et al. 2012; Jiang et al. 2016). This list does not include molecules that regulate or mediate immune response, dealt with later in this chapter. HSP72 modulates viral transcription rate by competing with the P protein for binding to the NTAIL domain of the N protein, improving the processivity of the L protein (Zhang et al. 2005). A variety of different kinases have been postulated to be responsible for phosphorylation of the P protein, enhancing or downregulating RNA synthesis and viral transcription, respectively (Sugai et al. 2012; Sugai et al. 2013). Many viruses exploit the cytoskeletal machinery for intracellular transport. MeV shedding in polarized epithelial cells depends on microtubules and recycling endosomes that have Rab11a (Nakatsu et al. 2013). F-actin was also shown to be important for transport of the RNP to the membrane and, more importantly, for preventing premature fusion by H and F by allowing M protein transport with the RNP (Dietzel et al. 2013).

9.5.4

Host Immune Response (Innate and Immune)

Infection with measles in early stages results in an innate response with the secretion of cytokines such as IL-1β, IL-2, IL-6, IL-10, IL-17, TNF-α, and IFNγ. At the same time, there is downregulation of IL-12. Although interferon production is a mainstay of early immune response against RNA viruses, measles infection does not induce it. This is the result of the action of the immunomodulatory proteins of the virus, as stated earlier. The virus does induce inflammasome. The cytokine and chemokine profile concurs with inflammasome and NF-κB activation (Griffin 2016). Infection with MeV results in a strong anti-measles immune response that gives lifelong immunity against measles. However, at the same time, the infected individual is briefly susceptible to opportunistic infections through a generalized immunosuppression, a phenomenon referred to as the measles paradox (de Vries et al. 2012; Morris et al. 2018). Although deficiency in lymphocytes numbers in measles lasts for a brief period, the immune amnesia remains for almost 2–3 years. This is thought to be due to the recovery of T cell numbers through the expansion of measles-specific T cells (Morris et al. 2018).

9.5.5

Virulence and Persistence

Although measles is very often cleared without adverse effects, on rare occasions, it can remain in the body and even affect CNS with serious to fatal outcomes. At least three known severe complications of primary measles infection have been described. The first one is the most common CNS complication: ADEM (Acute disseminated encephalomyelitis). ADEM can result from a variety of viral infections and vaccinations against viral diseases among other causes. The incidence and severity of ADEM after primary measles infection are much higher (1/1000 cases with elevated mortality) than vaccine-associated ADEM (1/1000,000 cases) (Fenichel 1982). The onset is usually a few days to months after initial infection or vaccination.

9

Measles: The Disease That Refuses to Be Vanquished

263

The disease mostly affects children (median age 6.5 years) and is characterized by ataxia, changed mental status, and in most severe cases, leukoencephalopathy, generally due to demyelination (Menge et al. 2005; Buchanan and Bonthius 2012). Two hypotheses have been put forward to explain the cause of ADEM. One hypothesis suggests that the infections damage the blood-brain barrier, leading to leakage of sequestered autoantigens into the bloodstream causing an autoimmune reaction. The second hypothesis revolves around molecular mimicry by antigens of pathogenic origins to set off autoimmunity, with mimicry of host protein vimentin suggested in the case of measles (Fujinami et al. 1983; Menge et al. 2005). The second most common consequence of MeV infection is MIBE (Measles Inclusion Body Encephalitis). MIBE is known to occur mostly within a year of a primary measles infection or vaccination, although there have been reports of longer periods of latency (Freeman et al. 2004; Buchanan and Bonthius 2012). MIBE typically occurs in severely immunocompromised individuals. Symptoms include seizures that do not respond to anticonvulsant treatment. SSPE is another CNS complication of measles. It is rare in occurrence with 0.004–0.011 cases per 100 primary infections. SSPE occurs more frequently when primary infection has occurred at an age lower than two years. Vaccination against measles has not been associated with SSPE. The disease begins with behavioral problems and usually progresses to death (Buchanan and Bonthius 2012). A hyperfusogenic F protein has been shown to be associated with the CNS complications. Many mutations such as the L454W and T461I mutation have been shown to make the F protein unstable. With these mutated F, infection can occur in the absence of any of the known receptors. It has been shown that inhibiting the F protein with peptides leads to the prevention of CNS spread. This shows the importance of the F protein in CNS complications (Jurgens et al. 2015; Mathieu et al. 2021). Alarmingly viruses carrying an unstable F can still spread outside the CNS as shown in cotton rat animal model (Mathieu et al. 2019). Although many early reports suggest that the M protein expression may be very little or absent in SSPE infection, many recent papers suggest that the M protein may also be mutated to adapt to CNS spread (Lin and Thormar 1980; Patterson et al. 2001). SSPE and MIBE strains have been recorded to belong to multiple genotypes, but these mostly correspond to the circulating strain during primary infection (Beaty and Lee 2016).

9.6

Clinical Manifestations

9.6.1

Phases of Disease and Symptoms

The typical infection shows 7–14 days of incubation period. This is followed by the triad of conjunctivitis, coryza, and cough accompanied by fever. The characteristic symptoms may also include spots on the buccal mucosa known as Koplik spots. These symptoms last for a couple of days before a characteristic maculopapular rash is seen. The infection begins to clear following this period and is mostly selflimiting. This coincides with the killing of infected cells by T cells. It marks the

264

A. Talekar and M. Porotto

peak of viremia and also the start of the decline of the virus. Most infections clear without further complications. A minority of infections can show CNS complications (Griffin 2013; Laksono et al. 2016).

9.7

Diagnostics and Therapeutics Approaches

In the case of an outbreak, the symptoms of measles include fever, rash, Koplik spots, and conjunctivitis. These symptoms were regarded as sufficient for diagnosis. However, a definitive diagnosis has been deemed necessary to confirm reported cases of measles (Sharma et al. 2022). Diagnosis may be either through detection of the virus or antibodies against the virus. Although virus culturing is possible, it is often not the method of choice due to non-uniformity in animal cell lines and the longer time required (Griffin 2013). Real-time reverse transcriptase polymerase chain reaction (real-time RT-PCR) with several genes from measles is currently the preferred technique to demonstrate viral presence in clinical samples (mostly nasopharyngeal swabs). RT-PCR has mainly been done using the N gene primers. However, other genes such as H and F have also been targeted (Hummel et al. 2006; Pabbaraju et al. 2019). The detection of antibodies is another technique used (Tuokko and Salmi 1983).

9.8

Prevention and Control

9.8.1

Management of Disease

Measles is known to have severe effects in children with vitamin A deficiency. Vitamin A is recommended by the WHO to treat measles infection to be given in two doses. A systematic review found that although this recommended two-dose regimen was linked to some lowering of death in measles cases, a single dose had no effect (Huiming et al. 2005). There are several challenges to developing antivirals to measles. Borad spectrum antivirals such as ribavirin and pegylated IFN-γ have been tried clinically. However, they are not advisable due to their high level of toxicity. Many small molecules are in trial but none have reached the clinic (Plemper 2020).

9.8.2

Prophylaxis

The existing measles vaccine was first developed by Enders in 1954 and eventually licensed in 1963 (Katz 2009). The vaccine strain developed by Enders is the Edmonston strain. AIK-C, Edmoston-Zagreb, Moraten, and Shwartz are strains derived from the Edmonston strain through different attenuation protocols. Other vaccine strains, including CAM-70, Shanghai-191, and Leningrad-16, have been developed through separate lineages, but all are related to genotype A (Griffin 2018).

9

Measles: The Disease That Refuses to Be Vanquished

265

All isolates of MeV belong to a single serotype, which has been advantageous for the immunization program. All tested MeV isolates can be neutralized by sera collected either from vaccinees or individuals naturally infected with the virus (Tamin et al. 1994). There is some difference in the sera from the two, however. Neutralization by sera from vaccinees shows involvement of antibodies mostly against the H glycoprotein. Most of these antibodies bind to the site on H that overlaps with binding to all three receptors, as discussed above (Hashiguchi et al. 2011a). This explains the effectiveness of the vaccine since this region may not tolerate mutations. The H glycoprotein itself is well conserved across genotypes and does not show too many mutations (Kimura et al. 2015). Most studies thus show that measles infections occur mostly in unvaccinated or incompletely vaccinated individuals (Muscat et al. 2009). By 2019, 20 of the 24 measles genotypes were eradicated by vaccination efforts. Of the reported cases in 2019, nearly 4/fifth belonged to D8 and 1/fifth belonged to B3 strains, while a small fraction of cases were due to D4 and H1 genotypes (World Health Organization 2020a). It was reported that MMR vaccine could lead to behavioral changes similar to autism in a case series. Subsequently, studies have shown that there is no association between the MMR vaccine for measles and incidence of autism (Taylor et al. 1999). The paper reporting the autism findings was also retracted later (Rao and Andrade 2011). However, the damage due to the earlier report was seen in the rise in measles cases. Public perception towards the vaccine had changed, and it resulted in a lower rate of vaccination. Measles which is highly contagious requires that a high level of vaccination is maintained to avoid outbreaks (Woo et al. 2004). During the COVID-19 pandemic, there was reduced vaccination coverage in most regions for most vaccines, including MeV-containing vaccines. The situation was reported to be especially dire in Africa, with outbreaks in Yemen and many places in sub-Saharan Africa. Some regions did show reduced numbers of measles cases, probably due to reduced contact during the COVID-19 pandemic (World Health Organization 2020b). Although very effective, there are reports of vaccine breakthrough cases (Bianchi et al. 2022). These unfortunate events have delayed the WHO goal of measles eradication.

9.9

Future Perspective

Measles due to its highly infectious nature has become a global threat despite having an effective vaccine. We require a dedicated effort to adhere to the new vaccination goals. In the meantime, however, we also need new therapeutics to deal with any infections that occur in endemic areas and susceptible, unvaccinated populations.

266

A. Talekar and M. Porotto

References Abdella R, Aggarwal M, Okura T, Lamb RA, He Y (2020) Structure of a paramyxovirus polymerase complex reveals a unique methyltransferase-CTD conformation. Proc Natl Acad Sci U S A 117(9):4931–4941. https://doi.org/10.1073/pnas.1919837117 Alkhatib G, Shen SH, Briedis D, Richardson C, Massie B, Weinberg R, Smith D, Taylor J, Paoletti E, Roder J (1994) Functional analysis of N-linked glycosylation mutants of the measles virus fusion protein synthesized by recombinant vaccinia virus vectors. J Virol 68(3): 1522–1531. https://doi.org/10.1128/JVI.68.3.1522-1531.1994 Angius F, Smuts H, Rybkina K, Stelitano D, Eley B, Wilmshurst J, Ferren M, Lalande A, Mathieu C, Moscona A, Horvat B, Hashiguchi T, Porotto M, Hardie D (2019) Analysis of a subacute sclerosing panencephalitis genotype B3 virus from the 2009–2010 South African measles epidemic shows that hyperfusogenic f proteins contribute to measles virus infection in the brain. J Virol 93(4). https://doi.org/10.1128/JVI.01700-18 Ansari MY, Singh PK, Rajagopalan D, Shanmugam P, Bellur A, Shaila MS (2019) The large protein “L” of Peste-des-petits-ruminants virus exhibits RNA triphosphatase activity, the first enzyme in mRNA capping pathway. Virus Genes 55(1):68–75. https://doi.org/10.1007/s11262018-1617-5 Bankamp B, Liu C, Rivailler P, Bera J, Shrivastava S, Kirkness EF, Bellini WJ, Rota PA (2014) Wild-type measles viruses with non-standard genome lengths. PLoS One 9(4):e95470. https:// doi.org/10.1371/journal.pone.0095470 Bankamp B, Wilson J, Bellini WJ, Rota PA (2005) Identification of naturally occurring amino acid variations that affect the ability of the measles virus C protein to regulate genome replication and transcription. Virology 336(1):120–129. https://doi.org/10.1016/j.virol.2005.03.009 Beaty SM, Lee B (2016) Constraints on the genetic and antigenic variability of measles virus. Viruses 8(4):109. https://doi.org/10.3390/v8040109 Bellini WJ, Englund G, Rozenblatt S, Arnheiter H, Richardson CD (1985) Measles virus P gene codes for two proteins. J Virol 53(3):908–919. https://doi.org/10.1128/JVI.53.3.908-919.1985 Bhattacharjee S, Jaiswal RK, Yadava PK (2019) Measles virus phosphoprotein inhibits apoptosis and enhances clonogenic and migratory properties in HeLa cells. J Biosci 44(1) Bianchi S, Gori M, Fappani C, Ciceri G, Canuti M, Colzani D, Dura M, Terraneo M, Lamberti A, Baggieri M, Senatore S, Faccini M, Magurano F, Tanzi E, Amendola A (2022) Characterization of vaccine breakthrough cases during measles outbreaks in Milan and surrounding areas, Italy, 2017–2021. Viruses 14(5):1068. https://doi.org/10.3390/v14051068 Bloyet L-M, Brunel J, Dosnon M, Hamon V, Erales J, Gruet A, Lazert C, Bignon C, Roche P, Longhi S, Gerlier D (2016) Modulation of re-initiation of measles virus transcription at intergenic regions by PXD to NTAIL binding strength. PLoS Pathog 12(12):e1006058. https://doi.org/10.1371/journal.ppat.1006058 Bloyet L-M, Schramm A, Lazert C, Raynal B, Hologne M, Walker O, Longhi S, Gerlier D (2019) Regulation of measles virus gene expression by P protein coiled-coil properties. Sci Adv 5(5): eaaw3702. https://doi.org/10.1126/sciadv.aaw3702 Blumberg BM, Crowley JC, Silverman JI, Menonna J, Cook SD, Dowling PC (1988) Measles virus L protein evidences elements of ancestral RNA polymerase. Virology 164(2):487–497. https:// doi.org/10.1016/0042-6822(88)90563-6 Bohn W, Rutter G, Hohenberg H, Mannweiler K, Nobis P (1986) Involvement of actin filaments in budding of measles virus: studies on cytoskeletons of infected cells. Virology 149(1):91–106. https://doi.org/10.1016/0042-6822(86)90090-5 Bovier FT, Rybkina K, Biswas S, Harder O, Marcink TC, Niewiesk S, Moscona A, Alabi CA, Porotto M (2021) Inhibition of measles viral fusion is enhanced by targeting multiple domains of the fusion protein. ACS Nano. https://doi.org/10.1021/acsnano.1c02057 Brindley MA, Plemper RK (2010) Blue native PAGE and biomolecular complementation reveal a tetrameric or higher-order oligomer organization of the physiological measles virus attachment protein H. JVI 84(23):12174–12,184. https://doi.org/10.1128/JVI.01222-10

9

Measles: The Disease That Refuses to Be Vanquished

267

Brunel J, Chopy D, Dosnon M, Bloyet L-M, Devaux P, Urzua E, Cattaneo R, Longhi S, Gerlier D (2014) Sequence of events in measles virus replication: role of phosphoprotein-nucleocapsid interactions. J Virol 88(18):10,851–10,863. https://doi.org/10.1128/JVI.00664-14 Buchanan R, Bonthius DJ (2012) Measles virus and associated central nervous system sequelae. Semin Pediatr Neurol 19(3):107–114. https://doi.org/10.1016/j.spen.2012.02.003 Calain P, Roux L (1993) The rule of six, a basic feature for efficient replication of Sendai virus defective interfering RNA. J Virol 67(8):4822–4830. https://doi.org/10.1128/JVI.67.8. 4822-4830.1993 Carsillo T, Huey D, Levinsky A, Obojes K, Schneider-Schaulies J, Niewiesk S (2014) Cotton rat (Sigmodon hispidus) signaling lymphocyte activation molecule (CD150) is an entry receptor for measles virus. PLoS One 9(10):e110120. https://doi.org/10.1371/journal.pone.0110120 Castaneda SJ, Wong TC (1990) Leader sequence distinguishes between translatable and encapsidated measles virus RNAs. J Virol 64(1):222–230. https://doi.org/10.1128/JVI.64.1. 222-230.1990 Cathomen T, Mrkic B, Spehner D, Drillien R, Naef R, Pavlovic J, Aguzzi A, Billeter MA, Cattaneo R (1998) A matrix-less measles virus is infectious and elicits extensive cell fusion: consequences for propagation in the brain. EMBO J 17(14):3899–3908. https://doi.org/10. 1093/emboj/17.14.3899 Cattaneo R, Kaelin K, Baczko K, Billeter MA (1989) Measles virus editing provides an additional cysteine-rich protein. Cell 56(5):759–764. https://doi.org/10.1016/0092-8674(89)90679-x Cattaneo R, Schmid A, Billeter MA, Sheppard RD, Udem SA (1988a) Multiple viral mutations rather than host factors cause defective measles virus gene expression in a subacute sclerosing panencephalitis cell line. J Virol 62(4):1388–1397. https://doi.org/10.1128/JVI.62.4. 1388-1397.1988 Cattaneo R, Schmid A, Eschle D, Baczko K, ter Meulen V, Billeter MA (1988b) Biased hypermutation and other genetic changes in defective measles viruses in human brain infections. Cell 55(2):255–265. https://doi.org/10.1016/0092-8674(88)90048-7 CDCGlobal (2022) Global measles outbreaks. In: Centers for Disease Control and Prevention. https://www.cdc.gov/globalhealth/measles/data/global-measles-outbreaks.html. Accessed 28 Jun 2022 Colf LA, Juo ZS, Garcia KC (2007) Structure of the measles virus hemagglutinin. Nat Struct Mol Biol 14(12):1227–1228. https://doi.org/10.1038/nsmb1342 Colombo M, Bourhis J-M, Chamontin C, Soriano C, Villet S, Costanzo S, Couturier M, Belle V, Fournel A, Darbon H, Gerlier D, Longhi S (2009) The interaction between the measles virus nucleoprotein and the Interferon Regulator Factor 3 relies on a specific cellular environment. Virol J 6:59. https://doi.org/10.1186/1743-422X-6-59 Communie G, Crépin T, Maurin D, Jensen MR, Blackledge M, Ruigrok RWH (2013) Structure of the tetramerization domain of measles virus phosphoprotein. J Virol 87(12):7166–7169. https:// doi.org/10.1128/JVI.00487-13 de Swart RL, Ludlow M, de Witte L, Yanagi Y, van Amerongen G, McQuaid S, Yüksel S, Geijtenbeek TBH, Duprex WP, Osterhaus ADME (2007) Predominant infection of CD150+ lymphocytes and dendritic cells during measles virus infection of macaques. PLoS Pathog 3(11):e178. https://doi.org/10.1371/journal.ppat.0030178 de Vries RD, McQuaid S, van Amerongen G, Yüksel S, Verburgh RJ, Osterhaus ADME, Duprex WP, de Swart RL (2012) Measles immune suppression: lessons from the macaque model. PLoS Pathog 8(8):e1002885. https://doi.org/10.1371/journal.ppat.1002885 de Witte L, Abt M, Schneider-Schaulies S, van Kooyk Y, Geijtenbeek TBH (2006) Measles virus targets DC-SIGN to enhance dendritic cell infection. J Virol 80(7):3477–3486. https://doi.org/ 10.1128/JVI.80.7.3477-3486.2006 Delpeut S, Noyce RS, Siu RWC, Richardson CD (2012) Host factors and measles virus replication. Curr Opin Virol 2(6):773–783. https://doi.org/10.1016/j.coviro.2012.10.008

268

A. Talekar and M. Porotto

Delpeut S, Sawatsky B, Wong X-X, Frenzke M, Cattaneo R, von Messling V (2017) Nectin-4 interactions govern measles virus virulence in a new model of pathogenesis, the squirrel monkey (Saimiri sciureus). J Virol 91(11):e02490–e02416. https://doi.org/10.1128/JVI.02490-16 Depla JA, Mulder LA, de Sá RV, Wartel M, Sridhar A, Evers MM, Wolthers KC, Pajkrt D (2022) Human brain organoids as models for central nervous system viral infection. Viruses 14(3):634. https://doi.org/10.3390/v14030634 Desfosses A, Goret G, Farias Estrozi L, Ruigrok RWH, Gutsche I (2011) Nucleoprotein-RNA orientation in the measles virus nucleocapsid by three-dimensional electron microscopy. J Virol 85(3):1391–1395. https://doi.org/10.1128/JVI.01459-10 Devaux P, von Messling V, Songsungthong W, Springfeld C, Cattaneo R (2007) Tyrosine 110 in the measles virus phosphoprotein is required to block STAT1 phosphorylation. Virology 360(1):72–83. https://doi.org/10.1016/j.virol.2006.09.049 Dietzel E, Kolesnikova L, Maisner A (2013) Actin filaments disruption and stabilization affect measles virus maturation by different mechanisms. Virol J 10:249. https://doi.org/10.1186/ 1743-422X-10-249 Dittmar S, Harms H, Runkler N, Maisner A, Kim KS, Schneider-Schaulies J (2008) Measles virusinduced block of transendothelial migration of T lymphocytes and infection-mediated virus spread across endothelial cell barriers. J Virol 82(22):11273–11,282. https://doi.org/10.1128/ JVI.00775-08 Dochow M, Krumm SA, Crowe JE, Moore ML, Plemper RK (2012) Independent structural domains in paramyxovirus polymerase protein. J Biol Chem 287(9):6878–6891. https://doi. org/10.1074/jbc.M111.325258 Dörig RE, Marcil A, Chopra A, Richardson CD (1993) The human CD46 molecule is a receptor for measles virus (Edmonston strain). Cell 75(2):295–305. https://doi.org/10.1016/0092-8674(93) 80071-l Dutch RE (2008) Paramyxoviruses. In: Mahy BWJ, Van Regenmortel MHV (eds) Encyclopedia of virology, 3rd edn. Academic Press, Amsterdam; Boston, pp 52–57 Enders JF (1961) Vaccination against measles: Francis Home redivivus. Yale J Biol Med 34:239– 260 Enders JF (1963) Vaccination against measles. Aust J Exp Biol Med Sci 41:467–489. https://doi. org/10.1038/icb.1963.67 Enders JF, Peebles TC (1954) Propagation in tissue cultures of cytopathogenic agents from patients with measles. Proc Soc Exp Biol Med 86(2):277–286. https://doi.org/10.3181/0037972786-21073 Farina C, Theil D, Semlinger B, Hohlfeld R, Meinl E (2004) Distinct responses of monocytes to Toll-like receptor ligands and inflammatory cytokines. Int Immunol 16(6):799–809. https://doi. org/10.1093/intimm/dxh083 Fenichel GM (1982) Neurological complications of immunization. Ann Neurol 12(2):119–128. https://doi.org/10.1002/ana.410120202 Freeman AF, Jacobsohn DA, Shulman ST, Bellini WJ, Jaggi P, de Leon G, Keating GF, Kim F, Pachman LM, Kletzel M, Duerst RE (2004) A new complication of stem cell transplantation: measles inclusion body encephalitis. Pediatrics 114(5):e657–e660. https://doi.org/10.1542/ peds.2004-0949 Frenzke M, Sawatsky B, Wong XX, Delpeut S, Mateo M, Cattaneo R, von Messling V (2013) Nectin-4-dependent measles virus spread to the cynomolgus monkey tracheal epithelium: role of infected immune cells infiltrating the lamina propria. J Virol 87(5):2526–2534. https://doi. org/10.1128/JVI.03037-12 Fujinami RS, Oldstone MB, Wroblewska Z, Frankel ME, Koprowski H (1983) Molecular mimicry in virus infection: crossreaction of measles virus phosphoprotein or of herpes simplex virus protein with human intermediate filaments. Proc Natl Acad Sci U S A 80(8):2346–2350. https:// doi.org/10.1073/pnas.80.8.2346 Fukuhara H, Ito Y, Sako M, Kajikawa M, Yoshida K, Seki F, Mwaba MH, Hashiguchi T, Higashibata M-A, Ose T, Kuroki K, Takeda M, Maenaka K (2019) Specificity of morbillivirus

9

Measles: The Disease That Refuses to Be Vanquished

269

hemagglutinins to recognize SLAM of different species. Viruses 11(8):E761. https://doi.org/10. 3390/v11080761 Gambrell A, Sundaram M, Bednarczyk RA (2022) Estimating the number of US children susceptible to measles resulting from COVID-19-related vaccination coverage declines. Vaccine: S0264-410X(22)00782–4. https://doi.org/10.1016/j.vaccine.2022.06.033 Ghafouri RR, Araj-Khodaei M, Targhi ST, Varshochi M, Parsian Z, Yarani R, Golzari SEJ (2019) First report of a disease by rhazes 10 centuries ago. Int J Prev Med 10:6. https://doi.org/10.4103/ ijpvm.IJPVM_216_17 Green MS, Schwartz N, Peer V (2022) Gender differences in measles incidence rates in a multiyear, pooled analysis, based on national data from seven high income countries. BMC Infect Dis 22(1):358. https://doi.org/10.1186/s12879-022-07340-3 Griffin DE (2013) Measles VIRUS. In: Knipe DM, Howley PM (eds) Fields virology, 6th edn. Wolters Kluwer/Lippincott Williams & Wilkins Health, Philadelphia, PA Griffin DE (2016) The immune response in measles: virus control, clearance and protective immunity. Viruses 8(10):E282. https://doi.org/10.3390/v8100282 Griffin DE (2018) Measles vaccine. Viral Immunol 31(2):86–95. https://doi.org/10.1089/vim.2017. 0143 Guerra FM, Bolotin S, Lim G, Heffernan J, Deeks SL, Li Y, Crowcroft NS (2017) The basic reproduction number (R0) of measles: a systematic review. Lancet Infect Dis 17(12):e420– e428. https://doi.org/10.1016/S1473-3099(17)30307-9 Guseva S, Milles S, Blackledge M, Ruigrok RWH (2019) The nucleoprotein and phosphoprotein of measles virus. Front Microbiol 10:1832. https://doi.org/10.3389/fmicb.2019.01832 Gutsche I, Desfosses A, Effantin G, Ling WL, Haupt M, Ruigrok RWH, Sachse C, Schoehn G (2015) Near-atomic cryo-EM structure of the helical measles virus nucleocapsid. Science 348(6235):704–707. https://doi.org/10.1126/science.aaa5137 Hahm B, Arbour N, Naniche D, Homann D, Manchester M, Oldstone MBA (2003) Measles virus infects and suppresses proliferation of T lymphocytes from transgenic mice bearing human signaling lymphocytic activation molecule. J Virol 77(6):3505–3515. https://doi.org/10.1128/ jvi.77.6.3505-3515.2003 Hahm B, Arbour N, Oldstone MBA (2004) Measles virus interacts with human SLAM receptor on dendritic cells to cause immunosuppression. Virology 323(2):292–302. https://doi.org/10.1016/ j.virol.2004.03.011 Hahm B, Trifilo MJ, Zuniga EI, Oldstone MBA (2005) Viruses evade the immune system through type I interferon-mediated STAT2-dependent, but STAT1-independent, signaling. Immunity 22(2):247–257. https://doi.org/10.1016/j.immuni.2005.01.005 Hashiguchi T, Fukuda Y, Matsuoka R, Kuroda D, Kubota M, Shirogane Y, Watanabe S, Tsumoto K, Kohda D, Plemper RK, Yanagi Y (2018) Structures of the prefusion form of measles virus fusion protein in complex with inhibitors. Proc Natl Acad Sci U S A 115(10): 2496–2501. https://doi.org/10.1073/pnas.1718957115 Hashiguchi T, Maenaka K, Yanagi Y (2011a) Measles virus hemagglutinin: structural insights into cell entry and measles vaccine. Front Microbiol 2. https://doi.org/10.3389/fmicb.2011.00247 Hashiguchi T, Ose T, Kubota M, Maita N, Kamishikiryo J, Maenaka K, Yanagi Y (2011b) Structure of the measles virus hemagglutinin bound to its cellular receptor SLAM. Nat Struct Mol Biol 18(2):135–141. https://doi.org/10.1038/nsmb.1969 Hsu EC, Iorio C, Sarangi F, Khine AA, Richardson CD (2001) CDw150(SLAM) is a receptor for a lymphotropic strain of measles virus and may account for the immunosuppressive properties of this virus. Virology 279(1):9–21. https://doi.org/10.1006/viro.2000.0711 Hu A, Cattaneo R, Schwartz S, Norrby E (1994) Role of N-linked oligosaccharide chains in the processing and antigenicity of measles virus haemagglutinin protein. J Gen Virol 75(Pt 5): 1043–1052. https://doi.org/10.1099/0022-1317-75-5-1043 Huber M, Cattaneo R, Spielhofer P, Orvell C, Norrby E, Messerli M, Perriard JC, Billeter MA (1991) Measles virus phosphoprotein retains the nucleocapsid protein in the cytoplasm. Virology 185(1):299–308. https://doi.org/10.1016/0042-6822(91)90777-9

270

A. Talekar and M. Porotto

Huiming Y, Chaomin W, Meng M (2005) Vitamin A for treating measles in children. Cochrane Database Syst Rev (4):CD001479. https://doi.org/10.1002/14651858.CD001479.pub3 Hummel KB, Lowe L, Bellini WJ, Rota PA (2006) Development of quantitative gene-specific realtime RT-PCR assays for the detection of measles virus in clinical specimens. J Virol Methods 132(1–2):166–173. https://doi.org/10.1016/j.jviromet.2005.10.006 Inoue Y, Sato H, Fujita K, Tsukiyama-Kohara K, Yoneda M, Kai C (2011) Selective translation of the measles virus nucleocapsid mRNA by la protein. Front Microbiol 2:173. https://doi.org/10. 3389/fmicb.2011.00173 Inoue Y, Tsukiyama-Kohara K, Yoneda M, Sato H, Kai C (2009) Inhibition of host protein synthesis in B95a cells infected with the HL strain of measles virus. Comp Immunol Microbiol Infect Dis 32(1):29–41. https://doi.org/10.1016/j.cimid.2008.08.007 Iwasaki M, Takeda M, Shirogane Y, Nakatsu Y, Nakamura T, Yanagi Y (2009) The matrix protein of measles virus regulates viral RNA synthesis and assembly by interacting with the nucleocapsid protein. J Virol 83(20):10374–10,383. https://doi.org/10.1128/JVI.01056-09 Jack PJM, Boyle DB, Eaton BT, Wang L-F (2005) The complete genome sequence of J virus reveals a unique genome structure in the family Paramyxoviridae. J Virol 79(16):10690–10,700. https://doi.org/10.1128/JVI.79.16.10690-10700.2005 Jiang Y, Qin Y, Chen M (2016) Host-pathogen interactions in measles virus replication and antiviral immunity. Viruses 8(11). https://doi.org/10.3390/v8110308 Jones-Engel L, Engel GA, Schillaci MA, Lee B, Heidrich J, Chalise M, Kyes RC (2006) Considering human-primate transmission of measles virus through the prism of risk analysis. Am J Primatol 68(9):868–879. https://doi.org/10.1002/ajp.20294 Jurgens EM, Mathieu C, Palermo LM, Hardie D, Horvat B, Moscona A, Porotto M (2015) Measles fusion machinery is dysregulated in neuropathogenic variants. mBio 6(1):e02528–e02514. https://doi.org/10.1128/mBio.02528-14 Källström H, Blackmer Gill D, Albiger B, Liszewski MK, Atkinson JP, Jonsson AB (2001) Attachment of Neisseria gonorrhoeae to the cellular pilus receptor CD46: identification of domains important for bacterial adherence. Cell Microbiol 3(3):133–143. https://doi.org/10. 1046/j.1462-5822.2001.00095.x Katz SL (2009) John F. Enders and measles virus vaccine—a reminiscence. Curr Top Microbiol Immunol 329:3–11. https://doi.org/10.1007/978-3-540-70523-9_1 Ke Z, Strauss JD, Hampton CM, Brindley MA, Dillard RS, Leon F, Lamb KM, Plemper RK, Wright ER (2018) Promotion of virus assembly and organization by the measles virus matrix protein. Nat Commun 9(1):1736. https://doi.org/10.1038/s41467-018-04058-2 Kemper C, Leung M, Stephensen CB, Pinkert CA, Liszewski MK, Cattaneo R, Atkinson JP (2001) Membrane cofactor protein (MCP; CD46) expression in transgenic mice. Clin Exp Immunol 124(2):180–189. https://doi.org/10.1046/j.1365-2249.2001.01458.x Kimura H, Saitoh M, Kobayashi M, Ishii H, Saraya T, Kurai D, Tsukagoshi H, Shirabe K, Nishina A, Kozawa K, Kuroda M, Takeuchi F, Sekizuka T, Minakami H, Ryo A, Takeda M (2015) Molecular evolution of haemagglutinin (H) gene in measles virus. Sci Rep 5:11648. https://doi.org/10.1038/srep11648 Koethe S, Avota E, Schneider-Schaulies S (2012) Measles virus transmission from dendritic cells to T cells: formation of synapse-like interfaces concentrating viral and cellular components. J Virol 86(18):9773–9781. https://doi.org/10.1128/JVI.00458-12 Kolakofsky D, Pelet T, Garcin D, Hausmann S, Curran J, Roux L (1998) Paramyxovirus RNA synthesis and the requirement for hexamer genome length: the rule of six revisited. J Virol 72(2):891–899. https://doi.org/10.1128/JVI.72.2.891-899.1998 Kühne M, Brown DWG, Jin L (2006) Genetic variability of measles virus in acute and persistent infections. Infect Genet Evol 6(4):269–276. https://doi.org/10.1016/j.meegid.2005.08.003 Kweder H, Ainouze M, Brunel J, Gerlier D, Manet E, Buckland R (2015) Measles virus: identification in the M protein primary sequence of a potential molecular marker for subacute sclerosing panencephalitis. Adv Virol 2015:769837. https://doi.org/10.1155/2015/769837

9

Measles: The Disease That Refuses to Be Vanquished

271

Laine D, Bourhis JM, Longhi S, Flacher M, Cassard L, Canard B, Sautès-Fridman C, RabourdinCombe C, Valentin H (2005) Measles virus nucleoprotein induces cell-proliferation arrest and apoptosis through NTAIL-NR and NCORE-FcgammaRIIB1 interactions, respectively. J Gen Virol 86(Pt 6):1771–1784. https://doi.org/10.1099/vir.0.80791-0 Laksono BM, de Vries RD, McQuaid S, Duprex WP, de Swart RL (2016) Measles virus host invasion and pathogenesis. Viruses 8(8). https://doi.org/10.3390/v8080210 Lambert DM, Barney S, Lambert AL, Guthrie K, Medinas R, Davis DE, Bucy T, Erickson J, Merutka G, Petteway SR (1996) Peptides from conserved regions of paramyxovirus fusion (F) proteins are potent inhibitors of viral fusion. Proc Natl Acad Sci U S A 93(5):2186–2191. https://doi.org/10.1073/pnas.93.5.2186 Lee JK, Prussia A, Paal T, White LK, Snyder JP, Plemper RK (2008) Functional interaction between paramyxovirus fusion and attachment proteins. J Biol Chem 283(24):16561–16,572. https://doi.org/10.1074/jbc.M801018200 Lemon K, de Vries RD, Mesman AW, McQuaid S, van Amerongen G, Yüksel S, Ludlow M, Rennick LJ, Kuiken T, Rima BK, Geijtenbeek TBH, Osterhaus ADME, Duprex WP, de Swart RL (2011) Early target cells of measles virus after aerosol infection of non-human primates. PLoS Pathog 7(1):e1001263. https://doi.org/10.1371/journal.ppat.1001263 Leonard VHJ, Sinn PL, Hodge G, Miest T, Devaux P, Oezguen N, Braun W, McCray PB, McChesney MB, Cattaneo R (2008) Measles virus blind to its epithelial cell receptor remains virulent in rhesus monkeys but cannot cross the airway epithelium and is not shed. J Clin Invest 118(7):2448–2458. https://doi.org/10.1172/JCI35454 Leong W-Y, Wilder-Smith AB (2019) Measles resurgence in Europe: migrants and travellers are not the main drivers. J Epidemiol Glob Health 9(4):294–299. https://doi.org/10.2991/jegh.k. 191007.001 Liljeroos L, Huiskonen JT, Ora A, Susi P, Butcher SJ (2011) Electron cryotomography of measles virus reveals how matrix protein coats the ribonucleocapsid within intact virions. Proc Natl Acad Sci 108(44):18,085–18,090. https://doi.org/10.1073/pnas.1105770108 Lin FH, Thormar H (1980) Absence of M protein in a cell-associated subacute sclerosing panencephalitis virus. Nature 285(5765):490–492. https://doi.org/10.1038/285490a0 Lin L-T, Richardson CD (2016) The host cell receptors for measles virus and their interaction with the viral hemagglutinin (H) protein. Viruses 8(9). https://doi.org/10.3390/v8090250 Ludlow M, McQuaid S, Cosby SL, Cattaneo R, Rima BK, Duprex WP (2005) Measles virus superinfection immunity and receptor redistribution in persistently infected NT2 cells. J General Virol 86(8):2291–2303. https://doi.org/10.1099/vir.0.81052-0 Maisner A, Klenk H, Herrler G (1998) Polarized budding of measles virus is not determined by viral surface glycoproteins. J Virol 72(6):5276–5278. https://doi.org/10.1128/JVI.72.6.5276-5278. 1998 Makarenko C, San Pedro A, Paiva NS, Santos JPCD, Medronho RDA, Gibson G (2022) Measles resurgence in Brazil: analysis of the 2019 epidemic in the state of São Paulo. Rev Saude Publica 56:50. https://doi.org/10.11606/s1518-8787.2022056003805 Manié SN, de Breyne S, Debreyne S, Vincent S, Gerlier D (2000) Measles virus structural components are enriched into lipid raft microdomains: a potential cellular location for virus assembly. J Virol 74(1):305–311. https://doi.org/10.1128/jvi.74.1.305-311.2000 Mathieu C, Bovier FT, Ferren M, Lieberman NAP, Predella C, Lalande A, Peddu V, Lin MJ, Addetia A, Patel A, Outlaw V, Corneo B, Dorrello NV, Briese T, Hardie D, Horvat B, Moscona A, Greninger AL, Porotto M (2021) Molecular features of the measles virus viral fusion complex that favor infection and spread in the brain. mBio 12(3):e0079921. https://doi. org/10.1128/mBio.00799-21 Mathieu C, Ferren M, Jurgens E, Dumont C, Rybkina K, Harder O, Stelitano D, Madeddu S, Sanna G, Schwartz D, Biswas S, Hardie D, Hashiguchi T, Moscona A, Horvat B, Niewiesk S, Porotto M (2019) Measles virus bearing measles inclusion body encephalitis-derived fusion protein is pathogenic after infection via the respiratory route. J Virol 93(8):e01862–e01818. https://doi.org/10.1128/JVI.01862-18

272

A. Talekar and M. Porotto

Menge T, Hemmer B, Nessler S, Wiendl H, Neuhaus O, Hartung H-P, Kieseier BC, Stüve O (2005) Acute disseminated encephalomyelitis: an update. Arch Neurol 62(11):1673–1680. https://doi. org/10.1001/archneur.62.11.1673 Morris SE, Yates AJ, de Swart RL, de Vries RD, Mina MJ, Nelson AN, Lin W-HW, Kouyos RD, Griffin DE, Grenfell BT (2018) Modeling the measles paradox reveals the importance of cellular immunity in regulating viral clearance. PLoS Pathog 14(12):e1007493. https://doi.org/10.1371/ journal.ppat.1007493 Morrison TG (2003) Structure and function of a paramyxovirus fusion protein. Biochim Biophys Acta (BBA) Biomembranes 1614(1):73–84. https://doi.org/10.1016/S0005-2736(03)00164-0 Mrkic B, Pavlovic J, Rülicke T, Volpe P, Buchholz CJ, Hourcade D, Atkinson JP, Aguzzi A, Cattaneo R (1998) Measles virus spread and pathogenesis in genetically modified mice. J Virol 72(9):7420–7427. https://doi.org/10.1128/JVI.72.9.7420-7427.1998 Mühlebach MD, Mateo M, Sinn PL, Prüfer S, Uhlig KM, Leonard VHJ, Navaratnarajah CK, Frenzke M, Wong XX, Sawatsky B, Ramachandran S, McCray PB, Cichutek K, von Messling V, Lopez M, Cattaneo R (2011) Adherens junction protein nectin-4 is the epithelial receptor for measles virus. Nature 480(7378):530–533. https://doi.org/10.1038/nature10639 Mura M, Ruffié C, Billon-Denis E, Combredet C, Tournier JN, Tangy F (2018) hCD46 receptor is not required for measles vaccine Schwarz strain replication in vivo: Type-I IFN is the species barrier in mice. Virology 524:151–159. https://doi.org/10.1016/j.virol.2018.08.014 Muscat M, Bang H, Wohlfahrt J, Glismann S, Mølbak K, EUVAC.NET Group (2009) Measles in Europe: an epidemiological assessment. Lancet 373(9661):383–389. https://doi.org/10.1016/ S0140-6736(08)61849-8 Nagano Y, Sugiyama A, Kimoto M, Wakahara T, Noguchi Y, Jiang X, Saijo S, Shimizu N, Yabuno N, Yao M, Gooley PR, Moseley GW, Tadokoro T, Maenaka K, Ose T (2020) The measles virus v protein binding site to STAT2 overlaps that of IRF9. J Virol 94(17). https://doi. org/10.1128/JVI.01169-20 Nakatsu Y, Ma X, Seki F, Suzuki T, Iwasaki M, Yanagi Y, Komase K, Takeda M (2013) Intracellular transport of the measles virus ribonucleoprotein complex is mediated by Rab11A-positive recycling endosomes and drives virus release from the apical membrane of polarized epithelial cells. J Virol 87(8):4683–4693. https://doi.org/10.1128/JVI.02189-12 Naniche D, Varior-Krishnan G, Cervoni F, Wild TF, Rossi B, Rabourdin-Combe C, Gerlier D (1993) Human membrane cofactor protein (CD46) acts as a cellular receptor for measles virus. J Virol 67(10):6025–6032. https://doi.org/10.1128/JVI.67.10.6025-6032.1993 Navaratnarajah CK, Vongpunsawad S, Oezguen N, Stehle T, Braun W, Hashiguchi T, Maenaka K, Yanagi Y, Cattaneo R (2008) Dynamic interaction of the measles virus hemagglutinin with its receptor signaling lymphocytic activation molecule (SLAM, CD150). J Biol Chem 283(17): 11763–11,771. https://doi.org/10.1074/jbc.M800896200 Newsdesk (2021) Measles outbreaks in Afghanistan, Vaccination campaign commences. Outbreaknewstoday Niewiesk S (1999) Cotton rats (Sigmodon hispidus): an animal model to study the pathogenesis of measles virus infection. Immunol Lett 65(1–2):47–50. https://doi.org/10.1016/s0165-2478(98) 00123-0 Niewiesk S, Eisenhuth I, ten Meulen V (1997) Protective immunity, but suppressed immune responses to third party antigens are generated in cotton rats during measles virus infection. Biochem Soc Trans 25(2):355S. https://doi.org/10.1042/bst025355s Noton SL, Fearns R (2015) Initiation and regulation of paramyxovirus transcription and replication. Virology 479–480:545–554. https://doi.org/10.1016/j.virol.2015.01.014 Noyce RS, Bondre DG, Ha MN, Lin L-T, Sisson G, Tsao M-S, Richardson CD (2011) Tumor cell marker PVRL4 (nectin 4) is an epithelial cell receptor for measles virus. PLoS Pathog 7(8): e1002240. https://doi.org/10.1371/journal.ppat.1002240 Noyce RS, Richardson CD (2012) Nectin 4 is the epithelial cell receptor for measles virus. Trends Microbiol 20(9):429–439. https://doi.org/10.1016/j.tim.2012.05.006

9

Measles: The Disease That Refuses to Be Vanquished

273

Ogino T, Banerjee AK (2011) An unconventional pathway of mRNA cap formation by vesiculoviruses. Virus Res 162(1–2):100–109. https://doi.org/10.1016/j.virusres.2011.09.012 Oldstone MBA (2000) Measles. In Viruses, plagues, and history. Oxford University Press, Oxford Pabbaraju K, Gill K, Wong AA, Tipples GA, Hiebert J, Severini A, Fonseca K, Tellier R (2019) Simultaneous detection and differentiation between wild-type and vaccine measles viruses by a multiplex real-time reverse transcription-PCR assay. J Clin Microbiol 57(4):e01828–e01818. https://doi.org/10.1128/JCM.01828-18 Patterson JB, Cornu TI, Redwine J, Dales S, Lewicki H, Holz A, Thomas D, Billeter MA, Oldstone MB (2001) Evidence that the hypermutated M protein of a subacute sclerosing panencephalitis measles virus actively contributes to the chronic progressive CNS disease. Virology 291(2): 215–225. https://doi.org/10.1006/viro.2001.1182 Patterson JB, Thomas D, Lewicki H, Billeter MA, Oldstone MB (2000) V and C proteins of measles virus function as virulence factors in vivo. Virology 267(1):80–89. https://doi.org/10.1006/viro. 1999.0118 Pawar SD, Kode SS, Keng SS, Tare DS, Diop OM, Abraham P, Sharma DK, Sangal L, Yadav PD, Potdar VA (2022) Replication of SARS-CoV-2 in cell lines used in public health surveillance programmes with special emphasis on biosafety. Indian J Med Res 155(1):129–135. https://doi. org/10.4103/ijmr.ijmr_1448_21 Pfaller CK, Bloyet L-M, Donohue RC, Huff AL, Bartemes WP, Yousaf I, Urzua E, Clavière M, Zachary M, de Masson d’Autume V, Carson S, Schieferecke AJ, Meyer AJ, Gerlier D, Cattaneo R (2020) The C protein is recruited to measles virus ribonucleocapsids by the phosphoprotein. J Virol 94(4). https://doi.org/10.1128/JVI.01733-19 Pfaller CK, Mastorakos GM, Matchett WE, Ma X, Samuel CE, Cattaneo R (2015) Measles virus defective interfering RNAs are generated frequently and early in the absence of C protein and can be destabilized by adenosine deaminase acting on RNA-1-like hypermutations. J Virol 89(15):7735–7747. https://doi.org/10.1128/JVI.01017-15 Plemper RK (2020) Measles resurgence and drug development. Curr Opin Virol 41:8–17. https:// doi.org/10.1016/j.coviro.2020.02.007 Plemper RK, Brindley MA, Iorio RM (2011) Structural and mechanistic studies of measles virus illuminate paramyxovirus entry. PLoS Pathog 7(6):e1002058. https://doi.org/10.1371/journal. ppat.1002058 Plemper RK, Compans RW (2003) Mutations in the putative HR-C region of the measles virus F2 glycoprotein modulate syncytium formation. JVI 77(7):4181–4190. https://doi.org/10.1128/ JVI.77.7.4181-4190.2003 Plemper RK, Hammond AL, Cattaneo R (2000) Characterization of a region of the measles virus hemagglutinin sufficient for its dimerization. J Virol 74(14):6485–6493. https://doi.org/10. 1128/jvi.74.14.6485-6493.2000 Plemper RK, Hammond AL, Cattaneo R (2001) Measles virus envelope glycoproteins heterooligomerize in the endoplasmic reticulum. J Biol Chem 276(47):44239–44,246. https://doi.org/ 10.1074/jbc.M105967200 Plumet S, Duprex WP, Gerlier D (2005) Dynamics of viral RNA synthesis during measles virus infection. J Virol 79(11):6900–6908. https://doi.org/10.1128/JVI.79.11.6900-6908.2005 Ramachandran A, Parisien J-P, Horvath CM (2008) STAT2 is a primary target for measles virus V protein-mediated alpha/beta interferon signaling inhibition. J Virol 82(17):8330–8338. https:// doi.org/10.1128/JVI.00831-08 Rao TSS, Andrade C (2011) The MMR vaccine and autism: sensation, refutation, retraction, and fraud. Indian J Psychiatry 53(2):95–96. https://doi.org/10.4103/0019-5545.82529 Ray J, Whitton JL, Fujinami RS (1991) Rapid accumulation of measles virus leader RNA in the nucleus of infected HeLa cells and human lymphoid cells. J Virol 65(12):7041–7045. https:// doi.org/10.1128/JVI.65.12.7041-7045.1991 Rendon-Marin S, da Fontoura BR, Canal CW, Ruiz-Saenz J (2019) Tropism and molecular pathogenesis of canine distemper virus. Virol J 16(1):30. https://doi.org/10.1186/s12985-0191136-6

274

A. Talekar and M. Porotto

Reuter T, Weissbrich B, Schneider-Schaulies S, Schneider-Schaulies J (2006) RNA interference with measles virus N, P, and L mRNAs efficiently prevents and with matrix protein mRNA enhances viral transcription. J Virol 80(12):5951–5957. https://doi.org/10.1128/JVI.02453-05 Riedl P, Moll M, Klenk H-D, Maisner A (2002) Measles virus matrix protein is not cotransported with the viral glycoproteins but requires virus infection for efficient surface targeting. Virus Res 83(1–2):1–12. https://doi.org/10.1016/s0168-1702(01)00379-3 Riley RC, Tannenbaum PL, Abbott DH, Atkinson JP (2002) Cutting edge: inhibiting measles virus infection but promoting reproduction: an explanation for splicing and tissue-specific expression of CD46. J Immunol 169(10):5405–5409. https://doi.org/10.4049/jimmunol.169.10.5405 Rima B, Balkema-Buschmann A, Dundon WG, Duprex P, Easton A, Fouchier R, Kurath G, Lamb R, Lee B, Rota P, Wang L, ICTV Report Consortium (2019) ICTV Virus taxonomy profile: paramyxoviridae. J General Virol 100(12):1593–1594. https://doi.org/10.1099/jgv.0. 001328 Rima BK, Duprex WP (2009) The measles virus replication cycle. Curr Top Microbiol Immunol 329:77–102. https://doi.org/10.1007/978-3-540-70523-9_5 Rota PA, Brown K, Mankertz A, Santibanez S, Shulga S, Muller CP, Hübschen JM, Siqueira M, Beirnes J, Ahmed H, Triki H, Al-Busaidy S, Dosseh A, Byabamazima C, Smit S, AkouaKoffi C, Bwogi J, Bukenya H, Wairagkar N, Ramamurty N, Incomserb P, Pattamadilok S, Jee Y, Lim W, Xu W, Komase K, Takeda M, Tran T, Castillo-Solorzano C, Chenoweth P, Brown D, Mulders MN, Bellini WJ, Featherstone D (2011) Global distribution of measles genotypes and measles molecular epidemiology. J Infect Dis 204(Suppl 1):S514–S523. https:// doi.org/10.1093/infdis/jir118 Runge S, Sparrer KMJ, Lässig C, Hembach K, Baum A, García-Sastre A, Söding J, Conzelmann K-K, Hopfner K-P (2014) In vivo ligands of MDA5 and RIG-I in measles virus-infected cells. PLoS Pathog 10(4):e1004081. https://doi.org/10.1371/journal.ppat.1004081 Salditt A, Koethe S, Pohl C, Harms H, Kolesnikova L, Becker S, Schneider-Schaulies S (2010) Measles virus M protein-driven particle production does not involve the endosomal sorting complex required for transport (ESCRT) system. J Gen Virol 91(Pt 6):1464–1472. https://doi. org/10.1099/vir.0.018523-0 Santiago C, Celma ML, Stehle T, Casasnovas JM (2010) Structure of the measles virus hemagglutinin bound to the CD46 receptor. Nat Struct Mol Biol 17(1):124–129. https://doi.org/10.1038/ nsmb.1726 Santoro F, Kennedy PE, Locatelli G, Malnati MS, Berger EA, Lusso P (1999) CD46 is a cellular receptor for human herpesvirus 6. Cell 99(7):817–827. https://doi.org/10.1016/s0092-8674(00) 81678-5 Sato H, Masuda M, Kanai M, Tsukiyama-Kohara K, Yoneda M, Kai C (2007) Measles virus N protein inhibits host translation by binding to eIF3-p40. J Virol 81(21):11569–11,576. https:// doi.org/10.1128/JVI.00570-07 Scheid A, Choppin PW (1977) Two disulfide-linked polypeptide chains constitute the active F protein of paramyxoviruses. Virology 80(1):54–66. https://doi.org/10.1016/0042-6822(77) 90380-4 Sellin CI, Horvat B (2009) Current animal models: transgenic animal models for the study of measles pathogenesis. Curr Top Microbiol Immunol 330:111–127. https://doi.org/10.1007/9783-540-70617-5_6 Shaffer JA, Bellini WJ, Rota PA (2003) The C protein of measles virus inhibits the type I interferon response. Virology 315(2):389–397. https://doi.org/10.1016/s0042-6822(03)00537-3 Sharma D, Sangal L, Vijay N, Nalavade U, Krishnasamy K, Pawar S, Kaur H, Narayan J, Rane S, Narkar M, Arumugam R, Dhanagaran D, Sugunan AP, Balakrishnan A, Joseph B, Turuk J, Sabat J, Sahoo P, Barde P, Sahare L, Ukey M, Kumar M, Sinha N, Bhuttoo ZA, Vijayachari P, Chander P, Sharma S, Venkatesha D, Gayathree L, Sharma C, Bhatnagar P, VanderEnde K, Kaundal N, Murugan R, Haldar P, Gadkari D, Aggarwal N, Gupta N (2022) Expansion of the measles and rubella laboratory network, India. Bull World Health Organ 100(4):247–255. https://doi.org/10.2471/BLT.21.286999

9

Measles: The Disease That Refuses to Be Vanquished

275

Solórzano-Santos F, Garduño-Espinoza J, Muñoz-Hernández O (2020) Measles outbreak during the COVID-19 pandemic in Mexico. Bol Med Hosp Infant Mex 77(5):282–286. https://doi.org/ 10.24875/BMHIM.20000173 Sugai A, Sato H, Yoneda M, Kai C (2012) Phosphorylation of measles virus phosphoprotein at S86 and/or S151 downregulates viral transcriptional activity. FEBS Lett 586(21):3900–3907. https:// doi.org/10.1016/j.febslet.2012.09.021 Sugai A, Sato H, Yoneda M, Kai C (2013) Phosphorylation of measles virus nucleoprotein affects viral growth by changing gene expression and genomic RNA stability. J Virol 87(21): 11684–11,692. https://doi.org/10.1128/JVI.01201-13 Suryanarayana K, Baczko K, ter Meulen V, Wagner RR (1994) Transcription inhibition and other properties of matrix proteins expressed by M genes cloned from measles viruses and diseased human brain tissue. J Virol 68(3):1532–1543. https://doi.org/10.1128/JVI.68.3.1532-1543.1994 Tahara M, Takeda M, Yanagi Y (2007) Altered interaction of the matrix protein with the cytoplasmic tail of hemagglutinin modulates measles virus growth by affecting virus assembly and cellcell fusion. J Virol 81(13):6827–6836. https://doi.org/10.1128/JVI.00248-07 Takeda M, Tahara M, Hashiguchi T, Sato TA, Jinnouchi F, Ueki S, Ohno S, Yanagi Y (2007) A human lung carcinoma cell line supports efficient measles virus growth and syncytium formation via a SLAM- and CD46-independent mechanism. J Virol 81(21):12091–12,096. https://doi. org/10.1128/JVI.01264-07 Takeuchi K, Kadota S, Takeda M, Miyajima N, Nagata K (2003a) Measles virus V protein blocks interferon (IFN)-alpha/beta but not IFN-gamma signaling by inhibiting STAT1 and STAT2 phosphorylation. FEBS Lett 545(2–3):177–182. https://doi.org/10.1016/s0014-5793(03) 00528-3 Takeuchi K, Miyajima N, Nagata N, Takeda M, Tashiro M (2003b) Wild-type measles virus induces large syncytium formation in primary human small airway epithelial cells by a SLAM(CD150)-independent mechanism. Virus Res 94(1):11–16. https://doi.org/10.1016/ s0168-1702(03)00117-5 Talekar A, Moscona A, Porotto M (2013) Measles virus fusion machinery activated by sialic acid binding globular domain. J Virol 87(24):13619–13,627. https://doi.org/10.1128/JVI.02256-13 Tamin A, Rota PA, Wang ZD, Heath JL, Anderson LJ, Bellini WJ (1994) Antigenic analysis of current wild type and vaccine strains of measles virus. J Infect Dis 170(4):795–801. https://doi. org/10.1093/infdis/170.4.795 Tatsuo H, Ono N, Tanaka K, Yanagi Y (2000) SLAM (CDw150) is a cellular receptor for measles virus. Nature 406(6798):893–897. https://doi.org/10.1038/35022579 Taylor B, Miller E, Farrington CP, Petropoulos MC, Favot-Mayaud I, Li J, Waight PA (1999) Autism and measles, mumps, and rubella vaccine: no epidemiological evidence for a causal association. Lancet 353(9169):2026–2029. https://doi.org/10.1016/s0140-6736(99)01239-8 Toth AM, Devaux P, Cattaneo R, Samuel CE (2009) Protein kinase PKR mediates the apoptosis induction and growth restriction phenotypes of C protein-deficient measles virus. J Virol 83(2): 961–968. https://doi.org/10.1128/JVI.01669-08 Tuokko H, Salmi A (1983) Detection of IgM antibodies to measles virus by enzyme-immunoassay. Med Microbiol Immunol 171(4):187–198. https://doi.org/10.1007/BF02123492 van Binnendijk RS, van der Heijden RW, Osterhaus AD (1995) Monkeys in measles research. Curr Top Microbiol Immunol 191:135–148. https://doi.org/10.1007/978-3-642-78621-1_9 Van Regenmortel MHV (2019) Solving the species problem in viral taxonomy: recommendations on non-Latinized binomial species names and on abandoning attempts to assign metagenomic viral sequences to species taxa. Arch Virol 164(9):2223–2229. https://doi.org/10.1007/s00705019-04320-y Vincent S, Gerlier D, Manié SN (2000) Measles virus assembly within membrane rafts. J Virol 74(21):9911–9915. https://doi.org/10.1128/jvi.74.21.9911-9915.2000 Wang N, Morra M, Wu C, Gullo C, Howie D, Coyle T, Engel P, Terhorst C (2001) CD150 is a member of a family of genes that encode glycoproteins on the surface of hematopoietic cells. Immunogenetics 53(5):382–394. https://doi.org/10.1007/s002510100337

276

A. Talekar and M. Porotto

Watanabe M, Hirano A, Stenglein S, Nelson J, Thomas G, Wong TC (1995) Engineered serine protease inhibitor prevents furin-catalyzed activation of the fusion glycoprotein and production of infectious measles virus. J Virol 69(5):3206–3210. https://doi.org/10.1128/JVI.69.5. 3206-3210.1995 Watanabe S, Ohno S, Shirogane Y, Suzuki SO, Koga R, Yanagi Y (2015) Measles virus mutants possessing the fusion protein with enhanced fusion activity spread effectively in neuronal cells, but not in other cells, without causing strong cytopathology. J Virol 89(5):2710–2717. https:// doi.org/10.1128/JVI.03346-14 Watanabe S, Shirogane Y, Suzuki SO, Ikegame S, Koga R, Yanagi Y (2013) Mutant fusion proteins with enhanced fusion activity promote measles virus spread in human neuronal cells and brains of suckling hamsters. J Virol 87(5):2648–2659. https://doi.org/10.1128/JVI.02632-12 Whelan SPJ, Barr JN, Wertz GW (2004) Transcription and replication of nonsegmented negativestrand RNA viruses. Curr Top Microbiol Immunol 283:61–119. https://doi.org/10.1007/978-3662-06099-5_3 Willy ME, Woodward RA, Thornton VB, Wolff AV, Flynn BM, Heath JL, Villamarzo YS, Smith S, Bellini WJ, Rota PA (1999) Management of a measles outbreak among Old World nonhuman primates. Lab Anim Sci 49(1):42–48 Woelk CH, Pybus OG, Jin L, Brown DWG, Holmes EC (2002) Increased positive selection pressure in persistent (SSPE) versus acute measles virus infections. J Gen Virol 83(Pt 6): 1419–1430. https://doi.org/10.1099/0022-1317-83-6-1419 Woo EJ, Ball R, Bostrom A, Shadomy SV, Ball LK, Evans G, Braun M (2004) Vaccine risk perception among reporters of autism after vaccination: vaccine adverse event reporting system 1990–2001. Am J Public Health 94(6):990–995. https://doi.org/10.2105/ajph.94.6.990 World Health Organization (2013) Weekly Epidemiological Record, 2013. Weekly Epidemiological Record 88(9) World Health Organization (2020a) Weekly Epidemiological Record, 2020. Weekly Epidemiological Record 95:557–572 World Health Organization (2020b) Weekly Epidemiological Record, 2020. 95:585–608 Yu X, Shahriari S, Li H-M, Ghildyal R (2016) Measles virus matrix protein inhibits host cell transcription. PLoS One 11(8):e0161360. https://doi.org/10.1371/journal.pone.0161360 Zhang X, Bourhis J-M, Longhi S, Carsillo T, Buccellato M, Morin B, Canard B, Oglesbee M (2005) Hsp72 recognizes a P binding motif in the measles virus N protein C-terminus. Virology 337(1): 162–174. https://doi.org/10.1016/j.virol.2005.03.035

Part II Haemorrhagic Fever Viral Infections

Viral Haemorrhagic Fevers

10

Abhranil Gangopadhayya and Prudhvi Lal Bhukya

Abstract

Viral haemorrhagic diseases are complicated infections manifesting as an array of signs & symptoms. These involve a variety of viral species from select few families. Strict biosafety precautions are necessary for diagnosing or investigating the viruses that cause Viral Haemorrhagic diseases. Such etiological agents primarily transmit through animal reservoirs and can adapt to man-to-man transmission, necessitating precautions for researching upon them. The manifestations of infection by such viruses includes but is not limited to Viral Haemorrhagic Fever. They have been the cause of noteworthy outbreaks of serious health concern in the past, something that has contributed towards the research on Viral Haemorrhagic diseases reaching the scale it has today. In this chapter, we will have a look at the salient features of Viral Haemorrhagic diseases, while also taking examples of some Viral Haemorrhagic diseases that have garnered attention in the past. The transmission, signs and symptoms, diagnosis and treatment for each of these will also be discussed in this chapter. Keywords

Viral haemorrhagic fever · Arenavirus · Flavivirus · Filovirus · Bleeding disorder · Biosafety

A. Gangopadhayya Medical Entomology and Zoology Group, ICMR-National Institute of Virology, Pune, Maharashtra, India P. L. Bhukya (✉) Vaccine Testing Laboratory, Rodent Experimentation Facility, ICMR-National Animal Facility Resource Facility for Biomedical Research, Hyderabad, Telangana, India # The Author(s), under exclusive license to Springer Nature Singapore Pte Ltd. 2023 P. L. Bhukya et al. (eds.), Emerging Human Viral Diseases, Volume I, https://doi.org/10.1007/978-981-99-2820-0_10

279

280

10.1

A. Gangopadhayya and P. L. Bhukya

Introduction

The blood of our body acts as a lifeline, transporting oxygen and carbon dioxide, harbouring immune cells and effectors and connecting almost all parts of the body to the other. An attack on this liquid connective tissue could spell disaster for the body, of course. It means that not only is the tissue that connects everything to everything potentially infected, the contents of it are also liable to be drastically altered, in a way that will significantly change the way our body functions. Loss of this blood due to an infection, however, means that not only is a person losing one of the most important defence mechanisms of their body, but they are also essentially losing their transporter of energy, in the form of oxygen, glucose, etc. Diseases that cause the excessive and uncontrolled loss of blood from the body are referred to as haemorrhagic diseases, and among these, a significant number are caused by agents that are viral in nature. These viral etiologies of haemorrhagic diseases belong to multiple families and have been isolated from a variety of geographical areas. The sheer extent of damage caused by them to a human body, and some crucial details of each disease, are the main scope of this chapter.

10.2

What is Haemorrhage

It can be defined in the most basic way as blood releasing either inside or outside the body from a broken blood vessel. The phenomenon can be classified broadly into four kinds, as described by the American College of Surgeons in their Advanced Trauma Life Support (ATLS) classification (Hooper and Armstrong, 2018). Considering a healthy adult patient to be 70 kilograms (kg) in weight, and that blood volume may be about 7% of total body weight, the classification divides the physiological responses accordingly. Class I haemorrhage is when 15% of the total blood volume is lost, which is approximately 750 millilitres (mL). Class II haemorrhage means 15–30% of blood volume lost, i.e., 750–1500 mL lost. Class III haemorrhage is when 30–40% of blood volume is lost, which is about 1500–2000 mL. Class IV is when the blood loss is over 40%. A patient taking beta blockers can have their increase of heart rate inhibited, and so the physiological change of heightened heart rate will not be seen in such a person. This is but one of the many examples of cases where the classification does not strictly apply. There are criteria to be fulfilled for a person to be diagnosed for a haemorrhagic disease caused by a pathological agent. But there are multiple scenarios where the causation is not due to a pathological agent. Rupture of blood vessels in the brain results in non-traumatic intracerebral haemorrhage, while secondary intracerebral haemorrhage results from anticoagulant usage (Qureshi et al., 2009). The primary kind presents with similar underlying pathological changes as is seen in the secondary kind. Clinical management of intracerebral haemorrhage has to be done using a combination of primary and specialized care, which can lead to lower chances of mortality. Subarachnoid haemorrhage accounts for 3% of strokes and 5% of strokecaused deaths. Computed Tomography (CT) scanning helps decrease the incidence

10

Viral Haemorrhagic Fevers

281

of the condition by differentially diagnosing it as something else. Most of the time, almost 85%, it is due to a ruptured aneurysm, non-aneurysmal perimesencephalic haemorrhage in 10% of cases, and some rare causes in 5% of cases. Massive obstetric haemorrhage causes a lot of maternal deaths and morbidity, with the chief reasons being abruption placentae, placenta praevia and postpartum haemorrhage (Bonnar, 2000). Appropriate measures are needed to treat these individual conditions, like surgical control of bleeding, oxytocin and prostaglandin treatment, ligation of arteries, etc. Liver rupture and acute fatty liver during pregnancy are other risk factors for massive obstetric haemorrhage. Upper gastrointestinal haemorrhage is when any part of the gastrointestinal tract, like the oesophagus, stomach or duodenum, has any haemorrhage occurring. Usually, it can be detected as vomit or stool being black, and in extreme cases it can lead to shock. Hospitalization is necessary in extreme cases, to inject resuscitating fluid and red blood cells (Stanley and Laine, 2019). Damage to superficial vessels in the skin leads to petechiae and ecchymosis, which is just minor bleeding. Alteration in vital signs and mental status indicates suspicions of significant blood loss that may manifest as other varieties of symptoms. When bleeding is from a body orifice or a traumatic wound, it is external bleeding. Imaging, physical tests, laboratory tests and close monitoring of vital signs can reveal whether there is any internal bleeding. Haemorrhagic death is potentially preventable, especially in people suffering acute trauma. When haemorrhage is subarachnoid, people often report the “worst headache of their life”, which is also referred to as a “thunderclap headache”. Arteriovenous malformations or traumatic brain injury can also be causes of subarachnoid haemorrhage (Agarwal et al., 2019). Haemothorax is when bleeding occurs in the pleural cavity of the chest. It can happen due to traumatic injuries, metastatic cancers, blood clotting disorders, even sometimes spontaneously. Dizziness, shortness of breath and chest pain are the most common signs and symptoms of this. Abdominal blood loss, resulting from trauma, manifests in non-specific symptoms, needing imaging for confirming suspicion. Hepatic, splenic, renal or adrenal organ damage, injury to the vascular system, complications during gynaecologic or obstetric procedures, coagulopathies, ectopic pregnancy (Pontius and Vieth, 2019), or cyst rupture could lead to abdominal haemorrhage. Symptoms include abdominal pain, haematemesis, melaena, haematuria, bruising, etc. Retroperitoneal injury can lead to haematomas in different anatomic zones. The first zone, or Zone 1, is due to pancreaticoduodenal injuries, due to injuries to major blood vessels. Zone 2 includes the regions around the kidneys, the colon and the flanks. Zone 3 is the pelvic region, where femoral vascular access injuries or pelvic fractures could happen (Baekgaard et al., 2019). Pain in the abdomen, back, flanks, compression of the bladder leading to urinary system disorders, and femoral nerve palsy are signs and symptoms of retroperitoneal haemorrhage. Some long bones of the body contain vasculature and also have blood vessels coursing along with them. Traumatic injury to them or any injuries during surgical procedures could lead to tremendous blood loss, at times resulting in death. Bones that are well-vasculated include the humerus, radius, ulna, femur, fibula, pelvis and vertebrae (Lazarev et al., 2019).

282

10.3

A. Gangopadhayya and P. L. Bhukya

Case Definition of a Haemorrhagic Fever

The American Centres for Disease Control and Prevention (CDC) have provided case definitions for Viral Haemorrhagic Fevers (VHFs) (Viral Hemorrhagic Fever | 2011 Case Definition n.d.). There are multiple kinds, which can be described as follows. Clinical criteria include an illness of acute onset and fever of more than 40°C, with some crucial criteria. Severe headache, muscle pain, vomiting, diarrhoea, abdominal pain, bleeding unlinked to any injury, thrombocytopenia, and erythematous maculopapular rash on the trunk, with desquamation after 3–4 days of the rash appearing, are clinical findings that have to be present either singly or many in number along with fever. Arenaviral infection specific symptoms include pharyngitis, retrosternal chest pain and proteinuria. There are laboratory criteria that are included in the diagnosis of VHFs. Enzyme Linked Immuno Sorbent Assay (ELISA) can be used to detect antigens specific for VHF pathogens, which may turn out to be positive. Isolation of the virus from blood or tissue in cultures can act as yet another confirmation. Reverse Transcription Polymerase Chain Reaction (RT-PCR) can be used to detect the presence of VHF virus specific gene sequences. Viral antigens can be detected in tissues using immunohistochemistry (IHC). Using these tests, one can determine with confidence if there is a haemorrhagic fever causing virus infecting a person, and if it is causing the symptoms manifested. Epidemiologically, there are certain factors as well which may link someone with a VHF. Someone coming into contact with the blood or bodily fluids of someone suffering from a VHF is one such factor. Travelling to an area that is endemic for VHFs is yet another. Working in a laboratory handling VHF specimens could expose a person to infection by such a virus, or a laboratory that handles bats, rodents or primates from VHF endemic areas. One other factor is exposure to semen from a person suffering from the acute or convalescent phase of a VHF that is within 10 weeks of the onset of symptoms. Clinical and epidemiological criteria being fulfilled means a case can be treated as suspected. It is confirmed only when both clinical and laboratory criteria are met.

10.4

Etiological Agents Causing Haemorrhagic Fevers

Haemorrhagic fevers are only caused by viruses. Bacterial origin haemorrhagic fevers are only speculated as of yet, without much definitively proven evidence. One such supposed outbreak was the Cocoliztli epidemic, which is assumed to have been due to the Salmonella enterica bacterium belonging to the serotype Paratyphi C (Vågene et al., 2018). Bacterial genomic studies have led to such an inference. A technique called the Megan Alignment Tool (MALT) was used to arrive at this inference. Ancient pathogen Deoxyribo Nucleic Acid (DNA) was searched for through this method, which was found in people who were buried in a cemetery at Teposcolula-Yucundaa, Oaxaca, southern Mexico, one which was linked to the

10

Viral Haemorrhagic Fevers

283

1545–1550 epidemic ravaging Mexico. Ten individuals were tested, revealing the pathogen to be the enteric fever causing organism. The pathogenic cause for the Cocoliztli epidemic has been debated for over a century. Some speculate that it could have been a viral haemorrhagic fever, which, coupled with the then living conditions and droughts in Mexico, brought the epidemic to such a level. While the etiologies of haemorrhages are wide and varied, as briefly discussed above, those of haemorrhagic fevers are limited to mainly a few virus families. These families are: • • • • • •

Arenaviridae Bunyaviridae Filoviridae Flaviviridae Rhabdoviridae Togaviridae

The Arenaviridae family consists of members usually having rodents as reservoirs, from which they can transmit to humans, with each member being specific to a particular rodent host for its maintenance (Arenaviridae | Viral Hemorrhagic Fevers (VHFs) | CDC n.d.). Bunyaviridae members have single-stranded genomes, are enveloped and are more than 300 in number (Bunyaviridae | Viral Hemorrhagic Fevers (VHFs) | CDC, n.d.). Filoviruses, belonging to the family Filoviridae, are capable of causing disease in humans and non-human primates and can be grouped into three genera (Filoviridae | Viral Hemorrhagic Fevers (VHFs) | CDC n.d.). Flaviviruses, belonging to the family Flaviviridae, infect mainly mammals and birds, spread through arthropod vectors (like ticks and mosquitoes), are enveloped and have positive-sense RNA genomes (Flaviviridae Wikipedia, n.d.). Rhabdoviridae members can infect humans and other mammals, invertebrates and even plants, belong to the order Mononegavirales, and have negative-sense RNA genomes (Rhabdoviridae - Wikipedia, n.d.). Togaviridae members are enveloped and icosahedral, possessing a positive-sense RNA genome of 11 kilobases (kb) length (Ryu, 2017). Viruses causing haemorrhagic fevers are therefore spread out over a few families, but their varying modes of producing pathophysiological manifestations are what make the challenges posed by each of them so unique and difficult. The next section will deal with each individual family of virus.

10.5

Haemorrhagic Fever Viruses Belong to Six Different Families

In this section, we will deal with each of the major families to which each virus causing VHF belongs, in more detail.

284

A. Gangopadhayya and P. L. Bhukya

10.5.1 Arenaviridae Members of this family can infect mammals, including humans, other primates, snakes and fish (Radoshitzky et al., 2019). They contain two to three single-stranded (ss) Ribo Nucleic Acid (RNA) segments in their genome that total to about 10.5 kb in length. The arenaviral virions are densely enveloped, about 40–200 nanometres (nm) in diameter, having club-shaped structures divisible into heads and stalks, on the surface layer. The genome of an arenavirus has three segments—small (S), medium (M) and large (L)—of ambisense RNA molecules.

10.5.2 Bunyaviridae Bunyavirus virions are generally spherical or pleomorphic, 80–120 nm in diameter and have morphologies that vary among the five genera (Bunyaviridae—Negative Sense RNA Viruses—Negative Sense RNA Viruses (2011)—ICTV, n.d.). The virion itself is sensitive to heat, detergents, formaldehyde and lipid solvents. A genome of 11–19 kb, divided into L, M & S segments of negative or ambisense RNA can be found in the virions. Two external glycoproteins, Gn & Gc, are proximal to either the amino or carboxy terminal of the M segment polyprotein. A nucleocapsid protein (N) and an RNA dependent RNA polymerase, the Large (L) protein, are also part of the virus proteome.

10.5.3 Filoviridae The virions are filamentous, about 790 nm long and 80 nm in diameter for the Marburgvirus, and 970 nm long and 80 nm wide for the Ebolavirus (Filoviridae ~ ViralZone n.d.). Seven proteins are encoded by the viral genome, which is 18 to 19 kb in size, and is composed of a single-stranded negative-sense linear RNA genome. Each gene is sequentially transcribed, starting from the leader region, from the encapsidated genome itself. The L protein caps and polyadenylates messenger RNAs (mRNAs) during protein synthesis. Apoptotic mimicry enables the virion’s entry through the GP glycoprotein. Polymerase stuttering enables the capping and polyadenylation of the viral mRNAs in the cytoplasm itself. Ribonucleocapsids (RNCs) interact with the Matrix protein, then releases the virion through the host endosomal sorting complex required for transport (ESCRT).

10.5.4 Flaviviridae This family’s members possess spherical, enveloped virions, about 50 nm in diameter, with icosahedral symmetry of surface proteins (Flaviviridae ~ ViralZone n.d.). Their genomes are about 9.7–12 kb in length, being monopartite, linear and positivesense single-stranded RNA in nature. There is a 3′ terminal loop and either a

10

Viral Haemorrhagic Fevers

285

methylated cap at the 5’end or a genome-linked VPg protein. The RNA of these viruses is infectious and itself serves as the genomic and viral messenger RNA. Host and viral proteases process the polyprotein produced from the entire viral genome during and after translation. Clathrin-mediated endocytosis or apoptotic mimicry enable virion entry. Replication occurs at the endoplasmic reticulum (ER) surface, in a place called the cytoplasmic viral factory. The positive-sense ssRNA genome is synthesized into a double-stranded (ds) RNA genome during replication. Viral assembly occurs at the ER surface, then they’re transported to the Golgi apparatus for preparation of exocytosis and release.

10.5.5 Rhabdoviridae Rhabdoviruses are enveloped, bullet-shaped, 180 nm long and 75 nm wide (Rhabdoviridae ~ ViralZone n.d.). Their genomes are of single-stranded, negativesense, linear RNA, 11–15 kb in size. Only the Varicosavirus genome is of two segments and codes for five or six proteins. The encapsidated genome is transcribed gene by gene from the leader region onwards, utilizing the start and stop signals flanking each gene. Clathrin-mediated endocytosis is how the virions enter cells. Polymerase stuttering caps and polyadenylates viral mRNAs. Only when the nucleoprotein concentration is enough to encapsidate newly synthesized genomes and antigenomes, does replication begin. RNCs bind to the Matrix protein, subsequently releasing virions through the host ESCRT complex.

10.5.6 Togaviridae Small, enveloped viruses that have 10–12 kb long, single-stranded, positive-sense RNA genomes are the members of this family. One genus, the Alphavirus, includes a lot of members that are mainly mosquito-borne and pathogenic to the vertebrate hosts that they parasitize, being important human and veterinary pathogens. The virions are 65–70 nm in diameter, having a single capsid protein and three glycoproteins. Replication of these viruses occurs in the cytoplasm, in vesicles made from the cell membrane or the endosomal compartment. Budding of assembled virions occurs from the cell membrane. Genomic RNA encodes non-structural proteins and subgenomic RNA encodes structural proteins, both synthesized as polyprotein precursors. The family belongs to the realm Riboviria, having one genus, Alphavirus, encompassing 31 members. Humans and non-human primates, equids, birds, amphibians, reptiles, rodents, pigs, sea mammals, salmonids, mosquitoes and some other arthropods is the host range of this virus family.

286

10.6

A. Gangopadhayya and P. L. Bhukya

Pathophysiological Markers of Haemorrhagic Fever

The pathology of VHFs can vary from virus to virus. In case of Ebola Haemorrhagic Fever, the liver, spleen, lung, testes, kidney are all affected by a kind of focal coagulative necrosis (Baskerville et al., 1985). Viral infiltration into the renal system through the glomerular and tubular epithelia can cause damage to it. Erythrocytic sludging and intense congestion can be observed in the brain but no inflammatory reaction. Microvasculature of all organs can be affected, and the endothelial cytoplasm can be affected by viral replication in them, followed by detachment from the basement membrane. Dengue Haemorrhagic Fever (DHF) is distinguished from Dengue Fever by the vascular leakage that occurs and the hypovolaemic shock occurring from that critical plasma volume loss (Srichaikul and Nimmannitya, 2000). Bone marrow suppression, leucopenia and thrombocytopenia are common occurrences during DHF. A host experiencing secondary Dengue virus (DENV) infection will have enhanced immune response against it, which ultimately leads to DHF. Vasculopathy, thrombopathy and Disseminated Intravascular Coagulation (DIC) are the reasons for bleeding during DHF.

10.7

Biosafety Precautions for Haemorrhagic Fever Viruses

Viruses that cause VHFs are to be treated and handled with high levels of safety precautions and security measures. Smallpox and haemorrhagic fever viruses both fall into the category of Risk Group 4 (RG4) agents, those that need to be handled with the strictest biosafety precautions (Nisii et al., 2009). In the network of European Biosafety Level 4 (BSL-4) laboratories, antigen capture and electron microscopy are not regarded as much as molecular detection and virus isolation techniques, because molecular detection and virus isolation provide reliable enough identification of a VHF agent, for which other techniques may not need widespread usage. Countries that are endemic to diseases like Crimean-Congo Haemorrhagic Fever (CCHF) may not have the required BSL-4 facilities to carry out diagnostics (Weidmann et al., 2016). It may be necessary to reclassify the CCHF virus as a lower Risk Group agent to facilitate handling of the virus in resource-insufficient locations, or by using enhanced BSL-2 safety measures. Injuries such as the needlestick kind are possible and life-threatening occurrences when working with such viruses. One article reports a needle-stick injury (NSI) in Hamburg, Germany, that occurred during animal experimentation with the Zaire ebolavirus (ZEBOV) (Günther et al., 2011). The person was promptly administered a recombinant Vesicular stomatitis virus (VSV) vaccine candidate hitherto tested in non-human primates, that may have acted as a post-exposure prophylactic and prevented Ebola Haemorrhagic Fever in the person. Some agents such as the DENV are generally handled in BSL-2 facilities, since therapeutics are available for the disease, which rarely progresses to the serious

10

Viral Haemorrhagic Fevers

287

dengue haemorrhagic fever (Dengue Virus Biological Agent Reference Sheet (BARS) | Environment, Health and Safety n.d.). BSL-2 laboratories require the usage of face protection, protective laboratory coats, gowns, smocks, or uniforms and gloves as personal protective equipment. However, generally haemorrhagic fever viruses are handled in a BSL-4 laboratory, given that most are RG4 agents, and this requires personnel to be highly trained, and capable of working in positive pressure personnel suits with a segregated air supply, in addition to the maximum biosafety measures being followed (Bayot and King, 2019). Since there is no treatment for RG4 viruses, it warrants the need of such extreme isolation precautions.

10.8

Some Notable Haemorrhagic Fever Viruses and the Diseases Caused by Them

10.8.1 Chikungunya Virus (CHIKV) It was first isolated from the Newala district of Tanganyika, from a study that was conducted there from February to March 1953 (Ross, 1956). It is spread through mosquitoes of the species Aedes aegypti and Ae. albopictus, with Ae. furcifer-taylori, Ae. africanus & Ae. luteocephalus being potential vectors (Burt et al., 2012). Its genome consists of non-structural (nsP1, 2, 3 & 4 being the proteins for negativestrand RNA synthesis, helicase/protease, RNA synthesis & RNA dependent RNA polymerase or RdRp respectively) and structural genes (C, E3, E2, 6K & E1, C being the protein for the capsid, E3 & 6K for small accessory peptides, and E1 & E2 being the major envelope glycoproteins) (Jain et al., 2017). After a mosquito bite, CHIKV replicates in the skin and fibroblasts, then spreads to the liver, muscle, joints, lymphoid tissue and the brain (Schwartz and Albert, 2010). Fever, joint pain and swelling, headache, muscle pain and rash are the symptoms of Chikungunya fever. As of 2007, the disease is known to have occurred in parts of South Asia, Japan, Australia, parts of Europe & Africa (Powers and Logue, 2007). The VeroE6, Vero CCL81, HepG2 and C6/36 cell lines may be used for virus isolation and propagation (Wikan et al., 2012). Detection of Immunoglobulin G & M specific for CHIKV by ELISA and viral genome detection by RT-PCR in blood samples can be used as diagnostic tests. Anti-pyretics, analgesics, large fluid intake, rest, paracetamol/acetaminophen and aspirin may be used as treatment methods, since no specific antivirals exist for CHIKV (Chikungunya Fact Sheet, n.d.).

10.8.2 Crimean-Congo Hemorrhagic Fever Orthonairovirus (CCHFV) The virus was first identified in Crimea in 1944 and then in Congo in 1969 (CrimeanCongo Hemorrhagic Fever (CCHF) | CDC n.d.). Hard ticks of the genus Hyalomma, human bodily fluids, infected animal blood and contaminated medical equipment serve as transmission modes. CCHFV has a single-stranded negative-sense RNA

288

A. Gangopadhayya and P. L. Bhukya

molecule, divided into: the small (S) RNA (coding for the N protein), the medium (M) RNA (coding for the viral glycoprotein precursor) and the large (L) RNA (coding for the large protein that has the RdRp function). Pathogenesis of CCHFV proceeds as infection of endothelial cells, excessive cytokine release, innate immune system malfunction and eventual haemorrhage (Akıncı et al., 2013). Headache, high fever, stomach, back and joint pain, vomiting, red eyes and throat, a flushed face, petechiae on the palate, jaundice, mood and sensory perception changes, severe bruising, nosebleeds and uncontrolled injection site bleeding are the clinical manifestations (Crimean-Congo Hemorrhagic Fever (CCHF) | CDC, n.d.). Areas endemic for CCHF are parts of the Middle East, Europe, Asia and Africa. The cell lines HUVEC, Huh7 & HEK293, Vero CCL81, as well as dog and monkey renal cell lines, can be used for culturing CCHFV (Dai et al., 2021). IgM and IgG detection and antigen-capture ELISA, Real Time RT-PCR, virus isolation and immunostaining can be used as diagnostics (Crimean-Congo Hemorrhagic Fever (CCHF) | CDC, n.d.). Treatment tactics include monitoring fluid balance, electrolyte abnormalities, oxygenation, haemodynamic support, secondary infections. Ribavirin has been reportedly of benefit in some human cases.

10.8.3 Dengue Virus (DENV) The most recent common ancestor of all four DENV serotypes existed at about 340 Anno Domini (AD) (Costa et al., 2012). It is spread by mosquitoes of the species Ae. aegypti or Ae. albopictus (Dengue | CDC n.d.). Its genome is composed of structural genes (C, prM, M & E for the Capsid, Membrane & Envelope proteins respectively) and non-structural genes (NS1, 2a, 2b, 3, 4a, 4b & 5 for the Interferon resistance, NS2-3 serine protease, Helicase, Endoplasmic Reticulum signal for NS4b, Interferon type I signalling blocker, NS3-4 replication & RdRp proteins respectively, with NS1 having unknown function) (Faheem et al., 2011). Pathogenesis is caused by differential targeting of specific vascular beds, involvement of viral virulence factors & detrimental host responses, eventually leading to abnormal haemostasis and abnormal vascular permeability (Martina et al., 2009). Signs and symptoms of Dengue include fever, rash, aches and pains behind the eye, in the muscles, joints or bones, nausea and vomiting, belly pain and tenderness, nose and gums bleeding, blood in vomit or stool, tired, restless or irritable feeling (Dengue | CDC n.d.). Dengue is known to occur in Mexico, South America, Africa, Southeast Asia and a part of Australia. DENV can be cultured using VeroE6, Vero CCL81 & C6/36 cell lines in vitro. Diagnosis of DENV infection can be by Real Time RT-PCR, NS1 ELISA, IgM ELISA and Plaque Reduction Neutralization Test (PRNT). Treatment consists of staying hydrated, acetaminophen, sponge baths and avoiding anticoagulant drugs or Non-Steroidal Anti-Inflammatory Drugs (NSAIDs).

10

Viral Haemorrhagic Fevers

289

10.8.4 Ebolavirus (EBOV) Its first human cases were in Nzara, South Sudan, between June and November 1976 (Report of a WHO/International Study Team, 1978). The virus is transmitted through the blood, organs, secretions and other body fluids of infected animals, through the vomit or faeces of infected people or animals and objects contaminated with them (Ebola (Ebola Virus Disease) | CDC n.d.). It can also spread through broken skin or mucous membrane contact, breast milk and pregnancy related fluids and tissues. Upon entry of the virus, it infects multiple cell types, multiplies in the regional lymph node, then moves to the liver, spleen, adrenal gland, causing hepatocellular and adrenocortical necrosis and their associated effects. Signs and symptoms include fever, aches, pains in the head, muscles and joints, weakness, fatigue, sore throat, appetite loss, abdominal pain, diarrhoea, vomiting, haemorrhaging, bleeding, bruising, red eyes, skin rash and hiccups. Ebola virus disease has been documented in the USA, UK, Italy, Spain and Africa. Huh-7 and VeroE6 cells can be used to culture the virus (Logue et al., 2019; Whitfield et al., 2020). PCR can be used for diagnosis of Ebola Virus disease (Ebola (Ebola Virus Disease) | CDC n.d.). The monoclonal antibody therapeutics Inmazeb and Ebanga have been approved for use against the Zaire Ebolavirus, while other treatment methods include oral or intravenous fluid administration, medication to support blood pressure, vomiting, diarrhoea, fever and pain, and treatment of other infections.

10.8.5 Marburg Marburgvirus (MARV) Its first outbreak occurred in the cities Marburg, Frankfurt and Belgrade, back in 1967 (Siegert et al., 2009). Transmission occurs through infected bat faeces or aerosols, contact with droplets or tissues of infected people, or objects contaminated by them, through handling infected primates, and nosocomially (Marburg Hemorrhagic Fever (Marburg HF) | CDC n.d.). The genes of MARV are: NP (nucleoprotein), VP35 (polymerase cofactor), VP40 (matrix protein), GP (glycoprotein), VP30 (replication-transcription protein), VP24 (minor matrix protein), L (non-structural, RdRp) (Rougeron et al., 2015). Macrophages & dendritic cells are primarily targeted by the virus, leading to paralysis of the innate immune system and lack of lymphocyte co-stimulation (Mehedi et al., 2011). Clinical manifestations caused by it include fever, chills, headache, myalgia, maculopapular rash, nausea, vomiting, chest pain, sore throat, abdominal pain, diarrhoea, jaundice, pancreatic inflammation, severe weight loss, delirium, shock, liver failure, massive haemorrhaging, and multi-organ dysfunction (Marburg Hemorrhagic Fever (Marburg HF) | CDC n.d.). Marburg haemorrhagic fever has occurred in Germany, Serbia, Kenya, Uganda, Democratic Republic of Congo, Angola and South Africa. MARV can be cultured in HepG2 cells (Becker et al., 1995). Antigen-capture and MAC ELISA, along with PCR and viral isolation, may be used for diagnosis a few days post symptom onset, while later stages may warrant an IgG ELISA, with immunohistochemistry, viral

290

A. Gangopadhayya and P. L. Bhukya

isolation and PCR from blood or tissues of deceased patients also viable options (Marburg Hemorrhagic Fever (Marburg HF) | CDC n.d.). Balancing fluids and electrolytes, maintaining oxygen status and blood pressure, and replacement of lost blood and clotting factors are the ways to manage MARV disease.

10.8.6 Variola Virus (VARV) The causative agent of Smallpox has been recorded even as early as the third century Before Christ Era (BCE) (Smallpox | CDC n.d.). Direct or face-to-face contact, droplet spread through coughing and sneezing, objects contaminated by fluid from scabs and the airborne route are the known methods of transmission. Signs and symptoms include high fever, head and body aches, vomiting, rashes, pustules and scabs. PCR and viral isolation are laboratory diagnostics for Smallpox. Vaccination is available and applicable for preventing or lessening disease severity if given within 2–3 days of initial exposure, and also available are the antivirals Tecovirimat, Cidofovir and Brincidofovir. The virus has a single segment of linear doublestranded DNA 186,102 base pairs in length. It makes its way into lymph nodes upon entry, then spreads into dermal blood and the kidneys, liver, spleen, lymph nodes and bone marrow, eventually causing pus formation in vesicles due to accumulation of polymorphonuclear cells. Smallpox was declared eradicated by the WHO in 1980. Guinea pig lung cells can be used to culture the VARV.

10.8.7 Tick-borne Encephalitis Virus (TBEV) The virus was first isolated in 1937 (Tick-borne Encephalitis (TBE) | CDC n.d.). Its major mode of transmission is through hard ticks of the family Ixodidae, which act as vectors and reservoirs. Signs and symptoms include meningitis, encephalitis, meningoencephalitis, fever, anorexia, muscle aches, malaise, headache, nausea and vomiting. Virus isolation from blood and IgM detection from blood or CSF are diagnostics that may be used in the first and second phases of disease respectively. Anti-inflammatory drugs like corticosteroids, supportive care for symptomatic relief, intubation and ventilator support are the therapeutic approaches available. The disease is prevalent in Central and Eastern Europe and Northern Asia (Weekly epidemiological record Relevé épidémiologique hebdomadaire 2011). The virus produces a single polyprotein that is cleaved into the following proteins—anchored core protein C, core (C), preM, Matrix (M), Envelope (E), NS1, 2a, 2b, 3, 4a, 2K protein, NS4b & NS5 (RdRp). The virus multiplies in the dendritic cells upon entry into the body, then spreads to lymph nodes, systemic circulation, crossing into the Central Nervous System (CNS), producing lesions characterized by cellular infiltration such as by microglia (Tick-Borne Encephalitis | IntechOpen n.d.). TBEV can be cultivated in the tick cell line RA-257 and the Porcine Stable (PS) cell line (Senigl et al., 2006).

10

Viral Haemorrhagic Fevers

291

10.8.8 Yellow Fever Virus (YFV) Yellow Fever began in Africa and with the import of enslaved sub-Saharan Africans by the Spanish and Portuguese in the seventeenth century, it was transported to South America (Viruses, Plagues, and History: Past, Present and Future - Michael B. A. Oldstone M.D. - Google Books n.d.). It is transmitted mainly by the Aedes & Haemagogus species of mosquitoes (Yellow Fever n.d.). Clinical manifestations include sudden onset fever, chills, severe headache, back pain, general body aches, nausea, vomiting, fatigue, weakness, high fever, jaundice, bleeding, shock and organ failure. Areas in Africa and South America are the ones primarily affected by the virus. Virus-specific IgM and neutralizing antibodies in serum, as well as viral detection in early phase blood samples are ways to diagnose YFV infection. Treatment involves taking rest, fluids, pain relievers and antipyretics and avoiding NSAIDs. The viral genome consists of structural genes (C, prM & E) and non-structural genes (NS1, 2A, 2B, 3, 4A, 4B & 5) (Yellow Fever Virus (YFV) Overview: Overview, Symptoms, Transmission, Diagnosis, etc- CUSABIO n.d.). Pathogenesis begins with the dendritic cells in lymph nodes, followed by hepatocyte infection and degradation by eosinophils and appearance of Councilman bodies (Quaresma et al., 2006). YFV can be propagated in the MA-104, Vero, LLC-MK2, MA-111, BHK, AP-61 & C6/36 cell lines (Manual for the monitoring of yellow fever virus infection The Department of Immunization, Vaccines and Biologicals thanks the donors whose unspecified financial support has made the production of this publication possible, 2004) (Table 10.1).

10.9

Haemorrhagic Fever with Renal Syndrome (HFRS)

A form of haemorrhagic fever occurs with infection by any one of the viruses including Hantaan virus, Dobrava virus, Saaremaa virus, Seoul virus and Puumala virus (CDC - Hemorrhagic Fever with Renal Syndrome (HFRS) - Hantavirus n.d.). Clinically similar diseases are caused by all these viruses, which are members of the Hantaviridae family. Korean haemorrhagic fever, epidemic haemorrhagic fever, nephropathia epidemica are all variations of HFRS. There are intense headaches, back and abdominal pain, fever, chills, nausea and blurred vision, flushing of the face, inflammation, vascular leakage and acute kidney failure. Serodiagnosis, antigen detection in tissues by immunohistochemistry or hantaviral RNA in blood or tissue, are the methods of laboratory diagnosis. Intravenous ribavirin has been found to help reduce chances of death when used early in disease. Maintenance of hydration, electrolyte levels, oxygen and blood pressure, as well as management of secondary infections are the ways to manage HFRS. Rodents are the primary transmission mode. Mortality rates vary depending on the infecting virus.

Disease caused Lassa Haemorrhagic Fever

Lujo Haemorrhagic fever

Argentine Haemorrhagic fever

Name of virus Lassa mammarenavirus (LASV)

Lujo mammarenavirus (LUJV)

Junín virus (JUNV)

Inhalation of aerosolized urine or faeces of infected Calomys musculinus mice, and body fluids of infected people (Argentine Hemorrhagic Fever n.d.)

Direct contact with infected rodents, or contact with their aerosolized faeces or urine, contact with body fluids of infected people

Transmission mode Ingestion/inhalation of objects contaminated with faeces or urine of infected Mastomys rats, exposure to infected human body fluids

Clinical manifestations Slight fever, general malaise, weakness, headache, haemorrhaging, respiratory distress, repeated vomiting, facial swelling, chest, back and abdomen pain, shock, hearing loss, tremors, and encephalitis Non-specific febrile illness, headache, muscle pain, morbilliform rash on face and trunk, face and neck swelling, pharyngitis, diarrhoea, respiratory distress, neurological signs, and circulatory collapse Fever, malaise, dizziness, myalgias, skin dysesthesia, oral ulcerations, lymphadenopathy, chest, back and abdominal pain, sore throat, headache, nausea, vomiting, cough, photophobia, conjunctival redness, facial flushing, small axillary petechiae, shock, pulmonary oedema, diffuse mucosal

Treatment Ribavirin, support of fluid, electrolyte balance, oxygenation and blood pressure management

Hydration and shock management, sedation, pain relief, precautions for bleeding disorders, transfusions, convalescent plasma, ribavirin

Immune plasma, ribavirin (Enria and Maiztegui, 1994)

Laboratory diagnosis IgM, IgG, antigen based ELISAs, RT-PCR, virus isolation

Virus isolation, RT-PCR, immunofluorescence, ELISA

RT-PCR (Lozano et al., 1995)

Table 10.1 Description and details of some other VHFs (sources: (Centers for Disease Control and Prevention n.d.)

292 A. Gangopadhayya and P. L. Bhukya

Bodily secretions and excretions of Zygodontomys brevicauda (Milazzo et al., 2011)

Tick bites, contact with infected or dead animals (Kyasanur Forest Disease (KFD) | CDC n.d.)

Brazilian Haemorrhagic fever

Venezuelan Haemorrhagic fever

Kyasanur Forest disease

Sabiá mammarenavirus (SABV)

Guanarito mammarenavirus (GTOV)

Kyasanur Forest disease virus (KFDV)

Aerosols from or contamination by excreta of infected Calomys callosus, person-to-person transmission (Kilgore et al., 1995) Excreta of rodents, contaminated surfaces and water, aerosols and body fluids from infected patients (Wayback Machine n.d.)

Bolivian Haemorrhagic fever

Machupo mammarenavirus (MACV)

Fever, eye redness, fatigue, dizziness, muscle aches, strength loss, exhaustion, bleeding under skin, internal organs and from body orifices, shock, nervous system malfunction, coma, delirium, and seizures Fever, malaise, headache, arthralgia, sore throat, vomiting, abdominal pain, diarrhoea, convulsions, haemorrhagic manifestations, leukopenia, thrombocytopenia Chills, fever, headache, severe muscle pain, vomiting, gastrointestinal symptoms, bleeding

haemorrhaging, meningoencephalitis, convulsions, and vesicular and/or petechial rash on the oropharynx Fever, malaise, headache, myalgia, petechiae on upper body, bleeding from nose and gums, tremors, delirium, and convulsions

None Serum anti-virus antibody detection (Tesh et al., 1993)

Viral Haemorrhagic Fevers (continued)

Hydration maintenance, taking precautions for bleeding disorders

Ribavirin (Barry et al., 1995), and fluid administration to avoid dehydration.

Immunoassay, and viral culture

PCR, viral isolation, and ELISA

Ribavirin (Kilgore et al., 1997)

IgM & IgG ELISA, RT-PCR (Patterson et al., 2014)

10 293

Alkhurma Haemorrhagic fever

Omsk Haemorrhagic fever

Chapare Haemorrhagic fever

Omsk Haemorrhagic fever virus (OHFV)

Chapare mammarenavirus (CHAPV)

Disease caused

Alkhurma Haemorrhagic fever virus (ALKV)

Name of virus

Table 10.1 (continued)

Bites from infected ticks, exposure to blood, faeces or urine of infected, sick or dead animals, mostly rodents, environmental transmission (such as through water), milk of infected goats or sheep (Omsk Hemorrhagic Fever | CDC n.d.). Bites and scratches of infected rodents, inhaling aerosolized urine, faeces or saliva from them, or

Bites of hard (Hyalomma dromedary) and soft (Ornithodoros savignyi) ticks, crushing infected ticks (Alkhurma Hemorrhagic Fever (AHF) | CDC n.d.)

Transmission mode

Clinical manifestations

Fever, headache, joint and muscle pain, pain behind eyes, stomach pain, vomiting, diarrhoea,

problems, abnormally low blood pressure, low platelet, red and white blood cell counts, severe headache, mental disturbances, tremors, vision deficits Fever, anorexia, general malaise, diarrhoea, vomiting, neurologic and haemorrhagic symptoms, multi-organ failure, thrombocytopenia, leukopenia and elevated liver enzymes Chills, fever, headache, severe muscle pain with vomiting, gastrointestinal symptoms, bleeding problems, abnormally low blood pressure, low platelet, red and white blood cell counts and encephalitis

Maintaining fluid and electrolyte balance, oxygen status, blood pressure

Hydration maintenance, bleeding disorder care, long term supportive care for complications

Management of hydration and shock, sedation, pain relief and transfusions

Viral isolation, PCR and ELISA

Real time RT-PCR, and viral detection from body fluids

Treatment

PCR, viral isolation from blood, and ELISA

Laboratory diagnosis

294 A. Gangopadhayya and P. L. Bhukya

Rift Valley fever

Rift Valley fever phlebovirus (RVFV)

Bas-Congo tibrovirus (BASV)

Whitewater arroyo Haemorrhagic fever

Whitewater arroyo mammarenavirus (WWAV)

Unknown, predicted to have cattle reservoir and biting midge vector (Babayan et al., 2018)

consuming food contaminated by them, and body fluids of infected and recovered patients (Chapare Hemorrhagic Fever (CHHF) | CDC n.d.) Rodents (Neotoma albigula), their faeces, nesting materials, surfaces contaminated with rodent faeces (Fatal Illnesses Associated With a New World Arenavirus— California, 1999–2000 n.d.) Bites of Aedes and Culex mosquitoes, bites of other insects, blood, body fluids and tissues of infected animals (Rift Valley Fever | CDC n.d.) Fever, weakness, back pain, dizziness, lesions on the eye, encephalitis, headaches, coma, seizures, jaundice, bloody vomit and stool, gums, skin, nose and injection site bleeding Fever, headache, abdominal pain, mouth, nasal, ocular and oral bleeding, haematemesis and bloody diarrhoea (Grard et al., 2012)

Haemorrhagic fever with liver failure, fever, headache, acute respiratory distress syndrome and myalgia

bleeding gums, rash, and irritability

Medication for fever and body ache, supportive care for serious cases

Fluid resuscitation, blood transfusion, empiric antibiotics

Antibody detection

As used for other Haemorrhagic fevers

Viral isolation, RT-PCR, and IgM & IgG ELISA

Nested RT-PCR, viral isolation

10 Viral Haemorrhagic Fevers 295

296

A. Gangopadhayya and P. L. Bhukya

10.10 Vaccines Against Haemorrhagic Fever Viruses Dengvaxia is a live recombinant tetravalent vaccine by Sanofi Pasteur that was first licensed for use in Mexico in 2015 (Vaccines and Immunization: Dengue n.d.). Vaccine candidates exist for CCHFV, with only a viral vector vaccine, MVA-GP, having reached Phase I trials (Overview of CCHF Vaccine Candidates CCHFV Vaccine Evaluation. . . n.d.). There have been Soviet and Bulgarian inactivated licensed vaccines as well. Merck manufactures a recombinant VSV vaccine for the Zaire ebolavirus, called Ervebo, licensed for use in the USA (Ebola Vaccine: Information about Ervebo® | Clinicians | Ebola (Ebola Virus Disease) | CDC n.d.). The Yellow Fever vaccine 17D has been one of the safest and most efficacious to exist, serving as inspiration for several other vaccine development strategies (Collins and Barrett, 2017). There has been a licensed, inactivated, tissue-culture based KFD vaccine in India which have been used to immunize people in endemic areas since 1990 (Vaccine Information, ICMR New Delhi - KFD n.d.). China and Korea have existing licensed Hantavirus vaccines, however these are not licensed in the USA or Europe (Tian and Stenseth, 2019). There have been vaccines existing for TBE, all inactivated-virus, tissue-culture based (WHO Position Paper on Tick-Borne Encephalitis (TBE) n.d.). Smallpox was the first contagious disease to be developed a vaccine against, done by Edward Jenner in 1796 (Smallpox Vaccines n.d.).

10.11 Models for VHF Research Lassa fever has the rhesus macaque as the widely accepted ideal disease model, while the marmoset is also considered as a smaller sized alternative (Falzaran and Bente, 2019). The same models are also best suited for the Junin virus. CCHF may be studied using a mouse model knocked out for the Signal Transducer & Activator of Transcription 1 (STAT1), which mimics human disease to some extent. Mice, rats, gerbils, hamsters and rhesus macaques are all models suitable for Rift Valley Fever, with mice perhaps being the best suited. Filoviruses have been studied in adapted mouse models, mice knockout models, and rodents, but the rhesus and cynomolgus macaques present the best models. Murine models for DENV have been developed, such as those having knocked out interferon receptors, but they have to be infected with mouse-adapted DENV strains. Rhesus & cynomolgus macaques, and hamsters have been found as suitable models for Yellow fever. Langurs and bonnet monkeys serve as animal models for Kyasanur Forest Disease. A lethal mouse model has also been established for the disease Omsk Haemorrhagic Fever.

10.12 Conclusion To conclude, VHFs are caused by an array of viral families, can result in varied symptoms and with research upon their prevention or treatment being in a multitude of stages at the moment. The necessity is to better characterize and group the newly

10

Viral Haemorrhagic Fevers

297

discovered viruses capable of causing VHF. This will result in a more efficient planning and survey of epidemiological factors in addition to pathogenic ones, creating a complete picture of the occurrence and distribution of VHFs and causative viruses. We are also shown a glimpse into the devastating effects of some viral diseases, which no other category of pathogen is capable of. It is the unique pathogenesis of these viruses that result in such extreme signs that are often associated with higher mortality. VHFs indicate the requirement of constantly performing research on such viruses, something that we can only do with adequately equipped laboratories with the correct biosafety containment levels. Careful specimen handling, research and data interpretation are some of the activities that can boost VHF understanding and perhaps pave paths towards understanding and curing them.

References Agarwal S, Zhou T, Frontera J (2019) Journal Club: association between aspirin dose and subarachnoid hemorrhage from saccular aneurysms. Neurology 92:920. https://doi.org/10.1212/ WNL.0000000000007460 Akıncı E, Bodur H, Leblebicioglu H (2013) Pathogenesis of Crimean-Congo hemorrhagic fever. Vector-Borne and Zoonotic Diseases 13:429. https://doi.org/10.1089/vbz.2012.1061 Alkhurma Hemorrhagic Fever (AHF) | CDC [WWW Document] (n.d.). https://www.cdc.gov/vhf/ alkhurma/index.html. Accessed 10 Aug 2021 Arenaviridae | Viral Hemorrhagic Fevers (VHFs) | CDC [WWW Document] (n.d.). https://www. cdc.gov/vhf/virus-families/arenaviridae.html. Accessed 15 April 2021) Argentine Hemorrhagic Fever [WWW Document] (n.d.). https://www.visualdx.com/visualdx/ diagnosis/argentine+hemorrhagic+fever?diagnosisId=53346&moduleId=16. Accessed 9 Aug 2021) Babayan SA, Orton RJ, Streicker DG (2018) Predicting reservoir hosts and arthropod vectors from evolutionary signatures in RNA virus genomes. Science 362:577–580. https://doi.org/10.1126/ SCIENCE.AAP9072 Baekgaard JS, Eskesen TG, Lee JM, Yeh DD, Kaafarani HMA, Fagenholz PJ, Avery L, Saillant N, King DR, Velmahos GC (2019) Spontaneous retroperitoneal and rectus sheath hemorrhage— management, risk factors and outcomes. World J Surg 43:1890. https://doi.org/10.1007/s00268019-04988-y Barry M et al (1995) Brief report: treatment of a laboratory-acquired Sabiá virus infection. N Engl J Med 333:294–296. https://doi.org/10.1056/NEJM199508033330505 Baskerville A, Fisher-Hoch SP, Neild GH, Dowsett AB (1985) Ultrastructural pathology of experimental ebola haemorrhagic fever virus infection. J Pathol 147:199. https://doi.org/10. 1002/path.1711470308 Bayot ML, King KC (2019) Biohazard levels, StatPearls. StatPearls Publishing Becker S, Spiess M, Klenk H-D (1995) The asialoglycoprotein receptor is a potential liver-specific receptor for Marburg virus. J Gen Virol 76:393–399. https://doi.org/10.1099/0022-1317-762-393 Bonnar J (2000) Massive obstetric haemorrhage. Best Pract Res Clin Obstet Gynaecol 14:1. https:// doi.org/10.1053/beog.1999.0060 Bunyaviridae | Viral Hemorrhagic Fevers (VHFs) | CDC [WWW Document] (n.d.). https://www. cdc.gov/vhf/virus-families/bunyaviridae.html. Accessed 15 Apr 202)

298

A. Gangopadhayya and P. L. Bhukya

Bunyaviridae—Negative Sense RNA Viruses—Negative Sense RNA Viruses (2011)—ICTV [WWW Document] (n.d.). https://talk.ictvonline.org/ictv-reports/ictv_9th_report/negativesense-rna-viruses-2011/w/negrna_viruses/205/bunyaviridae. Accessed 16 Apr 2021 Burt FJ, Rolph MS, Rulli NE, Mahalingam S, Heise MT (2012) Chikungunya: a re-emerging virus. Lancet 379:662. https://doi.org/10.1016/S0140-6736(11)60281-X CDC—Hemorrhagic Fever with Renal Syndrome (HFRS)—Hantavirus [WWW Document] (n.d.). https://www.cdc.gov/hantavirus/hfrs/index.html. Accessed 30 July 2021 Centers for Disease Control and Prevention [WWW Document] (n.d.). https://www.cdc.gov/. Accessed 9 Aug 2021 Chapare Hemorrhagic Fever (CHHF) | CDC [WWW Document] (n.d.). https://www.cdc.gov/vhf/ chapare/index.html. Accessed 11 Aug 2021 Chikungunya Fact Sheet [WWW Document] (n.d.). https://www.who.int/news-room/fact-sheets/ detail/chikungunya. Accessed 11 July 2021 Collins ND, Barrett ADT (2017) Live attenuated yellow fever 17D vaccine: a legacy vaccine still controlling outbreaks in modern day. Curr Infect Dis Rep 19:14. https://doi.org/10.1007/ S11908-017-0566-9 Costa RL, Voloch CM, Schrago CG (2012) Comparative evolutionary epidemiology of dengue virus serotypes. Infect Genet Evol 12:309–314. https://doi.org/10.1016/j.meegid.2011.12.011 Crimean-Congo Hemorrhagic Fever (CCHF) | CDC [WWW Document] (n.d.). https://www.cdc. gov/vhf/crimean-congo/index.html. Accessed 11 July 2021 Dai S, Wu Q, Wu X, Peng C, Liu J, Tang S, Zhang T, Deng F, Shen S (2021) Differential cell line susceptibility to Crimean-Congo hemorrhagic fever virus. Front Cell Infect Microbiol 11:236. https://doi.org/10.3389/fcimb.2021.648077 Dengue | CDC [WWW Document] (n.d.). https://www.cdc.gov/dengue/index.html. Accessed 12 July 2021 Dengue Virus Biological Agent Reference Sheet (BARS) | Environment, Health and Safety [WWW Document] (n.d.). https://ehs.cornell.edu/research-safety/biosafety-biosecurity/biologicalsafety-manuals-and-other-documents/bars-other/dengue-virus. Accessed 10 July 21 Ebola (Ebola Virus Disease) | CDC [WWW Document] (n.d.). URL https://www.cdc.gov/vhf/ ebola/index.html. Accessed 14 July 2021 Ebola Vaccine: Information about Ervebo® | Clinicians | Ebola (Ebola Virus Disease) | CDC [WWW Document] (n.d.). https://www.cdc.gov/vhf/ebola/clinicians/vaccine/index.html. Accessed 1 Aug 21 Enria DA, Maiztegui JI (1994) Antiviral treatment of argentine hemorrhagic fever. Antivir Res 23: 23–31. https://doi.org/10.1016/0166-3542(94)90030-2 Faheem M, Raheel U, Riaz MN, Kanwal N, Javed F, Us Sahar Sadaf Zaidi N, Qadri I (2011) A molecular evaluation of dengue virus pathogenesis and its latest vaccine strategies. Mol Biol Rep 38:3731–3740. https://doi.org/10.1007/S11033-010-0488-1 Falzaran D, Bente DA (2019) Animal models for viral haemorrhagic fever. Clin Microbiol Infect 21:e17–e27. https://doi.org/10.1111/1469-0691.12630 Fatal Illnesses Associated With a New World Arenavirus—California, 1999–2000 [WWW Document] (n.d.). https://www.cdc.gov/mmwr/preview/mmwrhtml/mm4931a1.htm. Accessed 11 Aug 2021 Filoviridae | Viral Hemorrhagic Fevers (VHFs) | CDC [WWW Document] (n.d.). https://www.cdc. gov/vhf/virus-families/filoviridae.html. Accessed 16 Apr 2021 Filoviridae ~ ViralZone [WWW Document] (n.d.). https://viralzone.expasy.org/23?outline=all_ by_species. Accessed 18 April 2021 Flaviviridae - Wikipedia [WWW Document] (n.d.). https://en.wikipedia.org/wiki/Flaviviridae. Accessed 16 April 21 Flaviviridae ~ ViralZone [WWW Document] (n.d.). https://viralzone.expasy.org/43?outline=all_ by_species. Accessed 18 April 21 Grard G, Fair JN, Lee D, Slikas E, Steffen I, Muyembe J-J, Sittler T, Veeraraghavan N, Ruby JG, Wang C, Makuwa M, Mulembakani P, Tesh RB, Mazet J, Rimoin AW, Taylor T, Schneider BS,

10

Viral Haemorrhagic Fevers

299

Simmons G, Delwart E, Wolfe ND, Chiu CY, Leroy EM (2012) A novel rhabdovirus associated with acute hemorrhagic fever in Central Africa. PLoS Pathog 8:e1002924. https://doi.org/10. 1371/JOURNAL.PPAT.1002924 Günther S, Feldmann H, Geisbert TW, Hensley LE, Rollin PE, Nichol ST, Ströher U, Artsob H, Peters CJ, Ksiazek TG, Becker S, ter Meulen J, Ölschläger S, Schmidt-Chanasit J, Sudeck H, Burchard GD, Schmiedel S (2011) Management of accidental exposure to Ebola virus in the biosafety level 4 laboratory, Hamburg, Germany. J Infect Dis 204:S785. https://doi.org/10. 1093/infdis/jir298 Hooper N, Armstrong TJ (2018) Shock, hemorrhagic. StatPearls. StatPearls Publishing Jain J, Kumari A, Somvanshi P, Grover A, Pai S, Sunil S (2017) In silico analysis of natural compounds targeting structural and nonstructural proteins of chikungunya virus. F1000Res 6: 1601. https://doi.org/10.12688/f1000research.12301.1 Kilgore PE, Peters CJ, Mills JN, Rollin PE, Armstrong L, Khan AS, Ksiazek TG (1995) Prospects for the control of Bolivian hemorrhagic fever. Emerg Infect Dis 1:97. https://doi.org/10.3201/ EID0103.950308 Kilgore PE et al (1997) Treatment of Bolivian hemorrhagic fever with intravenous ribavirin. Clin Infect Dis 24:718–722. https://doi.org/10.1093/CLIND/24.4.718 Kyasanur Forest Disease (KFD) | CDC [WWW Document] (n.d.). https://www.cdc.gov/vhf/ kyasanur/index.html. Accessed 10 Aug 2021 Lazarev A, Golokhvast K, Borozda I (2019) Review of the problems of diagnosis of Endopelvic Haemorrhage, its intensity, volume, and duration, and treatment methods of circulatory injuries and surgical hemostasis after pelvic fractures. Emerg Med Int 2019:1. https://doi.org/10.1155/ 2019/2514146 Logue J, Licona WV, Cooper TK, Reeder B, Byrum R, Qin J, Murphy ND, Cong Y, Bonilla A, Sword J, Weaver W, Kocher G, Olinger GG, Jahrling PB, Hensley LE, Bennett RS (2019) Ebola virus isolation using Huh-7 cells has methodological advantages and similar sensitivity to isolation using other cell types and suckling BALB/c laboratory mice. Viruses 11:161. https:// doi.org/10.3390/V11020161 Lozano ME et al (1995) Rapid diagnosis of Argentine hemorrhagic fever by reverse transcriptase PCR-based assay. J Clin Microbiol 33:1327–1332. https://doi.org/10.1128/JCM.33.5. 1327-1332.1995 Manual for the monitoring of yellow fever virus infection The Department of Immunization, Vaccines and Biologicals thanks the donors whose unspecified financial support has made the production of this publication possible (2004) Marburg Hemorrhagic Fever (Marburg HF) | CDC [WWW Document] (n.d.). https://www.cdc.gov/ vhf/marburg/index.html. Accessed 17 July 2021) Martina BEE, Koraka P, Osterhaus ADME (2009) Dengue virus pathogenesis: an integrated view. Clin Microbiol Rev 22:564–581. https://doi.org/10.1128/CMR.00035-09 Mehedi M, Groseth A, Feldmann H, Ebihara H (2011) Clinical aspects of Marburg hemorrhagic fever. Futur Virol 6:1091. https://doi.org/10.2217/FVL.11.79 Milazzo ML, Cajimat MNB, Duno G, Duno F, Utrera A, Fulhorst CF (2011) Transmission of Guanarito and Pirital viruses among wild rodents, Venezuela. Emerg Infect Dis 17(12): 2209–2215. https://doi.org/10.3201/EID1712.110393 Nisii C, Castilletti C, di Caro A, Capobianchi MR, Brown D, Lloyd G, Gunther S, Lundkvist A, Pletschette M, Ippolito G, Drosten C, Falk K, Georges MC, Meyer H, Becker S, Eickmann M, Huemer H, Charrel R (2009) The European network of biosafety-Level-4 laboratories: enhancing European preparedness for new health threats. Clin Microbiol Infect 15:720. https://doi.org/ 10.1111/j.1469-0691.2009.02946.x Omsk Hemorrhagic Fever | CDC [WWW Document] (n.d.). https://www.cdc.gov/vhf/omsk/index. html. Accessed 11 Aug 2021 Overview of CCHF Vaccine Candidates CCHFV Vaccine Evaluation. . . (n.d.) Patterson M, Grant A, Paessler S (2014) Epidemiology and pathogenesis of Bolivian hemorrhagic fever. Curr Opin Virol 0:82. https://doi.org/10.1016/J.COVIRO.2014.02.007

300

A. Gangopadhayya and P. L. Bhukya

Pontius E, Vieth JT (2019) Complications in early pregnancy. Emerg Med Clin North Am 37:219. https://doi.org/10.1016/j.emc.2019.01.004 Powers AM, Logue CH (2007) Changing patterns of chikunya virus: re-emergence of a zoonotic arbovirus. J Gen Virol 88:2363. https://doi.org/10.1099/vir.0.82858-0 Quaresma JAS, Barros VLRS, Pagliari C, Fernandes ER, Guedes F, Takakura CFH, Andrade HF, Vasconcelos PFC, Duarte MIS (2006) Revisiting the liver in human yellow fever: virus-induced apoptosis in hepatocytes associated with TGF-β, TNF-α and NK cells activity. Virology 345: 22–30. https://doi.org/10.1016/J.VIROL.2005.09.058 Qureshi AI, Mendelow AD, Hanley DF (2009) Intracerebral haemorrhage. Lancet 373:1632. https://doi.org/10.1016/S0140-6736(09)60371-8 Radoshitzky SR, Buchmeier MJ, Charrel RN, Clegg JCS, Gonzalez J-PJ, Günther S, Hepojoki J, Kuhn JH, Lukashevich IS, Romanowski V, Salvato MS, Sironi M, Stenglein MD, de la Torre JC (2019) ICTV virus taxonomy profile: Arenaviridae. J Gen Virol 100:1200. https://doi.org/10. 1099/jgv.0.001280 Report of a WHO/International Study Team (1978) Ebola haemorrhagic fever in Sudan, 1976. Bull World Health Organ 56:247 Rhabdoviridae - Wikipedia [WWW Document] (n.d.). https://en.wikipedia.org/wiki/ Rhabdoviridae. Accessed 16 April 2021 Rhabdoviridae ~ ViralZone [WWW Document] (n.d.). https://viralzone.expasy.org/2?outline=all_ by_species. Accessed 18 April 2021 Rift Valley Fever | CDC [WWW Document] (n.d.). https://www.cdc.gov/vhf/rvf/index.html. Accessed 11 Aug 2021 Ross RW (1956) The Newala epidemic: III. The virus: isolation, pathogenic properties and relationship to the epidemic. J Hyg 54:177. https://doi.org/10.1017/S0022172400044442 Rougeron V, Feldmann H, Grard G, Becker S, Leroy EM (2015) Ebola and Marburg haemorrhagic fever. J Clin Virol 64:111–119. https://doi.org/10.1016/J.JCV.2015.01.014 Ryu W-S (2017) Other positive-strand RNA viruses. In Molecular virology of human pathogenic viruses. Elsevier doi: https://doi.org/10.1016/B978-0-12-800838-6.00013-8 Schwartz O, Albert ML (2010) Biology and pathogenesis of chikungunya virus. Nat Rev Microbiol 8:491. https://doi.org/10.1038/nrmicro2368 Senigl F, Grubhoffer L, Kopecky J (2006) Differences in maturation of tick-borne encephalitis virus in mammalian and tick cell line. Intervirology 49:239–248. https://doi.org/10.1159/000091471 Siegert R, Shu H-L, Slenczka W, Peters D, Müller G (2009) Zur Ätiologie einer unbekannten, von Affen ausgegangenen menschlichen Infektionskrankheit. DMW - Deutsche Medizinische Wochenschrift 92:2341–2343. https://doi.org/10.1055/S-0028-1106144 Smallpox | CDC [WWW Document] (n.d.). https://www.cdc.gov/smallpox/index.html. Accessed 17 July 2021 Smallpox Vaccines [WWW Document] (n.d.). https://www.who.int/news-room/feature-stories/ detail/smallpox-vaccines. Accessed 1 Aug 2021 Srichaikul T, Nimmannitya S (2000) Haematology in dengue and dengue haemorrhagic fever. Best Pract Res Clin Haematol 13:261. https://doi.org/10.1053/beha.2000.0073 Stanley AJ, Laine L (2019) Management of acute upper gastrointestinal bleeding. BMJ:l536. https://doi.org/10.1136/bmj.l536 Tesh RB et al (1993) Field studies on the epidemiology of Venezuelan hemorrhagic fever: implication of the cotton rat Sigmodon alstoni as the probable rodent reservoir. Am J Trop Med Hyg 49:227–235. https://doi.org/10.4269/AJTMH.1993.49.227 Tian H, Stenseth NC (2019) The ecological dynamics of hantavirus diseases: from environmental variability to disease prevention largely based on data from China. PLoS Negl Trop Dis 13. https://doi.org/10.1371/JOURNAL.PNTD.0006901 Tick-borne Encephalitis (TBE) | CDC [WWW Document] (n.d.). https://www.cdc.gov/vhf/tbe/ index.html. Accessed 29 July 2021 Tick-Borne Encephalitis | IntechOpen [WWW Document] (n.d.). https://www.intechopen.com/ chapters/54912. Accessed 29 July 2021

10

Viral Haemorrhagic Fevers

301

Vaccine Information, ICMR New Delhi - KFD [WWW Document] (n.d.). https://vaccine.icmr.org. in/kfd. Accessed 1 Aug 2021 Vaccines and Immunization: Dengue [WWW Document] (n.d.). https://www.who.int/news-room/ q-a-detail/dengue-vaccines. Accessed 1 Aug 2021 Vågene ÅJ, Herbig A, Campana MG, Robles García NM, Warinner C, Sabin S, Spyrou MA, Andrades Valtueña A, Huson D, Tuross N, Bos KI, Krause J (2018) Salmonella enterica genomes from victims of a major sixteenth-century epidemic in Mexico. Nat Ecol Evol 2:520. https://doi.org/10.1038/s41559-017-0446-6 Viral Hemorrhagic Fever | 2011 Case Definition [WWW Document] (n.d.). https://wwwn.cdc.gov/ nndss/conditions/viral-hemorrhagic-fever/case-definition/2011/. Accessed 11 April 2021 Viruses, Plagues, and History: Past, Present and Future - Michael B. A. Oldstone M.D. - Google Books [WWW Document] (n.d.). https://books.google.co.in/books?id=2XbHXUVY65gC& pg=PA103&redir_esc=y#v=onepage&q &f=false Accessed 30 July 2021 Wayback Machine [WWW Document] (n.d.). https://web.archive.org/web/20120226155427/http:// www.nrt.org/production/NRT/NRTWeb.nsf/AllAttachmentsByTitle/A-1009WMDQRGBHF/ $File/07BrazilianHemorrhagicFever(BzHF)QRG.pdf?OpenElement. Accessed 10 Aug 2021 Weekly epidemiological record Relevé épidémiologique hebdomadaire (2011) Weidmann M, Avsic-Zupanc T, Bino S, Bouloy M, Burt F, Chinikar S, Christova I, Dedushaj I, El-Sanousi A, Elaldi N, Hewson R, Hufert FT, Humolli I, Jansen van Vuren P, Koçak Tufan Z, Korukluoglu G, Lyssen P, Mirazimi A, Neyts J, Niedrig M, Ozkul A, Papa A, Paweska J, Sall AA, Schmaljohn CS, Swanepoel R, Uyar Y, Weber F, Zeller H, Weidmann M (2016) Biosafety standards for working with Crimean-Congo hemorrhagic fever virus. J Gen Virol 97:2799– 2808. https://doi.org/10.1099/jgv.0.000610 Whitfield ZJ, Prasad AN, Ronk AJ, Kuzmin I, Ilinykh PA, Andino R, Bukreyev A (2020) Speciesspecific evolution of Ebola virus during replication in human and bat cells in brief speciesspecific evolution of Ebola virus during replication in human and bat cells. CellReports 32: 108028. https://doi.org/10.1016/j.celrep.2020.108028 WHO Position Paper on Tick-Borne Encephalitis (TBE) (n.d.) Wikan N, Sakoonwatanyoo P, Ubol S, Yoksan S, Smith DR (2012) Chikungunya virus infection of cell lines: analysis of the east, central and south African lineage. PLoS One 7:31102. https://doi. org/10.1371/journal.pone.0031102 Yellow Fever [WWW Document] (n.d.). https://www.cdc.gov/yellowfever/index.html. Accessed 30 July 2021 Yellow Fever Virus (YFV) Overview: Overview, Symptoms, Transmission, Diagnosis, etcCUSABIO [WWW Document] (n.d.). https://www.cusabio.com/infectious-diseases/yellowfever-virus.html. Accessed 30 July 2021

Emerging Arboviral Infections

11

G. Sai Lakshmi, Rizwana Syed, L. Preethi, Prudhvi Lal Bhukya, and Suhas T. Mhaske

Abstract

The emergence and re-emergence of arboviruses have been occurring since centuries. While many anthropological factors influence arbovirus emergence and dispersal, the role of arthropod vectors and their feeding habitats (anthropophilic and/or ornithophilic) in global or local geographic inflation is critical. In recent decades, they have had an impact on the epidemiology of certain emerging arboviruses in both hemispheres (yellow fever virus, dengue virus, West Nile virus, chikungunya virus, and Zika virus) and specific regions (Japanese encephalitis virus, St. Louis encephalitis virus, Murray Valley encephalitis virus, Usutu virus, Spondweni virus, O’nyong nyong virus, O’nyong virus, and Rift Valley fever virus). Due to error-prone RNA-dependent RNA polymerases, RNA viruses tend to possess genetic diversity, promoting high mutation rates that endorse adaptation to environmental changes or host immunity. This chapter outlines examples of (re)emerging pathogenic arboviruses and explanations of their emergency as well as various patterns of infection, with a focus on mosquito vectors and important determinants of arbovirus emergence. Finally, based on our current understanding of this virus, this chapter discusses recent research

G. Sai Lakshmi · R. Syed Whole Genome Sequencing Lab, CCMB-Siddhartha Medical College, Vijayawada, Andhra Pradesh, India L. Preethi Department of Pharmacy Practice, SRM College of Pharmacy, SRM Institute of Science and Technology, Kattankulathur, Chengalpattu, Tamil Nadu, India P. L. Bhukya · S. T. Mhaske (✉) Vaccine Testing Laboratory, Rodent Experimentation Facility, ICMR-National Animal Facility Resource Facility for Biomedical Research, Hyderabad, Telangana, India # The Author(s), under exclusive license to Springer Nature Singapore Pte Ltd. 2023 P. L. Bhukya et al. (eds.), Emerging Human Viral Diseases, Volume I, https://doi.org/10.1007/978-981-99-2820-0_11

303

304

G. Sai Lakshmi et al.

limitations encountered in developing control strategies to mitigate the impact of future emerging arbovirus diseases. Keywords

Arbovirus · Emergence · Epidemiology · Genomic diversity · Life cycle · Evolution

11.1

Introduction

In addition, five mosquito-borne infections that produce epidemics in humans have evolved in both hemispheres in the past centuries, like chikungunya virus (CHIKV), yellow fever virus (YFV), Zika virus (ZIKV), West Nile virus (WNV), and dengue virus (DENV). Mosquito-borne arboviruses like O’nyong nyong virus (ONNV), Murray Valley encephalitis virus (MVEV), Rift Valley fever virus (RVFV), Usutu virus (USUV), Spondweni virus (SPOV), Japanese encephalitis virus (JEV), and St. Louis encephalitis virus (SLEV) are associated with unique regions of the world. These pandemics are now exceptional. Many arthropods are zoonotic and can spread to other animals, including birds and many types of arthropods. Arboviruses have developed an unequal relationship with these symbiotic hosts over the years, unlike humans. Human exposure to mosquitoes and global mobility have increased dramatically due to the effects of population density due to urbanization and expansion of the global transportation system. Consequently, patterns of virus-vector-host interaction have evolved over the past several centuries. Flavivirus is a single-stranded RNA virus that causes major pollution and epidemics worldwide. It has a major international health impact, and the virus also has the potential to emerge and spread to non-endemic geographic areas. International weather exchange, rapid urbanization, increasing global tourism, increasing mosquito populations, disease transmission, and host and virus genetics may also play a significant role in the re-emergence of these viruses (Löscher and PrüferKrämer 2009). Ketkar et al. compiled a list of viral and host genetic variables that can enhance virus infectivity in the host, mosquito virus reproduction, and mosquito virus transmission (Trammell and Goodman 2021). In a phylogenetic survey, GalanHuerta et al. recorded changes within the envelope protein that can modulate viral motion interactions (Martinez-Liu et al. 2022). Intelligence operations provide timely monitoring of ongoing outbreaks around the arena, informed monthly through the Infectious Disease Risk Report (Gossner et al. 2022).

11.2

Yellow Fever Virus

The Flaviviridae family includes the prototype yellow fever virus. However, the virus still produces major epidemics despite the availability of a powerful vaccine (17D), as was the case in Brazil from December 2016 to March 2018, where there

11

Emerging Arboviral Infections

305

have been more than 2000 confirmed cases received, more than 500 deaths, and more than 4000 deaths from the epidemic (Gaythorpe et al. 2021). It also caused great devastation in Africa and the Americas. In recent years, the virus has come back in larger outbreaks in Africa and Brazil, and the first imported patients in Asia have raised frets about how yellow fever is changing. The incidence of yellow fever is quite stable; however, mortality rates changed widely among African nations over the course of the study (Nwaiwu et al. 2021). YFV is an “enveloped” infection with a genome of 11,000 nucleotides and is associated with a single-stranded positive-sense RNA genome. The genome is structured with a 5’ stop cap, 3 structural proteins, and 7 nonstructural (NS) protein structures. Human-to-human transmission of the YFV virus, recognized as the urban transmission cycle, is the result of Aedes aegypti colonization and periodic introduction of this vector into urban regions (Morita and Suzuki 2021). Cases of yellow fever were detected in Kwara, 21 years after the previous epidemic. Due to the late confirmation and denial of cases, as well as the lack of statistics from disorder healers, some healthcare workers have a very low suspicion index for yellow fever. There were delays in collecting and shipping samples to the local lab for testing (Nwachukwu et al. 2020). Between September 2017 and 2019, Nigeria had three intermediate outbreaks of yellow fever, which have been controlled by vaccination (Nomhwange et al. 2021). One study found that YFV cases were the result of visits made with the help of cities. According to geological treatment (Siqueira et al. 2021), the bordering autonomous cities of the country Minas Gerais have moved to the east of the country and the Atlantic coast, following a geographical process (Siqueira et al. 2021). Several studies have analyzed the genome-wide sequencing of YFV specimens from humans, mosquitoes, and nonhuman primates at some point during the 2017 Brazilian outbreak. The group includes all YFV sequences. Lineage (“sub-lineage 1E”) of the South American “genotype I” was found in December 2016 but has been circulating for some months (Gómez et al. 2018). In contrast, some researchers have used a fuzzy logistic regression model to think about compatibility with I/P and O/P characteristics. The results show that the previous method can predict epidemics in different regions with an average accuracy of 79.93% (Anggraeni et al. 2020). Prevention exploration easily shows that climate change is related to the development and return of vector-borne contagious conditions, YFV being an illustration. Despite the fact that many vector-borne conditions are getting better and better under control, the capability to help numerous new vector-borne conditions that may also arise in the future is uncertain.

11.3

Dengue Virus

The most widespread viral illness among trippers is dengue. Dengue infections have grown more than eightfold during the last two decades, from >8000 cases in 2000 to 4.2 million cases in 2019. There are four serotypes. DENV1, -V2, -V3, and -V4 are

306

G. Sai Lakshmi et al.

contagions that beget dengue fever. Fever outbreaks are more common in tropical and temperate countries during the thunderstorm (stormy) season. The World Health Organization reports that India recorded twice the number of cases compared to 2014; the Philippines reported an increase of nearly 50 compared to 2014; and Malaysia reported approximately 18% more cases than in 2014. DENV is a component of the “genus Flavivirus,” a zoonotic arbovirus that spreads throughout the world using humans as both a reservoir and an amplified host. It is an enveloped illness with a 10–11 kbp genome with a single-stranded, limited, “positive-sense RNA” genome. The genome contains three structural coding genes and seven nonstructural coding genes. With the recent emergence of an epidemic lineage of the West African Cosmo typal lineage II, genetically distinct from the African symbiotic genotype, enhanced whole-genome sequencing of DENV2 is required to improve arbovirus surveillance and disease prediction by better understanding its circulation dynamics (Fourié et al. 2021b). In 2017, the appearance of DENV3 genotypes 1 was first detected in Sri Lanka. Further surveillance of this emerging genotype is required to examine its effect on future epidemics and to better comprehend the molecular dengue epidemiology (Ngwe Tun et al. 2021). On the other hand, in Central Queensland, an outbreak of DENV2 began in May 2019 following public health actions. Nucleotide sequences of a serotype isolate obtained from the first confirmed case suggest that the epidemic was produced using a single DENV2 strain most closely connected to the SENV2 strain in “Southeast Asia” (Walker et al. 2021). In addition, appropriate medical advice on mosquito avoidance and continued monitoring of control strategies to prevent dengue as well as other mosquito-borne illnesses must be prioritized in the area (Walker et al. 2021). Climate is an important factor in dengue epidemics, both regionally and globally. Using a range of models, such as local meteorological variables like wind speed, temperature, humidity, and precipitation, the impact of humidity on dengue epidemics will be influenced by the use of temperature and/or precipitation. Informatics modeling has worked wonderfully and rationally in epidemiological studies (Salim et al. 2021). The seasonal pattern reported 92.8 and 98.5% of the variance in the dependent case for the outbreaks in Singapore 2020 and Honduras 2019, May– August and June–October, respectively (Martheswaran et al. 2022). Larger concurrent infections with DENV4 and the prospect of a strong future outbreak in Kerala have been reported (Rahul et al. 2022). According to some studies, dynamic surveillance can detect DENV4 cases for the first time in nearly two decades. Active dengue observation in Belize should be maintained to undertake some timely epidemic response attempts (Ly et al. 2022). Some recent studies with the help of Wei et al. showed that the mosquito’s multiplicative blood-sucking behavior affects the host while reducing the effectiveness of the bite, causing infected mosquitoes to bite more to obtain the same amount of additional blood as uninfected mosquitoes (Wei Xiang et al. 2022). Imported cases, mainly from Southeast Asian countries, had a great effect on the prevalence of dengue in Guangzhou in 2020. Study results show that E gene sequences and bushes of “phylogenetic” origin of the imported and neighboring cases are closely related to

11

Emerging Arboviral Infections

307

the virus sequences from Southeast Asia, but much less with DENV sequences isolated in “Guangzhou” earlier in the years (Jiang et al. 2022). Documenting the characteristics of dengue frequency and severity, as well as vaccination plans and implementation methods, would greatly benefit from a detailed description of the specific literature about the type of spread of DENV. Extensive use of data, like CI (Container Index), BI (Breteau Index), and HI (House Index), as well as the integration of data from social media systems to address dengue impacts in real time potentially improve prediction (Jain et al. 2019). Global phenomena such as urbanization and globalization play a large role in the spread of dengue. Future research should address the SVM as an epidemic predictor and the week of the year as a necessary forecaster of dengue epidemics at unusual spatial scales and in separate model kinds.

11.4

Zika Virus

Human Zika virus infections were sporadic for 50 years before they appeared in the Pacific and the Americas. McCrae and Kirya first kept a nonhuman monkey and mosquitoes away in Africa in 1947 and 1948, respectively. Those were the first people to notice that the Zika virus alone could stop yellow fever from spreading in the wild. (McCrae and Kirya 1982). Approximately 48 nations and territories in the USA have reported indigenous mosquito-borne ZIKV transmission as of 17 November 2016, for an overall 171,553 verified cases. The prevalence of ZIKV peaks in the coastal territories of the Pacific, the Americas, and West Africa, with an estimated 1.62 million individuals diseased in more than 70 international locations around the world. The genus Flavivirus is now classified into groups, species, and subgroups on a purely new molecular basis. The length of the ZIKV genome is around 10.7 kb. It codes for roughly 10.2 kb and contains a single polyprotein. It is divided into two main segments: seven nonstructural proteins (Ns1 to Ns5), pre-membrane (membrane), and three structural proteins capsid-C, envelope-E, and PrM/M (Chen and Whitehead 2021). The emergence and resurgence of arboviral pandemics have been spectacular over the past four decades, affecting both humans and animals. French Polynesia is an overseas region of France in the “South Pacific.” The outbreak lasted around 21 weeks, peaking in week 9 of 2014 with approximately 3500 appointments for Zika fever (Musso et al. 2014). ZIKV remained circulating in the USA as of 2015, with 137 confirmed cases recorded as of August. On January 28, 2014, the Chilean Health Ministry recorded the first case of automatic ZIKV contamination, fairy on Easter Island. At the end of 2014, clusters of “exotic diseases” were retrospectively recorded in Brazil, and an epidemic of “foreign diseases” affected hundreds of people in the northeast of Brazil, generally in Baha, Maranho, Paraba, Sergipe, Rio Grande do Norte, and Pernambuco. Until 2015, only rare cases of ZIKV illness were detected in Africa. However, pandemic pressure from ZIKV returned to its geographical starting point (Africa) in

308

G. Sai Lakshmi et al.

November 2015, when the Cape Verde Health Department declared a ZIKV epidemic. Seventy out of sixty-four serum samples tested positive for the virus at the Pasteur Institute in Dakar, Senegal. Despite Cape Verde’s proximity to Senegal, in which ZIKV is endemic, it is probable that the “Cape Verde” epidemic has something to do with the island’s tourist economy, especially since many Brazilians come to Cape Verde for holidays (Diallo et al. 2014) According to phylogenetic analysis in Bayes, the Indian virus has a complementary ancestor to the Malaysian sequence and is related to all other Asian sequences as a sister group. Then, 2 years later, in 1956, the MRCA of the Indian lineage as well as all following Asian ZIKV lines was developed, showing that the Indian ZIKV was added from an Asian source as an alternative to an African source (Pettersson et al. 2018). PAHO’s epidemiological alert for ZIKV called for the coordinated management of the intermediates and preventive measures in humans. Zika pandemics require vector control. Preventing Zika and other arbovirus trends requires field and pointof-care diagnostics and genomic and proteomic characterization to guide annotation. Epidemics can be contained through mosquito surveillance, early mosquito control, and proactive education campaigns involving local citizens and healthcare workers. ZIKV control requires modern vector management. The ZIKV future is still unclear, but its latest growth verifies that it is following the footsteps of DENV and CHIKV. However, the severity of the illness related to ZIKV in Brazil and French Polynesia proposes that the illness would become a main international public health issue. There is no ZIKV vaccine, but several are being developed using dengue vaccine technology. Therefore, personal safety from mosquito bites and vector handling are the same as for all diseases transmitted by Aedes aegypti without a vaccine.

11.5

Chikungunya Virus

The chikungunya virus, a mosquito-borne illness, is a main public health concern. After a long period of sporadic and intermittent outbreaks, the virus produced large outbreaks (Diallo et al. 2012). It is a joint infection of the “alphavirus genus” of the family “Togaviridae.” It is characterized by the presence of an acute fever progressing to excessive persistent arthralgia throughout the chronic phase of the illness (Gobbi et al. 2015). Chikungunya virus incorporates about 12 kb positive-sense RNA genome encoding five structural proteins (e1, 6k, e2, e3, and c) and four nonstructural proteins (nsp1–4), which can be generated from genomic sub-RNAs. In general, viruses circulate in a symbiotic cycle between mammalian hosts or nonhuman primates and the Aedes mosquito (Cleton et al. 2012). The virus has re-emerged since 2000, producing more epidemics of the disease’s more severe variations than in the past. In 2004, a deadly disease caused by the ECSA lineage developed and moved from Kenya’s coastal towns to the islands of the Indian Ocean, creating an unprecedented epidemic (Sergon et al. 2007). At the same time, the virus re-emerged in India after a 32-month hiatus, affecting 13 states specifically between 2005 and 2006. Although no CHIKV illness cases were

11

Emerging Arboviral Infections

309

recorded in Fiji until recently, the chance of CHIKV’s reappearance is great because of expectations in rise in population and low herd immunity. Therefore, chikungunya must be accounted for in the differential prognosis of acute febrile diseases (Aubry et al. 2020). Genome-wide phylogenetic analysis shows that the virus is frequently reintroduced into India, and the most advanced CHIKV epidemic with a frequent ancestor was as recent as 2006, with 50 medical isolates identified, gathered from two geographical regions, Delhi and Mumbai, between 2010 and 2016 (Chaudhary et al. 2021). Since then, there has been no similar spread of the virus in the Djiboutian territory. A study here confirmed a case of auto-acquired CHIKV illness in Djibouti (2019), indicating a re-emergence of the infection in the nation. The general population and expatriate residents of Djibouti are vulnerable to severe effects owing to acute and prolonged signs, impaired life quality, and socioeconomic effects resulting from this CHIKV strain and the high density of its effective transport; patients present with common signs and rheumatic fever up to 6 years after infection (Fourié et al. 2021a). The profiles provided above will help predict the result of the present along with future CHIKV epidemics. Its history of re-emergence, coupled with the absence of evidence of adaptation constraints early in the urban transmission cycle through environmental monitoring devices, recommends that CHIKV would continue to develop from Africa normally and indefinitely to cause outbreaks.

11.6

West Nile Virus

The WNV is a neurotropic flavivirus and was first detected in a febrile patient in Uganda (1937). WNV remains a major public concern in the USA, Europe, China, the Middle East, and Africa. WNV is an arthropod-borne illness that is spread through a pathogenic cycle between mosquitoes and vertebrate hosts, mainly birds (Chancey et al. 2015). It is a spherical, hermetic virus with a lipid bilayer around the nucleocapsid center. It is 40–50 nm in diameter. The genome is a single-stranded RNA with a positive sense. The genome encodes seven nonstructural proteins and three structural proteins (shell, membrane, and capsid) (Chambers et al. 1990). The virus is described as having two lineages. Infection with strain 1 viruses is frequent and has resulted in large epidemics with high mortality in horses (CastilloOlivares and Wood 2004) (Murgue et al. 2001). They have been largely detected in southern and central Africa, where they can often be related with systemic febrile infections without major utility (CNS) involvement (Tsai et al. 1998). The Greek VNO strains identified between 2010 and 2018 belong to subspecies ECU lineage value 2. In August 2018, a new genetic variant of VNO was identified in a field suitable for people. The strain coincides with the Eastern European subtype of lineage 2, implying that the virus was transmitted to the USA and that the epidemiology of the disease is constantly changing (Papa et al. 2019). In Istanbul, Turkey, researchers studied WNV strains circulating in free-range corvids. Phylogenetic analysis revealed that each sequence was grouped in the WNV-2 lineage and showed at least 97% homology to the WNV-2 sequence (Erdogan Bamac et al. 2021). In

310

G. Sai Lakshmi et al.

2018 and 2019, mosquitoes were concentrated in zoos and on equestrian pastures shortly after the diagnosis of bird and equine cases to detect vectors and define the virus. According to the results, virus pressure changed significantly in 2018, consistent with traces of WNV recovered from sick birds in eastern Germany. The results are the first exposure to WNV in mosquitoes within Germany and reveal the potential for the virus to be overwhelming throughout the country (Kampen et al. 2020). In 2018, large epicenters were observed. The best range of human WNV cases ever documented in Greece was accompanied by a broad geographical distribution, indicating the movement of a full-sized virus. Better surveillance is critical for the early identification of human infections and rapid response actions (Pervanidou et al. 2020). Pakistan, like the rest of the globe, has observed a marked explosion in mosquito-borne illnesses in latest years. In a live and continuous-flow study of human WNV in southern Pakistan, anti-WNV antibodies were observed in 105 samples from 977 patients, and WNV-infected patients were more likely to have intellectual impairment, seizures, and a reduced Glasgow coma rating (Khan et al. 2019). To minimize the impact of WNV infections, persistent mosquito and human surveillance is needed, in addition to greater expertise in prevention, early detection, and treatment measures (Wijayasri et al. 2019). In October 2020, VNO line 1 (vnv-l1) reappeared in Campania, Italy. This is the first detection of wNV-l1 in the Italian region since 2017. The results indicate the probability of a novel reappearance or a silent outflow that has not been reported in Italy, as well as an important need for maintenance. The surveillance of West Nile Virus (WNV) in Italy has indicated that the goshawk strain is classified under the WNV-L1 western Mediterranean cluster. Maintaining an active West Nile Virus (WNV) surveillance system within the Italian territory has significant importance (Mencattelli et al. 2021). Better surveillance is critical for the early identification of human infections and rapid response actions (Pervanidou et al. 2020). To minimize the impact of WNV infections, persistent mosquito and human surveillance is needed, in addition to greater expertise in prevention, early detection, and treatment measures. This is the first detection of wNV-l1 in the Italian region after 2017. Given the dearth of an actual remedy for WNV contamination, prevention remains the foundation of human WNV care from a public fitness angle. Personal protection and primarily community-based measures can be used to save you from the infection (García-Carrasco et al. 2021). Public mosquito management tasks to lower vector populations are used at various degrees in several towns in North America and can encompass the elimination of mosquito-hatching locations, use of larvicide, and targeted mosquito spraying. Reduced vector sports activities this season, along with special elements, may additionally have contributed to the huge growth. The complexity of predicting future occurrences of WNV contamination and outbreak areas is attributed to variations in vectors, human recreational activities, amplifying hosts such as hens, and environmental factors. (McDonald et al. 2021). The destiny of the epidemiologic style of WNV contamination in the north of the USA, and definitely at some point in the arena, is unknown.

11

Emerging Arboviral Infections

311

Simultaneously, it appears that WNV contamination has followed a pattern of epidemic proportions in the USA. This raises the possibility of significant future outbreaks. Furthermore, the resurgence of WNV in other countries increased the likelihood of widespread infection on a global scale. The recent epidemic of WNV contamination in the USA has served as a reminder of viruses’ ability to enter and thrive in new environments.

11.7

Conclusion

In the case of infectious illnesses, prevention is more critical than ever. Mosquito survival may also promote the virus’s annual return to the same locations where epidemics occurred in the previous year; modeling method must be constantly updated to continue forecasting the risk in the following years. To limit transmission, public fitness efforts like vector manipulation, attention campaigns among doctors and the overall public, and projects to guarantee the protection of blood products, cells, tissues, and organs are powerful. Within the destiny, vector-manipulated sports activities must be maintained, and the vector-borne disorder response plan must be updated.

References Anggraeni W, Sumpeno S, Yuniarno EM, Rachmadi RF, Gumelar AB, Purnomo MH (2020) Prediction of dengue fever outbreak based on climate factors using fuzzy-logistic regression. 2020 International Seminar on Intelligent Technology and Its Applications (ISITIA), pp 199–204. https://doi.org/10.1109/ISITIA49792.2020.9163708 Aubry M, Kama M, Henderson AD, Teissier A, Vanhomwegen J, Mariteragi-Helle T, Paoaafaite T, Manuguerra J-C, Christi K, Watson CH, Lau CL, Kucharski AJ, Cao-Lormeau V-M (2020) Low chikungunya virus seroprevalence two years after emergence in Fiji. Int J Infect Dis 90: 223–225. https://doi.org/10.1016/j.ijid.2019.10.040 Castillo-Olivares J, Wood J (2004) West Nile virus infection of horses. Vet Res 35(4):467–483. https://doi.org/10.1051/vetres:2004022 Chambers TJ, Hahn CS, Galler R, Rice CM (1990) Flavivirus genome organization, expression, and replication. Ann Rev Microbiol 44(1):649–688. https://doi.org/10.1146/annurev.mi.44.100190. 003245 Chancey C, Grinev A, Volkova E, Rios M (2015) The global ecology and epidemiology of West Nile virus. Biomed Res Int 2015:1–20. https://doi.org/10.1155/2015/376230 Chaudhary S, Jain J, Kumar R, Shrinet J, Weaver SC, Auguste AJ, Sunil S (2021) Chikungunya virus molecular evolution in India since its re-emergence in 2005. Virus Evolut 7(2). https://doi. org/10.1093/ve/veab074 Chen CC, Whitehead A (2021) Emerging and re-emerging infections in children. Emerg Med Clin North Am 39(3):453–465. https://doi.org/10.1016/j.emc.2021.04.002 Cleton N, Koopmans M, Reimerink J, Godeke G-J, Reusken C (2012) Come fly with me: review of clinically important arboviruses for global travelers. J Clin Virol 55(3):191–203. https://doi.org/ 10.1016/j.jcv.2012.07.004 Diallo D, Sall AA, Buenemann M, Chen R, Faye O, Diagne CT, Faye O, Ba Y, Dia I, Watts D, Weaver SC, Hanley KA, Diallo M (2012) Landscape ecology of sylvatic chikungunya virus and

312

G. Sai Lakshmi et al.

mosquito vectors in southeastern Senegal. PLoS Negl Trop Dis 6(6):e1649. https://doi.org/10. 1371/journal.pntd.0001649 Diallo D, Sall AA, Diagne CT, Faye O, Faye O, Ba Y, Hanley KA, Buenemann M, Weaver SC, Diallo M (2014) Zika virus emergence in mosquitoes in southeastern Senegal, 2011. PLoS One 9(10):e109442. https://doi.org/10.1371/journal.pone.0109442 Erdogan Bamac O, Cizmecigil UY, Mete A, Yilmaz A, Aydin O, Tali HE, Tali BH, Yilmaz SG, Gurel A, Turan N, Ozsoy S, Vatansever Celik E, Sadeyen J-R, Roman-Sosa G, Iqbal M, Richt JA, Yilmaz H (2021) Emergence of West Nile virus lineage-2 in resident corvids in Istanbul, Turkey. Vector Borne Zoonotic Dis 21(11):892–899. https://doi.org/10.1089/vbz.2021.0010 Fourié T, Dia A, Savreux Q, Pommier de Santi V, de Lamballerie X, Leparc-Goffart I, Simon F (2021a) Emergence of Indian lineage of ECSA chikungunya virus in Djibouti, 2019. Int J Infect Dis 108:198–201. https://doi.org/10.1016/j.ijid.2021.03.090 Fourié T, el Bara A, Dubot-Pérès A, Grard G, Briolant S, Basco LK, Ouldabdallahi Moukah M, Leparc-Goffart I (2021b) Emergence of dengue virus serotype 2 in Mauritania and molecular characterization of its circulation in West Africa. PLoS Negl Trop Dis 15(10):e0009829. https:// doi.org/10.1371/journal.pntd.0009829 García-Carrasco J, Muñoz A, Real R (2021) Anticipating the locations in Europe of high-risk areas for West Nile virus outbreaks in 2021. Zoonoses Public Health 68(8):982–986. https://doi.org/ 10.1111/zph.12877 Gaythorpe KA, Hamlet A, Jean K, Garkauskas Ramos D, Cibrelus L, Garske T, Ferguson N (2021) The global burden of yellow fever. elife 10:e64670. https://doi.org/10.7554/eLife.64670 Gobbi F, Buonfrate D, Angheben A, Degani M, Bisoffi Z (2015) Emergence and surveillance of chikungunya. Curr Trop Med Rep 2(1):4–12. https://doi.org/10.1007/s40475-015-0036-0 Gómez MM, de Abreu FVS, dos Santos AAC, de Mello IS, Santos MP, Ribeiro IP, Ferreira-deBrito A, de Miranda RM, de Castro MG, Ribeiro MS, Laterrière Junior RDC, Aguiar SF, Meira GLS, Antunes D, Torres PHM, Mir D, Vicente ACP, Guimarães ACR, Caffarena ER et al (2018) Genomic and structural features of the yellow fever virus from the 2016–2017 Brazilian outbreak. J Gen Virol 99(4):536–548. https://doi.org/10.1099/jgv.0.001033 Gossner CM, Fournet N, Frank C, Fernández-Martínez B, del Manso M, Gomes Dias J, de Valk H (2022) Dengue virus infections among European travellers, 2015 to 2019. Eur Secur 27(2). https://doi.org/10.2807/1560-7917.ES.2022.27.2.2001937 Jain R, Sontisirikit S, Iamsirithaworn S, Prendinger H (2019) Prediction of dengue outbreaks based on disease surveillance, meteorological and socio-economic data. BMC Infect Dis 19(1):272. https://doi.org/10.1186/s12879-019-3874-x Jiang LY, Liu Y, Su WZ, Cao YM, Liu WH, Di B, Yang ZC (2022) [Analysis on epidemiological characteristics of dengue fever and E gene evolution of dengue virus in Guangzhou, 2020]. Zhonghua Liu Xing Bing Xue Za Zhi 43(5):716–721. https://doi.org/10.3760/cma.j.cn11233820210930-00763 Kampen H, Holicki CM, Ziegler U, Groschup MH, Tews BA, Werner D (2020) West Nile virus mosquito vectors (Diptera: Culicidae) in Germany. Viruses 12(5):493. https://doi.org/10.3390/ v12050493 Khan E, Barr KL, Farooqi JQ, Prakoso D, Abbas A, Khan ZY, Ashi S, Imtiaz K, Aziz Z, Malik F, Lednicky JA, Long MT (2019) Corrigendum: human West Nile virus disease outbreak in Pakistan, 2015–2016. Front Public Health 6. https://doi.org/10.3389/fpubh.2018.00384 Löscher T, Prüfer-Krämer L (2009) Emerging and re-emerging infectious diseases. pp 39–67. https://doi.org/10.1007/978-0-387-93835-6_3 Ly AN, Manzanero R, Maliga A, Gunter SM, Ronca SE, Zielinski-Gutierrez E, Morey F, Bautista K, Espinosa-Bode A, López B, Cadena L, Fuentes RC, Erickson TA, Munoz FM, Mackey J, Morazán G, Murray KO (2022) Epidemiological and clinical characteristics of acute dengue virus infections detected through acute febrile illness surveillance, Belize 2020. Viruses 14(4):768. https://doi.org/10.3390/v14040768 Martheswaran TK, Hamdi H, Al-Barty A, Zaid AA, Das B (2022) Prediction of dengue fever outbreaks using climate variability and Markov chain Monte Carlo techniques in a stochastic

11

Emerging Arboviral Infections

313

susceptible-infected-removed model. Sci Rep 12(1):5459. https://doi.org/10.1038/s41598-02209489-y Martinez-Liu C, Machain-Williams C, Martinez-Acuña N, Lozano-Sepulveda S, Galan-Huerta K, Arellanos-Soto D, Meléndez-Villanueva M, Ávalos-Nolazco D, Pérez-Ibarra K, GalindoRodríguez S, de Jesús Garza-Juarez A, Rivas-Estilla AM (2022) Development of a rapid gold nanoparticle-based lateral flow immunoassay for the detection of dengue virus. Biosensors 12(7):495. https://doi.org/10.3390/bios12070495 McCrae AWR, Kirya BG (1982) Yellow fever and Zika virus epizootics and enzootics in Uganda. Trans R Soc Trop Med Hyg 76(4):552–562. https://doi.org/10.1016/0035-9203(82)90161-4 McDonald E, Mathis S, Martin SW, Erin Staples J, Fischer M, Lindsey NP (2021) Surveillance for West Nile virus disease—the United States, 2009–2018. Am J Transplant 21(5):1959–1974. https://doi.org/10.1111/ajt.16595 Mencattelli G, Iapaolo F, Monaco F, Fusco G, de Martinis C, Portanti O, di Gennaro A, Curini V, Polci A, Berjaoui S, di Felice E, Rosà R, Rizzoli A, Savini G (2021) West Nile virus lineage 1 in Italy: newly introduced or a re-occurrence of a previously circulating strain? Viruses 14(1):64. https://doi.org/10.3390/v14010064 Morita E, Suzuki Y (2021) Membrane-associated Flavivirus Replication complex—its Organization and regulation. Viruses 13(6):1060. https://doi.org/10.3390/v13061060 Murgue B, Murri S, Zientara S, Durand B, Durand J-P, Zeller H (2001) West Nile outbreak in horses in southern France, 2000: the return after 35 years. Emerg Infect Dis 7(4):692–696. https://doi.org/10.3201/eid0704.010417 Musso D, Nilles EJ, Cao-Lormeau V-M (2014) The rapid spread of the emerging Zika virus in the Pacific area. Clin Microbiol Infect 20(10):O595–O596. https://doi.org/10.1111/1469-0691. 12707 Ngwe Tun MM, Muthugala R, Rajamanthri L, Nabeshima T, Buerano CC, Morita K (2021) The emergence of genotype I of dengue virus serotype 3 during a severe dengue epidemic in Sri Lanka in 2017. Jpn J Infect Dis 74(5):443–449. https://doi.org/10.7883/yoken.JJID.2020.854 Nomhwange T, Jean Baptiste AE, Ezebilo O, Oteri J, Olajide L, Emelife K, Hassan S, Nomhwange ER, Adejoh K, Ireye F, Nora EE, Ningi A, Bathondeli B, Tomori O (2021) The resurgence of yellow fever outbreaks in Nigeria: a 2-year review 2017–2019. BMC Infect Dis 21(1):1054. https://doi.org/10.1186/s12879-021-06727-y Nwachukwu WE, Yusuff H, Nwangwu U, Okon A, Ogunniyi A, Imuetinyan-Clement J, Besong M, Ayo-Ajayi P, Nikau J, Baba A, Dogunro F, Akintunde B, Oguntoye M, Kamaldeen K, Fakayode O, Oyebanji O, Emelife O, Oteri J, Aruna O et al (2020) The response to re-emergence of yellow fever in Nigeria, 2017. Int J Infect Dis 92:189–196. https://doi.org/ 10.1016/j.ijid.2019.12.034 Nwaiwu AU, Musekiwa A, Tamuzi JL, Sambala EZ, Nyasulu PS (2021) The incidence and mortality of yellow fever in Africa: a systematic review and meta-analysis. BMC Infect Dis 21(1):1089. https://doi.org/10.1186/s12879-021-06728-x Papa A, Papadopoulou E, Chatzixanthouliou C, Glouftsios P, Pappa S, Pervanidou D, Georgiou L (2019) The emergence of West Nile virus lineage 2 belonging to the eastern European subclade, Greece. Arch Virol 164(6):1673–1675. https://doi.org/10.1007/s00705-019-04243-8 Pervanidou D, Vakali A, Georgakopoulou T, Panagiotopoulos T, Patsoula E, Koliopoulos G, Politis C, Stamoulis K, Gavana E, Pappa S, Mavrouli M, Emmanouil M, Sourvinos G, Mentis A, Tsakris A, Hadjichristodoulou C, Tsiodras S, Papa A (2020) West Nile virus in humans, Greece, 2018: the largest seasonal number of cases, 9 years after its emergence in the country. Eur Secur 25(32). https://doi.org/10.2807/1560-7917.ES.2020.25.32.1900543 Pettersson JH-O, Bohlin J, Dupont-Rouzeyrol M, Brynildsrud OB, Alfsnes K, Cao-Lormeau V-M, Gaunt MW, Falconar AK, de Lamballerie X, Eldholm V, Musso D, Gould EA (2018) Re-visiting the evolution, dispersal, and epidemiology of Zika virus in Asia. Emerg Microbes Infect 7(1):1–8. https://doi.org/10.1038/s41426-018-0082-5 Rahul A, Saini P, Valamparampil MJ, Singh G, Suresh MM, Prajitha KC, Jose MS, Nair AN, Ananth M, Sreekanth KB, Sujatha C (2022) Epidemiological and clinical characterization of

314

G. Sai Lakshmi et al.

dengue virus serotypes during 2017–2019 in southern Kerala, India. Trans R Soc Trop Med Hyg 116(10):900–909 Salim NAM, Wah YB, Reeves C, Smith M, Yaacob WFW, Mudin RN, Dapari R, Sapri NNFF, Haque U (2021) Prediction of dengue outbreak in Selangor Malaysia using machine learning techniques. Sci Rep 11(1):939. https://doi.org/10.1038/s41598-020-79193-2 Sergon K, Yahaya AA, Brown J, Bedja SA, Mlindasse M, Agata N, Allaranger Y, Ball MD, Powers AM, Ofula V, Onyango C, Konongoi LS, Sang R, Njenga MK, Breiman RF (2007) Seroprevalence of chikungunya virus infection on Grande Comore Island, the Union of the Comoros, 2005. Am J Trop Med Hygiene 76(6):1189–1193 Siqueira PC, Catão RDC, Gava C, Maciel ELN, do Prado TN (2021) Difusão espaço-temporal da febre amarela silvestre em um estado do Sudeste do Brasil, 2017. Cad Saude Publica 37(9). https://doi.org/10.1590/0102-311x00127620 Trammell CE, Goodman AG (2021) Host factors that control mosquito-borne viral infections in humans and their vector. Viruses 13(5):748. https://doi.org/10.3390/v13050748 Tsai T, Popovici F, Cernescu C, Campbell G, Nedelcu N (1998) West Nile encephalitis epidemic in southeastern Romania. Lancet 352(9130):767–771. https://doi.org/10.1016/S0140-6736(98) 03538-7 Walker J, Pyke A, Florian P, Moore F, Smoll N, Adegbija O, Khan A, Hasan R, Carroll H, Harris RR, Khandaker G (2021) Re-emergence of dengue virus in regional Queensland: 2019 dengue virus outbreak in Rockhampton, Central Queensland, Australia. Comm Dis Intell 45. https://doi. org/10.33321/cdi.2021.45.31 Wei Xiang BW, Saron WAA, Stewart JC, Hain A, Walvekar V, Missé D, Thomas F, Kini RM, Roche B, Claridge-Chang A, St. John AL, Pompon J (2022) Dengue virus infection modifies mosquito blood-feeding behavior to increase transmission to the host. Proc Natl Acad Sci 119(3):e2117589119. https://doi.org/10.1073/pnas.2117589119 Wijayasri S, Nelder M, Russell C, Johnson K, Johnson S, Badiani T, Sider D (2019) West Nile virus illness in Ontario, Canada: 2017. Can Commun Dis Rep 45(1):32–37. https://doi.org/10.14745/ ccdr.v45i01a04

Dengue Haemorrhagic Fever: A Resurgent Arbovirosis in Humans

12

Unnati Bhalerao, L. Preethi, Prudhvi Lal Bhukya, and Suhas T. Mhaske

Abstract

Dengue fever is the most important emerging and persistently re-emerging arbovirosis that is transmitted via the bite of infected Aedes mosquitoes. Etiologically, it is caused by any of the four serotypes of the dengue virus, a prototype Flavivirus of the family Flaviviridae. The disease is widespread throughout the tropics and subtropics of the world, and can spread from countries of high endemicity to those of low endemicity by international travel. The illness can present asymptomatically or may result in uncharacterized fever, dengue fever or even its more severe form of Dengue Hemorrhagic Fever which causes plasma leakage resulting in hypovolemic shock or the Dengue Shock Syndrome. Classical dengue is self-limiting and presents with an abrupt and acute onset of high fever, followed by the development of headache, retro-orbital pain, myalgia and arthralgia due to which dengue is commonly referred to as ‘breakbone fever’, and patients may also develop a maculopapular rash and lymphadenopathy. There is no cross protectivity among the four serotypes, and secondary infection with a different serotype is often correlated with a marked risk of severe dengue. Virus isolation, nucleic acid detection using Polymerase Chain Reaction and serological detection of the viral NS1 antigen and dengue-specific IgM and IgG antibodies

U. Bhalerao Department of Biology, Indian Institute of Science Education and Research Pune, Pune, Maharashtra, India L. Preethi Department of Pharmacy Practice, SRM College of Pharmacy, SRM Institute of Science and Technology, Kattankulathur, Chengalpattu, Tamil Nadu, India P. L. Bhukya · S. T. Mhaske (✉) Vaccine Testing Laboratory, Rodent Experimentation Facility, ICMR-National Animal Facility Resource Facility for Biomedical Research, Hyderabad, Telangana, India # The Author(s), under exclusive license to Springer Nature Singapore Pte Ltd. 2023 P. L. Bhukya et al. (eds.), Emerging Human Viral Diseases, Volume I, https://doi.org/10.1007/978-981-99-2820-0_12

315

316

U. Bhalerao et al.

are all common diagnostic techniques for dengue. Other laboratory findings indicative of dengue are leukopenia, thrombocytopenia and metabolic acidosis. With no specific antiviral therapy, disease management essentially involves supportive care using antipyretics and fluid replacement. Lastly, there have been several efforts to develop adequate preventive measures against dengue in the form of mosquito control and the development of dengue vaccines. Several vaccine candidates are being studied for dengue, with Sanofi Pasteur’s live attenuated Dengvaxia being the only currently licensed dengue vaccine. Thus, this chapter aims to provide a detailed overview of dengue, its etiology, pathogenesis and clinical presentation, diagnosis, therapy and prevention. Keywords

Dengue fever · Dengue hemorrhagic fever · Dengue shock syndrome · Breakbone fever · Hemorrhagic diathesis · Arbovirus · Flavivirus

12.1

Introduction

Dengue is one of the most important and persistently re-emerging tropical arbovirosis transmitted to humans via the bite of infected female mosquitoes of the genus Aedes, particularly Aedes aegypti and Aedes albopictus, and it is caused by one of the four serotypes of the dengue virus (DENV). This chapter provides a detailed account about dengue, its aetiology, epidemiology, immunopathogenesis, disease presentation, diagnosis, therapy and prophylactic measures.

12.1.1 Aetiology of Dengue: The Dengue Virus (DENV) 12.1.1.1 Classification of DENV The dengue virus is a prototype Flavivirus of the family Flaviviridae, which essentially consists of arboviruses such as the Japanese Encephalitis Virus (JEV), Yellow Fever Virus (YFV), West-Nile Fever Virus (WNFV) and several Tick-borne Encephalitis Viruses (TBEV). Strain diversity in dengue refers to minute changes occurring among different DENV isolates within a serotype. All DENV strains are a part of the Dengue Antigenic Complex, which consists of viruses with similarities in genome organization, antigenic cross-reactivity and sequence homology (Pierson and Diamond 2013). DENV is further classified into four genetically and antigenically related serotypes- Dengue Virus-1 (DENV-1), Dengue Virus-2 (DENV-2), Dengue Virus-3 (DENV-3) and Dengue Virus (DENV-4). Further, each serotype is divided into genotypes and lineages depending on the nucleotide and amino acid sequence variability of >6% and 3%, respectively, within a single serotype (Table 12.1.) (Shrivastava et al. 2018). Furthermore, DENV also exists as quasispecies within a host that arise due to the low fidelity nature of the non-structural protein 5 or NS5 polymerase which has a mutability of approximately 103 to 105 substitutions per nucleotide per replication cycle (Pierson and Diamond 2013).

12

Dengue Haemorrhagic Fever: A Resurgent Arbovirosis in Humans

317

Table 12.1 Genotypic classification of dengue virus serotypes (Data obtained from Phadungsombat et al. (2018)) Serotype DENV-1 DENV-2 DENV-3 DENV-4

Genotypes Genotypes I, II, III, IV, V, VI, and sylvatic genotypes Asian-I, Asian-II, Asian/American, American, cosmopolitan and sylvatic genotypes Genotypes I, II, III, IV, V Genotypes I, IIA, III, IIIB, IV, V, VI, and sylvatic genotypes

Fig. 12.1 Diagrammatic representation of the dengue virus structure. (Created with BioRender. com)

12.1.1.2 DENV Morphology The mature and infectious particle of the DENV has an icosahedral symmetry with an estimated diameter of 50 nanometres (nm) (Kuhn et al. 2002; Meng et al. 2015). It has a buoyant density of 1.19–1.23 grams/centimetre3 (g/cm3) and sediments at 170 and 210S (Lindenbach et al. 2013). The outer protein shell of a mature dengue virus particle is a well-defined lipid bilayer with a thickness of 10 nm and is hostderived. This protein shell has a relatively smooth surface, and within this lipid bilayer are embedded the envelope (E) glycoprotein homodimers and the membrane (M) proteins. In immature virus particles, this outer layer is composed of asymmetric trimers of E-prM heterotrimers. The prM protein, or the pre-membrane protein, is a precursor of the M protein, and it aids E protein folding and prevents premature fusion of E during transit through the acidic Trans Golgi Network (TGN) (Qi et al. 2008). The icosahedral envelope encloses the roughly spherical, electron-dense core (or nucleocapsid) of 30 nm, within which is enclosed the positive-sense RNA genome and the capsid (C) proteins (Fig. 12.1) (Kuhn et al. 2002). 12.1.1.3 Genome Organization The positive-sense RNA genome is infectious and serves as both the genomic RNA and the messenger RNA. It is approximately 11,000 nucleotides long and bears a 5′ type 1 cap (m7GpppAmN) which stabilizes the viral nucleic acid, helps in translation initiation and impairs innate antiviral host defences. However, it is devoid of a 3′

318

U. Bhalerao et al.

Fig. 12.2 Genome organization of DENV. (Created with BioRender.com)

polyadenylate (polyA) tail (Lindenbach et al. 2013). There also exists a 100 nucleotides long 5′ non-coding region (5′ NCR) and a 700 nucleotides long 3′ non-coding region (3′ NCR) flanking a single Open Reading Frame (ORF) of approximately 3400 codons (Fig. 12.2) (Lindenbach et al. 2013). These non-coding regions consist of secondary structures, conserved regions, sequence duplication and functional regions specific to the virus and its host, all of which may influence translation. The RNA undergoes co- and post-translational cleavage to express three structural and seven non-structural viral proteins. (Lindenbach et al. 2013).

12.1.1.4 Structural and Functional Features of DENV Proteins The structural proteins include the capsid (C), membrane (M) and envelope (E) proteins, while the non-structural proteins (NSPs) include NS1, NS2A, NS2B, NS3, NS4A, NS4B and NS5, and are expressed only within the host cell and not in the progeny mature virions (Table 12.2) (Lindenbach et al. 2013). 12.1.1.4.1 Structural Proteins Envelope (E) Protein

The E protein is glycosylated and has a molecular weight of ~53 kilodalton (kDa). Ninety head-to-tail oriented E homodimers are arranged as trimers on the outer viral surface in a tightly packed herringbone configuration–due to which DENV lacks a true T = 3 icosahedral symmetry (Verma et al. 2014). The E protein is essential for the initial receptor binding with surface receptors of the host cell and viral and endosomal membrane fusion at low pH. It is also essential for virion assembly and maturation, viral virulence and attenuation. Additionally, the E protein is also the DENV hemagglutinin and a major antigenic determinant against which anti-DENV neutralizing antibodies are produced. (Zonetti et al. 2018). Monomeric E is a class II fusion protein that is made up of three structurally distinct domains: domain I (DI), domain II (DII) and domain III (DIII), which are interconnected through flexible hinges. Ahelical anchor aids interaction among the three domains. Domain I forms an eight-stranded β barrel and is positioned at the N-terminus central region of the protein, domain II is the finger-like fusion component, projecting along the viral surface and consisting of a dimerization region and the fusion peptide, while domain III consists of the binding receptor region and is responsible for virus and host cell recognition and binding (Lindenbach et al. 2013; Zhang et al. 2017; Zonetti et al. 2018). However, the fusion peptide remains

12

Dengue Haemorrhagic Fever: A Resurgent Arbovirosis in Humans

319

Table 12.2 Proteins of DENV and their role in virus replication and pathogenesis (Adapted from (Nasar et al. 2020)) DENV protein A. Structural proteins 1. Envelope (E) protein 2. Pre-membrane (prM) protein

Function

Interacts with host cell receptors through its C-terminal anchor domain and mediates internalization through its soluble ectodomain Prevents fusion of immature viruses to host cell membrane by concealing the E protein fusion loop and forms the Membrane (M) protein in mature virions by cleavage of the furin cleavage site by host furin proteases 3. Capsid Mediates virus attachment to endoplasmic reticulum (ER) membrane through its hydrophobic membrane-spanning domain and aids (C) protein proper nucleocapsid formation by ensuring proper RNA folding B. Non-structural proteins (NSPs) 1. NS1 protein It helps evade the host immune system by inhibiting the classical and lectin pathways of complement activation, plays a role in viral replication and its soluble form binds to endothelial cells and aids vascular leakage 2. NS2A protein It is required for polyprotein processing, replication and progeny virion assembly 3. NS2B protein It plays the role of a cofactor for the NS32B serine protease required for polyprotein processing and plays a role in pathogenesis by aiding immune suppression and promoting pore formation and cell death in erythrocytes 4. NS3 protein Catalyses polyprotein processing through its serine protease activity and has RNA 5′ triphosphatase (RTPase)/nucleoside 5′ triphosphatase (NTPase) and helicase activity 5. NS4A protein It is a constituent of the viral replication complex and assists replication by interacting with host cellular vimentin to maintain the stability of the complex in the perinuclear area 6. NS4B protein It aids form the viral replication complex and helps dissociation of the NS3 helicase domain from single-stranded RNA and also interferes with signal transducer and activator of transcription 1 (STAT1) phosphorylation which further inhibits the IFN α/β signal transduction cascade 7. NS5 protein It possesses the RNA-dependent RNA polymerase activity required for de novo synthesis of viral RNA, and it also has guanylyltransferase, guanine-N7-methyltransferase and nucleoside-2′Omethyltransferase activities required for 5′-RNA capping. It also helps in viral evasion from the host immune system

concealed by the ‘pr’ domain of the prM protein or in the hydrophobic pocket of DI and DIII until it has to insert into the target membrane (Lindenbach et al. 2013). The flexible hinge connecting DI and DIII aids the exposure of the DII fusion loop in the low pH endosomal compartment, and this fusion loop further binds to the endosomal membrane for the ingress of the DENV RNA into the host cell. The E protein also comprises a stem region of two cationic, amphipathic and α-helical transmembrane domains (TMDs)- domain 1 (TM1), which is a stop-transfer sequence and domain

320

U. Bhalerao et al.

2 (TM2)- an internal signal sequence responsible for proper processing and localization of the DENV-NS1 protein. The envelope domains I, II and III, along with the TMDs, are pivotal for the irreversible confirmational changes required for proper E protein-folding and membrane fusion- a process which is further aided by the flexible hinges of the domains (X. Zhang et al. 2017). In the acidic endosome, E homodimers dissociate into monomers which further align in the form of fusogenic trimers, and after fusion, E folds such that the N-terminal fusion peptide interacts with the cell membrane. At the same time, its C-terminal TMD remains integrated into the viral membrane (Lindenbach et al. 2013). Pre-membrane (prM) and Membrane (M) Proteins

The M glycoprotein (~8 kDa) is translated as the pre-membrane protein (~21 kDa) and post-translational cleavage of this prM by a host furin protease at a furin cleavage site situated at the intersection of the N-terminal ‘pr’ cap domain, and this results in the formation of the E glycoprotein (Zonetti et al. 2018). The formation of the M protein is a crucial step in the DENV replication cycle since it further amplifies the infectivity of the virus and triggers a structural reorganization in the outer surface (Henchal and Putnak 1990). Progeny virions are put together and constructed in the ER and undergo maturation during passage through the low pH trans-Golgi network (TGN) and exosomes. Immature progeny virions put together in the ER’s neutral pH have outer surfaces comprised of 60 trimeric spikes of prM-E heterodimers. In low pH environments, the prM-E proteins take up a dimeric form. This conformational change results in the exposure of the furin-cleavage site, and the subsequently cleaved ‘pr’ continues to associate itself with the fusion loop until viral release from the cell (Q. Zhang et al. 2012). The neutral environment of the extracellular space triggers ‘pr’ release, which results in the formation of mature virions (Lindenbach et al. 2013). Capsid (C) Protein

The C protein is a basic protein of ~11 kDa that encapsulates the viral RNA and has an affinity for lipid bilayers and nucleic acids (Byk and Gamarnik 2016). It is the first protein encoded by the viral RNA and is connected to the prM protein through an anchor, which is an internal hydrophobic signal peptide spanning the ER and is responsible for prM transit into the ER lumen. The viral NS3 protease, along with the NS2B cofactor, cleaves the junction between C and the anchor, and the host signal peptidase results in cleavage between the anchor and prM (Byk and Gamarnik 2016). The hydrophobic tail at the C-terminus acts as a signal for the ER translocation of prM and is cleaved in two steps, once by the viral NS2B-3 protease and then by the signal peptidase (Lindenbach et al. 2013). The C protein exists as a homodimer in virions. Monomeric C consists of four α helices (α1 to α4), and α2 and α4 of one monomer lie anti-parallel to α2 and α4 of the other monomer, and maximal interaction in a C homodimer occurs between these two helices of two monomeric subunits (Byk and Gamarnik 2016). The hydrophobic N-terminal region of the DENV C protein bears basic residues which interact with the viral RNA with a very high-affinity and contribute to virion assembly (Byk and Gamarnik 2016).

12

Dengue Haemorrhagic Fever: A Resurgent Arbovirosis in Humans

321

Additionally, by virtue of its high content of basic residues and structural flexibility, the C protein acts as an RNA chaperone by preventing and even resolving RNA misfolding (Byk and Gamarnik 2016). 12.1.1.4.2 Non-structural Proteins (NSPs) Non-structural Protein 1 (NS1)

The NS1 protein (~46 kDa) is a glycoprotein which is highly conserved among flaviviruses. It is expressed as a monomer but undergoes dimerization in the ER lumen. These NS1 homodimers associate with organelle- and cell-membranes through anchorage to glycosyl-phosphatidyl inositol and lipid rafts. The protein is continuously secreted by infected host cells in a hexameric form, comprising three dimers held together in a barrel shape with the hydrophobic central cavity housing ~70 lipid molecules. This lipid content of NS1 allows it to interact with glycosaminoglycans in the membranes of uninfected cells and further get internalized and accumulate in late endosomes. Extracellular NS1 is highly immunogenic and induces a potent humoral response. Due to the high levels of accumulated NS1 in human sera and tissues, this protein acts as a diagnostic marker for the arbovirosis of dengue as well as a prime target for dengue-specific antiviral drug discovery (Chen et al. 2018; Lindenbach et al. 2013). Additionally due to the high-density lipoprotein (HDL)-like structure, it is believed that NS1 prevents coagulation as well, a theory further supported by the high levels of secreted NS1 that are detected in DHF and DSS patients (Chen et al. 2018). NS1 also helps evade the host immune response by interacting with the C4 protein of the complement system, thereby inhibiting the classical and lectin pathways of complement activation (Chen et al. 2018). Intracellular NS1 is equally essential as it also has a very essential part to play in the early viral genome replication (Lindenbach et al. 2013). Non-structural Proteins 2A (NS2A) and 2B (NS2B)

The NS2 coding region codes for two hydrophobic proteins: NS2A and NS2B. NS2A is a 22 kDa, ER-membrane-spanning, hydrophobic protein of the dengue virus (Bartenschlager and Miller 2008; Meng et al. 2015). It is composed of several putative transmembrane domains (Henchal and Putnak 1990). After polyprotein translation, its N-terminus is generated by an unknown ER-resident host protease, while NS2B-3 cleavage in the host cytoplasm generates the C-terminus of this protein. Functionally, NS2A is an essential component of the viral replication complex as it is required not only for viral replication but also for polyprotein processing of the C-terminus of NS1 and progeny virion assembly. More specifically, these functional aspects of NS2A are location-dependent in that NS2A present in the viral replication complex aid the process of RNA synthesis, while those NS2A molecules located at sites of virion assembly and budding aid progeny virion assembly (Meng et al. 2015). During replication, NS2A colocalizes the viral double-stranded RNA to interact with the 3′-UTR of the genomic RNA (MacKenzie et al. 1998). In addition, NS2A also antagonizes the host immune response by

322

U. Bhalerao et al.

inhibiting interferon signalling (Lindenbach et al. 2013). However, it is essential to note that the exact mechanisms of these functions of the NS2A protein have not yet been elucidated. The NS2B protein is a 14 kDa, integral membrane-associated protein which is conserved among flaviviruses and acts as a cofactor for and is a vital component of the active site of the viral NS3 protein. Moreover, its central region interacts with NS3 and aids the anchorage of the complex formed by NS23B and NS3 in the ER membrane (Meng et al. 2015). This complex is required for polyprotein processing, especially the cis-cleavage of NS2A from the polyprotein. It has also been reported to colocalize with dsRNA, suggesting a putative role in RNA replication. It may also play a role in enhancing the cytopathogenic role of NS2A by associating with it, aiding interaction between NS2A/2B and the plasma membrane of erythrocytes where it induces the formation of pores which increases the permeability of cells and may result in cell death. Additionally, the formation of the NS2B3 complex also aids immune suppression by cleavage of antiviral proteins rendering them ineffective. NS2B also targets cyclic GMP/AMP synthase (cGAS) to inhibit type I interferon synthesis for combatting the host immune response (Nasar et al. 2020). Non-structural Protein 3 (NS3)

The DENV NS3 protein is a 70 kDa enzyme of 618 amino acids with a multitude of functions. It is a hydrophilic protein that can function as a chymotrypsin-like serine protease as well as an RNA helicase/ATPase and RNA 5′ triphosphatase (RTPase)/ nucleotide 5′ triphosphatase (NTPase) (Meng et al. 2015). The NS2B protein is a cofactor essential for the enzymatic activity of NS3, and the NS2B3 complex is formed by linkage of residues of 49–66 of NS2B to NS3 at the N-terminus via a glycine-serine linker (Meng et al. 2015). These non-covalent interactions between NS2B and NS3 induce conformational changes in NS3, thereby allowing it to execute the cleavage of the viral protein at the NS2A/NS2B, NS2B/NS3, NS3/NS4A and NS4B/NS5 junctions during viral maturation. Lastly, the ATPase/ helicase and RTPase domains of NS3 are located at its C-terminus and are required for RNA replication and capping (Silva et al. 2019). Non-structural Proteins 4A (NS4A) and 4B (NS4B)

NS4 comprises two highly hydrophobic proteins, NS4A and NS4B, linked by a 23 residues fragment of NS4A called the 2 K fragment. Cleavage of NS4 is mediated by NS2B3 and results in NS4A and 2 K-NS4B. Further, the 2 K fragment acts as a signal for the translocation of NS4B to the ER lumen, where the 2 K fragment undergoes cleavage by a host signal peptidase which results in the production of NS4B (Gopala Reddy et al. 2018). NS4A is a 16 kDa protein with its N-terminus comprising three amphipathic α helices that communicate with the cytoplasmic side of the ER membrane and induce modifications in the host membrane to allow the formation of the replication complex (Nasar et al. 2020). The C-terminus comprises three transmembrane domains (TMDs) which interact with the ER lumen. One of the TMDs aids oligomerization of NS4A and NS4B, an essential step for viral replication. This domain

12

Dengue Haemorrhagic Fever: A Resurgent Arbovirosis in Humans

323

also induces structural changes in ER tubules to allow vesicle assembly mediated by the membrane. It does so by interacting with a host protein called reticulon 3.1A, a host transmembrane remodelling protein that allows proper ER tubule and vesicle formation. Similarly, DENV induces phosphorylation-mediated activation of and conformational changes in vimentin–a host scaffolding protein that promotes cell integrity, and this change in conformation allows it to interact with NS4A at the site of viral replication (Nasar et al. 2020). NS4B is another viral transmembrane protein that resides in the lumen of the ER unless it is recruited to the viral replication complex by NS4A. Its N-terminus is positioned in the ER lumen, and the C-terminus is present towards the cytoplasm, where it interacts with the NS5 protein and aids viral replication. Association of the NS4B cytoplasmic loop with the N-terminal region results in the dimerization of NS4B in DENV-infected cells. This protein comprises five transmembrane helices, which aid membrane rearrangement, which is required to form the replication complex (Nasar et al. 2020). NS4B also combats the host immune response by blocking IFN-α/β mediated signal transduction (Aruna 2014). Additionally, along with NS1 and NS4A, NS4B is believed to inhibit the autophagy of DENV-infected cells (Nasar et al. 2020). Non-structural Protein 5 (NS5)

NS5 is the largest (103 kDa) and most conserved protein among the four serotypes of DENV. This phosphoprotein comprises two functional regions, the methyltransferase (MTase) and the RNA-dependent RNA polymerase (RdRp) domains. The MTase domain is located at the amino-terminus of the protein while the RdRp domain is located at the carboxyl-terminus, and these two domains are connected by a linker of 5–6 residues. The MTase domain of NS5 acts as a guanylyl-transferase, guanine-N7methyltransferase and a nucleoside-2′O-methyltransferase. All these actions aid the formation of type I RNA caps at the 5′-UTR, which shields the viral RNA from degradation by hydrolases and aids the binding of viral RNA to ribosomes to allow translation to occur, and this capping process is carried out about the viral NS3 and NS5 proteins. The NS3 RTPase is essential for removing the ɣ-phosphate group from the 5′ triphosphorylated plus-sense ssRNA substrate. This is followed by GTP hydrolysis and transfer of GMP on pp-5′A for the formation of a 5′-5′ guanosyl cap (G5′-ppp-5′A) by the NS5 guanylyl transferase. This guanosyl cap then undergoes N7-methylation through S-adenosyl methionine which donates a methyl group to the guanine-N7, a reaction which is catalysed by the guanine-N7-methyltransferase, and this cap is then subjected to 2′-O-methylation by the nucleoside-2′Omethyltransferase activity of NS5 (Lindenbach et al. 2013). This methylation on the penultimate adenosine is essential for evading host immune responses as it has an inhibitory effect on interferon signalling. The RdRp domain of NS5 is required for the de novo synthesis of viral RNA. The RdRp is further divided into seven motifs (A-G), which contribute to the cationic binding site, sliding of the RNA in the RdRp tunnel, providing the GDD catalytic residues, the release of pyrophosphate (PPi) by-product, housing the structural zinc

324

U. Bhalerao et al.

cation and the stabilization of the nascent base pairs, respectively (el Sahili and Lescar 2017). In a DENV-infected cell, NS5 is located at the ER membrane, where it forms a complex with NS2B3 and stimulates the NTPase and RTPase enzymatic roles of NS3. Although NS5 plays an indispensable part in replicating viral RNA in the cytoplasm, it can also localize in the nucleus, disrupting the host-splicing machinery and preventing host messenger RNA (mRNA maturation). Additionally, NS5 also modulates the host immune response. It directly reduces STAT2 levels by ubiquitylation-mediated proteasomal degradation of STAT2, inhibiting interferon signalling (Nasar et al. 2020).

12.1.2 DENV Pathogenesis and Replication When the Aedes mosquito bites a human for a blood meal, the virus is released into the bloodstream with spill-over in the dermis and epidermis of the skin as a result of imbibition, and this allows the virus to infect a wide array of host cells, including the immature Langerhans cells and keratinocytes of the skin. These infected cells further travel to lymph nodes where the infection spreads to the recruited monocytes and macrophages that disseminate the virus throughout the lymphatic system making blood-derived monocytes, myeloid dendritic cells (DCs) and splenic and hepatic macrophages targets of the dengue virus. Infected blood cells and myeloid-DCs further cause dissemination of the virus to non-lymphoid organs (Martina et al. 2009).

12.1.2.1 Adsorption and Entry The replication cycle begins with viral attachment to permissive host cells through interactions between domain III of the viral E protein and appropriate host cellular receptors such as the highly sulphated glycosaminoglycan- heparan sulfate, the mannose receptor, which is a C-type lectin (molecules that bind mannose-rich glycans), heat shock protein 70 (Hsp70) and Hsp90, GRP78/BiP, CD14, the 37-kDa/67-kDa high-affinity laminin receptor and DC-specific intercellular adhesion molecule 3 (ICAM-3)-grabbing non-integrin (DC-SIGN) and liver/lymph nodespecific ICAM-3-grabbing non-integrin among many others (Clyde et al. 2006). This triggers the internalization of the virus by receptor-mediated endocytosis. For this purpose, virions diffuse across the cell surface and get internalized when they encounter preformed clathrin-coated pits. Viral particles are then transported to early or intermediate endosomes, which mature into late endosomes. The acidic pH of the resultant endosome induces the dissociation of E protein dimers and the irreversible trimerization of the E protein, which further mediates fusion of the envelope of the virus and the cellular membrane via the now exposed fusion peptide of the E protein (Bartenschlager and Miller 2008; Lindenbach et al. 2013). 12.1.2.2 Early Gene Expression and Proteolytic Processing Uncoating of the nucleocapsid then allows the egress of the positive-sense viral RNA into the cytoplasm, where it is translated into a polyprotein on the rough

12

Dengue Haemorrhagic Fever: A Resurgent Arbovirosis in Humans

325

Fig. 12.3 DENV polyprotein membrane topology and cleavage sites (Image source: (de Almeida et al. 2013))

endoplasmic reticulum (RER) surface. DENV translation depends on the 5′ cap, which is 2′-O methylated and helps evade innate antiviral defences, which may hinder the translational process. Initiation of translation occurs via ribosomal scanning for the initiation AUG codon–a process which is further facilitated by a small RNA stem-loop embedded within the C gene, which induces ribosomal pausing over the authentic initiation codon (Lindenbach et al. 2013). The resultant polyprotein is co- and post-translationally cleaved by viral and cellular proteases into the three structural and seven non-structural viral proteins (Fig. 12.3). An ER-resident host signalase functions for cleavage at the C/prM, prM/E, E/NS1, and 2K-NS4B junctions, while the virus-encoded serine protease-NS2B3 cleaves the polyprotein between NS2A/NS2B, NS2B/NS3, NS3/NS4A, NS4A/2K and NS4B/NS5 (Henchal and Putnak 1990; Lindenbach et al. 2013).

12.1.2.3 A Model of DENV RNA Replication Upon completion of early translation and proteolytic processing of the viral polyprotein, a replication complex (RC) is then formed at the ER membrane, and it comprises of the NS5 RNA-dependent RNA polymerase, the other accessory non-structural proteins, the positive-sense single-stranded RNA genome of the virus, and other cellular factors required for replication. Initially, a negative-sense ssRNA intermediate is synthesized, which serves as a template for producing multiple copies of the genome. This RNA synthesis is asymmetric with greater production of positive-sense strands than negative-sense strands. Additionally, the replication cycle also produces a double-stranded replicative form (RF), a heterogeneous population of replicative intermediates (RIs) and 0.2–0.6 kb subgenomic RNAs (sfRNAs) (Lindenbach et al. 2013). The newly synthesized positive-sense ssRNA copies then either attach to ribosomes to initiate a new cycle of translation, polyprotein processing and transit to the trans-Golgi network for virion assembly and maturation or are assembled into progeny virions as genomic RNA (Bartenschlager and Miller 2008; Henchal and Putnak 1990). 12.1.2.4 Assembly, Maturation and Egress of Progeny Virions DENV morphogenesis occurs in close association with intracellular membranes. The initial steps of assembly involve the association of the C protein dimers with RNA,

326

U. Bhalerao et al.

which results in the formation of nucleocapsids. This is followed by the budding of the nucleocapsids containing E-prM glycoprotein complexes into the membrane of the host ER. The nascent virions are then translocated to the cell surface through the secretory pathway, during which furin-mediated cleavage of the prM protein results in the production of mature virus particles, which are then egressed into the extracellular space via budding (Bartenschlager and Miller 2008; Lindenbach et al. 2013).

12.1.3 Epidemiology of Dengue Dengue ranks second after malaria, as one of the most serious vector-borne viral diseases, and it is characterized by a sudden onset of disease and a very high incidence rate which allows it to spread rapidly and cause massive outbreaks leading to public health emergencies (Jing and Wang 2019). It is associated with significant morbidity and mortality, especially when it presents severely with haemorrhagic manifestations. According to the WHO, approximately 3.9 billion dengue fever cases occur globally per year, from which 96 million cases manifest symptomatically, making it a severe threat to public health (Bhatt et al. 2013).

12.1.3.1 Discovery and Origin of Dengue Although dengue is a very ancient disease, its exact origin remains undetermined, probably due to its asymptomatic presentation causing it to remain undiagnosed in several cases. Nevertheless, the Aedes vector, as well as the virus, are believed to have originated in Africa and then further spread with the transportation of enslaved African people to the Americas and other parts of the world sixteenth century onwards (Gould and Solomon 2008; Morens et al. 2013). Another possibility is that the mosquito vectors were spread globally from 1492 onwards during the European discovery of the Americas. However, the earliest documentation of a dengue-like illness was mentioned in a Chinese encyclopaedia of disease symptoms and remedies, which was first published during the Jin Dynasty (265 A.D. to 420 A. D.) and then formally edited twice- in 610 A.D. and 992 A.D., and they referred to the disease as a “water poison” associated with flying insects (Gubler 1998). Among subsequent outbreaks and epidemics of probable dengue fever is the outbreak of a disease called ‘coup de barre’, meaning ‘beating with a stick’ or ‘Dandy fever’ that occurred in 1635 in the French West Indies islands of the Caribbean, as was reported by Jean-Baptiste du Tertre (du Tertre 1667; Morens et al. 2013). Another disease outbreak called The Darien Disaster, compatible with dengue, occurred in Panama in 1699 (Mcsherry 1982; Morens et al. 2013). Other records suggest unconfirmed dengue epidemics in Batavia (Jakarta), Indonesia, and Cairo, Egypt, in 1779 (Gubler 1998). The first report of a dengue epidemic was in 1779–1780, which occurred almost simultaneously in Asia, Africa and North America, indicating the global distribution of the Aedes mosquito vector for more than two centuries (Salles et al. 2018). Concurrent to this epidemic, the disease was identified and named dengue in 1779. Etymologically, the word dengue is hypothesized to be

12

Dengue Haemorrhagic Fever: A Resurgent Arbovirosis in Humans

327

derived from a Swahili phrase, ‘Ki denga pepo’, meaning ‘cramp-like seizures caused by an evil spirit’ (‘Etymologia: Dengue’ 2006). Additionally, the Swahili word ‘denga’ may have originated from the Spanish word “dengue’, meaning ‘fastidious or careful’, which describes the gait of a dengue fever patient–a result of the arthralgia experienced during the illness (History and Origin of Dengue Virus n.d.). Benjamin Rush devised the term breakbone fever’ to describe the symptoms of myalgia and arthralgia in the first confirmed case report of dengue published in 1789 on a case in 1780 (Rush 1794). After the epidemics of 1779–1780, several infrequent but large outbreaks of dengue were reported (Gubler 1998), and up to 1970, only nine countries had witnessed major dengue epidemics (Kothai and Arul 2020). Brathwaite Dick et al. divided the outbreak history of dengue into the four phases of the introduction of dengue in the Americas from 1600 to 1946, successful eradication of Aedes mosquitoes in 18 continental countries by 1970 through proper implementation of a continental plan that was initiated in 1947, reintroduction and reinfestation of Aedes aegypti mosquitoes from 1971 to 1999 as a result of the failure of the mosquito eradication program. The fourth phase occurred from 2000 onwards and was characterized by the failure to control the proliferation of Aedes mosquitoes, which resulted in increased dispersion of Aedes mosquitoes and the subsequent circulation of dengue viruses, all of which cumulatively resulted in an increase in their associated outbreaks (Dick et al. 2012). This, in conglomeration with its resurgent nature, makes the dengue virus a serious public health concern: a problem which has been further amplified by climate change and variability, rapid and uncontrolled urbanization and population growth, and the resultant poverty, international transport and travel, which promotes the dissemination of the virus from regions of high endemicity to those of low endemicity and the lack of adequate, virus-specific antivirals and improper implementation vaccination strategies (Gubler 1998).

12.1.3.2 Geographical Distribution and the Global Scenario of Dengue Geographically, dengue has a worldwide distribution but is particularly prevalent throughout the tropics and sub-tropics of the world. It is endemic in over 129 countries in the WHO regions of America, South-East Asia, Western Pacific, Eastern Mediterranean and Africa, with Asia bearing almost 70% of the disease burden (Dengue and Severe Dengue n.d.). Furthermore, the disease is broadening its geographical range to other parts of the world, including Europe, where it is responsible for massive outbreaks and even local transmission of the disease. Previously, dengue was only endemic in southern Europe in Greece and Turkey. Eventually, the disease disappeared from Europe after 1930, followed by a reduction in Aedes aegypti mosquitoes until the 1950s (Infectious Diseases in a Changing Climate: Information for Public Health Officials in the WHO European Region n.d.). Recent years have observed a resurgence of dengue in the WHO Europe regions; the disease also spread to newer parts in the region, such as France, Croatia, mainland Portugal, the Madeira Islands of Portugal, as well as up to 10 other countries of the region (Dengue and Severe Dengue n.d.). Similarly, the Western Pacific region and the Americas also recorded large outbreaks of dengue in 2016, which were

328

U. Bhalerao et al.

associated with significant mortality (Dengue and Severe Dengue n.d.). However, the incidence of dengue and severe dengue in the Americas markedly reduced to 73% and 53%, respectively, in 2017 (Dengue and Severe Dengue n.d.). The highest global burden due to dengue was recorded in 2019, with cases in all the WHO regions, and 2020 also observed an increase in the number of dengue cases in several countries and regions of the world (Dengue and Severe Dengue n.d.). Dengue is also associated with a higher occurrence in urban and semi-urban settings since urbanization has led to the inadequacy of water, sewer systems and waste management, creating new breeding grounds for its mosquito vector. It is also important to note that the dengue virus can infect individuals of any age group, gender and occupation, and infection rates are generally higher in non-endemic areas. Infection rates further increase in unsanitary conditions with breeding grounds for mosquitoes (Jing and Wang 2019).

12.1.3.3 Seasonality Dengue virus circulation shows a seasonal trend, and an increase in cases and epidemics is observed during and immediately after the warmer and wetter months of the year since increased rainfall and high-temperature conditions are conducive to vector proliferation. The extrinsic incubation period (EIP) of DENV may also be reduced in warmer environmental conditions, promoting better and more efficient viral transmission. However, the take on rainfall being beneficial for dengue transmission is controversial because although it provides suitable mosquito habitats, rainfall is also responsible for flushing away mosquito breeding sites and the eggs, larvae and pupae (Yuan et al. 2020). However, the occurrence of these seasonally influenced epidemics also depends on immunity profiles of the population in that region, and regions with dengue-naïve populations are more susceptible to witness full-blown epidemics (Morales et al. 2016). 12.1.3.4 Transmission Cycles and Host Range The female Aedes aegyptii mosquito is the primary endophilic vector for DENV and is known to inhabit clean, stagnant waters in manmade containers. In contrast, Aedes albopictus, an exophilic vector for DENV, is an arboreal mosquito less frequently associated with infections in urban settings. Female mosquitoes of this genus are anthropophilic, feed during the day, particularly at dusk and dawn and acquire the virus when they consume a blood meal from infected and viremic humans or animals (Gubler 1998). The extrinsic incubation period (EIP) in the mosquitoes is 8–12 days at 25–28 °C, and once infectious, mosquitoes can transmit the virus for their entire life span (Jing and Wang 2019). Additionally, transovarial (or vertical) transmission has also been reported in mosquitoes, making it all the more imperative to incorporate appropriate vector control measures. The dengue virus is maintained in the environment through two ecologically distinct transmission cycles (Fig. 12.4). Mosquito-to-human transmission may be observed in urban or even rural settings. The urban or endemic cycle is maintained exclusively and entirely by Ae. aegypti, and it comprises humans as the sole reservoir and amplification hosts. Conversely, Ae. albopictus plays a role in the rural and

12

Dengue Haemorrhagic Fever: A Resurgent Arbovirosis in Humans

329

Fig. 12.4 Transmission cycles of DENV. (Created with BioRender.com)

sylvatic (or enzootic) transmission cycles. Sylvatic cycles of transmission are more commonly associated with non-human primates as reservoirs and amplifying hosts with arboreal Aedes mosquitoes as vectors (Vasilakis et al. 2011).

12.1.4 Clinical Manifestations in Dengue Dengue is a dynamic and usually self-limiting illness that manifests either asymptomatically, as an uncharacterized febrile illness, classical Dengue Fever (DF), Dengue Haemorrhagic Fever (DHF) or DHF with Dengue Shock Syndrome (DSS). The disease comprises three phases: the acute febrile phase, the critical phase and the convalescent phase (Fig. 12.5). The acute febrile phase presents with an abrupt onset of high fever, followed by the development of headache, retro-orbital pain, myalgia and arthralgia, due to which dengue is commonly referred to as ‘break-bone fever’, and patients may also develop a maculopapular rash, petechiae or ecchymosis and lymphadenopathy. Other symptoms include vomiting, anorexia and headache. It is also associated with leukopenia and thrombocytopenia. This phase lasts for 2–5 days and is followed by rapid clinical deterioration (Baymiev et al. 2020; Nocker et al. 2006; Soejima et al. 2007). This period marks the onset of the critical phase. A fatal complication during the critical phase is DHF which causes plasma leakage that might result in hypovolemic shock or the DSS characterized by tachycardia, cool extremities, delayed capillary refill and diaphoresis, weak pulse, and lethargy or restlessness. Despite being highly severe, DHF and DSS are relatively rare manifestations. Moreover, the severity of the disease has a strong association with the DENVspecific T lymphocyte responses (Liesegang 2016). The critical phase lasts for

330

U. Bhalerao et al.

Fig. 12.5 The clinical course of dengue. (Image source: (Yacoub et al. 2014))

24–36 h and may either result in mortality or recovery. Recovery is rapid, but it may be associated with complications like encephalopathy, bradycardia, ventricular extrasystoles, myocarditis and encephalitis (Brescia et al. 2009). Viremia is detectable in the blood of infected individuals from 6 to 18 h before the onset of symptoms and persists till the fever resolves (Liesegang 2016). Moreover, there is no cross protectivity among the four serotypes of the dengue virus (DENV-1, DENV-2, DENV-3 and DENV-4). Secondary infection with a different serotype is associated with an increased risk of severe dengue due to antibody-dependent enhancement (ADE), which delays the anti-DENV humoral response since heterologous antibodies produced against the virus of the primary infection can bind to but not neutralize a virus of a different serotype (Sauch et al. 1991). These virus-antibody complexes then bind to the Fcɣ receptors of mononuclear phagocytes and dendritic cells, which are then infected by the virus. Additionally, scattered literature indicates the possibility of a fifth serotype (DENV-5), although not confirmed over the years, which not only increases the risk of severe dengue but may also impact the existing diagnostic, therapeutic and prophylactic efforts against dengue (Fittipaldi et al. 2010; Puente et al. 2020; Randazzo et al. 2018).

12.1.4.1 Classification of Cases The World Health Organization (WHO) initially classified symptomatic dengue cases into undifferentiated fever, DF and dengue DHF. DHF comprised of four grades of severity, with grades III and IV being associated with DSS. However, this classification system was associated with a multitude of limitations that made its application in actual clinical scenarios tedious. Therefore in 2009, a working group coordinated by the WHO altered the system of classification of dengue on the basis of levels of severity into dengue without warning signs, dengue with warning signs and severe dengue (Fig. 12.6). Dengue without warning signs presenting with fever with any two of the other associated symptoms such as abdominal pain, nausea,

12

Dengue Haemorrhagic Fever: A Resurgent Arbovirosis in Humans

331

Fig. 12.6 WHO classification system for dengue. (Image source: World Health Organization, 2009)

vomiting, body ache, maculopapular rashes and a positive tourniquet test is indicative of probable dengue, which requires minimal medical care. Dengue with warning signs, however, requires proper diagnosis and medical care, while severe dengue requires immediate hospitalization (Cangelosi and Meschke 2014).

12.1.5 Diagnosis of Dengue Timely and accurate diagnosis of dengue is essential to make effective prognosis of cases, appropriate surveillance and control of the disease, and research purposes. Viral diagnosis can include clinical evaluation, followed by virus detection, detection of the viral nucleic acid and/or antigens and antibodies specific to the virus (Muller et al. 2017). This section highlights the different aspects of the diagnosis of dengue. Diagnostic markers for dengue include the virus itself, viral nucleic acid (the positive-sense single-stranded RNA DENV genome), viral proteins (NS1 antigen) or the DENV-specific antibodies produced as a result of the host immune response. Each of these biomarkers is detectable at a particular time point during the infection, which provides us with information regarding the stage of the infection. Additionally, each of these biomarkers has various methods of detection. For example, the virus itself can be detected directly by virus isolation and microscopic examinations, or the viral nucleic acid can be detected by molecular techniques such as ReverseTranscription Polymerase Chain Reaction (RT-PCR), Nucleic acid sequence-based

332

U. Bhalerao et al.

amplification (NASBA) and Reverse Transcription Loop-Mediated Isothermal Amplification (RT-LAMP). The NS1 antigen and DENV-specific antibodies are detected by serological methods such as the Enzyme-Linked Immunosorbent Assay (ELISA).

12.1.5.1 Virus Isolation Virus isolation is a traditional and sensitive method used for DENV detection and identification, particularly during acute illness (Liesegang 2016). It involves culturing of specimens in suitable cell lines of either mosquito (AP61, Tra-284, AP64, C6/36, and CLA-1 cells) or mammalian origin (LLCMK2, Vero, and BHK-21 cells) (Parshionikar et al. 2010). Isolation of DENV in mice animal models for research is also an excellent technique since the virus can be produced in higher titres than cell culture. DENV viremia is particularly detectable 24–48 hours before the arrival of fever and lasts for 5–6 days, and it is during this period that the virus can be isolated from patient blood, serum and plasma and sometimes even from tissues of patients with severe dengue (Gyawali and Hewitt 2018). Additionally, since not all dengue virus serotypes are cytopathogenic, cell culture must be followed by an antigen detection immunofluorescence assay for confirmation and serotype identification. A common problem faced, especially during virus isolation from specimens of patients with secondary DENV infections, is the rapid anamnestic production of crossreactive antibodies during the acute, febrile phase of the disease that form immune-complexes with circulating viruses (Huang et al. 2016). Another limitation of this method is that although definitive, it is rather time-consuming since DENV has a long incubation period of 5–7 days. Owing to this, isolation has been replaced by the more modern detection methods of nucleic acid detection and serological testing (Fraisse et al. 2018). 12.1.5.2 Nucleic Acid Detection DENV RNA is detectable in the blood, serum and tissues of patients with high viremia, and methods of nucleic acid detection are preferred over conventional virus isolation due to their increased sensitivity, specificity and rapidity. They involve extraction and purification of the nucleic acid from the specimen, amplification, detection and characterization of the resulting amplified product (Fraisse et al. 2018). Over the years, Reverse Transcription-Polymerase Chain Reaction (RT-PCR) has been studied for many RNA viruses. For dengue diagnosis, RT-PCR provides a confirmatory, serotype-specific test, and it can utilize a wide range of primers to detect and amplify different portions of the DENV genome. First, reverse transcription is used to synthesize a complementary DNA (cDNA) of the viral genome using a reverse transcriptase enzyme. This is followed by a standard PCR using appropriate primers. This may be followed by another cycle of PCR amplification with serotype-specific, nested primers to detect the specific serotype of the virus. The PCR product is then separated by electrophoresis on an agarose gel and then visualized as bands of different molecular weights in the agarose gel using ethidium bromide dye and standard molecular weight markers. In this assay design, dengue serotypes are identified by the size of their bands (Soejima et al. 2016).

12

Dengue Haemorrhagic Fever: A Resurgent Arbovirosis in Humans

333

Real-time RT-PCR (RT-qPCR) is a one-step assay that amplifies and simultaneously quantitates viral RNA using primer pairs and probes specific for each DENV serotype. The quantitation relies upon the detection and quantitation of a fluorescent reporter probe whose signal increases with an increase in the PCR-amplified product. These probes may be dyes such as SYBR Green which bind to double-stranded DNA, or sequence-specific probes like TaqMan probes, LNA, or molecular beacon probes, which comprise of oligonucleotides which are labelled with a fluorescent reporter which allows detection only after probe hybridization with its complementary DNA target. Additionally, a DENV RT-qPCR may be singleplex to detect and quantitate a single serotype at one time simply, or it might be multiplex to detect and quantitate all four serotypes in a single sample (Chen et al. 2020). Nucleic acid sequence-based amplification (NASBA) is a method of isothermal RNA-specific amplification that, unlike PCR, does not utilize a thermal cycler and is based on in vitro transcription. It differs from PCR in that the reaction is isothermic (41 °C); it incorporates a dual function reverse transcriptase/DNA polymerase, T7 RNA polymerase, RNase H and a T7 promoter-labelled target-specific primer (Randazzo et al. 2018). It involves carrying out continuous cycles of RNA transcription to duplicate the target sequence through a double-stranded cDNA intermediate. It involves the production of an RNA: DNA hybrid containing the T7 promoter sequence, and this hybrid is degraded by RNase H, allowing the formation of dsDNA by the DNA polymerase. The viral RNA is reverse transcribed to a double-stranded DNA template utilised for RNA transcription by the T7 polymerase. The amplified RNA is then sensed using electrochemiluminescence or in real-time with fluorescent-labelled molecular beacon probes (Whiley and Sloots 2016). This method has also been applied to diagnose dengue and has been shown to have a sensitivity comparable with that of virus isolation by cell culture (Fraisse et al. 2018). Like NASBA, Reverse Transcription - Loop Mediated Isothermal Amplification (RT-LAMP) is another powerful, rapid, as well as efficient amplification tool carried out in isothermal settings. Amplification and detection are carried out together in one step by incubating the sample with four to six specific primers (forward and reverse primers) that are homologous to six distinct target sequences, with an inner primer that initiates the lamp reaction for the sense and anti-sense strands of the target. The outer primer initiates strand-displacement DNA replication to produce an ssDNA molecule which acts as the template for the DNA synthesis using the second set of inner and outer primers that produce a stem loop at the other end of the target. Subsequently, the inner primer binds to the loop of the nascent DNA to produce DNA in the form of the original stem-loop and a new stem-loop DNA with twice the length. (Dengue Guidelines For Diagnosis, Treatment, Prevention and Control 2009; Whiley and Sloots 2016).

12.1.5.3 NS1 Antigen Detection NS1 is an important diagnostic marker for dengue due to its secretion from infected cells and circulation at high levels of up to 50 micrograms/milliliter (μg/mL) in the blood of infected individuals. NS1 detection is possible right from the onset of fever

334

U. Bhalerao et al.

till up to 9 days or even longer in primary infections. It also persists during the viremic phase when viral RNA is detectable, but an antibody response is yet to be mounted, and NS1 levels correlate with the viral titer (Muller et al. 2017). The NS1 antigen is detected using antigen-capture ELISA or sandwich ELISA, which involves direct adsorption of the antigen onto the wells of a microtiter plate or through a precoated DENV-specific antibody. A second enzyme-conjugated NSI-specific antibody is then added to the wells, and subsequent detection and quantitation are based on an enzyme-substrate reaction. Although used routinely for dengue diagnosis, the sole problem arises in cases of secondary infections wherein cross-reactive antibodies sequester NS1 into immune complexes, thereby preventing their detection (Muller et al. 2017).

12.1.5.4 Serological Diagnosis Serological diagnosis of dengue can be achieved by a multitude of methods such as hemagglutination inhibition (HI) assays, complement fixation tests, dot-blot assays, Western blot, indirect immunofluorescent antibody assays and plaque reduction neutralization tests, and IgM and IgG antibody-capture ELISAs. The most commonly used methods include HI and IgM and IgG ELISAs. However, it is essential to note that testing in the early acute phase of illness provides negative results for these tests. HI relies on the ability of DENV antigens to agglutinate avian and trypsinized type O human erythrocytes. DENV-specific antibodies in the sera of infected individuals can interact with these antigens and prevent this agglutination. However, HI requires paired serum samples of the individual during the acute and convalescent phases of the infection. A significant drawback of this method is that it cannot discriminate among closely related flaviviruses, and cross-reactivity is a major possibility. The acute phase serum sample has a low antibody titer while convalescent-phase serum shows an increased HI antibody titer, and it is essential to note that antibody titers are seen to rise rapidly, particularly in secondary infections. Although the HI assay has since time immemorial, the highly productive IgM and IgG capture ELISAs are generally preferred. IgM antibodies appear in the serum of the infected 3–5 days after the fever sets in, peaking even after convalescence for up to several months and can be detected by IgM antibody capture ELISA (MAC ELISA), which involves the capture of IgM from patient sera by precoated antibodies specific for the μ-chain of IgM (Muller et al. 2017). Dengue serotypespecific antigens then interact with the captured DENV-specific IgM, which is detected by monoclonal or polyclonal antibodies labelled directly or indirectly with an enzyme that transforms a colourless substrate to a coloured product (Dengue Guidelines For Diagnosis, Treatment, Prevention and Control 2009). IgG antibodies are not detectable in the acute phase of a primary DENV infection but are seen to last for more than 10 months after infection. However, IgG may appear as soon as 3 days after the onset of symptoms in case of secondary infections as a result of the rapid anamnestic cross-reactive IgG response, and the nature of the infection, whether

12

Dengue Haemorrhagic Fever: A Resurgent Arbovirosis in Humans

335

primary or secondary, can be determined by assessing the IgM: IgG ratio during the acute phase of infection (Muller et al. 2017). Antibody-mediated virus neutralization can be defined as the interaction between a specific protein or glycoprotein on the virion surface and antibodies, which results in the inactivation of the virus so it can no longer infect and replicate in cell cultures or animals. Thus, a neutralizing antibody has the ability to defend a cell from a specific antigen or infectious entity by neutralizing its infectivity. Hence, neutralizing antibodies are often termed as correlates of protection. However, neutralization titers in serum do not have a perfect correlate with protection from infections in vivo. The essence of the neutralization assay is that when a given virus is grown on a cell monolayer, it causes plaques to form, and the number of plaques formed reduces if a virus-specific neutralizing antibody interacts with the virus in cell culture. This reduction in plaques gives a measure of the antibody titer.

12.1.6 Methods of Quantification of Dengue Viruses Virus quantification and titration involve enumerating the number of virus particles in order to estimate the virus concentration. It is required not only to diagnose a disease but also to quantify viruses in the field of research and development. Several methodologies have been developed over the years, including in vitro, cell culturebased methods like plaque assay, 50% tissue culture infectivity dose (TCID50), foci forming (FFU) assay and immunofluorescence assay, in vivo assays such as LD50 (lethal dose 50) which is very similar to TCID50, serological methods like hemagglutination inhibition and ELISA, molecular techniques like real-time RT-PCR and methods of direct counting of viral particles such as flow cytometry-based titration and transmission electron microscopy (TEM).

12.1.6.1 Cell Culture-based Virus Titration The advent of cell culture has not just made virus propagation a more manageable task but has also enabled the easy quantification of viruses. Among the several cell culture-based virus quantitative assays that investigators have reported are 50% Tissue Culture Infectivity Dose or TCID50, plaque assay, foci forming (FFU) assay and the immunofluorescence assay. Among these, the plaque assay is a gold standard technique for dengue virus titration. It involves the infection of confluent monolayers of a susceptible cell line with serial dilutions of a virus suspension. After a sufficient incubation period for virus adsorption onto the cells, an immobilizing overlay medium like agar, methylcellulose or carboxymethylcellulose (CMC) is added to the conventional cell culture medium to prevent the indiscriminate spread of the infection to other cells via the mechanical or convectional flow of the liquid medium during the incubation period (Baer and Kehn-Hall 2014). As a result, during viral propagation, the infection will remain constrained to the surrounding monolayer only. Upon completion of the incubation period and appropriate fixation and staining of the cell monolayers, discrete plaques or regions of cell death are counted, either manually or using a plaque counter, to obtain the titer of the virus suspension

336

U. Bhalerao et al.

in terms of plaque-forming units per milliliter (PFU/mL) which is a unit equivalent to a single infectious virus particle. Very similar to the plaque assay is 50% Tissue Culture Infectivity Dose or TCID50- an age-old technique of quantifying viral titers. It is based on the determination of the virus concentration at which 50% of the infected cells display cytopathic effect or CPE and involves serially diluting a virus suspension to infect a monolayer of susceptible cells in a 96-well plate. After incubation at appropriate time and temperature conditions, the percentage of CPE produced by the respective virus dilutions is then scored and used to mathematically calculate the results (Hsieh et al. 2017). The FFU assay is also a variant of the plaque assay, which also involves infection of cell monolayers with serial dilutions of a virus suspension. However, detection is based on immunostaining using virus-specific primary antibodies and primary antibody-specific, enzyme-labelled or fluorescently-labelled secondary antibodies, which aids visual detection and counting of the foci to express the results in terms of Foci Forming Units per milliliter (FFU/mL) (Alvarez et al. 2014). Although widely used, each of these cell culture-based virus titration methods has limitations. The plaque assay requires stains, such as neutral red, crystal violet or amido black, to obtain contrast between the living cells and plaques. Moreover, plaque assay, TCID50 and FFU assay cannot be used for viruses and cell line combinations that do not produce CPE. Additionally, one of the most significant disadvantages of these methods is the variable lengths of incubation periods for different viruses, which in the case of dengue, for example, lasts for 5–7 days. Lastly, these methods have a large margin of error due to the requirement of manual counting of CPE, plaques and foci.

12.1.6.2 Serological Methods of Virus Titration Although seldom practiced, virus titration can be achieved through serological assays. The hemagglutination assay (HA) is one such serological method that finds its basis in the ability of specific viral antigens to agglutinate erythrocytes through the sialic acid residues present on the erythrocytes. HA was first developed in 1941 by an American virologist, George Hirst, to quantify the relative concentration of viruses. In this assay, virus particles and erythrocytes form a lattice structure that prevents erythrocyte sedimentation. On the other hand, non-agglutinated erythrocytes can sediment to the bottom of the well. As a result, in a sample consisting of a low virus concentration, hemagglutination is low or does not occur at all. Based on this, the highest dilution of the serially diluted virus sample at which hemagglutination occurs is taken as the hemagglutination unit (HAU), which corresponds to the amount of virus needed to agglutinate an equal volume of standardized erythrocytes suspension (Hemagglutination - an Overview | ScienceDirect Topics n.d.). Another serological assay that can be used for virus titration is the antigen capture or sandwich enzyme-linked immunosorbent assay (ELISA), which finds its principle in antigen-antibody interactions and subsequent detection using different enzymesubstrate combinations, one of which involves the use of horseradish peroxidase,

12

Dengue Haemorrhagic Fever: A Resurgent Arbovirosis in Humans

337

biotin-avidin and its chromogenic substrate (hydrogen peroxide). It involves the coating of an antigen-specific primary antibody (or a capture antibody) onto the wells of a microtiter well plate and using a blocking buffer, such as bovine serum albumin, casein and gelatin, among many others, to prevent non-specific binding of proteins. This is followed by adding the antigen or the virus suspension, followed by adding a biotinylated secondary antibody specific to the virus. Subsequent addition of avidin-HRP (horseradish peroxidase) then causes the formation of a biotin-avidin complex, making an indirect link between the secondary antibody and HRP. Finally, a chromogenic substrate is added, and in the presence of the whole antibody-antigenbiotinylated HRP conjugate, a coloured product is formed, which can be further quantitated by checking the absorbance of the product using a colorimeter (ELISA: Basic Principles and Types of ELISA Assay | Abcam n.d.).

12.1.6.3 Virus Titration Using Real-time RT-PCR RT-qPCR is an assay for the simultaneous amplification and quantification of viral RNA using primer pairs and probes specific for an RNA virus. The quantitation relies upon the detection and quantitation of a fluorescent reporter probe whose signal increases with an increase in the PCR-amplified product. As mentioned earlier in this chapter, these probes may be dyes such as SYBR Green which bind to dsDNA, or sequence-specific probes like TaqMan probes, LNA, or molecular beacon probes, which comprise of oligonucleotides that are labelled with a fluorescent reporter, which allows detection only after probe hybridization with its complementary DNA target. The assay can also be conducted as a singleplex assay to detect and quantitate a single virus at one time simply, or it might be multiplex to detect and quantitate multiple viruses in a single sample (Chen et al. 2020). However, RT-qPCR quantitates the nucleic acid concentration in a particular sample, and it takes into account both the nucleic acid from infectious virus particles as well as free nucleic acid and nucleic acid from non-infectious virus particles. This incapability to distinguish between infectious and non-infectious virus particles limits its use in estimating virus infectivity (Grigorov et al. 2011). 12.1.6.4 Direct Counting of Viral Particles Methods for obtaining direct counts of viral particles include flow cytometry and transmission electron microscopy. Although most flow cytometers cannot offer high sensitivity, they can be used for the purpose of quantification. Flow cytometry estimates the number of whole virus particles using fluorescence which detects colocalized proteins and nucleic acid using two different staining dyes specific for the two types of molecules. These stained molecules are then analysed using a laser beam, and the number of molecules is measured along with the measured sample flow rate to calculate the concentration of virus particles per milliliter. Although relatively faster, this method requires expensive instrumentation and skilled laboratory personnel and has the additional drawback of relatively low sensitivity (Grigorov et al. 2011). Transmission electron microscopy for virus quantitation employs an electron beam focused with a magnetic field on an ultrathin negatively stained sample to

338

U. Bhalerao et al.

obtain an image in high resolution. This method can visualize individual virus particles and details of their morphology. Thus, quantitation can be done in terms of virus-like particles/mL. Although this technique is a high-end technique, it has many disadvantages, such as the requirement of high cost and bulky instrumentation, and skilled personnel to operate it. Additionally, quantitation of samples with a low viral load is not possible by this method, and a minimum concentration of 106 particles/mL is required (Malenovska 2013).

12.1.7 Therapeutic Approaches for Dengue The severity of dengue ranges from symptomatic with febrile and severe dengue hemorrhagic fever (DHF) and shock syndrome (DSS). However, treatments available for dengue are very limited as per the severity of the disease. The WHO recommends two treatment modalities for Dengue which are mainly based on symptomatic therapy and fluid administration (Masri et al. 2019). In symptomatic therapy, mostly analgesic and antipyretic agents like acetaminophen are prescribed. The other NSAIDS and aspirin are not preferred because they are known to induce thrombocytopenia (Masri et al. 2019). In milder cases, oral rehydration is the preferred mode of fluid administration, while more severe cases presenting with DHF and DSS warrant intravenous fluid administration. Both crystalloids and colloids have been examined for the treatment of dengue. Crystalloids are preferentially administered for treatment since there is a lower risk of coagulopathy and hypersensitivity reactions, while the use of colloids is warranted in cases of severe shock. Excessive bleeding or vascular leakages require more fluid administration along with blood transfusions. The volume of resuscitation fluid to be administered should be well judged to avoid pulmonary oedema or ascites during recovery of the patients (Masri et al. 2019). Recent years have also witnessed the development of DENV-specific antiviral drugs which require the attributes of being able to inhibit viral replication, reduce the transmissibility and disease severity by either targeting viral factors or host factors. A number of potential antiviral drugs have been screened in humans, but none has shown significant therapeutic effect so far (Masri et al. 2019). Antiviral drugs against DENV can target viral proteins so as to reduce replication which in turn would reduce viraemia. Among the antivirals that have been developed to attempt to act on this virus, is Balapiravir-a nucleoside analogue originally used against the Hepatitis C Virus, which targets the RNA-dependent RNA polymerase of DENV. However, this drug failed in clinical trials for dengue therapy. Other potential drugs that are being explored include NITD-008, alpha-glucosidase, celgosivir, statines, chloroquine and ivermectin. However, little to no success has been achieved in the prospect of using these as antivirals for the Dengue Virus (Masri et al. 2019).

12

Dengue Haemorrhagic Fever: A Resurgent Arbovirosis in Humans

339

Therapeutic advents targeting host factors in order to combat this virus include immunomodulators such as corticosteroids and monoclonal therapeutics. Monoclonal antibodies are emerging as potential therapeutics as a result of recent advances in our understanding of the virus and virus-antibody complex structure. These antibodies are targeted against both linear or quaternary DENV E protein that either inhibits viral attachment or fusion with the host cell membrane. These antibodies target hinge region of domain I and II (14c10, 1F4, 4CAU and 4C2I), domain III or dimer of E proteins (4UIF, 5A1Z, 4UIH, 4UTB and ab513) showing either serotype specific or cross neutralization (ref. Verma et al. 2014). Interestingly, monoclonal antibodies targeting NS1 have shown better survival in an immunocompromised mouse model of DENV disease but not yet been examined in humans. Though most of these antibodies have demonstrated in vivo efficacy, none of them have evaluated in clinical trials (Masri et al. 2019).

References de Almeida H, Bastos IMD, Ribeiro BM, Maigret B, Santana JM (2013) New binding site conformations of the dengue virus NS3 protease accessed by molecular dynamics simulation. PLoS One 8(8):e72402. https://doi.org/10.1371/journal.pone.0072402 Alvarez A, Barisone GA, Diaz E (2014) Focus formation: a cell-based assay to determine the oncogenic potential of a gene. J Vis Exp 94(94):51742. https://doi.org/10.3791/51742 Aruna R (2014) Review on dengue viral replication, assembly and entry into the host cells. Int J Curr Microbiol App Sci 3(11). http://www.ijcmas.com Baer A, Kehn-Hall K (2014) Viral concentration determination through plaque assays: using traditional and novel overlay systems. J Vis Exp 93:52065. https://doi.org/10.3791/52065 Bartenschlager R, Miller S (2008) Molecular aspects of dengue virus replication. In Future microbiology (Vol. 3, Issue 2, pp. 155–165). Future Medicine Ltd, London, UK. doi: https:// doi.org/10.2217/17460913.3.2.155 Baymiev AK, Baymiev AK, Kuluev BR, Shvets KY, Yamidanov RS, Matniyazov RT, Chemeris DA, Zubov V, Alekseev YI, Mavzyutov AR, Ivanenkov YA, Chemeris AV (2020) Modern approaches to differentiation of live and dead bacteria using selective amplification of nucleic acids. In Microbiology (Russian Federation) (Vol. 89, Issue 1, pp. 13–27). Pleiades Publishing. https://doi.org/10.1134/S0026261720010038 Bhatt S, Gething PW, Brady OJ, Messina JP, Farlow AW, Moyes CL, Drake JM, Brownstein JS, Hoen AG, Sankoh O, Myers MF, George DB, Jaenisch T, William Wint GR, Simmons CP, Scott TW, Farrar JJ, Hay SI (2013) The global distribution and burden of dengue. Nature 496(7446):504–507. https://doi.org/10.1038/nature12060 Brescia CC, Griffin SM, Ware MW, Varughese EA, Egorov AI, Villegas EN (2009) Cryptosporidium propidium monoazide-PCR, a molecular biology-based technique for genotyping of viable cryptosporidium oocysts. Appl Environ Microbiol 75(21):6856–6863. https://doi.org/10.1128/ AEM.00540-09 Byk LA, Gamarnik AV (2016) Properties and functions of the dengue virus capsid protein. Annu Rev Virol 3(1):263–281). Annual Reviews Inc. https://doi.org/10.1146/annurev-virology110615-042334 Cangelosi GA, Meschke JS (2014) Dead or alive: molecular assessment of microbial viability. Appl Environ Microbiol 80(19):5884–5891. American Society for Microbiology. https://doi.org/10. 1128/AEM.01763-14

340

U. Bhalerao et al.

Chen HR, Lai YC, Yeh TM (2018) Dengue virus non-structural protein 1: a pathogenic factor, therapeutic target, and vaccine candidate. J Biomed Sci. BioMed Central Ltd. 25(1):1–11. https://doi.org/10.1186/s12929-018-0462-0 Chen J, Wu X, Sánchez G, Randazzo W (2020) Viability RT-qPCR to detect potentially infectious enteric viruses on heat-processed berries. Food Control 107:106818. https://doi.org/10.1016/j. foodcont.2019.106818 Clyde K, Kyle JL, Harris E (2006) Recent advances in deciphering viral and host determinants of dengue virus replication and pathogenesis. J Virol 80(23):11418–11431. https://doi.org/10. 1128/jvi.01257-06 Dengue and Severe Dengue (n.d.). https://www.who.int/news-room/fact-sheets/detail/dengue-andsevere-dengue. Accessed 14 Jan 2021 Dengue Guidelines for Diagnosis, Treatment, Prevention and Control (2009). www.who.int/tdr Dick OB, San Martín JL, Montoya RH, del Diego J, Zambrano B, Dayan GH (2012) The history of dengue outbreaks in the Americas. Am J Trop Med Hyg 87(4):584–593. https://doi.org/10. 4269/ajtmh.2012.11-0770 ELISA: basic principles and types of ELISA assay | Abcam (n.d.). https://www.abcam.com/kits/ elisa-principle. Accessed 13 May 2021 Etymologia: Dengue (2006) Emerg Infect Dis 12(6):893–893. https://doi.org/10.3201/eid1206. et1206 Fittipaldi M, Rodriguez NJP, Codony F, Adrados B, Peñuela GA, Morató J (2010) Discrimination of infectious bacteriophage T4 virus by propidium monoazide real-time PCR. J Virol Methods 168(1–2):228–232. https://doi.org/10.1016/j.jviromet.2010.06.011 Fraisse A, Niveau F, Hennechart-Collette C, Coudray-Meunier C, Martin-Latil S, Perelle S (2018) Discrimination of infectious and heat-treated nor virus by combining platinum compounds and real-time RT-PCR. Int J Food Microbiol 269:64–74. https://doi.org/10.1016/j.ijfoodmicro.2018. 01.015 Gopala Reddy SB, Chin W-X, Shivananju NS (2018) Dengue virus NS2 and NS4: minor proteins, mammoth roles. Biochem Pharmacol 154:54. https://doi.org/10.1016/j.bcp.2018.04.008 Gould EA, Solomon T (2008) Pathogenic flaviviruses. In www.thelancet.com (Vol. 371). www. thelancet.com Grigorov B, Rabilloud J, Lawrence P, Gerlier D (2011) Rapid titration of measles and other viruses: optimization with determination of replication cycle length. PLoS One 6(9):e24135. https://doi. org/10.1371/journal.pone.0024135 Gubler DJ (1998) Dengue and dengue hemorrhagic fever. Clin Microbiol Rev 11(3) Gyawali P, Hewitt J (2018) Detection of infectious noroviruses from wastewater and seawater using PEMAXTM treatment combined with RT-qPCR. Water 10(7):841. https://doi.org/10.3390/ w10070841 Hemagglutination - an overview | ScienceDirect Topics (n.d.). https://www.sciencedirect.com/ topics/immunology-and-microbiology/hemagglutination. Accessed 12 May 2021 Henchal EA, Putnak JR (1990) The dengue viruses. Clin Microbiol Rev 3(4). http://cmr.asm.org/ History and Origin of Dengue Virus (n.d.). http://www.denguevirusnet.com/history-of-dengue. html. Accessed 12 Jan 2021 Hsieh MS, Chen MY, Hsieh CH, Pan CH, Yu GY, Chen HW (2017) Detection and quantification of dengue virus using a novel biosensor system based on dengue NS3 protease activity. PLoS One 12(11):e0188170. https://doi.org/10.1371/journal.pone.0188170 Huang X, Zhou X, He X, Wang P, Yue S, Wu L, Zhang Y, Xie Q, Zhang B, Zhao W (2016) Detection of infectious dengue virus by selective real-time quantitative polymerase chain reaction. Virol Sin 31(4):342–345). Science Press. https://doi.org/10.1007/s12250-016-3757-x Infectious Diseases in a Changing Climate: Information for Public Health Officials in the WHO European Region (n.d.) Jing Q, Wang M (2019) Dengue epidemiology. Global Health J 3(2):37–45. https://doi.org/10. 1016/j.glohj.2019.06.002

12

Dengue Haemorrhagic Fever: A Resurgent Arbovirosis in Humans

341

Kothai, R., & Arul, B. (2020). Dengue fever: an overview. In Dengue fever in a one health perspective. IntechOpen. doi: https://doi.org/10.5772/intechopen.92315 Kuhn RJ, Zhang W, Rossmann MG, Pletnev SV, Corver J, Lenches E, Jones CT, Mukhopadhyay S, Chipman PR, Strauss EG, Baker TS, Strauss JH (2002) Structure of dengue virus: implications for flavivirus organization, maturation, and fusion. Cell 108(5):717–725. https://doi.org/10. 1016/S0092-8674(02)00660-8 Liesegang TJ (2016) Ocular viral infections. In Lennette’s laboratory diagnosis of viral infections, 4th ed, pp. 425–448. CRC Press. doi: https://doi.org/10.3109/9781420084962.025 Lindenbach BD, Murray CL, Thiel H-JRCM (2013) Flaviviridae. In: Knipe DM, Howley PM, Cohen JI, Griffin DE, Lamb RA, Martin MA, Racaniello VR, Roizman B (eds) Fields virology, vol 1, 6th edn. Lippincott Williams & Wilkins, pp 712–746 MacKenzie JM, Khromykh AA, Jones MK, Westaway EG (1998) Subcellular localization and some biochemical properties of the flavivirus Kunjin nonstructural proteins NS2A and NS4A. Virology 245(2):203–215. https://doi.org/10.1006/viro.1998.9156 Malenovska H (2013) Virus quantitation by transmission electron microscopy, TCID50, and the role of timing virus harvesting: a case study of three animal viruses. J Virol Methods 191(2): 136–140. https://doi.org/10.1016/j.jviromet.2013.04.008 Martina BEE, Koraka P, Osterhaus ADME (2009) Dengue virus pathogenesis: an integrated view. Clin Microbiol Rev. American Society for Microbiology Journals 22:564–581. https://doi.org/ 10.1128/CMR.00035-09 Masri MFB, Rathore APS, St. John AL (2019) Therapeutics for dengue. Curr Treatment Options Infect Dis 11(3):199–214. https://doi.org/10.1007/S40506-019-00193-6 Mcsherry JA (1982) Some medical aspects of the Darien scheme: was it dengue? Scott Med J 27: 183 Meng F, Badierah RA, Almehdar HA, Redwan EM, Kurgan L, Uversky VN (2015) Unstructural biology of the dengue virus proteins. FEBS J 282(17):3368–3394. https://doi.org/10.1111/febs. 13349 Morales I, Salje H, Saha S, Gurley ES (2016) Seasonal distribution and climatic correlates of dengue disease in Dhaka, Bangladesh. Am J Trop Med Hyg 94(6):1359–1361. https://doi.org/ 10.4269/ajtmh.15-0846 Morens DM, Folkers GK, Fauci AS (2013) Dengue: the continual re-emergence of a centuries-old disease. EcoHealth 10:104–106. https://doi.org/10.1007/s10393-013-0825-7 Muller DA, Depelsenaire ACI, Young PR (2017) Clinical and laboratory diagnosis of dengue virus infection. J Infect Dis 215(suppl_2):S89. https://doi.org/10.1093/infdis/jiw649 Nasar S, Rashid N, Iftikhar S (2020) Dengue proteins with their role in pathogenesis, and strategies for developing an effective anti-dengue treatment: a review. J Med Virol 92(8):941–955. https:// doi.org/10.1002/jmv.25646 Nocker A, Cheung CY, Camper AK (2006) Comparison of propidium monoazide with ethidium monoazide for differentiation of live vs. dead bacteria by selective removal of DNA from dead cells. J Microbiol Methods 67(2):310–320. https://doi.org/10.1016/j.mimet.2006.04.015 Parshionikar S, Laseke I, Fout GS (2010) Use of propidium monoazide in reverse transcriptase PCR to distinguish between infectious and noninfectious enteric viruses in water samples. Appl Environ Microbiol 76(13):4318–4326. https://doi.org/10.1128/AEM.02800-09 Phadungsombat J, Lin MY-C, Srimark N, Yamanaka A, Nakayama EE, Moolasart V, Suttha P, Shioda T, Uttayamakul S (2018) Emergence of genotype cosmopolitan of dengue virus type 2 and genotype III of dengue virus type 3 in Thailand. PLoS One 13(11):e0207220. https://doi. org/10.1371/journal.pone.0207220 Pierson TC, Diamond MS (2013) Flaviviruses. In: Knipe DM, Howley PM, Jeffrey CI, Griffin DE, Lamb RA, Martin MA, Racaniello VR, Roizman B (eds) Fields virology, vol 1, 6th edn. Lippincott Williams & Wilkins, pp 747–794 Puente H, Randazzo W, Falcó I, Carvajal A, Sánchez G (2020) Rapid selective detection of potentially infectious porcine epidemic diarrhoea coronavirus exposed to heat treatments using viability RT-qPCR. Front Microbiol 11. https://doi.org/10.3389/fmicb.2020.01911

342

U. Bhalerao et al.

Qi R, Zhang L, Chi C (2008) Biological characteristics of dengue virus and potential targets for drug design. Acta Biochim Biophys Sin 40(2):91. https://doi.org/10.1111/j.1745-7270.2008. 00382.x Randazzo W, Vasquez-García A, Aznar R, Sánchez G (2018) Viability RT-qPCR to distinguish between HEV and HAV with intact and altered capsids. Front Microbiol 9(AUG). https://doi. org/10.3389/fmicb.2018.01973 Rush B (1794) An account of the bilious remitting yellow fever, as it appeared in the city of Philadelphia, in the year 1793. Thomas Dobson, Philadelphia. https://archive.org/details/ accountofbilious00rush/mode/2up el Sahili A, Lescar J (2017) Dengue virus non-structural protein 5. Viruses 9(4):1–20. MDPI AG. https://doi.org/10.3390/v9040091 Salles TS, da Encarnação Sá-Guimarães T, de Alvarenga ESL, Guimarães-Ribeiro V, de Meneses MDF, de Castro-Salles PF, dos Santos CR, do Amaral Melo AC, Soares MR, Ferreira DF, Moreira MF (2018) History, epidemiology and diagnostics of dengue in the American and Brazilian contexts: a review. Parasites and vectors 11(1). BioMed Central Ltd. https://doi.org/ 10.1186/s13071-018-2830-8 Sauch JF, Flanigan D, Galvin ML, Berman D, Jakubowski W (1991) Propidium iodide as an indicator of giardia cyst viability. Appl Environ Microbiol 57(11):3243–3247. https://doi.org/ 10.1128/aem.57.11.3243-3247.1991 Shrivastava S, Tiraki D, Diwan A, Lalwani SK, Modak M, Mishra AC, Arankalle VA (2018) Co-circulation of all the four dengue virus serotypes and detection of a novel clade of DENV-4 (genotype I) virus in Pune, India during 2016 season. PLoS One 13(2):e0192672. https://doi. org/10.1371/journal.pone.0192672 Silva EM, Conde JN, Allonso D, Ventura GT, Coelho DR, Carneiro PH, Silva ML, Paes MV, Rabelo K, Weissmuller G, Bisch PM, Mohana-Borges R (2019) Dengue virus nonstructural 3 protein interacts directly with human glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and reduces its glycolytic activity. Sci Rep 9(1):1–19. https://doi.org/10.1038/s41598-01939157-7 Soejima T, Iida KI, Qin T, Taniai H, Seki M, Takade A, Yoshida SI (2007) Photoactivated ethidium monoazide directly cleaves bacterial DNA and is applied to PCR for discrimination of live and dead bacteria. Microbiol Immunol 51(8):763–775. https://doi.org/10.1111/j.1348-0421.2007. tb03966.x Soejima T, Minami J, Xiao J, Abe F (2016) Innovative use of platinum compounds to selectively detect live microorganisms by polymerase chain reaction. Biotechnol Bioeng 113(2):301–310. https://doi.org/10.1002/bit.25711 du Tertre, J. B. (1667). Histoire generale des Antilles habitées par les François. : Divisée en deux tomes, et enrichie de cartes & de figures. Tome I [-IV]. . . . /. In Histoire generale des Antilles habitées par les François. : Divisée en deux tomes, et enrichie de cartes & de figures. Tome I [-IV]. . . . /. Chez Thomas Iolly, au palais, en la salle des merciers, à la palme, & aux armes d’Hollande.,. doi: https://doi.org/10.5962/bhl.title.119250 Vasilakis N, Cardosa J, Hanley KA, Holmes EC, Weaver SC (2011) Fever from the forest: prospects for the continued emergence of sylvatic dengue virus and its impact on public health. Nature Reviews Microbiology. NIH Public Access 9:532–541. https://doi.org/10.1038/ nrmicro2595 Verma R, Singh A, Singh S, Singh V, Singh A (2014) Dengue virus and its structure—a promising target for drug discovery. Int J Pharm Life Sci:3848–3858. https://www.researchgate.net/ publication/266261426_Dengue_Virus_and_its_Structure_-_A_Promising_Target_for_Drug_ Discovery Whiley DM, Sloots TP (2016) Molecular amplification methods in diagnostic virology. In Lennette’s laboratory diagnosis of viral infections, 4th ed. CRC Press, pp. 19–39. doi: https:// doi.org/10.3109/9781420084962.003

12

Dengue Haemorrhagic Fever: A Resurgent Arbovirosis in Humans

343

Yacoub S, Wertheim H, Simmons CP, Screaton G, Wills B (2014) Cardiovascular manifestations of the emerging dengue pandemic. Nat Rev Cardiol 11(6):335–345. Nature Publishing Group. https://doi.org/10.1038/nrcardio.2014.40 Yuan HY, Liang J, Lin PS, Sucipto K, Tsegaye MM, Wen TH, Pfeiffer S, Pfeiffer D (2020) The effects of seasonal climate variability on dengue annual incidence in Hong Kong: a modelling study. Sci Rep 10(1):1–10. https://doi.org/10.1038/s41598-020-60309-7 Zhang Q, Hunke C, Yau YH, Seow V, Lee S, Tanner LB, Guan XL, Wenk MR, Fibriansah G, Chew PL, Kukkaro P, Biuković G, Shi P-Y, Shochat SG, Grüber G, Lok S-M (2012) The stem region of premembrane protein plays an important role in the virus surface protein rearrangement during dengue maturation. J Biol Chem 287(48):40,525. https://doi.org/10.1074/jbc. M112.384446 Zhang X, Jia R, Shen H, Wang M, Yin Z, Cheng A (2017) Structures and functions of the envelope glycoprotein in Flavivirus infections. Viruses 9(11):338. https://doi.org/10.3390/v9110338 Zonetti LFC, Coutinho MC, de Araujo AS (2018) Molecular aspects of the dengue virus infection process: a review. Protein Pept Lett 25(8):712. https://doi.org/10.2174/ 0929866525666180709115506

Crimean-Congo Haemorrhagic Fever Virus: A Complete Overview

13

Mansi Kumari, Bhupender Sahu, Janvi Sharma, Khalid Umar Fakhri, and Umesh Kumar

Abstract

The Crimean-Congo haemorrhagic fever virus (CCHFV) is an arbovirus that is spread by ticks. Transmission with this virus has been documented in the Crimean Peninsula. Currently, the World Health Organization (WHO) has designated “CCHF” as the highest priority disease for public health study and growth. It was transmitted through blood or any other bodily substance. The danger of this virus re-emerging over decades is increasing, as is the risk of it expanding to new areas. Scientists had little knowledge of the CCHF virus-host cell response. Climate has an impact on the outcome of this contagious illness. Treatment for confirmed instances of CCHF includes symptom management as well as general supportive treatment. According to some research, nucleoprotein activity was investigated for innate defence. The Notch signalling pathway was downregulated during CCHF virus infection, suggesting that it, along with virus-host contact, plays a role in the early phases of viral replication. miRNAs are also receiving similar focus. One of the current efforts is the development of a CCHF-specific target product profiles (TPP) as part of WHO’s roadmap. There are no authorized antiviral treatments due to a lack of data; successful study with therapeutic approaches would only be feasible if entire endemic nations collaborated to produce fruitful results.

M. Kumari Dr. D. Y. Patil Biotechnology & Bioinformatics Institute Tathawade, Pune, Maharashtra, India B. Sahu · J. Sharma · U. Kumar (✉) School of Biosciences, Institute of Management Studies Ghaziabad (University Courses Campus), Ghaziabad, Uttar Pradesh, India K. U. Fakhri Department of Biosciences, Jamia Millia Islamia, New Delhi, India # The Author(s), under exclusive license to Springer Nature Singapore Pte Ltd. 2023 P. L. Bhukya et al. (eds.), Emerging Human Viral Diseases, Volume I, https://doi.org/10.1007/978-981-99-2820-0_13

345

346

M. Kumari et al.

Keywords

CCHF virus · Crimean-Congo haemorrhagic fever virus · Notch signalling pathway · Therapeutic · Pathogenesis

13.1

Introduction

Crimean-Congo haemorrhagic fever virus (CCHFV) is an arbovirus (arthropods borne virus), commonly transmitted by ticks belongs to genus Orthonairovirus and the family Nairoviridae (Ergönül 2006). Evidences from archaeological samples indicated that this virus was endemic in the Celtic settlements (around 15001100 BC). Infection of this virus, CCHF, was reported after an outbreak of severe haemorrhagic fever by Soviet scientists in the Crimea region (peninsula in Eastern Europe) in the mid-1940s and was later described as Crimean haemorrhagic fever (CHF) (Crimean-Congo Haemorrhagic Fever (CCHF) R&D Roadmap n.d.). In the late 1960s, the aetiology of this virus was established when it was found antigenically similar to the Congo virus, reported in the African population. The nomenclature of this virus passed through a number of steps, and in 1973, the ICTV (International Committee on Taxonomy of viruses) adopted Crimean-Congo haemorrhagic fever virus as the authorized name (Annual Epidemiological Reports for Crimean-Congo Haemorrhagic Fever n.d.; Crimean-Congo Haemorrhagic Fever (CCHF) R&D Roadmap n.d.).

13.2

Epidemiology

Many nations in Europe, Asia, and Africa currently have an endemic spread of the illness. In nature, Ixodid tick vectors, especially those belonging to the genus Hyalomma, are the major carriers of the CCHFV. While CCHFV infection is most frequently spread through tick biting, direct contact with blood or other fluids can also result in person-to-person transmission (Shahhosseini et al. 2021). Also feasible is direct zoonotic transmission from hosts that are infected with viraemia. When it was discovered in several tick species, including Hyalomma spp. gathered from market animals and hedgehogs, the first report of CCHFV in Nigeria was made in 1970. It is interesting that hardly many CCHF cases have been reported in Africa; the bulk come from South Africa. Numerous African nations have an unclear CCHF risk, and CCHFV infection there is frequently unreported or untreated (Bukbuk et al. 2016). Importantly, CCHFV poses a serious risk to healthcare workers and is a wellknown cause of nosocomial infections, especially when left untreated. There are endemic foci with CCHF throughout Asia, Europe, and Africa. Its geographic distribution is linked to that of Hyalomma spp. ticks, specifically H. marginatum, H. rufipes, H. anatolicum, and H. asiaticum, which are the primary effective carriers of the virus. The ability of a vector to obtain, maintain, and transmit a pathogen is referred to as “vector competence.” Southern Europe, as well as several

13

Crimean-Congo Haemorrhagic Fever Virus: A Complete Overview

347

regions of Asia and Africa, is home to H. marginatum (Papa et al. 2017). Its aggressiveness in looking for human hosts defines it. Before an arthropod can be implicated as a real vector, a number of conditions must be satisfied, including vector competence in lab studies, evidence that the arthropod species feeds in nature on a host that develops an appropriate viraemia, and evidence that it is active during the time of year when viral transmission is taking place. For the duration of the tick’s life, the virus can be found there, and the overwintering of infected ticks is essential to the persistence of epidemic foci. As with other arboviral infections, the main actors in CCHF are the vector, pathogen, and host, and it is up to their interactions whether the host contracts the virus or not. Conflict or cooperation among ticks, hosts, and pathogens as a result of their co-evolution benefits ticks and pathogens more than ticks and, to a lesser extent, hosts (Gargili et al. 2017).

13.3

Potential Risk of Emergence and Re-emergence

CCHF has emerged or re-emerged in various nations in the Eastern Mediterranean Region over the last decade, with a growing risk of spreading to new areas. However, increased wild boar and deer population densities may help CCHFV propagation by increasing tick counts and dispersal across Europe. Climate change is known to have a strong impact on animal migration, and changes in host migratory patterns have important consequences for infectious diseases. During the last decade, climate change has had a substantial impact on the extension of wildlife ranges into new places, drastically raising the risk of disease introduction and transmission into previously unexposed host populations. Furthermore, climate change affects tick survival, activity, and growth, as well as the structure of vegetation, where ticks may reach an ecological optimum. The risk evaluation was carried out utilizing data from public sources and scholarly publications. The likelihood of entry was assessed using three primary pathways: infected tick vectors, wildlife, and livestock. The risk of exposure was evaluated by considering the potential of infected ticks surviving once introduced into CCHF-free countries (depending on abiotic and biotic variables), as well as the exposure of native uninfected susceptible ticks to infected imported animals and livestock (Fanelli and Buonavoglia 2021).

13.4

Organization of Infectious Agents (Structural and Molecular)

CCHF virus is a member of the Orthonairovirus genus, family Nairoviridae, and order Bunyavirales. The viral genome is composed of three negative-sense RNA segments, spherical, and enveloped. Based on antigenic relationships, Orthonairovirus genus has 41 species which are separated into 7 serotypes. Hazara virus, Khasan virus, Nairobi sheep disease virus (NSDV), and Dugbe virus are pathogenic for Homo sapiens. Tick-borne virus (TBV) of sheep and goats causes

348

M. Kumari et al.

intermittent benign illness in humans and it is thought to be similar to the Ganjam virus (Baron and Holzer 2015). The nairoviruses were categorized based on their antigenic similarity. Later, morphological and molecular affinities between viruses were used to validate these groupings using extensive full-length sequence analysis (Walker et al. 2016).

13.5

Pathogenesis and Clinical Manifestation

CCHFV manifests itself in nature by being transmitted by ticks of the family Ixodidae and members of the genus Hyalomma, which are the principal vectors that transfer the virus to people and a wide range of domestic and wild animals (Gargili et al. 2017). It is believed that animals are the asymptomatic reservoirs of CCHFV and they are used for the distribution of virus to humans (Belobo et al. 2021). Africa, Asia, Eastern Europe, the Middle East, and South East Asia are the prominent regions where this vector is found. CCHFV vector goes through three morphological stages: larva, nymph, and adult-moulting. Feed for days and weeks on a host and acquire nutrients required during each transition stage (Estrada-Peña and de La Fuente 2014). CCHF is spherical shaped with a dense capsid, bordering by a lipid envelope and spikes on the surface. The virus is around 80-100 nm in diameter approximately. It has a lipid envelope with two different types of glycoproteins, GN and GC, that were important for binding. These are the important target for naturalizing it in the course of infection by antibodies. Inside Virion, it has a viral genome of three single-stranded negative-sense RNA genomic segments named: small (S), medium (M), and large (L), which are encapsulated by nucleoprotein (NP); additionally, it has RNA-dependent RNA polymerase (RdRp) for replication and transcription inside the host cell. Intra-strand base pairing between terminal nucleotides results in stable panhandle structures and non-covalently closed circular RNA molecules. Previous study has shown that terminal base-pairing creates functional promoter regions for viral RdRp interaction (Marriott and Nuttall 1996). S, M, and L segments are approx. 1.6 kb, having a single open reading frame (ORF) encodes nucleocapsid protein (N); approx. 5.4 kb encodes for large glycoprotein precursor (GPC) and other non-structural proteins; approx. 12.1 kb encodes only one protein L, i.e., RNA-dependent RNA polymerase respectively (Bertolotti-Ciarlet et al. 2005). CCHF virus surfaces are highly N-glycosylated (Erickson et al. 2007). Infection is caused by the clathrin-mediated endocytosis mechanism; after that fusion of viral envelopes takes place with the endosomal membrane. Transcription occurs and converts the negative-sense RNA to complementary positive-sense RNA (cRNA). Viral mRNA is made from cRNA by cap-snatching from the host. In host Golgi complex, newly formed virions are getting arranged. The CCHFV genome has indications of genetic recombination, which increases its variability (Elata et al. 2011). The virions are subsequently transported to the cell membrane and exocytosed from the infected cell. The environmental durability of virus is unclear, although the encased virions are vulnerable towards lipid solvents, and modest concentrations of beta-propiolactone

13

Crimean-Congo Haemorrhagic Fever Virus: A Complete Overview

349

and formalin decrease infectivity. Despite the fact that the virus is labile in infected human tissues after death, a study of human patients found that infectivity could be maintained in isolated serum at room temperature for at least a few days. Although autoclaving decreases infectivity, the virus stays stable in less than 60 degrees Celsius (Mazzola and Kelly-Cirino 2019). Cell lines like Vero, BHK21, CER, and SW13 are used to replicate the CCHF virus, but they are poor in cytopathic in cell culture. Titres may thus be determined via indirect immunofluorescence in infected cells (Shepherd et al. 1986). The life cycle of the CCHF virus starts after taking infected blood from infected animals by ticks. They get replicated in the tick midgut and then enter in salivary glands of ticks. There are many barriers present in the ticks during its replication and transmission. During the feeding period, the tick attaches to the host and then viral replication is stimulated (Gargili et al. 2017). CCHF virus reservoirs are ticks from the genus Hyalomma even in the absence of vertebrate hosts. Their infections are enzootic and asymptomatic. Virus is transmitted to Homo sapiens through tick bites, expose with animal tissue, blood, or by coming in contact with infected humans. Through Hospitals, i.e. Nosocomial transmission was also reported in Sudan in 2008 (Aradaib et al. 2010). Mammals are susceptible to CCHF virus infection, but birds are showing resistance to it. In humans, the disease progresses through four phases: incubation, pre-haemorrhagic, haemorrhagic, and convalescence. The incubation period is dependent on the route of transmission (Tipih and Burt 2020). All viruses utilize the host to reproduce, and they do this by stealing the host cell’s molecular machinery. The virions of the CCHFV attach to the host cell’s cell surface receptors to begin the replication cycle. The mRNA is translated into viral proteins, and cRNA acts as a template for the synthesis of vRNA. New nucleocapsids are produced by the interaction of the vRNA, RbRp, and capsid proteins. Scientists knew little about the CCHF virus-host cell response. In some studies, NP function was examined for innate immunity. In that, the interaction between NP and innate immunity has been addressed and suggested that NP regulates innate immunity by modulating interferon/cytokine response and also apoptosis pathways. Epitope mapping showed that nuclear proteins are highly immunogenic and T cell response to nuclear protein epitopes was in huge numbers than glycoproteins and suggested that NP is a target for recovery (Karaaslan et al. 2021). According to cell gene activity, the virus likes to take over core carbon and energy metabolism systems. These are the main controllers of chemical synthesis and cellular energy supply. By using cancer medications to target these crucial pathways, it may be possible to decrease virus proliferation in lab cells. Notch signalling facilitates the viral infectivity of RNA-based viruses and regulates inflammation (Shang et al. 2016). Notch signalling pathway was downregulated during CCHF virus infection, indicating that it plays a part in viral replication’s early stages. Toll-like receptor 4 (TLR4) activation during an acute infection was increased by Notch1 silencing. Recent studies indicate that in virus-host interaction and pathogenesis, miRNAs are playing an important role and could affect virus replication and get incorporated with the host transcriptome. The antiviral response may be significantly influenced by changes in miRNA expression. The interactions between viruses and miRNAs

350

M. Kumari et al.

reveal a sophisticated mechanism. miRNAs have a direct impact on the pathogenesis and replication of vRNA (Zhu et al. 2021). The most significant mechanism for causing inflammation is the Toll-like receptor pathway, and MiR-144-3p has a significant impact on this pathway. The aetiology of CCHF was induced by a logarithmic rise in proinflammatory cytokine production, which resulted in vascular collapse and endotheliitis (Zhang et al. 2017). Both NF-κB and IRF pathways association is very important in pathogenesis of viral infection, but MiR-18a-5p targets the IRF signalling pathway along with other pathways like Notch2 pathways and TGF-β receptor. MiR-590-5p, a key player in opioid-induced immunosuppression in monocytes through blocking the CREB1/CREB5-NF-B signalling pathway, was shown to have CREB1 and CREB5 as direct target genes. Identification of treatment targets for the condition will be possible thanks to the discovery of miRNAs in CCHF patients (Arslan et al. 2019).

13.6

Diagnostic and Therapeutic Approaches

Treatment for verified cases of CCHF involves managing symptoms while providing general supportive care. There is not a recognized antiviral medication. Although clinical data is ambiguous, the antiviral medication ribavirin is extensively utilized due to its in vitro activity. To identify CCHF virus, many techniques were performed in laboratories such as reverse transcriptase (RT)-PCR, immunofluorescence assay (IFA), antibody (IgG, IgM) and antigen-capture ELISA, and virus isolation. Since RT-PCR assays offer the best possibility to sense and detect the active infections as earliest time point, they are typically used to diagnose patients with CCHF. The great diversification and in situ evolution of CCHFV could make lineage recognition difficult, especially for RT-PCR methods that depend on an unchanged/preserve sequence over a period of time in the evolution and that unchanged/preserve genomic sequence used for detection. Moreover, minor genomic changes have less of an effect on serological detection. It is advised that nucleic acid amplification tests (NAAT, e.g., RT-PCR) be used in conjunction with immunological assays for maximum detection sensitivity detection due to CCHFV strain changes (de la Calle-Prieto et al. 2018). A pure form of set of target product profiles (TPP) through clinical designs as well as operational design parameters, together with spectrum of minimal to optimal performance characteristics, will help in future development of latest and nextgeneration diagnostic tools for CCHF. Multiplexed real-time PCR, which used in Syndromic testing panels for speedy differentiation of CCHF from other VHF pathogens; many circulating strains and viral mutations potentially evaluate the susceptibility of well-designed probes used in molecular diagnostics and point-ofcare testing diagnostics for patient triage, also includes field of testing as well as screening, are all examples of relevant and application-driven TPPs that easily created support to the development of CCHF diagnostics that have been recognized here to expedite care and reduce transmission risk (Treatment Crimean-Congo

13

Crimean-Congo Haemorrhagic Fever Virus: A Complete Overview

351

Hemorrhagic Fever (CCHF) | CDC n.d.). A CCHF-specific TPP is one of the ongoing initiatives, and it is being created by WHO as part of its roadmap.

13.7

Control Approach Against CCHF Virus

Handling or dealing with specimens is a major issue specially in laboratory fields. Hyalomma marginatum are the main vector in Europe that it’s almost impossible to handle with that much of precision (Shahhosseini et al. 2021). Biorisk management developed a foundation to tackle this by following some biosafety equipment and should be handled by a trained staff. Tackle with postexposure injuries specially at the affected site should be immediately clean. In order to take precautions, case should be observed under supervision for at least 14 days with daily monitoring and symptoms/signs. No antiviral treatment is approved. Along with this controversary is running due to limitation in available data. Practices of safe injection and safe burial should be done everywhere.

13.8

Future Perspective of CCHF Virus

Currently, WHO listed “CCHF” as topmost priority disease for research and development in Public Health. It still needs comprehensive education in clinical trials. Studies in virology shows prophylactic and therapeutic approaches as well. Moreover, Computational Virtual Screening, inhibiting RNA synthesis, viral proteintargeting drug discovery in computational approaches, anti-CCHFV therapy development, catalytic domain of RNA polymerase (an efficient target towards Pan Virus) and then advances in areas, that areas could be in structural analysis, animal model development, virus-post interaction & many more in future which is unrevealed for now can pay for effective medical measurement against CCHF. Additionally, successful research with therapeutic approaches be only possible if whole endemic countries came together in collaboration to conclude productive results (Dai et al. 2021).

References Annual Epidemiological Reports for Crimean-Congo Haemorrhagic Fever (n.d.). https://www. ecdc.europa.eu/en/all-topics-z/crimean-congo-haemorrhagic-fever/surveillance-and-diseasedata/annual-epidemiological. Accessed 18 Nov 2022 Aradaib IE, Erickson BR, Mustafa ME, Khristova ML, Saeed NS, Elageb RM, Nichol ST (2010) Nosocomial outbreak of Crimean-Congo hemorrhagic fever, Sudan. Emerg Infect Dis 16(5): 837–839. https://doi.org/10.3201/EID1605.091815 Arslan S, Engin A, Aydemir EI, Sahin NO, Bayyurt B, Sari I, Cosgun Y, Bakir M (2019) Identification of potential microRNA markers related to Crimean-Congo hemorrhagic fever disease. J Cell Biochem 120(9):15506–15517. https://doi.org/10.1002/JCB.28817

352

M. Kumari et al.

Baron MD, Holzer B (2015) Nairobi sheep disease virus/Ganjam virus. Rev Sci Tech 34(2): 411–417. https://doi.org/10.20506/RST.34.2.2367 Belobo JTE, Kenmoe S, Kengne-Nde C, Emoh CPD, Bowo-Ngandji A, Tchatchouang S, Wobessi JNS, Mikangue CAM, Tazokong HR, Bebey SRK, Noura EA, Ka’e AC, Simo REG, Modiyinji AF, Ngongang DT, Che E, Kenfack S, Nzukui ND, Adjia NA et al (2021) Worldwide epidemiology of Crimean-Congo hemorrhagic fever virus in humans, ticks and other animal species, a systematic review and meta-analysis. PLoS Negl Trop Dis 15(4):e0009299. https:// doi.org/10.1371/JOURNAL.PNTD.0009299 Bertolotti-Ciarlet A, Smith J, Strecker K, Paragas J, Altamura LA, McFalls JM, Frias-Stäheli N, García-Sastre A, Schmaljohn CS, Doms RW (2005) Cellular localization and antigenic characterization of crimean-congohemorrhagic fever virus glycoproteins. J Virol 79(10):6152–6161. https://doi.org/10.1128/JVI.79.10.6152-6161.2005 Bukbuk DN, Dowall SD, Lewandowski K, Bosworth A, Baba SS, Varghese A, Watson RJ, Bell A, Atkinson B, Hewson R (2016) Serological and Virological evidence of Crimean-Congo Haemorrhagic fever virus circulation in the human population of Borno State, Northeastern Nigeria. PLOS Neglected Tropical Diseases 10(12):e0005126. https://doi.org/10.1371/ JOURNAL.PNTD.0005126 Crimean-Congo Haemorrhagic Fever (CCHF) R&D Roadmap (n.d.). https://www.who.int/newsroom/articles-detail/crimean-congo-haemorrhagic-fever-(cchf)-r-d-roadmap. Accessed 18 Nov 2022 Dai S, Deng F, Wang H, Ning Y (2021) Crimean-Congo hemorrhagic fever virus: current advances and future prospects of antiviral strategies. Viruses 13(7). https://doi.org/10.3390/V13071195 de la Calle-Prieto F, Martín-Quirós A, Trigo E, Mora-Rillo M, Arsuaga M, Díaz-Menéndez M, Arribas JR (2018) Therapeutic management of Crimean-Congo haemorrhagic fever. Enferm Infecc Microbiol Clin (English Ed) 36(8):517. https://doi.org/10.1016/J.EIMCE.2017.04.016 Elata AT, Karsany MS, Elageb RM, Hussain MA, Eltom KH, Elbashir MI, Aradaib IE (2011) A nosocomial transmission of crimean-congohemorrhagic fever to an attending physician in North Kordufan, Sudan. Virology J 8(1):1–7. https://doi.org/10.1186/1743-422X-8-303/FIGURES/4 Ergönül Ö (2006) Crimean-Congo haemorrhagic fever. 6(4):203–214. https://www.sciencedirect. com/science/article/pii/S1473309906704352. Accessed 18 Nov 2022 Erickson BR, Deyde V, Sanchez AJ, Vincent MJ, Nichol ST (2007) N-linked glycosylation of Gn (but not Gc) is important for Crimean Congo hemorrhagic fever virus glycoprotein localization and transport. Virology 361(2):348–355. https://doi.org/10.1016/J.VIROL.2006.11.023 Estrada-Peña A, de La Fuente J (2014) The ecology of ticks and epidemiology of tick-borne viral diseases. Antivir Res 108(1):104–128. https://doi.org/10.1016/J.ANTIVIRAL.2014.05.016 Fanelli A, Buonavoglia D (2021) Risk of Crimean Congo haemorrhagic fever virus (CCHFV) introduction and spread in CCHF-free countries in southern and Western Europe: A semiquantitative risk assessment. One Health (Amsterdam, Netherlands) 13:100290. https://doi.org/ 10.1016/J.ONEHLT.2021.100290 Gargili A, Estrada-Peña A, Spengler JR, Lukashev A, Nuttall PA, Bente DA (2017) The role of ticks in the maintenance and transmission of Crimean-Congo hemorrhagic fever virus: A review of published field and laboratory studies. Antivir Res 144:93–119. https://doi.org/10.1016/J. ANTIVIRAL.2017.05.010 Karaaslan E, Çetin NS, Kalkan-Yazıcı M, Hasanoğlu S, Karakeçili F, Özdarendeli A, Kalkan A, Kılıç AO, Doymaz MZ (2021) Immune responses in multiple hosts to Nucleocapsid protein (NP) of Crimean-Congo hemorrhagic fever virus (CCHFV). PLoS Negl Trop Dis 15(12): e0009973. https://doi.org/10.1371/JOURNAL.PNTD.0009973 Marriott AC, Nuttall PA (1996) Large RNA segment of Dugbenairovirus encodes the putative RNA polymerase. J Gen Virol 77(8):1775–1780. https://doi.org/10.1099/0022-1317-77-8-1775/ CITE/REFWORKS Mazzola LT, Kelly-Cirino C (2019) Diagnostic tests for Crimean-Congo haemorrhagic fever: a widespread tickborne disease. BMJ Glob Health 4(Suppl 2):1114. https://doi.org/10.1136/ BMJGH-2018-001114

13

Crimean-Congo Haemorrhagic Fever Virus: A Complete Overview

353

Papa A, Tsergouli K, Tsioka K, Mirazimi A (2017) Crimean-Congo hemorrhagic fever: tick-hostvirus interactions. Front Cell Infect Microbiol 7(MAY):213. https://doi.org/10.3389/FCIMB. 2017.00213 Shahhosseini N, Wong G, Babuadze G, Camp JV, Ergonul O, Kobinger GP, Chinikar S, Nowotny N (2021) Crimean-Congo hemorrhagic fever virus in Asia, Africa and Europe. Microorganisms 9(9):1907. https://doi.org/10.3390/MICROORGANISMS9091907 Shang Y, Smith S, Hu X (2016) Role of notch signaling in regulating innate immunity and inflammation in health and disease. Protein Cell 7(3):159–174. https://doi.org/10.1007/ S13238-016-0250-0 Shepherd AJ, Swanepoel R, Leman PA, Shepherd SP (1986) Comparison of methods for isolation and titration of Crimean-Congo hemorrhagic fever virus. J Clin Microbiol 24(4):654–656. https://doi.org/10.1128/JCM.24.4.654-656.1986 Tipih T, Burt FJ (2020) Crimean-Congo hemorrhagic fever virus: advances in vaccine development. BioResearch Open Access 9(1):137–150. https://doi.org/10.1089/BIORES.2019.0057 Treatment | Crimean-Congo Hemorrhagic Fever (CCHF) | CDC (n.d.). https://www.cdc.gov/vhf/ crimean-congo/treatment/index.html. Accessed 18 Nov 2022 Walker PJ, Widen SG, Wood TG, Guzman H, Tesh RB, Vasilakis N (2016) A global genomic characterization of nairoviruses identifies nine discrete genogroups with distinctive structural characteristics and host-vector associations. Am J Trop Med Hyg 94(5):1107–1122. https://doi. org/10.4269/AJTMH.15-0917/-/DC7/SD7.PDF Zhang X, He X, Liu Y, Zhang H, Chen H, Guo S, Liang Y (2017) MiR-101-3p inhibits the growth and metastasis of non-small cell lung cancer through blocking PI3K/AKT signal pathway by targeting MALAT-1. Biomed Pharmacother 93:1065–1073. https://doi.org/10.1016/J.BIOPHA. 2017.07.005 Zhu T, Liu H, Su L, Xiong X, Wang J, Xiao Y, Zhu Y, Peng Y, Dawood A, Hu C, Chen X, Chen H, Chen Y, Guo A (2021) MicroRNA-18b-5p downregulation favors mycobacterium tuberculosis clearance in macrophages via HIF-1α by promoting an inflammatory response. ACS Infect Dis 7(4):800–810. https://doi.org/10.1021/ACSINFECDIS.0C00650/ASSET/IMAGES/LARGE/ ID0C00650_0007.JPEG

Ebola Virus Disease: An Emerging Lethal Disease in Africa

14

Arindam Mitra, Rajoni Samadder, Asmita Mukhopadhyay, Moutusi Mistry, and Anusua Roy

Abstract

Ebola virus, a member of filovirus family, is the causative agent of Ebola Virus Disease. Since the first incidence of the disease near the Ebola River in 1976, the virus repeatedly emerged and triggered 35 outbreaks in African countries as of December 2022. The largest of the Ebola outbreak, caused by the Zaire Ebolavirus, the most lethal species of Ebola virus, has caused more than 11,000 deaths during 2014–2016. Ebola emerged in West Africa for the first time and even moved to United States and Europe during this epidemic. The recent outbreak of Ebola during 2018–2020 resulted in more than 2000 deaths in Africa. Ebola is transmitted zoonotically via animals and can also spread human to human via bodily fluids or fomites. The zoonotic transmission is thought to be caused by increasing ecological disturbances such as deforestation which might have brought animals and humans in close proximity. An improvement in

A. Mitra (✉) · A. Roy Department of Biological Sciences, School of Life Science and Biotechnology, Adamas University, Kolkata, India e-mail: [email protected] R. Samadder Department of Biological Sciences, School of Life Science and Biotechnology, Adamas University, Kolkata, India Department of Applied Microbiology, School of Bioscience and Technology, Vellore Institute of Technology, Vellore, India A. Mukhopadhyay · M. Mistry Department of Biological Sciences, School of Life Science and Biotechnology, Adamas University, Kolkata, India Department of Microbiology, Amity Institute of Microbial Technology, Amity University, Noida, India # The Author(s), under exclusive license to Springer Nature Singapore Pte Ltd. 2023 P. L. Bhukya et al. (eds.), Emerging Human Viral Diseases, Volume I, https://doi.org/10.1007/978-981-99-2820-0_14

355

356

A. Mitra et al.

healthcare facilities, surveillance, diagnosis, education and preparedness for future outbreaks among others can reduce viral outbreaks. This chapter will give an overview of the organization, potential risk of emergence and re-emergence, epidemiology, transmission, pathogenesis, clinical presentation, diagnosis and management of Ebola, a virus that can emerge again in the near future. Keywords

Ebola virus disease · Infectious diseases · Outbreak · Emerging pathogen · Zoonosis

14.1

Introduction

14.1.1 Brief History Ebola Virus Disease (EVD), an emerging viral disease with a high case-fatality rate, is caused by Ebola Virus (EBOV). Considered one of the deadliest human diseases, the mortality rate of EVD varies from 25 to 90%, depending on the strain of the virus. The first EBOV outbreak occurred in a village near the River Ebola in northern Zaire (currently in the Democratic Republic of Congo) and southern Sudan in 1976. The two simultaneous outbreaks were initially assumed to be caused by infected travelers moving from one area to other. However, it was found that these outbreaks were caused by two phylogenetically related strains of ebolaviruses, namely the Zaire Ebola virus and Sudan Ebola virus, respectively. These concurrent outbreaks were thought to be spillover events from two different reservoirs, triggered by an unknown factor. Initial searches to identify the reservoir of the virus through wildlife surveillance studies were inconclusive. Eventually, based on a large number of studies, several species of fruit bats belonging to the family Pteropodidae are thought to be the potential reservoir of the virus, or they may be involved in the emergence of the virus in a repeated manner (Leroy et al. 2005). One of the consequences of the disease is a severe fatal hemorrhagic fever, but other non-specific symptoms such as fever, headache, malaise, diarrhea, and vomiting are also common. In extreme cases, these symptoms are followed by multiorgan failure, septic shock, and death. Due to this, EVD was initially referred to as Ebola hemorrhagic fever; however, later it was found that in many cases the infection may not lead to hemorrhage and it was classified as viral hemorrhagic fevers (Mangat and Louie 2021). The virus seems to cause sudden outbreaks, disappear for a while, and reappear again. Repeated episodes of EVD were mainly concentrated in African continent spanning more than four decades.

14

Ebola Virus Disease: An Emerging Lethal Disease in Africa

357

14.1.2 Discovery and History Ebola virus was the second filovirus discovered in 1976, the first being the Marburg virus, found in Marburg, Germany, in 1967. Handling of African green monkeys was attributed to the hemorrhagic fever syndrome observed in Marburg, Germany, and Belgrade, Yugoslavia, which resulted in 32 infections, out of which 7 died in Europe. In 1976, two species of EBOV, namely Zaire ebolavirus (EBOV) and Sudan Ebolavirus (SUDV) were responsible for almost two simultaneous outbreaks of characteristic hemorrhagic fever in Yambuku (now Democratic Republic of Congo) and Nzara (now southern Sudan) (Report of a WHO/International Study Team 1978; Report of an International Commission 1978). Another strain, Reston ebolavirus (RESTV), was identified from macaques transported from the Philippines to Reston, Virginia, in 1989, currently not considered to be pathogenic to humans but highly pathogenic to non-human primates (Geisbert et al. 1992). Furthermore, in 1994, Tai forest ebolavirus (TAFV) was discovered from a single viral hemorrhagic fever in non-human primates in Cote d’Ivoire. Prior to 2010, Tai forest ebolavirus was known as Cote d’Ivoire Ebola virus, known to cause nonfatal infection in macaques. A fifth species, Bundibugyo ebolavirus (BDBV), was identified from an outbreak of human hemorrhagic fever in Bundibugyo district, Uganda, in 2007. In 2018, a sixth species of EBOV, Bombali ebolavirus (BOMV), was detected in the Bombali district in Sierra Leone. This species could be found in bats and is not known to be pathogenic in humans. Besides, a sequence of a new filovirus was obtained from dead bats in Spain named Lloviu virus and placed under the genus Cuevavirus under Filoviridae in 2011. In Africa, Marburg virus, Zaire ebolavirus, Sudan ebolavirus, and Bundibugyo ebolavirus are considered national pathogens. Of all the outbreaks, the 2014–2016 outbreak recorded the most significant number of infections and mortalities, bringing this dreaded disease to the world’s attention. There were approximately 28,000 cases and 11,000 deaths in this outbreak. Another outbreak of EVD took place in the Democratic Republic of Congo, with more than 3000 cases and 2000 deaths during 2018–2020. A recent outbreak occurred in the Democratic Republic of Congo and Guinea in February 2021. As of March 2021, there were 18 cases and nine reported deaths in Guinea.

14.2

Epidemiology

14.2.1 Geographical Distribution/Demographic Age Most cases of EVD have been detected in Africa. The virus repeatedly resurfaced in the African continent, mainly in Guinea, Sudan, Uganda, Gabon, and the Democratic Republic of Congo. During the 2014–2016 outbreak, countries in West Africa, such as Liberia, Sierra Leone, and Guinea, were also infected for the first time. This particular outbreak also saw the import of EVD in the US, Italy, Spain, the UK, Nigeria, Mali, and Senegal. Infected travelers crossing international borders were responsible for the outbreak in US and Europe during the 2014–2016 outbreak

358

A. Mitra et al.

(Poletto et al. 2014). Laboratory accidents were also responsible for a few cases in Germany, Russia, and England (Emond et al. 1977; Gunther et al. 2011). Children under 5 years are vulnerable to Ebola infections; specifically, those under 1 year are most susceptible (Gulland 2015). In contrast, ages 5–19 are less vulnerable to Ebola infections (Bower et al. 2016). In another study, it was shown that patients with ages higher than 40 have a greater probability of death compared to patients younger than 18. Also, patients with a higher viral load greater than 106 copies/ml and diarrhea are correlated with mortality (Li et al. 2016). Besides higher viral load, confusion, abdominal pain, conjunctivitis, and vomiting also indicate poor survival in patients with EVD (Ji et al. 2016). Women aged 25–64 are reported to have more significant infections in DRC as women are more likely to be caregivers in that age group (Rosello et al. 2015).

14.2.2 Mortality and Morbidity The mortality and morbidity of EVD vary with the species of EBOV causing the infection. The mortality of EVD ranged from 25 to 90%, with an average mortality of around 50%. Mortality can be as high as 90% in infections caused by Zaire ebolavirus, the deadliest of all EBOV. Zaire ebolavirus, Sudan ebolavirus, and Bundibugyo are pathogenic to humans, whereas Reston EBOV and Tai forest EBOV are not considered highly pathogenic to humans. Mortality of healthcare workers has been reported due to EVD; 1.45% in Guinea, 8.07% in Liberia, and 6.85% in Sierra Leone (Evans et al. 2015). Because of the burden of EVD in the countries mentioned above, malaria patients could not be provided proper care, which resulted in an additional 10,000 deaths (Walker et al. 2015). Antibodies of the Ebola virus were also detected in wild animals, including gorillas, chimpanzees, and other animals in Gabon, from 1994 to 2003 (Lahm et al. 2007). The case fatality rate is a ratio of mortality out of a total number of cases divided by a total number of cases and is often used as an indicator of the lethality of a microbe (Allam 2014; Kucharski and Edmunds 2014). CFR was 88% (280 mortality out of 318 cases) in DRC by Zaire ebolavirus and 53% (151 mortality out of 284 cases) in Southern Sudan by Sudan Ebolavirus during 1976. During 2014–2016, CFR was around 28%, 45%, and 67% in Sierra Leone, Liberia, and Guinea, caused by Zaire ebolavirus. A 25% and 51% CFR was reported in 2007 and 2012 caused by Bundibugyo ebolavirus in DRC and RoC, respectively. However, the case fatality rate is not an accurate predictor because of undetected cases, incomplete data on detected cases, or lack of data about confirmed cases. Furthermore, survivors from Ebola treatment units in Guinea were reported to have a higher chance of death post-infection of EVD, with the typical manifestation of renal failure (Keita et al. 2019). Table 14.1 represents CFR in various outbreaks from 1976 onwards. Apart from humans, wildlife, including gorillas and chimpanzees in African countries, has been found dead in large numbers, and EBOV could be detected in these animal carcasses (Bermejo et al. 2006; Rouquet et al. 2005).

14

Ebola Virus Disease: An Emerging Lethal Disease in Africa

359

Table 14.1 Functional roles of EBOV proteins Protein NP VP35 VP40 GP sGP

Protein name Nucleoprotein Polymerase cofactor Viral matrix protein Glycoprotein Soluble glycoprotein

ssGP

Small soluble glycoprotein Transcription activator Minor matrix protein

VP30 VP24 L

RNA-dependent RNA polymerase

Functional role Protects RNA by encapsidation of viral genome Inhibits IFN signaling and evasion of immune response Assembly and budding Attachment to host cells Modulation of host immune response; possibly pathogenesis Role not clear Transcription of the viral genome Inhibits IFN signaling and evasion of immune response; nucleocapsid assembly Transcription, regulation of the genome; mRNA editing

14.2.3 Origin of Infection and Diversity Ebola virus belongs to filoviruses, thought to have existed much before it was discovered (Suzuki and Gojobori 1997). Filoviruses sporadically infect humans and non-human primates but principally circulate among non-human hosts. The passage of EBOV in different hosts and its adaptation in appropriate hosts can contribute to EBOV spillover from animals to humans (Gale et al. 2016). Even though EVD is considered zoonotic in origin, extensive surveillance in wild animals initially failed to detect the presence of EBOV. However, as non-human primates exhibit symptoms of severe Ebola infection, they are not thought to be reservoirs of EBOV. Eventually, it is believed that from bats, the virus could amplify in other hosts such as gorillas, chimpanzees, baboons, duikers, several species of monkeys, and antelopes before it gets transmitted to humans due to proximity or butchering or eating of these animals. Later, it was widely accepted that fruit bats could serve as reservoirs of EBOV due to the presence of Ebola-specific sequences or antibodies in three species of bats (Leroy et al. 2009, 2005). However, these bats do not exhibit symptoms of Ebola infections. EBOV displayed better adaptation in African primates compared to other animals based on codon usage (Luo et al. 2020). EBOV’s molecular evolution also depends on the geographical regions where the virus was detected (Pereira-Gomez et al. 2020).

14.2.4 Spread of Disease The spread of EVS is mainly sporadic, which repeatedly emerges in Africa due to urbanization, crowding, deforestation, eating bushmeat, etc. The spread of Ebola occurs in a wave-like front, moving from northwestern to southeastern, starting from an epicenter since the 1976 outbreak (Zhang and Wang 2014). Mortality in primates due to EBOV infection increases at the end of the dry season, when the food source

360

A. Mitra et al.

becomes limiting. Crowding of bats, non-human primates, and other fruit-eating animals occurs near the limited number of fruit-bearing trees or near the fallen or partially eaten fruits, which most likely facilitate the transmission of EBOV between animals from infected to susceptible animals and also from the reservoir to secondary hosts. The chance of spillover events increases from secondary hosts to people living near the forest or in rural settings (Rewar and Mirdha 2014). Transmission of EBOV from animal to human is considered a rare event, whereas human-to-human transmission is the primary mode of spread of the EVD. Direct contact and contact with bodily fluids from infected individuals are the primary modes of human-to-human transmission. Nosocomial infections or infections spread within hospital settings due to non-sterile needles or to and from healthcare workers dealing with EVD patients are possible transmission routes. The virus is shed in bodily fluids and compartments such as blood, stool, urine, sweat, breast milk, saliva, vomit, tears, semen, cerebrospinal fluid, amniotic fluid, and aqueous humor, among others. Transmission from mother to infant via breast milk is also suggested and can lead to infant mortality (Medina-Rivera et al. 2021). Besides, unsafe burial practices and religious practices facilitate the transmission of Ebola to people close to individuals who died of EVD (Manguvo and Mafuvadze 2015).

14.2.5 Biosafety Measures The Ebola virus must be handled with extreme precautions in maximum containment as the virus can cause fatal infections, and fatal laboratory accidents have been reported [8]. EBOV is categorized under Category A priority pathogen by NIAID and Category A agent of bioterrorism by CDC. Laboratory experiments and diagnostic procedures with the virus must be done by trained personnel following a proper protocol, such as wearing a positive pressure suit with a separate air supply. Laboratories working with Ebola must have a Biosafety level 4 (BSL-4) facility, the highest Biosafety levels, and relevant approval from regulatory agencies. Inactivation of the virus can be done in a BSL-3 facility, depending on the protocol, and once inactivated, the specimen can be handled in a BSL-2 facility. Specific proteins and cDNA of the EBOV genome can also be held in a BSL-2 facility. Ebola healthcare workers or caregivers are particularly at risk. However, proper use of personal protective equipment and exposure precautions can reduce the transmission in healthcare settings. Wherever necessary, appropriate signs and symbols must be posted indicating the level of biosafety or biohazard.

14.3

Potential Risk of Emergence and Re-emergence

EBOV is considered an emergent and re-emergent disease of significant public health concern (Rojas et al. 2020). After the 1976 outbreak in DRC, strains of Zaire ebolavirus emerged and remerged repeatedly in 1977, 1994, 1995, 1996, 2002–2003, 2005, 2007, 2008–2009 and 2014–2016, 2017, 2018–2020 in Africa

14

Ebola Virus Disease: An Emerging Lethal Disease in Africa

361

Fig. 14.1 Mortality due to outbreaks of Ebola in Africa during 1976–2020

(Baize et al. 2014; Grard et al. 2011). Figure 14.1 summarizes the repeated emergence and mortality due to EVD during the last four decades in Africa. Repeated emergence of EVD could be either due to a sequential shedding of virus from an infected reservoir host or due to transmission of the virus to reservoir animal during a migration event. However, surveillance of wild animals for EBOV near the site of the outbreak may not pinpoint the reservoir or secondary animals of the possible zoonotic infection (Gryseels et al. 2020). Recently, it has been demonstrated that EBOV may persist in survivors in a latent state for years and can potentially lead to a new transmission and outbreak (Chertow 2019). The sequence of Ebola virus isolated from an EVD survivor during the 2014–2016 outbreak matches that of an EBOV responsible for a recent outbreak in Guinea in February 2021 (Kupferschmidt 2021). This report indicates that Ebola can persist for years, and then it can infect again sometimes in the future under the appropriate conditions. Several factors, such as social, genetic, economic, anthropogenic, healthcare, ecological, and climate, are responsible for the periodic emergence of EVD in Africa (Redding et al. 2019).

14.4

Organization of Infectious Agents

14.4.1 Classification Before 1971, due to the lack of evidence and evolutionary history, the virus classification was complex. In 1974, the current classification system for viruses by the International Committee on Taxonomy of Viruses (ICTV) (Lefkowitz et al.

362

A. Mitra et al.

Fig. 14.2 Classification scheme of Ebolavirus

2018) came into existence. This system classifies viruses based on their biological and genetic characteristics and ranks the virus according to their order, family, genus, and species. This committee maintains the universal nomenclature of viruses. The Baltimore classification of viruses is based on the type of genetic material incorporated in the virion. Ebola virus comes under the class V group of Baltimore classes, including negative-sense RNA strand (Kuhn 2021). Ebola virus belongs to the order Mononegavirales with eleven families, family Filoviridae with five genera, and genus Ebolavirus with six species, named from the region they were first detected: Zaire ebolavirus (EBOV), Bundibugyo ebolavirus (BDBV), Reston ebolavirus (RESTV), Sudan ebolavirus (SUDV), Taï Forest ebolavirus (TAFV), and Bombali ebolavirus (BOMV). The classification of Ebolavirus is listed in Fig. 14.2.

14.4.2 Virion Structure and Morphology Under transmission electron microscopy, the virus appears like a thread with variable shapes (Ellis et al. 1978). The virion is around 80 nm wide and can be up to 14 mm long. In general, the shape of the virus is long and filamentous with occasional branches, which places them under the genus Filoviridae, defined by its characteristic filament appearance. Other forms include cylindrical, tubular, “6”, “U”, circular, and hairpin can also be detected. The shape of the virion may vary at different stages of the life cycle, giving the virus a pleomorphic appearance (Kiley et al. 1980). The central core of the Ebola virus has nucleoprotein in which the genetic material is wound and covered by ribonuclear protein complex (RNP) called Nucleocapsid. The virus has an outer covering of glycoprotein (GP) with 7–10 spikes at an interval of 10 nm protruding out of the lipid membrane of the virus (Matua et al. 2015).

14

Ebola Virus Disease: An Emerging Lethal Disease in Africa

363

14.4.3 Genome Structure and Organization The genome of EBOV consists of enveloped, linear, non-segmented, negative-sense, single-stranded RNA of nearly 19 kb in length. The genome comprises seven genes that encode at least nine proteins (Muhlberger 2007). The genome is organized in the following linear order: nucleoprotein (NP), viral proteins, polymerase cofactor (VP35), matrix protein (VP40), glycoprotein (GP), soluble glycoprotein (sGP), small soluble glycoprotein (ssGP), transcription activator (VP30), minor matrix protein (VP24), and RNA-dependent RNA polymerase (L) (Elliott et al. 1985). A schematic representation of the genome is given in Fig. 14.3. Neither the 3′ end of the EBOV genome is polyadenylated, nor the 5′ end is capped and free. However, the transcripts are polyadenylated at the 3′ end and capped at the 5′ end. A 3′ leader and 5′ trailer sequence regulate the replication and transcription. The length and composition of intergenic regions vary in EBOV, and genes can overlap at different positions. Each gene in the EBOV genome is flanked by an untranslated genome (UTRs). Boundaries of genes have conserved transcriptional initiation and termination signals. Seven genes are responsible for the host’s viral replication, transcription, translation, and infection. Nucleoprotein (NP) is an RNA-binding protein that assists in the encapsidation of the viral genome. Each subunit of NP binds to several RNA bases, usually 6–10 bases, generating multiple subunits of NP enclosing bits of the genome and protecting it. The glycoprotein (GP) encodes three different products due to co-transcriptional mRNA editing by-products of the L gene. GP, also referred to as spike protein, is responsible for attachment, penetration, infection, and interacting with more than one receptor of the host, causing inflammation, cell damage, and cytotoxicity in the host (Davey et al. 2017). One truncated GP product is soluble glycoproteins GP (sGP), considered crucial for immunomodulation of host cells and pathogenesis (Zhu et al. 2019). The role of ssGP is not yet clear. The glycoprotein is usually a target for vaccine development (Dash et al. 2017; Kasereka et al. 2021). Minor matrix protein (VP24) is a structural protein associated with the membrane. VP24 inhibits IFN signaling and is responsible for shielding EBOV from cellular immune response (Fanunza et al. 2019). VP24 is also crucial for the assembly of nucleocapsids (Mateo et al. 2011). The viral matrix protein (VP40) plays a pivotal role in viral budding and assembly and regulates replication and transcription of the viral genome (Hartlieb and Weissenhorn 2006; Hoenen et al. 2010). Like VP24, the polymerase cofactor (VP35) inhibits IFN signaling and avoids immune response (Fanunza et al. 2019; Zinzula and Tramontano 2013). VP35 is also a critical determinant of viral pathogenesis and regulates transcription (Messaoudi et al.

Fig. 14.3 Genome organization of EBOV

364

A. Mitra et al.

2015). The RNA-dependent RNA polymerase (L) catalyzes viral RNA transcription, polyadenylation, capping, mRNA editing, and genome regulation (Jamin and Yabukarski 2017; Paesen et al. 2015). The roles of these EBOV proteins are highlighted in Table 14.1.

14.4.4 Viral Protein and Life Cycle The viral life cycle includes the multiple steps inside the host cell to produce progeny virus and requires the engagement of several proteins in different life cycle stages (Yu et al. 2017). The virus’s life cycle includes entry, replication, and exit or budding out. The entrance consists of attachment and penetration of the virus, following uncoating. The second step comprises the viral genome replication using the host machinery, and the final step includes packaging and budding out of the host. GP mediates the Ebola virus (EBOV) attachment to the host cells, expressed on the surface of EBOV. The virus has different types of GPs with distinct roles. The glycoprotein is synthesized as a precursor to pre-GP (or GP0); after post-translation processing, the pre-GP precursor is cleaved by furin into extracellular GP1 and GP2 transmembrane, subunits that are connected by a disulfide bridge. Another transcriptional editing site in the GP gene expresses additional proteins such as soluble glycoprotein (sGP), delta peptide, and small soluble glycoprotein (ssGP). GP1 protein is divided into three domains; receptor-binding domain (RBD), glycan cap, and mucin-like domain (MLD). RBD helps GP1 bind to multiple receptors. The glycan cap protects the GP1 from antibody interaction, forms a loop with GP2 transmembrane, and evades premature fusion of GP2. The MLD domain works as a shield to GP1 from immune recognition of the host. Attachment is mediated by GP1 protein of EBOV with asialoglycoprotein receptor on hepatocytes (Simmons et al. 2003). Recent studies have demonstrated that lipid rafts are essential for mediating the attachment of EBOV to host cells (Jin et al. 2020). The process of macropinocytosis mediates the virus’s entry after binding the GP1 receptor with the host cell receptor (Aleksandrowicz et al. 2011; Mulherkar et al. 2011). This initiation leads to the formation of macropinosomes in the plasma membrane, followed by internalization and penetration of the EBOV. Proteins involved in autophagy are thought to play a role in macropinocytosis (Florey et al. 2011). During macropinocytosis, several endocytic enzymes, cholesterol, and GTPases play an essential role in EBOV GP-dependent signaling or transduction (Aleksandrowicz et al. 2011). Inside the macropinosome (endosome), the enzymatic activity of cathepsin cleaves the GP of EBOV, followed by a change in the pH to 5.7 in the early endosome, while the cleavage of the GP inside the endosome is independent of the pH. The acidic condition of macropinosome triggers GP to become activated to bring conformational change that leads to fusion (Sakurai 2015). The EBOV follows the endolysosomal pathway after internalization and is trafficked through early and late endosomes. The intermediate steps of trafficking are still unknown (Saeed et al. 2010). GP2 mediates the uncoating and fusion of the

14

Ebola Virus Disease: An Emerging Lethal Disease in Africa

365

EBOV. GP2 is known as the viral I fusion protein. GP2 of EBOV has five domains; fusion loop, C terminal heptad region, N terminal heptad region, a transmembrane region, and cytoplasmic region. The fusion loop of GP2 is inserted into the endosomal membrane and initiates membrane fusion. Several unknown enzymes are also responsible for triggering the fusion. The exposure of genetic material of EBOV into the cytoplasm is facilitated by uncoating. Endosomal protein NiemannPick C1 (NPC1) acts as cholesterol transporter in the host’s cell membrane and is one of the endosomal receptors of EBOV responsible for fusion and entry (Cote et al. 2011). GP2 of EBOV binds with the C domain of NPC1 and brings a conformational change in GP2 in the N-terminal that facilitates membrane fusion (Carette et al. 2011). Subsequently, each gene of the EBOV undergoes capping and polyadenylation and then undergoes translation with help host ribosome to produce protein. The molecular mechanism by which VP35 releases RNA from RNP is still unknown. VP30 plays an important role in the transcription of the genome of EBOV. Once enough VP proteins and ssRNAs are transcribed, then the VP35, NP, and L proteins induce the viral genome replication, followed by the generation of antigenomic RNA consisting of positive-stranded RNA from which negative-stranded RNA are produced and then encapsulated by VP35, NP, VP30, and VP24. The exit is divided into two steps, assembly and budding or release. NP, VP24, GP, and VP40 play important role in both the steps, assembly and budding. Assembly involves the formation of Nucleocapsid, which is synthesized at first in the perinuclear space and then transported to the budding site in the plasma membrane. GP protein is involved in particle formation along with VP40, before that GP gets synthesized in the endoplasmic reticulum and then transported to the plasma membrane via Golgi apparatus. GP undergoes post-transitional modification called acylation. While VP24 contributes to assembly, NP assembles in helical tubes and forms a nucleocapsid-like structure with VP24 and VP35; VP40 mediates the transportation to the cell surface via microtubules. Finally, the virion in Nucleocapsid is incorporated into the virion by NP-VP40 interaction. VP40 plays a major role in interacting with the inner leaflet during budding (Pleet et al. 2017). VP40 has two domains, which bind with the specific receptor of the plasma membrane with a formation of virus-like particles and bud out from plasma membrane (Jasenosky et al. 2001). VP40 undergoes oligomerization probably as hexamer and localizes in the plasma membrane’s inner leaflet. The hydrophobic part of VP40 helps penetrate and lock inside the plasma membrane. GP2 and tetherin also play a major role in budding. Tetherin is a host cell transmembrane protein that induces virion retention or prevents diffusion of the viral particle after budding (Kupzig et al. 2003). GP antagonizes the mechanism of tetherin by blocking the interaction of VP40 with tetherin (Gustin et al. 2015; Lopez et al. 2010).

366

14.5

A. Mitra et al.

Pathogenesis in Humans, Host Viral Interaction Host Immune Response

14.5.1 Pathogenesis of Ebola Virus in Humans Ebola virus enters the human body via mucosal membranes, abrasions, and injuries in the skin, typically via infected body fluids that allow direct entry of the virus to the targeted cells or by direct parental transmission. Typical early symptoms of EBOV include high fever, malaise, and fatigue. Before the onset of the symptoms, these infected cells pass through the lymphatic vessels to lymph nodes and nodal chains, where viral RNA replication and dissemination occur. The fever stays for 0–3 days, and gastrointestinal symptoms gradually start, including nausea, vomiting, chest pain, diarrhea, and abdominal pain for 5–10 days. If symptoms like vomiting and diarrhea appear severely within 2 or 3 days, the person has the highest risk of getting affected by EVD. The virus’s incubation period and symptoms’ appearance can take 2–21 days. Symptoms are categorized based on severity; an early non-specific ailment such as fever, myalgia, and headache; a second phase characterized by gastrointestinal ailments such as diarrhea, vomiting, dehydration, and pain in the abdomen. A reduction in liver and kidney marks the final phase function with impairment of metabolism and results in convulsions, shock, and death due to multiple organ failures (Furuyama and Marzi 2019). Replication of EBOV inside the host is associated with pathologies such as immune disorders, blood coagulation, and cell and tissue damage due to direct viral invasion or indirect host-mediated effectors. EBOV, after internalized, targets many other organs and invades almost all human cells using different attachment mechanisms except the case of lymphocytes. Necrosis of hepatocytes with distinct inclusions of viral nucleocapsids is observed. Viral antigens and inclusions are also observed within alveolar macrophages. Necrosis of the spleen and depletion of lymph is also detected post-EBOV infection (Martines et al. 2015). Viral RNA is transcribed and translated into viral proteins such as GP, NP, VP24, VP35, VP40, and L by host machinery, allowing viral genome replication.

14.5.2 The Host Cell Pathology Parenchymal cells of different organs, such as liver, kidney, spleen and lymph nodes, and blood vessels, get infected due to necrosis caused by virions. A broad spectrum of diseases seems to occur after transmission of the virus. Symptoms like a multiorgan failure, dysregulated organ system, vascular diseases, and coagulation impairment lead to the individual’s death within 10 days after the onset of the symptoms. Viremia can be detected in the blood. In several cases, viremia reaches high levels as 10^6 plaque-forming units.

14

Ebola Virus Disease: An Emerging Lethal Disease in Africa

367

14.5.3 Ebola Virus Gene Products Functions and Host Interactions NP is an essential component of Nucleocapsid. VP35 is the component of Nucleocapsid, L polymerase cofactor, which helps in ssRNA packaging and interferon suppression. This targets innate immune response, and interacts with cellular kinases IKKs and TBK-1. Aggregates as the plasma membrane of the host cell until the other components are produced and the virion is ready to bud. As for GP, there are two separate glycoproteins, GP and sGP. GP forms spikes on the outer envelope of the virion, required for viral cellular entry and cell fusion protein. sGP is secreted from the host cell. GP interacts by binding cell lectins, and interacts with Niemon-Pick C1. sGP helps in modulation of host immunity. VP30 is another component of nucleoplasmin. It blocks IFN-α/β + IFN-γ signaling, causes immune dysregulation, and also interacts with endosomal trafficking protein. RNA replicase (L) is solely needed for transcription and translation of the viral genome.

14.5.4 Host Immune Response Innate immunity receptors include TLRs (toll like receptors), NLRs (NOD-like receptors), and RLRs (RIG-1 like receptors). These receptors are germline encoded and they do not undergo gene rearrangement. RIG-1 (retinoic acid inducible gene I) like helicases and TLRS recognizes nucleotides from RNA viruses which triggers the signals that induce anti-viral mediators like type I interferons (IFNs) and pro-inflammatory cytokines. Cytokines bind receptors on another cell. IFNs that are produced by infected cells produce several cellular proteins which have antiviral activities. In many viral infections, innate immunity cannot handle viral infections, only then the adaptive defences are induced to mobilize the host survival. The adaptive defence systems include antibiotics and lymphocytes, required for destruction of viruses and are often known as humoral response. Innate and adaptive immune system work together to fight against the virus but in some cases, they are unable to kill the disease-causing viruses.

14.5.4.1 Innate Immune Response The first targets of the virus are the macrophages and the DCs because they are present at the site of infection which accounts for innate immune dysregulation causing acute EBOV infection. In case of macrophage, secretion of pro-inflammatory cytokines such as IL-6, TNF, IFN-β, production of tissue factor as well as vasoactive peptides increases during the emergence of disease. Activation of macrophages is due to GP and sometimes due to the involvement of TLR-4. In murine models, GP induces the production of TLR-4 which triggers the hypersecretion of macrophage inflammatory protein, TNF, IL-1β, IL-6, IFN-γ, IL-2, IL-4, IL-12p70, IL-10, reactive oxygen species and nitrogen radicals, creating a cytokine storm which results in blood vessel damage. However, TLR-4 inhibits the migration of macrophages to lymph nodes and hypersecretion of cytokines, which decreases the lethality of the infection. In animal models, such as non-human primates (NHPs),

368

A. Mitra et al.

the overproduction of TNF has been linked to lymphocyte apoptosis, resulting in lymphopenia, a symptom also observed in EBOV disease. In case of DC, VP35 and VP24 activate the DCs after the viral infection occurs. VP30 obstructs the production of type I IFN by DCs by blocking the anti-viral sensing RIG-I like receptors. On the other hand, IFN-I activates IFN receptor bearing cells and leads them to STAT1. IFN signature genes are activated by STAT1. IFN signature genes are the genes associated with anti-viral immune response. VP24 is the inhibitor of STAT1 that prevents translocation of STAT1 as well as signaling of IFN I. This defects the system of IFN signaling thus preventing DC maturation and an inability to catch up adaptive immune system. Finally, in neutrophils, GPs bind to the Fc receptor of the neutrophils which causes netosis. Netosis results in tissue damage, probably responsible for autoimmune-like symptoms.

14.5.4.2 Adaptive Immune Response Ebola virus alters the connection between innate and adaptive immune system. When innate and humoral immunity works together in our body, it provides complete protection against viruses. Long lasting antibody responses help in recovery against infections. Hormonal T cells after activation undergo metabolic transformation and start secreting various cytokines which play an important role in the conversion of B cells into antibody secreting plasma cells. These antibodies then bind to the viral antigen and remove them from the host. But in case of EBOV, the antigen presenting cells (APCs) delay the antibody response and lower the B-cell frequency so that the virus does not get out of the host. When EBOV disease survivals and fatalities were compared, it showed that levels of EBOV-specific IgG and IgM predicted the viral control, and the humoral response supports a good cellular response. The levels of IgM were low and EBOV-specific IgG could not be detected in fatal cases. High level of antibodies was detected in survivors who persists over time and confers protection.

14.5.5 Evasion of the Immune System EBOV utilizes multiple mechanisms to evade the host immune system. VP24 inhibits IFN signaling by preventing the dimerization of tyrosine kinases and nuclear translocation of signal transducer and activator of transcription 1 (STAT1). VP35 has an IFN inhibitory domain that binds with dsRNA in host cells and prevents it from binding to RIG-I. VP35 prevents maturation of dendritic cells to prevent upregulation of MHCI and MHCII and the co-stimulatory molecules CD40, CD80, CD86, impairs antigen binding to CD8+ and CD4+ T cells and T-cell activation which results in linkage of the adaptive and innate responses. sGP, binds EBOV neutralizing antibodies and impairs humoral immune response. Gp also plays a role by inducing cytotoxicity and injury in epithelial cells.

14

Ebola Virus Disease: An Emerging Lethal Disease in Africa

14.6

369

Diagnosis and Therapy

Diagnosis of infectious diseases is crucial for containing outbreaks. Early and accurate detection of EBOV is crucial for identification, isolation, contact tracing, and control of the EVD in a time-bound manner. A delay or inaccurate identification of EVD could hinder responses to control the transmission at the local, national, or international level (Strong and Feldmann 2017). Choice of diagnostic method relies on sensitivity, specificity, and cost for any EVD diagnosis. Major challenges for the development of diagnostic method and initial diagnosis are mostly restricted to highly biocontainment BSL-4 laboratories in government and defense organizations. Newer point of care and molecular detection methods were developed and tested post the 2014–2016 epidemic as this epidemic gained the attention of the disease in a global scale (Pollock and Wonderly 2017). Prior to the 2014, diagnosis mostly relied on clinical symptoms and isolation of contacts by use of infection control and epidemiological techniques. Detection of antibody titers in the blood following EBOV infection is not very useful in the management of EVD as antibody levels could be detected approximately in 3 weeks’ time and also due to some percentages of healthy population who are IgG-positive. Hence, detection of viral antigens or nucleic acids by molecular methods is more reliable. EVD is primarily diagnosed via Polymerase Chain Reaction (PCR) and serology-based methods. The serological test detects specific anti-EVD immunoglobulin G (IgG) and immunoglobulin M (IgM) antibodies by Enzyme-linked immunosorbent assay (ELISA). Table 14.2 lists some of the techniques used for the detection of EBOV. Clinical diagnosis is not always accurate as it relies on non-specific symptoms exhibited in other diseases such as typhoid and malaria. WHO approved the first PCR-based diagnostic of L gene in 2014, but the method required the extraction of EBOV RNA from blood and transportation of the kit in frozen condition to the field (Bhadelia 2015; Panning et al. 2007). This necessitates the development of a rapid Table 14.2 Diagnostic tools for detection of EBOV Technique Antigen ELISA Polymerase chain reaction Fluorescence assay

Sample source Blood and serum Blood, tissue, and serum Tissue

ELISA (enzyme-linked immunosorbent assay) Immunoblot

Serum

Immunohistochemistry

Skin and liver tissue Serum

Indirect immunofluorescence assay

Serum

Target Viral antigen Viral nucleic acid Viral antigen Virus-specific antibody Virus-specific antibody Viral antigen Virus-specific antibody

Limits of detection 30 ng of recombinant NP Range from 104 to 1010 per reaction Qualitative imaging method 20 ng of EBOV Qualitative assay Qualitative imaging method Qualitative imaging method

370

A. Mitra et al.

point of care detection based on an immunochromatographic assay that detects VP40 antigen from serum, plasma, and blood, a lateral flow and that had been approved by WHO (Boisen et al. 2016; Olschlager and Hess 2015).

14.7

Prevention and Management of EVD

Although control of diseases is focused on preventing the transmission and spread of virus, several approaches like early case identification, clinical management, health education, safe burial practices, rapid isolation of suspected infected practices, and hygiene maintenance are employed. Early case identification is essential to prevent transmission, which would require reinforcement of surveillance systems for early identification of suspects in high-risk areas. Surveillance systems in the national laboratories should be able to rapidly and reliably detect the EVD using state-of-theart technologies. Isolation of the affected people is done quickly to control the outbreak of the disease, and isolated people can be taken care of and monitored in appropriate settings such as Ebola Treatment Centers (ETCs). ETCs should be near the affected communities and operate with a transparent policy. Recently, individual treatment units, such as biosecurity emergency rooms have been developed during the 2018 Democratic Republic of Congo epidemics. Traditional burial ceremonies with safety precautions contributed to effectively controlling the disease. Health campaigns and educational activities help the community to recognize EBOV disease cases and act appropriately. In addition, these activities overcome cultural beliefs and practices that challenge disease control. Several prevention programs developed by PAHO (Pan American Health Organization)/WHO (World Health Organization) prevent transmission and include several protocols for environmental cleaning and disinfection, hand hygiene, use of disinfectants, decontamination, and proper use of personal protective elements for health professionals and caregivers, and safe handling of contaminated materials or biomedical wastes. In addition to preventing hemorrhages, some anticoagulants, including recombinant nematode anticoagulant protein C2 (rNAPc2), can be used. The expected and confirmed cases of EVD should be kept under regular quantification of biochemical boundary, including electrolyte balance, which can stop renal failure. At the same time, the mortality rate can be decreased by the availability of oxygen, renal replacement, and proper ventilation to severely ill patients. Organization such as “Translators without Borders,” with a proven record of facilitating the communication of public health measures in local languages, implements the proposed standards effectively. Population resistance can result in vast outbreaks.

14.8

Future Perspectives

Rapid diagnostic tests and proper reporting in a time-bound manner is important for containing the outbreak of EVD. Increased surveillance for EBOV in animals is on the rise due to concerted multi-country efforts to control EVD; however, more efforts

14

Ebola Virus Disease: An Emerging Lethal Disease in Africa

371

are required in this regard. Resource constraints, weak healthcare services, and poor patient to physician ratio are some barriers to reducing the burden of EVD. An interesting study identified that antibody levels in Ebola survivors would peak and fall long after the infection and suggested that viral antigens in those survivors would also increase and decrease over time (Woolsey and Geisbert 2021). A defined nutritional support in Ebola Treatment Units or an optimal nutritional requirement for Ebola patients is currently lacking, and the focus should be on standardizing the nutritional requirement of EVD patients (Ververs and Gabra 2020; Ververs and Vorfeld 2021). Virus threshold values Ct from patients with acute EBOV can be used as an early predictor for high-risk transmission in households and communities for investigations and control of EVD (Reichler et al. 2020). A recent rapid diagnostic test using a fever panel test could detect EBOV with high specificity and sensitivity and suggested possible point-of-care usage of such tests in outbreaks (Moran et al. 2020).

References Aleksandrowicz P, Marzi A, Biedenkopf N, Beimforde N, Becker S, Hoenen T, Feldmann H, Schnittler HJ (2011) Ebola virus enters host cells by macropinocytosis and clathrin-mediated endocytosis. J Infect Dis 204(Suppl 3):S957–S967. https://doi.org/10.1093/infdis/jir326 Allam MF (2014) Ebola hemorrhagic fever: case fatality rate 90%? Cent Eur J Public Health 22(3): 207. https://doi.org/10.21101/cejph.a4070 Baize S, Pannetier D, Oestereich L, Rieger T, Koivogui L, Magassouba N, Soropogui B, Sow MS, Keita S, De Clerck H, Tiffany A, Dominguez G, Loua M, Traore A, Kolie M, Malano ER, Heleze E, Bocquin A, Mely S, Raoul H, Caro V, Cadar D, Gabriel M, Pahlmann M, Tappe D, Schmidt-Chanasit J, Impouma B, Diallo AK, Formenty P, Van Herp M, Gunther S (2014) Emergence of Zaire Ebola virus disease in Guinea. N Engl J Med 371(15):1418–1425. https:// doi.org/10.1056/NEJMoa1404505 Bermejo M, Rodriguez-Teijeiro JD, Illera G, Barroso A, Vila C, Walsh PD (2006) Ebola outbreak killed 5000 gorillas. Science 314(5805):1564. https://doi.org/10.1126/science.1133105 Bhadelia N (2015) Rapid diagnostics for Ebola in emergency settings. Lancet 386(9996):833–835. https://doi.org/10.1016/S0140-6736(15)61119-9 Boisen ML, Cross RW, Hartnett JN, Goba A, Momoh M, Fullah M, Gbakie M, Safa S, Fonnie M, Baimba F, Koroma VJ, Geisbert JB, McCormick S, Nelson DK, Millett MM, Oottamasathien D, Jones AB, Pham H, Brown BL, Shaffer JG, Schieffelin JS, Kargbo B, Gbetuwa M, Gevao SM, Wilson RB, Pitts KR, Geisbert TW, Branco LM, Khan SH, Grant DS, Garry RF (2016) Field validation of the ReEBOV antigen rapid test for point-of-care diagnosis of Ebola virus infection. J Infect Dis 214(suppl 3):S203–S209. https://doi.org/10.1093/infdis/jiw261 Bower H, Johnson S, Bangura MS, Kamara AJ, Kamara O, Mansaray SH, Sesay D, Turay C, Checchi F, Glynn JR (2016) Exposure-specific and age-specific attack rates for Ebola virus disease in Ebola-affected households, Sierra Leone. Emerg Infect Dis 22(8):1403–1411. https:// doi.org/10.3201/eid2208.160163 Carette JE, Raaben M, Wong AC, Herbert AS, Obernosterer G, Mulherkar N, Kuehne AI, Kranzusch PJ, Griffin AM, Ruthel G, Dal Cin P, Dye JM, Whelan SP, Chandran K, Brummelkamp TR (2011) Ebola virus entry requires the cholesterol transporter Niemann-Pick C1. Nature 477(7364):340–343. https://doi.org/10.1038/nature10348 Chertow DS (2019) Understanding long-term effects of Ebola virus disease. Nat Med 25(5): 714–715. https://doi.org/10.1038/s41591-019-0444-0

372

A. Mitra et al.

Cote M, Misasi J, Ren T, Bruchez A, Lee K, Filone CM, Hensley L, Li Q, Ory D, Chandran K, Cunningham J (2011) Small molecule inhibitors reveal Niemann-pick C1 is essential for Ebola virus infection. Nature 477(7364):344–348. https://doi.org/10.1038/nature10380 Dash R, Das R, Junaid M, Akash MF, Islam A, Hosen SZ (2017) In silico-based vaccine design against Ebola virus glycoprotein. Adv Appl Bioinform Chem 10:11–28. https://doi.org/10. 2147/AABC.S115859 Davey RA, Shtanko O, Anantpadma M, Sakurai Y, Chandran K, Maury W (2017) Mechanisms of filovirus entry. Curr Top Microbiol Immunol 411:323–352. https://doi.org/10.1007/82_2017_ 14 Elliott LH, Kiley MP, McCormick JB (1985) Descriptive analysis of Ebola virus proteins. Virology 147(1):169–176. https://doi.org/10.1016/0042-6822(85)90236-3 Ellis DS, Simpson IH, Francis DP, Knobloch J, Bowen ET, Lolik P, Deng IM (1978) Ultrastructure of Ebola virus particles in human liver. J Clin Pathol 31(3):201–208. https://doi.org/10.1136/ jcp.31.3.201 Emond RT, Evans B, Bowen ET, Lloyd G (1977) A case of Ebola virus infection. Br Med J 2(6086):541–544. https://doi.org/10.1136/bmj.2.6086.541 Evans DK, Goldstein M, Popova A (2015) Health-care worker mortality and the legacy of the Ebola epidemic. Lancet Glob Health 3(8):e439–e440. https://doi.org/10.1016/S2214-109X(15) 00065-0 Fanunza E, Frau A, Corona A, Tramontano E (2019) Insights into Ebola virus VP35 and VP24 interferon inhibitory functions and their initial exploitation as drug targets. Infect Disord Drug Targets 19(4):362–374. https://doi.org/10.2174/1871526519666181123145540 Florey O, Kim SE, Sandoval CP, Haynes CM, Overholtzer M (2011) Autophagy machinery mediates macroendocytic processing and entotic cell death by targeting single membranes. Nat Cell Biol 13(11):1335–1343. https://doi.org/10.1038/ncb2363 Furuyama W, Marzi A (2019) Ebola virus: pathogenesis and countermeasure development. Annu Rev Virol 6(1):435–458. https://doi.org/10.1146/annurev-virology-092818-015708 Gale P, Simons RR, Horigan V, Snary EL, Fooks AR, Drew TW (2016) The challenge of using experimental infectivity data in risk assessment for Ebola virus: why ecology may be important. J Appl Microbiol 120(1):17–28. https://doi.org/10.1111/jam.12973 Geisbert TW, Jahrling PB, Hanes MA, Zack PM (1992) Association of Ebola-related Reston virus particles and antigen with tissue lesions of monkeys imported to the United States. J Comp Pathol 106(2):137–152. https://doi.org/10.1016/0021-9975(92)90043-t Grard G, Biek R, Tamfum JJ, Fair J, Wolfe N, Formenty P, Paweska J, Leroy E (2011) Emergence of divergent Zaire Ebola virus strains in Democratic Republic of the Congo in 2007 and 2008. J Infect Dis 204(Suppl 3):S776–S784. https://doi.org/10.1093/infdis/jir364 Gryseels S, Mbala-Kingebeni P, Akonda I, Angoyo R, Ayouba A, Baelo P, Mukadi DB, Bugentho E, Bushmaker T, Butel C, Calvignac-Spencer S, Delaporte E, De Smet B, Dux A, Edidi-Atani F, Fischer R, Kahandi C, Kapetshi J, Sumba SK, Kouadio L, Bendeke AM, Mande C, Sepolo GM, Moudindo J, Ngole EM, Musaba P, Mutombo P, Bass IN, Nebesse C, Ngoy S, Kumogo SN, Seifert SN, Tanzito J, Akaibe D, Amundala N, Arien KK, Gembu GC, Leendertz FH, Leirs H, Mukinzi JC, Munster V, Muyembe-Tamfum JJ, Peeters M, Verheyen E, Ahuka-Mundeke S (2020) Role of wildlife in emergence of Ebola virus in Kaigbono (Likati), Democratic Republic of the Congo, 2017. Emerg Infect Dis 26(9):2205–2209. https://doi.org/ 10.3201/eid2609.191552 Gulland A (2015) Ebola mortality is highest among babies, finds study. BMJ 350:h1718. https:// doi.org/10.1136/bmj.h1718 Gunther S, Feldmann H, Geisbert TW, Hensley LE, Rollin PE, Nichol ST, Stroher U, Artsob H, Peters CJ, Ksiazek TG, Becker S, ter Meulen J, Olschlager S, Schmidt-Chanasit J, Sudeck H, Burchard GD, Schmiedel S (2011) Management of accidental exposure to Ebola virus in the biosafety level 4 laboratory, Hamburg, Germany. J Infect Dis 204(Suppl 3):S785–S790. https:// doi.org/10.1093/infdis/jir298

14

Ebola Virus Disease: An Emerging Lethal Disease in Africa

373

Gustin JK, Bai Y, Moses AV, Douglas JL (2015) Ebola virus glycoprotein promotes enhanced viral egress by preventing Ebola VP40 from associating with the host restriction factor BST2/ Tetherin. J Infect Dis 212(Suppl 2):S181–S190. https://doi.org/10.1093/infdis/jiv125 Hartlieb B, Weissenhorn W (2006) Filovirus assembly and budding. Virology 344(1):64–70. https://doi.org/10.1016/j.virol.2005.09.018 Hoenen T, Jung S, Herwig A, Groseth A, Becker S (2010) Both matrix proteins of Ebola virus contribute to the regulation of viral genome replication and transcription. Virology 403(1): 56–66. https://doi.org/10.1016/j.virol.2010.04.002 Jamin M, Yabukarski F (2017) Nonsegmented negative-sense RNA viruses-structural data bring new insights into Nucleocapsid assembly. Adv Virus Res 97:143–185. https://doi.org/10.1016/ bs.aivir.2016.09.001 Jasenosky LD, Neumann G, Lukashevich I, Kawaoka Y (2001) Ebola virus VP40-induced particle formation and association with the lipid bilayer. J Virol 75(11):5205–5214. https://doi.org/10. 1128/JVI.75.11.5205-5214.2001 Ji YJ, Duan XZ, Gao XD, Li L, Li C, Ji D, Li WG, Wang LF, Meng YH, Yang X, Ling BF, Song XA, Gu ML, Jiang T, Koroma SM, Bangalie J, Duan HJ (2016) Clinical presentations and outcomes of patients with Ebola virus disease in Freetown, Sierra Leone. Infect Dis Poverty 5(1):101. https://doi.org/10.1186/s40249-016-0195-9 Jin C, Che B, Guo Z, Li C, Liu Y, Wu W, Wang S, Li D, Cui Z, Liang M (2020) Single virus tracking of Ebola virus entry through lipid rafts in living host cells. Biosaf Health 2(1):25–31. https://doi.org/10.1016/j.bsheal.2019.12.009 Kasereka MC, Mumtaz Z, Hawkes MT (2021) Recombinant vesicular stomatitis virus expressing Ebola virus glycoprotein (rVSV-EBOV), a new Ebola vaccine. Drugs Today (Barc) 57(1): 27–45. https://doi.org/10.1358/dot.2021.57.1.3233361 Keita M, Diallo B, Mesfin S, Marega A, Nebie KY, Magassouba N, Barry A, Coulibaly S, Barry B, Balde MO, Pallawo R, Sow S, Bah AO, Balde MS, Van Gucht S, Konde MK, Diallo AB, Djingarey MH, Fall IS, Formenty P, Glynn JR, Subissi L (2019) Subsequent mortality in survivors of Ebola virus disease in Guinea: a nationwide retrospective cohort study. Lancet Infect Dis 19(11):1202–1208. https://doi.org/10.1016/S1473-3099(19)30313-5 Kiley MP, Regnery RL, Johnson KM (1980) Ebola virus: identification of virion structural proteins. J Gen Virol 49(2):333–341. https://doi.org/10.1099/0022-1317-49-2-333 Kucharski AJ, Edmunds WJ (2014) Case fatality rate for Ebola virus disease in West Africa. Lancet 384(9950):1260. https://doi.org/10.1016/S0140-6736(14)61706-2 Kuhn JH (2021) Virus taxonomy. In: Encyclopedia of virology. pp 28–37. https://doi.org/10.1016/ B978-0-12-809633-8.21231-4 Kupferschmidt K (2021) Ebola virus may lurk in survivors for many years. Science 371(6535): 1188. https://doi.org/10.1126/science.371.6535.1188 Kupzig S, Korolchuk V, Rollason R, Sugden A, Wilde A, Banting G (2003) Bst-2/HM1.24 is a raftassociated apical membrane protein with an unusual topology. Traffic 4(10):694–709. https:// doi.org/10.1034/j.1600-0854.2003.00129.x Lahm SA, Kombila M, Swanepoel R, Barnes RF (2007) Morbidity and mortality of wild animals in relation to outbreaks of Ebola haemorrhagic fever in Gabon, 1994-2003. Trans R Soc Trop Med Hyg 101(1):64–78. https://doi.org/10.1016/j.trstmh.2006.07.002 Lefkowitz EJ, Dempsey DM, Hendrickson RC, Orton RJ, Siddell SG, Smith DB (2018) Virus taxonomy: the database of the international committee on taxonomy of viruses (ICTV). Nucleic Acids Res 46(D1):D708–D717. https://doi.org/10.1093/nar/gkx932 Leroy EM, Kumulungui B, Pourrut X, Rouquet P, Hassanin A, Yaba P, Delicat A, Paweska JT, Gonzalez JP, Swanepoel R (2005) Fruit bats as reservoirs of Ebola virus. Nature 438(7068): 575–576. https://doi.org/10.1038/438575a Leroy EM, Epelboin A, Mondonge V, Pourrut X, Gonzalez JP, Muyembe-Tamfum JJ, Formenty P (2009) Human Ebola outbreak resulting from direct exposure to fruit bats in Luebo, Democratic Republic of Congo, 2007. Vector Borne Zoonotic Dis 9(6):723–728. https://doi.org/10.1089/ vbz.2008.0167

374

A. Mitra et al.

Li J, Duan HJ, Chen HY, Ji YJ, Zhang X, Rong YH, Xu Z, Sun LJ, Zhang JY, Liu LM, Jin B, Zhang J, Du N, Su HB, Teng GJ, Yuan Y, Qin EQ, Jia HJ, Wang S, Guo TS, Wang Y, Mu JS, Yan T, Li ZW, Dong Z, Nie WM, Jiang TJ, Li C, Gao XD, Ji D, Zhuang YJ, Li L, Wang LF, Li WG, Duan XZ, Lu YY, Sun ZQ, Kanu ABJ, Koroma SM, Zhao M, Ji JS, Wang FS (2016) Age and Ebola viral load correlate with mortality and survival time in 288 Ebola virus disease patients. Int J Infect Dis 42:34–39. https://doi.org/10.1016/j.ijid.2015.10.021 Lopez LA, Yang SJ, Hauser H, Exline CM, Haworth KG, Oldenburg J, Cannon PM (2010) Ebola virus glycoprotein counteracts BST-2/Tetherin restriction in a sequence-independent manner that does not require Tetherin surface removal. J Virol 84(14):7243–7255. https://doi.org/10. 1128/JVI.02636-09 Luo W, Roy A, Guo F, Irwin DM, Shen X, Pan J, Shen Y (2020) Host adaptation and evolutionary analysis of Zaire ebolavirus: insights from codon usage based investigations. Front Microbiol 11:570131. https://doi.org/10.3389/fmicb.2020.570131 Mangat R, Louie T (2021) Viral hemorrhagic fevers. StatPearls, Treasure Island, FL Manguvo A, Mafuvadze B (2015) The impact of traditional and religious practices on the spread of Ebola in West Africa: time for a strategic shift. Pan Afr Med J 22(Suppl 1):9. https://doi.org/10. 11694/pamj.supp.2015.22.1.6190 Martines RB, Ng DL, Greer PW, Rollin PE, Zaki SR (2015) Tissue and cellular tropism, pathology and pathogenesis of Ebola and Marburg viruses. J Pathol 235(2):153–174. https://doi.org/10. 1002/path.4456 Mateo M, Carbonnelle C, Martinez MJ, Reynard O, Page A, Volchkova VA, Volchkov VE (2011) Knockdown of Ebola virus VP24 impairs viral nucleocapsid assembly and prevents virus replication. J Infect Dis 204(Suppl 3):S892–S896. https://doi.org/10.1093/infdis/jir311 Matua GA, Van der Wal DM, Locsin RC (2015) Ebolavirus and Haemorrhagic syndrome. Sultan Qaboos Univ Med J 15(2):e171–e176 Medina-Rivera M, Centeno-Tablante E, Finkelstein JL, Rayco-Solon P, Pena-Rosas JP, GarciaCasal MN, Rogers L, Ridwan P, Martinez SS, Andrade J, Layden AJ, Chang J, Zambrano MP, Ghezzi-Kopel K, Mehta S (2021) Presence of Ebola virus in breast milk and risk of mother-tochild transmission: synthesis of evidence. Ann N Y Acad Sci 1488(1):33–43. https://doi.org/10. 1111/nyas.14519 Messaoudi I, Amarasinghe GK, Basler CF (2015) Filovirus pathogenesis and immune evasion: insights from Ebola virus and Marburg virus. Nat Rev Microbiol 13(11):663–676. https://doi. org/10.1038/nrmicro3524 Moran Z, Rodriguez W, Ahmadou D, Soropogui B, Magassouba NF, Kelly-Cirino C, Ben Amor Y (2020) Comparative performance study of three Ebola rapid diagnostic tests in Guinea. BMC Infect Dis 20(1):670. https://doi.org/10.1186/s12879-020-05339-2 Muhlberger E (2007) Filovirus replication and transcription. Future Virol 2(2):205–215. https://doi. org/10.2217/17460794.2.2.205 Mulherkar N, Raaben M, de la Torre JC, Whelan SP, Chandran K (2011) The Ebola virus glycoprotein mediates entry via a non-classical dynamin-dependent macropinocytic pathway. Virology 419(2):72–83. https://doi.org/10.1016/j.virol.2011.08.009 Olschlager S, Hess M (2015) ReEBOV Antigen Rapid Test kit for Ebola. Lancet 386(10010):2254. https://doi.org/10.1016/S0140-6736(15)01106-X Paesen GC, Collet A, Sallamand C, Debart F, Vasseur JJ, Canard B, Decroly E, Grimes JM (2015) X-ray structure and activities of an essential Mononegavirales L-protein domain. Nat Commun 6:8749. https://doi.org/10.1038/ncomms9749 Panning M, Laue T, Olschlager S, Eickmann M, Becker S, Raith S, Courbot MC, Nilsson M, Gopal R, Lundkvist A, di Caro A, Brown D, Meyer H, Lloyd G, Kummerer BM, Gunther S, Drosten C (2007) Diagnostic reverse-transcription polymerase chain reaction kit for filoviruses based on the strain collections of all European biosafety level 4 laboratories. J Infect Dis 196 (Suppl 2):S199–S204. https://doi.org/10.1086/520600

14

Ebola Virus Disease: An Emerging Lethal Disease in Africa

375

Pereira-Gomez M, Lopez-Tort F, Fajardo A, Cristina J (2020) An evolutionary insight into emerging ebolavirus strains isolated in Africa. J Med Virol 92(8):988–995. https://doi.org/10. 1002/jmv.25627 Pleet ML, DeMarino C, Lepene B, Aman MJ, Kashanchi F (2017) The role of Exosomal VP40 in Ebola virus disease. DNA Cell Biol 36(4):243–248. https://doi.org/10.1089/dna.2017.3639 Poletto C, Gomes MF, Pastore y Piontti A, Rossi L, Bioglio L, Chao DL, Longini IM, Halloran ME, Colizza V, Vespignani A (2014) Assessing the impact of travel restrictions on international spread of the 2014 West African Ebola epidemic. Euro Surveill 19(42):20936. https://doi.org/ 10.2807/1560-7917.es2014.19.42.20936 Pollock NR, Wonderly B (2017) Evaluating novel diagnostics in an outbreak setting: lessons learned from Ebola. J Clin Microbiol 55(5):1255–1261. https://doi.org/10.1128/JCM.00053-17 Redding DW, Atkinson PM, Cunningham AA, Lo Iacono G, Moses LM, Wood JLN, Jones KE (2019) Impacts of environmental and socio-economic factors on emergence and epidemic potential of Ebola in Africa. Nat Commun 10(1):4531. https://doi.org/10.1038/s41467-01912499-6 Reichler MR, Bruden D, Thomas H, Erickson BR, Knust B, Duffy N, Klena J, Hennessy T, Household Transmission Investigative T (2020) Ebola patient virus cycle threshold and risk of Household Transmission of Ebola virus. J Infect Dis 221(5):707–714. https://doi.org/10. 1093/infdis/jiz511 Report of a WHO/International Study Team (1978) Ebola haemorrhagic fever in Sudan, 1976. Report of a WHO/International Study Team. Bull World Health Organ 56(2):247–270 Report of an International Commission (1978) Ebola haemorrhagic fever in Zaire, 1976. Bull World Health Organ 56(2):271–293 Rewar S, Mirdha D (2014) Transmission of Ebola virus disease: an overview. Ann Glob Health 80(6):444–451. https://doi.org/10.1016/j.aogh.2015.02.005 Rojas M, Monsalve DM, Pacheco Y, Acosta-Ampudia Y, Ramirez-Santana C, Ansari AA, Gershwin ME, Anaya JM (2020) Ebola virus disease: an emerging and re-emerging viral threat. J Autoimmun 106:102375. https://doi.org/10.1016/j.jaut.2019.102375 Rosello A, Mossoko M, Flasche S, Van Hoek AJ, Mbala P, Camacho A, Funk S, Kucharski A, Ilunga BK, Edmunds WJ, Piot P, Baguelin M, Tamfum JJ (2015) Ebola virus disease in The Democratic Republic of the Congo, 1976-2014. elife 4:e09015. https://doi.org/10.7554/eLife. 09015 Rouquet P, Froment JM, Bermejo M, Kilbourn A, Karesh W, Reed P, Kumulungui B, Yaba P, Delicat A, Rollin PE, Leroy EM (2005) Wild animal mortality monitoring and human Ebola outbreaks, Gabon and republic of Congo, 2001-2003. Emerg Infect Dis 11(2):283–290. https:// doi.org/10.3201/eid1102.040533 Saeed MF, Kolokoltsov AA, Albrecht T, Davey RA (2010) Cellular entry of Ebola virus involves uptake by a macropinocytosis-like mechanism and subsequent trafficking through early and late endosomes. PLoS Pathog 6(9):e1001110. https://doi.org/10.1371/journal.ppat.1001110 Sakurai Y (2015) Ebola virus host cell entry. Uirusu 65(1):71–82. https://doi.org/10.2222/jsv.65.71 Simmons G, Reeves JD, Grogan CC, Vandenberghe LH, Baribaud F, Whitbeck JC, Burke E, Buchmeier MJ, Soilleux EJ, Riley JL, Doms RW, Bates P, Pohlmann S (2003) DC-SIGN and DC-SIGNR bind ebola glycoproteins and enhance infection of macrophages and endothelial cells. Virology 305(1):115–123. https://doi.org/10.1006/viro.2002.1730 Strong JE, Feldmann H (2017) The crux of Ebola diagnostics. J Infect Dis 216(11):1340–1342. https://doi.org/10.1093/infdis/jix490 Suzuki Y, Gojobori T (1997) The origin and evolution of Ebola and Marburg viruses. Mol Biol Evol 14(8):800–806. https://doi.org/10.1093/oxfordjournals.molbev.a025820 Ververs M, Gabra M (2020) Nutritional Care for Patients with Ebola virus disease. Emerg Infect Dis 26(1):20–25. https://doi.org/10.3201/eid2601.191024 Ververs M, Vorfeld C (2021) Guidance materials from 2014 to 2019 on nutritional care for Ebola patients in Ebola treatment units: an analysis. Public Health Nutr 24(1):139–145. https://doi.org/ 10.1017/S136898002000261X

376

A. Mitra et al.

Walker PG, White MT, Griffin JT, Reynolds A, Ferguson NM, Ghani AC (2015) Malaria morbidity and mortality in Ebola-affected countries caused by decreased health-care capacity, and the potential effect of mitigation strategies: a modelling analysis. Lancet Infect Dis 15(7):825–832. https://doi.org/10.1016/S1473-3099(15)70124-6 Woolsey C, Geisbert TW (2021) Antibodies periodically wax and wane in survivors of Ebola. Nature 590(7846):397–398. https://doi.org/10.1038/d41586-020-03044-3 Yu DS, Weng TH, Wu XX, Wang FXC, Lu XY, Wu HB, Wu NP, Li LJ, Yao HP (2017) The lifecycle of the Ebola virus in host cells. Oncotarget 8(33):55750–55759. https://doi.org/10. 18632/oncotarget.18498 Zhang L, Wang H (2014) Forty years of the war against Ebola. J Zhejiang Univ Sci B 15(9): 761–765. https://doi.org/10.1631/jzus.B1400222 Zhu W, Banadyga L, Emeterio K, Wong G, Qiu X (2019) The roles of Ebola virus soluble glycoprotein in replication, pathogenesis, and countermeasure development. Viruses 11(11). https://doi.org/10.3390/v11110999 Zinzula L, Tramontano E (2013) Strategies of highly pathogenic RNA viruses to block dsRNA detection by RIG-I-like receptors: hide, mask, hit. Antivir Res 100(3):615–635. https://doi.org/ 10.1016/j.antiviral.2013.10.002

Hantaviruses as Emergent Zoonoses: A Global Threat

15

Chayna Singha Mahapatra

Abstract

Hantaviruses are highly zoonotic and present worldwide except in Australia. In humans, this virus produces two major clinical syndromes—in Asian and European countries (Old World Hantavirus) it produces Heamorrhagic Fever with Renal Syndrome, and in American countries (New World Hantavirus) hantavirus pulmonary syndrome. This enveloped and negative-sense singlestranded RNA virus belongs to the genus Hantavirus of family Bunyaviridae. Rodents are the natural hosts, where viruses establish a persistence without any apparent illness. Transmission among rodents generally occurs as aerosol borne through contaminated excretory product inhalation and transmission to human occurs through natural or occupational contact with infected rodents excreta or rodent bite. Generally, the disease occurs throughout the year but achieves peaks in winter and spring. Approximately 1,50,000 to 2,00,000 hantavirus cases happen each year with case fatality rates ranging from 3 to 12%. The disease can be diagnosed with a previous history of rodent exposure, serological tests like ELISA or plaque reduction neutralization test (gold standard test). The preventive strategy includes rodent control, surveillance, awareness camps, and vaccination. Inactivated vaccines have been reported to be widely used to control disease in the endemic areas. Currently, there is no specific therapy available but along with supportive care, treatments with antiviral drugs like Ribavirin is showing promising response. Keywords

Hantavirus · Zoonotic · Rodents · Haemorrhagic fever with renal syndrome · Hantavirus pulmonary syndrome C. S. Mahapatra (✉) Veterinary Microbiology, ICAR-Indian Veterinary Research Institute, Bareilly, Uttar Pradesh, India # The Author(s), under exclusive license to Springer Nature Singapore Pte Ltd. 2023 P. L. Bhukya et al. (eds.), Emerging Human Viral Diseases, Volume I, https://doi.org/10.1007/978-981-99-2820-0_15

377

378

15.1

C. S. Mahapatra

Introduction

Hantaviruses are emerging zoonotic viruses. Previously this rodent-borne virus was regarded as the third most fatal where rabies stood first and AIDS second (Martin 1996). This deadly virus sustains persistently in Rodentia without manifesting clinical symptoms and commonly spread from the reservoir through exposure to infected rodents or their dropping (Jonsson et al. 2010). The occurrence of two major outbreaks in the 1990s led to the discovery of the hantavirus. Old World hantaviruses were reported from Asia and Europe which was causing hemorrhagic fever with renal syndrome (HFRS) and New World hantavirus was causing hantavirus cardiopulmonary syndrome (HCPS) (Avšič-Županc et al. 2019; Wei et al. 2022a, 2022b). This pathogen infects various cells affecting many body functions. Infections comprehend lung and kidney ailment varying from sub-clinical, mild to severe with a deadly outcomes where HPCS presents with acute respiratory distress (Avšič-Županc et al. 2019) but HFRS has pronounced renal dysfunction (Jiang et al. 2016). Moreover, some species are non-pathogenic to humans. Common symptoms are mainly due to increased vascular permeability and immune activation that are responsible for particular organ failure (Mir 2010; Braun et al. 2014). Presumptive diagnosis is done based on characteristic clinical and laboratory findings which are again affirmed by serological and/or molecular testing. Non-specific treatment comprises cardiovascular, respiratory, and renal function support. Prevention of hantavirus infections solely involves personal protective measures to avoid exposure to virus-contaminated aerosol and rodent control.

15.2

Brief History

Though the first reference of hantavirus was in12th century, the disease was first clinically recognized in 1931 in China (Nichol et al. 1993; Jiang et al. 2017). In the 1930s, in Sweden series of clinical cases showing a milder form of HFRS i.e., Nephropathia epidemica was reported (Settergren 2000). In the early 1940s, 12,000 cases were reported in the Japanese Army near the boundary between Far East Russia and Northeastern China (Lee and Dalrymple 1989). Between 1950 and 1954, during the Korean War HFRS came to recognition when above 3000 United Nations warfighters got infected (Heyman et al. 2009). Until 1976, an etiological agent was not isolated, which was first done by Lee and colleagues from rodents and named as Hantaan virus due to its geographical location in South Korea near the river Hantan (Mir 2010; Dara and Abhinav 2020). In the subsequent years, other prominent orthohantaviruses including the Puumala and Seoul were isolated and collectively designated as the Old World hantaviruses. In the United States, an outbreak of HPCS-like disease in 1993 in the Four corners region guided to the disclosure of another orthohantavirus i.e Sin Nombre orthohantavirus (Van Hook 2018). Till now, approximately 20 pathogenic strains out of a total of 43 hantavirus strains are acknowledged in the American countries and are designated as the New World hantaviruses.

15

Hantaviruses as Emergent Zoonoses: A Global Threat

15.3

379

Discovery

Despite the designation of the Hantaan virus as the prototype of the Orthohantavirus genus, the Thottapalayam virus is the first prototype shrew-borne hantavirus isolated from an Asian house shrew in India back in 1964 (Song et al. 2007). A recent phylogenetic analysis suggested that the first appearance of hantaviruses was in bats or in voles and shrews before becoming emergent in rodents (Guo et al. 2013). Meanwhile, in Finland, the Puumala virus was discovered from bank voles as an acausal agent of nephropathia epidemica. In 1978, the causative agent of HFRS, i.e., Hantaan virus (HTNV) and its reservoir host, i.e., striped field mouse were identified. In the same year near the Hantan river in South Korea, the isolation of Korean Hemerologic fever-causing agent was done from field mice. So the virus was named ‘Hantaan’ after the name of the river Hantan (Muranyi et al. 2005; Mir 2010). In 1982, the first recognition of a New World hantavirus, i.e., Prospect Hill virus was documented in Maryland which was carried by a meadow vole (Lewis 2005). In 1993, the discovery of HCPS publicized an intense investigation of hantavirus and immediately the second episode broke out in the Four Corner states of the United States. So initially it was referred to as Four Corners disease and now it is known as HPS or hantavirus HCPS. After the first incident in the United States, several others were reported in Western Europe, and subsequently in South America. Other HFRScausing pathogens: in 1982, Seoul virus carried by urban rats in Korea (Nielsen et al. 2010); in 1992, Dobrava-Belgrade virus carried by yellow-necked mice in Slovenia and Serbia (Panculescu-Gatej et al. 2014); and in 1997, Saaremaa virus carried by Estonian field mice (Plyusnin et al. 2006) were also soon discovered. Eventually, following primeval opinion of the hantavirus presence, in 2012 in Africa a novel hantavirus, i.e., Sangassou virus was reported from Guinea (Klempa et al. 2012).

15.4

Epidemiology

15.4.1 Geographical Distribution/Demography Hantavirus infections have been reported worldwide excluding Australia. Apart from the old world and new world concept, HFRS is specifically prevalent in the regions of China, the Korean Peninsula, Russia, and Northern and Western Europe. The highest occurrence of HPS is generally recorded in Argentina, Brazil, Chile, Panama, and Canada also the United States (Jonsson et al. 2010).

15.4.2 Age/Mortality and Morbidity Depending on the strain or isolate of hantaviruses, in some outbreaks mortality rate may reach up to 12% in the case of HFRS and 60% in the case of HPS (Jonsson et al. 2010). The incidence rate was recorded as highest in the people of age group 55–59 years but the case-fatality rate was increased for patients over 80 years of

380

C. S. Mahapatra

age. Case-fatality rate goes down to 0.1–1% when the disease severity is mild as seen in the case of nephropathia epidemica (Hjertqvist et al. 2010).

15.4.3 Origin of Infection and Diversity Hantaviruses are usually transmitted in humans by infected rodent exposure possibly through direct contact or inhalation of rodent excreta. Person-to-person or hospitalborne (nosocomial) transmission is not documented except for Andes orthohantavirus in the province of Chile and Argentina. Usually, city-born HFRS cases are linked to rat-borne hantaviruses in Asia. On the contrary, in Europenephropathia epidemica (NE) which is less severe due to a milder variant of HFRS, i.e., Puumala virus (PUUV) is harbored by the bank voles. So, there is a huge diversity of possible sources of infection. Rodent host Old World hantavirus Apodemus agrarius (striped field mouse)

Virus isolate or strain

Clethrionomys glareolus (Bank vole)

Hantaan virus (HTNV) Saaremaa virus (SAAV) Seoul virus (SEOV) DobravaBelgradevirus (DOBV) Amur virus (AMRV) Soochong virus Puumala virus (PUUV)

Microtus pennsylvanicus (Eastern meadow vole) Microtus fortis (Reed vole) Myodes regulus (Royal vole) Microtus arvalis (Common vole) Microtus californicus (California vole) Lemmus sibericus (West Siberian lemming)

Prospect Hill virus (PHV) Khabarovsk virus (KHAV) Muju virus (MUJV) Tula virus (TULV) Isla Vista virus (ISLAV) Topografov virus (TOPV)

Rattus norvegicus (Norway rats) Apodemus flavicollis (Yellow-necked field mouse) Apodemus peninsulae (Korean field mouse)

Geographic distribution

Disease

Eastern Asia (China, South Korea) and Russia Central Europe and Scandinavia Global

HFRS

Balkans

HFRS

Russia, Korean peninsula

HFRS

South Korea Western Europe, Scandinavia and Western Russia USA (Maryland)

Unknown HFRS/NE

Russia

Unknown

South Korea

Unknown

Russia/Europe

Unknown

North America

Unknown

Siberia

Unknown

HFRS HFRS

Unknown

(continued)

15

Hantaviruses as Emergent Zoonoses: A Global Threat

Rodent host New World hantavirus Peromyscus maniculatus (Deer mice) Oligoryzomys longicaudatus (Pygmy rice rat) Peromyscus leucopus (white-footed mice)

Sigmodon hispidus (cotton mice) Oryzomys palustris (Marsh rice rat) Oligoryzomys fulvescens (Fulvous colilargo) Peromyscus boylii (Brush mouse) Oryzomys couesi (Coues’s rice rat) Oligoryzomys chocoensis (Chacoan pygmy rice rat) Oligoryzomys flavescens (Yellow pigmy rice rat) Bolomys obscurus (Dark bolo mouse) Calomys laucha (Small vesper mouse) Bolomys lasiurus (Hairy- ailed bolo mouse) Oligoryzomys nigripes (Black footed pigmy rice rat) Zygodontomys brevicauda (Short tailed zygodont) Reithrodontomys mexicanus (Mexican harvest mouse) Sigmodon alstoni (Alston cotton rat) Akodon azarae (Azara’s grass mouse) Holochilus chacoensis (Chacoan marsh rat)

Virus isolate or strain

381

Geographic distribution

Disease

Sin Nombre virus (SNV) Andes virus (ANDV) Oran virus (ORNV) New York virus (NYV) Monongahela virus (MGLV) Black Creek Canal virus (BCCV) Bayou virus (BAYV) Choclo virus

North western America

HPS

South America (Argentina, Chile) Argentina

HPS

Northeastern America

HPS

North America

HPS

United States

HPS

North America

HPS

Panama

HPS

Limestone Canyon virus Playa de Oro virus Catacamas virus Bermejo virus (BMJV) Lechiguanas virus (LECV) Maciel virus (MCLV) Laguna Negra virus (LANV) Araraquara virus

North America

Unknown

Mexico Honduras Argentina

Unknown Unknown HPS

Argentina

HPS

Argentina

HPS

Paraguay, Bolivia, Argentina Brazil

HPS

Juquitiba virus

Brazil

HPS

Calabazo virus

Panama

Unknown

Rio Segundo virus (RIOSV)

Cost Rica

Unknown

Cano Delgadito virus (CADV) Pergamino virus (PRGV) Alto Paraguay virus

Venezuela

Unknown

Argentina

Unknown

Paraguayan Chaco

Unknown

HPS

HPS

(continued)

382

C. S. Mahapatra

Rodent host Akodon montensis (Montane grass mouse) Oligoryzomys nigripes (Black footed pigmy rice rat) Oligoryzomys microtis (small eared pygmy rice rat) Unclassified Suncus murimus (House shrew)

Virus isolate or strain Ape Aime virus Jaborá virus Itapúa virus

Geographic distribution Paraguay Brazil, Paraguay Paraguay

Disease Unknown Unknown Unknown

Rio Mamore virus

Bolivia, Peru

Unknown

Thottapalayam virus (TPMV)

Asia

Nonpathogenic

15.4.4 Spread of Disease (Epidemic, Sporadic, Pandemics Etc.) Hantaviruses appear in different epidemiological patterns and expand worldwide. The type of spread is predicted by high rodent density which is again correlated with high summer temperatures. The peak of the epidemic curve is observed between the month of June and October (autumn/winter peak) and then declines with sporadic reports (Zhang et al. 2014). Though there are reports of serious epidemics during the 1980s and 1990s, still no pandemic risk for HFRS (Gonzalez et al. 2018). Any activity creating close proximity to rodent secretion and droppings fuels the chances of infection. The main mode of Hantavirus transmission is through urine, feces, saliva by rodent animals, or the aerosolized virus containing particles stirred up into the air and rarely due to scratch and bite of infected one. Shreds of evidence are indicating the mite-hantavirus association is having a role in transmission as well as maintenance in nature. The only known person-to-person transmissible hantavirus is Andes orthohantavirus, a member of the New World hantaviruses in South America and the primary cause of HCPS over there (Padula et al. 1998; Alonso et al. 2020).

15.5

Potential Risk of Emergence and Re-emergence

Hantaviruses are continuously evolving around the world. The emergence of hantaviruses can often be driven by various factors, one of which is related to changing ecological interactions between humans and rodents. Therefore, changes in the geographic distribution of reservoir species might cause the emergence of a previously free region. Further, emergence is linked to the massive reproduction of reservoir species with an increased probability of human exposure. There is a possibility of the presence of unidentified reservoirs inside human territory too. The emergence of hantaviruses might also be influenced by co-infections in the reservoir where re-assortment facilitates better host adaptation and emergence. Spillover or cross-species transmission is a rare event but can help in host switching

15

Hantaviruses as Emergent Zoonoses: A Global Threat

383

usually leading to infection in any new dead-end hosts, but sometimes lead to forward transmission (Holmes and Zhang 2015). Not only the virus, host, or reservoir properties but emergence can also be influenced by environmental factors. Interestingly, hantavirus also seems to be quite stable outside of the host body, which also indirectly aids transmission via aerosols over a large area (Schönrich et al. 2008). Last but not least, novel viruses might have existed already in the human population or the reservoirs, but were not detected due to insufficient diagnostic tools.

15.5.1 Biosafety Measures (Handling of Virus) CDC recommends following universal precautionary measures for handling hantavirus samples. For handling infected human sera or their body fluids, biosafety level 2 (BSL-2) is recommended. Contaminated tissue materials should be handled only under BSL-2 containment facilities along with BSL-3 practices. BSL-3 containment is required for virus propagation but large-scale propagation and preparation and handling of concentrated virus demand BSL-4 containment (Knudsen et al. 1994). Experimentally infected host species must be accommodated in animal biosafety level 2 (ABSL-2) containment supported with ABSL-2 practices to avoid exposure through excretion. All work including virus inoculation for any permissive host should be conducted at ABSL-4 (Meechan and Potts 2020).

15.6

Organization of Infectious Agents (Structural and Molecular)

Classification Realm: Riboviria Kingdom: Orthornavirae Phylum: Negarnaviricota Class: Ellioviricetes Order: Bunyavirales Family: Hantaviridae Subfamily: Mammantavirinae Genus: Orthohantavirus Orthohantaviruses specifically are mammalian hantaviruses which contain 38 species that are transmitted through rodents.

15.6.1 Morphology and Virion Structure The virion has a shape varying from spherical to pleomorphic without any protrusions. Virion size measures about 120–160 nanometers in diameter. More

384

C. S. Mahapatra

than 50% of virion mass is contributed by protein, lipid contributes 20–30%, and the rest 2–7% by carbohydrates producing 1.18 g/cm3 dense virion (Hussein et al. 2011). The virus is enveloped which is surrounded by three nucleocapsids. Some 5–10 nm long projections (spikes) are out from the surface and embedded in a 5 nm thick lipid bilayer producing a grid-like structure made of two glycoproteins Gn and Gc (D’Souza and Patel 2020). The nucleocapsids are circular and composed of nucleocapsid protein N. On the interaction of this N protein with the three viral genome segments give rise to helical symmetry. Depending on the arrangement, the ribonucleocapsid is filamentous in shape having 200–300 nm length and 2–2.5 nm width. The tomographic reconstruction displays a set of collateral rod-like dense structures beneath the membrane representing the three RNPs. Hantaviruses lack matrix protein.

15.6.2 Genome Structure and Organization The hantavirus genome is a tripartite negative-sense, single-stranded RNA having 12,000 nucleotides (nt) (Riera 2019). The complete genome sequence varies from 11,845 nucleotides (nt) for HTNV to 12,317 nt for SNV. Tri-segments have been named small (S), medium (M), and large (L) based on their size. The sequence for S segment is 1–3 kilobases (kb) and encodes the nucleocapsid (N) protein. The sequence for the M segment is 3.2–4.9 kb and encodes a glycoprotein precursor polyprotein for Gn and Gc. The sequence for the L segment is 6.8–12 kb and encodes the viral RNA polymerase (Muyangwa et al. 2015). At the 5′ end and 3′ end of each segment, there are short non-coding sequences: 5′ end non-coding region is 37–51 nt long but 3′ non-coding location differs, i.e., in the S segment between 370–730 nt; in medium segment between 168–229 nt; and in L segment 38–43 nt. All three segments contain a consensus sequence (AUCAUCAUC) at 3′ end which is complementary to the 5′-terminal sequence (Chinthaginjala et al. 2020). This complementarity circularizes RNA components and forms a panhandle structure which acts as primer and has a role in replication as well as encapsidation. Any nonstructural proteins are not yet known.

15.6.3 Viral Proteins and Life Cycle Old and New World hantaviruses have some common characteristics of their life cycles; however, their evolution may be different specifically in host cell-virus interactions (Ramanathan 2007). The attachment of hantaviruses to different target organs occurs through viral glycoproteins (Gn). Integrins act as receptors that interacts with the viral glycoproteins for entry. For Microtus-borne hantaviruses, β1integrins act as mediators of apathogenic hantaviruses, whereas β3 integrins for pathogenic hantaviruses. However, there are other receptors like decay-accelerating factor (DAF), a complement regulatory protein that promotes pathogenic hantavirus

15

Hantaviruses as Emergent Zoonoses: A Global Threat

385

entry. HTNV enters target cells through either apical or basal route via clathrincoated pits and then moves to early endosomes and is subsequently delivered to endo-lysosomes (Jonsson et al. 2010). Virus uncoating occurs within the endolysosomal compartments liberating the RNPs. The viral polymerase (RdRp) transcribes and generates the mRNAs for all three S, M, and L genomic RNAs. Subsequent translation of the S and L mRNAs occurs on free ribosomes, whereas the M-segment occurs on membrane-bound ribosomes. The early and abundantly synthesized protein is the N protein which plays key roles in many steps including translation, trafficking, and assembly. As a maturational step, during import into the ER, the precursor protein for glycol protein is proteolytically cleaved to generate Gn and Gc. This step is self-regulated due to the presence of conserved amino acid motif ‘WAASA’ acting as a proteolytic cleavage site situated at the terminus of Gn. Thereafter Gn and Gc get glycosylated in the ER and sent to the Golgi complex. Immediately the viral polymerase produces a signal to switch from transcription to the replication of genomic RNAs. Then encapsulation of the newly formed RNAs by the N protein will take place forming the RNPs. N protein trafficking via microtubule to the ER-Golgi-intermediate compartment (ERGIC) propose that the ERGIC and the Golgi complex may be crucial for virus assembly for both Old and New World hantaviruses (Hepojoki et al. 2012). The newly assembled virions at the plasma membrane are then released through exocytosis.

15.7

Pathogenesis in Human Host Viral Interaction

The pathogenesis of hantavirus is unclear due to a lack of suitable animal models. After exposure, within 1–2 weeks, symptoms of HFRS usually develop (Wei et al. 2022a, 2022b); but in uncommon cases, it could be as long as 8 weeks. Though the primary replication site of HFRS is yet unknown, it affects mainly blood vessels showing increased vascular permeability, endothelial dysfunction, and dramatic kidney damage. The incubation period of HPS is considered to range from 1 to 4 weeks. Most of the indications are related to the lungs, spleen, and gall bladder. HPS patients typically present prodromal syndrome including fever, myalgias, and nausea/ vomiting. The hallmark of HPS is the speedy onset of severe respiratory illness producing pulmonary edema. Hypoxia due to reducing blood oxygen level produces myocardial depression and death occurs due to cardiogenic shock. Drowsiness, vertigo, and other central nervous system (CNS) ailment symptoms may be noticed. Ocular disturbances including loss of vision are pathognomonic for NE. PUUV has been reported to cause encephalitis, and other kidney injury signs including proteinuria, high creatinine levels, hematuria, and polyuria (Chand et al. 2020; Koehler et al. 2022).

386

C. S. Mahapatra

15.7.1 Host Immune Response (Innate and Adaptive) 15.7.1.1 Innate Immune Response Innate immunity is regarded as the first line of defense against any virus likewise for hantavirus infection too. The nucleic acid of the virus act as pathogen-associated molecular patterns (PAMPs) to bind to retinoic acid-inducible gene I (RIG-I), TLR3, and MDA5 act as a ligand of target cells (Voutilainen et al. 2012). Thus induce interferon signaling pathway and interferon response. Nucleotide-binding oligomerization domain-like receptors (NLRs) are also involved in host innate immunity by the formation of NLRP3 inflammasome which is accountable for the induction of IL-1β. On the other hand, NLRC3 is a negative regulator of IFN-I. Long non-coding RNAs (lncRNAs) and miRNAs are also responsible for regulating innate immunity. Hantavirus-infected dendritic cells activate T cells by production of pro-inflammatory cytokines like TNF-α and IFN-α and infected monocytes resulted in increased production of free radicals and NO-synthase. PUUV-infected monocytes can exert antiviral action by inducing IFN-α, MxA, and activating mucosal-associated invariant T (MAIT) cells. However, hantavirus has established mechanisms to avoid the host innate immune defense which are—inhibiting IFN signaling and regulating cell death (Zhang et al. 2021). Henceforth, it is concluded that in hantavirus-infected cells, IFN and IFN inducible gene expression can be highly impacted by induced activation of IRF1 and IRF3. Upregulation of transcriptional activity of B-cell lymphoma 2 (Bcl-2) and vascular endothelial growth factor (VEGF) work hand in hand to prevent apoptosis in vitro which can explain the absence of apoptosis (CPE). 15.7.1.2 Adaptive Immunity Virus replication in macrophages and CD8 T cells induces uncontrolled immune activation. An excess of cytokines especially interleukin-1 (IL-1), IL-6 and tumor necrosis factor-alpha (TNF-α) give rise to uncontrolled systemic inflammatory response and help in the progression of HFRS and HPC. It is universally recognized that type I IFN response plays a critical role and is central to the host for combating hantaviral infection. After hantaviral antigen recognition, CD4 T cells differentiate into Th1 cells which are responsible for cell-mediated immunity by producing interferon-gamma (IFN-γ) and TNF-β, whereas IL-4 and IL-5 are two major effector cytokines that boost humoral responses. Besides, regulatory T cells (Treg) who produces two inhibitory cytokines IL-10 and transforming growth factor β (TGF-β) hav a role in immune regulation and immunopathology. For HPS patients, IL-4 was absent in the sera, but the level of IL-5 was significantly increased. High levels of IL-6 increase nitric oxide (NO) which is having negative correlation with arterial blood pressure and causes hypotension and depressed myocardial function in HPS. Increased IFN-γ levels tell that early Th1 activation in HPS favors clearance of the virus. However, over-activation can aggravate HPS by producing immunopathogenic effects, e.g., increased levels of TNF-β produces cardiovascular diseases. As a humoral response in HPS patients, strong presence of IgA and IgG (G1 and G3) class of antibodies.

15

Hantaviruses as Emergent Zoonoses: A Global Threat

15.8

387

Virulence and Persistence

To replicate inside cells with success, viruses modulate the host signaling pathways and exhibit counter defence mechanism against IFN-induced host defense. Yet variation of hantavirus virulence is still very difficult to define. A single amino acid (aa) exchange in the GPC, or two aa exchanges in the N protein, and two aa exchanges in the RdRp may cause enhanced virulence. Virulence may increase by genetic modification due to mutation or genetic rearrangements and subsequent selection pressure in the reservoir population. Alternatively, virulence may decrease by attenuation. Factors for attenuation of PUUV in cell culture passaging were mapped to the coding domain of the L-segment and to S-segment non-coding region. Persistent and symptomless status is usually attained in natural hosts. Although it is well-known that after getting infected, cells of natural hosts do not exhibit apoptosis but the molecular mechanisms of persistence are yet undefined. Two possible mechanisms are—(1) Prolonged neutrophils survival due to delayed apoptosis, specifically induced by the pathogenic hantavirus, and (2) Protection of infected cells from destruction by the immune cells activities. For illustration, when there is up-regulation of pro-inflammatory mediators like IL-4 from Th2 phenotypes there will be viral clearance, whereas the predominance of cytokines corresponding to the Th1 and Treg phenotypes are related to persistence.

15.9

Clinical Manifestations

15.9.1 Phases of Disease The period between exposure and appearance of first symptoms varies from 1 to 6 weeks with an average of 2 weeks after exposure. The disease starts with a short prodromal phase lasting 3–5 days which shows nonspecific flu-like symptoms. In conjunction with acute pyrexia and myalgias, the early symptoms of cough, chills, headache, dizziness and nausea, vomition, diarrhoea-like gastrointestinal disturbances may also be recorded. Patients experience difficultly breathing, and shortness of breath (breathing rate up to 30/min) and within 24 h most of the patients develop tachypnoea and tachycardia. Late symptoms appear 4–10 days after the initial onset of illness.

15.9.2 Clinical Symptoms In accordant with the viral strain and its prevalence geographically, the clinical presentation of the disease may vary. In Asia, hantavirus mainly targets the human excretory organ kidney and causes hemorrhagic fever with renal syndrome (HFRS) whereas in North America, principally the lungs and leads to hantavirus pulmonary or cardio-pulmonary syndrome (HPS or HPCS). In contrast to the severity of HFRS and HPS, milder forms of the disease called nephropathia epidemica (NE) is existing

388

C. S. Mahapatra

in Europe which is often asymptomatic. Clinical symptoms may be exhibited between 1 and 4 weeks after initial exposure.

15.9.3 Early Symptoms At first, a patient may experience universal flu-like symptoms which includes fever, fatigue, and muscle aches, especially in the large muscle groups of the body. Other symptoms may also be noticed like chills, headache, giddiness, and gastrointestinal disturbances such as abdominal cramps, nausea, and vomition and diarrhoea.

15.9.4 Late Symptoms The advanced symptoms appear 4–10 days after the early stages of the illness. Signs of HPS include—high fever, shortness of breath, and cough with spitting of bloody mucous. Relative bradycardia and transient mild hypotension in time lead to fluid retention in the lungs which eventually progress to the shock stage (MacNeil et al. 2011). For HFRS, after 4 days renal failure develops contributing to proteinuria, hematuria, and pyuria. In rare cases, 1% seizures or grievous focal neurologic indications may be recorded.

15.10 Diagnosis 15.10.1 Clinical Assessment Blood profile including CBC should be repeated every 8–12 h if a hantavirus infection is suspected. WBC count tends to shift towards the left with as high as 50% precursor cells. A fall in the serum albumen, the presence of atypical lymphocytes, and a nascent in the hematocrit value is indicative of a shift of fluid from the circulation into the lungs while the onset of pulmonary edema. HPS at severe conditions may develop coagulopathy, e.g., disseminated intravenous coagulation (DIC) and the count of platelets go below 150,000 units which is unlikely to happen in the case of HFRS. A strikingly reduced platelet count announces the transition from the prodromal to the cardiopulmonary stage of the illness (Bisen and Raghuvanshi 2013).

15.10.2 Differential Diagnosis • Pneumonia: Severe atypical pneumonia in the early phase of the hantaviral disease (especially HPS) should be distinguished from atypical (walking) pneumonia caused by certain bacteria like Mycoplasma pneumoniae, Chlamydophila pneumoniae, Chlamydia psittaci, Legionella spp., Mycobacterium spp., and also Influenza virus.

15

Hantaviruses as Emergent Zoonoses: A Global Threat

389

• Heart failure: Failure of the heart due to Hantavirus must be differentiated from any previous history of high blood pressure, rheumatic heart disease, or valvular or coronary arteriosclerosis. Radiology may present enlargement of the heart and butterfly wings like pulmonary edema or pleural effusion with a clinical condition exhibiting non-productive cough, dyspnea, and edema of limbs (Luby et al. 2015). • Leptospirosis: Organ impairment by hantavirus simulate the pulmonaryhemorrhagic phase of leptospirosis which sparsely shows hemorrhagic manifestation because of jaundice due to liver damage or renal ailment (Lee et al. 2014). • Rickettsiosis: Rickettsial rash which is usually maculopapular rash but may unfold into hemorrhagic papules mimicking hemorrhagic fever caused by hantavirus.

15.10.3 Radiology Nearly all patients will have findings of interstitial edema at 48 h post identification in chest X-ray. Bilateral pulmonary edema in about one-third of patients and perihilar opaqueness with some grade of pleural effusions in the rest of two-third of patients.

15.10.4 Laboratory Animal Model Assays Currently, there are no small animal model that can fully represent the disease in human. But many small mammals can act as laboratory model.

15.10.4.1 Mice BALB/c mice have been the predominant model but others including C57BL/6 and NMRL also being used. An early pathogenic study performed in suckling mice showed that hantavirus infection through multiple routes develops widespread viral dissemination characterized by brain, liver, lung, and spleen lesions. Lethality in infant mice is age dependent where it is 100% in 3-day-old mice which comes down to 50% in 7-day old and non-lethal in 14-day-old animals (Golden et al. 2015; Dowall et al. 2020). Asymptomatic persistent infection similar to the natural host occurs when sub-lethal infection is established. Immunocompromised like nude mice and severe combined immunodeficient (SCID) mice show much greater dissemination of hantaviruses. In SCID mice, viral distribution was more considerable which eventually develop wasting disease. Rats can also act as models for hantaviruses. 15.10.4.2 Hamsters Hamsters are regarded as the gold standard of laboratory animal models of hantaviruses. HPS-associated hantaviruses-infected hamsters develop symptoms

390

C. S. Mahapatra

that simulate human disease (Wilson et al. 2020). Outbred Syrian hamsters’ consequences of asymptomatically disseminated infection which has been exploited to measure neutralizing antibody levels. Other than the pathogenesis study, the hamster model was used as a suitable alternative to evaluate several hantavirus vaccines like viral vector, DNA vaccine, and virus-like particle (VLP) vaccines (Golden et al. 2015). Immunosuppressed hamsters when infected with hantaviruses like SNV, accurately mimic HPS.

15.10.4.3 NHP Models Commencing events of creating a nonhuman hantavirus primate (NHP) was unsuccessful to a large extent when infected Cynomolgus macaques failed to develop clinical disease. Recently, rhesus macaques have come out as the first promising NHP to be used (Safronetz et al. 2015). 15.10.4.4 Reservoir Hosts Any reservoir for hantavirus like smaller-sized mammals including rodents (rats, mice, and voles), insectivorous animals (shrews and moles) as well as bats can serve as an animal model (Schlegel et al. 2014; Golden et al. 2015).

15.10.5 Isolation To date, hantavirus isolation from human sources is very difficult (Young et al. 1998; D’Souza and Patel 2020). Therefore, isolation of viruses is not considered as an ideal option for diagnostic purposes. However, experimental isolation of hantaviruses may be achieved by inoculating clinical specimens onto cultures of the Vero E-6 cell line and identifying using immunofluorescence after 1–2 weeks of incubation (Bedi et al. 2022).

15.10.6 Serologic Assays Plaque Reduction Neutralization Test (PRNT) has been traditionally used for serologically confirming hantaviral infections (Mir 2010). For commercial use and epidemiological investigation, enzyme-linked immunosorbent assays (ELISA) are widely used for the detection of hantaviral antibodies. To diagnose early infections, IgM ELISA is used where there should be a four-fold rise in infected. The rise of IgG antibody in four-fold indicate sera collected in the convalescent-phase of the disease (Mir 2010; Haese et al. 2015). Progen and RIDASCREEN® Hantavirus Puumala IgM/IgG ELISA assay are widely used in Western Europe (Depypere et al. 2020). To identify antibodies against recombinant hantaviral protein and synthetic peptides for hantavirus, a Rapid Immunoblot Strip Assay (RIBA) is in use.

15

Hantaviruses as Emergent Zoonoses: A Global Threat

391

15.10.7 Immunofluorescence Assay Serologic tests involving virus-infected cells are not commonly recommended because it requires BSL-3 containment. Initially in Europe and Asia, this test was used for serodiagnosis of HFRS where biochips containing infected cells are then reacted with diluted serum samples.

15.10.8 Immunoblot Assay In this assay, diluted sera is conjugated with antigens from the hantavirus and incubated on test strips. A control line is incorporated for easy detection of the antibody class IgG or IgM. This test has been implicated and is available in Europe in the brand name of recomLine Bunyavirus IgG/IgM test kit, Germany.

15.10.9 Focus Reduction Neutralization Test As hantaviral antibodies significantly cross-react (Mattar et al. 2015), a focus on reduction neutralization test (FRNT) can identify specific hantaviruses. FRNT is considered as gold standard which can identify and measure neutralizing antibody level of serum by comparing it with the relevant hantavirus titer. As the standard hantavirus serum is from experimentally inoculated rodents, it is usually less specific than acute phase sera of patients. This test is time-consuming, labor-intensive, and needs BSL-3 containment.

15.10.10 Molecular Diagnosis Hantaviral RNA extracted from lung tissue or blood collected from post-mortem sample should be subjected to PCR reaction after reverse transcription (RT-PCR) targeting S and M segments. PCR can detect hantavirus RNA 7–10 days after onset of symptoms. Though it is a highly sensitive diagnostic test, RT-PCR usually faces the issue of cross-contamination. Use and sensitivity of RT-PCR get compromised and become more cumbersome due to the presence of diverse viruses. In that case, a distinct advantage is that PCR product may be sequenced and analyzed phylogenetically. However, when viral RNA load is very low specially from tissue samples of humans and rodents nested-RT-PCR is the most suitable technique using primers designed against regions with high homology. Nested-RT-PCR tests have already been standardized for the diagnosis of HTNV, PUUV, and SNV. For very early detection of viral RNA even prior to the appearance of IgM antibodies, realtime RT-PCR could be another sensitive tool. When combined with immunologic techniques, Hantavirus real-time RT-PCR can guide knowing the mechanisms of pathogenesis and finding targets for antiviral treatments.

392

C. S. Mahapatra

15.10.11 Immunohistochemistry (IHC) Laboratory confirmation of tissue samples can be done by another sensitive method: IHC testing. Tissues fixed with formalin are treated with specific antibodies (monoclonal/polyclonal) to bind and detect hantavirus antigens. For HPS patients where sera are not available for diagnosis, IHC has got a very important role. In an outlined geographical area, IHC is also useful for retrospective assessment of the prevalence of the disease.

15.11 Prevention and Control 15.11.1 Vector Control According to the CDC, the method for the best prevention against acquiring hantavirus infection is to lessen physical exposure with rodent and rodent habitats. Unspecific prevention can be established by destructing rodent habitation, preventing entry inside the home by sealing holes or setting traps, use of rat kills or employing predators such as cats. As the viability of the virus at normal room temperature outside the host remain active for 48–72 h, ventilation or sunlight exposure of the rooms should be done before entering.

15.11.2 Personal Protective Measures Protective measures should be taken like the use of disinfectants, use of rubber gloves while handling infected materials, and use of respirators to avoid aerosol inhalation. Extra care while cleansing potentially rodent-infested habitats and rooms is crucial to bring down the risk of exposure.

15.11.3 Vaccines Besides general prevention in humans, for the specific prevention of Hantavirus vaccination is necessary mainly in risk groups. As of 2021, the United States Food and Drug Administration (FDA) has not approved any hantaviral vaccines for human use. Four types of vaccines have been researched and out of them, only DNA vaccines have progressed to clinical trials. 1. First-generation vaccines Inactivated vaccines: Inactivated vaccines produce short lasting immunity and do not cover cell-mediated immunity. Both rodent-brain-derived and inactivated cell culture vaccines have been formulated and tried in China as well as Korea. Since 1995, inactivated vaccines against HTNV and SEOV has got widespread

15

Hantaviruses as Emergent Zoonoses: A Global Threat

393

use in areas where HFRS endemicity prevails (Liu et al. 2020). Since 2003, Vero cell-cultured and purified bivalent vaccines after inactivation with formaldehyde for HTNV and SEOV are in use. In HTNV-vaccinated animal sera the level and proportion of the positive rates of N protein-specific IgM and IgG were significantly high. The highest values of specific IgG were reached at 3 months postvaccination and high seropositivity were maintained up to 3 post-vaccination years. Another hantavirus vaccine produced by formalin-inactivation and marketed as Hantavax® has been extensively utilized in South Korea for HFRS. Three-dose vaccination schedule (0, 1, and 13 months) of Hantavax® produce seroconversion with high titer of specific antibodies but was unable to produce significant effectiveness. 2. Second-generation vaccines (a) Virus-like particle vaccine Virus-like particles (VLP) mimic natural virus particles but are non-infectious due to a lack of infectious genetic material. Due to inherent self-assembly characteristics, structural proteins of the virus assemble in a repetitive manner without nucleic acid to form VLP. VLP vaccine is safe and efficacious in humans against hantavirus. European researchers have shown hepatitis B virus (HBV) core particles carrying the N protein of Hantaan or Puumala are highly immunogenic in mice and produce all IgG sub-classes of N protein-specific antibodies without any hindrance by core-specific antibodies (Koletzki et al. 2000). In China, the granulocyte-macrophage colony-stimulating factor (GM-CSF) and the cluster of differentiation (CD40L)-incorporated VLPs which were expressed in the eukaryotic system (Sf-9 and Chinese hamster ovary cells) showed a long-term and stable protective effect in mice (Cheng et al. 2016). In mice, HTNV VLP-induced immunity (cellular and humoral) was higher than immunity given by inactivated vaccines. This enhanced cellular response of the HTNV-specific VLP vaccine is due to the activation of macrophages and dendritic cells producing a greater CTL response and a higher levels of IFN-gamma. (b) Recombinant protein vaccine Baculovirus-expressed recombinant Gn and Gc glycoproteins and also the N protein is potent antigens to induce immunity against hantavirus. The amino terminus of the recombinant protein is the most epitopic and serves as the main antigenic domain. Adjuvantation can enhance the antigenicity as well as protective efficacy of such vaccine candidates. Some adjuvants like aluminum hydroxide, Freund’s adjuvant, OMP ‘A’ of Klebsiella pneumoniae, the IL-2 gene of humans, or the heat-shock proteins (HSPs) have been tested. 3. Third-generation vaccines Recombinant vector vaccine: For prevention of hantavirus infection in animals, these groups of vaccines are highly effective and may demand booster vaccinations to sustain long-term immunity. By inserting two genome segments (M and S) of HTNV into the vaccinia virus vector, a double-recombinant vaccine

394

C. S. Mahapatra

was prepared which could protect hamsters from virulent HTNV and SEOV challenge but not PUUV. Replication of defective adenovirus vectors expressing ANDV membrane glycoprotein or nucleoprotein elicited potent immunity in mice and protects hamsters against ANDV challenge (Safronetz et al. 2009). However, there was interference by pre-existing antibodies to common circulating adenoviruses. Vesicular stomatitis virus (VSV) pseudotyped vector expressing Gn and Gc of HTNV was able to protect mice against lethal HTNV challenge (Brown et al. 2011). Similarly competent recombinant VSV expressing ANDV Gn and Gc precursor was efficacious in Syrian hamster against challenge (Mittler et al. 2019). (a) Nucleic acid-based (DNA) vaccine: Currently, DNA vaccines are the most widely used HFRS and HCPS vaccines. In the USA, diversified DNA vaccines targeting the envelope glycoprotein gene of HTNV were developed. The pan-hantavirus vaccine using mixed plasmid DNA has also been tried. A chimeric DNA vaccine with multiple epitopes consisting of 25 epitopic glycoproteins of SEOV, HTNV, and PUUV (named SHP chimera) has also been developed (Zhao et al. 2012). Two separate DNA vaccines targeting the HTNV Gn or Gc fused with lysosome-associated membrane protein 1 (LAMP1) were formulated (Jiang et al. 2015).

15.11.4 Management of Diseases Hantaviruses primarily infect the endothelial system causing extensive capillary leakage of various organs including lungs and kidneys which results in several clinical indications. Hypotensive shock in HFRS and noncardiogenic pulmonary edema in HPS may progress to multi-organ failure.

15.11.4.1 Supportive Care Careful observation and prompt and judicious supportive treatment improve the survival rate of patients by greatly reducing mortality rates. In general for HFRS patients, maintenance of physiological blood pressure is important which can be done by intravenous administration of water and electrolyte. Besides that in patients with severe thrombocytopenia, platelet transfusion could be a choice. Intermittent hemodialysis (IHD) is highly effective to improve uremia and the first choice to rectify kidney dysfunction. For critical HFRS patients with multi-organ injury continuous renal replacement therapy (CRRT) should be applied. 15.11.4.2 Therapeutic At present, no post-exposure therapeutic agent has got approval against hantaviral infection, but various strategic treatments have been practiced to handle HFRS or HPS. To inhibit HPS in vivo, the application of immunotherapy has been demonstrated by administering neutralizing antibodies during acute phases of

15

Hantaviruses as Emergent Zoonoses: A Global Threat

395

illness. Passive transfer of serain hamster from duck, goose, or rabbit could save it from HPS. The trial shows that infected human sera could be used as a treatment option for HPS with borderline success. Two recombinant monoclonal antibodies, JL16 and MIB22 have completely neutralized deadly ANDV in hamsters (Williamson et al. 2021). Sometimes corticosteroids are also used as placebo therapy for HPS but that is clinically insignificant to patients.

15.11.4.3 Virus-Targeting Antivirals Antiviral treatment works best when applied soon after early signs of illness are exhibited, perhaps because in the case of post-acute infection uncontrolled immune responses aggravate the pathogenesis (Dheerasekara et al. 2020). 15.11.4.4 Ribavirin To date for hantaviruses, ribavirin is the only licensed antiviral whose therapeutic effectiveness had been proven in infected suckling mice and Syrian hamsters (Ogg et al. 2013). Mortality was decreased by seven-fold when patients were treated with a proper ribavirin dosage. It remained completely protective after intra-peritoneal administration up to 3 days post-infection, supporting the potential use as therapeutic. However, once HPS has advanced to the cardiopulmonary phase, ribavirin could not exert its effectiveness. Ribavirin therapy develops bradycardia, reversible anaemia, hyperbilirubinemia, and rashes as side effects in humans. 15.11.4.4.1 Favipiravir Favipiravir (T-705) is a pyrazine derivative which is the most recently developed anti-hantaviral drug. It can potently inhibit SNV and ANDV in vitro even at ≤ 5 μg/ mL. The effectivity of T-705 was imparted by decreased infectious viral load. T-705 is well tolerated in humans. Oral administration remained protective when used prophylactically prior to the onset of viremia against HPS.T-705 is much safer as it has got 6 times greater 50% lethal dose (LD50) over ribavirin in hamsters (Dheerasekara et al. 2020). 15.11.4.4.2 Lactoferrin It is a glycoprotein that binds iron. By inhibiting virus adsorption onto the cells, it shows its efficacy against Hantavirus. Lactoferrin and ribavirin in vitro produced a synergetic effect and completely inhibit foci formation. In vivo lactoferrin therapy was evaluated in suckling mice by administration of approximately 160 mg/kg body weight preceding the Hantavirus challenge which has demonstrated improved survival rates to around 90% (Brocato and Hooper 2019). 15.11.4.4.3 Vandetanib This therapeutic agent is a tyrosine kinase inhibitor. It targets the vascular endothelial growth factor (VEGF) receptor 2 activation which is responsible for the progression of HPS. Furthermore, survivability was increased by 23%in ANDV/hamsters models when challenged with ANDV after treating for 5 days with Vandetanib

396

C. S. Mahapatra

(Brocato and Hooper 2019). Unfortunately, serious side effects in human trials include allergy, hypertension, and various cardiovascular and pulmonary effects have been recorded on its initial evaluation. 15.11.4.4.4 ETAR This nucleoside analog stands for 1-β-D-Ribofuranosyl-3-ethynyl-[1,2,4] triazole (ETAR). It showed in vitro effectivity against HTNV and ANDV. Suckling mice could get protected with around 25% survival rate after intraperitoneal administration of ETAR at a dose rate of 12.5 to 25 mg/kg when challenged with HTNV at 10-day post-vaccination (Dheerasekara et al. 2020). 15.11.4.4.5 Cyclic Peptides CLVRNLAWC and CQATTARNC are two cyclic nonapeptides that have shown in vitro effects against SNV and ANDV (Hall et al. 2009). 15.11.4.4.6 Chloroquine This quinine substitute has a potential antiviral effect against Hantaan, Sin Nombre, Andes, and Dobrava-Belgrade virus (Vergote et al. 2021).

15.12 Future Perspective The emergence and re-emergence of zoonotic pathogens are always mysterious and unresolved. One approach to answering that has been the formulation and analyzation of SIR (susceptible, infectious, and recovered) type mathematical models for virus–host models (Wesley 2008). Prediction of the next zoonotic threat will be easier as it will bear some similarities to former counterparts. The ‘zoonotic spillovers’ potentially contribute to the sylvatic cycle of pathogen and cross-species transmission and may be instrumental in the evolutionary process of novel hantaviruses (Ermonval et al. 2016). Discrete-time SI model can be applied to investigate the role of juvenile and developmental (non-reproductive) stages as well as reproductive stages in the persistence of infection. These attempts will accelerate the exploration of new ecological epitome and will impart a true perception of episodic zoonotic epidemics.

References Alonso DO, Pérez-Sautu U, Bellomo CM, Prieto K, Iglesias A, Coelho R et al (2020) Person-toperson transmission of Andes virus in hantavirus pulmonary syndrome, Argentina, 2014. Emerg Infect Dis 26(4):756 Avšič-Županc T, Saksida A, Korva M (2019) Hantavirus infections. Clin Microbiol Infect 21:e6– e16 Bedi JS, Vijay D, Dhaka P (2022) Textbook of Zoonoses. John Wiley & Sons Bisen PS, Raghuvanshi R (2013) Emerging epidemics: management and control. John Wiley & Sons

15

Hantaviruses as Emergent Zoonoses: A Global Threat

397

Braun M, Björkström NK, Gupta S, Sundström K, Ahlm C, Klingström J, Ljunggren HG (2014) NK cell activation in human hantavirus infection explained by virus-induced IL-15/IL15Rα expression. PLoS Pathog 10(11):e1004521 Brocato RL, Hooper JW (2019) Progress on the prevention and treatment of hantavirus disease. Viruses 11(7):610 Brown KS, Safronetz D, Marzi A, Ebihara H, Feldmann H (2011) Vesicular stomatitis virus-based vaccine protects hamsters against lethal challenge with Andes virus. J Virol 85(23): 12781–12791 Chand S, Thapa S, Kon S, Johnson SC, Poeschla EM, Franco-Paredes C et al (2020) Hantavirus infection with renal failure and proteinuria, Colorado, USA, 2019. Emerg Infect Dis 26(2):383 Cheng LF, Wang F, Zhang L, Yu L, Ye W, Liu ZY et al (2016) Incorporation of GM-CSF or CD40L enhances the immunogenicity of Hantaan virus-like particles. Front Cell Infect Microbiol 6:185 Chinthaginjala H, Ahad HA, Sumanth G, Shaik M, Dasari RR (2020) Hunting hantavirus: a quick guide for Healthcare Professionals before It Invades the Globe unlike COVID-19. Int J Pharm Phytopharmacological Res 1–6 D’Souza MH, Patel TR (2020) Biodefense implications of New-World Hantaviruses. Front Bioeng Biotechnol 8:925 Dara L, Abhinav GVKS (2020) HANTAVIRUS: an aerosolized virus. Sciences (IRJPMS) 3(3): 33–35 Depypere M, Lagrou K, Van Esbroeck M, Houben E, Van Ranst M (2020) Analytical performance of the RIDASCREEN® Hantavirus Puumala IgG/IgM ELISA assay. Viruses 12(2):226 Dheerasekara K, Sumathipala S, Muthugala R (2020) Hantavirus infections— treatment and prevention. Curr Treat Options Infect Dis 12(4):410–421 Dowall SD, Graham VA, Aram M, Findlay-Wilson S, Salguero FJ, Emery K, Hewson R (2020) Hantavirus infection in type I interferon receptor-deficient (A129) mice. J Gen Virol 101(10): 1047 Ermonval M, Baychelier F, Tordo N (2016) What do we know about how hantaviruses interact with their different hosts? Viruses 8(8):223 Golden JW, Hammerbeck CD, Mucker EM, Brocato RL (2015) Animal models for the study of rodent-borne hemorrhagic fever viruses: arenaviruses and hantaviruses. BioMed Res Int 2015: 793257 Gonzalez JP, Souris M, Valdivia-Granda W (2018) Global spread of hemorrhagic fever viruses: predicting pandemics. In: Hemorrhagic fever viruses. Humana Press, New York, NY, pp 3–31 Guo WP, Lin XD, Wang W, Tian JH, Cong ML, Zhang HL et al (2013) Phylogeny and origins of hantaviruses harbored by bats, insectivores, and rodents. PLoS Pathog 9(2):e1003159 Hall PR, Hjelle B, Njus H, Ye C, Bondu-Hawkins V, Brown DC et al (2009) Phage display selection of cyclic peptides that inhibit Andes virus infection. J Virol 83(17):8965–8969 Haese N, Brocato RL, Henderson T, Nilles ML, Kwilas SA, Josleyn MD, Hammerbeck CD, Schiltz J, Royals M, Ballantyne J, Hooper JW, Bradley DS (2015) Antiviral biologic produced in DNA vaccine/goose platform protects hamsters against hantavirus pulmonary syndrome when administered post-exposure. PLoS Negl Trop Dis 9(6):e0003803 Hepojoki J, Strandin T, Lankinen H, Vaheri A (2012) Hantavirus structure– molecular interactions behind the scene. J Gen Virol 93(8):1631–1644 Heyman P, Vaheri A, Lundkvist Å, Avsic-Zupanc T (2009) Hantavirus infections in Europe: from virus carriers to a major public-health problem. Expert Rev Anti-Infect Ther 7(2):205–217 Hjertqvist M, Klein SL, Ahlm C, Klingström J (2010) Mortality rate patterns for hemorrhagic fever with renal syndrome caused by Puumala virus. Emerg Infect Dis 16(10):1584 Holmes EC, Zhang YZ (2015) The evolution and emergence of hantaviruses. Curr Opin Virol 10: 27–33 Hussein IT, Haseeb A, Haque A, Mir MA (2011) Recent advances in hantavirus molecular biology and disease. Adv Appl Microbiol 74:35–75

398

C. S. Mahapatra

Jiang DB, Sun YJ, Cheng LF, Zhang GF, Dong C, Jin BQ et al (2015) Construction and evaluation of DNA vaccine encoding Hantavirus glycoprotein N-terminal fused with lysosome-associated membrane protein. Vaccine 33(29):3367–3376 Jiang H, Du H, Wang LM, Wang PZ, Bai XF (2016) Hemorrhagic fever with renal syndrome: pathogenesis and clinical picture. Front Cell Infect Microbiol 6:1 Jiang H, Zheng X, Wang L, Du H, Wang P, Bai X (2017) Hantavirus infection: a global zoonotic challenge. Virol Sin 32(1):32–43 Jonsson CB, Figueiredo LTM, Vapalahti O (2010) A global perspective on hantavirus ecology, epidemiology, and disease. Clin Microbiol Rev 23(2):412–441 Klempa B, Witkowski PT, Popugaeva E, Auste B, Koivogui L, Fichet-Calvet E et al (2012) Sangassou virus, the first hantavirus isolate from Africa, displays genetic and functional properties distinct from those of other murinae- associated hantaviruses. J Virol 86(7): 3819–3827 Knudsen RC, Mathews HM, Richmond JY, Craven RB, Garner JS, Karabatsos N, et al (1994) Laboratory management of agents associated with hantavirus pulmonary syndrome; interim biosafety guidelines Koehler FC, Di Cristanziano V, Späth MR, Hoyer-Allo KJR, Wanken M, Müller RU, Burst V (2022) The kidney in hantavirus infection— epidemiology, virology, pathophysiology, clinical presentation, diagnosis and management. Clin Kidney J 15:1231 Koletzki D, Lundkvist Å, Sjölander KB, Gelderblom HR, Niedrig M, Meisel H et al (2000) Puumala (PUU) hantavirus strain differences and insertion positions in the hepatitis B virus core antigen influence B-cell immunogenicity and protective potential of core-derived particles. Virology 276(2):364–375 Lee HW, Dalrymple JM (1989) Manual of hemorrhagic fever with renal syndrome, vol 11. Korea Univ Seoul Inst Viral Diseases, p S846 Lee HW, Vaheri A, Schmaljohn CS (2014) Discovery of hantaviruses and of the Hantavirus genus: personal and historical perspectives of the Presidents of the International Society of Hantaviruses. Virus Res 187:2–5 Lewis SL (2005) A newly identified hantavirus: The development of immunologic diagnostic assays and phylogenetic analysis for detection and characterization. The University of Tennessee Liu R, Ma H, Shu J, Zhang Q, Han M, Liu Z et al (2020) Vaccines and therapeutics against hantaviruses. Front Microbiol 10:2989 Luby S, Gurley E, Shapshak P, Sinnot JT, Somboonwit C, Kuhn JH (2015) Global virology Iidentifying and investigating viral diseases. Springer, New York MacNeil A, Ksiazek TG, Rollin PE (2011) Hantavirus pulmonary syndrome, United States, 1993–2009. Emerg Infect Dis 17(7):1195 Martin, M. (1996, May 15th). The hanta phantom. Down to Earth Mattar S, Guzmán C, Figueiredo LT (2015) Diagnosis of hantavirus infection in humans. Expert Rev Anti-Infect Ther 13(8):939–946 Meechan, P. J., & Potts, J. (2020). Biosafety in microbiological and biomedical laboratories Mir MA (2010) Hantaviruses. Clin Lab Med 30(1):67–91 Mittler E, Dieterle ME, Kleinfelter LM, Slough MM, Chandran K, Jangra RK (2019) Hantavirus entry: Perspectives and recent advances. Adv Virus Res 104:185–224 Muranyi W, Bahr U, Zeier M, van der Woude FJ (2005) Hantavirus infection. J Am Soc Nephrol 16(12):3669–3679 Muyangwa M, Martynova EV, Khaiboullina SF, Morzunov SP, Rizvanov AA (2015) Hantaviral proteins: structure, functions, and role in hantavirus infection. Front Microbiol 6:1326 Nichol ST, Spiropoulou CF, Morzunov S, Rollin PE, Ksiazek TG, Feldmann H et al (1993) Genetic identification of a hantavirus associated with an outbreak of acute respiratory illness. Science 262(5135):914–917

15

Hantaviruses as Emergent Zoonoses: A Global Threat

399

Nielsen CF, Sethi V, Petroll AE, Kazmierczak J, Erickson BR, Nichol ST et al (2010) Case Report: Seoul Virus Infection in a Wisconsin Patient with Recent Travel to China, March 2009: First Documented Case in the Midwestern United States. Am J Trop Med Hygiene 83(6):1266 Ogg M, Jonsson CB, Camp JV, Hooper JW (2013) Ribavirin protects Syrian hamsters against lethal hantavirus pulmonary syndrome—after intranasal exposure to Andes virus. Viruses 5(11): 2704–2720 Padula PJ, Edelstein A, Miguel SDL, Lopez NM, Rossi CM, Rabinovich RD (1998) Hantavirus pulmonary syndrome outbreak in Argentina: molecular evidence for person-to-person transmission of Andes virus. Virology 241(2):323–330 Panculescu-Gatej RI, Sirbu A, Dinu S, Waldstrom M, Heyman P, Murariu D et al (2014) Dobrava virus carried by the yellow-necked field mouse Apodemus flavicollis, causing hemorrhagic fever with renal syndrome in Romania. Vector-Borne Zoonotic Diseases 14(5):358–364 Plyusnin A, Vaheri A, Lundkvist A (2006) Saaremaa hantavirus should not be confused with its dangerous relative, Dobrava virus. J Clin Microbiol 44(4):1608–1611 Ramanathan H (2007) Trafficking of hantaviral nucleocapsid proteins. The University of Alabama at Birmingham Riera CS (2019) Hantaviruses, Escapees from the Death Row: Viral Mechanisms Towards Apoptosis Resistance. Doctoral dissertation, Karolinska Institutet (Sweden) Safronetz D, Hegde NR, Ebihara H, Denton M, Kobinger GP, St. Jeor S et al (2009) Adenovirus vectors expressing hantavirus proteins protect hamsters against lethal challenge with Andes virus. J Virol 83(14):7285–7295 Safronetz D, Feldmann H, De Wit E (2015) Birth and pathogenesis of rogue respiratory viruses. Ann Rev Pathol Mech Disease 10:449–471 Schlegel M, Jacob J, Krüger DH, Rang A, Ulrich RG (2014) Hantavirus emergence in rodents, insectivores and bats: what comes next? In: The role of animals in emerging viral diseases. Academic Press, pp 235–292 Schönrich G, Rang A, Lütteke N, Raftery MJ, Charbonnel N, Ulrich RG (2008) Hantavirus-induced immunity in rodent reservoirs and humans. Immunol Rev 225(1):163–189 Settergren B (2000) Clinical aspects of nephropathia epidemica (Puumala virus infection) in Europe: a review. Scand J Infect Dis 32(2):125–132 Song JW, Baek LJ, Schmaljohn CS, Yanagihara R (2007) Thottapalayam virus, a prototype shrewborne hantavirus. Emerg Infect Dis 13(7):980 Van Hook CJ (2018) Hantavirus pulmonary syndrome—the 25th anniversary of the Four Corners outbreak. Emerg Infect Dis 24(11):2056 Vergote V, Laenen L, Mols R, Augustijns P, Van Ranst M, Maes P (2021) Chloroquine, an antimalaria drug as effective prevention for hantavirus infections. Front Cell Infect Microbiol 11: 580532 Voutilainen L, Savola S, Kallio ER, Laakkonen J, Vaheri A, Vapalahti O, Henttonen H (2012) Environmental change and disease dynamics: effects of intensive forest management on Puumala hantavirus infection in boreal bank vole populations. PLoS One 7(6):e39452 Wei X, Li X, Song S, Wen X, Jin T, Zhao C et al (2022a) Trends and focuses of hantavirus researches: a global bibliometric analysis and visualization from 1980 to 2020. Arch Public Health 80(1):1–14 Wei X, Meng B, Peng H, Li Y, Liu M, Si H et al (2022b) Hemorrhagic fever with renal syndrome caused by destruction of residential area of rodent in a construction site: epidemiological investigation. BMC Infect Dis 22(1):1–10 Wesley CL (2008) Discrete-time and continuous-time models with applications to the spread of hantavirus in wild rodent and human populations. Doctoral dissertation, Texas Tech University Williamson BN, Prescott J, Garrido JL, Alvarez RA, Feldmann H, Barría MI (2021) Therapeutic Efficacy of Human Monoclonal Antibodies against Andes Virus Infection in Syrian Hamsters. Emerg Infect Dis 27(10):2707 Wilson JM, Makidon PE, Bergin IL (2020) Rat models of infectious disease. In: The laboratory rat. Academic Press, pp 1107–1134

400

C. S. Mahapatra

Young JC, Mills JN, Enria DA, Dolan NE, Khan AS, Ksiazek TG (1998) New world hantaviruses. Br Med Bull 54(3):659–673 Zhang YH, Ge L, Liu L, Huo XX, Xiong HR, Liu YY et al (2014) The epidemic characteristics and changing trend of hemorrhagic fever with renal syndrome in Hubei Province, China. PloS One 9(3):e92700 Zhang Y, Ma R, Wang Y, Sun W, Yang Z, Han M et al (2021) Viruses run: the evasion mechanisms of the antiviral innate immunity by hantavirus. Front Microbiol 12 Zhao C, Sun Y, Zhao Y, Wang S, Yu T, Du F et al (2012) Immunogenicity of a multi-epitope DNA vaccine against hantavirus. Hum Vaccin Immunother 8(2):208–215

Kyasanur Forest Disease: A Neglected Zoonotic Disease of India

16

Himanshu Kaushal, Shalini Das, Ramesh S. Kartaskar, Mahesh M. Khalipe, and Tushar Chiplunkar

Abstract

Kyasanur Forest Disease (KFD) is an acute viral illness with life-threatening hemorrhagic fever in humans and monkeys. It is caused by the KFD virus, tickborne flavivirus, endemic in the western ghats of southern India. Haemaphysalis spinigera, a hard tick, has been demonstrated to be the main vector and reservoir of the KFD virus. In humans, the disease clinically manifests in various forms, ranging from a mild form to severe hemorrhagic complications leading to death. The majority of infected individuals recover without many complications; however, approximately 20% of cases suffer from more severe biphasic clinical manifestations with a case fatality rate of 3–5%. Initially, KFD was confined to the state of Karnataka, India but in recent years, the KFD virus has geographically expanded to adjoining states such as Tamil Nadu, Kerala, Goa and Maharashtra. With a partially effective vaccine and no specific antivirals drug, KFD is a major public health concern in the southern parts of India. Even over six decades of discovery of the KFD virus, a biosafety level 3 pathogen, we lack effective countermeasures; thus, KFD remained a neglected disease. Therefore, it is imperative to develop innovative intervention strategies such as repurposing drugs, developing a more effective vaccine, capacity building for diagnostics and social awareness to counteract this dreaded disease.

H. Kaushal (✉) · S. Das ICMR-National Institute of Virology, Pune, India R. S. Kartaskar · T. Chiplunkar Taluka Health Office, Sindhudurg, Maharashtra, India M. M. Khalipe District Health Office, Sindhudurg, Maharashtra, India # The Author(s), under exclusive license to Springer Nature Singapore Pte Ltd. 2023 P. L. Bhukya et al. (eds.), Emerging Human Viral Diseases, Volume I, https://doi.org/10.1007/978-981-99-2820-0_16

401

402

H. Kaushal et al.

Keywords

Alkhurma Hemorrhagic fever virus · Haemaphysalis · Kyasanur Forest Disease · KFD · Monkey fever · Omsk Hemorrhagic fever virus · Russian Spring Summer Encephalitis virus · Tick · Zoonotic

16.1

Historical Perspective

The history of Kyasanur Forest Disease (KFD) dates back nearly six decades, in the year 1957. The disease was discovered in the ‘Kyasanur Forest’ of Shimoga (renamed Shivamogga) district, in the state of Karnataka, India. A zoonotic disease that was originally limited to monkeys later spilled over to forest dwellers and nearby village residents. The disease is also called ‘monkey fever’ because of its close association with dead monkeys (Pavri 1989). The disease is caused by the Kyasanur Forest Disease virus (KFDV) of the family Flaviviridae and is transmitted via ticks (Mythreyi et al. 2021). The earliest report of fever outbreaks in humans with a history of forest exposure in the Kyasanur area was recorded in 1957. During the same period, the report of the death of a large number of monkeys in the Kyasanur forest was also noticed. The affected persons primarily were villagers living nearby forest areas and often had to visit forests for their livelihood such as cultivating crops in the semi-cleared areas, gathering firewood, and grazing animals (Trapido et al. 1959). The increased human activities in the forested areas might have favoured the virus spill over to vulnerable mammalian hosts, responsible for observed fever outbreaks in the area. Initially, the local public health authorities perceived this outbreak due to an enteric fever, and soon after the government of Karnataka declared it a typhoid epidemic (Bhat 1990; Work et al. 1957). As a containment strategy, the distribution of antibiotics was started across the affected zones and patient care was strengthened. However, the anti-typhoid measures failed to contain outbreak (Directorate of Health and Family Welfare and Goverment of Karnataka 2020). Later, monkey fever was misunderstood as Yellow Fever, another viral haemorrhagic disease transmitted by the infected Aedes aegypti mosquitoes. However, the Yellow fever virus was not isolated from the mosquito pools collected from the affected areas, even after multiple attempts (Work et al. 1957). Therefore, the presence of Yellow fever was ruled out. Soon after, attempts to isolate viruses from infected monkeys and human cases were successful and the viral isolates were found to be of similar nature (Work et al. 1957). The virus was identified and classified to a member of the Russian SpringSummer Encephalitis (RSSE) complex (Work et al. 1957). This provided clue that the probable etiological viral agents might have come from Siberian regions through migratory birds. This initiated a massive launch of investigations on the role of migratory birds in bringing ticks and the virus (Holbrook 2012). Among all the tick populations collected, the genus Haemaphysalis accounted for 99.5% and others belonged to the genera Amblyomma, Boophilus, Dermacentor and Hyalomma

16

Kyasanur Forest Disease: A Neglected Zoonotic Disease of India

403

(Gupta and Pal 1975). H. spinigera was the principal species, followed by H. wellingtoni and H. turturis. The tick surveillance revealed that all identified tick populations were indigenous to the region and the study concluded that there was no evidence of birds transporting ticks from the other regions. Tick surveillance activities continued further and massive tick populations were collected and virus isolation was attempted. Finally, KFDV was successfully isolated from nymphs of H. spinigera and H. turturis (Rajagopalan and Anderson 1971). The clinical manifestations of KFDV-infected cases showed similar features to that of Omsk Hemorrhagic Fever (OHF), caused by a virus of the RSS complex with no overt signs of encephalitis (Work 1958a). Viruses that are closely linked to KFD are OHF virus present in Siberia (Work et al. 1959), Alkhurma hemorrhagic fever virus (AHFV) in Saudi Arabia (MacKenzie and Williams 2009) and Nanjianyin virus in China (Wang et al. 2009). Despite genetically related, KFDV and AHFV remarkably differ in their pathogenesis and tissue tropism (Sawatsky et al. 2014). KFD is classified under tick-borne viral hemorrhagic fever (NCDC 2020).

16.2

Epidemiology

In 1957, the first KFD case was reported from the Shimoga district, Karnataka that geographically represents the western ghats of southern India. Between 1957 and 1971, the disease was largely confined to the Shimoga district of Karnataka. From 1972 onwards, sporadic cases of KFD were noted in the neighbouring districts such as Udupi, Uttar Kannada, and Dakshina Kannada (Pattnaik 2006). Since 1973, geographical expansion of the KFD virus was noted and cases have been reported from several new foci distant from original endemic areas. In 2012–2013, the KFD virus was detected in autopsy samples of monkeys and tick pools in Nilgiris district of Tamil Nadu and Wayanad district of Kerala state (Directorate of Health and Family Welfare and Goverment of Karnataka 2020; Mourya et al. 2013). In 2014–2015, two other districts of Kerala viz. Malappuram and Alappuzha reported human cases of KFD (Bhatia et al. 2020; Sadanandane et al. 2017). In 2015, the state of Goa for the first time saw a case of KFD with nine deaths (Murhekar et al. 2015; Patil et al. 2017). In 2016, Sindhudurg district of Maharashtra reported 129 cases of KFD and 8 deaths (Bhatia et al. 2020). Currently, approximately 400–500 cases of KFD are reported annually with case fatality rates of 3 to 5% (Holbrook 2012). The chronological detection of KFD cases is depicted in the Fig. 16.1. Until now, KFD is confined to India only and has been reported from five states namely Karnataka, Tamil Nadu, Kerala, Goa and Maharashtra (Fig. 16.2). However,

Fig. 16.1 Chronological detection of KFD cases in India

404

H. Kaushal et al.

Fig. 16.2 Pictorial representation of states of India with confirmed cases of KFD. Source: The layout of India map was made from mapchart.net available from (https://mapchart.net/india.html)

anti-KFDV antibodies have been detected from non-endemic areas such as Kutch and Saurashtra (Gujarat), Rajasthan, Ramtek (Nagpur), Kingston, and Parbatpur (West Bengal) (Mourya et al. 2012; Sarkar and Chatterjee 1962). Additionally, a recent serosurvey in the human population employing hemagglutination inhibition assay and detection of neutralizing antibodies (NAbs) indicated the exposure to KFDV in the Andaman and Nicobar islands of India (Pattnaik 2006). Regions of India showing the presence of antibodies against KFDV is shown in Fig. 16.3. The KFD virus belongs to the tick-borne encephalitis (TBE) serocomplex of flaviviruses that includes OHF virus, TBE virus, Powassan virus, Langat virus and Louping ill virus. Molecular epidemiological studies have revealed that the KFD virus is closely related to some other tick-borne viruses. The sequence identity demonstrated similarity with Alkhurma virus (97%), TBEV (79.6%), Louping ill virus (79%), OHFV (78.7%), Langat virus (78.7%) and Powassan virus (76.3%) (Shah et al. 2018). OHFV which is prevalent in Siberia is distantly related to KFD virus (Shah et al. 2018).

16

Kyasanur Forest Disease: A Neglected Zoonotic Disease of India

405

Fig. 16.3 Regions of India showing the presence of antibodies against KFDV. Source: The layout of India map was made from mapchart.net available from (https://mapchart.net/india.html)

16.3

Transmission

In the transmission cycle of the KFD virus, ticks serve as the main vector and reservoirs of KFDV (Sadanandane et al. 2017). A study on tick surveillance from Malappuram and Wayanad districts of Kerala demonstrated H. spinigera and H. turturis as the main reservoirs of the KFD virus (Sadanandane et al. 2017). Other Haemaphysalis species also act as vectors in virus transmission including H. formosensis, H. cuspidate, H. aculeate, H. papuana kinneari, H. bispinosa, H. kyasanurensis and H. wellingtoni (Shah et al. 2018). Besides, other genera such as Ixodes, Rhipicephalus, Dermacentor, Hyalomma, Argas, and Ornithodoros are demonstrated to have an ability to cause infection (Ajesh et al. 2017). Among these genera, Ixodes serve as a key disease vector of animals and humans and is considered a key reservoir of KFD virus (Boshell and Rajagopalan 1968). The Haemaphysalis ticks transmit the infection to non-human vertebrates such as birds or mammals (Ajesh et al. 2017).

406

H. Kaushal et al.

Ticks in its nymphal stage are the most efficient in the viral transmission. Unfed nymphs stage is particularly anthropophilic in nature and prefers humans over other animal species, and thus transmits the infection to human beings (Pattnaik 2006). After the maturation of the infected nymph into adults, the female ticks lay eggs and eventually giving rise to larvae, which feed on small animals and monkeys and may accidentally infect humans. Subsequently, larvae grow into nymphs and thus life cycle continues (Mourya et al. 2014). The natural host of KFDV includes wild non-human primates such as red-faced bonnet monkeys and black-faced langurs (Bhatt et al. 1966). The wild monkeys get the infection by the bites of KFDV-infected ticks. The infection causes acute febrile disease in monkeys and if left unattended, the monkeys eventually die. After the monkey’s death, the body temperature drops and infested ticks move away and thereby generating newer hot spots of infected ticks for further dissemination of viral disease (Sharma et al. 2019). A reservoir species plays a critical role in the maintenance of pathogens that circulate between the vectors and the reservoirs. In the endemic areas, KFDV is mainly circulated and maintained in the small animals such as rodents, shrews and ground birds (Mourya et al. 2013; Shah et al. 2018). Due to the shorter lifespan of rodents, there is always a large naïve population of rodents available to maintain the virus in the natural cycle. For this reason, they are considered the ideal maintenance host of KFDV (Holbrook 2012). Besides, anti-KFDV NAbs have been found in buffaloes, wild boars, cattle, squirrels, shrews, bats and several bird species (Bhat et al. 1978). There is no report of human-to-human transmission of KFDV, and humans are the dead-end hosts (Sharma et al. 2019) as ticks mainly infest animals. Humans are not the preferred hosts and get the disease by infected nymphs only accidently (Murhekar et al. 2015). The transmission cycle of the KFDV is depicted in Fig. 16.4.

16.4

Clinical Features

Clinical features of KFD resemble that of another hemorrhagic viral disease, OHF (Růžek et al. 2010). The disease clinically manifests in various forms, ranging from a mild form to severe hemorrhagic complications leading to death. The majority of infected individuals with the KFD virus recover without much complication (Iyer et al. 1959; Work et al. 1957). However, approximately 20% of cases show biphasic clinical manifestations (Rajaiah 2019). Also, a recent report has demonstrated the presence of anti-KFDV IgM in the sera of healthy individuals from endemic areas indicating the presence of asymptomatic infection (Gurav et al. 2018). The typical course of KFDV infection starts with the initial incubation period of 3 to 8 days. Thereafter, the disease clinically manifests with a sudden onset of high fever (>40 °C) with chills and severe headache. Other symptoms such as vomiting, severe muscle pain, gastrointestinal complications, and bleeding from the nose, and gum may occur 3–4 days following the onset of initial symptoms. Additional findings include low blood pressure, thrombocytopenia, erythrocytopenia, and

16

Kyasanur Forest Disease: A Neglected Zoonotic Disease of India

407

Fig. 16.4 The life cycle of Haemaphysalis tick and KFD virus transmission

leukopenia. In the majority of KFD cases, the initial clinical symptoms subsided after 1–2 weeks and the patients clinically recover. However, a subset (20%) of KFD cases experiences the second wave of symptoms in the beginning of the third week from the onset of the initial phase. The typical symptoms include manifestation of neurological signs such as mental disturbances, tremors, severe headache and vision deficits (Wadia 1975; Work 1958a; Work et al. 1957). However, no studies have demonstrated evidence of meningitis or encephalitis post-infection with KFDV (Webb 1961; Work et al. 1957). Also, long-term complications following recovery from KFD infection are rare (Munivenkatappa et al. 2018). Some atypical clinical complications associated with a subset of KFD cases have been reported. These include the discharge of fresh blood in the stool (Priya et al. 2016), the opacity of the lens and keratitis (Grard et al. 2007; Pattnaik 2006; Rao 1958; Shah et al. 2018; Work et al. 1957), hepatosplenomegaly (Adhikari Prabha et al. 1993; Webb 1961; Work et al. 1957), signs of dehydration and hypotension (Adhikari Prabha et al. 1993; Pavri 1989), blood-tinged sputum, pneumonia (Work 1958a), papulovesicular eruption on the soft palate, (Work et al. 1959), and loss of hair (Sadanandane et al. 2017). There may be enlarged and soft or sometimes shotty cervical lymph glands (Work 1958a).

408

16.5

H. Kaushal et al.

Diagnosis

During the early days, diagnosis of KFD mainly relied on classical methods such as animal inoculation tests and antibody-based assays such as neutralization test (NT) (Anderson 1970; Work 1958b), hemagglutination inhibition (HI) (Upadhyaya et al. 1975), complement fixation (CF) (Work 1958b). The preferred diagnostic samples include human peripheral blood, monkey viscera samples and a tick pool. With the advent of the molecular test, reverse transcription-polymerase chain reaction (RT-PCR) became the first line of a diagnostic assay for KFD (Mehla et al. 2009; Mourya et al. 2012). This assay is highly sensitive and fast compared to the earlier diagnostic methods such as virus isolation, HI, CF and NT (Pavri and Anderson 1970). The PCR test employs flavivirus-specific non-structural (NS) protein-5 amplification for the KFD diagnosis (Mourya et al. 2012). The utility of molecular diagnostic assay is limited to the initial phase of the illness because detectable viremia persists only for a week or so. Thereafter, diagnosis of KFD relies on the ELISA-based serological assay (Yadav et al. 2019). A recent study by Yadav et al. demonstrated PCR positivity during the first four days post onset of symptoms. After 10 days of illness, PCR could detect the virus in less than 20% of the KFD case, thus indicating a downward trend of viremia indicating virus clearance. However, in some cases, virus was detected till 18 days post illness (Yadav et al. 2019). Additionally, beyond 10 days post illness, the ELISA-based serological method was found relevant for KFD diagnosis (Gupta et al. 2022; Yadav et al. 2019). The algorithm for confirmatory diagnosis of KFD based on the available diagnostic assays is described in Fig. 16.5.

16.6

Laboratory Findings

Leukopenia is a consistent feature during the initial stage of the disease. This decrease in the total count of WBCs is contributed by a drop in both lymphocytes and neutrophils (John 2014; Pattnaik 2006). In the majority of the cases, the neutrophil count may drop below 2000 cells/ml and viremia is constantly high during the first-week post onset of symptoms (Pattnaik 2006) Peripheral blood leukocyte counts reached normal during the convalescent phase of KFD (Devadiga et al. 2020). Liver enzymes such as alanine aminotransferase, aspartate aminotransferase, and alkaline phosphatase were slightly raised during the acute phase of KFDV. Bleeding and clotting time are high in few patients (Devadiga et al. 2020). Studies by Sathe et al. found that the circulating levels of IFN during the acute phase were higher than in the convalescent phase (Pattnaik 2006; Sathe et al. 1991) Besides, low levels of serum albumin, high levels of bilirubin, and raised zinc sulphate turbidity was noted as the abnormal pattern (NCDC 2020).

16

Kyasanur Forest Disease: A Neglected Zoonotic Disease of India

409

Fig. 16.5 The proposed flowchart for the confirmatory diagnosis of Kyasanur Forest Disease

16.7

Pathophysiology

KFD virus largely targets human vascular endothelial cells or vascular beds leading to increased intravascular permeability and consequently hemorrhagic manifestations (Sirmarova et al. 2018). In majority of the hemorrhagic KFD cases, the underlying causes of coagulopathy are multifactorial that include disseminated intravascular coagulation (DIC), hepatic damage, and marrow injury to megakaryocytes (Venugopal et al. 1992). The bleeding in most hemorrhagic fevers has been demonstrated due to DIC implicated in the depletion of coagulation factors resulting in substantial plasma leakage and hypovolemia. This may trigger multiorgan failure, shock, or death if the patient is not attended to on time (Khan et al. 2008). Studies on post-mortem histology indicated focal necrosis in liver and shedding of tubular epithelium in kidney (Work et al. 1959). The primary pathological conditions are hepatomegaly with parenchymatous degeneration, hemorrhagic pneumonitis, nephrosis, and reticuloendothelial cells in the spleen and liver with high

410

H. Kaushal et al.

erythrophagocytosis in the spleen (Pattnaik 2006). A subset of patients may develop bronchopneumonia or coma before death (Pattnaik 2006).

16.8

Host-Immune Responses

Host-immune responses to KFDV have not been studied in detail and therefore, pathological and/or protective immune factors could not be characterised. However, reports on other flavivirus suggested that the viral components in the infected cells initiate signaling cascades, leading to type 1 IFN (IFN-α and IFN-β) production. Subsequently, the activation of the JAK/STAT signaling leads to an antiviral state and adaptive immune responses (de la Fuente et al. 2017). The role of humoral immune responses has been demonstrated in limiting the KFD virus infection. In the initial phase of KFD, complement-fixing and hemagglutination inhibition antibodies rise, followed by an increase in anti-KFDV NAbs by second week, reaching the peak by third or fourth week. These antibodies largely target Flavivirus E protein and inhibit viral attachment, internalization, and replication within the infected cells. Anti-KFDV antibodies persist for a decade even in the non-relapse KFD cases (Achar et al. 1981).

16.9

Genome

KFD virus belongs to the family Flaviviridae and has a linear, non-segmented, positive-sense RNA genome. Its genome has 10,774 bases and encodes a single polypeptide C-prM-E-NS1-NS2A-NS2B-NS3-NS4A-NS4B-NS5 and posttranslation, the polypeptide is cleaved into seven non-structural proteins (NS1, NS2a, NS2b, NS3, NS4a, NS4b, and NS5) and three structural proteins (C, M/prM, and E) (Dodd et al. 2011). It has a spherical shape of 40–65 nm with an icosahedral nucleocapsid. The KFD virus genome structure is depicted in Fig. 16.6. The envelope (E) glycoprotein of the KFD virus has 80% amino acid sequence homology with that of TBEV. Furthermore, the KFD virus was demonstrated to have approximately 40% sequence homology with other flaviviruses such as Japanese encephalitis, West Nile, dengue virus, and yellow fever viruses with conserved cysteine. Whereas the partial c-DNA sequence of the NS5, an RNA-dependent RNA polymerase have sequence similarity with Alkhurma virus (99%), followed by

Fig. 16.6 Structure of KFDV

16

Kyasanur Forest Disease: A Neglected Zoonotic Disease of India

411

TBEV (94%); RSSE (93%), Langat (93%), OHF (93%) viruses (Holmes et al. 1999; Pattnaik 2006; Seligman and Gould 2004).

16.10 Treatment There is no approved treatment for KFD and the patient management relies mainly on symptomatic and supportive care (Sunith et al. 2020). The supportive care includes maintaining basic parameters like BP, hydration and normal blood cell counts. A blood transfusion may be considered depending on the patient’s condition (John 2014). For secondary bacterial infections, antimicrobial therapy is recommended while for managing nervous complaints, anticonvulsants, and corticosteroids are given (Adhikari Prabha et al. 1993). No specific procedures for patients’ isolation appear to be directed (Roy et al. 2014).

16.11 Vaccine The attempt to develop the KFD vaccine was done as early as 1960. The first KFD vaccine was based on the RSSE virus due to its antigenic similarity with the KFD virus. On the request of the Indian Council of Medical Research, the Walter Reed Army Institute of Research with the help of the Rockefeller Foundation developed formalin-inactivated, mouse-brain preparation of RSSEV vaccine against KFD (Aniker et al. 1962). The RSSEV vaccine failed to elicit protective immunity in the vaccinees (Pavri et al. 1962; Shah et al. 1962). Another attempt was made to develop a vaccine by growing KFDV in the Swiss albino mice brains, followed by inactivation by formalin (Mansharamani et al. 1965). The vaccine elicited NAbs in mice models but had a short shelf life. Later, KFDV vaccine was generated by propagating the KFDV in chick embryos; however, vaccine could not induce protective immunity in mice (Dandawate et al. 1965a, 1965b). In 1966, a formalin-inactivated experimental vaccine was developed by propagating the virus in chick embryo fibroblast cultures (Pattnaik 2006). This vaccine elicited sufficient protective immunity and was found safe and stable (Mansharamani et al. 1967; Mansharamani and Dandawate 1967). However, Kasabi et al. reported that the vaccine efficacy in humans was only about 62% upon two doses, and rose to 83% with booster vaccinations (Kasabi et al. 2013). Currently, this vaccine is licensed for use in KFD endemic areas for individuals aged between 7 and 65 years. The vaccine regimen has two doses of the vaccine administration with a minimum gap of 4 weeks. As the current available vaccine confers partial protection against KFDV, the booster doses are given every 6–9 months and repeated every year if any confirm KFD cases of human or monkey is reported.

412

H. Kaushal et al.

16.12 Preventive Measures In the absence of antiviral drugs and an effective vaccine against KFD, control of the disease burden and arising consequences heavily depend on the effective implementation of appropriate preventive measures in the affected areas. Routine KFD surveillance should be taken in the endemic areas. Early diagnosis and reporting of KFD cases to the local health authorities should be encouraged. Following detection of confirmed KFD cases, surveillance of the contact cases is to be done immediately to trace active cases that will be in their containment. The monkey death in endemic areas should be an alarming signal for the possible KFD outbreaks and the area should be cordoned off and properly sanitised. Besides, tick surveillance facilitates the early detection of potential zones for human KFD outbreak and should be undertaken routinely. The community should be made aware of the causation of the diseases, its control measures, tick biology and the importance of early reporting of cases and monkey death to the local authority at the earliest. Vaccination is the foremost strategy to prevent and control KFD and the people at large should be educated about the benefits of timely vaccination. For ticks’ control, reduction at the source is an important intervention strategy. Benzene hexachloride is among the effective chemicals for the control of tick. Another key preventive strategy is awareness about personal protection. People should wear personal protective equipment/clothing, apply tick repellent while visiting forested endemic areas and upon return examine the body parts for tick and removal. This is to protect individuals or group from a tick bite that interrupts the contact between infected ticks with humans. Another important component is training and capacity building to keep the health workers, professionals and other stakeholders up to date about case definitions, case management, facility-based surveillance, and prevention and control aspects of KFD.

16.13 Future Perspectives KFD virus is classified under risk group 3 pathogens; therefore, there is always a serious concern with its containment (Roy et al. 2014). Also, it is noted that there is a gradual geographical expansion of KFDV across the Western Ghats of India, resulting in an upsurge in the total KFD cases reported annually. In the absence of proper treatment and the availability of the partially protective vaccine, it is imperative to focus more on the feasible preventive measures. Simultaneously, thrust should also be given to developing an effective vaccine against KFD to control this dreaded disease. To formulate and evaluate an effective vaccine candidate, studies to explore the immunological mechanism of protection should be taken up. The detailed mechanism of protective humoral as well as cellular immunity which confers immunity to the recovered KFD cases or asymptomatic cases would provide cues to the development of the next-generation vaccine candidates. Similarly, precise knowledge of host-pathogen interaction and virus pathogenesis would help identify promising drug targets and the development of effective antiviral drugs.

16

Kyasanur Forest Disease: A Neglected Zoonotic Disease of India

413

Platforms for the research and development of new antivirals drugs and the repurposing of available drugs should be initiated. Besides, newer diagnostic assays that are quick, and require minimum expertise and infrastructure should be developed and employed in primary health centres. There should be an aggressive campaign to bring awareness among the residents about various preventive measures to minimise the tick exposure. While going to forested areas in the endemic, people should apply tick repellents, cover the body parts and check for ticks upon return; these minor preventives can minimise the chances of infection. People should be advised to seek early diagnosis and reporting. Various surveillance programs for tick, mammalian and avian species involved in the transmission cycle of KFD should be routinely undertaken. Such activities will provide information regarding the distribution and expansion of KFDV due to changes in climatic conditions that eventually facilitate to identify areas at-risk for virus exposure.

References Achar TR, Patil AP, Jayadevaiah MS (1981) Persistence of humoral immunity in Kyasanur forest disease. Indian J Med Res 73(1):1–3. https://pubmed.ncbi.nlm.nih.gov/6263796/ Adhikari Prabha MR, Prabhu MG, Raghuveer CV, Bai M, Mala AM (1993) Clinical study of 100 cases of Kyasanur Forest disease with clinicopathological correlation. Indian J Med Sci 47(5):124–130. https://pubmed.ncbi.nlm.nih.gov/8225455 Ajesh K, Nagaraja BK, Sreejith K (2017) Kyasanur forest disease virus breaking the endemic barrier: an investigation into ecological effects on disease emergence and future outlook. Zoonoses Public Health 64(7):e73–e80. https://doi.org/10.1111/zph.12349 Anderson CR (1970) Serum neutralization of Kyasanur Forest disease virus in mice. Indian J Med Res 58(11):1584–1586. https://pubmed.ncbi.nlm.nih.gov/4994290/ Aniker SP, Work TH, Chandrasekharaiya T, Murthy DP, Rodrigues FM, Ahmed R, Kulkarni KG, Rahman SH, Mansharamani H, Prasanna HA (1962) The administration of formalin-inactivated RSSE virus vaccine in the Kyasanur Forest disease area of Shimoga District, Mysore State. Indian J Med Res 50:147–152. https://pubmed.ncbi.nlm.nih.gov/13861642/ Bhat HR (1990) Kyasanur Forest disease and decimation of monkeys in Malnad area of Karnataka. Biol Ind 2:59–67. https://doi.org/10.1201/b15172-33 Bhat HR, Sreenivasan MA, Goverdhan MK, Naik SV, Banerjee K (1978) Antibodies to Kyasanur forest disease virus in bats in the epizootic-epidemic area and neighbourhood. Indian J Med Res 68(3):387–392. https://pubmed.ncbi.nlm.nih.gov/217820/ Bhatia B, Feldmann H, Marzi A (2020) Kyasanur forest disease and alkhurma hemorrhagic fever virus—two neglected zoonotic pathogens. Microorganisms 8(9):1–17. https://doi.org/10.3390/ microorganisms8091406 Bhatt PN, Work TH, Varma MG, Trapido H, Murthy DP, Rodrigues FM (1966) Kyasanur forest diseases. IV. Isolation of Kyasanur forest disease virus from infected humans and monkeys of Shimogadistrict, Mysore state. Indian J Med Sci 20(5):316–320. https://pubmed.ncbi.nlm.nih. gov/4957898/ Boshell J, Rajagopalan PK (1968) Preliminary studies on experimental transmission of Kyasanur Forest disease virus by nymphs of Ixodes petauristae Warburton, 1933, infected as larvae on Suncus murinus and Rattus blanfordi. Indian J Med Res 56(4):589–593. https://pubmed.ncbi. nlm.nih.gov/5679151/ Dandawate CN, Mansharamani HJ, Jhala HI (1965a) Experimental vaccine against Kyasanur Forest disease (KFD) virus from embryonated eggs. I. Adaptation of the virus to developing chick

414

H. Kaushal et al.

embryo and preparation of formolised vaccines. Indian. J Pathol Bacteriol 8(4):241–260. https:// pubmed.ncbi.nlm.nih.gov/5850010/ Dandawate CN, Mansharamani HJ, Jhala HI (1965b) Experimental vaccine against Kyasanur Forest disease (KFD) virus from embryonated eggs. II. Comparative immunogenicity of vaccines inactivated with formalin and beta-propio-lactone (BPL). Indian. Journal of Pathology & Bacteriology 8(4):261–270. https://pubmed.ncbi.nlm.nih.gov/5850011/ de la Fuente J, Antunes S, Bonnet S, Cabezas-Cruz A, Domingos AG, Estrada-Peña A, Johnson N, Kocan KM, Mansfield KL, Nijhof AM, Papa A, Rudenko N, Villar M, Alberdi P, Torina A, Ayllón N, Vancova M, Golovchenko M, Grubhoffer L et al (2017) Tick-pathogen interactions and vector competence: identification of molecular drivers for tick-borne diseases. Front Cell Infect Microbiol 7:114. https://doi.org/10.3389/FCIMB.2017.00114 Devadiga S, McElroy AK, Prabhu SG, Arunkumar G (2020) Dynamics of human B and T cell adaptive immune responses to Kyasanur Forest disease virus infection. Sci Rep 10(1):15306. https://doi.org/10.1038/s41598-020-72205-1 Directorate of Health and Family Welfare & Goverment of Karnataka (2020) Operational Manual Kyasanur Forest Disease. https://pubmed.ncbi.nlm.nih.gov/11849118/ Dodd KA, Bird BH, Khristova ML, Albariño CG, Carroll SA, Comer JA, Erickson BR, Rollin PE, Nichol ST (2011) Ancient ancestry of KFDV and AHFV revealed by complete genome analyses of viruses isolated from ticks and mammalian hosts. PLoS Negl Trop Dis 5(10):e1352. https:// doi.org/10.1371/journal.pntd.0001352 Grard G, Moureau G, Charrel RN, Lemasson JJ, Gonzalez JP, Gallian P, Gritsun TS, Holmes EC, Gould EA, de Lamballerie X (2007) Genetic characterization of tick-borne flaviviruses: new insights into evolution, pathogenetic determinants and taxonomy. Virology 361(1):80–92. https://doi.org/10.1016/j.virol.2006.09.015 Gupta KK, Pal Y (1975) Kyasanur Forest disease. J Indian Med Assoc 64(9):236–237. https://doi. org/10.4269/ajtmh.1969.18.67 Gupta N, Wilson W, Neumayr A, Saravu K (2022) Kyasanur forest disease: a state-of-the-art review. QJM 115(6):351–358. https://doi.org/10.1093/qjmed/hcaa310 Gurav YK, Yadav PD, Gokhale MD, Chiplunkar TR, Vishwanathan R, Patil DY, Jain R, Shete AM, Patil SL, Sarang GD, Sapkal GN, Andhare MD, Sale YR, Awate PS, Mourya DT (2018) Kyasanur Forest disease prevalence in Western Ghats proven and confirmed by recent outbreak in Maharashtra, India, 2016. Vector-Borne and Zoonotic Diseases 18(3):164–172. https://doi. org/10.1089/vbz.2017.2129 Holbrook MR (2012) Kyasanur forest disease. Antiviral Res 96(3):353–362. https://doi.org/10. 1016/j.antiviral.2012.10.005 Holmes EC, Worobey M, Rambaut A (1999) Phylogenetic evidence for recombination in dengue virus. Mol Biol Evol 16(3):405–409. https://doi.org/10.1093/oxfordjournals.molbev.a026121 Iyer CG, Laxmana Rao R, Work TH, Narasimha Murthy DP (1959) Kyasanur Forest disease VI. Pathological findings in three fatal human cases of Kyasanur Forest disease. Indian J Med Sci 13:1011–1022. https://pubmed.ncbi.nlm.nih.gov/14406181/ John JK (2014) Kyasanur Forest disease: a status update. Adv Anim Vet Sci 2(6):329–336. https:// doi.org/10.14737/journal.aavs/2014/2.6.329.336 Kasabi GS, Murhekar MV, Sandhya VK, Raghunandan R, Kiran SK, Channabasappa GH, Mehendale SM (2013) Coverage and effectiveness of Kyasanur Forest disease (KFD) vaccine in Karnataka, South India, 2005-10. PLoS Negl Trop Dis 7(1):e2025. https://doi.org/10.1371/ journal.pntd.0002025 Khan SH, Goba A, Chu M, Roth C, Healing T, Marx A, Fair J, Guttieri MC, Ferro P, Imes T, Monagin C, Garry RF, Bausch DG (2008) New opportunities for field research on the pathogenesis and treatment of Lassa fever. Antivir Res 78(1):103–115. https://doi.org/10.1016/j. antiviral.2007.11.003 MacKenzie JS, Williams DT (2009) The zoonotic flaviviruses of southern, south-eastern and eastern Asia, and australasia: the potential for emergent viruses. Zoonoses Public Health 56(6–7):338–356. https://doi.org/10.1111/j.1863-2378.2008.01208.x

16

Kyasanur Forest Disease: A Neglected Zoonotic Disease of India

415

Mansharamani HJ, Dandawate CN (1967) Experimental vaccine against Kyasanur Forest disease (KFD) virus from tissue culture source. II. Safety testing of the vaccine in cortisone sensitized Swiss albino mice. Indian. J Pathol Bacteriol 10(1):25–32. https://pubmed.ncbi.nlm.nih.gov/ 6036490/ Mansharamani HJ, Dandawate CN, Krishnamurthy BG, Nanavati AN, Jhala HI (1965) Experimental vaccine against Kyasanur Forest disease (KFD) virus from mouse brain source. Indian J Pathol Bacteriol 12:159–177. https://pubmed.ncbi.nlm.nih.gov/14340436/ Mansharamani HJ, Dandawate CN, Krishnamurthy BG (1967) Experimental vaccine against Kyasanur Forest disease (KFD) virus from tissue culture source. I. some data on the preparation and antigenicity tests of vaccines. Indian. J Pathol Bacteriol 10(1):9–24. https://pubmed.ncbi. nlm.nih.gov/6068256/ Mehla R, Kumar SRP, Yadav P, Barde PV, Yergolkar PN, Erickson BR, Carroll SA, Mishra AC, Nichol ST, Mourya DT (2009) Recent ancestry of Kyasanur Forest disease virus. Emerg Infect Dis 15(9):1431–1437. https://doi.org/10.3201/eid1509.080759 Mourya DT, Yadav PD, Mehla R, Barde PV, Yergolkar PN, Kumar SRP, Thakare JP, Mishra AC (2012) Diagnosis of Kyasanur forest disease by nested RT-PCR, real-time RT-PCR and IgM capture ELISA. J Virol Methods 186(1–2):49–54. https://doi.org/10.1016/j.jviromet.2012. 07.019 Mourya DT, Lakra RJ, Yadav PD, Tyagi P, Raut CG, Shete AM, Singh DK (2013) Establishment of cell line from embryonic tissue of Pipistrellus ceylonicus bat species from India & its susceptibility to different viruses. Indian J Med Res 138:224–231. https://pubmed.ncbi.nlm.nih.gov/240 56599/ Mourya DT, Yadav PD, Patil DY (2014) Expediency of dengue illness classification: the Sri Lankan perspective highly infectious tick-borne viral diseases: Kyasanur forest disease and Crimean-Congo haemorrhagic fever in India. WHO South-East Asia J Public Health 3(1):8. https://doi.org/10.4103/2224-3151.206890 Munivenkatappa A, Sahay RR, Yadav PD, Viswanathan R, Mourya DT (2018) Clinical & epidemiological significance of Kyasanur forest disease. In. Indian J Med Res 148(2): 145–150). Indian J Med Res. https://doi.org/10.4103/ijmr.IJMR_688_17 Murhekar MV, Kasabi GS, Mehendale SM, Mourya DT, Yadav PD, Tandale BV (2015) On the transmission pattern of Kyasanur Forest disease (KFD) in India. Infect Dis Poverty 4(1):37. https://doi.org/10.1186/s40249-015-0066-9 Mythreyi R, Geethanjali B, Basalingappa KM, Gopenath T, Parthiban R, Raviraja S (2021) Kyasanur Forest disease: a tropical disease of the Southwest India. Biosci Biotech Res Comm 14(5):145–153. https://bbrc.in/special-issue-volume-14-number-5-2021/ NCDC (2020) Kyasanur Forest disease: a public health concern. https://ncdc.gov.in/index1.php? lang=1&level=1&sublinkid=139&lid=106 Patil DY, Yadav PD, Shete AM, Nuchina J, Meti R, Bhattad D, Someshwar S, Mourya DT (2017) Occupational exposure of cashew nut workers to Kyasanur Forest disease in Goa, India. Int J Infect Dis 61:67–69. https://doi.org/10.1016/j.ijid.2017.06.004 Pattnaik P (2006) Kyasanur forest disease: an epidemiological view in India. Rev med Virol 16(3): 151–165. https://doi.org/10.1002/rmv.495 Pavri K (1989) Clinical, Clinicopathologic, and hematologic features of Kyasanur Forest disease. Rev Infect Dis 11(ii):S854–S859. https://doi.org/10.1093/clinids/11.Supplement_4.S854 Pavri KM, Anderson CR (1970) Serological response of man to Kyasanur Forest disease. Indian J Med Res 58(11):1587–1607. https://pubmed.ncbi.nlm.nih.gov/5505348/ Pavri KM, Gokhale T, Shah KV (1962) Serological response to Russian spring-summer encephalitis virus vaccine as measured with Kyasanur Forest disease virus. Indian J Med Res 50:153–161. https://pubmed.ncbi.nlm.nih.gov/14484654/ Priya C, Jayakrishnan T, Lilabi MP, Thomas B, Suthanthira K (2016) An outbreak of Kyasanur Forest disease in Kerala: a clinico epidemiological study. Indian J Forensic Commun Med 3(4): 272–275. https://www.ijfcm.org/article-details/3321

416

H. Kaushal et al.

Rajagopalan PK, Anderson CR (1971) Further studies on ticks of wild monkeys of Kyasanur Forest disease area Shimoga District. Indian J Med Res 59(6):847–860. https://pubmed.ncbi.nlm.nih. gov/5001100/ Rajaiah P (2019) Kyasanur Forest disease in India: innovative options for intervention. Human Vaccines Immunother 15(10):2243–2248. https://doi.org/10.1080/21645515.2019.1602431 Rao RL (1958) Clinical observations on Kyasanur Forest disease cases. J Indian Med Assoc 31(3): 113–116. https://pubmed.ncbi.nlm.nih.gov/13588005/ Roy P, Maiti D, Goel M, Rasania S (2014) Kyasanur Forest disease: an emerging tropical disease in India. J Res Med Dental Sci 2(2):1. https://doi.org/10.5455/jrmds.2014221 Růžek D, Yakimenko VV, Karan LS, Tkachev SE (2010) Omsk Haemorrhagic fever. Lancet 376(9758):2104–2113. https://doi.org/10.1016/S0140-6736(10)61120-8 Sadanandane C, Elango A, Marja N, Sasidharan PV, Raju KHK, Jambulingam P (2017) An outbreak of Kyasanur forest disease in the Wayanad and Malappuram districts of Kerala. India Ticks Tick-Borne Diseases 8(1):25–30. https://doi.org/10.1016/j.ttbdis.2016.09.010 Sarkar JK, Chatterjee SN (1962) Survey of antibodies against arthropod-borne viruses in the human sera. Indian J Med Res 50:833–841. https://pubmed.ncbi.nlm.nih.gov/13991507/ Sathe PS, Dandawate CN, Sharadamma K, Ghosh SN (1991) Circulating interferon-alpha in patients with Kyasanur forest disease. Indian J Med Res 93:199–201. https://pubmed.ncbi. nlm.nih.gov/1959947/ Sawatsky B, McAuley AJ, Holbrook MR, Bente DA (2014) Comparative pathogenesis of Alkhumra hemorrhagic fever and Kyasanur Forest disease viruses in a mouse model. PLoS Negl Trop Dis 8(6):e2934. https://doi.org/10.1371/journal.pntd.0002934 Seligman SJ, Gould EA (2004) Live flavivirus vaccines: Reasons for caution. Lancet 363(9426): 2073–2075. https://doi.org/10.1016/S0140-6736(04)16459-3 Shah KV, Aniker SP, Murthy DP, Rodrigues FM, Jayadeviah MS, Prasanna HA (1962) Evaluation of the field experience with formalin-inactivated mouse brain vaccine of Russian spring-summer encephalitis virus against Kyasanur Forest disease. Indian J Med Res 50:162–174. https://www. semanticscholar.org/paper/Evaluation-of-the-field-experience-with-mouse-brain-Kv-Sp/ b67cc0215165e305e7ff811e652b5cf75a381a10 Shah SZ, Jabbar B, Ahmed N, Rehman A, Nasir H, Nadeem S, Jabbar I, Rahman Z, Ur Azam S, Ur Rahman Z, Azam S (2018) Epidemiology, pathogenesis, and control of a tick-borne disease— Kyasanur Forest disease: current status and future directions. Front Cell Infect Microbiol 8:149. https://doi.org/10.3389/fcimb.2018.00149 Sharma SN, Kumawat R, Singh SK (2019) Kyasanur forest disease: vector surveillance and its control. J Commun Dis 51(2):38–44. https://doi.org/10.24321/0019.5138.201915 Sirmarova J, Salat J, Palus M, Hönig V, Langhansova H, Holbrook MR, Ruzek D (2018) Kyasanur Forest disease virus infection activates human vascular endothelial cells and monocyte-derived dendritic cells. Emerg Microbes Infect 7(1):175. https://doi.org/10.1038/s41426-018-0177-z Sunith R, Prem Kumar R, Rajanna R (2020) Kyasanur forest disease: a review article. Pharma Innovation 9(2):118–120. https://www.thepharmajournal.com/archives/?year=2020&vol=9& issue=2&ArticleId=4357 Trapido H, Rajagopalan PK, Work TH, Varma MG (1959) Kyasanur Forest disease. VIII. Isolation of Kyasanur Forest disease virus from naturally infected ticks of the genus Haemaphysalis. Indian J Med Res 47(2):133–138. https://pubmed.ncbi.nlm.nih.gov/13653739/ Upadhyaya S, Murthy DPN, Anderson CR (1975) Kyasanur Forest disease in the human population of Shimoga District, Mysore State, 1959-1966. Indian J Med Res 63(11):1556–1563. https:// pubmed.ncbi.nlm.nih.gov/1222964/ Venugopal K, Buckley A, Reid HW, Gould EA (1992) Nucleotide sequence of the envelope glycoprotein of negishi virus shows very close homology to louping III virus. Virology 190(1):515–521. https://doi.org/10.1016/0042-6822(92)91245-P Wadia RS (1975) Neurological involvement in Kyasanur Forest disease. Neurol India 23(3): 115–120. https://pubmed.ncbi.nlm.nih.gov/1214955/

16

Kyasanur Forest Disease: A Neglected Zoonotic Disease of India

417

Wang J, Zhang H, Fu S, Wang H, Ni D, Nasci R, Tang Q, Liang G (2009) Isolation of kyasanur forest disease virus from febrile patient, Yunnan, China. Emerg Infect Dis 15(2):326–328. https://doi.org/10.3201/eid1502.080979 Webb HE (1961) Kyasanur forest disease: a general clinical study in which some cases with neurological complications were observed. Trans R Soc Trop Med Hyg 55(3):284–298. https://doi.org/10.1016/0035-9203(61)90067-0 Work TH (1958a) Russian spring-summer virus in India: Kyasanur Forest disease. Prog Med Virol 1:248–279. https://pubmed.ncbi.nlm.nih.gov/13579010/ Work TH (1958b) Virological aspects of Kyasanur Forest disease. J Indian Med Assoc 31(3): 111–113. https://pubmed.ncbi.nlm.nih.gov/13588004/ Work TH, Trapido H, Murthy DP, Rao RL, Bhatt PN, Kulkarni KG (1957) Kyasanur forest disease. III. A preliminary report on the nature of the infection and clinical manifestations in human beings. Indian J Med Sci 11(8):619–645. https://pubmed.ncbi.nlm.nih.gov/13474777/ Work TH, Roderiguez FR, Bhatt PN (1959) Virological epidemiology of the 1958 epidemic of Kyasanur Forest disease. Am J Public Health 49(7):869–874. https://doi.org/10.2105/ajph.49. 7.869 Yadav P, Gurav Y, Shete A, Jain R, Nyayanit D, Pardeshi P, Viswanathan R, Chiplunkar T, Awate P, Majumdar T, Sahay R, Mourya D (2019) Kinetics of viral RNA, immunoglobulin-M & G antibodies in Kyasanur forest disease. Indian J Med Res 150(2):186–193. https://doi.org/ 10.4103/ijmr.IJMR_1929_17

An Imminence to Humans and Animals: The Rift Valley Fever Virus

17

Aparna Kalyanaraman, L. Preethi, and Prudhvi Lal Bhukya

Abstract

Rift Valley Fever (RVF) is an acute viral hemorrhagic fever caused by an arbovirus Rift Valley Fever Virus (RVFV) belonging to the genus Phlebovirus in the Bunvaviridae family is the most serious infection in Africa today. The Aedes mosquito is the vector for RVF virus. The vector transmits the virus horizontally and transovarially. Serious diseases are caused in Ruminant animals and humans due to repeated Rift Valley Fever epidemics. Over the past 25 years, RVF disease has expanded its geographic range into Eastern and Southern Africa and the Middle East causing massive epidemics in Madagascar and Egypt. In 2006, a major outbreak occurred in North-Eastern Kenya which later on spread into Tanzania and the Southern region of Somalia. RVFV affects humans, cattles, and sheep. RVFV is transmitted to humans either through contact with the blood of infected animals or tissues during slaughter, disposal of infected or diseased animals, or autopsy. In young stock, mortality rate may be heavy due to abortion storms that usually occur within a few days after infection. Humans infected with the RVF virus develop febrile disease and recover within 2 weeks. Whereas, a few individuals develop severe diseases like necrosis, hemorrhagic pneumonia,

A. Kalyanaraman Department of Biotechnology, Dr. M.G.R. Educational and Research Institute, Kattankulathur, Tamil Nadu, India L. Preethi Department of Pharmacy Practice, SRM College of Pharmacy, SRM Institute of Science and Technology, Kattankulathur, Chengalpattu, Tamil Nadu, India P. L. Bhukya (✉) Vaccine Testing Laboratory, Rodent Experimentation Facility, ICMR-National Animal Facility Resource Facility for Biomedical Research, Hyderabad, Telangana, India e-mail: [email protected] # The Author(s), under exclusive license to Springer Nature Singapore Pte Ltd. 2023 P. L. Bhukya et al. (eds.), Emerging Human Viral Diseases, Volume I, https://doi.org/10.1007/978-981-99-2820-0_17

419

420

A. Kalyanaraman et al.

retinitis accompanied with vision loss, and meningoencephalitis. As of now, there are no FDA-approved treatments for RVF. Keywords

Rift Valley Fever · Arbovirus · Phlebovirus · Bunvaviridae · Abortion storm

17.1

Introduction

RVFV abbreviated as Rift Valley Fever Virus, is an arbovirus of the Bunyaviridae family and Phlebovirus genus primarily affects domestic ruminants and humans. RVFV is mainly transmitted by mosquitoes and it was identified in 1930 on a farm adjacent to Lake Naivasha in the Rift Valley of Kenya, during an investigation into an epidemic among sheep that was associated with higher rates of deaths and abortions among new-born lambs and pregnant ewes, respectively. RVFV causes severe diseases in domestic animals and especially sheep are more susceptible to the disease when compared to cattle while goats are less susceptible. About 90–100% of the pregnant ewes are usually aborted within a couple of days after infection. Rift valley Fever is a communicable disease, the virus affects humans through inoculation after contact with infected animals or through ingestion of uncooked or unpasteurized by-products of infected animals. Transmission of the virus can also occur due to inhalation of aerosols that are produced during the slaughter of infected animals. However, infections also occurred from the infected mosquito bites, mainly culex and Aedes also blood-feeding vectors such as flies and ticks have also been identified as potential vectors of infection. Several types of fatal and severe illnesses were observed in humans including haemorrhagic manifestations, retinitis, meningoencephalitis, and hepatitis (Paweska and Jansen van Vuren 2014).

17.2

Epidemiology

The first outbreak of Rift Valley Fever was first identified in Kenya in 1931. Following this periodic epizootic occurred in Kenya and in South Africa, the first major outbreak was recognized in the year 1950–1951. This caused an estimated 100,000 deaths and 500,000 abortions. Following this, subsequently, the epizootics were confirmed in Mozambique, Zimbabwe, Namibia, Sudan, Zambia, and other East African countries. In the years 1974–1976, a major and wide outspread in South Africa caused an extensive loss of cattle and sheep. The potential lethality of the epizootic virus for the human race was associated with encephalitis and haemorrhagic fever. In the late 1980s, geographical distribution of the virus had spread to Central Africa and Sub-Saharan regions (Paweska and Jansen van Vuren 2014). In 1979, the virus was first isolated outside the African continent in Madagascar. In Egypt, the first occurrence of the disease was in 1977–1978 and it resulted in approximately 200,000 human infections out of which at least 598 were

17

An Imminence to Humans and Animals: The Rift Valley Fever Virus

Table 17.1 An insight on the history of RVFV outbreak.

Country Kenya South Africa Egypt Zimbabwe Mauritania Senegal Kenya Somalia Tanzania Mauritania Saudi Arabia Yemen Egypt Sudan Madagascar Somalia Tanzania Kenya South Africa Mauritania

421

Extensive outbreak 1931 1950–1951 1977–1978 1978 1988 1987–1989 1997–1998

1998 2000 2000–2001 2003 2007–2008 2008–2009 2006–2007

2010–2011 2012

fatal due to haemorrhagic fever and encephalitis. In 1987–1988, the disease outbreak was recorded for the first time in Senegal and Mauritania. In the year 2000, RVFV first spread across Arabian Peninsula and the Red Sea. A severe outbreak of the disease was reported between 2006 and 2011 from East Africa, Madagascar, and South Africa and the Archipelago of Comoros in the French Island reported the first viral activity (Paweska and Jansen van Vuren 2014) (Table 17.1).

17.2.1 Molecular Epidemiology Hereditary variations of RVFV descent from different origins persevere in Africa through vertical transmission in mosquitoes and disease of vertebrate hosts and enormous flare-ups arise in long periods of hefty precipitation and floods. On various events, infections from these lineages have been moved to external enzootic locales through the development of contaminated creatures and additionally mosquitoes, causing huge flare-ups in nations where the infection had not recently been noted, as exemplified by the flare-ups in Egypt in 1977, western Africa in 1988, and the Arabian Peninsula. Such infections might actually get set up in their new domains through the disease of wild and home-grown ruminants and different creatures and vertical transmission in neighbourhood skilful mosquito species. Emotional natural changes, a developing human/home-grown creatures/untamed life interface, expanded exchange furthermore, and development of creatures all through and outside Africa probably add to the geographic dispersal of the infection.

422

A. Kalyanaraman et al.

Genomic reassortment is a possibly strong system to produce hereditary variety and in the end, drive the rise of novel RVFV variations. The reassortment of RNA genome fragments among infections of the family Bunyaviridae has been accounted for in both in vitro and in vivo examines, including the arrangement of reassortants in dually contaminated mosquitoes. Reassortment occasions among RVFV strains have likewise been reported. Nonetheless, the effect of reassortment on RVFV replication, wellness, and what’s more, harmfulness stays to be examined. A new report showed that a solitary nucleotide heterogeneity at nucleotide 847 of M-section (M847) may generously influence the RVFV’s harmfulness in mice. A recombinant RVFV ZH501 conveying adenine build-up at M847 encoding glutamic corrosive contrasted with hereditarily indistinguishable infection, however, conveying a guanine build-up encoding glycine amino corrosive at the relating site repeated more quickly and to altogether higher titres in mice, of which most kicked the bucket inside 8 days post-immunization, while the last hereditary infection variation had weakened harmfulness to these creatures. Notwithstanding, the impact of this single replacement in the Gn protein on RVFV harmfulness in different species actually should be resolved. As a result of the extending arrangement information base, the quantity of distinguished viral ancestries of the infection has expanded from 3 in an early examination to 15 lineages (assigned A-O). Infection secluded from one region will in general group together inside each heredity, yet infection hereditary variations with removed causes are found inside various ancestries, giving proof of inescapable dispersal and development of RVFV all through Africa. The solid phylogenetic linkage of infection strains from inaccessible geographic areas recommends that the development of contaminated animals and the regular dispersal of mosquitoes permit the spread of RVFV all through mainland Africa, Madagascar, and the Arabian Peninsula. Independent of the genome sections examined, the hereditary variety of RVFV is low, and around 4% and 1% at the nucleotide and protein-coding levels, individually. The low hereditary variety of RVFV may mirror the developmental limitation forced on arboviruses by their modifying replication in mammalian and arthropods. Late Bayesian examination recommends that the hour of difference of RVFV secludes from the latest normal progenitor, dated 1880–1890, corresponds with the pioneer time frame when the presentation of huge centralization of vulnerable sheep and dairy cattle imported from Europe would have worked with development of an obscure ancestor infection. The transformative pace of the infection is like that of other RNA infections, proposing that the chief factor for low hereditary variety among RVFV detaches is ongoing induction from an ancestral derivative infection in Africa (Paweska and Jansen van Vuren 2014).

17.3

Potential Risk of Emergence and Re-emergence

In nations where RVFV action was not recently identified, flare-ups of the infection in creature and human populaces result from the spread of a solitary lineage of the infection portrayed by negligible hereditary variety. For instance, the correlation of

17

An Imminence to Humans and Animals: The Rift Valley Fever Virus

423

RVFV secluded from the 1977 Egyptian flare-up distinguished a single heredity of the infection with 60

43 to >60

–

>90

52

>60

–

–

–

– 2–4

– –

– 2.09 (d7)

2 (d6) –

– –

– 5.04 (d39)

87–140

–

–

–

–

1.24–1.50

–

109 (d7) –

– 2.09– 5.04 (d7– 39) –

–

–

1.61 (d39)

–

Note: The value of the day of the illness was recorded in parentheses ALT alanine aminotransferase; AST aspartate aminotransferase; CRP C-reactive protein; ESR erythrocyte sedimentation rate; Hb hemoglobin; HCT hematocrit; INR international normalised ratio; LDH lactate dehydrogenase; ND not has done; PCT procalcitonin; PTT partial thromboplastin time; WBC white blood cell counts a During their infections, patients 1, 2, and 5 got red blood cell transfusions, platelet transfusions, and new frozen plasma

20.6.4.2 Molecular Test PCR is used in nucleic acid-based molecular diagnostics to make a huge increase in the number of nucleic acid molecules in a patient sample, which is called amplifying the target sequence(s). 20.6.4.2.1 Polymerase Chain Reaction (PCR) Methods PCR can detect LUJV RNA in clinical samples. Reverse-transcriptase-PCR (RT-PCR) or quantitative real-time RT-PCR can identify LUJV RNA directly and specifically. “Nuclear-based PCR detects complex genetic material in pathogens,

20

Lujo Hemorrhagic Fever

487

including viruses” (Vieth et al. 2005). Although RT-PCR is a quick and sensitive diagnosis, it has the potential to give false-positive findings. The high variability of genome sequences hinders one-step real-time RT-PCR studies utilising primers for the same nucleoprotein gene. At the start of infection, RT-PCR can detect the Lujo virus genome in blood, serum, or organ fragments (Paweska 2014). The serum is isolated from the blood and stored in clear or ethylenediaminetetraacetic acid (EDTA)-containing tubes for RT-PCR. RT-PCR Assay

The SuperScript® III One-Step RT-PCR System with Platinum Taq was used for PCR amplification. The final master mix (20 μL) was made, consisting of 12.5 L of 2× Reaction Mix, 4.5 μL of PCR-grade water, 1 μL of each primer (at a concentration of 10 μM), and 1 μL of SuperScript® III RT/Platinum® Taq mix. A 25 μL reaction volume was then created by adding 5 μL of the template to the original mixture. The cycling settings were 50 °C for 15 min, 95 °C for 2 min of initial PCR activation, 45 cycles of 95 °C for 15 s of denaturation, 55 °C for 30 s of annealing, 68 °C for 45 s, and 68 °C for 7 min of extension (Atkinson et al. 2014). Real-Time RT-PCR Assay

Using the SuperScript® III Platinum One-step qRT-PCR kit, the real-time RT-PCR experiment was planned and carried out. The final master mix, which had a capacity of 15 μL, had 10 μL of 2× Reaction mix, 1.7 μL of PCR-grade water, 1 μL of each primer (at an 18 μM concentration), 0.5 μL of the probe (at a 25 μM concentration), and 0.8 μL of SuperScript® III enzyme mix. The master mixture was diluted to a final volume of 20 μL with the addition of 5 μL of template RNA. The cycling conditions were as follows: reverse transcription at 50 °C for 10 min; initial PCR activation at 95 °C for 2 min; 45 cycles of denaturation at 95 °C for 10 s; annealing at 60 °C for 40 s (with fluorescence quantification at every 60 °C steps); and a final chilling step at 40 °C for 30 s (Atkinson et al. 2014). Primers and Probes for the Detection of LUJV RNA

An RT-PCR test has been developed for the direct detection of LUJV RNA using the two complete S-segment sequences on Genbank, NC012776.1 and FJ952384.1, both of which were obtained during the original epidemic and are equivalent. The LUJV glycoprotein expression pattern was discovered using a set of primers. In this experiment, these primers increased the amount of LUJV viral RNA, and they were optimised by using the QIAquick Gel Extraction Kit (Qiagen) as directed by the company. For one-step RT-PCR, use primers Lujo GP S1046F (TGTTGGCTGGTTAGTAATGG), Lujo GP S1145R (CTTTCTTTAGCATCTCGGTCAG), and Lujo GP S1120P (FAM TTTATCTGCCTCATCTTCCATATCATG-BHQ1). The real-time yields a 100 bp amplicon product. Recently, other workers employed a pair of primers called Lujo GP S579R (ATGACAAGAACTGCACTGGTC) and Lujo GP S1145F (CTTTCTTTAGCATCTCGGTCAG) to produce an amplicon product of around 566 base pairs for use in a one-step RT-PCR system that combines superscript

488

Alka and A. B. Sonkar

reverse transcriptase and platinum Taq-polymerase (Atkinson et al. 2014). Using a similar system, Vieth et al. (2007) used a different set of primers for OW arenavirus F (AGAATYAGTGAAAGGGARAGYAAYTC) and OW arenavirus R (CACATCATTGGTCCCCATTTACTRTGATC) to yield PCR products of approximately 395 bp (Atkinson et al. 2014; Vieth et al. 2007).

20.6.4.3 Histological Findings Tissue samples were placed in 10% neutral buffered formalin and subjected to gamma radiation (2.0 × 106 RAD) before being cut into sections and stained with hematoxylin and eosin (Bird et al. 2012). Brian H. Bird and his colleagues examined guinea pig tissue samples 2, 5, 7, 9, or 14 days post-infection (PI) and terminal cases. Animals infected with the LUJV exhibited hepatocyte and cardiac necrosis. Hepatic necrosis showed no gender differences. Non-terminal (5–9 days post-PI) animals had similar hepatic necrosis. Bird et al. found that most infected guinea pigs had cardiac necrosis that ranged from mild to severe (Bird et al. 2012).

20.7

Diagnostics and Therapeutics Approaches

20.7.1 Laboratory Diagnosis Immunoglobulin M (IgM) antibodies can be used to diagnose acute infection using RT-PCR and IgM capture ELISA. Viral antigens in liver tissue can be found by immunofluorescence, ELISA, and RT-PCR in fatal cases. ELISA capture by immunoglobulin G identifies convalescent patients retrospectively (IgG). Blood or lymphoid tissues can be infected with live viruses using Vero cells. With the Lujo virus sequence identified, reagents can be developed to quickly diagnose new cases. Lujo was isolated from blood samples of patients 2 and 3 in Johannesburg 2–13 days after its initial occurrence (CDC 2013; Sewlall and Paweska 2017). Post-mortem liver tissue also contained the virus (CDC 2013). After studying the Lujo virus’s genome, unique RT-PCR molecular detections were developed. Serological tests like indirect immunofluorescent examination, ELISA, and antibody detection can diagnose Lujo hemorrhagic fever. People from endemic regions with fever, rash, pharyngitis, reduced platelet counts, and high liver enzymes should still be accused of infection. Therapeutic specimens are tested using specific assays (CDC 2013; Sewlall and Paweska 2017). The Sanger sequencing method is also available; however, it can only be used to find new or undiscovered VHF viruses (species or strains) (Simulundu et al. 2016).

20.7.2 Therapeutic Approaches Intensive study of the Lujo virus and its management is difficult because the only reported cases are in unstable areas (Sewlall et al. 2014). Convalescent plasma reduces arenavirus hemorrhagic fever fatalities, and ribavirin may treat LUHF

20

Lujo Hemorrhagic Fever

489

(CDC 2013). Further testing was unlikely in 2008, so further testing was unlikely (Sewlall et al. 2014). Ribavirin prevents disease progression in arenavirus-exposed people. Lujo hemorrhagic fever requires sustainable treatment. It includes hydration, shock control, sedation, pain relief, and transfusions (if needed) (CDC 2013). Statins are immunomodulatory, anti-inflammatory, antibacterial, and vasculaturestabilizing, while N-acetylcysteine is an antioxidant. Ribavirin blocks pro-inflammatory and Th-2 cytokines, which are part of humoral immunity, but keeps Th-1 cytokines, which are good for cell immunity (Ning et al. 1998; Paweska 2014) of arenaviruses to human health, increased proliferation of new viral species, and lack of management or preventive tools search for novel antiviral compounds urgent. All VHFs have few treatment options, but early differential diagnosis affects containment and clinical care (Gowen and Bray 2011; Paweska 2014). VHFs are similarly advised to have fluid and blood pressure therapy for septic shock due to the same cause. Due to the prevalence of malaria and tick-borne rickettsia in Africa, patients can receive urgent antibacterial and antiparasitic care before an LHF diagnosis can be made. Several VHF vaccine candidates exist. Multiple candidates are being tested in primates. Multivalent arenavirus immunisation is encouraged by the recent finding of HLA-restricted CD8+ T-cell epitopes that are cross-reactive or species-specific (Paweska 2014).

20.7.3 Recovery LUHF mortality is unknown, but 4 of 5 cases were fatal. Patients infected with other arenaviruses will excrete viruses in their urine or sperm for weeks. Infectivity must be controlled with these fluids because convalescent patients can infect others, especially sexual partners (CDC 2013). Ribavirin is an antiviral agent derived from purine nucleosides used to treat hepatitis C and respiratory syncytial virus (RSV). RNA polymerase inhibition and RNA fragment initiation and extension inhibition are its main actions. It has the lowest risk of side effects for arenavirus infections like LASV and NW viruses. The arenavirus action process is not fully understood, but it appears to focus on many stages of the life cycle (Sewlall and Paweska 2017). Inpatient 3 and then inpatient 5 sought oral ribavirin in the LUJV epidemic (2 g loading and 1 g every 6 h thereafter). Ribavirin has an efficient firstpass metabolism and a 60% oral bioavailability. In arenavirus, it was not even proven successful. Patient 5’s symptoms worsened after receiving oral and IV ID-8 (20 mg/kg every 6 h). At this point, we would not dismiss ribavirin’s use in treating LUJV (Sewlall and Paweska 2017). Additional therapies with proven or speculative efficacy in severe sepsis or inflammation (mainly in patient 5) were tried. Statins were present in this formulation as N-acetyl cysteine, VIIa recombinant factor, and atorvastatin (Sewlall and Paweska 2017; Simulundu et al. 2016). Patient 2 helped with mechanical breathing, hemodialysis, and plasmapheresis. It is invasive and involves specialised ICUs. People think that the high number of secondary attacks may be the cause of this epidemic (Sewlall and Paweska 2017).

490

20.8

Alka and A. B. Sonkar

Prevention and Control

20.8.1 Management of Disease Monitoring rodents is ideal, but it would not prevent exposure to Lujo hemorrhagic fever outdoors. For other hemorrhagic fevers, total barrier nursing protocols should be enforced for suspected or confirmed LUHF case management (CDC 2013). LHF infection management involves case identification, isolation, and encounter tracking. Constant monitoring and precautions are required in hospitals, clinics, and during medical air evacuations. The International Health Regulations prevent the spread of disease around the world. All international patient transfers must follow international health rules (Merianos and Peiris 2005; World Health Organization 2008) to prevent the spread of infectious diseases by air.

20.8.1.1 Precautions for Isolation LHF patients should be isolated and treated as infectious. If possible, a patient should be placed in a negative-pressure isolation chamber (Helmick et al. 1986). VHF barrier nursing precautions include masks, gloves, gowns, aprons, face guards, shoe covers, and balaclavas. Endotracheal intubation can produce aerosols, so use N95 masks, positive pressure respirators, and goggles or visors. Patients with LHF must be managed and isolated in the ICU. ICU doctors, nurses, and other staff must be trained in barrier nursing practices before caring for VHF patients. Regular training can maintain staff experience and skills. No infections have occurred since following all protocols (Paweska 2014; Sewlall et al. 2014). 20.8.1.2 Clinical Management Despite the epidemiological connections between all of the patients, the arenavirus infection was not discovered until 13 October (ID-3 of Patient-5’s sickness). In three South African hospitals, three healthcare workers treated the five patients. Clinical continuity was impossible. Broad-spectrum antibiotics (4/4), IV fluids (4/4), hemodialysis (2/4), packed RBC, platelets, and fresh frozen plasma (2/4), mechanical ventilation (2/4), plasmapheresis (1/4), and oral ribavirin (1/4, but only three doses before to death) were all administered to non-survivors. The survivor took similar medications. Sewlall et al. believe that her survival was aided by the administration of recombinant factor VIIa, N-acetylcysteine, and atorvastatin on day 2, as well as the prompt initiation of ribavirin (oral ribavirin on day 1 and IV ribavirin on day 8) (Sewlall et al. 2014). The patient felt better on October 27, and RT-PCR failed to find viral RNA in his blood and urine three times (Paweska et al. 2009). He was released on December 2.

20.9

Future Perspectives and Anything Outstanding

It is hoped that raising global consciousness and putting in place broad-based coordinated processes would lead to earlier identification and control of potential outbreaks. Hopefully, further research into the genetic and cellular processes of viral

20

Lujo Hemorrhagic Fever

491

pathogenicity will reveal new therapeutic targets. The LUJV outbreak in 2008 was fortunate in that it was contained in a small area. However, future outbreaks of arenavirus or other VHF cannot be forecast in terms of their identification, location, or size. As a result, building diagnostic capability across the area is critical to ensuring a quick and efficient response. In-silico bioinformatics research may be a promising method for speeding up the manufacture of vaccines against highly pathogenic species. One of the main causes of this is that most well-known agents have not undergone extensive in vitro and in vivo testing. In this scenario, the biggest challenge is a race against time, but this vast body of research will eventually help us combat any other variants of the Lujo virus that might appear in the future.

References Atkinson B, Chamberlain J, Dowall SD, Cook N, Bruce C, Hewson R (2014) Rapid molecular detection of Lujo virus RNA. J Virol Methods 195:170–173 Bausch DG, Mills JN (2014) Arenaviruses: Lassa fever, Lujo hemorrhagic fever, lymphocytic choriomeningitis, and the South American hemorrhagic fevers. In: Viral infections of humans. Springer, pp 147–171 Bird BH, Dodd KA, Erickson BR, Albariño CG, Chakrabarti AK, McMullan LK et al (2012) Severe hemorrhagic fever in strain 13/N Guinea pigs infected with Lujo virus. PLoS Negl Trop Dis 6(8):e1801 Blumberg L, Enria D, Bausch D (2014) Viral Haemorrhagic fevers. In: Manson’s tropical diseases: twenty-third edition, pp 171–194.e172 Borrow P, Martínez-Sobrido L, De la Torre JC (2010) Inhibition of the type I interferon antiviral response during arenavirus infection. Viruses 2(11):2443–2480 Briese T, Paweska JT, McMullan LK, Hutchison SK, Street C, Palacios G et al (2009) Genetic detection and characterization of Lujo virus, a new hemorrhagic fever–associated arenavirus from southern Africa. PLoS Pathog 5(5):e1000455 Burrell CJ, Howard CR, Murphy FA (2016) Chapter 30. Arenaviruses. In: Fenner and white’s medical virology. Academic Press, pp 425–436 CDC (2013) Lujo Hemorrhagic Fever (LUHF). Viral Hemorrhagic Fever (VHFs). https://www.cdc. gov/vhf/lujo/index.html Fischer SA, Graham MB, Kuehnert MJ, Kotton CN, Srinivasan A, Marty FM et al (2006) Transmission of lymphocytic choriomeningitis virus by organ transplantation. N Engl J Med 354(21):2235–2249 Flanagan ML, Oldenburg J, Reignier T, Holt N, Hamilton GA, Martin VK, Cannon PM (2008) New world clade B arenaviruses can use transferrin receptor 1 (TfR1)-dependent and-independent entry pathways, and glycoproteins from human pathogenic strains are associated with the use of TfR1. J Virol 82(2):938–948 Frame JD, Baldwin JM Jr, Gocke DJ, Troup JM (1970) Lassa fever, a new virus disease of man from West Africa. Am J Trop Med Hyg 19(4):670–676 Gonzalez J-P, Sauvage F (2016) Machupo, Guanarito, Sabia, and Chapare viruses. Mol Detect Human Viral Pathogens 68:747–757 Gowen BB, Bray M (2011) Progress in the experimental therapy of severe arenaviral infections. Future Microbiol 6(12):1429–1441 Hallam SJ, Koma T, Maruyama J, Paessler S (2018) Review of mammarenavirus biology and replication. Front Microbiol 9:1751 Helmick C, Scribner C, Webb P, Krebs J, Mccormick J (1986) No evidence for increased risk of Lassa fever infection in hospital staff. Lancet 328(8517):1202–1205

492

Alka and A. B. Sonkar

Huzella LM, Cann JA, Lackemeyer M, Wahl-Jensen V, Jahrling PB, Kuhn JH, Perry DL (2016) 2 general disease pathology in filoviral and arenaviral infections. Viral Hemorrhagic Fevers 15 Kunz S, Rojek JM, Perez M, Spiropoulou CF, Oldstone MB (2005) Characterization of the interaction of Lassa fever virus with its cellular receptor α-dystroglycan. J Virol 79(10): 5979–5987 Lennette EH (1985) Laboratory diagnosis of viral infections MacLachlan NJ, Dubovi EJ (2011) Chapter 23: Arenaviridae. In: Fenner’s veterinary virology, 4th edn. Academic Press, San Diego, pp 385–392 Mahanty S, Bausch DG, Thomas RL, Goba A, Bah A, Peters CJ, Rollin PE (2001) Low levels of interleukin-8 and interferon-inducible protein–10 in serum are associated with fatal infections in acute Lassa fever. J Infect Dis 183(12):1713–1721 Manzione ND, Salas RA, Paredes H, Godoy O, Rojas L, Araoz F et al (1998) Venezuelan hemorrhagic fever: clinical and epidemiological studies of 165 cases. Clin Infect Dis 26(2): 308–313 Merianos A, Peiris M (2005) International health regulations (2005). Lancet 366(9493):1249–1251 Morales MAA, Calderón GE, Riera LM, Ambrosio AM, Enrıa DA, Sabattini MS (2002) Evaluation of an enzyme-linked immunosorbent assay for detection of antibodies to Junin virus in rodents. J Virol Methods 103(1):57–66 Nakauchi M, Fukushi S, Saijo M, Mizutani T, Ure AE, Romanowski V et al (2009) Characterization of monoclonal antibodies to Junin virus nucleocapsid protein and application to the diagnosis of hemorrhagic fever caused by south American arenaviruses. Clin Vaccine Immunol 16(8): 1132–1138 Ning Q, Brown D, Parodo J, Cattral M, Gorczynski R, Cole E et al (1998) Ribavirin inhibits viralinduced macrophage production of TNF, IL-1, the procoagulant fgl2 prothrombinase and preserves Th1 cytokine production but inhibits Th2 cytokine response. J Immunol 160(7): 3487–3493 Palacios G, Druce J, Du L, Tran T, Birch C, Briese T et al (2008) A new arenavirus in a cluster of fatal transplant-associated diseases. N Engl J Med 358(10):991–998 Paweska JT (2014) Lujo virus hemorrhagic fever. In: Emerging infectious diseases. Elsevier, pp 95–110 Paweska JT, Sewlall NH, Ksiazek TG, Blumberg LH, Hale MJ, Lipkin WI et al (2009) Nosocomial outbreak of novel arenavirus infection, southern Africa. Emerg Infect Dis 15(10):1598 Raaben M, Jae LT, Herbert AS, Kuehne AI, Stubbs SH, Chou Y-Y et al (2017) NRP2 and CD63 are host factors for Lujo virus cell entry. Cell Host Microbe 22(5):688–696. e685 Radoshitzky SR, Kuhn JH, Spiropoulou CF, Albariño CG, Nguyen DP, Salazar-Bravo J et al (2008) Receptor determinants of zoonotic transmission of New World hemorrhagic fever arenaviruses. Proc Natl Acad Sci 105(7):2664–2669 Sewlall NH, Paweska JT (2017) Lujo virus: current concepts. Virus Adapt Treat 9:41–47 Sewlall NH, Richards G, Duse A, Swanepoel R, Paweska J, Blumberg L et al (2014) Clinical features and patient management of Lujo hemorrhagic fever. PLoS Negl Trop Dis 8(11):e3233 Shao J, Liang Y, Ly H (2015) Human hemorrhagic fever causing arenaviruses: molecular mechanisms contributing to virus virulence and disease pathogenesis. Pathogens 4(2):283–306 Simulundu E, Mweene AS, Changula K, Monze M, Chizema E, Mwaba P et al (2016) Lujo viral hemorrhagic fever: considering diagnostic capacity and preparedness in the wake of recent Ebola and Zika virus outbreaks. Rev Med Virol 26(6):446–454 Sizikova TE, Lebedev VN, Syromyatnikova SI, Borisevich SV (2017) Lujo hemorrhagic fever. Vopr Virusol 62(4):149–153. https://doi.org/10.18821/0507-4088-2017-62-4-149-153 Smelt SC, Borrow P, Kunz S, Cao W, Tishon A, Lewicki H et al (2001) Differences in affinity of binding of lymphocytic choriomeningitis virus strains to the cellular receptor α-dystroglycan correlate with viral tropism and disease kinetics. J Virol 75(1):448–457

20

Lujo Hemorrhagic Fever

493

Spiropoulou CF, Kunz S, Rollin PE, Campbell KP, Oldstone MB (2002) New World arenavirus clade C, but not clade A and B viruses, utilizes α-dystroglycan as its major receptor. J Virol 76(10):5140–5146 Vieth S, Drosten C, Charrel R, Feldmann H, Günther S (2005) Establishment of conventional and fluorescence resonance energy transfer-based real-time PCR assays for detection of pathogenic New World arenaviruses. J Clin Virol 32(3):229–235 Vieth S, Drosten C, Lenz O, Vincent M, Omilabu S, Hass M et al (2007) RT-PCR assay for detection of Lassa virus and related Old World arenaviruses targeting the L gene. Trans R Soc Trop Med Hyg 101(12):1253–1264 World Health Organization (2008) International health regulations (2005): World Health Organization

Chapare Hemorrhagic Fever

21

Archana Bharti Sonkar and Alka

Abstract

In Bolivia, Chapare virus (ChapVs), a single-stranded RNA virus, causes Chaparehemorrhagic fever (CHHF). It is also known as Chapare Mammarena virus (MAVs), and it is a virus that has just recently been found to exist. ChapaVs are transmitted through rodent saliva, urine, droplets, or by infected individuals. Arenaviruses, which include Ebola virus disease (EVD), are the primary cause of this disease and many others (EVD). Arenaviruses are the most common causes of BHF and MHF in Bolivia. The ChapVs infection presents with symptoms that often include fever, anorexia malaise, and, myalgia. After 3–4 days, the patient began experiencing symptoms including headaches, arthralgia, and excessive tiredness. It is very uncommon for patients to have bleeding and neurological symptoms such as petechiae, irritability, tremors, bleeding gums, and lethargy. This is followed by a deterioration of the patient’s condition, various bleeding indicators, and eventually death. Human serum, blood, sperm, urine, and respiratory secretions contain the ChapVs. Diagnostic tests include RT-PCR, ELISA, IHC, cell culture, and electron microscopy. The first outbreak was in 2003 in Bolivia’s Chapare Province; the second was in 2019 in Caranavi. There is presently no therapy for CHHF. Keywords

Chapare virus · Chaparehemorrhagic fever · Mammarenavirus · Bolivia · Arenaviruses

A. B. Sonkar (✉) · Alka Department of Pharmaceutical Sciences, Babasaheb Bhimrao Ambedkar University (A Central University), Lucknow, India # The Author(s), under exclusive license to Springer Nature Singapore Pte Ltd. 2023 P. L. Bhukya et al. (eds.), Emerging Human Viral Diseases, Volume I, https://doi.org/10.1007/978-981-99-2820-0_21

495

496

21.1

A. B. Sonkar and Alka

Introduction

Chaparehemorrhagic fever (CHHF) is a viral hemorrhagic fever (VHF) caused by contamination with the Chapare virus (ChapVs) infection. The ChapVs are an important part of the arenavirus. The arenavirus belongs to the Arenaviridae family (Delgado et al. 2008), whose individuals are normally associated with rodenttransmitted diseases in people. The Arenaviridae family is divided into New World (NW) and Old World (OW) complexes (Gonzalez et al. 2007; Almeida et al. 2018). The ChapVs belong to the NW complex. The MAVs (formerly arenaviruses) contain viruses liable for initiating HHF and, in Bolivia, named as BHF diseases, containing NW viruses Guanarito, Machupo, Junin, Sabia, and ChapVs and OW viruses Lujo, and Lassa virus (McLay et al. 2013; Hallam et al. 2018). Arenaviruses are generally spread to humans by direct exposure to contagious rodents (rats) or indirectly through an infected rat’s urine or excrement. Every infection is ordinarily related to a certain rodent species of animal in which it has been kept. Various arenaviruses have been reported in rats, but only a few cause hemorrhagic infections. Arenavirus illnesses are quite common in certain parts of the world and may cause severe sickness. Typically, a new arenavirus is discovered every 3–5 years. Guanarito was identified in Venezuela, 1989, Sabia-in-Brazil, 1993, ChapVs in Bolivia, 2003–2004, and Lujo in South Africa, 2008 as the most recent addition to this series of human pathogenic viral infections (RodriguezMorales et al. 2019; Gonzalez and Sauvage 2016).

21.1.1 Brief History Recently, CDC scientists confirmed the person-to-person transmission of rare ChapVs in Bolivia in their latest research. Arenavirus, like ChapVs, is usually transmitted by rodents (Delgado et al. 2008) and may be transmitted by direct touch with contaminated rodents, their urine, and droppings, or via connection with a tainted human. The CHHF is produced by the arenavirus family, which is mainly accountable for disorders such as EVD. So far, two cases of CHHF have been recorded. In June 2019, the Bolivian Ministry of Health reported a group of cases of hemorrhagic fever (HF) with an unknown cause (Rodriguez-Morales et al. 2019). • Case 1, was identified in Caranavi Municipality, as a 65-year-old laborer, on May 1st, after 8 days of infection symptoms of fever, stomach pain, myalgia, vomiting, and retro-orbital pain including gingival hemorrhage. Then he died on May 12. • In case 2, medical attended to case one, a 25-year-old medical person, who developed indistinguishable indications on May 20th, On June 2; he was transferred to a reference emergency unit in La Paz and died 2 days later. • Case 3, the co-worker with Case 1, a 22-year-old farming worker, comes into view with identical effects: maculopapular rash and impatience condition on May 29. Following that, on June 3, he was transferred from Caranavi to La Paz and relieved from their 27-day hospitalization on June 30. Cases 4 and 5 had contact

21

Chapare Hemorrhagic Fever

497

with Case 2 during the transfer on June 2 and the endoscopic examination on June 4, while suffering from fever, malaise, and arthromyalgia on June 18 due to significant gingival hemorrhage. • Case 4, a 48-year-old medical ambulance helper, and • Case 5, a 42-year-old medical worker who works as a gastroenterologist, died on July 10th (Delgado et al. 2008).

21.1.2 Discovery At the ASTMH annual meeting, researchers from the USCDC revealed that during the 2019 Bolivia epidemic, scientists discovered that the virus may be transmitted from individual to individual. Near homes and farmlands, ChapVs infected rodents were discovered. The evidence examined by researchers proved that healthcare workers come under a higher risk zone because of their direct dealings with patients. Healthcare workers’ safety with the ChapVs should be possible by avoiding direct or indirect contact with patients’ blood, saliva, urine, or semen. The researchers further uncovered the RNA fragments associated with ChapVs infection. This suggests that the illness could be sexually transmitted (Gonzalez et al. 2007; Rodriguez-Morales et al. 2019).

21.2

Epidemiology

21.2.1 Geographical Distribution/Demographic In South America, two land-locked countries are situated, the first is Bolivia, and the second one is Paraguay. Bolivia shares its boundary with Brazil, Chile, Argentina, Paraguay, and Peru. The capital of Bolivia, named La Paz, is located near Titicaca Lake on the western side. The Chapare region is situated in the center of Bolivia’s country. The name of the Chapare region is due to the famous Chapare river flowing in this area. Famous ChapVs were first discovered in this Chapare region. Based on the particular name of the Chapare River, the identified virus is additionally (Fig. 21.1) named ChapVs (Cossaboom et al. 2020) .

21.2.2 Age, Mortality, and Morbidity Only one confirmed case of ChapVs was fatal in the first documented outbreak. In the second outbreak of 2019, three of the five recorded cases were fatal (the outbreak casualty pace was 60%) (Rodriguez-Morales et al. 2019).

498

A. B. Sonkar and Alka

Fig. 21.1 Map of Bolivia country. (Adapted from: “Chapare Virus, a Newly Discovered Arenavirus Isolated from a Fatal Hemorrhagic Fever Case in Bolivia” Delgado et al., 2008, 4(4), pp. 1–6. (Delgado et al. 2008))

21.2.3 Origin of Infection and Diversity An EVD that first originated in provincial Bolivia in 2004 might be transmitted from person-to-person after being discovered by a USCDC researcher. In 2019, three healthcare professionals in Bolivia came into contact with the infection of two patients suffering from Chapare disease. Two medical specialists (physicians) and one patient died as a result of these disease contaminations. Previously, the first confirmed instance of the infectious disease was reported more than a decade ago (Rodriguez-Morales et al. 2019; Escalera-Antezana et al. 2020).

21.2.4 Spread of Disease (Epidemics, Sporadic, Pandemics, Etc.) The latest outbreak of the ChapVs was noticed in 2019. The ChapVs RNA was identified in a rodent species known as the pigmy rat, which was prevalent across Bolivia and a few of its neighboring countries (Loayza Mafayle et al. 2022). Chapare spreads clearly through direct contact with the host’s excreted fluid. The viral infection is also documented to be most prevalent in several tropical places, particularly in specific areas of South America where the pigmy rice rodent with short ears can often be seen. According to experts, ChapVs may be transferred among people through bodily fluids, and this has been confirmed during the identification of diseases’ propensity to cause pandemics. As per the view of ChapVs researchers, the ChapVs infection can be communicated among people through body liquids and body waste. Scientists come across the ChapVs while recognizing pathogens that can cause pandemics (Rodriguez-Morales et al. 2019; Gonzalez and Sauvage 2016).

21

Chapare Hemorrhagic Fever

499

21.2.5 Biosafety Measures (Handling of Virus) Researchers are looking into the virus using suspected samples while maintaining the highest level of biosecurity for analyses of virus samples, limitations, sample collection, time gap after infection, the onset of symptoms, and freezing procedure of samples (the guidelines suggest a BSL4 lab) and carefully following all procedures for self-safety, inactivating samples, and getting rid of waste (Delgado et al. 2008).

21.2.5.1 Collection of Human Samples Virus isolation, virus detection, antigen detection, or RNA detection, will be performed with the collected sample (after 1–2 days of infection onset, during fever condition). Blood (cells buff coat and sera), sperm, and urine must be stored at 4 °C for the first 12 h, and then at -80 °C until analyzed. The presence of viruses in blood samples is shown a few days after the beginning of the disease, and viral RNA from sera may be collected for weeks, approximately 20 days following the disease beginning (Gonzalez et al. 2007; Gonzalez and Sauvage 2016). ChapVs may be isolated from various bodily fluids like sperm or urine (Rodriguez-Morales et al. 2019). Time is taken for the detection of different biological fluids—Antibody detection—1–5 days after the beginning of symptoms; late blood sample detection: 2 weeks just after the appearance of disease; this will be beneficial to examine IgG and IgM antibodies and should be stored at a low temperature (either 4 °C or -20 ° C). 21.2.5.2 Rodent Samples Human and specimen samples must be preserved in the refrigerator. Urine and blood are the most frequently used samples for testing. After the animals have been euthanized, their different organs will be separated for diagnostic or physiopathology reasons (kidney, brain, liver, heart, and spleen). Aliquoted biomaterial into 1 mL Nunc cryotubes, placed into sealed boxes and then frozen at a temperature of -70 °C (BL3, locked freezer). Blood and urine samples (1 mL) were collected and aliquoted in Nunc cryotube vials from the first week of illness onset, and throat swabs were resuspended in 1 mL of saline to examine the samples (Rodriguez-Morales et al. 2019). 21.2.5.3 Handling of Virus Samples Take out the stored sample-containing box from the freezer, and it is kept under a bio-safety cabinet (Class II) from the freezer. Separate all stored samples one by one according to need using sterile forceps in aseptic conditions and placing them in the appropriate rack container (Escalera-Antezana et al. 2020). After thawing the samples at room temperature for approximately 10 min, separate 200 μL from each vial into 1 mL of Trizol (prepare the trizol preparation 1 day before and placed in the BL3 refrigerator condition at 4 °C) containing 1.2 mL Eppendorf tubes. Quickly fill tubes with 10% Clorox. The remaining samples should be placed in a sealed box, and they should be returned to the freezer (Trizol instantly destroys viral

500

A. B. Sonkar and Alka

proteins and releases non-infectious RNA). If samples that have been stored are no longer infectious, replace them from BL3 and process them under the conditions of BL2 since they are no longer infectious. Conventional PCR-based test will be carried out using fresh Eppendorf that carries the arenavirus-extracted RNA. All this Eppendorf will be delivered in a fresh, sterilized, and closed plastic vessel (Rodriguez-Morales et al. 2019; Gonzalez and Sauvage 2016).

21.3

Potential Risk of Emergence and Re-emergence

In South America (2019), physicians confused ChapVs with dengue as it is like a hemorrhagic fever prevalent disease. However, further tests didn’t give any indications of dengue infection. After that, researchers hypothesized that it may be something else and decided to test it on different pathogens that are present in a particular area, like Machupo and yellow fever, which are both lethal hemorrhagic fevers. However, the outcomes came out negative. The CDC’s association with the Latin America-centered PAHO assisted in identifying the virus after receiving the sample of the ChapVs from PAHO. This hemorrhagic fever originally happened in Chapare Province, Cochabamba, Bolivia (2003), which brought about one deadly case and disappeared. The subsequent episode happened in Caranavi Province, Bolivia (2019), and brought about five affirmed cases, three of which were deadly (Table 21.1). The Chapare 2019, outbreak uncovered that the virus could also spread from one individual to another. The CDC specialists further detailed that the infection is additionally observed after 168 days in one Chapare-contaminated survivor’s semen. Moreover, the infection was found in rodents near the surrounding farmlands where the first contaminated patient lived. These suspected animal-borne viruses emerge and re-emerge repeatedly, and their numbers are likely to increase due to human encroachment on rodent habitats. Therefore, more research into these viral infections, including both acute disease models and also in their natural animal

Table 21.1 Age, relationship with an infected person, clinical symptoms, and death/survival of Chapare infected patient. Adopted from: https://doi.org/10.1016/j.tmaid.2020.101589 (EscaleraAntezana et al. 2020) Case No. 1. 2. 3. 4. 5.

Gender (year) Male (65y) Female (25y) Male (48y) Male (42y) Male (21y)

Relationship and contacts Exposer to rodents Physician of case 1 Physician of case 2 Physician of case 2 Son-in-law of case 1

Major clinical symptoms Fever and digestive hemorrhage Fever and digestive hemorrhage Fever and digestive hemorrhage Fever and digestive hemorrhage Fever and digestive hemorrhage

RTPCR Not done Not done Positive

Died/ survival Died

Positive

Died

Not done

Survived

Died Survived

21

Chapare Hemorrhagic Fever

501

hosts, is crucial, as it will help drive future MCM innovation. This study emphasizes the importance of increased public monitoring, education, and awareness, as well as improved CHHF detection technology and prevention methods (Cossaboom et al. 2020; Golden et al. 2015).

21.4

Organization of Infectious Agents (Structural and Molecular)

21.4.1 Classification Kingdom Phylum Class Order Family Genus Species

: : : : : : :

Orthornavirae Negarnaviricota Ellioviricetes Bunyavirales Arenaviridae Mammarenavirus Chaparemammarenavirus

21.4.2 Morphology and Virion Structure The viral components are generally spherical and have a diameter of ≃110–130 nm. A bi-layer-lipid membrane covered them completely. They display granular patterns that are ribosomes obtained from human hosts during their cross-section. According to their structural characteristics (Fig. 21.2), they acquire their name from the Latin word “arena” which signifies “sandy” (Golden et al. 2015). Because of their genetic component, genome construction by RNA, and due to lack of fully explored details of their replication process, researchers assumed that new research virus particles called virions are formed via budding development on the outer surface of infected host cells.

21.4.3 Genome Structure and Organization Arenavirus is a negative ssRNA virus, whose genome is composed of two (L and R) RNA segments. Each segment encodes two molecules of proteins, however, ORF is in an inverse manner (see Fig. 21.3). The first protein’s sequencing is effectively coded in the viral genome’s ssRNA; the second is coded in the opposite sense and is coded by the viral RNA’s arrangement reciprocal. In the recognization of two sequences, a sequence is known as vRNA, found in the virion whereas another is called VRR. Z and L proteins are encoded in the L genomic region (~7.2 kb), which is responsible for viral RNA polymerase (L protein) and a zinc-binding protein (Z protein). Non-covering ORF with inverted polarity is used to encode the N protein

502

A. B. Sonkar and Alka

Virion

Lipid membrane bilayer

S-RNA segment

Matrix protein (Z) Glycoprotein-tetramer (4*GPC) Cellular ribosome RNA Polymerase (L) Nucleoprotein (N) with RNA segment (embedded in protein N)

L-RNA segment

Fig. 21.2 Structure of Virion. Adapted from “Machupo, guanarito, sabia, and chapare viruses”, J.-P. Gonzalez & Sauvage, 2016, pp. 749–759 (Gonzalez and Sauvage 2016) Genome

S-Segment

L-Segment vRNA 3’-OH vcRNA

5’

L 5’ Z

3’-OH

3’-OH

5’

vRNA

N

5’ GPC

vcRNA 3’-OH

Fig. 21.3 Structure of genome and its organization. Adapted from “Machupo, Guanarito, Sabia, and Chapare viruses”, J.-P. Gonzalez & Sauvage, 2016, pp. 749–759 (Gonzalez and Sauvage 2016)

and the envelope GPC protein in the S genomic region (~3.5 kb). More hairpin configurations may be framed by an intergenic non-coding region, which serves to isolate the gene of both (S and L) segments. In every RNA segment, the 5′ and 3′ un-translated ending sequences have a usually preserved opposing matching sequence that spans 19 nucleotides at each endpoint. Most arenaviruses share nucleocapsid antigens, and quantitative links illustrate the difference between African and Western hemisphere viruses (Gonzalez and Sauvage 2016; Murphy et al. 1969; Sarute and Ross 2017).

21.4.4 Propagation and Assay in In-Vitro and In-Vivo Laboratory Models Animal models replicate some, but not all, NW arenavirus-related human illnesses. Even though OW mice (Mus musculus/Mus domesticus) are not effectively infected

21

Chapare Hemorrhagic Fever

503

with NW Arenaviruses (clade B), both wild-type and mutant Mus species have been studied a lot to look at pathophysiology and immune response. Mice missing type I and III interferon receptors are likewise very vulnerable to infection with pathogenic viruses and quickly succumb to infection, but they do not mimic the human disease—free from hemorrhagic lesions were seen in all tissue. Elevated cytokines levels caused by the virus may be necessary for pathogenesis in humans, including endothelial damage. Interferon-deficient mice wouldn’t get this illness. NW arenaviruses’ mice receptor is unknown. Mice cell entrance receptors are L-type calcium channels. Because NW arenaviruses employ different receptors in mice, their in vivo cell type tropism may vary from that in people, contributing to their changed pathogenic behavior. Due to disparities in illness outcomes and the absence of a complete immune response, the currently researched mice models with immunological dysfunction are not relevant for studying in vivo infection. Guinea pigs have been infected with NW arenavirus, and their sickness more accurately mirrors that found in humans. However, infection is 100% lethal, possibly because of a lack of humoral Ab response to infection. NW arenaviruses, which don’t cause illness in humans, infect other animals, including hamsters. Similarly, ribavirin helped monkeys. Although primates are beneficial for evaluating medicines and vaccination approaches, working with ABSL-4 drugs in big animals prohibits their use as a disease progression model (Sarute and Ross 2017).

21.4.5 Viral Proteins and Life Cycle The ssRNA molecules L and S are responsible for structuring the arenavirus genomic characteristics. By inhaling airborne contaminants, a virus enters a host’s body. In the early stages of a disease, macrophages are a good place to find contamination and infection. This makes alveolar macrophages the most important examining cells (Sarute and Ross 2017). The genome segments combine with the ribonucleic proteins L and N to generate a ribonucleic particle. Particles of arenavirus are made up of these four proteins: They are enclosed in a lipid bilayer that contains the G protein (GP1, GP2, and SSP), and the Z protein lines the inside of the lipid bilayer (Fig. 21.4). The following proteins or protein domains, the atomic structures of which are known, are displayed in the figure or surface presentation in the close-up: The stages of the arenaviral life cycle are represented by the four primary key pathways for antiviral drugs. These areas of interest are as follows: binding and entry; immune response; replication and transcription; and maturation and budding (Delgado et al. 2008; Kerber et al. 2014; Sarute and Ross 2017).

21.5

Pathogenesis in Humans

Viral pathogenesis is the study of the interactions and methods by which viruses cause sickness in particular target hosts, typically at the molecular or cellular level. During viral infection, the virus replicates on the host, and the host mounts an

RNA release

Acidification of endosome leads to GP2 mediated envelope fusion and RNA release

Fusion

Endocytosis

Virion attachment

Fig. 21.4 Arenavirus structure and the viral lifecycle

Receptor binding

Binding and Entry

Released Genomic vRNA

Ezrly(NP, LP) mRNA

Synthesized anti-genomic vRNA

Nucleus

Rough ER

GPC Translation and glycosylation in ER

Late (GPC, Z) mRNA

Synthesized genomic vRNA

Golgi

Release of mature virus

SKI-1/ S1P maturation and cleavage of GPC into GP1/ GP2 in Golgi complex

Maturation and budding

SPase cleavage of SSP in ER

Z translation

Immune and response

Replication and transcription

Cytoplasm

NP, LP translation

Z mediated ESCRT-1 trafficking of replicative complex to plasma membrane

Virion assembly and budding

504 A. B. Sonkar and Alka

21

Chapare Hemorrhagic Fever

505

immunological reaction against the virus. Viruses may cause sickness, be scattered throughout the body, and reproduce due to explicit destructiveness characteristics (Peters 2002; Payne 2017).

21.5.1 Host Viral Interaction ChapVs RNA was identified in a rodent species of Bolivia normally known as the pigmy rat. The pigmy rat has been discovered throughout Bolivia and in several neighboring countries. Distinctly through direct contact with liquid discharged from the infected body. ChapVs have been most commonly transmitted in tropical areas, particularly in South America, where pigmy rice rats are widespread (Loayza Mafayle et al. 2022).

21.5.2 Host Immune Response (Innate and Immune) Clinical symptoms included headache, fever, myalgia, vomiting, and arthralgia, followed by various hemorrhagic signs after 14 days from the beginning of the disease. The initial stages of the virus are similar to dengue fever, dengue hemorrhagic fever, and yellow fever. In this sense, arenavirus exposure requires virologic testing. Because of the rapid progression of contamination by NW arenaviruses and because mortality may happen even before antibodies are discovered, analysis is critical, and testing can be focused on a specific virus based on the regular nidality of NW arenaviruses. Regardless of a presumed acute human disease by an arenavirus, all research center examinations should be carried out in BL4 (highly safe conditions) (Gonzalez et al. 2007).

21.5.3 Virulence and Persistence NW infections may cause persistent disease in their normal rodent hosts through ingestion of infected food, inward breath of infection-containing mist, or direct contact with the surface of contaminated materials. Arenaviruses can spread from where they were first found to cause a disease that affects the whole body. This can cause severe illness and death in both animals and people (Shao et al. 2015).

21.6

Clinical Manifestations

The deadly disease starts treacherously after an incubation of 1 to about 14 days. The main indications or signs are frequent malaise and fever, mild headache, anorexia, myalgia, or stomachache (Fig. 21.5). Following 3–4 days, when multiple biological systems are included, the signs become more serious: stomach torment, prostration, nausea and vomiting, mild diarrhea, or constipation (Fig. 21.5). At times,

506

A. B. Sonkar and Alka Clinical Symptoms of CHAPV infection (%) U pp er F di ev ge er s D tive iz zi ... n Fa ess tig Ab u do C e m h in ills al p N ain au Vo se Th m a R eq rom D iting ia ui re boc rrh d y m top ea ec e ha nia ni ca R A l... en D H a RS ep l f at ailu i En c fa re ce ilu ph re al iti At s ax ia

Clinical findings of patients with CHAPV infection (%)

120 100 80 60 40 20 0

Clinical Symptoms

Fig. 21.5 Clinical findings of patients with ChapVs infection (%). Adapted from: “Clinical features of fatal cases of Chapare virus hemorrhagic fever originating from rural La Paz, Bolivia, 2019: A cluster analysis”, 36, 101589 (Escalera-Antezana et al. 2020)

photophobia, dizziness, retro-orbital pain, or confusion may happen just as the principal indications of vascular impairment like a conjunctival injection, hypotension (postural), skin petechiae, or flushing over the head and upper trunk. Around 30% of patients suffer from more severe hemorrhagic or neurological indications (seizures, hand or tongue tremors, and an unconscious state). Severe hemorrhagic indications like mucous membrane bleeding (nose, vagina/uterus, gums, and GI tract) and wounding at the needle penetration destinations are normal in patients. Demise normally occurs 7–12 days after the beginning of sickness because of shock and organ failure. Enduring patients start to improve from the inside in the second week after the commencement of the illness (Escalera-Antezana et al. 2020).

21.6.1 Phases of Disease In South America, arenavirus caused acute viral febrile sickness symptoms that lasted between 1 and 2 weeks after the clinical manifestation of HF. The sickness begins continuously, with general retro-orbital pain, headache, conjunctival hyperemia, retro-orbital torment, malaise, and moderate to continuous fever, which is followed by different digestive system-related signs and symptoms. There might be ecchymosis and bruises, with erythema on the neck, face, and chest upper portion. Progression of thrombocytopenia and leukopenia is normal for extreme cases. Indications normally resolve 10–15 days after the beginning of the disease in patients who endure it. The incubation time in reported cases is 6–14 days. However, it can vary from 5 to 21 days (Huang et al. 2015).

21

Chapare Hemorrhagic Fever

507

21.6.2 Clinical Symptoms The virus, Chapare, was originally identified to cause HF similar to Ebola, as well as bleeding gums, stomach discomfort, vomiting, and skin rashes. VHF is a serious condition and a kind of life-threatening infection that may affect many organs and damage the blood vessel walls (Shao et al. 2015).

21.6.3 Serology, Molecular, and Histological Approaches 21.6.3.1 Ag Captures Enzyme-Linked Immunosorbent Assay (ELISA) This strategy permits the quantitative detection of Chapare antigens by using inactivated fluid samples (supernatants of cell culture or sera). Beta-propio-lactone or irradiation inactivates the virus and an ELISA is subsequently performed if precise Abs are accessible. For instance, three MAbs, E4–2, C6–9, and C11–12, have been delivered for the detection of arenavirus and can be utilized for building up an antigen-capture ELISA. Two tests opened up to explicitly distinguish Junín infection antigen utilizing MAb C6–9, as well as another utilizing E-4-2 or MAb C11–12 to recognize any remaining human pathogenicity of arenaviruses in the South American region, such as Chapare, Machupo, Sabia, and Guanarito viruses. The test’s specificity is sufficient to identify the viral antigens in throat washes, blood tests, or urine tests at the most severe phase of arenavirus infection (Gonzalez and Sauvage 2016). 21.6.3.2 Immuno-Histochemical Staining (IHC) MAb reactive response for NW Arenaviruses could be used to tell the difference between viral antigens in a narrow segment of essential organs and skin biopsies from animals and people who have already died (Hetzel et al. 2013; Maes et al. 2019). 21.6.3.3 Fluorescence Microscopy (IFAs) It is based on a particular antibody response test, which is another well-known approach for detecting ChapV infection in clinical specimens. The fundamental concern with this approach is the significant cross-reactivity with arenaviruses. The existence of Abs coordinated in sera against the nucleocapsid protein is utilized to diagnose viral illnesses in this approach. To acquire viral antigens or mixedculture findings, use the newly established approach for infecting Vero-cell-culture. Following that, fixed infected cells are treated by incubating with repeated dilutions of sera, and cleaned, and the existence of anti-arenavirus (IgM or IgG) is shown by re-incubation with applicable fluorescein-conjugated anti-IgA. The technique’s fundamental flaw is the subjective interpretation of findings for determining the endpoints (Gonzalez and Sauvage 2016).

508

A. B. Sonkar and Alka

21.6.3.4 Antibody (Ab) Detection ELISA Antigens from ChapVs-infected Vero cells were absorbed into microwell plates and incubated with successive sera dilutions. Subsequently incubating and washing the sample, the applicable amount of anti-Ab serum is applied to the plate and combined with the peroxidase-ABTS system. The activity of peroxidase, which produces changes in the color of the sample stock, indicates the existence of an actual disease condition. The technique seems to be suitable for identifying IgG in infected wild rats as well. A modified procedure was applied to identify the existence of IgM. Antihuman IgM is coated on microwell plates before serum and cell-lysate antigens are diluted. In this discipline, it has been suggested that microwell plates be replaced by filter paper discs. Sensitivity and accuracy are reduced with this methodology. Furthermore, novel recombinant proteins allow for safe modifications during ELISA estimation (Maes et al. 2019; Hetzel et al. 2013). 21.6.3.5 Neutralization Test (NT) In NT, the virus becomes infectious by an antibody response. Serum and viruses are combined and vaccinated in cell culture. Hem-adsorption/hem-agglutination may reveal unneutralized viruses. Neutralization types are described below: I. Reversible neutralization—the neutralizing interaction can be reversed by diluting the Ab-Ag within 30 min after Ag-Ab complex formation; or II. Stable neutralization—It requires fewer Ab molecules than reversible neutralization, which occurs when Ab particles contact two Ag sites.

21.6.3.6 Real-Time Reverse Transcription (RT)-PCR Assay All known clade B viruses could be identified by using a standard RT-PCR technique based on FRET probes (Hetzel et al. 2013). FRET probes targeted genomic sequences inside the nucleo-protein gene were used as a primer and this technique was established through the use of RNA templates and reagents. The real-time PCR assay revealed 0.5 and 5 TCID50 of the Junin and Guanarito viruses, respectively. RNA from the Tacaribe, Cupixi, and Amaparivirus families were amplified by using the clade B PCR with RNA from the Juin, Guanarito, Machupo, and Sabia families per 5-500 TCID50 reaction. It was possible that new clade B Arena viruses could be discovered by using universal PCR in human and animal reservoirs (Bowen et al. 1996). When actual viral RNA was not widely available, researchers developed a novel method of creating RNA templates using synthetic oligonucleotides in order to generate a specific test in a specific population (Weaver et al. 2000). The FRET probe technique (Vieth et al. 2005) used was described in detail as follows: 1. By using QIAamp Viral RNA kit (Qiagen), firstly prepared RNA from 140 μL of supernatant or body fluids. Then, homogenized 5 mg of tissue in 600 μL of Qiagen’s lysis buffer solution with a Fast Prep FP120 bead mill (Savant Instruments Inc., NY). The RNeasy Mini kit (Qiagen) was used to separate the RNA from the cell debris and 60 μL RNA was eluted.

21

Chapare Hemorrhagic Fever

509

2. The enzymes superscript reverse transcriptase and Platinum Taq polymerase was used in one-step RT-PCR (Life Technologies). In 20 μL, there were 10 μL of the kit reaction mixture (1.2 mM MgSO4), 40 ng bovine serum albumin (Sigma) per μl (4 μL of enzyme mixture, and 3 μL of RNA). During each experiment different primers, FRET probes, and MgSO4 could be used. 3. Universal RT-PCR was used with 0.5 μM of the following primers and 1.25 Mm more MgSO4 to identify human pathogenic arenavirus of South America (clade B) RNA: GuaS2041a + (5′-CCATTTTTAAACCCTTTCTC ATCATG-3′) GuaS2041b + (5′-CCATTTTTGAAGCCCTTCTCATCATG-3′) GuaS2333a (5′-CAAATACTCGGGAGGTCTTGGGACAACAC-3′) GuaS2333b (5′-CAAATTCTTGGGAGATCTTGGGACAACAC-3′) GuaS2333c - (5′CAAATCATCGGCAGGTCATGGGACAACAC-3′). 4. Real-time RT-PCR for the Junin virus requires 0.75 μM GuaS2041a+, 0.75 μM GuaS2333c, 0.15 μM probe Jun87-115FL (TGGAACAATGCCATCTC AACAGGGTCAGT, [3′]-fluorescein), 0.15 μM probe JunROX120-145 (GGTCCTTCAATGTCGAGCCAAAGGGT,[5′]-6-carboxy-Xrhodamine (ROX), [3′]-phosphate), and 1.75 mM additional MgSO4. 5. Use 0.75 μM of GuaS2041a +, 0.75 μM of GuaS2333a +, 0.375 μM of Gua49-78FL (GTTTTCTGAAACAGTGCACATAGTTTCCTG, [3′]-fluorescein), 0.15 μM of GuaROX84–113 (GGTTGGAAAACTGCCAACTC CACAGGATCA, [5′]-ROX, [3′]-phosphate), and 1.75 mM additional MgSO4. 6. To carry out the reaction, use Light Cycler equipment (Roche), and the following cycling profiles were included: reverse transcription at 50 °C for 30 min; initial denaturation at 95 °C for 3 min; 10 pre-cycles at 95 °C for 5 s; 60 °C for 5 s with a temperature drop of 1 °C for each cycle; 72 °C for 20 s; and 40 cycles at 95 °C for 5 s; 55 °C for 10 s; and 72 °C for 20 s. For Junin and Guanarito virus-specific tests using probe detection, read fluorescence at the 55 °C annealing phase and execute a melting curve analysis to select the right product by its specific melting temperature. The melting curve studied used temperatures of 95 °C for 5 s, 45 ° C for 15 s, and 85 °C at a rate of 0.1 °C/s with continuous fluorescence readings (Gonzalez and Sauvage 2016).

21.6.3.7 Histopathological Analysis Samples of tissue were put in a 10% formaldehyde solution at least for 3–4 days. After that, the samples were properly washed with distilled water and then transferred to 70% ethanol. Finally, the samples were embedded in paraffin wax and sliced with a microtome to a width of about 5 μm. The samples were then stained with hematoxylin and eosin stains and examined under a light microscope at 10× to 40× magnifications.

510

21.7

A. B. Sonkar and Alka

Diagnostics and Therapeutics Approaches

In respect to MAV diagnostics, virus isolation is considered the gold standard. MAVs are easily accessible through cell culture, specifically from Vero cells, and can be obtained with relative ease. Early samples were taken (after one to a couple of days from the commencement of the fever indications) so that a diagnosis could be made. Viruses can be found in a variety of biological products, such as blood, so these samples were taken (cell buff coat and serum). Tests such as ELISA, VNA, and IFA are typically utilized in order to identify MAV antibodies. The techniques of RT-PCR are helpful for identifying the viral contamination of MAVs effectively. Because of the expensive equipment and expertise required, the application of these tests to environmental or clinical elements used for the early diagnosis of human cases has been limited. Isolation of the virus is the method that is most reliable for diagnosing MAVs. Cell culture is a simple and efficient method for the production of MAVs, particularly in Vero cells (Vieth et al. 2008).

21.8

Prevention and Control

Taking multiple precautions to prevent and control viral infection transmission • Firstly, control the rodents within the home and surrounding areas, especially for the prevention of ChapVs. • Consume no food or beverage that has been affected by infected rodents. • Infected people should maintain a strategic distance from contact with the infected person after recovery until they test negative. • Healthcare facilities must be secure and the most significant biosecurity measures should be followed as the disease is highly contagious. Because of ChapVs transmission from one person to a second, the infectious materials of Chapare patients like urine, blood, saliva, respiratory secretions, semen, and other biological fluids, while the patient has symptoms. Infected people can infect others (family members, workers in the health sector, etc.) via infected biological fluids. Thus, it is crucial to avoid coming into contact with a ChapVs carrier’s bodily fluids (Bausch et al. 2000; Moreno et al. 2011).

21.8.1 Management of Disease Prophylactic and therapeutic treatment approaches are used against MAVs hemorrhagic fevers. Hemorrhagic fever treatments are mainly care and passive antibody therapy. The current way to treat AHF is with an immune-convalescent plasma transfusion with effective doses of JUNV antibodies that neutralize the virus. Off-label usage of the non-immuno-suppressive guanosine analog ribavirin (1-ß-dribofuranosyl-1-H-1, 2, 4-triazole-3-carboxamide), an IMPDH inhibitor, is the only

21

Chapare Hemorrhagic Fever

511

current anti-MAVs medication. Regarding bioterrorism and the health risks that come from being infected with pathogenic MAVs, there is less availability of vaccines that have been approved by the FDA. There are currently no specific medications available to cure this condition. In general, patients consider intravenous liquids (Moreno et al. 2011; Rollin et al. n.d.).

21.9

Future Perspective and Anything Outstanding for Virus

Arenaviruses address an enormous and systematically different group of viruses that are kept up in the environment by small rodents. Despite this, the causal agents transmit serious viral diseases, which are HF associated with significant mortality rates. New sequencing machines will allow CDC experts to quickly develop an RT-PCR assay similar to the one that was to analyze Covid-19 to assist in the identification of ChapVs. The researchers’ current focus is on identifying the disease-spreading method and determining the severity of the mysterious ChapVs. Is there anything noteworthy about the virus? Researchers assume that the infection was present in Bolivia for a long time before it was officially recorded. Contaminated individuals may be misidentified as having dengue since the mosquito-bite illness is known to produce similar characteristics. Researchers discovered that the Chapare infection is substantially more difficult to get than the COVID infection because it is not communicable via breathing. According to the CDC website, dehydration shock management is accomplished by fluid resuscitation, sedation, pain medication, and transfusion as supportive care. This looks at how to stop CHHF and is mostly about how better enforcement, public understanding, and better explanations are needed.

References Almeida A, Olaya-Gómez J, Sánchez-Ramírez N, Murillo D, Cardona-Ospina JA, Lagos-GrisalesG, Rodriguez-Morales A (2018) Mitigation of the global impact of Lassa fever: have we investigated enough about this arenavirus? A bibliometric analysis of Lassa fever research. Travel Med Infect Dis 24:13–14. https://doi.org/10.1016/j.tmaid.2018.06.012 Bausch DG, Rollin PE, Demby AH, Coulibaly M, Kanu J, Conteh AS, Wagoner KD, McMullan LK, Bowen MD, Peters CJ, Ksiazek TG (2000) Diagnosis and clinical virology of Lassa fever as evaluated by enzyme-linked immunosorbent assay, indirect fluorescent-antibody test, and virus isolation. J Clin Microbiol 38(7):2670–2677. https://doi.org/10.1128/JCM.38.7.2670-2677. 2000 Bowen MD, Peters CJ, Nichol ST (1996) The phylogeny of New World (Tacaribe complex) arenaviruses. Virology 219(1):285–290. https://doi.org/10.1006/viro.1996.0248 Cossaboom C, Ramirez A, Romero C, Morales-Betoulle M, Vega GA, Gutiérrez JTM, Loayza R, Ardaya JCA, Martínez SS, Zambrana MC, Colque EG, Aguilera GA, Guzmán JR, Alvis FLM, Aguilera CEA, Mendez-Rico J, Whitmer S, Patel K, Klena J, Montgomery J (2020) Re-emergence of Chapare hemorrhagic fever in Bolivia, 2019. Int J Infect Dis 101:244–245. https://doi.org/10.1016/j.ijid.2020.11.073 Delgado S, Erickson BR, Agudo R, Blair PJ, Vallejo E, Albariño CG, Vargas J, Comer JA, Rollin PE, Ksiazek TG, Olson JG, Nichol ST (2008) Chapare virus, a newly discovered arenavirus

512

A. B. Sonkar and Alka

isolated from a fatal hemorrhagic fever case in Bolivia. PLoS Pathog 4(4):1–6. https://doi.org/ 10.1371/journal.ppat.1000047 Escalera-Antezana JP, Rodriguez-Villena OJ, Arancibia-Alba AW, Alvarado-Arnez LE, BonillaAldana DK, Rodríguez-Morales AJ (2020) Clinical features of fatal cases of Chapare virus hemorrhagic fever originating from rural La Paz, Bolivia, 2019: a cluster analysis. Travel Med Infect Dis 36:101589. https://doi.org/10.1016/j.tmaid.2020.101589 Golden JW, Hammerbeck CD, Mucker EM, Brocato RL (2015) Animal models for the study of rodent-borne hemorrhagic fever viruses: arenaviruses and hantaviruses. Biomed Res Int 2015: 793257. https://doi.org/10.1155/2015/793257 Gonzalez J-P, Sauvage F (2016) Machupo, guanarito, sabia, and chapare viruses. In: Molecular detection of human viral pathogens, pp 749–759 Gonzalez JP, Emonet S, de Lamballerie X, Charrel R (2007) Arenaviruses. In: Childs JE, Mackenzie JS, Richt JA (eds) Wildlife and emerging zoonotic diseases: the biology, circumstances and consequences of cross-species transmission. Springer, Berlin Heidelberg, pp 253–288. https://doi.org/10.1007/978-3-540-70962-6_11 Hallam SJ, Koma T, Maruyama J, Paessler S (2018) Review of mammarenavirus biology and replication. Front Microbiol 9:1751. https://doi.org/10.3389/fmicb.2018.01751 Hetzel U, Sironen T, Laurinmäki P, Liljeroos L, Patjas A, Henttonen H, Vaheri A, Artelt A (2013) Isolation, identification, and characterization of novel arenaviruses, the etiological agents of boid inclusion body disease. J Virol 87(20):10918–10935. https://doi.org/10.1128/JVI. 01123-13 Huang C, Kolokoltsova OA, Yun NE, Seregin AV, Ronca S, Koma T, Paessler S (2015) Highly pathogenic New World and Old World human arenaviruses induce distinct interferon responses in human cells. J Virol 89(14):7079–7088. https://doi.org/10.1128/JVI.00526-15 Kerber R, Reindl S, Romanowski V, Gómez RM, Günther S, Meulen J (2014) Research efforts to control highly pathogenic arenaviruses: a summary of the progress and gaps. J Clin Virol:1–8. https://doi.org/10.1016/j.jcv.2014.12.004 Loayza Mafayle R, Morales-Betoulle ME, Romero C, Cossaboom CM, Whitmer S, Alvarez Aguilera CE, Avila Ardaya C, Cruz Zambrana M, Dávalos Anajia A, Mendoza Loayza N, Montaño A-M, Morales Alvis FL, Revollo Guzmán J, Sasías Martínez S, Alarcón De La Vega G, Medina Ramírez A, Molina Gutiérrez JT, Cornejo Pinto AJ, Salas Bacci R et al (2022) Chapare hemorrhagic fever and virus detection in rodents in Bolivia in 2019. N Engl J Med 386(24):2283–2294. https://doi.org/10.1056/NEJMoa2110339 Maes P, Adkins S, Alkhovskiy S, Zupanc T, Ballinger M, Bente D, Beer M, Bergeron E, Blair C, Briese T, Buchmeier M, Burt F, Calisher C, Charrel R, Choi I-R, Clegg J, la Torre J, Lamballerie X, DeRisi J, Kuhn J (2019) Taxonomy of the order bunyavirales: second update 2018. Arch Virol 164:927–941. https://doi.org/10.1007/s00705-018-04127-3 McLay L, Liang Y, Ly H (2013) Comparative analysis of disease pathogenesis and molecular mechanisms of New World and Old World arenavirus infections. J Gen Virol 95:1–15. https:// doi.org/10.1099/vir.0.057000-0 Moreno H, Gallego I, Sevilla N, de la Torre JC, Domingo E, Martín V (2011) Ribavirin can be mutagenic for arenaviruses. J Virol 85(14):7246–7255. https://doi.org/10.1128/JVI.00614-11 Murphy FA, Webb PA, Johnson KM, Whitfield SG (1969) Morphological comparison of Machupo with lymphocytic choriomeningitis virus: basis for a new taxonomic group. J Virol 4(4): 535–541. https://doi.org/10.1128/JVI.4.4.535-541.1969 Payne S (2017) Chapter 9: Viral pathogenesis. In: Payne S (ed) Viruses. Academic Press, pp 87–95. https://doi.org/10.1016/B978-0-12-803109-4.00009-X Peters CJ (2002) Human infection with arenaviruses in the Americas. Curr Top Microbiol Immunol 262:65–74. https://doi.org/10.1007/978-3-642-56029-3_3 Rodriguez-Morales A, Castañeda-Hernández D, Escalera Antezana JP, Alvarado-Arnez L (2019) Organisms of concern but not foodborne or confirmed foodborne: bolivian hemorrhagic fever virus (machupo virus). https://doi.org/10.1016/B978-0-08-100596-5.22639-5

21

Chapare Hemorrhagic Fever

513

Rollin PE, Nichol ST, Zaki S, Ksiazek TG (n.d.) Arenaviruses and filoviruses. In: Murray PR, BBaron EJ, Jorgensen JH, Landry ML, Pfaller MA (eds) , pp 1510–1522 Sarute N, Ross SR (2017) New World arenavirus biology. Ann Rev Virol 4(1):141–158. https://doi. org/10.1146/annurev-virology-101416-042001 Shao J, Liang Y, Ly H (2015) Human hemorrhagic fever causing arenaviruses: molecular mechanisms contributing to virus virulence and disease pathogenesis. Pathogens (Basel, Switzerland) 4:283–306. https://doi.org/10.3390/pathogens4020283 Vieth S, Drosten C, Charrel R, Feldmann H, Günther S (2005) Establishment of conventional and fluorescence resonance energy transfer-based real-time PCR assays for detection of pathogenic New World arenaviruses. J Clin Virol 32(3):229–235. https://doi.org/10.1016/j.jcv.2004.07.011 Vieth S, Drosten C, Lenz O, Vincent M, Omilabu S, Hass M, Becker-Ziaja B, ter Meulen J, Nichol S, Schmitz H, Günther S (2008) RT-PCR for detection of Lassa virus and related Old World arenaviruses targeting the L gene. Trans R Soc Trop Med Hyg 101:1253–1264. https:// doi.org/10.1016/j.trstmh.2005.03.018 Weaver SC, Salas RA, de Manzione N, Fulhorst CF, Duno G, Utrera A, Mills JN, Ksiazek TG, Tovar D, Tesh RB (2000) Guanarito virus (Arenaviridae) isolates from endemic and outlying localities in Venezuela: sequence comparisons among and within strains isolated from Venezuelan hemorrhagic fever patients and rodents. Virology 266(1):189–195. https://doi.org/ 10.1006/viro.1999.0067

Bas-Congo Tibrovirus

22

Jithin S. Sunny, M. Jeevan Kumar, Sambrinath Christopher, Archana Vishwakarma, Ramya Mohandass, and Lilly M. Saleena

Abstract

Amongst the pathogenic diseases known to affect humans, viral hemorrhagic fever [VHF] shows a case-fatality rate of up to 90%. Centres for disease control and prevention categorizes four distinct families that cause VHF; Arenaviridae, Bunyaviridae, Filoviridae, and Flaviviridae. A new viral strain under the genus Tibrovirus called Bas-Congo virus (BASV) was discovered in the viral family Rhabdoviridae. In cases involving BASV, the patient died 3 days after the condition developed suddenly and was accompanied by mucosal haemorrhage and a high body temperature. Such pathogenicity was distinct from other well characterized members of Tibrovirus such as rabies. Though human tibroviruses are common, they remain largely uncharacterized. The current information on BASV is not enough to fully understand the underlying disease mechanism, although the available genome information could prove valuable. This newly added VHF causing virus could be crucial in understanding the emergence of several future outbreaks like the 2012 outbreak of Ebola hemorrhagic fever which showed how limited our understanding of such pathogens is. Since the emergence of such viral strains continues to be reported, through this chapter we hope to gather the current knowledge on BASV and discuss its future implications.

J. S. Sunny · S. Christopher · L. M. Saleena (✉) Department of Biotechnology, SRM Institute of Science and Technology, Kattankulathur, Tamil Nadu, India e-mail: [email protected] M. J. Kumar · A. Vishwakarma · R. Mohandass Department of Genetic Engineering, SRM Institute of Science and Technology, Kattankulathur, Tamil Nadu, India # The Author(s), under exclusive license to Springer Nature Singapore Pte Ltd. 2023 P. L. Bhukya et al. (eds.), Emerging Human Viral Diseases, Volume I, https://doi.org/10.1007/978-981-99-2820-0_22

515

516

J. S. Sunny et al.

Keywords

Bas-Congo tibrovirus · Rhabdoviridae · Viral hemorrhagic fever · Genome · Pathogen

22.1

Introduction

A Congolese patient presented with acute-phase viral hemorrhagic fever in 2012. A new Rhabdovirus, eventually designated Bas-Congo virus (BASV), was discovered while studying the patient serum. The Rhabdoviridae family has about 100 singlestranded non-segmented viruses that may infect a broad variety of hosts, including plants (Rose and Schubert 1987). These viruses are mostly known infamously for causing rabies and vesicular stomatitis in cattle. The family Rhabdoviridae currently includes 18 genera. More importantly, there are a minimum of 150 unclassified viruses under this family (Swenson et al. 2019). As reported earlier, these viruses are found in a large variety of hosts. These include, vertebrate host which are distributed amongst genus Lyssavirus, Novirhabdovirus, Perhabdovirus, Sprivivirus and Tupavirus. Vertebrates hosting this virus can contract it by mediation of various arthropod vectors like mosquitoes, and sandflies. Besides them, there are several other invertebrate hosts which have been found in association with genera Almendravirus, Alphanemrhavirus, Caligrhavirus, and Sigmavirus. These are Alphanucleorhabdovirus, Betanucleorhabdovirus, Cytorhabdovirus, Dichorhavirus, etc. Viruses seen affecting vertebrates are mostly associated with severe hemorrhagic diseases. This list is increasing as new evidences of unclassified rhabdoviruses continue to be reported. A comprehensive list of more than 140 such viruses has been detailed by (Bourhy et al. 2005). This has made the family Rhabdoviridae the largest and diverse single stranded RNA virus group. The characterization of many unrepresented virus is now under attention. This is partly due to the fact that several of these viruses may possess disease pathogenesis capability. As seen above rhabdoviruses are capable of infecting both invertebrates and vertebrates. Only few of them, however, have been confirmed to infect humans like ledantevirus, lyssaviruses (Lelli et al. 2018) such as rabies virus [RABV], vesiculoviruses which include chandipura and Vesicular Stomatitis Indiana Virus [VSIV] (Rihn et al. 2019). Chandipura Virus [CV] has caused outbreaks of encephalitis in the past in India and has a 50% approximate fatality. VSIV has largely been attributed to livestock but there are cases of mild influenza signs in humans. Possibly the best known amongst them, rabies virus has caused rabies and encephalitis resulting in the death of more than 1 lakh people every year. Viral species Australian bat lyssavirus, Duvenhage virus from the same genus lyssavirus are known to cause pathogenesis similar to rabies. Several such viruses remain yet to be characterized. Due to advancement in next generation sequencing methods, several viruses across the various genera have been discovered. One of the lesser known genuses is Tibrovirus (Kuhn et al. 2020). These viruses are highly uncharacterized amongst the rhabdoviruses. Since we know very

22

Bas-Congo Tibrovirus

517

less about them, understanding their pathogenic potential becomes even more crucial. The first of this virus was discovered from midges and was called Tibrogargan virus. This virus is prevalent in cattle and has not been associated with diseases in human. Similarly, Costal Plains virus discovered from cattle has been found to be not disease causing. The genus Tibrovirus has grown in the past few years. A new member of this genus was discovered in a patient who came with bleeding nose, hematemesis, conjunctival injection, and bloody diarrhoea. (Grard et al. 2014). Two days after the first patient’s symptoms began, the patient was found dead. Another patient also passed away within 3 days in this small group of related instances with the same symptoms. Only the third example, a male nurse who cared for the two patients mentioned above survived despite exhibiting the same identical symptoms. The assembled viral genome revealed a novel tibrovirus. BASV was found to be phylogenetically similar to other tibroviruses. The discovery of BASV and reports of other tibroviruses in human sera has suggested the capability of at least some of these tibroviruses to act as human pathogens.

22.2

Epidemiology

The source of BASV infection and transmission has not yet been identified (Chiu et al. 2013). A small cluster of this disease has established that the transmission is unlikely waterborne or airborne. There are hypothesis stating an arthropod-borne transmission since the phylogenetic position of BASV places it along with dimarhabdovirus which is associated with mosquito bites. BASV was detected in the Kongo Central Province, Democratic Republic of the Congo (DRC). To this date, BASV has only been found in this region. Even though the first two patients died, the serum from asymptomatic nurse who was in their contact has served as a confirmation for the virus. The L gene-specific RNA copies were 1.09 × 106 according to a quantitative polymerase chain reaction experiment. VSIV particles that were pseudotyped with the BASV envelope glycoprotein helped to identify antibodies in the patient (Steffen et al. 2013). These neutralizing antibodies indicate the virus exposure. Since there were no samples that were available from the deceased patients, a direct connection between them could not be established. The BASV infected sera from the third patient was cultured along with different types of cells from mosquito larva to monkey kidney epithelial cells. The replication of the virus was, however, undetected. Further study even inoculated laboratory mice with BASV-positive serum but observed no death or even illness (Grard et al. 2014). Variability in sample storage temperatures, non-specific mouse models are likely being attributed to the negative results. As only plasma was surveyed, the possibility of finding pathogens in other tissue is also equally valid for unseen cytopathic effects. There were also 121 cases reported of hemorrhagic diarrhea around the Mangala region where BASV was reported around the same time (Kuhn et al. 2020). None of the cases were identified with BASV, although three of them were found to be caused by Shigella, bacteria responsible for intestinal infection leading to severe diarrhea.

518

22.3

J. S. Sunny et al.

Potential Risk of Emergence and Re-emergence

Tibroviruses remains highly uncharacterized. Since 2012, the RNA genome discovery of BASV followed by EKV-1 [Ekpoma virus 1] and EKV-2 (Stremlau et al. 2015) from patients in central and western African regions suggests the need for an intensive look into its potential to infect humans. BASV was discovered from a patient who was severely ill and hence it should be under the pathogen list for surveillance. Tibroviruses infecting humans could be widespread throughout the region. According to previous studies, human interaction with BASV is regionally restricted. The samples from the Kasa-Oriental Province in the DRC, which were all negative, were used to corroborate this. On the other hand, a serosurvey done in the Republic of the Congo reported a 4% prevalence of antibodies against the mononegaviral envelope of BASV. A machine learning-based study has recently predicted that the natural host for BASV may be mostly cattle (Babayan et al. 2018). Under such circumstance, the human infection could have been completely accidental. This theory is further strengthened by midges that have been predicted as possible vectors for transmitting BASV. Currently, rhabdoviruses other than RABV are not considered a primary health concern. But the capability of tibroviruses to infect and replicate in humans is important to be noted. Without a high-quality isolate, it would be hard to support Koch’s universal postulates that BASV is a human pathogen. However, all known tuberculosis viruses, including BASV, have recently been observed to enter human cells using recombinant vesiculoviruses that can produce viral glycoproteins (Caì et al. 2019). This evidence, however, cannot confirm whether BASV does indeed infect humans.

22.4

Organization of Infectious Agents

22.4.1 Classification In recent years, a steady growth was observed in the genus tibrovirus, notably Bas-Congo virus as tibrovirus (Walker et al. 2015). This newly discovered infection related with an acute hemorrhagic fever was recognized from serum sample gathered from blood of three patients in the Democratic Republic of Congo. The identified virus was named the Bas-Congo Virus (BASV) (Grard et al. 2014). De novo genome assembly of BASV was performed utilizing the next generation sequencing. The BASV genome is exceptionally varying possessing just 25% amino acid similarity to rhabdovirus and 98% after several weeks (Zhang et al. 2020b; Zhou et al. 2020).

23

Rapid Diagnostic of Emerging Human Viral Pathogens: Lessons Learnt. . .

537

Another drawback of using IgM ELISA for COVID-19 detection is their non-specificity, whereas IgG takes long time to reach detectable levels. Consequently serological testing may not be the gold standard detection method for early cases except for testing late cases or determining the seropositivity in a population (Tang et al. 2020). Interestingly, manual ELISA kits are also coupled to various interfering factors, like non-specific binding and cross-reactivity towards MERS-CoV and SARS-CoV-1, and other existing endemic coronaviruses depending upon type of antigen with which the plate is initially coated. For example, a bat SARS-CoV Rp3 N protein based ELISA kit was developed against SARSCoV-2 in early cases of COVID-19 (Zhou et al. 2020). Though this method can likely give false positive results as human beta coronaviruses N protein is highly conserved (Sun and Meng 2004). Thus, cross-reactivity is very common among antigens of similar types of coronavirus (HKU1, 229E, OC43, NL63) associated with etiology of common cold (Wang et al. 2020a). Although, spike protein (SP) is prone to mutations still many ELISA kit developers focus on Spike protein-based ELISA methods. The S protein aids in entry of the virus into the host cell and also regulates host tropism and further virus transmission, to some extent, and hence a suitable candidate for developing ELISA against COVID-19 (Tang et al. 2020). Though the roadmap is challenging, ELISA based testing has advantages to help through this pandemic and in the near future. The development as well as quality evaluation of ELISA kits is a challenging task, as it can support the qRT-PCR (the gold standard) based testing and also overcome some of its existing limitations (Zhou and Zhao 2020) .

23.2.10 Automated Serology Owing to the increased demand for diagnosis of large sample volume levies an enormous work load and monetary burden on testing labs. Automation of the routine testing comes to rescue in this situation. Automated serology not only reduces the turn-around-time but can also increase the quality and efficiency of the tests. Commonly employed serological tests, can easily be automated, and deployed in labs exploring seroprevalence studies in large set up population. In the year 2020, the healthcare market was exhilarated with variety of COVID-19 testing platforms within a few months into the pandemic. With the rise in COVID-19 cases around the globe, laboratory-based EIA automated systems entered the market and offered increased sensitivity, specificity and high throughput. However, the transition from manual to automation possessed a challenge as many manual COVID-19 ELISA kits used the 96-microplate along with colorimetric signal detection, whereas the automated systems, used different materials such as metal-based nanoparticles (magnetic nanobeads) or polystyrene (PS-COOH) along with chemiluminescencebased sensitive detection systems. Biospace DiaSorin, 2020 (Saluggia, Italy) launched a fully automated serology testing system in early 2020, to detect AntiSARS-CoV-2 antibodies against S1 and S2 domains. Such a dual detection increases the specificity of the assay and false-positivity due to other similar viruses. Another

538

M. Chadha et al.

chemiluminescence-based fully automated system LIAISON® XL platform performs with minimal manpower testing 170 samples/h Bio-Rad (USA) also a blood-based Enzyme Immuno Assay to detect antibodies against COVID-19 virus both manually or in automated format (Binder et al. 1999). Dynex Technologies, Inc. have developed an automated ELISA system that can be used in 2–12 plate format from routine to high-throughput formats. Moreover, Eurobio Scientific with Snibe Co., Ltd have launched a CLIA based instrument named MagLumi that can be used for high-throughput (280 samples/h) serosurveillance studies (GlobeNewswire 2020). Though a major challenge in developing serological tests is to increase specificity, high cross-reactivity was observed in fifteen patient serum samples tested for S protein of SARS-CoV-1 and SARS-CoV-2 (Lv et al. 2020).

23.2.11 Rapid Serological Tests Standardized development of novel serology-based assays is always encouraged to hasten the availability of testing/diagnosis. But, validation of these assays is obligatory/mandatory to guarantee high sensitivity and specificity of the tests (ARUP 2020). Since ages rapid antibody tests served as versatile tool and are still being used for testing even asymptomatic population. The tests are fast and generally give clear positive or negative results that are easy to interpret. Some of these assays use lateral flow immunoassays, others use time-resolved fluorescence immunoassays or use colloidal gold immunoassays detecting the presence of antibodies in whole blood, serum or plasma. These kits follow the same principle of pipetting fresh blood followed by buffer onto the cassette, in 515 min the results are read as lines on the cassette window.

23.2.12 Protein Testing The WHO (2020) suggests improvisation of patient screening with amalgamation of NAAT and serological assays with quantification of proteins. Protein screening from initial diagnosis to final recovery offers major advantage over NAAT tests in being economical and easily used in low-resource settings (Mahmoudi et al. 2020; Sood et al. 2020). Indulgence of viral-protein antibodies for protein testing have an advantage as the levels are higher thus offering better resolution for detection as compared to viral titers that are not constant during the course of the infection (To et al. 2020).

23.2.13 LIPS Profiling of Viral Antibodies Along with NAAT, antibody measurement remains an important tool for diagnosis of viral infection. Serology and Western blotting are parallelly used for quantification of antibody titers, though many recent approaches are considerably

23

Rapid Diagnostic of Emerging Human Viral Pathogens: Lessons Learnt. . .

539

advantageous (Burbelo et al. 2019). One such approach is Luciferase Immunoprecipitation Systems (LIPS), using luciferase-tagged antigens for virus discovery diagnosis, identification, analysis of treatment regime and establishing the hierarchy of viral infections (Burbelo et al. 2015). Chimeric luciferase-viral fusion proteins like Nano luciferase, Gaussia luciferase are expressed by mammalian expression vectors. These luciferase-tagged viral Ag are incubated with patient that are immunoprecipitated by protein A/G beads and washed thoroughly. Further, corresponding luciferase activity is recorded by a luminometer and is directly proportional to the antibody titre in sample (Burbelo et al. 2015). In LIPS, immunoreactivity can be detected either against partial or whole viral proteomes like HIV (Burbelo et al. 2018), HCV (Burbelo et al. 2010a) and HTLV-I (Burbelo et al. 2008). In certain settings, a single viral protein can be used to diagnose a particular virus, while in some cases, many proteins are targeted. For example, gG-1, gG-2 (Burbelo et al. 2009a) and the gE (Cohen et al. 2014) respectively are sufficient to diagnose HSV1, HSV2 and varicella infection, respectively that too with high sensitivity and specificity. However, in case of Kaposi’s sarcoma herpesvirus multiple proteins are required to give output with high diagnostic sensitivity (Burbelo et al. 2009b). Since LIPS can detect conformational antibodies, this assay is particularly important in identifying proteins that are not detected in other assays, such as Western Blot, ELISA and protein arrays. Owning to its dynamicity in range of detection of antibody and ability to assess antibodies for multiple antigens targeted against a single virus, LIPS finds its use to classify and group patients co-infections, like HIV, HTLV-I, KSHV and EBV (Burbelo et al. 2010b; Cohen et al. 2011; Mendoza et al. 2012). LIPS can be helpful to ascertain the effect of viral treatment by checking the Ab levels in real-time. Apart from perusing the aspect of immune response towards virus at a period, LIPS has given a cutting edge to diagnosis of virus’s not related to chronic infections but may sometimes influence complex interactions in patients with chronic illness (Burbelo et al. 2013). In a recent report (Burbelo et al. 2019) on identification of antibody profiles through LIPS, 11 viruses in healthy persons and 3 patients with chronic diseases surprisingly showed viral infections and also revealed differences in anti-viral antibody titers among chronic patients suffering from different diseases. HIV subjects showed a high level of cytomegalovirus and Human simplex virus2 viral infections in comparison to control group but surprisingly showed antibody against many other viruses like enteroviruses and EBV. This technique is extensively used for characterization and investigation of novel viruses. LIPS has been used previously to identify and characterize astroviruses, targeting kids and adult population (Burbelo et al. 2011a), which was further corroborated by DNA sequencing of viruses in CSF from patients establishing HMOAst-C as etiological agent of viral encephalitis (Brown et al. 2015; Frémond et al. 2015; Naccache et al. 2015). These findings signal towards the usefulness of these novel techniques to identify novel viral infections, how these outcomes can be further used to elucidate and solve unidentified agents causing anonymous human diseases. In a study by Burbelo et al. LIPS has been credited for identification of HCV-like viruses (NPHV) outside primates, in horses as reservoirs, which presented

540

M. Chadha et al.

the (Burbelo et al. 2012). Other significant LIPS studies have been reported about a novel parvovirus causing hepatitis in horses (Divers et al. 2018) and experimental infection revealing HCV-like virus in rats (Trivedi et al. 2018). LIPS documents another applications in diagnosis and characterization of novel viral agents such as MERS (Alagaili et al. 2014) and a novel bat coronavirus, HKU2, causing lethal infection in swine, leading to development of a diagnostic assay of HKU2 (Zhou et al. 2018). LIPS can be an important tool to check the real time status of human health. A better and efficient form of LIPS, LIPSTICKS, for HIV and NPHV infections can provide results in under 1 min/sample (Burbelo et al. 2017). Future advancements with LIPSTICKS and the process of development of LIPS arrays against series of viral proteins (Burbelo et al. 2011b) for antibody profiling in near future can lead to in-depth analysis of virus role in human and animal health.

23.2.14 Nucleic Acid Amplification Test (NAAT) Nucleic acid amplification tests (NAAT) using PCR techniques has undoughty advanced molecular diagnosis of diseases in both human and animals. Enzyme based amplification of region of interest in the genome by specific oligos, forms the basis of the assay. The amplified DNA fragments are further analysed by either a fluorescence-based detection system, or by DNA sequencing. The NAATs have undergone numerous advances since discovery and are now indispensable in clinical diagnosis of viral diseases (as they can simultaneously detect and determine the viral load (Duong and Ginocchio 2016; Souf 2016; Hammou et al. 2020; Caruana et al. 2020). The specificity and sensitivity of NAAT is very high owing to the use of highly specific primer, making them ‘gold standard’ method for in vitro diagnosis, in most cases. The most widely used NAAT is the real-time PCR (quantitative PCR or qPCR) that can use genomic DNA as well as the RNA as template. Due to the simultaneous amplification and analysis, this assay provides fast results. Use of standards provides accurate viral load. The tests are comparatively fast to develop and upscale for production in epidemic and pandemic situations as seen previously in MERS, Influenza H5N1 and SARS-CoV-2. Further, multiplex qPCR techniques have been developed that can simultaneously detect multiple targets in a single sample. This helps to identify and quantify multiple genes from a single virus thereby increasing specificity and sensitivity of the test. It also helps in screening of multiple pathogens that cause similar symptoms, in a single sample thereby reducing cost and time (Mahony et al. 2007; Park et al. 2012). To combat huge volumes of samples, high throughput systems that can perform extraction, amplification and detection within one unit have been developed. The Roche Cobas 6800/8800 is one such mammoth system that can simultaneously extract RNA, add master mix, amplify the target amplicon and report the results. Such IVD approved systems come in very handy during epidemic and pandemic

23

Rapid Diagnostic of Emerging Human Viral Pathogens: Lessons Learnt. . .

541

situations as they can work round the clock and can save a lot of time as witnessed during the current COVID-19 pandemic. Use of microfluidics with PCR-based systems has further decreased the processing time and can detect targets in less than 15 mins giving high sensitivity and efficiency. Chip-based qPCR were used during 2009 H1N1 outbreak. Such techniques are useful in epidemics (Song et al. 2012). Similarly, cartridge-based tests that can go from sample addition to results with 2 h are also available. Bosch has revealed such cartridge-based test that can be used with their already existing Vivalytic analysis device to check 10 viruses including SARS-CoV-2. Similarly, CBNAAT (Cartridge based NAAT), originally developed for diagnosis of TB was used in large scale during the COVID-19 pandemic (Kumar et al. 2021).

23.2.15 Limitations Even with high TAT and price advantage in diagnosing viral infections the limitations of PCR are an important parameter to consider. Due to its high sensitivity and ability to amplify low copy number samples, contamination risk is high. Also, qPCR has a substantially extended run time (approx. 2–5 h) compared to other techniques. QPCR further requires expensive equipment, consumables and a trained manpower to use. High mutation rate in some viruses is another cause of concern. If the mutation arises in the primer/probe binding regions, it may cause the virus to escape detection by the test.

23.2.16 NAAT During COVID-19 Pandemic Within a short span of COVID-19 outbreak, the markets were flooded with rapid and accurate SARS-CoV-2 detection kits that were important for controlling of the viral spread to some extent. Various studies revealed high accuracy of NAAT than radiology tests (CT scan and X-ray) and serology tests for diagnosing COVID-19. The primary method for detection of SARS-CoV-2 is RT-PCR. In this method upper respiratory tract samples are taken and their RNA is extracted. Reverse transcription and cDNA amplification are performed using reverse transcriptase enzyme. Deciphering the SARS-CoV-2 genome helped developing many NAAT tests including rRT-PCR and RT-LAMP. However, these assays are time-taking, labour-intensive, require sophisticated lab setups. These kits are also dependent on uninterrupted supply of high end plasticware that are DNase/RNase free such as 96 well plates, sealers, barrier tips, etc. Although qRT-PCR is currently the diagnostic test of choice there are some limitations. Various external factors may influence the accuracy of qRT-PCR results, like sample handling and storage, sample source, the quality of detection kits and long processing time. Recent evidences have shown that the accuracy of many available commercial SARS-CoV-2 qRT-PCR kits are subpar in quality (i.e., 40% RT-PCR false negatives (Wang et al. 2020b; Wikramaratna et al. 2020; Li et al. 2020b). Furthermore, qRT-PCR can only be operated by trained manpower in a sophisticated lab having >BSL-2 levels.

23.2.17 Rapid and Point of Care (POC) NAAT: RT-LAMP Advances in molecular techniques have brought molecular diagnostic tests through point of care (POC) devices revolutionizing the IVD industry. It not only increases the tests being conducted but also potentially reduces the TAT. Most importantly, POC testing support surveillance, infection control measures, suitable use of quarantine resources, test at port of entry. These POC devices use same wet laboratorybased with automation. Therefore, the tests can be performed in near-patient settings without the use of an elaborate laboratory setup, thereby reducing the turnaround time. LAMP (Loop-mediated isothermal amplification) was developed by Notomi et al. (2015) using four to six primers and a Bsm DNA polymerase. The primers make a dumbbell structure that subsequently functions as initiator for the next round of amplification using isothermal polymerases that initiates loop amplification. The method produces 109 DNA copies within an hour when kept at 60–65 °C (Ménová et al. 2013). This technique is unaffected by inhibitor therefore, direct samples can be used as starting material for the amplification. Magnesium pyrophosphate, produced during the LAMP reaction can be used to change the colour of the reaction vial by adding pH-sensitive dyes or metal-sensitive indicators. The most challenging part is to design the six primers for the LAMP assay, as the Tm of all primers should be similar Fortunately, Primer Explorer V5 is available online for designing of primer for LAMP assays (Eiken Chemical Co. Ltd, 2020). Currently, many isothermal amplification techniques are being used for detection of SARS-CoV-2 (Zhang et al. 2020d; Lu et al. 2020a; Zhu et al. 2020). The short assay time along with similar sensitivity to RT-PCR is an advantage. Many of these POC tests use isothermal NAAT, such as Alere™ i Influenza A&B Abbott ID NOW COVID-19 and Microsens Dx RapiPrep#COVID-19, whereas many are PCR based, such as Credo Vita PC R COVID-19 assay, Cepheid Xpert SARS-CoV2 and GenMark ePlex SARS-CoV-2. Some use lateral flow technology (Green et al. 2020). The sensitivity of this test is equivalent to that of qRT-PCR. Most importantly, this technique is very specific because of the usage of six to eight primers (Yang et al. 2018; Zhang et al. 2020c; Younes et al. 2020). Cepheid SARS-CoV2 test can give results under 45 min (Cepheid 2020; Sweet and Schuba 2020) but, requires the GeneXpert equipment which are scarce. The RNA extraction is a common preliminary step and can limit scalability during outbreak situations. The portable Abbott ID NOW isothermal amplification device gives results in 65-year-olds, there is minimal data on comparative vaccine effectiveness. Serological Humour levels have been observed to be lower and decreasing in research on elder folks’ reactions and as a result, clinical protection is unlikely to last the entire time. Throughout the year, emphasizing the need for more vaccines with immunogenic properties, a new high-dose trivalent inactivated influenza vaccine with immunogenic properties has been developed. The level of haemagglutinin in the blood has increased by fourfold and has been created and is licensed for usage since 2009 in the United States. This has been demonstrated to increase antibody reactions and be more efficient. In persons over the age of 65, it is useful to prevent mortality in case of dementia. In a current metaanalysis, however, defense against post-influenza mortality with the massive-dosage trivalent vaccine was shown to be just 22.2% (95% confidence interval -18.2 to 48.8%). Since 2013, quadrivalent flu vaccination has been licensed in the United States, which includes an extra B-like viral-strain and has been demonstrated to elicit comparable immunogenic response as the trivalent vaccine strains. To cover the circulating strains, current influenza vaccines must be given once a year. In influenza and other respiratory viral particles, such as SARS-CoV-2 and RSV, further effort is required to develop fruitful vaccinations for the elderly.

24.17 Additional Vaccines, As Well As Novel Vaccination Strategies Immunization is critical to prevent respiratory virus infection, since it allows individual protection as well as herd immunity among mass; this is especially crucial in aged people in hospitals or long-term care facilities. COVID-19 vaccines are now in advancement, with favourable findings in delivering 94% protection in over-65s. The ability to provide long-term protection for elderly people has not yet been demonstrated, and widespread distribution is still some time off. Although vaccines for influenza are available, vaccines for other respiratory viruses such as RSV are still unavailable. The burden and immunobiology of RSV have, however, been greatly improved and more than 100 vaccine candidates are currently undergoing preclinical and clinical testing at different stages. Because of the low immunogenic cross-reactivity between the >160 serogroups of HRV,

24

Novel Diagnostic Methods for Emerging Respiratory Viral Infection

579

Viral Antigen Functionalization Techniques

Adjuvant Vaccine Development

Fig. 24.4 Adjuvant vaccine (Draz and Shafiee 2018)

vaccines have been difficult to develop, and it seems improbable that a single immunogen will provide resistance against all HRV serotypes. However, in recent preclinical research, peptide immunogens have been successfully employed to create cross-reactivity of antibodies. T cell induction mechanisms are also under investigation to develop a widely cross-reactive vaccine. Vaccines for HRV and other viruses causing respiratory illness, for example HMPV are being developed using new technologies. In order to care for the vulnerable elderly population, new vaccinations against major bacterial infections that worsen lung disorders will be crucial. Early attempts to enhance the immunogenic reaction in aged patients after immunization included rising the antigen dosage or administering an adjuvant at the same time. Since 2015, an adjuvant vaccine for influenza based on MF59 (a squalene: oil-in-water emulsion) has been authorized for usage in the United States. Nonetheless, the effectiveness of high dosage and MF59-adjuvanted influenza vaccinations has not been compared in any randomized controlled trials. New immunostimulant-containing adjuvants based on liposomes may also improve immunization effectiveness. For example, ASO1 was newly licensed for using in elderly persons after clinical trials showed it to be effective against herpes zoster, and it may have broader promise for respiratory virus vaccination (Fig. 24.4). There are also several TLR stimulating agents in the works. A TLR4 agonist is a synthetic variant of LPS from Salmonella Minnesota. An RSV F-protein vaccine candidate has been examined in a phase I study. Other TLR agonists include imiquimod, a TLR7/8 agonist, when administered topically to young adults have been proven to improve the efficiency of the trivalent influenza vaccine. Several promising TLR stimulants are also being developed. TLR4 is activated by a synthetic LPS variant from Salmonella Minnesota. An RSV F-protein vaccine candidate was used in a phase I experiment to investigate this. The place of vaccine distribution is being increasingly recognized as having an impact on the immune response and vaccine efficacy. Vaccine delivery in the lungs may be possible in the future, thanks to advancements in less invasive delivery systems. However, due to the difficulties of immunizations in the elderly, new vaccine development approaches for this demographic are being explored. Senolytics and

580

Sakshi et al.

other immunemodulatory medicines are being tested in clinical trials to see if they can improve vaccine responses. For instance, in a phase IIa trial, the mTOR inhibitor RAD001 was found to improve vaccination responses in aged patients, possibly by modifying cellular metabolism and upregulating the expression of genes associated with interferon (IFN). Due to the growing possibility for integrating diverse omics datasets, systems vaccination is now frequently utilized to understand immunological reactions to immunizations in various populations. When employing this method and adding immunobiography, medical, immunome, microbiome, and different omics datasets, the advancement of novel vaccines and adjuvants shows considerable promise. Additionally, this model has the ability to categorize older subgroups in the long term for individualized immunization plans.

24.18 Antiviral Therapeutics Numerous new therapeutics are now being tested as part of the ongoing inquiry into potential COVID-19 treatments. Exogenous IFN-, however, has the ability to prevent respiratory virus infections in the aged, and preliminary findings from a randomized administered trial show that IFN- is effective in easing symptoms in COVID-19 hospitalized patients. Dexamethasone has also been demonstrated to reduce death in up to a third of hospitalized COVID-19 affected people with acute respiratory COVID-19 problems, and it is currently frequently prescribed to COVID-19 patients who need oxygen. However, it is yet unclear how effective these new therapies are for treating elderly patients. Starting anti-viral treatment as soon as feasible is the cornerstone of treating influenza. Baloxavir was shown to help minimize risk-prone influenza issues and shorten the period it took for symptoms to improve in a recent phase III experiment. Antiviral drugs are effective when administered to people with less severe influenza infections within 48 h, according to clinical research. However, no finished randomized, placebo-controlled trials in hospitalized patients have been conducted. The effectiveness of antiviral drugs in the elderly needs additional research due to the prevalence of complex influenza illnesses and late influenza diagnosis. Antivirals like Oseltamivir are known to cause a number of side effects, and new drug reactions are being discovered, such as one with warfarin. Therefore, special concerns should be made before treating frail aged people, and influenza infection should be verified using precise diagnosis. For the treatment of influenza, new antiviral substances are also being researched. These include small-molecule polymerase inhibitors, convalescent plasma, and monoclonal and polyclonal antibodies that target the virus. Similar to influenza infection, supportive treatment is mostly used to treat older people who have other acute respiratory viruses. This is an ongoing process that requires regular monitoring, fluid replacement if needed, supplemental oxygen as needed, fever management, and the usage of bronchodilators till the patient gets well. About NSAIDs and antihistamines can help with some viral infection

24

Novel Diagnostic Methods for Emerging Respiratory Viral Infection

581

symptoms. However, due to underlying kidney illness, a risk of GI bleeding, and confusion, these are frequently contraindicated in the eldest individuals. Similar to influenza infection, there are presently no antiviral medications that reduce the time period of HRV sickness that are authorized for clinical use. Supportive care is typically used to treat older persons who have other acute respiratory viruses. NSAIDs and antihistamines can help with some viral infection symptoms. Due to underlying kidney illness, the possibility of GI bleeding, and confusion, they are frequently contraindicated in the oldest individuals. There are currently no antiviral medications that can reduce the length of an HRV infection for clinical usage. There are a few promising novel options for the cure of ailments caused by RSV in the aged, however there are now no efficient antiviral drugs available. Numerous fresh antiviral tactics are now being researched and have already been examined. These include strategies to stop RSV from fusing with epithelial cells, like antibodies that target the RSV fusion proteins (like Palivizumab), that have been approved for use as a preventative measure in high-risk children. Nucleoside analogs (including JNJ-64041575), which impede viral replication, are also being studied, and clinical trials of phase II have shown their antiviral effects and efficiency in lowering disease signs. To reduce viral protein synthesis, small interfering RNAs have been tested (Watson and Wilkinson 2021). A siRNA (ALN-RSV01) that specifically aims at the nucleocapsid of RSV was employed in a clinical experiment with lung transplant recipients. This demonstrated that while there were no antiviral effects, the daily total symptom score did improve. For strengthening the immunity for the cure of respiratory viruses; immunomodulatory antiviral drugs are also now being researched. An inhibitor of statins, COX-2 (celecoxib), azithromycin, and pioglitazone are some of these intrinsic immunogenic proteins that have been recombinant surfactant proteins A and D, play important functions as widely precise innate immune-regulatoryentities and immune modulators, and they may 1 day be developed into antiviral medicines (Watson and Wilkinson 2021) (Table 24.2).

582

Sakshi et al.

Table 24.2 Respiratory viruses and the many methods used for diagnosis (Zhang et al. 2020) Type of virus Human RSV

Influenza virus

Coronavirus

Rhinovirus

Adenovirus

Family and genus Family—Paramyxoviridae and genus—Pneumovirus

Family—Orthomyxoviridae and genus—Influenza virus A, Influenza virus B, Influenza virus C, Influenza virus D, Isavirus, Quaranjavirus, and Thogotovirus Family—Coronaviridae and genus— Alphacoronavirus,, Deltacoronavirus, Betacoronavirus, and Gammacoronavirus Family—Picornaviridae and genus— Enterovirus

Family—Adenoviridae and genus— Atadenovirus, Mastadenovirus, Aviadenovirus and Siadenovirus

Diagnosis methods IFA; ELISA-based test; DFA; LFIA (RemelXpect, Binax now RSV, Directigen EZ RSV, BD, QuickLab RSV, Respi-Strip); real-time PCR based (TaqMan PCR, locked nucleic acid (LNA)-based one-tube nested real-time (OTNRT) RT-PCR); RT-RAA assay; RT-SIBA Viral culture; IFA; ELISA-based test; PCR-based (RT-PCR, LAMP); DNA-microarray-based; sequencingrelated tests RT-PCR; rRT-PCR (PowerCheck, DiaPlexQ, Anyplex, AccuPower, LightMix, UltraFast); RT-LAMP; rtRT-LAMP CFT; HI; IFA; ELISA; semi-nested RT-PCR assay; one-step Panenterhino/ Ge/08 real-time RT-RCR assay; WGS-based assays Viral culture; indirect ELISA; IFA; LAT; EIA; rtPCR based (RealStar® Adenovirus PCR kit 1.0, in-house hAdV qPCR assay)

References Afsahi S, Lerner MB, Goldstein JM, Lee J, Tang X, Bagarozzi DA Jr et al (2018) Novel graphenebased biosensor for early detection of Zika virus infection. Biosens Bioelectron 100:85–88 Amaro F, Sánchez-Seco MP, Vázquez A, Alves MJ, Zé-Zé L, Luz MT et al (2019) The application and interpretation of IgG avidity and IgA ELISA tests to characterize Zika virus infections. Viruses 11(2):179 Banerjee R, Jaiswal A (2018) Recent advances in nanoparticle-based lateral flow immunoassay as a point-of-care diagnostic tool for infectious agents and diseases. Analyst 143(9):1970–1996 Beck ET, Henrickson KJ (2010) Molecular diagnosis of respiratory viruses. Future Microbiol 5(6): 901–916 Bramhachari PV, Mohana Sheela G, Prathyusha AMVN, Madhavi M, Satish Kumar K, Reddy NNR, Berde CP (2020) Advanced immunotechnological methods for detection and diagnosis of viral infections: current applications and future challenges. In: Dynamics of immune activation in viral diseases. Springer, Singapore, pp 261–275 Chang YF, Wang WH, Hong YW, Yuan RY, Chen KH, Huang YW et al (2018) Simple strategy for rapid and sensitive detection of avian influenza A H7N9 virus based on intensity-modulated SPR biosensor and new generated antibody. Anal Chem 90(3):1861–1869 Chiu CY, Coffey LL, Murkey J, Symmes K, Sample HA, Wilson MR et al (2017) Diagnosis of fatal human case of St. Louis encephalitis virus infection by metagenomic sequencing, California, 2016. Emerg Infect Dis 23(10):1964

24

Novel Diagnostic Methods for Emerging Respiratory Viral Infection

583

Crim RL, Kumari S, Jayanti P, Audet S, Kulkarni A, Beeler J (2019) Development of luciferase immunoprecipitation systems (LIPS) assay to detect IgG antibodies against human respiratory syncytial virus G-glycoprotein. Vaccine 7(1):16 Deyde VM, Sampath R, Garten RJ, Blair PJ, Myers CA, Massire C et al (2010) Genomic signaturebased identification of influenza A viruses using RT-PCR/electro-spray ionization mass spectrometry (ESI-MS) technology. PLoS One 5(10):e13293 Draz MS, Shafiee H (2018) Applications of gold nanoparticles in virus detection. Theranostics 8(7): 1985 Duchesne L, Njouom R, Lissock F, Tamko-Mella GF, Rallier S, Poiteau L et al (2017) HCV Ag quantification as a one-step procedure in diagnosing chronic hepatitis C infection in Cameroon: the ANRS 12336 study. J Int AIDS Soc 20(1):21446 Duncombe TA, Tentori AM, Herr AE (2015) Microfluidics: reframing biological enquiry. Nat Rev Mol Cell Biol 16(9):554–567 Ebner K, Rauch M, Preuner S, Lion T (2006) Typing of human adenoviruses in specimens from immunosuppressed patients by PCR-fragment length analysis and real-time quantitative PCR. J Clin Microbiol 44(8):2808–2815 Emmerich P, Mika A, von Possel R, Rackow A, Liu Y, Schmitz H et al (2018) Sensitive and specific detection of Crimean-Congo hemorrhagic fever virus (CCHFV)—specific IgM and IgG antibodies in human sera using recombinant CCHFV nucleoprotein as antigen in μ-capture and IgG immune complex (IC) ELISA tests. PLoS Negl Trop Dis 12(3):e0006366 Faye M, Dacheux L, Weidmann M, Diop SA, Loucoubar C, Bourhy H et al (2017) Development and validation of sensitive real-time RT-PCR assay for broad detection of rabies virus. J Virol Methods 243:120–130 Fernandes JN, Dos Santos LM, Chouin-Carneiro T, Pavan MG, Garcia GA, David MR et al (2018) Rapid, noninvasive detection of Zika virus in Aedes aegypti mosquitoes by near-infrared spectroscopy. Sci Adv 4(5):eaat0496 Fischer K, Diederich S, Smith G, Reiche S, Pinho dos Reis V, Stroh E et al (2018) Indirect ELISA based on Hendra and Nipah virus proteins for the detection of henipavirus specific antibodies in pigs. PLoS One 13(4):e0194385 Furuya AK, Hunt D, George KS, Dupuis AP, Kramer LD, Shi PY, Wong S (2019) Use of the immunoglobulin G avidity assay to differentiate between recent Zika and past dengue virus infections. Clin Sci 133(7):859–867 Gootenberg JS, Abudayyeh OO, Kellner MJ, Joung J, Collins JJ, Zhang F (2018) Multiplexed and portable nucleic acid detection platform with Cas13, Cas12a, and Csm6. Science 360(6387): 439–444 Hansen S, Hotop SK, Faye O, Ndiaye O, Böhlken-Fascher S, Pessôa R et al (2019) Diagnosing Zika virus infection against a background of other flaviviruses: studies in high-resolution serological analysis. Sci Rep 9(1):1–10 Hayden RT, Uhl JR, Qian X, Hopkins MK, Aubry MC, Limper AH, Lloyd RV, Cockerill FR (2001) Direct detection of legionella species from bronchoalveolar lavage and open lung biopsy specimens: comparison of light cycler PCR, In situ hybridization, direct fluorescence antigen detection, and culture. J Clin Microbiol 39(7):2618–2626. https://doi.org/10.1128/JCM.39.7. 2618-2626.2001 Kaushik A, Yndart A, Kumar S, Jayant RD, Vashist A, Brown AN et al (2018) A sensitive electrochemical immunosensor for label-free detection of Zika-virus protein. Sci Rep 8(1):1–5 Kim HS, Lee K, Kim SJ, Cho S, Shin HJ, Kim C, Kim JS (2018) Arrayed CRISPR screen with image-based assay reliably uncovers host genes required for coxsackievirus infection. Genome Res 28(6):859–868 Koishi AC, Suzukawa AA, Zanluca C, Camacho DE, Comach G, Duarte dos Santos CN (2018) Development and evaluation of a novel high-throughput image-based fluorescent neutralization test for detection of Zika virus infection. PLoS Negl Trop Dis 12(3):e0006342

584

Sakshi et al.

Lewandowski K, Xu Y, Pullan ST, Lumley SF, Foster D, Sanderson N et al (2019) Metagenomic nanopore sequencing of influenza virus direct from clinical respiratory samples. J Clin Microbiol 58(1):e00963–e00919 Magro L, Jacquelin B, Escadafal C, Garneret P, Kwasiborski A, Manuguerra JC et al (2017) Based RNA detection and multiplexed analysis for Ebola virus diagnostics. Sci Rep 7(1):1–9 Makarova KS, Wolf YI, Alkhnbashi OS, Costa F, Shah SA, Saunders SJ et al (2015) An updated evolutionary classification of CRISPR-Cas systems. Nat Rev Microbiol 13(11):722–736 Miller S, Naccache SN, Samayoa E, Messacar K, Arevalo S, Federman S et al (2019) Laboratory validation of a clinical metagenomic sequencing assay for pathogen detection in cerebrospinal fluid. Genome Res 29(5):831–842 Mirian M, Khanahmad H, Darzi L, Salehi M, Sadeghi-Aliabadi H (2017) Oligonucleotide aptamers: potential novel molecules against viral hepatitis. Res Pharm Sci 12(2):88 Mohan H, Gill PS, Kumar A (2019) Hemagglutinin gene based biosensor for early detection of swine flu (H1N1) infection in human. Int J Biol Macromol 130:720–726 Oh S, Kim J, Tran VT, Lee DK, Ahmed SR, Hong JC et al (2018) Magnetic nanozyme-linked immunosorbent assay for ultrasensitive influenza A virus detection. ACS Appl Mater Interfaces 10(15):12534–12543 Ojha R, Nandani R, Pandey RK, Mishra A, Prajapati VK (2019) Emerging role of circulating microRNA in the diagnosis of human infectious diseases. J Cell Physiol 234(2):1030–1043 Omar NAS, Fen YW (2017) Recent development of SPR spectroscopy as potential method for diagnosis of dengue virus E-protein. Sens Rev 38:106 Pisanic N, Rahman A, Saha SK, Labrique AB, Nelson KE, Granger DA et al (2017) Development of an oral fluid immunoassay to assess past and recent hepatitis E virus (HEV) infection. J Immunol Methods 448:1–8 Qadiri SSN, Kim SJ, Krishnan R, Kim JO, Kim WS, Oh MJ (2019) Development of an in-situ hybridization assay using riboprobes for detection of viral haemorrhagic septicemia virus (VHSV) mRNAs in a cell culture model. J Virol Methods 264:1–10 Qin P, Park M, Alfson KJ, Tamhankar M, Carrion R, Patterson JL et al (2019a) Rapid and fully microfluidic Ebola virus detection with CRISPR-Cas13a. ACS Sens 4(4):1048–1054 Qin S, Volokhov D, Rodionova E, Wirblich C, Schnell MJ, Chizhikov V, Dabrazhynetskaya A (2019b) A new recombinant rabies virus expressing a green fluorescent protein: a novel and fast approach to quantify virus neutralizing antibodies. Biologicals 59:56–61 Roingeard P, Raynal PI, Eymieux S, Blanchard E (2019) Virus detection by transmission electron microscopy: still useful for diagnosis and a plus for biosafety. Rev Med Virol 29(1):e2019 Saito S, Takayama I, Nakauchi M, Nagata S, Oba K, Odagiri T, Kageyama T (2019) Development and evaluation of a new real-time RT-PCR assay for detecting the latest H9N2 influenza viruses capable of causing human infection. Microbiol Immunol 63(1):21–31 Santiago GA, Vázquez J, Courtney S et al (2018) Performance of the Trioplex real-time RT-PCR assay for detection of Zika, dengue, and chikungunya viruses. Nat Commun 9:1391. https://doi. org/10.1038/s41467-018-03772-1 Shirato K, Semba S, El-Kafrawy SA, Hassan AM, Tolah AM, Takayama I et al (2018) Development of fluorescent reverse transcription loop-mediated isothermal amplification (RT-LAMP) using quenching probes for the detection of the Middle East respiratory syndrome coronavirus. J Virol Methods 258:41–48 Somerville LK, Ratnamohan VM, Dwyer DE, Kok J (2015) Molecular diagnosis of respiratory viruses. Pathology 47(3):243–249 Souf S (2016) Recent advances in diagnostic testing for viral infections. Oxford University Press, Oxford Tiwari PM, Vanover D, Lindsay KE, Bawage SS, Kirschman JL, Bhosle S et al (2018) Engineered mRNA-expressed antibodies prevent respiratory syncytial virus infection. Nat Commun 9(1): 1–15

24

Novel Diagnostic Methods for Emerging Respiratory Viral Infection

585

Tsang MK, Ye W, Wang G, Li J, Yang M, Hao J (2016) Ultrasensitive detection of Ebola virus oligonucleotide based on upconversion nanoprobe/nanoporous membrane system. ACS Nano 10(1):598–605 Van Belkum A, Niesters HG (1995) Nucleic acid amplification and related techniques in microbiological diagnostics and epidemiology. Cell Mol Biol 41(5):615–623 Wang R, Ongagna-Yhombi SY, Lu Z, Centeno-Tablante E, Colt S, Cao X et al (2019) Rapid diagnostic platform for colorimetric differential detection of dengue and Chikungunya viral infections. Anal Chem 91(8):5415–5423 Watson A, Wilkinson TM (2021) Respiratory viral infections in the elderly. Ther Adv Respir Dis 15:1753466621995050 Wesolowska-Andersen A, Everman JL, Davidson R, Rios C, Herrin R, Eng C et al (2017) Dual RNA-seq reveals viral infections in asthmatic children without respiratory illness which are associated with changes in the airway transcriptome. Genome Biol 18(1):1–17 Whiteside TL (2006) Immune suppression in cancer: effects on immune cells, mechanisms and future therapeutic intervention. In: Seminars in cancer biology, vol 16. Academic Press, New York, pp 3–15 Wong SJ, Furuya A, Zou J, Xie X, Dupuis AP II, Kramer LD, Shi PY (2017) A multiplex microsphere immunoassay for zika virus diagnosis. EBioMedicine 16:136–140 Zhang H, Rao H, Wang Y, Wang J, Kong X, Ji Y et al (2019) Evaluation of an antigen assay for diagnosing acute and chronic hepatitis E genotype 4 infection. J Gastroenterol Hepatol 34(2): 458–465 Zhang N, Wang L, Deng X, Liang R, Su M, He C et al (2020) Recent advances in the detection of respiratory virus infection in humans. J Med Virol 92(4):408–417

Evolution of Viral Diagnostics: A Peek into Time

25

Geetika Arora, Shreya Gupta, and Daman Saluja

Abstract

Time and again, viral infections have shaken the world to its core. From serious pandemic situation like COVID-19 to common influenza episodes, clinical prognosis is often dependent on timely detection of the infectious agent. Accurate diagnosis of the disease is not just crucial in preventing the transmission but is also of key importance for monitoring response to the treatment and hence, ensuring appropriate disease control and management. This chapter throws light on the current technological advances made in the field of clinical diagnostics with respect to the viruses. In its course, from classical serological tests through RT-PCR to the very recent CRISPER-Cas based tests have been discussed with prime focus on their application in the diagnosis as well as management of the viral infections. The evolution in the arena of clinical diagnostics has witnessed combining rapidity with robustness in detecting viral pathogens such that even the most sensitive assays can be completed in as much as an hour. Handy portable instruments have effectively replaced the giant ones and the diagnosis can be performed at the site of care with bare minimum technical expertise using fully automated systems, thereby revolutionizing the field of diagnostics. Towards the end, the chapter discusses the indispensability of artificial intelligence (AI) in the coming generation of diagnostics where it might aid not just in viral detection and disease prognosis but might also help in predicting and preparing for an outbreak much before it knocks our door.

G. Arora · S. Gupta Dr. B. R. Ambedkar Center for Biomedical Research, University of Delhi, Delhi, India D. Saluja (✉) Dr. B. R. Ambedkar Center for Biomedical Research, University of Delhi, Delhi, India Delhi School of Public Health, IoE, University of Delhi, Delhi, India # The Author(s), under exclusive license to Springer Nature Singapore Pte Ltd. 2023 P. L. Bhukya et al. (eds.), Emerging Human Viral Diseases, Volume I, https://doi.org/10.1007/978-981-99-2820-0_25

587

588

G. Arora et al.

Keywords

Serological assays · Molecular diagnosis and viral diagnosis

25.1

Introduction

Global pandemics have never been more threatening any time earlier than they are now. Recent years have witnessed an ever increase in the frequency of newly emerging viral infections, e.g., SARS, ZIKA, NIPAH, EBOLA, and the very recent SARS-CoV-2 virus (Hui et al. 2020; Lever and Whitty 2016; Lo and Rota 2008; Rather et al. 2017; Vijayanand et al. 2004) whereas the well-characterized viruses like HIV and Hepatitis have still been playing demons taking millions of lives year after year. As per WHO’s estimates, globally 32.5 crore people live with Hepatitis infection caused by one or the other types (Hepatitis A, B, C, D, or E) (World Health Organization 2020a, b). While around 9 lakhs died of irreparable liver damaged owing to Hepatitis B infection. In India, about 4 crore people are chronically infected with hepatitis B and 60 lakhs to 1.2 crore people are chronically infected with hepatitis C. According to the Indian Journal of Medical Research, in India about 2,50,000 people die of viral hepatitis or its sequelae every year. Another major viral infection based mortality is caused by HIV infection [70 lakhs in 2019 (UNAIDS 2020)]. A more recent viral infection by Sars-Cov2 has resulted in 17.5 crores of infection within a year with about 37.6 lakhs deaths. Be it a newly emerged virus or a pre-existing one, besides being responsible for catastrophically high morbidity and mortality, the socio-economic burden caused by their outbreaks is enormous. A large proportion of viral infection and their sequelae can be averted by early diagnosis and awareness. High prevalence and sudden emergence have led to tremendous efforts put together in order to improve clinical diagnostics. With the ever-enhancing technologies in clinical diagnostics, as of today, a myriad of diagnostic tests is available for management of viral infections. This era belongs to molecular detection attributed majorly to serological or NAAT based tests with numerous modifications in loop. The latter is crowned gold standard for many individual infections but especially for virus caused gastrointestinal and respiratory infections (Kiselev et al. 2020) whereas ELISA is still the most relied upon test when it comes to protein detection as in case of HIV. Although these molecular approaches are swore upon when it comes to accurate diagnosis yet for some infections like viral encephalitis MRI gives a better diagnosis as well as it apprises of the progression of the infection (Jayaraman et al. 2018). Furthermore, evident with Covid-19 outbreak, nothing is comparable to electron microscopy and sequencing when it comes to characterizing a new viral pathogen paving its way towards silent disaster (World Health Organization 2021a; Varga et al. 2020). Accurate and early screening is the key to effective prevention and clinical management of the infectious diseases. An integral part of diagnosis includes not just detection of pathogen in the patient’s sample but elucidation of factors that confer resistance to treatment, escapes natural immunity and response to vaccine,

25

Evolution of Viral Diagnostics: A Peek into Time

589

and also clades profile deciphering various mutations leading to differential prognosis. Certainly, rapid diagnosis is a necessity to allow early treatment, prevent severe complications and mortality in case of any infection. In this ever-growing world of technology, many deliverable advancements have been made that hold the potential to transform the field of clinical diagnostics, but factors like huge infrastructure and high cost are limiting their implementation on global scale. This chapter chronologically discusses the diagnostic methods used in the management of viral infections and sheds light on the recent advancements that have revolutionized diagnostic industry by over-coming major comprehensible limitations.

25.2

Viral Culture

The viral culture system for virus isolation has served as an important diagnostic technique in clinical virology for decades (Hodinka and Kaiser 2013). It was seen as a “gold standard” when very few options were available to detect viral illness (Stürmer and Reinheimer 2012). Unlike bacteria, viruses require host cells for their growth which is needed for their replication process. A simple methodology of viral culture includes cultivation of the infected host cells on growth media that can be used for harvesting virus particles. If the viral culture shows certain cytopathic effects, then culture is scored as positive (Leland and Ginocchio 2007). Culture is uniquely used to detect Herpes virus from Herpes sore (Ian Freshney 2010), for the detection of CMV, VZV, adenoviruses, RSV, influenza, and parainfluenza virus (Steinhardt et al. 1913). It is possible to detect viral pneumonia using viral culture of viral specimen collected from sputum samples, upper and lower respiratory tracts, and bronchoalveolar lavage (Viral Pneumonia Workup 2016). The use and importance of viral culture as a diagnostic tool is declining day by day because the pace of isolation of viruses from culture is slow, timeconsuming, labor-intensive and lower sensitivity (Kim et al. 2008).

25.3

Serological Assays

To establish the etiology of viral infection in an individual, serological assays involving two specific approaches for diagnosis are suggested: (1) increase in the titre of IgM/IgG antibodies (2) the presence of viral components (antigens) leading to the development of disease (Vainionpää and Leinikki 2008). The increased titres of IgM antibodies suggest the case of primary viral infection as IgM is the first antibody to be produced on viral exposure (Hedman et al. 1993). Antigen detection methods have been particularly useful for viruses that are slow growing, or labile, and difficult to culture (Greer and Alexander 1995). The most crucial viral targets for antigen detection are influenza, parainfluenza viruses, respiratory syncytial virus (RSVs) and adenoviruses found in respiratory samples (Piché-Renaud et al. 2016), Human Simplex virus (HSV) and Varicella zoster virus (VZV) in cutaneous specimens, rotaviruses in stool samples, and CMV and Hepatitis B virus in blood

590

G. Arora et al.

specimens (Fan et al. 2014). Viruses such as rhinoviruses and enteroviruses that show antigen heterogeneity makes antigen detection challenging and mostly not suitable for them (Stobart et al. 2017). The advantages of antigen detection involves rapid reproducibility of results, lack of requirement of viral viability, flexible handling, and convenient transport conditions (Fierz 2004; Ohst et al. 2018). Antibody levels are usually investigated from serum samples taken at acute and convalescent phase of infection. Virus-specific antibodies based diagnostic kits have been developed for detection of Epstein–Barr virus (EBV), Cytomegalovirus (CMV), hepatitis A virus, hepatitis B virus, parvoviruses, rubella, mumps viruses, SARS-CoV2, and encephalitis viruses (Peaper and Landry 2014). The IgM antibody levels start to rise after about 7–10 days of onset of illness and then begin to decline. The production of IgG antibodies start a few days after IgM response and they persist for long time (Mann and Woods 1995). Serological assays have proven to be beneficial in numerous ways. In primary infection they provide information about the kind of viral infection even when the viral components cannot be detected in the samples (Enache 2012). They can be used to evaluate the risk of certain chronic infection (e.g., HIV and HCV) that may result due to viral exposure. This kind of assay acts as a boon for viral epidemiological studies, determination of vaccine-induced immunity (Burgess et al. 2008). Despite so many advantages, this technique has a lot of pitfalls. In some of the viral infections, the antibody response is either not strong enough to be detected or is produced much later during the course of infection (Bryan 1987). Some of the antigens have low specificity which does not allow unambiguous interpretation of the results. In immunocompromised individuals, a very weak, negligible immune response is produced which is tedious to detect (Chernesky and Mahony 1984).

25.4

Neutralizing Antibody Assay

The most customary serological assay that is used is Neutralizing Antibody Assay. Neutralizing antibodies are called so because of their ability to decrease the infectious capacity of the virus. They are produced both during acute infection and last for entire lifetime (Svar Life Science 2016). Both IgM and IgG antibodies play an important role in the neutralization reaction (Payne 2017). In the assay, specific amounts of infectious viruses are mixed with the serum sample and incubated for a short time. Then the residual activity or neutralizing activity of the antibody is measured and compared with the infectivity of the original virus (Wang et al. 2005).

25.5

Hemagglutination Inhibition (HI) Test

In many animal species, aggregation of the RBCs may occur during viral infection. This aggregation is basically the result of binding of the viral particles to the hemagglutinin molecules found at the surface of RBCs (ScienceDirect Topics 2003). Hemagglutination inhibition test takes advantage of the virus’s capability to

25

Evolution of Viral Diagnostics: A Peek into Time

591

cause clumping of the RBC’s which is basically prevented by the action of antiviral antibodies produced in the serum (Pedersen 2008). Hemagglutination inhibition is widely used for diagnostic purposes and public health applications for several infections, like detection of orthomyxoviruses (influenza), paramyxoviruses (measles, mumps), arboviruses, ferlaviruses, togaviruses including rubella and flaviviruses (Vainionpää and Leinikki 2008; Landry et al. 2000).

25.6

Enzyme Linked Immunosorbent Assay

The enzyme linked immunosorbent assay (ELISA) is a powerful method used for serodiagnosis of viruses. Originally described by Engvall and Perlmann (1971), this method allows the analysis of viral antigens immobilized in microplate wells using virus specific antibodies (Van Elslande et al. 2020). There are several types of ELISA tests (Koenig and Paul 1982; Cambra et al. 1991) and the most widely used are double antibody sandwich ELISA (DAS-ELISA), double antibody sandwich indirect ELISA (DASIELISA; also named triple antibody sandwich-TAS), Plate Trapping Antigen ELISA (PTA direct and indirect ELISA) and Tissue printELISA, also named Direct tissue blot immunoassay-DTBIA (direct-ELISA). It is the mainstay for the diagnosis of infections of many different viruses including HIV-1, HTLV-1, adenoviruses, ZIKA virus (flavivirus), dengue virus, and cytomegaloviruses in clinical samples (Thermo Fisher Scientific 2020; Waritani et al. 2017). The average limit of detection by the ELISA test reaches up to pg/mL of viral titre. Some of the major pitfalls of enzyme based ELISA includes insipid conjugation of enzymes with antibodies, loss of activity of enzymes post conjugation step, poor sensitivity, and high production cost (Bukasov et al. 2021).

25.6.1 Microfluidics Based ELISA Recently ELISA is being used with microfluidic devices which results in a faster and economical method of diagnosing RNA viruses (Monto and Maassab 1981). Microfluidic devices are a kind of integrated systems which use minute quantities of reagents, thus economical. Researchers have used this assay for the detection of Hendra-virus specific IgG antibodies within 60 min (Tozetto-Mendoza et al. 2021). In another study conducted by Yu et al. detection of avian influenza virus (AIV) was done only in 1.5 h through this microfluidic based ELISA. Sandwich ELISA based microfluidic system has been used for the diagnosis of influenza virus as well (Shen et al. 2019).

25.6.2 Gold-Nano Particles in ELISA Nanoparticles based ELISA is developed in order to improve the specificity and sensitivity of the assay. Gold nanoparticles are employed for this purpose due to their

592

G. Arora et al.

facile synthesis, appreciable optical and electronic properties, and superior surface functionalization (Tabatabaei et al. 2021). Cost-effectiveness, longer shelf-life and sensitivity are some of the advantages of nanoparticle based immunoassay owing to which this is considered as an efficient method as compared to enzyme based assay (Gao et al. 2020). Gold nanoparticles improve the detection range of traditional ELISA by providing additional binding sites for detection of antibodies and improve the signal intensity of this assay therefore they serve as multivalent scaffold for immobilization of the biomolecules (Ghoshdastidar et al. 2020). Similarly, another modified ELISA assay, MELISA assay (magnetic nanoparticles modified ELISA assay) is developed to enhance the sensitivity of conventional enzyme-based assay. It has been reportedly used for the detection of Respiratory syncytial virus (RSV) (Zhan et al. 2014). Some of these assays are in development for SARS-CoV2 as well.

25.7

Chemiluminescence Immunoassay (CLIA)

CLIA assay works by combining chemiluminescence with immunochemical reactions. In recent years, it has proven itself as a promising diagnostic tool for detection of HIV and hepatitis B virus. Liu et al. based on their study on Foot-andMouth Disease (FMD) viral disease in pigs reported that CLIA has a higher sensitivity and shorter detection time than other immunoassays. The key advantages of CLIA assay includes high signal to noise ratio, higher sensitivity, and wide linear range (Liu et al. 2017). Absence of interfering emissions, rapid acquisition of the analytical signal, high stability of reagents and their conjugates, low consumption of reagents, random access adds up to the list making chemiluminescence assay a potential diagnostic tool for viruses. The limitations of CLIA are represented by limited Ag detection, high costs, limited test panels and closed analytical systems (Cinquanta et al. 2017).

25.8

Microscopy

Viral particles cannot be visualized by naked eyes and are not alive unless they infect host cells. Ruska and his colleagues were the first to visualize Tobacco Mosaic Virus (TMV) using EM (Goldsmith and Miller 2009). Electron microscopy for viruses have come into play from 1930s and allows quick visualization of viruses in a wide range of clinical samples. EM detection is usually done for fecal samples housing rotavirus, adenoviruses, also suitable for poxviruses, and herpesviruses in vesicular fluid. It also helps in the identification of herpesviruses and rabies virus in brain biopsy samples (Biel et al. 2004; Singh et al. 2006). One of the most accountable advantage of EM is that it does not require virus-specific reagents for their detection. Rest of the molecular and serological tests require virus specific probes for efficient diagnosis. In case of novel virus infection, it is hard to pick the right reagent (Goldsmith and Miller 2009). EM grants an “open view” (term coined by Hans

25

Evolution of Viral Diagnostics: A Peek into Time

593

Gelderblom) of whatsoever is available, while molecular tests require prior knowledge about the potential agent(s) to demonstrate the correct test (Doane and Anderson 1987). Even in the era of molecular diagnostics, EM is considered as a mainstay for the detection of viruses causing outbreaks. The first outbreak of Ebola Virus in Zaire was elucidated using EM (Johnson et al. 1977). In 1999 Trichodysplasia spinulosa, strange skin infection causing polyomavirus was detected using EM (Haycox et al. 1999). Stored viral solutions may not remain viable for culture or molecular tests after certain period of time but EM does not require live or intact cells (Hsiung 1994). As the nature of this technique is rapid, EM is on the frontline for the surveillance of potential bioterrorism incidents due to viral agents (Miller 2003). Naked human viruses including parvoviruses, enteroviruses, and caliciviruses (22–35 nm): polyomaviruses and papillomaviruses (40–50 nm), and reoviruses, rotaviruses, and adenoviruses (70–90 nm) can be distinctly visualized using EM (Miller 1986).

25.9

Magnetic Resonance Imaging

MRI is considered as a mainstay diagnostic tool in the field of neuroscience and medicine for the non-invasive imaging of the tissues and proteins (Hoerr and Faber 2014). For its ability to be used for longitudinal studies, it can be used for the diagnosis of infectious diseases both caused by bacteria and viruses. Primarily used for visualization of local inflammation, accumulation of fluid, and other pathological alterations manifested due to viral infection of brain (Palestro et al. 2007; Soldatos et al. 2012). A non-invasive diagnostic tool is seen as a reliable procedure to distinguish between the pathological aberrations arising due to viral infection from those occurring otherwise. As it enhances the diagnosis, it can open new doors for the novel therapeutic options and thus aid in disease management (Gemmel et al. 2009; Walker 2008). Due to low resolution of this technique, its use is often limited to those viruses confined to brain mainly causing viral encephalitis (Jayaraman et al. 2018). Early diagnosis of both primary and secondary encephalitis is possible due to MRI as it produces images of focal alterations, cerebral edema, hemorrhages and necrotic tissue (Egdell et al. 2012). Herpes simplex Encephalitis (HSE) is most common virus to be detected using MRI which causes necrotizing viral encephalitis. Its applications also include diagnosis of Japanese encephalitis virus, cytomegaloviruses, Parechovirus encephalitis, and Dengue encephalitis (McCabe et al. 2003). Other viruses and their effects that can be checked using MRI are HIV (Human Immunodeficiency Virus), Varicella Zoster virus and Rasmussen’s virus paramyxovirus, and Nipah Virus (Tabatabaei et al. 2021; Gao et al. 2020). Besides effective diagnosis and disease management, it also paves way for follow-up after treatment. Nanoscale MRI is another high-sensitivity tool used for its ability to produce contrast due to selective-isotope labelling and its non-destructive nature (Gupta et al. 2012; Siu et al. 2004). An important breakthrough in MRI sensitivity is introduction of Magnetic Resonance Force Microscopy which produced images with a resolution

594

G. Arora et al.

up to 4 nm of Tobacco Mosaic Virus particles (Degen et al. 2008). The obstructions to the use of MRI in diagnosis arises due to the nature of the technology itself which involves feeling claustrophobic inside the enclosed space of MRI machine, reaction to contrast agents used and effect on metallic implanted devices in the body if any (MSD Manual 2021).

25.10 Computed Tomography Computed tomography otherwise known as CT scan is a painless and non-invasive diagnostic tool which uses a combination of X-rays and computer processing to generate images of the internal tissues, bones, organs, and blood vessels from different angles with details. The series of images that are produced are used to generate a cross sectional picture by the computer (WebMD 2021). CT is usually performed for the community acquired lower respiratory viral infections such as those occurring due to invasion by Influenza virus, Respiratory syncytial virus, Parainfluenza, Adenovirus and SARS-CoV-2 which led to a pandemic (Miller et al. 2011). The CT scan examination is usually done to look for the presence or absence of tree in bud opacities, bronchial wall thickenings, ground glass opacities, and airspace consolidation (Shiley et al. 2010). Despite the availability of highsensitivity molecular tests, there is still a dependency on CT scan for diagnosis of viruses because of lack of transportation facilities and limitations of sample collection and kit performance (Ai et al. 2020). Chest CT scan is relatively easy to perform and results in fast diagnosis. Therefore, CT scan proved as a beneficial tool for the diagnosis of COVID-19 and its effect on lungs. The low-sensitivity of RT-PCR implies that COVID-19 may not be detected at an early stage and such patients may further spread this contagious disease (STAT 2021). Chest CT demonstrates respiratory findings such as ground-glass opacities, multifocal patchy consolidation, and/or interstitial changes with a peripheral distribution typical to COVID-19 (Huang et al. 2020a). CT reveals certain pulmonary abnormalities characteristic of COVID-19 in RT-PCR negative patients. Hazy, patchy, “ground glass,” white spots in the lung are seen as the tell-tale sign of infection and aid in treatment (Lei et al. 2020).

25.11 NAAT-Based Assays NAAT based assays are considered as gold-standard assays for diagnosis of many viral infections. They detect the genetic material of the virus be it a DNA or RNA instead of antigens or antibodies as in serological tests. NAAT assays are far more sensitive than the serological tests or culture methods. The biggest advantages associated with a NAAT assay is its lower turn-around time and its ability to be automated easily. All these factors along with reduction in cost in recent times make them potential candidate for development of Point of care tests (Goldenberg 2013; Napoli et al. 2013). NAAT tests unlike several other tests do not require viable

25

Evolution of Viral Diagnostics: A Peek into Time

595

organisms which makes collection and transportation easy and utilization of diverse biological samples (Beal et al. 2016; Cao et al. 2015). A huge variety of NAATs being exploited for diagnosis of several viral infections are RT-PCR, ligase chain reaction, DNA microarray based test, sequencing, Loop mediated isothermal amplification (LAMP), Nucleic Acid Sequencing Based Amplification (NASBA), Transcription Mediated Amplification (TMA), Strand Displacement Amplification (SDA), and Recombinase Polymerase Amplification (RPA), Helicase dependent isothermal amplification (Caruso et al. 2021). Many of these techniques make possible the differential and simultaneous detection of closely related strains as well as co-infections via providing a provision for multiplexing.

25.11.1 Polymerase Chain Reaction Ever since its discovery by Kary Mullis in 1985, PCR revolutionized the field of molecular diagnostics. Minute amount of nucleic acid can be detected accurately owing to its superior specificity and sensitivity. Various PCR based assays (uniplex, multiplex, nested, real-time) have been developed for diagnosis of viral infection. Where DNA viruses can be detected simply by carrying out amplification of a unique region, for RNA viruses another step of Reverse transcription is carried out for generation of cDNA prior to amplification, making the assay Reverse Transcription-Polymerase Chain Reaction (RT-PCR). Two basic chemistries are exploited in detection and quantification of amplified products in case of quantitative PCR (qPCR)-DNA binding dyes and fluorophore-labelled oligonucleotides. Based on the structure and mechanism by which these fluorophore-labelled oligonucleotides also called Probes help detect the amplified products, they can be classified into various types including-TaqMan, Scorpion, Amplifluor, Lux, Cyclones, Beacon, HyBeacon, MGB probes etc. (Navarro et al. 2015). qPCR/qRT-PCR assays are used as Gold standards for diagnosis of many viral diseases. Trombetta et al. projected high sensitivity of RT-PCR assays for identification of Influenza A and B viruses (Trombetta et al. 2018). RT-PCR assays are also being used commercially for detection of highly pathogenic H5N1 and H7N9, SARS-CoV-2, avian influenza viruses. Nested PCR using Fusion (F) gene and TaqMan based qRT-PCR using F and Nucleocapsid (N) gene are being used for detection of Respiratory syncytial virus (RSV), the leading cause of lower respiratory tract infection in infants. Further, multiplex qRT-PCR assays was developed for various respiratory tract infections like NxTAG-RPP for influenza virus, Panther fusion respiratory assay for Flu A/B, FTD 21 for simultaneous detection of coronaviruses (229E, OC43, NL63, and HKU1), flu A/B, influenza A/B, human adenovirus, bocavirus, enterovirus, metapneumonia virus, rhinovirus, parainfluenza virus and RSV (World Health Organization 2021b; Zhang et al. 2020b). qPCR assays are considered as Gold Standard assays with high clinical sensitivity and specificity for detection of two sexually transmitted infections causing viruses; HPV and HSV, from a variety of clinical samples which include Swab, skin lesions, fluid/

596

G. Arora et al.

exudate from vesicle base, mucosal sample without lesions, aqueous/vitreous humor, corticospinal fluid and blood (Caruso et al. 2021). During the ongoing pandemic, numerous qRT-PCR based kits have been developed and extensively used for screening populations across the globe for the novel coronavirus (SARS-CoV-2) that can potentially provide results in 3–4 h interval. However, their use has been limited to mainstream laboratories, due to requirement of bulky and expensive instruments, requirement to batch samples in large runs and most importantly the need of a highly trained personal (Younes et al. 2020). It is rationally believed that cost-effective and automated qRT-PCR assays that could be used as POCT would prove to be a game changer in the field of molecular diagnosis.

25.11.2 Loop-Mediated Isothermal Amplification-Based Assay (LAMP) LAMP method has been evaluated for diagnosing various viral infections including infection caused by rhinovirus and adenovirus, new castle disease, SARS, COVID19 and AIDS. For detection of RNA viruses, this technique uses enzyme reverse transcriptase along with Bst polymerase that possesses strand displacement activity in addition to isothermal amplification. LAMP assays are designed using two pairs of primers designed to complimentarily bind six unique target regions in the viral cDNA/gDNA (Fig. 25.1a). The amplification product, Amplicons are mostly determined either photometrically by measuring the magnesium pyrophosphate formed as a by-product in the reaction, by observing the colour change in the reaction vial by the virtue of intercalating dyes like SYBR® Green or by coupling the LAMP assays with Lateral Flow Dipstick (LFD) method (Vemula et al. 2016). Using the LAMP assay, Poon et al. reported 100% sensitivity for detection of H1N1 and H3N2 subtypes of influenza virus (Poon et al. 2005). LAMP assays have also been evaluated for various pathogenic avian influenza A subtypes and were found to yield better sensitivities with respect to their RT-PCR counterparts (Imai et al. 2006, 2007; Nakauchi et al. 2014). RT-LAMP assays targeting N gene and ORF1a gene of MERS-CoV was successfully developed showing high efficiency and no cross reactivity with any other respiratory virus (Shirato et al. 2018). Further, RT-LAMP technique was clubbed with vertical flow visualization strip (RT-LAMP-VF) by Huang’s research group to specifically identify a region in the N gene of MERS-CoV (Huang et al. 2018b). RT-LAMP assays have also been evaluated for detecting several genes of Zika virus. A triplex RT-LAMP protocol coupled with a smart phone has been developed for simultaneous detection of ZIKA virus, Chikungunya virus and densonucleosis virus (Da Silva et al. 2019). Ebola virus is among the devastating viruses with high infectious rate as well as high mortality rate. During the time of endemic that broke in West Africa in 2014 and that gradually spread its wings in USA as well, certain RT-LAMP based diagnostic assays helped combat the battle (Coarsey et al. 2017; Kurosaki et al. 2007; Whitehouse et al. 2015). During COVID-19 pandemic as well, RT-LAMP has given very promising results. RT-LAMP assays performed in isothermal conditions targeting ORF1ab, Spike,

Evolution of Viral Diagnostics: A Peek into Time

Fig. 25.1 Working of various NAAT based methods. (a) Loop mediated isothermal amplification (Da Silva et al. 2019), (b) Nucleic Acid Sequencing Based Amplification (NASBA) (Schneider 2015), (c) Helicase dependent isothermal amplification (HDA) (Barreda-García et al. 2018) and (d) transcription mediated amplification (TMA) (Buchan and Ledeboer 2014)

25 597

598

G. Arora et al.

Nucleocapsid, or Envelop gene of SARS-CoV-2 were evaluated and specific and sensitive results have been obtained using them in merely 15–40 min time (El-Tholoth et al. 2020; Huang et al. 2020b; Lamb et al. 2020; Li and Ren 2020; Yan et al. 2020; Yang et al. 2020; Yu et al. 2020; Zhang et al. 2020c).

25.11.3 Nucleic Acid Sequencing Based Amplification (NASBA) This method makes use of three enzymes (AMV-RT, RNase H and T7 RNA polymerase) and two oligonucleotide primers, one of which includes a T7 promotor site at its 5′end. Principally, Primer 1 with its T7 promotor site hybridizes to ssRNA and is elongated by the activity of AMV-RT enzyme. RNaseH chops off the RNA from the cDNA:RNA hybrid so formed following which primer 2 anneals to the remaining ssDNA copy. This primer is further extended by AMV-RT resulting into a dsDNA structure with an active T7 promotor site. T7 RNA polymerase docks onto it and a new RNA molecule can be transcribed from this dsDNA which further re-enters the reaction till the time all the primers are consumed. Afterwards, the sole contribution to amplification would be via the process of transcription (Schneider 2015). The technique has been successfully employed in the detection of HIV-1, avian influenza A subtypes H5N1 and H7N9, Hepatitis A, B and C viruses. Wang et al demonstrated modified NASBA called as simple method for amplifying RNA targets (SMART) for detection of H1N, H3N2 and pH1N1 subtypes of influenza virus with sensitivity of 98.3% and specificity of 95.7% (Schneider 2015). This assay is performed at a temperature as low as 41 °C and thus the primers can specifically bind to ssRNA and allows amplification even when the primers are consumed while being sensitive, specific and rapid diagnostic test.

25.12 Microarray-Based Approaches Microarrays-based assays have emerged as very helpful tools in the identification of influenza viruses and differentially detecting its subtypes. Some of the commercially available microarrays are FluChip microarray for detection of H1N1, H3N2 and H5N1 strains, MChip microarray which is a semi-conductor-based microarray developed by CombiMatrix Corporation in order to detect all known subtypes of Influenza A virus and NanoChip 400 systems that detect various markers of H5N1 virus. Although microarray technique has been extensively used in the detection of various sub-types of influenza virus but the approach has also been extended to the detection of 24 single nucleotide poly-morphism (SNP) mutations across the Spike gene of SARS-CoV-2 (Guo et al. 2014; Shen et al. 2020).

25

Evolution of Viral Diagnostics: A Peek into Time

599

25.13 Helicase Dependent Isothermal Amplification (HDA) HDA is an isothermal DNA amplification approach that most closely mimics an in vivo process of DNA replication. Developed by Vincent et al. (2004), this technique projects huge potential in the arena of viral diagnostics as it conveniently replaces heat for denaturing DNA using the DNA unwinding activity of Helicase enzyme (Vincent et al. 2004). In addition to Helicase, the process requires two accessory proteins viz. Methyl-directed mismatch repair (MutL) protein and single strand binding (SSB) protein in order to prevent re-annealing of recently unwound DNA. The other requirements of the assay are similar to that of a PCR besides that the reaction mixture should be enriched with higher concentration of dATP and Mg2+ dATP here are not just a substrate for the amplification reaction but also a co-factor for the helicase enzyme whereas Mg2+ acts as cofactor for both Helicase and Polymerase. The potential of the technique has been worked out with UvrD helicase and DNA polymerase I Klenow fragment, both the enzyme belonging to E. coli such that the reaction worked isothermally at 37 °C. Later a thermostable helicase, Tte-UvrD from Thermoanaerobacter tengcongenesis, has also been evaluated to work in combination with Bst-DNA polymerase making it feasible to carry out the reaction at a higher temperature range of 60–65 °C, the assay being called thermophilic form of HDA (tHDA) (An et al. 2005; Barreda-García et al. 2018). The technique has already been exploited to identify HIV, HSV-1 and HSV-2 using Real-time detection method, and HPV16 and HPV-18 virus using Lateral flow dipstick (LFD) method and holds the potential to replace thermal cycling based PCR with more rapid and equally sensitive and specific isothermal assay (Barbieri et al. 2014; Jordan et al. 2012; Kim et al. 2011).

25.14 Transcription Mediated Amplification (TMA) TMA is an isothermal amplification reaction that exponentially yields RNA amplicons from RNA targets. In this approach reverse, transcriptase first converts RNA molecule into cDNA molecule which further acts as template to produce numerous copies of RNA which are detected by the virtue to fluorescent or chemiluminescent probes. The amplification is as each RNA produced repeatedly undergoes TMA in subsequent stages. TMA is potentially much more sensitive method of diagnosis than PCR as in each cycle 100–1000 copies of RNA are produced than 2 copies as in PCR (Datta et al. 2014). In the recent years, the technique has been exploited to a significant extent for diagnosing viral pathogens with RNA genome. Assays developed using TMA approach have been evaluated for detection of HSV types 1 and 2, the deadly HIV and HBV in the clinical samples (Swenson et al. 2016; Vermeulen et al. 2019; Wu et al. 2017). Even more recently an automated transcription mediated amplification test has been successfully developed targeting two separate sequences in ORF-1 region of SARS-CoV-2 genome (Pham et al. 2020). In nutshell, being highly sensitive, having abilities of multiplex

600

G. Arora et al.

detection, and being isothermal in approach makes this technique well suited for routine practices in mainstream clinical laboratories.

25.15 Microfluidics Based Amplification Assays Microfluidics term specifically pertains to the techniques associated with exquisite control and practice of fluid flow in small scale. In recent years, microfluidics technology has been thoroughly explored to serve as a reliable tool in viral diagnostics. It has been realized that a variety of bench-top approaches can be translated on to miniaturized microfluidic devices, better known as “Lab-on-chip devices,” in order to reduce the quantity of reagents used and to speed up the reactions. Since the time from conceiving the idea of establishing PCR based assays on lab-on-chip devices, researchers involved in silicon-based micromachining took this challenge up and made very sophisticated, miniaturized, and portable PCR and qPCR instruments (Zhu et al. 2020). Majorly three techniques have been employed in developing PCR instruments on a microfluidic platform: Droplet based systems: they split samples to form droplets which include cells (Streets and Huang 2014). These droplets when loaded onto the microfluidic channel are subjected to a sequence of procedures from cell lysis through DNA extraction to PCR and fluorescence detection indicative of results (Rival et al. 2014).

25.15.1 Chip-Based Systems These systems are contrived by micromachining microfluidic channels in materials such as silicon, glass or polymers (Rival et al. 2014). Samples loaded into these channels are subjected to the same series of treatments as in Droplet-based methods. Chip-base systems are portable and save time such as each cycle of the PCR reaction can potentially be summed up in 15s (Farrar and Wittwer 2015).

25.15.2 Hybrid Systems The core of smallest qPCR systems already optimized and evaluated to carry out reaction for identification of H7N9 avian influenza virus and Ebola virus are the Hybrid systems (Ahrberg et al. 2016a, b). Here PCR mix is held in stationary phase covered by mineral oil forming a virtual reaction chamber. It uses micro-heater located beneath the chamber to carry out thermal heating whereas the cooling occurs passively. It integrates heating/cooling system with the fluorescence detection system and hence, the name (Zhu et al. 2020). Wang et al. fabricated LAMP-integrated microfluidic chip system and evaluated its performance for detection of respiratory infection viruses viz. influenza A virus subtypes H1N1, H3N2, H5N1, and H7N9, influenza B virus and human adenovirus. Results of clinical evaluation so obtained depicted high specificity and sensitivity with the reaction turn-around time of 1 h

25

Evolution of Viral Diagnostics: A Peek into Time

601

(Wang et al. 2018). With such promising results, microfluidic based NAAT assays could serve as a reliable, fast, portable point-of-care assays which could help deal with more than ever frequently viral infection outbreaks and reach a new generation in clinical diagnostics.

25.16 Aptamers First described almost 30 years ago, the applications of aptamers have gained width very recently. Aptamers are RNA/DNA oligonucleotides or peptides that by the virtue of their 3D structure associate with the target molecule very specifically and with high affinity. They are artificially synthesized via an in vitro technology called as the Systematic Evolution of Ligands by Exponential Enrichment (SELEX). In the SELEX method, the target to be detected is incubated with a pool of aptamers library which is often a nucleic acid library constituting 104–105 random oligonucleotides (30–100 bases) flanked by constant sequences at both the ends. Out of all the sequences that bind the target are kept whereas those that don’t are washed off. Subsequently, a new gene pool is created by amplifying, for 8–15 cycles, the aptamers that bind to the target (Davydova et al. 2016; Torres-Chavolla and Alocilja 2009; Zou et al. 2019). The gene pool created henceforth is highly specific and holds great affinity for the target while being more stable than the conventional antibodies, thus holding great potential to be used as a feasible diagnostic tool in virus detection (Resch 2017; Seo and Man 2017). Aptamer based biosensors, called aptasensors, have been developed that recognize and bind the target and then translate and output signals from the interaction in a detectable form (Zou et al. 2019). Surface Plasmon Resonance (SPR)-based aptasensor has been developed by Bai et al. to detect avian flu influenza type H5N1 virus which was found out to be fast and portable method, but the sensitivity was inferior to corresponding PCR-based methods (Bai et al. 2012). Using similar approach, efforts have also been made to develop aptasensors that could detect HIV-T at protein (Tombelli et al. 2005). With time, certain modifications have also been made in the conventional aptamer assay to improve sensitivity. One such method involves use of Nanoparticles-based colorimetric aptasensors employed to detect influenza A type H3N2 and HCV in separate diagnostic assays (Chen et al. 2016; Liu et al. 2012). Interestingly an approach coupling ELISA with Aptamer based diagnostics has also gained popularity. In this approach, instead of capturing and detecting antibody, capturing and detecting aptamers are used and the technique is thus known as Enzyme linked Aptamer assay (ELAA). Sandwich ELAA for detecting influenza A subtypes H3N2 and H1N1, human norovirus, Zika virus and HCV have already been individually evaluated (Escudero-Abarca et al. 2014; Lee and Zeng 2017; Park et al. 2013; Shiratori et al. 2014). While there are still some gaps in developing aptamers for diagnostic purposes, the results obtained with aptamers in viral diagnostics have been promising and with relevant improvements, a whole new future of diagnostics central to aptamers can be anticipated.

602

G. Arora et al.

25.17 Next-Generation Sequencing Next generation sequencing (NGS) has recently become a very popular technique when it comes to diagnosis of various viral diseases as it directly analyses the viral nucleic acid present in the clinical sample. The most important step is to prepare the sample for the NGS platform to be used for sequencing. The sequencing data thus obtained will be analyzed using various bioinformatics tools. Numerous NGS platforms available for sequencing are pyrosequencing, ILLUMINA, SOLEXA, and others. The emerging Oxford nanopore (MinIon) technology sequences the viral genome based on the sensing of the ionic current arising due to the DNA/RNA molecules that pass through the nanopores. It has a lot of merits over NGS but it has high error rate too. Firstly, it can generate longer read lengths making it suitable for the detection of the whole virus genome with a shorter turn-around time. It is an internet-free technique with great portability making it useful in the field during viral outbreaks. Lastly, it is an affordable technique for low-budget countries and fund restricted laboratories as well due to its low capital cost. It has been used for the detection of many pathogenic viruses lately. Recently, NGS was used for the rapid identification of Influenza A (H1N1) virus (Baillie et al. 2012; Kustin et al. 2019). Dessilly et al. used NGS for the detection of HIV-1 drug resistance mutations and Ebola virus (Towner et al. 2008). Unlike the PCR and DNA microarray methods, NGS does not require prior knowledge of the genomic sequences of the viral pathogens. It does not require target specific primers and oligonucleotide probes. However still the use of NGS is limited in clinical settings due to the number of samples per run, cost of sequencing and skills requirement for bioinformatics data analysis.

25.18 CRISPR-Cas Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) and CRISPRassociated (Cas) proteins, since their discovery in 1987, have been a widely explored subject of interest in clinical research and applications (Ishino et al. 1987). CRISPRCas systems are classified into two major classes, class I and II, each containing three subtypes (Makarova et al. 2019). Type I, II Class I encompasses almost 90% of known CRISPR-Cas systems and is mainly found in the fungi whereas, Class II CRISPR-Cas systems are more common in bacteria (Jolany et al. 2020; Shmakov et al. 2017). Potential of Class II has been greatly explored in the field of diagnosis of infectious diseases, in recent years, including the newly emerged SARS-CoV-2 viral infection (Xiang et al. 2020). The unique signature endonucleases associated with type II, type V and type VI are Cas9, Cas12, and Cas13 respectively (Shmakov et al. 2017). While Cas9 and Cas12 recognize and cleave double stranded DNA, Cas13 targets RNA (Ford 2019). The way by which CRISPR-Cas system functions in bacteria is quite simple and very efficient. CRISPR loci are recognized as a stretch of 20–40 bp sequence repeats separated by 20–58 bp ‘spacer’ sequences (Ishino et al. 2018). Downstream to it lies a stretch of sequences encoding for Cas proteins

25

Evolution of Viral Diagnostics: A Peek into Time

603

(Barrangou et al. 2007). Whenever a bacteriophage penetrates the bacterial membrane, Cas proteins cut a part of the foreign DNA/RNA and insert it within the CRISPR loci. CRISPR loci constitutively expresses pre-CRISPR Ribonucleic acid (pre-crRNA) containing all the CRISPR repeats and spacers. Cas proteins further cleave pre-crRNA yielding mature crRNA containing one spacer and one repeat each (Westra et al. 2014). Whenever any of these crRNA encounter a complimentary foreign DNA/RNA sequence, they form a complex along with the target sequence and Cas proteins, subsequently degrading and eliminating the invader, thereby preventing the foreseeable infection (Binnie et al. 2021).

25.18.1 Cas Specific CRISPR-Cas Application in Diagnostics 25.18.1.1 Cas9 Based Diagnostics Cas9 is the most extensively studied member of the Cas family and its role in diagnostics has been extensively exploited. Cas9 along with RNase III catalyze the maturation of pre-crRNA into crRNA. Trans-activating CRISPR RNA (tracr-RNA) binds to the repeat sequence of crRNA transforming its 3′end into double stranded RNA making a structure known as single guide RNA (sgRNA). Further a complex formed by sgRNA and Cas9 together recognize and cleave the target DNA as shown in Fig. 25.2 (Chylinski et al. 2014). Cas9 was first used for the purpose of development of diagnostic against Zika viruses in 2016. Here Nucleic acid sequence-based amplification followed by CRISPR cleavage (NASBACC) was used for viral detection. This technique was coupled with Toehold reaction in order to distinguish between two closely related strains of Zika virus such that if sgRNA/Cas9 complex could identify a target site along with PAM sequence, it created blunt end nick in the dsDNA yielding truncated RNA via in vitro transcription whereas, non-targeted DNA produces intact RNA which can activate Toehold reaction. The results were indicated by a colour change on paper disc. Thus, this technique can potentially differentiate between two very closely related strains of viruses (Pardee et al. 2016). Another diagnostic technology employing Cas9 is CRISPR/Cas9-triggered nicking endonuclease-mediated strand displacement amplification (CRISDA) for ultrasensitive detection of dsDNA (Zhou et al. 2018). CRISPR/Cas9-triggered isothermal exponential amplification reaction (CAS-EXPAR) is yet another method which utilized target DNA specific blunt end nicking activity of Cas9. Over and above, this strategy bypasses the need of exogenous primers and thereby further increases specificity of the assay (Huang et al. 2018a). Another strategy CRISPR/Cas9-mediated lateral flow nucleic acid assay (CASLFA) developed with the aim of detecting African Swine fever virus (ASFV) makes use of the very sensitive Lateral flow nucleic acid assay coupled with CRISPR-Cas technology for diagnosis (Wang et al. 2020). The application of CRISPR-Cas9 knowledge has been extended to the development of diagnostic kits for early detection of SARS-CoV-2 in the ongoing pandemic. Among the several kits developed, one makes use of what is known as dead Cas9 (dCas9) which specifically binds to the target DNA but doesn’t make a nick. In this kit fluorescein

604

G. Arora et al.

tracrRNA

Cas9 crRNA 5ʹ

3ʹ

sgRNA

PAM

Nucleases

Fig. 25.2 Cas9 together with crRNA and tracrRNA investigates the target DNA for the presence of PAM sequence before looking for sequence complimentary to crRNA. Binding of crRNA to the target strand finally triggers cleavage of the target as well as non-target strand (Hille et al. 2018)

amidites (FAM) tracrRNA-sgRNA has been used along with anti-FAM conjugated antibody nanoparticles and the assay has been demonstrated to work as a POCT and the technology goes by FNCAS9 Editor-Linked Uniform Detection Assay (FELUDA) (Azhar et al. 2020).

25.18.1.2 Cas12 Based Diagnostics After Cas9, Cas12 is an extensively studied effector protein finding its application in targeting dsDNA. Interestingly, the field of molecular diagnostics exploited the

25

Evolution of Viral Diagnostics: A Peek into Time

605

property of collateral damage of non-specific ssDNA by Cas12 in addition to targeting unique region of dsDNA (Binnie et al. 2021; Jolany et al. 2020; Srivastava et al. 2020). It’s a type V effector which is further classified into subtypes a–g. Cas12b and Cas12c need tracrRNA just like Cas9 but Cas12a works without it. crRNA and Cas12 form a complex which identifies a unique sequence and PAM on the target DNA. Upon associating with the target, Cas12 from the complex cuts the dsDNA and also cuts the surrounding ssDNA sequences non-specifically as shown in Fig. 25.3. This collateral damage caused by Cas12 which has found its job in diagnosis of viral infections (Jolany et al. 2020; Li et al. 2019; Rusk 2019) where ssDNA can be used as a probe upon conjugation with a dye whose fluorescence can be measured using a fluorometer or coupled with paper-based detection system. Two of the major CRISPR/Cas12 based diagnostic systems are DNA Endonuclease Targeted CRISPR Trans Reporter (DETECTR) and one-HOur Low-cost Multipurpose highly Efficient System (HOLMES). HOLMES based diagnostic system has been evaluated for detection of both DNA virus (Pseudorabies virus) and RNA virus (Japanese encephalitis virus) (Li et al. 2018). CRISPR/Cas12 based detection method has also been worked out for identification of Human Papilloma Virus (HPV) by relying on DETECTR method (Chen et al. 2018). Only recently the DETECTR method has also been utilized for development of a visual and rapid diagnostic kit for detection of SARS-CoV-2 virus (Broughton et al. 2020). Two more methods, All-in-One Dual CRISPR-Cas12a (AIOD-CRISPR) and iSCAN (in vitro Specific CRISPR-based Assay for Nucleic acids detection), have been successfully developed for accurate identification of SARS-CoV-2 and HIV which exploit the collaterally damaging property of Cas12 effector protein (Ali et al. 2020; Ding et al. 2020).

25.18.1.3 Cas13 Based Diagnostics Cas13 belongs to class VI of CRISPR/Cas system and possesses RNase activity. Cas13 effector has Higher Eukaryotes and Prokaryotes Nucleotide Binding Domain (HEPN) and carries out collateral nuclease activity just like Cas12 effector. Cas13crRNA complex binds to the target ssRNA by the virtue of unique complementary target and protospacer flanking site (PFS) which is an analogue of PAM in case of RNA targets. Upon binding, it cleaves the target ssRNA specifically and non-target ssRNA non-specifically (Hille et al. 2018; Jolany et al. 2020; Strich and Chertow 2018). While exploiting the potential of Cas13 effector in viral diagnosis, an additional step of in vitro RNA is required. Upon binding of crRNA/Cas13 complex to the targeted RNA, collateral cleavage of trans ssRNA takes which if conjugated to fluorescent dyes emit signals that can be detected via various techniques (Fig. 25.4). For development of viral diagnostic kits, Cas13 based specific high-sensitivity enzymatic reporter unlocking (SHERLOCK) has played significant role (Gootenberg et al. 2017). The SHERLOCK has already been exploited for diagnosis of dengue virus, Zika virus, and novel SARS-CoV-2 virus (Kellner et al. 2020; Zhang et al. 2020a). Another Cas13 based Rugged, Equitable, Scalable Testing (CREST) has been developed for identification of SARS-CoV-2 virus (Rauch et al. 2020). Cas13-assisted restriction of viral expression and readout (CARVER)

606

G. Arora et al.

Fig. 25.3 crRNA forms complex with Cas12 and recognizes PAM sequences on the target DNA. Upon binding to the PAM sequence along with the unique complementary sequence on the target DNA, Cas12 leads to cleavage of the target DNA as well as single stranded DNA in collateral damage. This property of collateral damage is exploited in DETECTR technology where the ssDNA conjugated to a fluorophore and a quencher acts as a probe. Once the probe is cleaved by Cas12, the signal coming from the fluorophore can be detected indicating the presence of target DNA that is required to interact with the crRNA-Cas12 complex for its activation

is yet another method which has been evaluated for detection of lymphocytic choriomeningitis virus and influenza A virus among others (Freije et al. 2019). Cas13 also appears to hold a highly promising position in diagnostics in near future due to huge scope in multiplexing.

25

Evolution of Viral Diagnostics: A Peek into Time

607

Fig. 25.4 crRNA forms complex with Cas13 and recognizes PFS sequences on the target RNA. Upon binding to the PFS sequence along with the unique complementary sequence on the target RNA, Cas13 leads to cleavage of the target RNA as well as single stranded RNA in collateral damage. This property of collateral damage is exploited in SHERLOCK technology where the non-specific RNA conjugated to a fluorophore and a quencher acts as a probe. Once the probe is cleaved by Cas13, the signal coming from the fluorophore can be detected indicating the presence of target RNA that is required to interact with the crRNA-Cas13 complex for its activation

608

G. Arora et al.

25.19 Lab-on-Chip Assays Lab-on-chip (LOC) device technology has progressed, in the recent past, from simple structures able to perform single task to complex integrated structures being able to carry out all processes from sample to result in one go (Haeberle and Zengerle 2007). The characteristics of LOCs enable to provide near the patient’s site point-of-care solutions while involving minimalistic human interference (Jung et al. 2015). Several LOC platforms using microfluidic based technology have been deployed in the detection of various viral pathogens ranging from Dengue Virus (DENV) to HIV. Both the conventional methods of diagnosis; immunoassays and NAAT have been integrated with microfluidics for easier detection of viral pathogens. Immunoassays on-chip: Miniaturization of antigen-antibody reactions on microfluidic based strips have not only increased the accuracy of results but have also made the assay portable (Ng et al. 2018). Several kinds of microfluidics-based cartridges have been deployed to sensitively detect various viruses. Inkjet-based digital microfluidic cartridges combined with instrument to carry out ELISA was developed and employed in detection of measles and rubella virus specific IgG antibodies. Similarly, bead-based microfluidic system clubbed with immunoassay has been used for detection of influenza virus, DENV, and HIV-1 (Coarsey et al. 2019; Iswardy et al. 2017; Krejcova et al. 2014). NAAT-based assays on-chip: The NAAT assays generally comprises of three steps; sample preparation, amplification, and detection and analysis. Each of these steps can be integrated with microfluidic system in order to assemble a complete point of-care solution. NAAT assays based on thermal-cycling as well as isothermal conditions have been extensively used for diagnosis of various viral diseases. Moreover, PCR-based microfluidics can be fabricated in two ways; (1) time-domain thermal cycling and (2) space-domain thermal cycling. Changing the temperature in the reaction chamber while using stationary samples allows a time-domain PCR apparatus to thermally cycle, resulting in a simple design. Microfluidic devices designed with this concept have been deployed in the detection of HCV, HPV, HIV, and ZIKV as well (Powell et al. 2018). In the space-domain microfluidics-based PCR, the thermal cycling is accomplished by moving the sample through various temperature zones in the instrument. Use of affordable roll-to-roll embossing techniques, like the one used for Ebola virus detection, enables the mass production of a device with a disposable microfluidic chip (Fernández-Carballo et al. 2017). The chip’s extensive microfluidic channel guides the PCR solution through various differentially heated regions. Further, a real-time LAMP-based integrated microsystem has also been designed to diagnose several respiratory viruses, including influenza A virus subtypes H1N1, H3N2, H5N1, and H7N9; influenza B virus; and human adenoviruses (Wang et al. 2018). Microfluidics based RT-LAMP assay has also been designed for the detection of ZIKV. This test involves a heating system utilizing an exothermic chemical process. This released energy is employed to carry out the isothermal LAMP reaction thereby bypassing the need of an external power supply. Use of leucocrystal violet dye allowed the detection of the amplification

25

Evolution of Viral Diagnostics: A Peek into Time

609

products via naked eye (Song et al. 2016). LOC systems provide significant benefits in infectious disease diagnostics, particularly when combined with recently emerging technologies like as 3D printing which are appropriate for quick prototyping and, eventually, manufacturing.

25.20 Artificial Intelligence Artificial intelligence (AI) is a very new and flourishing discipline of science in which computer-based systems are designed to closely mimic human intellect. The biggest advantage of AI is its potential to analyze the vast medical and biological data produced on daily basis and subsequently employ a sub-discipline of AI called as machine learning (ML) to learn via statistical models using examples in data. Based on these approaches, AI has been harnessed in numerous applications across public health sector from disease diagnosis, through prediction of prognosis to drug development (Park et al. 2020). Interestingly, some research groups made use of “Rough set theory” to predict new viral mutations much before the emergence of new viral strains. One such group predicted nucleotide substitutions in RNA sequence of Avian pneomoencephalitis virus (New Castle’s disease virus) with an accuracy of around 70% (Park et al. 2020). Such tools become of utmost importance when fighting with catastrophic viral outbreaks. Using the predicted new RNA sequence, potential changes in the viral protein involved can be deciphered using nearly perfected tools like AlphaFold and its more advanced version AlphaFold 2 and ultimately, its clinical manifestations on the host can be predicted much before the new strains actually begin to take a toll on human race. Recently, Jin et al. proposed an AI based system for early detection of COVID-19 infection using chest CT scans and it was found to outperform five experienced radiologists in correctly detecting the infection (Jin et al. 2020). Thus, AI has the potential to revolutionize the arena of diagnostics and can help the medical sector be prepared in advance for any deleterious viral pandemic. The management of the patients in resource limited settings, during the critical times of emergency, can be optimized using AI to an extent that based on the predicted prognosis, the allocation of resources and infrastructure can be prioritized. It doesn’t seem a far cry anymore that with little more development in this field we would be able to foresee the upcoming naturally occurring viral outbreaks and might be able to prevent them with correct measures taken in time.

References Ahrberg CD, Ilic BR, Manz A, Neužil P (2016a) Handheld real-time PCR device. Lab Chip 16(3): 586–592. www.rsc.org/loc Ahrberg CD, Manz A, Neužil P (2016b) Palm-sized device for point-of-care Ebola detection. Anal Chem 88(9):4803–4807

610

G. Arora et al.

Ai T et al (2020) Correlation of chest CT and RT-PCR testing for Coronavirus disease 2019 (COVID-19) in China: a report of 1014 cases. Radiology 296(2):E32–E40. https://doi.org/10. 1148/radiol.2020200642 Ali Z et al (2020) ISCAN: an RT-LAMP-coupled CRISPR-Cas12 module for rapid, sensitive detection of SARS-CoV-2. Virus Res 288:198129 An L et al (2005) Characterization of a thermostable UvrD helicase and its participation in helicasedependent amplification. J Biol Chem 280(32):28952–28958. http://www.jbc.org Azhar M et al (2020) Rapid, field-deployable nucleobase detection and identification using FnCas9. bioRxiv 2020:028167. https://doi.org/10.1101/2020.04.07.028167 Bai H et al (2012) A SPR Aptasensor for detection of avian influenza virus H5N1. Sensors 12(9): 12506–12518. http://www.mdpi.com/1424-8220/12/9/12506 Baillie GJ et al (2012) Evolutionary dynamics of local pandemic H1N1/2009 influenza virus lineages revealed by whole-genome analysis. J Virol 86(1):11–18 Barbieri D, Venturoli S, Rösl F, Rincon-Orozco B (2014) Detection of high-risk human papillomavirus type 16 and 18 using isothermal helicase-dependent amplification. Diagn Microbiol Infect Dis 79(2):178–182 Barrangou R, Fremaux C, Deveau H, Richards M, Boyaval P, Moineau S, Romero DA, Horvath P (2007) CRISPR provides acquired resistance against viruses in prokaryotes. Science 315:1709 Barreda-García S et al (2018) Helicase-dependent isothermal amplification: a novel tool in the development of molecular-based analytical systems for rapid pathogen detection. Anal Bioanal Chem 410(3):679–693 Beal SG, Assarzadegan N, Rand KH (2016) Sample-to-result molecular infectious disease assays: clinical implications, limitations and potential. Expert Rev Mol Diagn 16(3):323–341 Biel SS et al (2004) Detection of human polyomaviruses in urine from bone marrow transplant patients: comparison of electron microscopy with PCR. Clin Chem 50(2):306–312 Binnie A et al (2021) CRISPR-based strategies in infectious disease diagnosis and therapy. Infection 1:3. https://doi.org/10.1007/s15010-020-01554-w Broughton JP et al (2020) CRISPR-Cas12-based detection of SARS-CoV-2. Nat Biotechnol 38(7): 870–874. https://doi.org/10.1038/s41587-020-0513-4 Bryan JA (1987) The serologic diagnosis of viral infection. An update. Arch Pathol Lab Med 111(11):1015–1023 Buchan BW, Ledeboer NA (2014) Emerging technologies for the clinical microbiology laboratory. Clin Microbiol Rev 27(4):783–822. https://journals.asm.org/journal/cmr Bukasov R, Dossym D, Filchakova O (2021) Detection of RNA viruses from influenza and HIV to Ebola and SARS-CoV-2: a review. Anal Methods Adv Methods Appl 13(1):34–55. https:// pubs.rsc.org/en/content/articlehtml/2021/ay/d0ay01886d Burgess STG et al (2008) A multiplexed protein microarray for the simultaneous serodiagnosis of human immunodeficiency virus/hepatitis C virus infection and typing of whole blood. Anal Biochem 382(1):9–15 Cambra M et al (1991) Comparison of different immunosorbent assays for Citrus Tristeza Virus (CTV) using CTV specific monoclonal and polyclonal antibodies. International Organization of Citrus Virologists Conference Proceedings (1957–2010) 11(11). https://escholarship.org/uc/ item/3sb6f7wq (May 28, 2023) Cao B et al (2015) DNA microarray characterization of pathogens associated with sexually transmitted diseases. PLoS One 10(7):181 Caruso G, Giammanco A, Virruso R, Fasciana T (2021) Current and future trends in the laboratory diagnosis of sexually transmitted infections. Int J Environ Res Public Health 18(3):1–17 Chen C et al (2016) Functionalized magnetic microparticle-based colorimetric platform for influenza A virus detection. Nanotechnology 27(43):435102 Chen JS et al (2018) CRISPR-Cas12a target binding unleashes indiscriminate single-stranded DNase activity. Science 360(6387):436–439 Chernesky MA, Mahony JB (1984) Detection of viral antigens, particles, and early antibodies in diagnosis. Yale J Biol Med 57(5):757–776

25

Evolution of Viral Diagnostics: A Peek into Time

611

Chylinski K, Makarova KS, Charpentier E, Koonin EV (2014) Classification and evolution of type II CRISPR-Cas systems. Nucleic Acids Res 42(10):6091–6105 Cinquanta L, Fontana DE, Bizzaro N (2017) Chemiluminescent immunoassay technology: what does it change in autoantibody detection? Autoimmun Highlights 8(1):9 Coarsey CT et al (2017) Strategies in Ebola virus disease (EVD) diagnostics at the point of care. Crit Rev Microbiol 43(6):779–798 Coarsey C et al (2019) Development of a flow-free magnetic actuation platform for an automated microfluidic ELISA. RSC Adv 9(15):8159–8168 Da Silva SJR, Pardee K, Pena L (2019) Loop-mediated isothermal amplification (LAMP) for the diagnosis of Zika virus: a review. Viruses 12(1):19 Datta S, Chatterjee S, Veer V (2014) Recent advances in molecular diagnostics of hepatitis B virus. World J Gastroenterol 20(40):14615–14625 Davydova A et al (2016) Aptamers against pathogenic microorganisms. Crit Rev Microbiol 42(6): 847–865 Degen CL et al (2008) Nanoscale magnetic resonance imaging. PNAS 106(5):1313–1317. https:// doi.org/10.1073/pnas.0812068106 Ding X, Yin K, Li Z, Liu C (2020) All-in-one dual CRISPR-Cas12a (AIOD-CRISPR) assay: a case for rapid, ultrasensitive and visual detection of novel coronavirus SARS-CoV-2 and HIV virus. bioRxiv 2020:998724 Doane FW, Anderson N (1987) Electron microscopy diagnostic virology practical guide and atlas. Cambridge University Press, Cambridge. https://www.cambridge.org/in/academic/subjects/lifesciences/biological-imaging/electron-microscopy-diagnostic-virology-practical-guide-andatlas?format=HB&isbn=9780521243117 Egdell R, Egdell D, Solomon T (2012) Herpes simplex virus encephalitis. BMJ (Online) 344(7861): e3630 El-Tholoth M, Bau HH, Song J (2020) A single and two-stage, closed-tube, molecular test for the 2019 novel coronavirus (COVID-19) at home, clinic, and points of entry. ChemRxiv 2020: 11860137 Enache EM (2012) Serologic tests. In: Encyclopedia of immigrant health. Springer, New York, pp 1342–1343. https://doi.org/10.1007/978-1-4419-5659-0_693 Escudero-Abarca BI et al (2014) Selection, characterization and application of nucleic acid aptamers for the capture and detection of human norovirus strains. PLoS One 9(9):e106805 Engvall E, Perlmann P (1971) Enzyme-linked immunosorbent assay (ELISA). Quantitative assay of immunoglobulin G. Immunochemistry 8(9):871–874. https://pubmed.ncbi.nlm.nih.gov/513 5623/ (May 28, 2023) Fan F, Day S, Xuedong L, Tang YW (2014) Laboratory diagnosis of HSV and varicella zoster virus infections. Future Virol 9(8):721–731. https://doi.org/10.2217/fvl.14.61 Farrar JS, Wittwer CT (2015) Extreme PCR: efficient and specific DNA amplification in 15–60 s. Clin Chem 61(1):145–153 Fernández-Carballo BL et al (2017) Continuous-flow, microfluidic, QRT-PCR system for RNA virus detection. Anal Bioanal Chem 410(1):33–43. https://doi.org/10.1007/s00216-017-0689-8 Fierz W (2004) Basic problems of serological laboratory diagnosis. Methods Mol Med 94:393–427 Ford T (2019) The Cas proteins behind CRISPR diagnostics. Mammoth Biosciences Inc., Brisbane Freije CA et al (2019) Programmable inhibition and detection of RNA viruses using Cas13. Mol Cell 76(5):826–837.e11 Gao Y, Zhou Y, Chandrawati R (2020) Metal and metal oxide nanoparticles to enhance the performance of enzyme-linked immunosorbent assay (ELISA). ACS Appl Nano Mater 3(1): 1–21. https://doi.org/10.1021/acsanm.9b02003 Gemmel F, Dumarey N, Welling M (2009) Future diagnostic agents. Semin Nucl Med 39(1):11–26 Ghoshdastidar S et al (2020) Plate-adherent nanosubstrate for improved ELISA of small molecules: a proof of concept study. Anal Chem 92(16):10952–10956. https://doi.org/10.1021/acs. analchem.0c01441

612

G. Arora et al.

Goldenberg S (2013) Molecular-based diagnostics, including future trends. Medicine (United Kingdom) 41(11):663–666 Goldsmith CS, Miller SE (2009) Modern uses of electron microscopy for detection of viruses. Clin Microbiol Rev 22(4):552–563 Gootenberg JS et al (2017) Nucleic acid detection with CRISPR-Cas13a/C2c2. Science 356(6336): 438–442 Greer S, Alexander GJM (1995) 4 Viral serology and detection. Baillieres Clin Gastroenterol 9(4): 689–721 Guo X et al (2014) Development of a single nucleotide polymorphism DNA microarray for the detection and genotyping of the SARS coronavirus. J Microbiol Biotechnol 24(10):1145–1454 Gupta RK, Soni N, Kumar S, Khandelwal N (2012) Imaging of central nervous system viral diseases. J Magn Reson Imaging 35(3):477–491 Haeberle S, Zengerle R (2007) Microfluidic platforms for lab-on-a-chip applications. Lab Chip 7(9):1094–1110 Haycox CL et al (1999) Trichodysplasia spinulosa—a newly described folliculocentric viral infection in an immunocompromised host. J Investig Dermatol Symp Proc 4(3):268–271 Hedman K, Lappalainen M, Söderlund M, Hedman LA (1993) Avidity of IgG in serodiagnosis of infectious diseases. Rev Med Microbiol 4:123–129. https://researchportal.helsinki.fi/en/ publications/avidity-of-igg-in-serodiagnosis-of-infectious-diseases Hille F et al (2018) The biology of CRISPR-Cas: backward and forward. Cell 172(6):1239–1259 Hodinka RL, Kaiser L (2013) Is the era of viral culture over in the clinical microbiology laboratory? J Clin Microbiol 51(1):2–8 Hoerr V, Faber C (2014) Magnetic resonance imaging characterization of microbial infections. J Pharm Biomed Anal 93:136–146 Hsiung GD (1994) Hsiung’s diagnostic virology. Yale University Press, Yale. https://yalebooks. yale.edu/book/9780300058451/hsiungs-diagnostic-virology Huang M, Zhou X, Wang H, Xing D (2018a) Clustered regularly interspaced short palindromic repeats/Cas9 triggered isothermal amplification for site-specific nucleic acid detection. Anal Chem 90(3):2193–2200 Huang P et al (2018b) A rapid and specific assay for the detection of MERS-CoV. Front Microbiol 9:1101. https://doi.org/10.3389/fmicb.2018.01101/full Huang C et al (2020a) Clinical features of patients infected with 2019 novel coronavirus in Wuhan, China. Lancet 395(10223):497–506 Huang WE et al (2020b) RT-LAMP for rapid diagnosis of coronavirus SARS-CoV-2. Microb Biotechnol 13(4):950–961. https://doi.org/10.1111/1751-7915.13586 Hui DS et al (2020) The continuing 2019-NCoV epidemic threat of novel coronaviruses to global health—the latest 2019 novel coronavirus outbreak in Wuhan, China. Int J Infect Dis 91:264– 266. https://doi.org/10.1016/j.ijid.2020.01.009 Ian Freshney R (2010) Culture of animal cells: a manual of basic technique and specialized applications, 7th edn. Wiley, New York. https://www.wiley.com/en-us/Culture+of+Animal +Cells%3A+A+Manual+of+Basic+Technique+and+Specialized+Applications%2C+7th+Edi tion-p-9781118873656 Imai M et al (2006) Development of H5-RT-LAMP (loop-mediated isothermal amplification) system for rapid diagnosis of H5 avian influenza virus infection. Vaccine 24(44–46):6679–6682 Imai M et al (2007) Rapid diagnosis of H5N1 avian influenza virus infection by newly developed influenza H5 hemagglutinin gene-specific loop-mediated isothermal amplification method. J Virol Methods 141(2):173–180 Ishino Y et al (1987) Nucleotide sequence of the Iap gene, responsible for alkaline phosphatase isozyme conversion in Escherichia coli, and identification of the gene product. J Bacteriol 169(12):5429–5433 Ishino Y, Krupovic M, Forterre P (2018) History of CRISPR-Cas from encounter with a mysterious repeated sequence to genome editing technology. J Bacteriol 200:e00580-17

25

Evolution of Viral Diagnostics: A Peek into Time

613

Iswardy E et al (2017) A bead-based immunofluorescence-assay on a microfluidic dielectrophoresis platform for rapid dengue virus detection. Biosens Bioelectron 95:174–180 Jayaraman K, Rangasami R, Chandrasekharan A (2018) Magnetic resonance imaging findings in viral encephalitis: a pictorial essay. J Neurosci Rural Pract 9(4):556–560 Jin C et al (2020) Development and evaluation of an artificial intelligence system for COVID-19 diagnosis. Nat Commun 11(1):1–14. https://doi.org/10.1038/s41467-020-18685-1 Johnson KM, Lange JV, Webb PA, Murphy FA (1977) Isolation and partial characterisation of a new virus causing acute hæmorrhagic fever in zaire. Lancet 309(8011):569–571 Jolany S et al (2020) CRISPR-based diagnosis of infectious and noninfectious diseases. Biol Proced Online 3:1–14 Jordan JA et al (2012) Evaluation of a manual DNA extraction protocol and an isothermal amplification assay for detecting HIV-1 DNA from dried blood spots for use in resourcelimited settings. J Clin Virol 54(1):11–14 Jung W, Han J, Choi JW, Ahn CH (2015) Point-of-care testing (POCT) diagnostic systems using microfluidic lab-on-a-chip technologies. Microelectron Eng 132:46–57 Kellner MJ et al (2020) Author Correction: SHERLOCK: nucleic acid detection with CRISPR nucleases [(Nature Protocols, (2019), 14, 10, (2986–3012), 10.1038/S41596-019-0210-2)]. Nat Protoc 15(3):1311 Kim JS et al (2008) Enhanced detection of respiratory viruses using cryopreserved R-mix ready cells. J Clin Virol 42(3):264–267 Kim HJ et al (2011) A rapid and simple isothermal nucleic acid amplification test for detection of herpes simplex virus types 1 and 2. J Clin Virol 50(1):26–30 Kiselev D et al (2020) Current trends in diagnostics of viral infections of unknown etiology. Viruses 12(2):1–28 Koenig R, Paul HL (1982) Variants of Elisa in plant virus diagnosis. J Virol Methods 5(2):113–125. https://www.sciencedirect.com/science/article/pii/016609348290088X Krejcova L et al (2014) 3D Printed chip for electrochemical detection of influenza virus labeled with CdS quantum dots. Biosens Bioelectron 54:421–427 Kurosaki Y et al (2007) Rapid and simple detection of Ebola virus by reverse transcription-loopmediated isothermal amplification. J Virol Methods 141(1):78–83 Kustin T et al (2019) A method to identify respiratory virus infections in clinical samples using next-generation sequencing. Sci Rep 9(1):1–8 Lamb LE, Bartolone SN, Ward E, Chancellor MB (2020) Rapid detection of novel coronavirus (COVID-19) by reverse transcription-loop-mediated isothermal amplification. medRxiv 2020: 20025155. https://doi.org/10.1101/2020.02.19.20025155 Landry ML et al (2000) A standardized plaque reduction assay for determination of drug susceptibilities of cytomegalovirus clinical isolates. Antimicrob Agents Chemother 44(3): 688–692 Lee KH, Zeng H (2017) Aptamer-based ELISA assay for highly specific and sensitive detection of Zika NS1 protein. Anal Chem 89(23):12743–12748. https://doi.org/10.1021/acs.analchem. 7b02862 Lei J, Li J, Li X, Qi X (2020) CT imaging of the 2019 novel coronavirus (2019-NCoV) pneumonia. Radiology 295(1):18. https://doi.org/10.1148/radiol.2020200236 Leland DS, Ginocchio CC (2007) Role of cell culture for virus detection in the age of technology. Clin Microbiol Rev 20(1):49–78 Lever RA, Whitty CJM (2016) Ebola virus disease: emergence, outbreak and future directions. Br Med Bull 117(1):95–106 Li C, Ren L (2020) Recent progress on the diagnosis of 2019 novel coronavirus. Transbound Emerg Dis 67(4):1485–1491 Li SY et al (2018) CRISPR-Cas12a has both cis- and trans-cleavage activities on single-stranded DNA. Cell Res 28(4):491–493. https://doi.org/10.1038/s41422-018 Li Y, Li S, Wang J, Liu G (2019) CRISPR/Cas systems towards next-generation biosensing. Trends Biotechnol 37(7):730–743

614

G. Arora et al.

Liu M et al (2012) Interface engineering catalytic graphene for smart colorimetric biosensing. ACS Nano 6(4):3142–3151. https://doi.org/10.1021/nn3010922 Liu Z et al (2017) Chemiluminescence immunoassay for the detection of antibodies against the 2C and 3ABC nonstructural proteins induced by infecting pigs with foot-and-mouth disease. Virus 24(8):e00153–e00117. https://doi.org/10.1128/CVI.00153-17 Lo MK, Rota PA (2008) The emergence of Nipah virus, a highly pathogenic paramyxovirus. J Clin Virol 43(4):396–400 Makarova KS, Wolf YI, Koonin EV (2019) Evolutionary classification of CRISPR-Cas systems: a burst of class 2 and derived variants. Nat Rev Microbiol 18(2):67–83 Mann LM, Woods GL (1995) Rapid diagnosis of viral pathogens. Clin Lab Med 15(2):389–405 McCabe K, Tyler K, Tanabe J (2003) Diffusion-weighted MRI abnormalities as a clue to the diagnosis of herpes simplex encephalitis. Neurology 61(7):1015–1016 Miller SE (1986) Detection and identification of viruses by electron microscopy. J Electron Microsc Tech 4(3):265–301 Miller SE (2003) Bioterrorism and electron microscopic differentiation of poxviruses from herpesviruses: dos and don’ts. Ultrastruct Pathol 27(3):133–140 Miller WT et al (2011) CT of viral lower respiratory tract infections in adults: comparison among viral organisms and between viral and bacterial infections. Am J Roentgenol 197(5):1088–1095 Monto AS, Maassab HF (1981) Ether treatment of type B influenza virus antigen for the hemagglutination inhibition test. J Clin Microbiol 13(1):54–57 MSD Manual (2021) Magnetic resonance imaging (MRI)—special subjects—MSD Manual Consumer Version. https://www.msdmanuals.com/en-in/home/special-subjects/common-imagingtests/magnetic-resonance-imaging-mri. Accessed 23 Apr 2021 Nakauchi M et al (2014) Development of a reverse transcription loop-mediated isothermal amplification assay for the rapid diagnosis of avian influenza A (H7N9) virus infection. J Virol Methods 204:101–104 Napoli Z et al (2013) Frequency of sexually transmitted diseases and main methodological implications. Microbiol Med 28(2):2250 Navarro E, Serrano-Heras G, Castaño MJ, Solera J (2015) Real-time PCR detection chemistry. Clin Chim Acta 439:231–250. https://doi.org/10.1016/j.cca.2014.10.017 Ng AHC et al (2018) A digital microfluidic system for serological immunoassays in remote settings. Sci Transl Med 10(438):eaar6076 Ohst C et al (2018) Reliable serological testing for the diagnosis of emerging infectious diseases. In: Advances in experimental medicine and biology. Springer, New York, pp 19–43 Palestro CJ, Love C, Miller TT (2007) Diagnostic imaging tests and microbial infections. Cell Microbiol 9(10):2323–2333 Pardee K et al (2016) Rapid, low-cost detection of Zika virus using programmable biomolecular components in brief. Cell 165(5):1255–1266. https://doi.org/10.1016/j.cell.2016.04.059 Park JH et al (2013) Infectivity of hepatitis C virus correlates with the amount of envelope protein E2: development of a new aptamer-based assay system suitable for measuring the infectious titer of HCV. Virology 439(1):13–22 Park Y et al (2020) Emergence of new disease: how can artificial intelligence help? Trends Mol Med 26(7):627–629. https://doi.org/10.1016/j.molmed.2020.04.007 Payne S (2017) Methods to study viruses. In: Viruses. Elsevier, Amsterdam, pp 37–52 Peaper DR, Landry ML (2014) Laboratory diagnosis of viral infection. In: Handbook of clinical neurology. Elsevier, Amsterdam, pp 123–147 Pedersen JC (2008) Hemagglutination-inhibition test for avian influenza virus subtype identification and the detection and quantitation of serum antibodies to the avian influenza virus. Methods Mol Biol 436:53–66 Pham J et al (2020) Performance characteristics of a high-throughput automated transcriptionmediated amplification test for SARS-CoV-2 detection. J Clin Microbiol 58(10):e01669– e01620

25

Evolution of Viral Diagnostics: A Peek into Time

615

Piché-Renaud PP et al (2016) Evaluation of a fluorescent immunoassay rapid test (Sofia™) for detection of influenza A + B and RSV in a tertiary pediatric Setting. Diagn Microbiol Infect Dis 84(4):304–308 Poon LLM et al (2005) Detection of human influenza A viruses by loop-mediated isothermal amplification. J Clin Microbiol 43(1):427–430 Powell L et al (2018) Rapid and sensitive detection of viral nucleic acids using silicon microchips. Analyst 143(11):2596–2603 Rather IA et al (2017) ZIKA virus: an emerging worldwide threat. Front Microbiol 8:1417 Rauch JN et al (2020) A scalable, easy-to-deploy, protocol for Cas13-based detection of SARSCoV-2 genetic material. bioRxiv 2020:052159. https://doi.org/10.1101/2020.04.20.052159 Resch B (2017) Product review on the monoclonal antibody palivizumab for prevention of respiratory syncytial virus infection. Hum Vaccines Immunother 13(9):1–12 Rival A et al (2014) An EWOD-based microfluidic chip for single-cell isolation, MRNA purification and subsequent multiplex QPCR. Lab Chip 14(19):3739–3749 Rusk N (2019) Spotlight on Cas12. Nat Methods 16(3):215 Schneider P (2015) Submicroscopic Plasmodium falciparum gametocytaemia and the contribution to malaria transmission. Radboud University, Nijmegen ScienceDirect Topics (2003) Hemagglutination inhibition test—an overview. Elsevier, Amsterdam. https://www.sciencedirect.com/topics/agricultural-and-biological-sciences/hemagglutinationinhibition-test Seo HB, Man BG (2017) Aptamer-based sandwich-type biosensors. J Biol Eng 11(1):11 Shen KM et al (2019) An integrated microfluidic system for rapid detection and multiple subtyping of influenza A viruses by using glycan-coated magnetic beads and RT-PCR. Lab Chip 19(7): 1277–1286 Shen M et al (2020) Recent advances and perspectives of nucleic acid detection for coronavirus. J Pharm Anal 10(2):97–101 Shiley KT, Van Deerlin VM, Miller WT (2010) Chest CT features of community-acquired respiratory viral infections in adult inpatients with lower respiratory tract infections. J Thorac Imaging 25(1):68–75 Shirato K et al (2018) Development of fluorescent reverse transcription loop-mediated isothermal amplification (RT-LAMP) using quenching probes for the detection of the middle east respiratory syndrome coronavirus. J Virol Methods 258:41–48 Shiratori I et al (2014) Selection of DNA aptamers that bind to influenza A viruses with high affinity and broad subtype specificity. Biochem Biophys Res Commun 443(1):37–41 Shmakov S et al (2017) Diversity and evolution of class 2 CRISPR-Cas systems. Nature Publishing Group, London Singh HK et al (2006) Negative-staining electron microscopy of the urine for the detection of polyomavirus infections. Ultrastruct Pathol 30:329–338 Siu JCW, Chan CY, Wong YC, Yuen MK (2004) Magnetic resonance imaging findings of Japanese encephalitis. J Hong Kong Coll Radiol 7(2):76–80 Soldatos T et al (2012) Magnetic resonance imaging of musculoskeletal infections. systematic diagnostic assessment and key points. Acad Radiol 19(11):1434–1443 Song J et al (2016) Instrument-free point-of-care molecular detection of Zika virus. Anal Chem 88(14):7289–7294. https://doi.org/10.1021/acs.analchem.6b01632 Srivastava S, Upadhyay DJ, Srivastava A (2020) Next-generation molecular diagnostics development by CRISPR/Cas tool: rapid detection and surveillance of viral disease outbreaks. Front Mol Biosci 7:582499. https://doi.org/10.3389/fmolb.2020.582499/full STAT (2021) CT scans might offer a more accurate way to diagnose Covid-19—STAT. https:// www.statnews.com/2020/04/16/ct-scans-alternative-to-inaccurate-coronavirus-tests/. Accessed 16 May 2021 Steinhardt E, Israeli C, Lambert RA (1913) Studies on the cultivation of the virus of vaccinia. Zenodo 13:294. https://doi.org/10.1093/infdis/13.2.294

616

G. Arora et al.

Stobart CC, Nosek JM, Moore ML (2017) Rhinovirus biology, antigenic diversity, and advancements in the design of a human rhinovirus vaccine. Front Microbiol 8:2412 Streets AM, Huang Y (2014) Microfluidics for biological measurements with single-molecule resolution. Curr Opin Biotechnol 25:69–77 Strich JR, Chertow DS (2018) CRISPR-Cas biology and its application to infectious diseases. J Clin Microbiol 57(4):e01307 Stürmer M, Reinheimer C (2012) Description of two commercially available assays for genotyping of HIV-1. Intervirology 55(2):134–137 Svar Life Science (2016) Neutralization antibody assays. Svar Life Science, Malmö. https://www. svarlifescience.com/knowledge/technologies/cell-based-assays-ilite-technology/neutralizationantibody-assays Swenson PD et al (2016) Evaluation of a transcription mediated amplification assay for detection of herpes simplex virus types 1 and 2 MRNA in clinical specimens. J Clin Virol 80:62–67 Tabatabaei MS, Islam R, Ahmed M (2021) Applications of gold nanoparticles in ELISA, PCR, and immuno-PCR assays: a review. Anal Chim Acta 1143:250–266 Thermo Fisher Scientific (2020) Overview of ELISA | Thermo Fisher Scientific—IN. https://www. thermofisher.com/in/en/home/life-science/protein-biology/protein-biology-learning-center/pro tein-biology-resource-library/pierce-protein-methods/overview-elisa.html. Accessed 21 May 2021 Tombelli S, Minunni M, Luzi E, Mascini M (2005) Aptamer-based biosensors for the detection of HIV-1 Tat protein. In: Bioelectrochemistry. Elsevier, Amsterdam, pp 135–141 Torres-Chavolla E, Alocilja EC (2009) Aptasensors for detection of microbial and viral pathogens. Biosens Bioelectron 24(11):3175–3182 Towner JS et al (2008) Newly discovered Ebola virus associated with hemorrhagic fever outbreak in Uganda. PLoS Pathogens 4(11):e1000212. https://doi.org/10.1371/journal.ppat.1000212 Tozetto-Mendoza TR et al (2021) Nucleoprotein-based ELISA for detection of SARS-COV-2 IgG antibodies: could an old assay be suitable for serodiagnosis of the new coronavirus? J Virol Methods 290:114064 Trombetta VK, Chan YL, Bankowski MJ (2018) Are rapid influenza antigen tests still clinically useful in today’s molecular diagnostics world? Hawai’i J Med Public Health J Asia Pacific Med Public Health 77(9):226–230 UNAIDS (2020) Global HIV and AIDS statistics—2020 fact sheet. UNAIDS, Geneva. https:// www.unaids.org/en/resources/fact-sheet Vainionpää R, Leinikki P (2008) Diagnostic techniques: serological and molecular approaches. In: Encyclopedia of virology. Elsevier, Amsterdam, pp 29–37 Van Elslande J et al (2020) Diagnostic performance of seven rapid IgG/IgM antibody tests and the Euroimmun IgA/IgG ELISA in COVID-19 patients. Clin Microbiol Infect 26(8):1082–1087 Varga Z et al (2020) Electron microscopy of SARS-CoV-2: a challenging task—Authors’ reply. Lancet 395(10238):e100 Vemula SV et al (2016) Current approaches for diagnosis of influenza virus infections in humans. Viruses 8(4):96 Vermeulen M et al (2019) Reassessment of hepatitis B virus window periods for two transcriptionmediated amplification assays using screening data of South African blood donors. Transfusion 59(9):2922–2930 Vijayanand P, Wilkins E, Woodhead M (2004) Severe acute respiratory syndrome (SARS): a review. Clin Med 4(2):152–160 Vincent M, Yan X, Kong H (2004) Helicase-dependent isothermal DNA amplification. EMBO Rep 5(8):795–800 Viral Pneumonia Workup 2016. What is the role of viral culture in the workup of viral pneumonia? https://www.medscape.com/answers/300455-107864/what-is-the-role-of-viral-culture-in-theworkup-of-viral-pneumonia. Accessed 16 May 2021 Walker UA (2008) Imaging tools for the clinical assessment of idiopathic inflammatory myositis. Curr Opin Rheumatol 20(6):656–661

25

Evolution of Viral Diagnostics: A Peek into Time

617

Wang S, Sakhatskyy P, Hui T, Chou W, Lu S (2005) Assays for the assessment of neutralizing antibody activities against severe acute respiratory syndrome (SARS) associated coronavirus (SCV). J Immunol Methods 301(1–2):21–30 Wang R et al (2018) Rapid detection of multiple respiratory viruses based on microfluidic isothermal amplification and a real-time colorimetric method. Lab Chip 18(22):3507–3515 Wang X et al (2020) Clustered regularly interspaced short palindromic repeats/Cas9-mediated lateral flow nucleic acid assay. ACS Nano 14(2):2497–2508 Waritani T, Chang J, McKinney B, Terato K (2017) An ELISA protocol to improve the accuracy and reliability of serological antibody assays. MethodsX 4:153–165 WebMD (2021) CT scan (CAT scan): purpose, procedure, risks, side-effects, results. https://www. webmd.com/cancer/what-is-a-ct-scan. Accessed 16 May 2021 Westra ER, Buckling A, Fineran PC (2014) CRISPR-Cas systems: beyond adaptive immunity. Nat Rev Microbiol 12(5):317–326 Whitehouse CA, Bavari S, Perkins MD (2015) United States FDAs emergency use authorization of Ebola virus diagnostics: current impact and lessons for the future. Expert Rev Mol Diagn 15(10):1231–1235 World Health Organization (2020a) Hepatitis B. World Health Organization, Geneva. https://www. who.int/news-room/fact-sheets/detail/hepatitis-b World Health Organization (2020b) Hepatitis C. World Health Organization, Geneva. https://www. who.int/news-room/fact-sheets/detail/hepatitis-c World Health Organization (2021a) Genomic sequencing of SARS-CoV-2: a guide to implementation for maximum impact on public health. World Health Organization, Geneva. https://www. who.int/publications/i/item/9789240018440 World Health Organization (2021b) WHO | Respiratory Syncytial Virus (RSV). World Health Organization, Geneva. http://www.who.int/influenza/rsv/en/ Wu D et al (2017) Application of transcription mediated amplification and real-time reverse transcription polymerase chain reaction in detection of human immunodeficiency virus RNA. J Cent South Univ 42(7):776–782 Xiang X et al (2020) CRISPR-Cas systems based molecular diagnostic tool for infectious diseases and emerging 2019 novel coronavirus (COVID-19) pneumonia. J Drug Target 28(7–8): 727–731 Yan C et al (2020) Rapid and visual detection of 2019 novel coronavirus (SARS-CoV-2) by a reverse transcription loop-mediated isothermal amplification assay. Clin Microbiol Infect 26(6): 773–779. https://doi.org/10.1016/j.cmi.2020.04.001 Yang W et al (2020) Rapid detection of SARS-CoV-2 using reverse transcription RT-LAMP method. medRxiv 2020:20030130. https://doi.org/10.1101/2020.03.02.20030130 Younes N et al (2020) Challenges in laboratory diagnosis of the novel coronavirus SARS-CoV-2. Viruses 12(6):582 Yu L et al (2020) Rapid colorimetric detection of COVID-19 coronavirus using a reverse transcriptional loop-mediated isothermal amplification (RT-LAMP) diagnostic platform: ILACO. medRxiv 2020:20025874. https://doi.org/10.1101/2020.02.20.20025874 Zhang F, Abudayyeh OO, Gootenberg JS (2020a) A protocol for detection of COVID-19 using CRISPR diagnostics Zhang N et al (2020b) Recent advances in the detection of respiratory virus infection in humans. J Med Virol 92(4):408–417 Zhang Y et al (2020c) Rapid molecular detection of SARS-CoV-2 (COVID-19) virus RNA using colorimetric LAMP. medRxiv 2020:20028373. https://doi.org/10.1101/2020.02.26.20028373

618

G. Arora et al.

Zhan L, Li CM, Wu WB, Huang CZ (2014) A colorimetric immunoassay for respiratory syncytial virus detection based on gold nanoparticles-graphene oxide hybrids with mercury-enhanced peroxidase-like activity. Chem Commu (Cambridge, England) 50(78):11526–11528. https:// pubmed.ncbi.nlm.nih.gov/25131342/ (May 28, 2023) Zhou W et al (2018) A CRISPR-Cas9-triggered strand displacement amplification method for ultrasensitive DNA detection. Nat Commun 9(1):1–11 Zhu H et al (2020) PCR past, present and future. BioTechniques 69(4):317–325 Zou X et al (2019) Application of aptamers in virus detection and antiviral therapy. Front Microbiol 10:1462