CRISPR-Cas Methods: Volume 2 (Springer Protocols Handbooks) 1071616560, 9781071616567

Citation preview

M. Tofazzal Islam Kutubuddin Ali Molla Editors

CRISPR-Cas Methods Volume 2

SPRINGER PROTOCOLS HANDBOOKS

For further volumes: http://www.springer.com/series/8623

Springer Protocols Handbooks collects a diverse range of step-by-step laboratory methods and protocols from across the life and biomedical sciences. Each protocol is provided in the Springer Protocol format: readily-reproducible in a step-by-step fashion. Each protocol opens with an introductory overview, a list of the materials and reagents needed to complete the experiment, and is followed by a detailed procedure supported by a helpful notes section offering tips and tricks of the trade as well as troubleshooting advice. With a focus on large comprehensive protocol collections and an international authorship, Springer Protocols Handbooks are a valuable addition to the laboratory.

CRISPR-Cas Methods Volume 2

Edited by

M. Tofazzal Islam Institute of Biotechnology and Genetic Engineering (IBGE), Bangabandhu Sheikh Mujibur Rahman Agricultural University, Gazipur, Bangladesh

Kutubuddin Ali Molla ICAR-National Rice Research Institute, Cuttack, Odisha, India

Editors M. Tofazzal Islam Institute of Biotechnology and Genetic Engineering (IBGE) Bangabandhu Sheikh Mujibur Rahman Agricultural University Gazipur, Bangladesh

Kutubuddin Ali Molla ICAR-National Rice Research Institute Cuttack, Odisha, India

ISSN 1949-2448 ISSN 1949-2456 (electronic) Springer Protocols Handbooks ISBN 978-1-0716-1656-7 ISBN 978-1-0716-1657-4 (eBook) https://doi.org/10.1007/978-1-0716-1657-4 © The Editor(s) (if applicable) and The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2021, Corrected Publication 2022 Chapter 16 is licensed under the terms of the Creative Commons Attribution 4.0 International License (http:// creativecommons.org/licenses/by/4.0/). For further details see license information in the chapter. This work is subject to copyright. All rights are solely and exclusively licensed by the Publisher, whether the whole or part of the material is concerned, specifically the rights of translation, reprinting, reuse of illustrations, recitation, broadcasting, reproduction on microfilms or in any other physical way, and transmission or information storage and retrieval, electronic adaptation, computer software, or by similar or dissimilar methodology now known or hereafter developed. The use of general descriptive names, registered names, trademarks, service marks, etc. in this publication does not imply, even in the absence of a specific statement, that such names are exempt from the relevant protective laws and regulations and therefore free for general use. The publisher, the authors, and the editors are safe to assume that the advice and information in this book are believed to be true and accurate at the date of publication. Neither the publisher nor the authors or the editors give a warranty, expressed or implied, with respect to the material contained herein or for any errors or omissions that may have been made. The publisher remains neutral with regard to jurisdictional claims in published maps and institutional affiliations. This Humana imprint is published by the registered company Springer Science+Business Media, LLC, part of Springer Nature. The registered company address is: 1 New York Plaza, New York, NY 10004, U.S.A.

Foreword It is always a privilege to be able to witness a scientific revolution and it is even more exciting to be involved from the very beginning. It is now thirty years ago that I have started to work with site-specific nucleases to induce genetic change. Back in 1993, we published the first paper describing that, through DSB induction, homologous recombination can be induced in the cells of a multicellular eukaryote. In the early 1990s, only three groups were working on such questions, ours was working on plants and two other groups were working on human cells, and I remember a meeting where the three of us, being postdocs and young group leaders, met in Avignon during a conference for the first time. At the time, this was the whole community. It felt a bit like a single person standing on a unique mountain, with nobody else in sight. This situation slowly changed with the rise of ZFNs and the TALENs. However, following the introduction of CRISPR-Cas as an easily programmable and efficient endonuclease in 2012, I felt like suddenly waking up in the middle of a Tsunami. Not only were we now able to induce multiple breaks at the same time by using multiple sgRNAs, but we were also able to use CRISPR-Cas for many other purposes which are not linked to DSB induction. Never before, the face of biology has been changing faster than now. It was a well-deserved and overdue decision when in 2020 the discovery of Cas9 as a programmable nuclease was acknowledged with the Nobel Prize. From the beginning, an increasing power has been originating from the ever-growing community of CRISPR-Cas users. Everybody can contribute to its success by developing new tools or new applications which again will inspire others to drive further developments. It is a bit like a perpetuum mobile and in the end, you might end up with something you could not even have imagined in your wildest dreams. For me, as a plant scientist, it has been eye-opening to realize that, by using CRISPR-Cas, we are now not only able to change shape, size, quality, and number of tomato fruits but we are also able to create a new kind of crop, e.g., from a wild rice species. When I first started to induce breaks, I was hoping to, one day, solve one of the main hurdles in the field of plant breeding: the need to break genetic linkages for trait control. It was more than rewarding when we were finally able to lay the groundwork for overcoming this bottleneck by establishing plant chromosome restructuring last year. It is very important to lay the foundations to make the CRISPR-Cas technology accessible to as many scientists as possible. I was very happy to contribute to the first volume of CRISPR-Cas Methods, edited by Prof Tofazzal Islam, Dr. Pankaj Bhowmik, and Dr. Kutubuddin Molla. Due to the tremendous success of this volume and rapid progress in this field, the editors have decided to publish a second volume. They were able to line up prominent actors in the field, covering the latest developments from bacteria and plants to animals and human cells. I am convinced that this volume will be at least as successful as the first one and will be of great help to newcomers as well as to experienced scientists. The rise of CRISPR-Cas has given us the chance to make the world better, to fight diseases, drastically reduce the use of pesticides in agriculture, and to develop new crop plants that fare better in times of global warming. To make this happen, we not only need visions but also efficient protocols, which are laid down in this book. Karlsruhe Institute of Technology, Karlsruhe, Germany

v

Holger Puchta

Preface For the development of a method for genome editing, the Royal Swedish Academy of Sciences has decided to award the Nobel Prize in Chemistry 2020 to Emmanuelle Charpentier and Jennifer A. Doudna. They discovered one of gene technology’s sharpest tools: the CRISPR-Cas9 genetic scissor. Applying these, researchers can change the DNA of animals, plants, and microorganisms with extremely high precision. CRISPR-Cas genetic scissors have emerged as a tool for rewriting the code of life. The Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)-CRISPRassociated (Cas)-mediated genome editing is a transformative new technology, which revolutionized basic and applied biology. Compared to other genome editing tools such as zincfinger nucleases (ZFNs) and transcriptional activator-like effector nucleases (TALENs), the CRISPR-Cas technology is faster, cheaper, and user-friendly. The implementation of ZFN and TALEN site-directed nucleases for genome editing has proven to be cumbersome as they require sophisticated protein design, synthesis, and validation. After the recognition by Nobel Prize in Chemistry 2020, the application of the CRISPR-Cas toolkit is expected to be expanded more dramatically in many areas of bioediting including plant, microbial, and animal sciences and also in basic research. Over the last 8 years of tremendous improvement in the methodologies, the CRISPRCas toolbox is now beneficial for crop improvement, curing genetic diseases, and engineering desirable genetic traits. Live-cell imaging, high-throughput functional genomic screens, domestication of wild crops, creating biodiversity, and point-of-care diagnostic are also being done with the versatile CRISPR-Cas toolbox. The diversity, modularity, and efficacy of CRISPR-Cas systems are driving a biotechnological revolution. One of the unique features of the CRISPR-Cas system is its ability to create DNA double-strand breaks (DSBs) at the target loci. This feature can be used to introduce a variety of modifications in the genome of any target organism including crop plants. Immediately after the DSB generation, two main DNA repair pathways naturally become functional—(a) nonhomologous end joining (NHEJ) and (b) homology-directed repair (HDR). As there is no requirement of the homologous repair template or donor DNA, the NHEJ has become a popular way to disrupt the function of gene(s) by creating small insertions or deletions (indels) at specific points in the target sequence. Furthermore, multiplex editing can also be used to create multigene knockouts, chromosomal deletions and translocations, and gene knock-in. The base editing, prime editing, and many other advancements in the CRISPR-Cas technology are shaping it as a user-friendly toolkit for bioediting. The HDR-mediated precise editing is still challenging for the plant and other higher eukaryotes. An efficient and convenient plant transformation protocol is a prerequisite for the success in CRISPR-Cas-mediated genome editing of a target organism. One of the important areas of the application of CRISPR technology in agriculture is to accelerate plant breeding for ensuring food and nutritional security of the increasing world population. The latest development of CRISPR-mediated base editors enables us to precisely edit crop genome even at a single base resolution to correct trait governing single nucleotide polymorphism (SNP). Using this fast evolving system, we can introduce new plant traits more quickly and precisely. The protocol of CRISPR-Cas genome editing is

vii

viii

Preface

becoming more user-friendly, faster, and cheaper day by day. Recently, DNA-free genome editing with direct delivery of pre-assembled CRISPR-Cas9 ribonucleoprotein complex was successfully used to achieve targeted mutagenesis. Genome-editing using DNA-free systems could circumvent restrictive GMO regulations, thus paving the way for widespread use of this innovative technology in crop improvement. Success stories of the development of CRISPR-Cas genome-edited crops and their free pass to release in the practical field in the USA, Canada, Japan, and some other countries have opened a new window of making a new green and industrial revolution. Methodical advances in CRISPR-Cas editing need to be compiled for the massive use of this novel tool to enhance the speed of plant breeding. Although there are many recent reports of successful CRISPR-Cas-mediated gene editing, the experimental tools required to implement this powerful technology are yet to be embraced by most of the biological science laboratories as routine protocols. Several factors that affect the success and efficiency of CRISPR-mediated gene editing include efficient gRNA designing and assembling multiple gRNA cassettes, selection of suitable base editors, efficient delivery of Cas9 and gRNA vectors, selection and regeneration of edited organisms, efficient detection of the gene editing event, and so on. The efficiency of gene editing will depend on whether or not these conditions are optimal. To address these issues, the first volume of the series book CRISPR-Cas Methods provides the fundamentals of the CRISPR-Cas system and the advances in protocols of CRISPR-Cas genome editing for the improvement of various traits in crop plants and other organisms in 16 chapters. The rapid significant progress in methodologies and interests of the users of volume 1 prompted us to compile volume 2. Volume 2 details various advancements in CRISPR-Cas technical protocols for various cells ranging from bacteria, plants, humans, induced pluripotent stem cells, and nematodes. Besides, this series also included protocols for prime editing, base editing, multiplex editing, editing in cell-free extract, in silico analysis of gRNA secondary structure, and CRISPRdiagnosis. Step-by-step protocols with adequate illustrations in 24 chapters is an extension of volume 1, which serves as a laboratory manual providing readers a holistic view of CRISPR-Cas methodologies and their practical application for the editing of crop plants, cell lines, nematodes, and microorganisms. It is recognized that realistic, cost-effective, and robust CRISPR-Cas teaching tools are largely lacking for high school, community college, and four-year college courses. In Chapter 1, Pisarcik and coworkers present a CRISPR-based gene editing method using a cell-free system and provided a short and full-semester curriculum that incorporates additional methods in molecular biology to complement the CRISPR-Cas gene editing activity. The specificity and efficacy of the CRISPR-Cas-mediated genome editing are primarily determined by a short sequence known as guide RNA (gRNA). Recent studies have demonstrated that the secondary structure of gRNAs plays a key role in target recognition in CRISPR-Cas-mediated genome editing. In Chapter 2, Hassan et al. describe with illustrations a protocol to determine the gRNA secondary structure and explain how to interpret the results. Although there are several webtools available to design guide RNAs, many times the cleavage efficiency differs abruptly from the efficiency predicted online. Chapter 3 by Karmakar et al. presents an in vitro screening method for effective guide RNAs. This method would allow researchers to determine the most effective guide RNA before going for in vivo experiments. Cas12a (formerly Cpf1) is a Class 2 Type V-A CRISPR system that has been widely used in genome editing to target AT-rich regions. In Chapter 4, Zhang and Qi describe a highly efficient CRISPR-Cas12a expression system and a user-

Preface

ix

friendly toolbox for vector assembly. The use of this multiplexing toolbox will be expanding the application of CRISPR-Cas12a in basic and translational research in plants. DNA methylation is an important epigenetic mark involved in the regulation of gene expression, transposon silencing, and genome integrity. In Chapter 5, Ghoshal and Gardiner elaborately describe a protocol for manipulating DNA methylation status and also to analyze DNA methylation data to validate the effectiveness and specificity of the construct. The protocol developed by them will be useful to researchers interested in targeted maneuvering of DNA methylation in plants for both basic research and crop engineering. One of the key advantages of CRISPR-Cas systems for biotechnology is that their nucleases can use multiple guide RNAs in the same cell. Cooper and Hasty in Chapter 6 describe a simple method to accurately assemble natural, multiplex CRISPR arrays that can be completed in 1–2 days. This should be of great use both in prokaryotes with their native CRISPR systems and in eukaryotes when paired with Cas12a or other CRISPR nucleases that also process their own arrays. Prime editing is a CRISPR-Cas9-derived precise genome editing strategy, which was recently developed to introduce targeted indels and all 12 classes of point mutations without double-strand breaks or donor DNA. In Chapter 7, Sretenovic and coworkers described a fast and efficient method for the construction of prime editing vectors based on Gateway assembly and efficiency assessment of prime editors through transient expression analyses in rice protoplasts. Transformation is one of the major bottlenecks for applying genome editing in leguminous crop plants. Gayen and Karmakar in Chapter 8 provided an overview of the rational designing of the constructs, transformation, screening, and analysis of the data for applying the technique in leguminous plants. Different web tools and resources available for assisting genome editing experiments in legumes were also highlighted. Chapter 9 by Chen et al. presents a step-by-step guide to the CRISPR-Cas9-mediated targeted mutagenesis or large fragment deletions in soybean. This chapter illustrates the detailed procedure of different essential steps including the design of sgRNAs, construction of CRISPR-Cas9 vectors, Agrobacterium-mediated soybean transformation, and identification of mutant lines. Base editing has emerged as a novel and efficient genome editing approach for improving agronomic traits of crop plants. Chen and coworkers in Chapter 10 described a detailed protocol of generating point mutations in soybean using base editors. In Chapter 11, Butler and Jiang described their protocol of efficient genome editing in potato using a hairy root transformation system. Similarly, Satheesh et al. provided a detailed protocol for an efficient plant transformation with CRISPR-Cas binary vector and regeneration in tomato in Chapter 12 to generate stable lines along with variant analysis of putative mutant lines followed by phenotypic analysis for the trait of interest. Rice is core to the nutrition and livelihood of more than half of the world population and plays a significant role in world food security. Two chapters described the protocols of CRISPR-Cas genome editing in rice. In Chapter 13, Barman describes the methods of CRISPR-Cas9 vector construction with single and multiple gene targets in rice. His protocol covered all important steps of target sequence selection, single/multiple targets vector construction, mutation detection, and selection of T-DNA-free mutant lines. The application of heterosis in rice production greatly improves rice yield, but hybrid vigor is hard to preserve in the offspring due to genetic segregation. Liu et al. in Chapter 14 describe a pioneering application of multiplex CRISPRCas9 technology for generating clonal seeds from hybrid rice.

x

Preface

A DNA test is widely used in pathogen diagnosis and genetically modified organism (GMO) administration. To date, a low-cost, user-friendly, and field-deployable DNA test method with high accuracy and sensitivity is limited. Zhang et al. in Chapter 15 described an all-paper-based DNA test method using CRISPR-Cas12a for rapid diagnosis of phytopathogens and GMO. That method combined filter-paper-based DNA purification, recombinase polymerase amplification, target gene detection with Cas12a, and lateral flow assay. Human induced pluripotent stem cells (iPSCs) have become broadly accessible for research in the last few years. In Chapter 16, In ’t Groen et al. provide protocols for CRISPR-Cas9-mediated gene editing in human iPSCs for the generation of gene knockouts, large deletions, and the introduction of a donor template in a safe harbor genomic locus. Hirosawa and Saito in Chapter 17 describe the design principle of the microRNAresponsive Cas9 and AcrllA4 (anti-CRISPR protein for spCas9) switch and the procedures for performing cell-type-specific genome editing. Next, Ameen et al. in Chapter 18 describe the use of lentiviral vectors (LentiCRISPRv2/lentiGuide-Puro) for CRISPR-Cas9 genome editing and provide strategies for minimizing the off-targets in mammalian cells. These guidelines will help researchers with limited CRISPR-Cas experience to perform gene editing successfully. In Chapter 19, Lin et al. describe a protocol that utilizes T4 RNA ligase 1 (single-stranded RNA ligase) to link two base-paired RNA molecules to investigate potential interactions between small regulatory RNA (sRNA) and CRISPR-Cas system. This protocol provides users a detailed method of identifying candidate sRNAs that may regulate CRISPR-Cas adaptation and/or other functions through unbiased screening and validation. The increasing emergence of antibiotic-resistant bacteria makes it more difficult for us to fight against infectious diseases and develop new antibiotics. Jiang et al. in Chapter 20 describe a method to adopt a phage-based delivery system for endogenous type III-A CRISPR-Cas antimicrobials against Mycobacterium tuberculosis and also provide an updated protocol for the construction of recombinant mycobacteriophage plasmids. In Chapter 21, Chen et al. portray a method of genome editing in lytic Escherichia coli T4 phage. This protocol could be adapted for any other phage modifications by active heterologous CRISPR-Cas9 in their host. Clostridium thermocellum is an anaerobic thermophile that can efficiently degrade lignocellulosic biomass and directly convert it into value-added products such as ethanol. In Chapter 22, Stettner and Eckert detail their efficient 2-step CRISPR-Cas genome editing protocol for C. thermocellum, using both the native Type I-B CRISPR-Cas system and an exogenous Type-II CRISPR system from Geobacillus stearothermophilus. Two detailed protocols for carrying out genome editing in model organism Caenorhabditis elegans are described in Chapters 23 and 24. In Chapter 23, Tellez-Arreola provides a protocol to knock-out genes in C. elegans by employing multiple sgRNAs combined with the homologous recombination-mediated repair. On the other hand, Kim and Zhang in Chapter 24 focused on a procedure on how to prepare repair templates for error-free precise genome editing via homologous recombination in C. elegans. Volume 2 represents a concerted effort from the editors and all contributors representing many different countries. The editors gratefully acknowledge the authors who contributed to this book on CRISPR-Cas Methods. The editorial assistance of Jeffrey Newton from Springer deserves credit for excellent coordination, inviting authors, and collecting the

Preface

xi

chapters. We appreciate Dr. Mahmuda Umme Rayhan of IBGE of BSMRAU for assistance in checking the glossary and index of this book. Our thanks are also due to other editorial staff for their precious bits of help in formatting and incorporating editorial changes in the manuscripts. We believe researchers who work or will work on CRISPR-Cas gene editing will find this volume as an essential guidebook for implementing their research projects. Gazipur, Bangladesh Cuttack, Odisha, India

M. Tofazzal Islam Kutubuddin A. Molla

Contents Foreword. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Preface . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Contributors. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

1 A Complete Methodology for the Instruction of CRISPR-Based Gene Editing Using a Simplified Cell-Free Extract System with Genetic Readout in Bacteria . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Kristen M. Pisarcik, Brett M. Sansbury, and Eric B. Kmiec 2 In Silico Analysis of gRNA Secondary Structure to Predict Its Efficacy for Plant Genome Editing. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Md Mahmudul Hassan, Abul Kashem Chowdhury, and Tofazzal Islam 3 In Vitro Cas9 Cleavage Assay to Check Guide RNA Efficiency . . . . . . . . . . . . . . . Subhasis Karmakar, Deeptirekha Behera, Mirza Jaynul Baig, and Kutubuddin A. Molla 4 Efficient Multiplexed CRISPR-Cas12a Genome Editing in Plants. . . . . . . . . . . . . Yingxiao Zhang and Yiping Qi 5 CRISPR-dCas9-Based Targeted Manipulation of DNA Methylation in Plants . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Basudev Ghoshal and Jason Gardiner 6 Rapid Assembly of Multiplex Natural CRISPR Arrays . . . . . . . . . . . . . . . . . . . . . . . Robert M. Cooper and Jeff Hasty 7 Assembly and Assessment of Prime Editing Systems for Precise Genome Editing in Plants. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Simon Sretenovic, Changtian Pan, and Yiping Qi 8 Designing, Performing, and Analyzing CRISPR-Cas9-Mediated Genome Editing Experiments in Leguminous Plants . . . . . . . . . . . . . . . . . . . . . . . . Dipak Gayen and Subhasis Karmakar 9 Generation of Knockout and Fragment Deletion Mutants in Soybean by CRISPR-Cas9 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Li Chen, Yupeng Cai, and Wensheng Hou 10 Targeted Base Editing in Soybean Using a CRISPR-Cas9 Cytidine Deaminase Fusion . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Li Chen, Yupeng Cai, and Wensheng Hou 11 Efficient Genome Editing in Potato Using a Hairy Root Transformation System . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Nathaniel M. Butler and Jiming Jiang 12 Efficient CRISPR-Cas9-Mediated Genome Editing in Tomato . . . . . . . . . . . . . . . Viswanathan Satheesh, Jinkai Li, and Mingguang Lei 13 CRISPR-Cas9-Mediated Genome Editing in Rice: A Systematic Protocol for Single- and Multi-Target Vector Construction . . . . . . . . . . . . . . . . . . Hirendra Nath Barman

xiii

v vii xv

1

15 23

41

57 73

83

103

123

137

149 159

179

xiv

Contents

14

Generating Clonal Seeds from Hybrid Rice with CRISPR-Cas9 . . . . . . . . . . . . . . Chaolei Liu, Chun Wang, and Kejian Wang 15 CRISPR-Cas12a-Based DNA Detection for Fast Pathogen Diagnosis and GMO Test in Plants . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Yun-Mu Zhang, Yinong Yang, and Kabin Xie 16 CRISPR-Cas9-Mediated Gene Editing in Human Induced Pluripotent Stem Cells . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Stijn L. M. in ’t Groen, Mike Broeders, and W. W. M. Pim Pijnappel 17 Cell-Type-Specific CRISPR-Cas9 System with miRNAs . . . . . . . . . . . . . . . . . . . . . Moe Hirosawa and Hirohide Saito 18 CRISPR/Cas9 Gene Editing in Mammalian Cells Using LentiCRISPRv2/LentiGuide-Puro Vectors . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Zubaida Sa’id Ameen, Ece Cakiroglu, Serif Senturk, Abdullahi Umar Ibrahhim, and Mehmet Ozsoz 19 An Approach to Proximity Ligation by T4 RNA Ligase to Screen sRNA That Regulate CRISPR-Cas Systems . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Ping Lin, Qinqin Pu, and Min Wu 20 Genetic Engineering of a Phage-Based Delivery System for Endogenous III-A CRISPR-Cas System Against Mycobacterium tuberculosis . . . . . . . . . . . . . . . Zheng Jiang, Junwei Wei, Nan Peng, and Yingjun Li 21 CRISPR-Cas9-Mediated Genome Editing in Escherichia coli Bacteriophages . . . Yibao Chen, Xiangmin Li, Shuang Wang, Ping Qian, and Yingjun Li 22 CRISPR-Cas Genome Editing in the Cellulolytic Bacterium Clostridium thermocellum . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Sean Stettner and Carrie Eckert 23 Gene Targeting in Caenorhabditis elegans Using a Combination of Multiple sgRNAs and a Homologous Recombination-Mediated Repair. . . . . . . . . . . . . . . . Jose´ Luis Te´llez-Arreola 24 Design of Repair Templates for CRISPR-Cas9-Triggered Homologous Recombination in Caenorhabditis elegans . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Hyun-Min Kim and Xiaojuan Zhang Correction to: CRISPR-Cas9-Mediated Genome Editing in Rice: A Systematic Protocol for Single- and Multi-Target Vector Construction. . . . . . . . . . . . . . . . . . . . . . .

207

221

235 265

281

301

311 325

335

345

357

C1

Correction to: CRISPR-Cas9-Mediated Gene Editing in Human Induced Pluripotent Stem Cells . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

C3

Glossary . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Index . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

371 395

Contributors MIRZA JAYNUL BAIG • ICAR-National Rice Research Institute, Cuttack, India HIRENDRA NATH BARMAN • Plant Physiology Division, Bangladesh Rice Research Institute, Gazipur, Bangladesh DEEPTIREKHA BEHERA • ICAR-National Rice Research Institute, Cuttack, India MIKE BROEDERS • Department of Pediatrics, Erasmus MC University Medical Center, Rotterdam, The Netherlands; Department of Clinical Genetics, Erasmus MC University Medical Center, Rotterdam, The Netherlands; Center for Lysosomal and Metabolic Diseases, Erasmus MC University Medical Center, Rotterdam, The Netherlands NATHANIEL M. BUTLER • Vegetable Crops Research Unit, United States Department of Agriculture-Agricultural Research Service, Madison, WI, USA; Department of Horticulture, University of Wisconsin, Madison, WI, USA YUPENG CAI • National Center for Transgenic Research in Plants, Institute of Crop Sciences, Chinese Academy of Agricultural Sciences, Beijing, China ECE CAKIROGLU • Izmir International Biomedicine and Genome Institute, Dokuz Eylul University, Izmir, Turkey; Functional Cancer Genomics Group, Izmir Biomedicine and Genome Center, Dokuz Eylul University Health Campus, Izmir, Turkey LI CHEN • National Center for Transgenic Research in Plants, Institute of Crop Sciences, Chinese Academy of Agricultural Sciences, Beijing, China YIBAO CHEN • State Key Laboratory of Agricultural Microbiology and College of Veterinary Medicine, Huazhong Agricultural University, Wuhan, China ABUL KASHEM CHOWDHURY • Department of Genetics and Plant Breeding, Patuakhali Science and Technology University, Patuakhali, Bangladesh ROBERT M. COOPER • BioCircuits Institute, University of California, San Diego, La Jolla, CA, USA CARRIE ECKERT • Renewable and Sustainable Energy Institute, University of Colorado Boulder, Boulder, CO, USA; National Renewable Energy Lab, Golden, CO, USA JASON GARDINER • Department of Molecular, Cell and Developmental Biology, University of California, Los Angeles, Los Angeles, CA, USA DIPAK GAYEN • Department of Biochemistry, Central University of Rajasthan, Ajmer, Rajasthan, India BASUDEV GHOSHAL • Department of Molecular, Cell and Developmental Biology, University of California, Los Angeles, Los Angeles, CA, USA MD MAHMUDUL HASSAN • Department of Genetics and Plant Breeding, Patuakhali Science and Technology University, Patuakhali, Bangladesh JEFF HASTY • BioCircuits Institute, University of California, San Diego, La Jolla, CA, USA; Molecular Biology Section, Division of Biological Sciences, University of California, San Diego, La Jolla, CA, USA; Department of Bioengineering, University of California, San Diego, La Jolla, CA, USA MOE HIROSAWA • Department of Life Science Frontiers, Center for iPS Cell Research and Application (CiRA), Kyoto University, Kyoto, Japan WENSHENG HOU • National Center for Transgenic Research in Plants, Institute of Crop Sciences, Chinese Academy of Agricultural Sciences, Beijing, China

xv

xvi

Contributors

ABDULLAHI UMAR IBRAHHIM • Biomedical Engineering Department, Near East University, Nicosia, TRNC, Cyprus STIJN L. M. IN ’T GROEN • Department of Pediatrics, Erasmus MC University Medical Center, Rotterdam, The Netherlands; Department of Clinical Genetics, Erasmus MC University Medical Center, Rotterdam, The Netherlands; Center for Lysosomal and Metabolic Diseases, Erasmus MC University Medical Center, Rotterdam, The Netherlands TOFAZZAL ISLAM • Institute of Biotechnology and Genetic Engineering (IBGE), Bangabandhu Sheikh Mujibur Rahman Agricultural University, Gazipur, Bangladesh JIMING JIANG • Department of Plant Biology, Department of Horticulture, Michigan State University, East Lansing, MI, USA ZHENG JIANG • State Key Laboratory of Agricultural Microbiology and College of Life Science and Technology, Huazhong Agricultural University, Wuhan, China SUBHASIS KARMAKAR • ICAR-National Rice Research Institute, Cuttack, India; Crop Physiology and Biochemistry Division, Central Rice Research Institute, Cuttack, Odisha, India HYUN-MIN KIM • School of Pharmaceutical Science and Technology, Tianjin University, Tianjin, China ERIC B. KMIEC • Gene Editing Institute, Helen F. Graham Cancer Center & Research Institute, ChristianaCare Health System, Newark, DE, USA; Department of Medical and Molecular Sciences, University of Delaware, Newark, DE, USA MINGGUANG LEI • Shanghai Center for Plant Stress Biology, CAS Center for Excellence in Molecular Plant Sciences, Chinese Academy of Sciences, Shanghai, China JINKAI LI • Shanghai Center for Plant Stress Biology, CAS Center for Excellence in Molecular Plant Sciences, Chinese Academy of Sciences, Shanghai, China XIANGMIN LI • State Key Laboratory of Agricultural Microbiology and College of Veterinary Medicine, Huazhong Agricultural University, Wuhan, China YINGJUN LI • State Key Laboratory of Agricultural Microbiology and College of Life Science and Technology, Huazhong Agricultural University, Wuhan, China PING LIN • Department of Biomedical Sciences, School of Medicine and Health Sciences, University of North Dakota, Grand Forks, ND, USA; Wound Trauma Medical Center, State Key Laboratory of Trauma, Burns and Combined Injury, Daping Hospital, Army Medical University, Chongqing, China; Biological Science Research Center, Southwest University, Chongqing, China CHAOLEI LIU • State Key Laboratory of Rice Biology, China National Rice Research Institute, Chinese Academy of Agricultural Sciences, Hangzhou, China KUTUBUDDIN A. MOLLA • ICAR-National Rice Research Institute, Cuttack, India MEHMET OZSOZ • Biomedical Engineering Department, Near East University, Nicosia, TRNC, Cyprus CHANGTIAN PAN • Department of Plant Science and Landscape Architecture, University of Maryland, College Park, MD, USA NAN PENG • State Key Laboratory of Agricultural Microbiology and College of Life Science and Technology, Huazhong Agricultural University, Wuhan, China W. W. M. PIM PIJNAPPEL • Department of Pediatrics, Erasmus MC University Medical Center, Rotterdam, The Netherlands; Department of Clinical Genetics, Erasmus MC University Medical Center, Rotterdam, The Netherlands; Center for Lysosomal and Metabolic Diseases, Erasmus MC University Medical Center, Rotterdam, The Netherlands KRISTEN M. PISARCIK • Gene Editing Institute, Helen F. Graham Cancer Center & Research Institute, ChristianaCare Health System, Newark, DE, USA; Department of Medical and Molecular Sciences, University of Delaware, Newark, DE, USA

Contributors

xvii

QINQIN PU • Department of Biomedical Sciences, School of Medicine and Health Sciences, University of North Dakota, Grand Forks, ND, USA YIPING QI • Department of Plant Science and Landscape Architecture, University of Maryland, College Park, MD, USA; Institute for Bioscience and Biotechnology Research, University of Maryland, Rockville, MD, USA PING QIAN • State Key Laboratory of Agricultural Microbiology and College of Veterinary Medicine, Huazhong Agricultural University, Wuhan, China ZUBAIDA SA’ID AMEEN • Biomedical Engineering Department, Near East University, Nicosia, TRNC, Cyprus HIROHIDE SAITO • Department of Life Science Frontiers, Center for iPS Cell Research and Application (CiRA), Kyoto University, Kyoto, Japan BRETT M. SANSBURY • Gene Editing Institute, Helen F. Graham Cancer Center & Research Institute, ChristianaCare Health System, Newark, DE, USA; Department of Medical and Molecular Sciences, University of Delaware, Newark, DE, USA VISWANATHAN SATHEESH • Shanghai Center for Plant Stress Biology, CAS Center for Excellence in Molecular Plant Sciences, Chinese Academy of Sciences, Shanghai, China SERIF SENTURK • Izmir International Biomedicine and Genome Institute, Dokuz Eylul University, Izmir, Turkey; Functional Cancer Genomics Group, Izmir Biomedicine and Genome Center, Dokuz Eylul University Health Campus, Izmir, Turkey SIMON SRETENOVIC • Department of Plant Science and Landscape Architecture, University of Maryland, College Park, MD, USA SEAN STETTNER • Renewable and Sustainable Energy Institute, University of Colorado Boulder, Boulder, CO, USA JOSE´ LUIS TE´LLEZ-ARREOLA • Departamento de Neurobiologı´a Celular y Molecular, Instituto de Neurobiologı´a, Universidad Nacional Autonoma de Me´xico, Juriquilla, Quere´taro, Mexico; Department of Biology, University of Utah, Salt Lake City, UT, USA CHUN WANG • State Key Laboratory of Rice Biology, China National Rice Research Institute, Chinese Academy of Agricultural Sciences, Hangzhou, China KEJIAN WANG • State Key Laboratory of Rice Biology, China National Rice Research Institute, Chinese Academy of Agricultural Sciences, Hangzhou, China SHUANG WANG • State Key Laboratory of Agricultural Microbiology and College of Veterinary Medicine, Huazhong Agricultural University, Wuhan, China JUNWEI WEI • State Key Laboratory of Agricultural Microbiology and College of Life Science and Technology, Huazhong Agricultural University, Wuhan, China MIN WU • Department of Biomedical Sciences, School of Medicine and Health Sciences, University of North Dakota, Grand Forks, ND, USA KABIN XIE • National Key Laboratory of Crop Genetic Improvement and Hubei Key Laboratory of Plant Pathology, Huazhong Agricultural University, Wuhan, China YINONG YANG • Department of Plant Pathology and Environmental Microbiology, The Pennsylvania State University, University Park, PA, USA XIAOJUAN ZHANG • School of Pharmaceutical Science and Technology, Tianjin University, Tianjin, China YINGXIAO ZHANG • Department of Plant Science and Landscape Architecture, University of Maryland, College Park, MD, USA YUN-MU ZHANG • National Key Laboratory of Crop Genetic Improvement and Hubei Key Laboratory of Plant Pathology, Huazhong Agricultural University, Wuhan, China

Chapter 1 A Complete Methodology for the Instruction of CRISPR-Based Gene Editing Using a Simplified Cell-Free Extract System with Genetic Readout in Bacteria Kristen M. Pisarcik, Brett M. Sansbury, and Eric B. Kmiec Abstract While we advanced the understanding of CRISPR-Cas gene editing, we recognized that realistic, costeffective, and robust teaching tools were largely lacking for high school, community college, and 4-year college courses. Through funding from a National Science Foundation Advanced Technological Education (NSF-ATE) grant, we have developed an innovative laboratory exercise and curriculum on gene editing. A modular laboratory exercise, based on in vitro gene editing, allows students to gain a full understanding of the CRISPR-Cas technology in a short- or long-course format, where auxiliary methods can complement the experience. This exercise gives students the opportunity for hands-on experience with the CRISPRdirected gene editing methodologies that genetic engineers utilize in dissecting the function of a human gene or advancing a therapeutic approach to an inherited disease. The in vitro system is novel in its ability to present the broad spectrum of gene editing reaction outcomes without the complexity or cost of in vivo cell work. A major variability in inconsistent results arises from the transfection of mammalian cells, often skewing the ratio of successful, precise, and error-prone gene editing events. Here, we present a CRISPRbased gene editing method using the cell-free system and provide a short- and full-semester curriculum that incorporates additional methods in molecular biology that complement the CRISPR-Cas gene editing activity. Keywords CRISPR, Educational curriculum, Gene editing, Gene editing laboratory, CRISPR laboratory exercise

1

Introduction For many decades, the possibility of purposely altering the DNA sequence in mammalian cells with great precision and efficiency has held a certain fascination for genetic engineers. While major advances over the past 20 years have provided the foundational framework for the process of gene editing [1–3], the evolution and development of Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) with their associated Cas nucleases

M. Tofazzal Islam and Kutubuddin Ali Molla (eds.), CRISPR-Cas Methods: Volume 2, Springer Protocols Handbooks, https://doi.org/10.1007/978-1-0716-1657-4_1, © The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2021

1

2

Kristen M. Pisarcik et al.

[4–6] have accelerated accurate genetic engineering significantly. The discovery of this genetic tool has, in some ways, democratized the capacity for genetic engineers to reconstruct mammalian genomes at an unprecedented precision and efficiency. CRISPRCas gene editing is having a major impact on many aspects of biomedical research and therapeutic application. Remarkably, CRISPR-Cas systems are advancing in clinical trials for the treatment of Leber Congenital Amaurosis (LCA10) [7], Sickle Cell Disease [8], and even squamous cell carcinoma [9]. While the development of a genetic treatment for these debilitating diseases is the most visible accomplishment of this breakthrough technology, CRISPR-Cas systems have also impacted drug discovery, drug screening, and diagnostics, most apparently for the COVID-19 pandemic [10–13]. Clearly, addition of this genetic tool to the molecular biology armament will advance our capacity to develop more relevant and effective treatments for human disease. Our laboratory focuses on the elucidation of the mechanism of action of CRISPR-based gene editing in human cells while exploring the regulatory circuitry that controls the overall process [14–16]. Mechanistic studies will guide development of CRISPRCas therapeutics, and we have begun a detailed analysis of the diversity of genetic outcomes created in a population of human cells treated with CRISPR-Cas [17]. As part of our mechanistic analysis of CRISPR activity, we created a cell-free extract-based, in vitro gene editing system wherein we control many of the reaction parameters that surround gene editing activity [18–20]. The cell-free system utilizes a mammalian cell extract, a plasmid bearing the lacZ gene, and an appropriate CRISPR-Cas (Cas9 or Cas12a) complex to catalyze deletion of a specific sequence or insertion/ replacement with a new sequence when a single-stranded DNA donor template is provided. This gene editing reaction, performed in a cell-free system, provides a foundation for educational laboratory exercises which can be incorporated into short- and fullsemester curriculum to communicate the principles of gene editing and complementary microbiology techniques.

2

Materials Prepare all buffers using nuclease-free water, and for best results, prepare buffers on the day they are used.

2.1

In Vitro Reaction

2.1.1 Equipment

1. Thermocycler or heat block. 2. Adjustable incubator. 3. Tabletop centrifuge.

A Complete Methodology for the Instruction of CRISPR-Based Gene Editing. . . 2.1.2 Reagents and Buffers

3

1. Cas buffer: 20 mM HEPES, 150 mM potassium chloride. 2. RNA buffer: 100 mM potassium acetate, 30 mM HEPES, pH 7.5. 3. 10
hypotonic buffer: 200 mM Tris, 150 mM magnesium chloride, 4 mM DTT, and 10 mM ATP. 4. 10
NEBuffer 3.1. 5. T4 DNA ligase (recommended). 6. IPTG/X-gal solution. 7. Kanamycin or appropriate antibiotic. 8. S.O.C. medium. 9. DNA Clean and Concentrator-5 Kit (Zymo). 10. Mammalian cell-free extract as prepared by Sansbury et al. [18]. 11. Nuclease-free water. 12. Purified AsCas12a protein (IDT). 13. HDR-NS oligonucleotide (50 - GGTTTTCCCAGTCAC GACGTTGTAAAAGCGGCCGCCGACGGCCAGTGC CAAGCTTGCATGCCTGCAGGTC-30 , IDT). 14. 1364-crRNA (50 -CCCAGTCACGACGTTGTAAAA-30 , IDT). 15. lacZ plasmid pHSG299 (Takara Bio Company) or pUC19 plasmid harboring the lacZ gene. 16. Chemically competent E. coli cells.

2.2 Cleavage Reaction Gel and NotI RFLP Analysis

1. Thermocycler or heat block. 2. Gel electrophoresis equipment and imaging system.

2.2.1 Equipment 2.2.2 Reagents

1. Proteinase K. 2. NotI restriction enzyme. 3. Gel electrophoresis reagents and buffers.

3

Methods

3.1 In Vitro Editing of the lacZ Gene

1. Mix 1μL of 10μM Cas12a protein with 4μL Cas buffer to obtain 5μL solution with a total of 10 pmol.

3.1.1 Cas12a-crRNA Complex (RNP Formation)

2. Mix 1μL of 10μM 1364-crRNA with 4μL RNA buffer to obtain 5μL solution with a total of 10 pmol. 3. Combine 5μL of each 10 pmol Cas12a and 10 pmol crRNA in a single tube to generate 10μL of RNP complex; mix. 4. Incubate at room temperature for 15 min.

4

Kristen M. Pisarcik et al.

3.1.2 Cleavage Reaction of the lacZ Plasmid

1. To the tube containing 10μL RNP, add: 10
NEBuffer 3.1, 500 ng of plasmid, and bring to 20μL with nuclease-free water; mix. 2. Incubate reaction mixture at 37  C for 15 min.

3.1.3 Recover and Clean DNA Using a Clean and Concentrator Kit (See Table 1)

1. Elute DNA in 25μL nuclease-free water.

3.1.4 Recircularization Reaction

1. To a new tube, add: 20μL of recovered DNA, 1μL of 100μM HDR-NS oligonucleotide, 10
hypotonic buffer, 5μL cell-free extract, and bring to 30μL using nuclease-free water; mix (see Table 1). 2. Incubate at 37  C for 15 min.

3.1.5 Recover and Clean DNA Using a Clean and Concentrator Kit

1. Elute DNA in 25μL nuclease-free water (see Table 1).

3.1.6 Transformation of Edited DNA into Competent E. coli Cells

1. Transform 2.5μL recovered DNA into DH5α competent E. coli cells according to manufacturer’s protocol.

3.2 Cleavage Gel Reaction to Confirm Cutting of the lacZ Gene

1. Follow Subheading 3.1.1, steps 1 and 2 and Subheading 3.1.2, steps 1 and 2.

2. Plate the transformed cells onto medium selected with appropriate antibiotic and include X-gal/IPTG solution to allow for blue-white colony screening (see Table 1).

2. Add 2μL of Proteinase K; mix. 3. Incubate an additional 10 min at 37  C. 4. Visualize results on a 1% agarose gel. 5. Include undigested lacZ plasmid as a control.

3.3 RFLP Analysis Using NotI Restriction Enzyme

1. Prepare 20μL of 250–500 ng of each sample of DNA for digestion and bring to volume with nuclease-free water. 2. Set up digestion reaction according to the enzymes manufacturer’s instructions. 3. Visualize results on a 1% agarose gel (see Fig. 4). 4. Include an undigested plasmid sample as the control.

4

Results Figure 1 provides a general overview of the workflow of the in vitro gene editing system in a temporal fashion, step-by-step. In the first step, the CRISPR-Cas complex is assembled, pairing the specifically

A Complete Methodology for the Instruction of CRISPR-Based Gene Editing. . .

5

Table 1 Troubleshooting guidance for preforming an in vitro gene editing reaction Issue

Resolution

No white colonies present

1. Perform a cleavage reaction following steps 3.2 to determine if the RNP is cleaving the lacZ plasmid. 2. Use quick ligase to increase efficiency of successful recirculization and the number of white colonies. (a) Add 1μL of T4 DNA ligase to 5μL of CFE (b) Add 5μL of CFE + ligase to the reaction as described in Subheading 3.1.4, step 1 3. Reference your competent cell transformation protocol for specific troubleshooting and/or run the recommended transformation controls. 4. Perform an additional DNA purification step using the Zymo Select-A-Size DNA Clean & Concentrator Kit after the cleavage reaction and recircularization reaction (Subheadings 3.1.3 and 3.1.5.) (a) Recover DNA using Select-A-Size DNA Clean & Concentrator Kit following the manufacturers protocol (b) Elute sample in 40 μL nuclease-free H2O (c) Proceed to Subheadings 3.1.3 and 3.1.5

Only white colonies present

1. Ensure the ChromoMax IPTG/X-gal solution was added to the agar plates

Suggestions for improvement of the method and troubleshooting various scenarios when conducting the experiment, with the most common, corresponding resolution

designed CRISPR RNA (crRNA) with the appropriate Cas protein, Cas9, or Cas 12a, respectively. Site-specific gene editing activity takes place only upon successful complexation of these two important components which form a ribonucleoprotein (RNP). In the second step, a plasmid construct containing the lacZ gene is mixed with the RNP, designed to cleave the gene at a specific site, to initiate the gene editing reaction. This reaction is like a restriction enzyme digestion but is carried out by an RNP complex. The linearized plasmid is then purified and concentrated, and the cellfree extract, generated most often from HEK 293 cells, is added. In this particular cycle reaction, a single-stranded oligonucleotide is added to catalyze homology-directed repair (HDR). The oligonucleotide provides the DNA template that directs DNA insertion or replacement at the break site created by the RNP while the cell-free extract supplies recombination and repair enzymatic activities including resection, paring, repairing, and ligation. In the fourth step, the plasmid DNA is once again cleaned and concentrated and subsequently transformed into competent E. coli, the sixth step of the reaction. After plating on antibiotic-laden agarose, the bacterial cells are incubated for approximately 12 h. The visualization of white colonies on the transformed plates indicate successful gene editing activity, usually appearing against a backdrop of blue colonies. In the last step, the plasmid DNA can be isolated and

6

Kristen M. Pisarcik et al.

Step 1.1 Cas12a-crRNA RNP formation

Complex the Cas12a and CRISPR RNA to form a ribonucleoprotein (RNP)

Clean and concentrate the re-circularized plasmid DNA

Step 1.5 Recover DNA

Transform the DNA into competent E. coli cells for lacZ readout

Step 1.6 Transformation of edited DNA

Transform

Step 1.2 Cleavage Reaction

Cut the plasmid DNA using the RNP

=

DNA

E.coli

Step 1.3 Recover DNA

Clean and concentrate the linearized plasmid DNA

Step 1.4 Recircularization Reaction

Rejoin the plasmid with an HDR oligonucleotide and cell-free extract

Visualize blue and white colonies on the transformation plates

Reacon Readout Visual blue/white bacterial colonies and Sanger sequencing readouts

Isolate plasmid DNA and sequence

+ CFE

Fig. 1 Experimental workflow diagram. In vitro gene editing protocol and tools schematic. An RNP complex is assembled (Step 1.1) to cleave plasmid DNA within the lacZ gene (Step 1.2). The linearized plasmid is recovered (Step 1.3); single-stranded donor DNA and mammalian cell-free extract execute HDR via gene editing creating a new NotI restriction site (Step 1.4). The circularized plasmid is recovered (Step 1.5) and transformed into E. coli (Step 1.6) for the readout. Isolated DNA may be analyzed by sequencing

immediately prepared for restriction digestion (RFLP) or for direct DNA sequencing (Sanger sequencing). Figure 2 provides a schematic outlining of the fundamental and competing pathways active in this gene editing exercise. Here, a CRISPR-Cas12a RNP executes DNA cleavage at the target site. The single-stranded donor DNA, here termed HDR template (in green), is added with the cell-free extract. Enzymatic activities in the cell-free extract align the single-stranded HDR template in homologous register at the target sequence since the DNA template has been designed and synthesized with complementary arms that span the break site. The HDR reaction can lead to precise insertion of the HDR template followed by DNA synthesis and DNA ligation or any imprecise or partial insertion that results in mutagenesis. In a competing pathway, the HDR template does not become incorporated into the break site at all and through the action of DNA resection vis-a`-vis nonhomologous end joining (NHEJ) activity, a portion of the broken plasmid DNA is lost. This system recapitulates the competing activities that go on in an intact cell where many of the targeted genomes are not successfully modified and a high degree of mutagenic activity is a predictable and guaranteed outcome. For this system, the lacZ gene embedded in the plasmid provides a template for the visual readout of gene editing activity as the disruption of the lacZ gene results in the production of a

A Complete Methodology for the Instruction of CRISPR-Based Gene Editing. . .

7

Cas12a Nuclease crRNA

I. + Cell free extract HDR Template GCGGCCGC

II.

III.

GCGGCCGC CGCCGGCG

Homology Directed Repair (HDR) Products prone to precise template-driven repair

Non-homologous End Joining (NHEJ) Products prone to inserted and/or deleted nucleotides

Fig. 2 CRISPR-based DNA repair pathways HDR and NHEJ. Representation of the two most common general molecular pathways activated by crisper directed gene editing. Repair pathways are initiated after the Cas12a nuclease double-stranded DNA breakage. In HDR (left), a single-stranded oligonucleotide and cell-free extract drive the repair. In NHEJ (right), the DNA ends are processed and re-ligated without a repair template and are subject to indel formation. In the in vitro system, both pathways occur simultaneously

non-functional β-galactosidase protein. When plasmids containing a disrupted lacZ gene are cultured in the presence of X-gal, a source of galactose, a change in the color of bacterial colonies, from blue to white, will be visible. Figure 3 depicts a range of agarose plates containing transformed bacterial cells with gene edited or unmodified plasmid templates. Deep blue colonies harbor plasmid molecules that have not been genetically reengineered while white colonies indicate some form of gene editing has taken place; the presence of white colonies do not automatically represent precise gene editing since the objective of the editing reaction is to interrupt the coding region of the lacZ gene through donor insertion. We have designed the in vitro gene editing system so that the HDR template contains an eight-base sequence that is recognized by the restriction enzyme NotI, a cleavage site that does not appear in the host plasmid. Designing the target site in this matter affords the opportunity to analyze the isolated plasmid DNA for insertion of at least the eight-base pair NotI sequence, as well as the degree of insertion and/or deletion (indel) variation among the edited plasmid population.

8

Kristen M. Pisarcik et al. 24 hrs, -80°C

24 hrs, 20°C (RT)

24 hrs, 4°C (RT)

24 hrs, 20°C (RT)

72 hrs, 20°C (RT)

72 hrs, - 80°C

72 hrs, 4°C (RT)

Colony Restreaks

Fig. 3 Visualization of successful gene editing outcomes on bacterial plates. Example of bacterial plates exhibiting phenotypic readout of the in vitro reaction. A variety of bacterial readout plates are shown depicting the standard blue to white color transition from reactions using cell-free extracts stored at several temperatures (80  C, 4  C and 20  C (RT)) for either 24 or 72 h prior to use. White colonies indicate editing has occurred within the lacZ gene and blue colonies indicate there was no editing within the gene in the target plasmid. Bottom right panel represents several restreaked blue and white colonies which demonstrate genetic inheritance and stability of the genetically modified gene sequence

Figure 4 presents an agarose gel containing plasmid DNA samples isolated from several white colonies. As can be seen in lanes 1, 6, and 10, NotI treatment of the plasmid DNA results in linearization of the DNA template, indicating the presence of the NotI sequence. These results support the notion that site-specific DNA insertion through the process of gene editing has taken place, but it does not reveal whether precise or error-prone insertion has occurred. That determination must be made by subjecting the targeted isolated plasmid to DNA sequencing analysis. This gel does provide, however, several important observations on the activity of gene editing. First, CRISPR-based gene editing is a highly active process and genetically engineered templates can be isolated by a simple blue/white color selection. Second, while each of the plasmid molecules were isolated from white colonies, it is clear that insertion of the eight-base pair NotI site occurred only in 30% of the reactions, indicating that imprecise or error-prone HDR is a parallel activity occurring in the in vitro system, a true reflection of gene editing outcomes in human cells. Figure 5 provides the DNA sequence analyses of plasmid molecules isolated from ten white colonies and two blue colonies that

pHSG299

A Complete Methodology for the Instruction of CRISPR-Based Gene Editing. . .

9

Bacterial Colonies 1

2

3

4

5

6

7

8

9

10

Kilobases 3.0 2.0

Linear Supercoiled

1.0

Fig. 4 Confirmation of gene editing using NotI digestion and agarose gel electrophoresis. Isolated DNA from ten bacterial colonies transformed with plasmids recovered from in vitro gene editing reaction were subject to NotI enzyme digestion to confirm the integration of the NotI site into the lacZ gene from the donor template. Clones 1, 6, and 10 represented successful gene editing through the presence of the NotI restriction site and subsequent restriction enzyme cleavage (RLFP); boxed in red

Fig. 5 Gene editing analyses using Sanger DNA sequencing. In vitro gene editing tools and outcomes. (a) The 1364 RNP PAM and target site are presented within the lacZ gene region of pHSG299 with the associated oligonucleotide donor DNA template in the purple box. The sequences are below with inserted bases in red. Samples 1–5 have perfect HDR, 6–10 have various insertions and integrations, and 11–12 are blue, wild-type colonies without editing. (b) A visual representation of each indel pattern shown in panel (a) is provided. Precise HDR outcomes are represented in green, error-prone (including pure DNA deletion), insertions in yellow, and integrations in gray. The number of sequences for each pattern can be seen in parentheses to the left, and the indel sizes are shown in parentheses on the right

have undergone the in vitro gene editing reaction. In panel A (top), the DNA sequence of the lacZ gene and the target site of CRISPR activity are depicted along with the HDR template. The first ten sequences in the panel reflect plasmid molecules obtained from the white colonies. Sequence lanes 11 and 12 represent plasmid molecules isolated from two blue colonies. The red boxes indicate that genetic change observed at the target site. Notably lanes 11 and 12 have no altered DNA sequence, and these plasmids were either unmodified or re-circularized and re-ligated without sequence alteration. In panel B, we provide a visual representation of the population of sequence changes that occurred in this reaction. The

10

Kristen M. Pisarcik et al.

green bar indicates precise insertion of the eight-base pair NotI sequence, whereas the other colors depict aberrant, pure deletion or error-prone insertion. Out of the ten white colonies analyzed from the single gene editing reaction, five displayed precise HDR, whereas five displayed error-prone HDR or DNA deletion.

5

Discussion We have described a concise methodology for the instruction of CRISPR-based gene editing for high school and college students. The reaction is simple, cost-effective and takes advantage of wellestablished molecular biology reagents that are likely present in any teaching laboratory. The reaction can be broken down into a series of teachable modules. The assembly of a protein and nucleic acid to create a ribonucleoprotein complex is fundamental to almost every aspect of gene function including expression, transcription, replication, repair, and methylation. The CRISPR-Cas complex is used to cleave plasmid DNA, and the result can be visualized by agarose gel electrophoresis. Supercoiled DNA migrates further in the electric field, whereas linear DNA migrates more slowly and thus the RNP particle mimics activity of a novel restriction enzyme that can be designed to cleave at most sites within the genome, sites that lack targets for traditional restriction enzymes. The cleavage of the lacZ gene within its coding region provides the opportunity for genetic modification of a functioning gene. Subsequently, interruption of the coding region, through frameshift, deletion, or insertion, can lead to a simple readout where plasmid DNA modified by gene editing activity can be readily and simply identified. The source of the cell-free extract could be primary cells, explants, or standard cell lines all of which can be grown under various conditions to enhance or diminish the recombination and/or repair activities in the cell-free extract. For example, if a cell line is used, the cells could be synchronized at each of these cell cycle checkpoints, and the extract prepared at that point. Conversely, the cells could be cycled to a checkpoint, synchronized, and then released, followed by extract preparation; cells could be grown in the presence of an inhibitor that targets a specific enzyme thought to be involved in gene editing, and extract preparation can be followed. Discussion surrounding specific activities that can regulate function in gene editing in human cells can derive through modulation of extract preparation. The in vitro system also allows for the visualization of all the genetic outcomes of a gene editing reaction. In many cases, cellbased experiments reveal only the percentage of desired outcome and leave the rest of the cells within a targeted population largely undefined. In some cases, next generation sequencing can be used to define the whole population, but these analyses are expensive and

A Complete Methodology for the Instruction of CRISPR-Based Gene Editing. . .

11

time consuming, unlikely to be budgeted in a high school or college instructional curriculum. The in vitro reaction, through readout in bacterial cells, each colony bearing a unique plasmid, reveals the diversity of genetic events. As we have seen above, in some cases, no gene editing takes place, and the resultant blue colony is readily visualized. In other cases, the white colonies represent a population of modified plasmids that run the gambit of change including deletion, insertion, precise, and error-prone molecular activities that in fact truly reflect the type of genetic outcomes seen in gene editing trials in humans. This important observation could be used as a platform for discussions surrounding the safety of the technique itself and ethical responsibility of clinicians and research scientists. Finally, the in vitro gene editing method affords flexibility in the number of laboratory exercises undertaken by a specific class. The entire reaction only requires simple fundamental equipment, pipette men, and an instrument used for introduction of plasmid DNA into chemically competent cells. In Table 2, we provide a Table 2 Partial and complete semester curriculum for the in vitro gene editing method Suggested short and long-term curriculum vitae Week

Laboratory activities

1

Aseptic technique; sterilization methods; medium preparation

2

Preparing an overnight culture; quadrant streaking; patch plate

3

Bacterial transformation; plating dilutions; discuss blue-white screening

4

Plasmid isolation

5

Restriction digestion, agarose gel electrophoresis

6

Polymerase chain reaction, gel electrophoresis

7

Designing CRISPR RNAs and homology directed repair oligonucleotide

8

In vitro reaction part I: Stop after first plasmid cleanup; gel electrophoresis of cleavage gel

9

In vitro reaction part II: Stop after second plasmid cleanup

10

In vitro reaction part III: E. coli transformation; medium preparation

11

In vitro reaction part IV: Plasmid isolation; restriction digestion; gel electrophoresis

12

In vitro reaction part V: Colony PCR; PCR purification; gel electrophoresis

13

In vitro reaction part VI: Prepare PCR for sequencing

14

Analyze sequencing results

15

Laboratory course wrap-up

Potential laboratory exercises and associated educational topics which can be covered utilizing this protocol. Instructors have the freedom to select topics that fit best within their established curriculum

12

Kristen M. Pisarcik et al.

15-week laboratory course guide, outlining which type of activities could be part of the class. We have added laboratory activities and suggestions for discussions of certain methodologies that are relevant to the gene editing reaction itself or the analytical tools used to determine the genetic outcomes of the reaction. This full-semesterlong course can obviously be broken into modules or reduced in length based on the needs or timeframe of a specific laboratory objective. References 1. Kim H, Kim JS (2014) A guide to genome engineering with programmable nucleases. Nat Rev Genet 15:321–334 2. Khan SH (2019) Genome-editing technologies: concept, pros, and cons of various genome-editing techniques and bioethical concerns for clinical application. Mol Ther Nucleic Acids 16:326–334 3. Gaj T, Gersbach CA, Barbas CF (2013) ZFN, TALEN, and CRISPR/Cas-based methods for genome engineering. Trends Biotechnol 31:397–405 4. Ran FA, Hsu PD, Wright J et al (2013) Genome engineering using the CRISPR-Cas9 system. Nat Protoc 8:2281–2308. https://doi. org/10.1038/nprot.2013.143 5. Pickar-Oliver A, Gersbach CA (2019) The next generation of CRISPR–Cas technologies and applications. Nat Rev Mol Cell Biol 20:490–507 6. Komor AC, Badran AH, Liu DR et al (2017) CRISPR-based technologies for the manipulation of eukaryotic genomes. Cell 168:20–36. https://doi.org/10.1016/j.cell.2016.10.044 7. Single ascending dose study in participants with LCA10—full text view—ClinicalTrials. gov. https://clinicaltrials.gov/ct2/show/ NCT03872479. Accessed 7 Mar 2020 8. Study of safety and efficacy of genome-edited hematopoietic stem and progenitor cells in Sickle Cell Disease (SCD)—full text view— ClinicalTrials.gov. https://clinicaltrials.gov/ct2/ show/NCT04443907. Accessed 28 Aug 2020 9. Banas K, Banas K, Rivera-Torres N et al (2020) Kinetics of nuclear uptake and site-specific DNA cleavage during crispr-directed gene editing in solid tumor cells. Mol Cancer Res 18:891–902. https://doi.org/10.1158/ 1541-7786.MCR-19-1208 10. Xiang X, Qian K, Zhang Z et al (2020) CRISPR-Cas systems based molecular

diagnostic tool for infectious diseases and emerging 2019 novel coronavirus (COVID19) pneumonia. J Drug Target:1–10. https:// doi.org/10.1080/1061186X.2020.1769637 11. Zhang F, Abudayyeh OO, Gootenberg JS et al (2020) A protocol for detection of COVID-19 using CRISPR diagnostics. Bioarchive:1–8 12. Broughton JP, Deng X, Yu G et al (2020) CRISPR–Cas12-based detection of SARSCoV-2. Nat Biotechnol 38:870–874. https:// doi.org/10.1038/s41587-020-0513-4 13. Metsky H, Freije C, Kosoko-Thoroddsen T-S, et al (2020) CRISPR-based surveillance for COVID-19 using genomically-comprehensive machine learning design. bioRxiv 2020.02.26.967026. https://doi.org/10. 1101/2020.02.26.967026 14. Bialk P, Rivera-Torres N et al (2015) Regulation of gene editing activity directed by singlestranded oligonucleotides and CRISPR/Cas9 systems. PLoS One 10:e0129308. https://doi. org/10.1371/journal.pone.0129308 15. Rivera-Torres N, Banas K, Bialk P et al (2017) Insertional mutagenesis by CRISPR/Cas9 ribonucleoprotein gene editing in cells targeted for point mutation repair directed by short single-stranded DNA oligonucleotides. PLoS One 12:e0169350. https://doi.org/10. 1371/journal.pone.0169350 16. Bialk P, Sansbury B, Rivera-Torres N et al (2016) Analyses of point mutation repair and allelic heterogeneity generated by CRISPR/ Cas9 and single-stranded DNA oligonucleotides. Sci Rep 6:32681. https://doi.org/10. 1038/srep32681 17. Sansbury BM, Hewes AM, Kmiec EB (2019) Understanding the diversity of genetic outcomes from CRISPR-Cas generated homology-directed repair. Commun Biol 2:1–10. https://doi.org/10.1038/s42003019-0705-y

A Complete Methodology for the Instruction of CRISPR-Based Gene Editing. . . 18. Sansbury BM, Wagner AM, Nitzan E et al (2018) CRISPR-directed in vitro gene editing of plasmid DNA catalyzed by Cpf1 (Cas12a) nuclease and a mammalian cell-free extract. Cris J 1:191–202. https://doi.org/10.1089/ crispr.2018.0006 19. Sansbury BM, Wagner AM, Tarcic G et al (2019) CRISPR-directed gene editing catalyzes precise gene segment replacement

13

in vitro enabling a novel method for multiplex site-directed mutagenesis. Cris J 2:121–132. https://doi.org/10.1089/crispr.2018.0054 20. Hewes AM, Sansbury BM, Barth S et al (2020) gRNA sequence heterology tolerance catalyzed by CRISPR/Cas in an in vitro homologydirected repair reaction. Mol Ther Nucleic Acids 20:568–579. https://doi.org/10. 1016/j.omtn.2020.03.012

Chapter 2 In Silico Analysis of gRNA Secondary Structure to Predict Its Efficacy for Plant Genome Editing Md Mahmudul Hassan, Abul Kashem Chowdhury, and Tofazzal Islam Abstract CRISPR-Cas technology is now a widely used approach for sequence-specific genome modifications in a wide range of organisms. The specificity and efficacy of the CRISPR-Cas-mediated genome editing are primarily determined by a short sequence known as guide RNA (gRNA). Recent studies have demonstrated that the secondary structure of gRNAs plays a key role in target recognition in CRISPR-Cas-mediated genome editing. Although there are many tools currently available for designing gRNAs, these tools do not allow for determining the gRNA secondary structure. Given the critical role of gRNA secondary structure in target recognition and efficacy of CRISPR-Cas systems, it is vital to assess the gRNA secondary structure. Here, we describe a protocol to determine the gRNA secondary structure using RNA-fold software and explain how to interpret the results. Key words CRISPR-Cas9, Genome Editing, gRNA Secondary structure, gRNA Efficiency

1

Introduction CRISPR-Cas system is now the primary technology used to edit genome of various organism. In the recent years, various types of CRISPR-Cas systems have been discovered and optimized to edit genome in a wide range of organisms. Among the different CRISPR-Cas systems developed, CRISPR-Cas9 is the most widely used CRISPR-based genome editing technology. Genome editing using CRISPR-Cas9 system relies on the induction of doublestranded break (DSB) in a predefined genomic site recognized by a short guiding sequence known as CRISPR (crRNA) or guide RNA (gRNA) or spacer [1–3]. gRNA/crRNA/spacer interacts with another RNA molecule known as trans-activating crRNA (tracrRNA), and together they form a complex where Cas9 protein binds. The crRNA-tracrRNA-Cas9 complex then moves to the target site of genome where crRNA binds to its target (also known as protospacer) through complementary base pairing

M. Tofazzal Islam and Kutubuddin Ali Molla (eds.), CRISPR-Cas Methods: Volume 2, Springer Protocols Handbooks, https://doi.org/10.1007/978-1-0716-1657-4_2, © The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2021

15

16

Md Mahmudul Hassan et al.

[4, 5]. In the natural CRISPR-Cas9 system found in bacteria or archaea, crRNA and tracrRNA exist separately. To make the CRISPR-Cas9 system user friendly, these two CRIPSR RNA molecules are fused together to form a single guide RNA (sgRNA), which contains crRNA/gRNA/spacer at the 50 -end and tracrRNA at the 30 -end [3, 6]. Adjacent to the crRNA, there is 12 nt repeat sequence, whereas tracrRNA harbors a 14 nt anti-repeat sequence adjacent to it (Fig. 1). This forms a repeat and anti-repeat (RAR) stem loop. sgRNA is an integral part of CRISPR-Cas9-mediated genome editing and required for various types of CRISPR application such as creating small insertions or deletions to knockout gene function, editing individual bases, transcriptional regulation of gene via CRISPR-activation (CRISPRa) or CIRPSR interference (CRISPRi), live cell imaging, control 3D organization of genome, epigenome editing, insertion or replacement of DNA segment into a predefined locus via prime editing or homology directed gene editing, RNA editing [6]. The specificity and efficacy of the CRISPR-Cas9-mediated genome editing is primarily determined by the sequence features of gRNA [7, 8]. In addition to the sequence feature, secondary structure of gRNA and/or sgRNA is also an important determinant of its success [8–13]. In a functionally active sgRNA, nucleotides at position 18–20 in the 30 -end of gRNA (i.e., in the seed region) are more accessible, whereas these nucleotides are less accessible in non-functional sgRNA. In addition to the accessibility of nucleotide at position 18–20, accessibility of bases at position 51–53 of sgRNA is also significantly different between the active and inactive sgRNA [14, 15]. Thus, a differentiation between the functionally active and inactive sgRNA can be predicted by analyzing the secondary structure of the sgRNA. An effective sgRNA requires four stem loop structures for its efficient processing and binding to Cas9 protein. These are RAR stem loop, stem loop 1, stem loop 2, stem loop 3 (Fig. 1). RAR stem loop (GAAA) is involved in processing of gRNA (i.e., crRNA) from the precursor crRNA (pre-crRNA) and makes it available to bind to the Cas9 protein. Stem loop 1 is required for the formation of a functional Cas9-sgRNA-DNA complex, whereas the stability of this complex is promoted by the stem loop 2 and 3 and thus improve the in vivo activity of Cas9 [13, 15]. In plants, it has been demonstrated that stem loop 1 lose its structure meaning that it does not contribute to the editing efficiency [15]. Analysis of predictive structure of functionally active sgRNA shows that it forms a stable stem-loop structure at the nucleotide position 21–50, i.e., stem loop structure occurs in the tracrRNA region (Fig. 4). On the other hand, predictive structure of functionally inactive sgRNA shows that in most cases, nucleotides at position 51–53 are found paired with nucleotides at position of 18–20, i.e., with 30 -end of the seed region of gRNA. The pairing between the

In Silico Analysis of gRNA Secondary Structure to Predict Its Efficacy for. . .

17

Fig. 1 Schematic representation of the sgRNA secondary structure. Watson–Crick and non-Watson–Crick base pairs are indicated by black lines. Disordered nucleotides are boxed by dashed lines. (Source [15])

nucleotide at position 18–20 of gRNA and 51–53 of tracrRNA results in the formation of an extended stem loop structure at nucleotide position between 18 and 53 of sgRNA. As nucleotide position at 18–20 of sgRNA is important for recognition of PAM sequence in the target, the formation of extended stem loop structure in this region makes them less accessible for pairing with target sequence. Therefore, not only the sequence specificity but also possible intramolecular structure of the guide sequence must be considered when trying to design highly efficient crRNAs, as was done previously with SpCas9 [16, 17]. Having perfect secondary structure, however, does not guarantee that sgRNA will be functional. There are many instances that selecting sgRNA without secondary structure analysis perform just fine. As well as with the requirement to have some structural motifs, the functionality of sgRNA can also be influenced by the formation of secondary structure within the gRNA part of the sgRNA. It has been shown that free energy (ΔG) of self-folding potential, i.e., forming structure within itself is higher in non-functional gRNA than the functional gRNA [8, 18]. Therefore, in a secondary structure analysis, if a gRNA shows the more negative ΔG value, there will be more possibility to form secondary structure within this gRNA. This will make the gRNA less accessible for base pairing with the target sequence. The secondary structure and self-folding potential of sgRNA can be determined by RNA-fold software [19]. Here, we describe a step-by-step protocol to analyze the sgRNA with RNA-fold software. This will help researcher to analyze their candidates sgRNAs and select the most potent one for the desired experiment (Fig. 2).

18

Md Mahmudul Hassan et al.

Fig. 2 A screenshot of the RNA-fold web server

2

2.1

Materials

Procedure

l

Equipment: A computer with access to internet and a web browser.

l

Data: DNA or RNA sequence.

l

Programs: RNA-fold webserver (http://rna.tbi.univie.ac.at/ cgi-bin/RNAWebSuite/ RNA fo ld.cgi). 1. Open a web browser and then go to RNA fold web server (http://rna.tbi.univie.ac.at/cgi-bin/RNAWebSuite/ RNAfold.cgi). 2. In the software interface, there are three sections. The first section allows user to input the sequence. The second and third sections allow user to decide an appropriate algorithm and the desired output, respectively. For the sgRNA secondary structure analysis, select minimum free energy (MFE) and partition function in the fold algorithm and basic option. Keep the advanced option as default. In the output section, select all three (Fig. 3). 3. Paste your sgRNA sequence in the input field (Fig. 4) and click proceed, and you will be directed to the result page. In the RNA-fold server output page, go to the graphical output section. You will see two output images. One MFE secondary structure and one centroid secondary structure. Having high similarity between these structures indicates reliable prediction

In Silico Analysis of gRNA Secondary Structure to Predict Its Efficacy for. . .

19

Fig. 3 A screenshot of the RNA-fold web server with the required option selected

Fig. 4 A screenshot of the RNA-fold web server with the input sequence shown

[19]. Down the images, you will see several image display options. Keep them as default. Download the MFE secondary structure image. To download, go to the download section under the heading image description. Download the images with MFE structure drawing, encoding base-pair probabilities. To download, click on “image converter link” and open a new tab in the browser. Save the images in an appropriate location in your computer.

20

Md Mahmudul Hassan et al.

Fig. 5 Schematic diagram of the secondary structure of sgRNA. Left image (i) shows the predictive secondary structure of a high-performing sgRNA, whereas one in the right (ii) is a predictive structure of a low-performing sgRNA. In this case, the low-performing sgRNA lacks the essential stem loop structure require for gRNA processing and binding to the Cas9. sgRNA sequence for this analysis was obtained from [20]

4. To interpret gRNA secondary structure, look for the presence of key structural motifs such as RAR, stem loop 2 and stem loop 3 (Fig. 5). If you see any of this stem loop is absent from the sgRNA secondary structure, that sgRNA might not be a good candidate for the desired application as it lacks the key structural properties for its processing and binding to the Cas9 protein. 5. Repeat the analysis for gRNA part of sgRNA using the same procedure and calculate the self-folding free energy of the predictive secondary structure of the gRNA of interest. Selffolding free energy value of the gRNA can be found in the first section of result page of RNA-fold web server. Ref. [18] reported that when the self-folding free energy value is between 0 and 2.0 kcal/mole, the cleavage efficiency of Cas9 is the highest. Therefore, select gRNA having the free energy selffolding potential value within this range (Fig. 6). 6. Look at the secondary structure of gRNA part alone and notice whether the seed region is paired or unpaired. If the seed region is paired, there is a high chance that this gRNA will not be able to access its target site. In that case, try to pick a different gRNA if situation permits. Figure 7 shows an example of unpaired and paired seed regions. In summary, the following structural features have been found associated with the functional sgRNA: l

Presence of three stem loop structures, RAR, second and third (see Fig. 2 for details).

l

Seed region of gRNA (i.e., crRNA/spacer) is unpaired.

l

Self-folding potential value of gRNA is between 0 and 2.0 kcal/ mole.

In Silico Analysis of gRNA Secondary Structure to Predict Its Efficacy for. . .

21

Fig. 6 A screenshot of RNA-fold web server result page, showing the minimum free energy prediction value

Fig. 7 Schematic diagram of the predictive secondary structure of gRNA. Left picture (i) shows the predictive secondary structure of a high-performing gRNA, whereas one in the right (ii) is a predictive structure of a low-performing gRNA. The free energy of self-folding potential of high-performing gRNA (i) and low-performing gRNA (ii) were ΔG ¼ 1.30 kcal/mole and 2.40 kcal/mole, respectively. gRNA sequence for this analysis was obtained from [20]

22

Md Mahmudul Hassan et al.

References 1. Gaj T et al (2016) Genome-editing technologies: principles and applications. Cold Spring Harb Perspect Biol 8 2. Jinek M et al (2013) RNA-programmed genome editing in human cells. Elife 2:e00471 3. Jinek M et al (2012) A programmable dualRNA-guided DNA endonuclease in adaptive bacterial immunity. Science 337:816–821 4. Amitai G, Sorek R (2016) CRISPR-Cas adaptation: insights into the mechanism of action. Nat Rev Microbiol 14:67–76 5. Hille F, Charpentier E (2016) CRISPR-Cas: biology, mechanisms and relevance. Philos Trans R Soc Lond B Biol Sci 371 (1707):20150496 6. Molla KA et al (2020) Wide horizons of CRISPR-Cas-derived technologies for basic biology, agriculture, and medicine. In: Islam MT et al (eds) CRISPR-Cas methods. Springer, USA, pp 1–23 7. Matson AW et al (2019) Optimizing sgRNA length to improve target specificity and efficiency for the GGTA1 gene using the CRISPR/Cas9 gene editing system. PLoS One 14:e0226107 8. Wong N et al (2015) WU-CRISPR: characteristics of functional guide RNAs for the CRISPR/Cas9 system. Genome Biol 16:218 9. Zhang D et al (2019) Unified energetics analysis unravels SpCas9 cleavage activity for optimal gRNA design. Proc Natl Acad Sci U S A 116:8693–8698 10. Kocak DD et al (2019) Increasing the specificity of CRISPR systems with engineered RNA secondary structures. Nat Biotechnol 37:657–666

11. Xu J et al (2017) Optimized guide RNA structure for genome editing via Cas9. Oncotarget 8:94166–94171 12. Ma X et al (2015) A robust CRISPR/Cas9 system for convenient, high-efficiency multiplex genome editing in monocot and dicot plants. Mol Plant 8:1274–1284 13. Nishimasu H et al (2014) Crystal structure of Cas9 in complex with guide RNA and target DNA. Cell 156:935–949 14. Bruegmann T et al (2019) Evaluating the efficiency of gRNAs in CRISPR/Cas9 mediated genome editing in poplars. Int J Mol Sci 20 (15):3623 15. Liang G et al (2016) Selection of highly efficient sgRNAs for CRISPR/Cas9-based plant genome editing. Sci Rep 6:21451 16. Lee K et al (2019) Activities and specificities of CRISPR/Cas9 and Cas12a nucleases for targeted mutagenesis in maize. Plant Biotechnol J 17:362–372 17. Thyme SB et al (2016) Internal guide RNA interactions interfere with Cas9-mediated cleavage. Nat Commun 7:11750 18. Jensen KT et al (2017) Chromatin accessibility and guide sequence secondary structure affect CRISPR-Cas9 gene editing efficiency. FEBS Lett 591:1892–1901 19. Gruber AR et al (2008) The Vienna RNA websuite. Nucleic Acids Res 36:W70–W74 20. Yamamoto A et al (2019) Developing heritable mutations in Arabidopsis thaliana using a modified CRISPR/Cas9 toolkit comprising PAM-altered Cas9 variants and gRNAs. Plant Cell Physiol 60:2255–2262

Chapter 3 In Vitro Cas9 Cleavage Assay to Check Guide RNA Efficiency Subhasis Karmakar, Deeptirekha Behera, Mirza Jaynul Baig, and Kutubuddin A. Molla Abstract The CRISPR (clustered regularly interspaced short palindromic repeats)-Cas (CRISPR-associated protein) system has become a popular toolkit for editing genomes of interest in a wide variety of organisms. The Cas9 endonuclease enzyme is targeted to a specific genomic region by a small single guide RNA (sgRNA). The cleavage efficiency of Cas9 varies greatly from one sgRNA to another sgRNA. Mutagenesis rate of a CRISPR-Cas experiment strongly depends on the sgRNA used. Presently accessible web-based tools for sgRNA design predict a wide variety of candidate sgRNAs for a single genomic target site. Despite these in silico predictions, not every sgRNA displays the same cleavage efficiency. To encounter this discrepancy, here, we present an in vitro method to screen multiple sgRNAs to identify the most suitable one that can efficiently introduce a double-stranded break at a particular genomic target site. This screening method allows a researcher to choose the best one among several online predicted sgRNAs prior to deliver genome editing reagents into live plant or animal cells. Key words CRISPR-Cas9, In vitro transcription, Protospacer adjacent motif (PAM), In vitro cleavage, sgRNA

1

Introduction The CRISPR (clustered regularly interspaced short palindromic repeats)-Cas (CRISPR-associated protein), a bacterial adaptive immune system, is used in diverse organisms to edit specific DNA sequences efficiently in vivo with high precision [1–3]. The CRISPR-Cas system from Streptococcus pyogenes, consists of Cas9 protein and RNAs (crRNA and tracrRNA), is most widely used [4]. The crRNA (CRISPR RNA), consists of 16–22 nucleotides derived from 30 end of the repeat sequence and 20 nucleotides (nt) complementary to the target DNA site, guides Cas9 protein to the target DNA site [5]. So, the crRNA is 36–42 nt long. The tracrRNA (trans activating crRNA) is required for crRNA maturation, and DNA cleavage by Cas9, which is partially complementary

M. Tofazzal Islam and Kutubuddin Ali Molla (eds.), CRISPR-Cas Methods: Volume 2, Springer Protocols Handbooks, https://doi.org/10.1007/978-1-0716-1657-4_3, © The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2021

23

24

Subhasis Karmakar et al.

to crRNA [6, 7]. The crRNA and tracrRNA are artificially combined to form a single guide RNA (sgRNA) with a tetraloop. This sgRNA can guide Cas9 to a target DNA similar to crRNAtracrRNA hybrid [7]. The Cas9, a large protein, consists of two nuclease domains, such as RuvC-like domain and HNH (His-AsnHis)-like domain. HNH domain of Cas9 cleaves complementary DNA strand (to sgRNA), whereas RuvC-like domain cleaves non-complementary strand [5, 7]. At first, Cas9 protein assembles with the mature sgRNA to form an effector complex. The RNP (ribonucleoprotein) complex will recognize the target DNA sequence, guided by 20 nt guide sequence in the 50 end of sgRNA [7]. The sgRNAs are equally important for using diverse CRISPR-Cas-mediated tools like base editing, prime editing, epigenome editing, transcriptional regulation, and DNA imaging [8]. This RNP complex (Cas9-sgRNA) generally cleaves dsDNA 3 base pair upstream of protospacer adjacent motif (PAM), although cleavage at 3, 4, and 5 base upstream to PAM in the non-complementary strand is also known [9]. The PAM has been demonstrated to be an important part for DNA recognition [10]. The PAM is a short stretch of nucleotides adjacent (either upstream or downstream) to the target DNA sequence that is essential for Cas9 to cleave. For SpCas9 (Cas9 from Streptococcus pyogenes), a downstream NGG sequence acts as PAM. Synthesis of a specific RNA transcript under in vitro condition is relatively easy because of the availability of bacteriophage RNA polymerase and specific DNA vectors. RNA polymerases, encoded by SP6, T7, or T3 bacteriophage, recognize specific promoter sequences with high degree of specificity [11–13]. Generally, specific fragment of a gene or sequence of interest is cloned under the influence of a strong promoter, such as SP6, T7, or T3 from phages, and is transcribed by phage RNA polymerase (RNAP) [14, 15]. In vitro transcribed large-scale RNA mimics biologically active RNA in various applications. In vitro generated RNA transcripts are also used as a template for protein synthesis in the cellfree system [16]. Several commercially available plasmids contain above-mentioned promoters, present in upstream of MCS (multiple cloning sites). The target gene of interest can be cloned downstream of these promoters and subsequently transcribed by cognate RNAP. The sgRNA can be in vitro synthesized using the same method and subsequently be combined with the recombinant Cas9 protein to form the effector RNP complex. Guide RNA synthesized through in vitro transcription process bypasses the cloning process and allows rapid validation of CRISPR reagents. The effector RNP complex can be incubated with a target DNA (either PCR product or plasmid) containing perfect homology to the 20-nucleotide guide RNA in the 50 end of sgRNA.

In Vitro Cas9 Cleavage Assay to Check Guide RNA Efficiency

25

In this chapter, we describe a stepwise protocol to perform Cas9 in vitro cleavage assay with multiple guide RNAs to evaluate their efficiency. This method can be used as a rapid and efficient way to predict the most suitable guide RNA that can provide doublestranded break at particular genomic locus in vivo.

2

Materials

2.1 Web Tools/ Databases for Sequence Information Acquisition

1. MSU Rice Genome Annotation Project (http://rice.plan tbiology.msu.edu/). 2. Rice Annotation Project Database (https://rapdb.dna.affrc.go. jp/). 3. National Center for Biotechnology Information (https:// www.ncbi.nlm.nih.gov/). 4. CRISPR-PLANT crispr2/).

V2

(https://www.genome.arizona.edu/

2.2 Chemicals, Reagents, Buffers, and Kits

1. Plasmid vector (Addgene: pRGEB32).

2.2.1 Cloning of sgRNA and Construction of CRISPR Vector

4. 25 mM dNTPs (Thermo Scientific).

2. Oligonucleotide primers. 3. DNase/RNase-free molecular grade water. 5. Agarose (MB). 6. 6 DNA gel loading dye (Thermo Scientific). 7. 1 kbp and 100 bp plus DNA ladder (Thermo Scientific). 8. PCR purification kit. 9. Plasmid purification kit. 10. Gel extraction kit. 11. Nanodrop/UV spectrophotometer. 12. Bovine serum albumin (NEB). 13. Enzymes: Q5 high fidelity DNA polymerase (NEB), Taq DNA polymerase (Promega), T4 DNA ligase (NEB), BsaI (NEB). 14. 5 Green GoTaq master mix (Promega). 15. Competent cells: E. coli Top10/DH5α. 16. Dry or water bath for 42  C. 17. Luria–Bertani broth and solid media. 18. Antibiotic: kanamycin, ampicillin.

2.2.2 In Vitro Transcription

1. Transcript Aid T7 High Yield Transcription Kit (Thermo Scientific #K0441). 2. DNA template (need to be generated or synthesized).

26

Subhasis Karmakar et al.

3. Ethanol (70% and 96%). 4. Phenol, Tris-saturated, pH 7–8. 5. Phenol, pH 4.7 (for transcript purification). 6. Chloroform. 7. Sterile, disposable plasticware and RNase-free pipette tips. 8. Latex gloves, powder-free. 2.2.3 RNA Transcript Purification

1. 6% denaturing polyacrylamide gel containing 8 M urea. 2. 10 TBE gel electrophoresis buffer: 890 mM Tris, 890 mM boric acid, 25 mM EDTA. 3. Elution buffer: 0.5 M ammonium acetate, 1 mM EDTA, 0.2% (w/v) sodium dodecylsulfate (SDS). 4. Phenol: chloroform: isoamyl alcohol (25:24:1). 5. 3 M Sodium acetate (pH 5.2): Prepare a 3 M sodium acetate solution and adjust to pH 5.2 by the addition of glacial acetic acid. 6. 100% ethanol. 7. Guide-it™ IVT RNA Clean-Up Kit (Takara #632638).

2.2.4 Target DNA (Genomic or Plasmid) Isolation

1. 1.5 mL Eppendorf tubes (Eppendorf®). 2. Pipette tips (Corning, Axygen®, T-1000-B; T-200-Y; T-300). 3. Young leaves of greenhouse grown rice variety. 4. β-Mercapto-ethanol (ME) (Thermo Fisher Scientific, Gibco®, 21985023). 5. PVP-40 (AMRESCO, 0507-500G). 6. Phenol: chloroform: isoamyl alcohol (25:24:1) (Coolaber, SL2040-100 mL) (purity: AR). 7. Chloroform, purity: AR. 8. Isopropanol, purity: AR. 9. 75% ethanol, purity: AR. 10. Ultrapure water. 11. CTAB (AMRESCO, 0833-1KG). 12. Sodium chloride, purity: GR. 13. EDTA (AMRESCO, 0322). 14. Tris (AMRESCO, 0497-5KG). 15. 2% CTAB. 16. 10% RNase A (Thermo Scientific).

In Vitro Cas9 Cleavage Assay to Check Guide RNA Efficiency 2.2.5 Equipment

27

1. Pipettes. 2. Stainless steel spoon. 3. Mortar (diameter: 100 mm) and pestle (size: 117 mm). 4. Water bath (65  C). 5. High-speed centrifuges. 6. Refrigerator (20  C). 7. Dry bath (37  C). 8. Magnetic stirrer. 9. Electrophoresis equipment. 10. Liquid nitrogen.

2.2.6 In Vitro Cleavage Assay

1. Cas9 Nuclease, S. pyogenes (NEB #M0386). 2. NEBuffer 3.1. 3. Nuclease-free water. 4. Proteinase K, Molecular Biology Grade (NEB #P8107S). 5. sgRNA containing the 20-nt guide sequence to target genomic region of interest. 6. DNA substrate containing homologous sequence of the 20-nt guide (the substrate DNA can be circular or linearized plasmid, PCR products from genomic or plasmid DNA, or synthesized oligonucleotide).

3

Methods Procedure overview (see Fig. 1).

3.1 sgRNA-Encoding Template Generation 3.1.1 Cloning of Single sgRNA into pRGEB32 Vector

1. Select several top guides to target a particular gene of interest (e.g., gene 1) using CRISPR-PLANTv2 or any other website. 2. Design forward and reverse oligos for each guide. The same web tools can be utilized for this purpose. 3. Add the adapter sequence 50 GGCA to the 50 end of the forward oligo and add sequence 50 AAAC to the 50 of the reverse oligo (see the following table). Synthesize the oligos from any vendor. Oligo

Sequence

Forward

50 -GGCA-N1. . .. . .. . .. . .. . .. . .N20-30

Reverse (complementary)

50 -AAAC-N20. . .. . .. . .. . .. . .. . .N1-30

4. Dissolve the oligos to 100 μM with nuclease-free water.

28

Subhasis Karmakar et al.

Fig. 1 Different steps of sgRNA screening protocol

5. Into a PCR tube, add the following components to carry out oligo annealing: Stock concentration

Reagents

Volume Cycle

100 μM 100 μM 10

Forward oligo Reverse oligo T4 DNA ligase buffer

1 μL 1 μL 1 μL

10 U

T4 PNK (NEB) 0.5 μL Sterile water 6.5 μL

Total

37  C, 60 min 95  C,10 min Slowly cool to 25  C at a rate of 0.1  C/s

10 μL

6. When this annealing reaction is completed, add 190 μL water to 10 μL reaction mixture. 7. Prior to performing the ligation reaction of the annealed oligos into the pRGEB32 vector, digest pRGEB32 with BsaI, and purify it: Stock concentration

Reagents

Volume

Incubation

300 ng/μL 10

pRGEB32 CutSmart buffer

3 μL 3 μL

Incubate at 37  C for 20 min

20 U/μL

BsaI (NEB) Sterile water

0.5 μL 23.5 μL

Total

30 μL

8. Purify BsaI digested vector using gel extraction kit, and quantify using NanoDrop 2000 spectrophotometer. Dilute an aliquot if necessary, to achieve final concentration of 25 ng/μL.

In Vitro Cas9 Cleavage Assay to Check Guide RNA Efficiency

29

9. Perform the following ligation reaction with diluted annealed oligos and the BsaI-digested pRGEB32 vector: Stock concentration

Reagents

Volume Incubation

Vector (BsaI digested pRGEB32) Insert (annealed oligonucleotide, from step 6) T4 DNA ligase buffer 10 4 U/μL (NEB# T4 DNA ligase (NEB) Sterile water M0102L)

2 μL

Total

20 μL

25 ng/μL

Incubate at 22  C for overnight

10 μL 2 μL 1 μL 5 μL

10. Transform 10 μL of the ligation into 100 μL of E. coli Top10 chemically competent cells according to manufacturer’s protocol. Briefly, thaw the cells 10 min on ice, add 10 μL of the ligation mixture to the cells, and incubate on ice 30 min. Heat shock the cells at 42  C for 30 s, and then immediately return to the ice for 2 min. Add 300 μL of LB medium (without antibiotic) to the cells and incubate at 37  C with shaking for 1 h. In a sterile hood, spread-plate 100 μL of the recovered cells onto LB + 50 μg/mL kanamycin plate, allow the plate to dry, and place plate lid side down in a 37  C incubator overnight. 11. Kanamycin-resistant colonies would be visible next day. Perform colony PCR with the following reaction (Guide-gene1): Stock concentration Reagents 5 10 μM 10 μM

Total

Colony Go Taq green master mix 257-F (gene1-forward oligo) 93R (binds 150 bp downstream) Sterile water

Volume PCR program 5 μL 0.5 μL 0.5 μL 4 μL

95  C, 2 min 95  C, 30 s 55  C, 20 s 35 cycles 72  C, 20 s 72  C, 2.5 min; 4  C, hold

10 μL

12. Perform agarose gel electrophoresis to identify positive colonies. 13. Inoculate PCR-positive colony for culture in 5 mL of LB + 50 μg/mL kanamycin and incubate cultures at 37  C overnight with shaking. In the next day, perform plasmid miniprep according to manufacturer’s recommendations. Check the concentration of plasmid DNA with Nanodrop spectrophotometer.

30

Subhasis Karmakar et al.

14. Perform Sanger sequencing with 93F primer to confirm guide sequence. 15. These positive recombinant plasmids, harboring desired sgRNA will be used to amplify template for IVT. 3.2 In Vitro Transcription of a sgRNA

1. Use the recombinant plasmid vector (developed in Subheading 3.1.1, step 15), harboring the desired sgRNA (Fig. 2), to amplify a PCR fragment employing the primer listed below.

3.2.1 Template Generation for In Vitro Transcription

Primer name Sequence

Purpose

IVT1-F

gaaattaatacgactcactataggcccggttgtccttcaggaat

R

CTcctgcaggcAAAAAAAGCACCGACTCGGT

IVT template amplification for Gene 1

2. Design a 46- to 48-nt forward PCR primer (see Note 1). The forward primer should contain the following four sequence elements, as shown in the above table and Fig. 3. (a) A T7 promoter sequence (22 nt) (nucleotide marked red font in the table) at the 50 end of the primer. (b) A transcription initiation site [two guanine (G) residues]: The addition of G residue is dependent on the 50 end of the target sequence. The T7 promoter requires at least two G- residue for efficient transcription (nucleotide marked as green font in the table; see Note 2). (c) Specific sgRNA target sequence (20 nt) (nucleotide marked as blue font in the table). (d) The reverse primer should bind at the end of the scaffold template sequence. 3. Perform PCR to generate template following the table below. PCR amplicon will contain T7 promoter followed by the sgRNA coding sequence. Name of the template for IVT Primer pair T1

IVT1-F and 93R

Template From Subheading 3.1.1, step 15

Expected amplicon size 140 bp

In Vitro Cas9 Cleavage Assay to Check Guide RNA Efficiency

31

Fig. 2 sgRNA encoding template generation. Flowchart showing different steps for construction of recombinant plasmid harboring sgRNA, which will be used to generate template for in vitro transcription

32

Subhasis Karmakar et al. A. Design a 46-48 nt forward primer T7 Promoter +extra 2-nt

Protospacer (crRNA)

B. Generate tempate for In vitro transcription of sgRNA 46-48 nt forward primer

Protospacer (crRNA) +Scaffold template (tracrRNA)

PCR with Q5 polymerase

Reverse primer complementary to scaffold template

T7 Promoter Target specific tracrRNA crRNA

C. Production of sgRNA by In vitro transcription and purification by kit

sgRNA

sgRNA coding sequence

Fig. 3 Different steps for the production of sgRNA for in vitro cleavage assay: (a) Designing of forward primer for generating template for in vitro transcription of sgRNA. (b) Template generation for in vitro transcription of sgRNA. (c) Generation of sgRNA through in vitro transcription and purification

In Vitro Cas9 Cleavage Assay to Check Guide RNA Efficiency 3.2.2 In Vitro Transcription

1. Prepare the reaction mixture at room temperature as per the table below. Stock concentration Reagents

Volume Incubation

5

4 μL Transcript aid reaction buffer (see Note 3) DEPC-treated water up to 20 μL

100 mM

ATP/CTP/GTP/UTP mix

8 μL

1 μg

Template DNA (from Subheading 3.2.1, step 3)

–

Transcript aid enzyme mix DEPC-treated water up to 20 μL

2 μL

Total 3.2.3 Purification of RNA Transcript

33

Incubate 37  C for 2h

20 μL

1. RNA transcript should be purified before the downstream application. Any existing DNA should be removed with DNaseI treatment (see Note 4). 2. Several RNA purification kits are available in the market for removal of all the protein and nucleotide contaminants (one example is Takara# 632638). 3. Alternatively, the phenol (pH 4.7): chloroform extraction and ethanol precipitation method can be used to purify RNA as per the following protocol. (a) Add 115 μL of DEPC-treated water and 15 μL of 3 M sodium acetate solution (pH 5.2) with the 20 μL reaction (from Subheading 3.2.2) and mix thoroughly. (b) Add equal volume of phenol/chloroform (1:1) to the mixture. (c) Centrifuge at 13,000 rpm for 10 min. (d) Collect the upper layer and add equal volume of chloroform. (e) Centrifuge at 13,000 rpm for 10 min. (f) Collect upper aqueous phase, transfer to a separate tube, and add two volume of ethanol for precipitation of RNA. (g) Incubate the tube at 20  C for 1 h and then centrifuge at 13,000 rpm for 30 min. (h) Discard the supernatant and wash the pellet with 70% ethanol. (i) Resuspended the pellet in 20 μL of RNase-free water (see Notes 5 and 6). (j) Finally store RNA at 80  C or use immediately.

34

Subhasis Karmakar et al.

3.3 Genomic DNA Isolation from Rice Leaves

1. Cool mortar and pestle in liquid nitrogen or place them at 80  C for 30 min before use. 2. Harvest 200 mg rice leaf from greenhouse and grind in liquid nitrogen to make a fine powder using mortar and pestle. Transfer the powder into an Eppendorf tube. 3. Add 400 μL of 2% CTAB solution (preheated at 65  C) to the tube. Mix by vortexing until the sample is thoroughly suspended. 4. Incubate the CTAB-treated samples in a 65  C water bath for at least 15 min. Centrifuge the samples at 12,000 x g for 10 min. Collect the supernatant. 5. Add 500 μL of phenol: chloroform: isoamyl alcohol (25:24:1) to the supernatant. Mix thoroughly. Centrifuge the samples at 12,000  g for 15 min. 6. Transfer the supernatant to a new collection tube. Be careful not to transfer the intermediate protein layer. 7. Add an equal volume of chloroform to the aqueous phase. Mix by shaking and inverting. Centrifuge the sample at 12,000  g for 15 min. 8. Transfer the supernatant to a new collection tube. 9. Add to the aqueous phase an equal volume of chilled 100% ethanol. Mix by gently inverting the tube and place at 20  C for at least 1 h. Centrifuge the sample at 13,000  g for 30 min. 10. Decant the supernatant. 11. Add 300 μL of 70% ethanol to the pellet in the tube. 12. Centrifuge the sample at 12,000  g for 10 min. Decant the supernatant and place the tube at speed vac for at least 30 min to dry. Alternatively, pellet could be air dried. 13. Add 30 μL of ultrapure water to the tube and let it stand for 10 min to dissolve the gDNA sample. 14. Store genomic DNA at 20  C or use immediately.

3.4 PCR Amplification of Target from gDNA (See Note 7)

1. Design suitable primers to amplify the region to be targeted by Cas9. The optimal amplicon size is 500–800 bp, with the sgRNA target sequence located asymmetrically within the amplicon sequence (see Note 8). Each cleavage fragment should be at least 250 bp, and there should be a >100 bp size difference between the pieces after in vitro Cas9 cleavage (Fig. 4). Remember, Cas9 makes a cleavage 3 bp upstream of the PAM (NGG). These guidelines need to be followed for efficient amplification of genomic sites and decent assay resolution on an agarose gel (see Note 9).

In Vitro Cas9 Cleavage Assay to Check Guide RNA Efficiency

35

Fig. 4 PCR-amplified region. Amplified region (500–800 bp) includes 20 bp target sequence for sgRNA. sgRNA-Cas9-mediated cleavage occurs at the target site, generating fragments of unequal size. An example is shown here for one guide RNA

2. Prepare the following reaction mixture: (amplification of gene 1 target). Stock concentration

Reagents

Volume

PCR program

30 ng/μL 5

Genomic DNA Go Taq green master mix

1 μL 12.5 μL

95  C, 2 m 95  C, 30s

10 μM

Forward primer

1.25 μL

55 C, 20 s 35 cycles

10 μM

Reverse primer Sterile water

1.25 μL 9 μL

72  C, 20 s 72  C, 2.5 min 4  C, hold

Total

25 μL

3. Run 5 μL of the PCR product on 1.5% agarose gel to confirm proper amplification.

36

Subhasis Karmakar et al.

3.4.1 Purification of PCR Product

1. Add 5 volumes of PCR Binding Solution (SPB) (DS0027) to 1 volume of the PCR sample and mix well by pipetting. 2. Apply the mixture to the HiElute Miniprep Spin Column (capped) [Himedia-DBCA03]. Centrifuge for 1 min at 12,000  g. 3. Discard the flow-through and place the column in the same collection tube. 4. Add 700 μL of diluted wash solution (HPE) (DS0024) to the column. Centrifuge for 1 min at 12,000  g (13,000 rpm) in a tabletop microcentrifuge. 5. Discard the flow-through and re-place the column in the same collection tube. 6. Centrifuge for 1 min at 12,000  g to remove excess ethanol. 7. Transfer the column to a clean 1.5 mL uncapped collection tube, pipette 30 μL of elution buffer (ET) (DS0040) to the center of the column and incubate at room temperature (15–25  C) for 1 min. Centrifuge for 1 min at 12,000  g in a tabletop microcentrifuge. 8. Store the purified product 20  C or use immediately.

3.5 In Vitro Cleavage of Target DNA with SpCas9 Nuclease

Assemble the reagents in the following order at room temperature: Stock concentration Reagents 10 300 nM 1 μM

30 nM

Total

Volume

Incubation

NEBuffer 3.1 sgRNA (IVT generated transcript) SpCas9 Nuclease (M0386S) Nuclease-free water

3 μL Pre-incubate 3 μL (30 nM final) for 10 min at 25  C 1 μL (~30 nM final) 20 μL

Substrate DNA (purified PCR product of target gene)

3 μL (3 nM final)

37  C for 15 min

30 μL

1. Add 1 μL of Proteinase K to each sample, mix thoroughly, and briefly centrifuge. 2. Incubate at room temperature for 10 min. 3. Proceed with fragment analysis in agarose gel (2%). 3.5.1 Analysis of Cleavage Product

Different sgRNAs synthesized through IVT can be tested against target DNA sites. According to the protocol, the target DNA fragment, the sgRNA, and recombinant Cas9 components need to be combined in an in vitro cleavage reaction. For example, a

In Vitro Cas9 Cleavage Assay to Check Guide RNA Efficiency

37

500 bp amplicon is targeted by Cas9 with three different guides to generate fragments of unequal size (Fig. 5). After the incubation, load the reaction mixtures to a 2% agarose gel and perform electrophoresis. Visualize the gel in gel documentation system and perform densitometric analysis of the agarose gel to clarify the percentage of sgRNA-directed Cas9-mediated cleavage (Fig. 5). From Fig. 5, it could be ascertained that guide RNA 3 is better than the other two for using in an in vivo experiment.

Cas9

Cas9

PAM Sequence (5’-NGG-3’)

+ Target gene of interest

sgRNA Cas9-sgRNA Complex

Assembly of Cas9-sgRNA complex with target sequence

sgRNA (crRNA+ tracrRNA) synthesized through IVT

In vitro cleavage of target sequence by recombinant Cas9 and synthesized sgRNA Double stranded break Separate cleavage product on an 2% agarose gel M

NC

55%

42%

1

2

71%

3

Uncleaved DNA

Cleaved fragments

Cas9 cleavage observed in vitro

Fig. 5 Assessment of in vitro cleavage efficiency of different sgRNAs. A PCR amplification product harboring a sgRNA target site is synthesized from genomic DNA. In this example, 3 sgRNAs (1, 2, and 3) are made with IVT and assayed their efficiency. The PCR fragment is then combined with a candidate sgRNA and recombinant Cas9 protein in Eppendorf tubes. The products are separated by 2% agarose gel electrophoresis. NC represents negative control that lacked sgRNA. Cleavage efficiency is assessed by agarose gel electrophoresis and presented here in the form of percentage (%) of cleaved product

38

4

Subhasis Karmakar et al.

Notes 1. The forward primer should be exposed to salt-free purification following synthesis procedure, and diluted to a concentration of 10 μM with nuclease-free water. 2. If specific target sequence already comprises two Gs at the begining, there is no requirement to add extra Gs for transcription initiation. Extra Gs could decrease the cleavage efficiency. 3. If higher amount of sgRNA is required, scale up the total reaction volume up to 50 μL. 4. Before purification of sgRNA, make the IVT wash buffer by adding 24 mL of 96–100% absolute ethanol (only if you are using Takara# 632638 kit for purification). 5. In 20 μL of elution volume, a concentration of >0.5 μg/μL is predictable. This is suitable for in vitro Cas9 cleavage assay. For generating higher concentration of sgRNA, the elution volume can be reduced to 5 μL. 6. The sgRNA may be slightly visible after running on agarose gel electrophoresis, usually appearing nearabout the 130-bp position in a 2–2.5% agarose gel. If this counteracts with assay clarification, the samples can be treated with RNase A (e.g., 5 μg RNase A for 30 min at 37  C) prior to gel loading. 7. A range of dilution (from undiluted to 1:50) may be needed for proper amplification of target DNA to achieve clear amplification results. 8. Adjustments of PCR cycles may be necessary, depending on the amplicon size. 9. Yield of PCR products should be strong and shows single band; 100–250 ng of PCR product (in a volume of 5 μL) will be essential for the subsequent in vitro cleavage assay, ensuring that the bands remain easily visible on agarose gel after the cleavage assay.

Acknowledgments We highly acknowledge the funding from Indian Council of Agricultural Research (ICAR), New Delhi, in the form of the Plan Scheme “Incentivizing Research in Agriculture” project and support from the Director, National Rice Research Institute (NRRI). SK would like to acknowledge financial support from the DBT-RA program in Biotechnology and Life Sciences of DBT, Government of India. Figures were made with Biorender.com.

In Vitro Cas9 Cleavage Assay to Check Guide RNA Efficiency

39

References 1. Horvath P, Barrangou R (2010) CRISPR/Cas, the immune system of bacteria and archaea. Science 327(5962):167–170 2. Xie K, Yang Y (2013) RNA-guided genome editing in plants using a CRISPR–Cas system. Mol Plant 6(6):1975–1983 3. Mali P, Aach J, Stranges PB, Esvelt KM, Moosburner M, Kosuri S et al (2013) Cas9 transcriptional activators for target specificity screening and paired nickases for cooperative genome engineering. Nat Biotechnol 31 (9):833–838 4. Doudna JA, Charpentier E (2014) The new frontier of genome engineering with CRISPR-Cas9. Science 346(6213) 5. Gasiunas G, Barrangou R, Horvath P, Siksnys V (2012) Cas9–crRNA ribonucleoprotein complex mediates specific DNA cleavage for adaptive immunity in bacteria. Proc Natl Acad Sci U S A 109(39):E2579–E2586 6. Deltcheva E, Chylinski K, Sharma CM, Gonzales K, Chao Y, Pirzada ZA, Eckert MR, Vogel J, Charpentier E (2011) CRISPR RNA maturation by trans-encoded small RNA and host factor RNase III. Nature 471:602–607 7. Jinek M, Chylinski K, Fonfara I, Hauer M, Doudna JA, Charpentier E (2012) A programmable dual-RNA–guided DNA endonuclease in adaptive bacterial immunity. Science 337 (6096):816–821 8. Molla KA, Karmakar S, Islam MT (2020a) Wide horizons of CRISPR-Cas-derived technologies for basic biology, agriculture, and medicine. In: Islam, Bhowmik, Molla (eds) CRISPR-Cas methods. Humana, New York, NY, pp 1–23

9. Molla KA, Yang Y (2020b) Predicting CRISPR/Cas9-induced mutations for precise genome editing. Trends Biotechnol 38 (2):136–141 10. Sternberg SH, Redding S, Jinek M, Greene EC, Doudna JA (2014) DNA interrogation by the CRISPR RNA-guided endonuclease Cas9. Nature 507(7490):62–67 11. Butler ET, Chamberlin MJ (1982) Bacteriophage SP6-specific RNA polymerase. I. Isolation and characterization of the enzyme. J Biol Chem 257 (10):5772–5778 12. Davanloo P, Rosenberg AH, Dunn JJ, Studier FW (1984) Cloning and expression of the gene for bacteriophage T7 RNA polymerase. Proc Natl Acad Sci U S A 81(7):2035–2039 13. Jorgensen ED, Joho K, Risman S, Moorefield MB, McAllister WT (1989) Promoter recognition by bacteriophage T3 and T7 RNA polymerases. DNA-protein interaction in transcription: 79–88 14. Melton DA, Krieg PA, Rebagliati MR, Maniatis T, Zinn K, Green MR (1984) Efficient in vitro synthesis of biologically active RNA and RNA hybridization probes from plasmids containing a bacteriophage SP6 promoter. Nucleic Acids Res 12(18):7035–7056 15. Krieg PA, Melton DA (1987) In vitro RNA synthesis with SP6 RNA polymerase. Methods Enzymol 155:397–415 16. Krieg PA, Melton DA (1984) Formation of the 30 end of histone mRNA by posttranscriptional processing. Nature 308 (5955):203–206

Chapter 4 Efficient Multiplexed CRISPR-Cas12a Genome Editing in Plants Yingxiao Zhang and Yiping Qi Abstract Cas12a (formerly Cpf1) is a Class 2 Type V-A clustered regularly interspaced short palindrome repeats (CRISPR) system that has been widely used in plant genome editing to target AT-rich regions. Cas12a only requires short CRISPR RNAs (crRNAs) for DNA targeting, making it an ideal platform to achieve multiplexed genome engineering. Highly efficient multiplexed genome editing will allow gene family knockout for reverse genetics, manipulation of metabolic pathways, and the simultaneous introduction of multiple agronomically important traits into elite crop cultivars. To apply multiplexed genome editing in plants, here we describe a highly efficient CRISPR-Cas12a expression system and a user-friendly toolbox for vector assembly. In this system, both Cas12a and crRNAs are driven by Pol II promoters, and each crRNA is flanked by hammer head (HH) and hepatitis delta virus (HDV) ribozymes to ensure precise processing. This multiplex system is highly flexible, allowing researchers to make modifications based on plant species and project objectives. The use of this multiplexing toolbox will broaden the application of CRISPRCas12a in basic and translational research in plants. Keywords CRISPR-Cas12a, Multiplexed genome editing, Gateway cloning

1

Introduction The Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)-associated protein (Cas) systems are versatile genome editing tools widely applied in many plant species. Aside from inducing targeted insertions and deletions (indels) and precise DNA changes, CRISPR systems can also be engineered to recruit effector proteins to achieve transcriptional regulations, epigenetic modifications, live-cell imaging, etc. [1]. So far, three CRISPR systems have been successfully demonstrated in plant genetic engineering, including Cas9, Cas12a, and Cas12b systems [2–8], which have different protospacer adjacent motif (PAM) preferences, CRISPR RNA (crRNA) structures, editing profiles, activities, and specificities. Cas12a is a Class 2 Type V-A CRISPR system targeting T-rich PAMs, hence suitable for editing AT-rich regions [9]. Unlike

M. Tofazzal Islam and Kutubuddin Ali Molla (eds.), CRISPR-Cas Methods: Volume 2, Springer Protocols Handbooks, https://doi.org/10.1007/978-1-0716-1657-4_4, © The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2021

41

42

Yingxiao Zhang and Yiping Qi

Cas9, Cas12a cleaves 18–23 bases downstream of the PAM, generating staggered ends, which usually results in larger deletions than Cas9 [9]. Cas12a only requires short (~43 nt) crRNAs for DNA targeting, which are easy to synthesize and stack [9]. In addition, Cas12a possesses RNase activity that can process CRISPR arrays to form mature crRNAs [9]. These features make Cas12a an ideal platform for multiplexed genetic engineering, which can be used to achieve gene family knockout, metabolic pathway manipulation, multi-trait breeding, and genetic engineering in polyploid plants. Cas12a-mediated genetic engineering has been demonstrated in multiple plant species, including rice (Oryza sativa) [7, 8, 10– 13], Arabidopsis thaliana [8, 14, 15], tobacco (Nicotiana tabacum and N. attenuate) [7, 16], soybean (Glycine max) [16], maize (Zea mays) [14, 17], tomato (Solanum lycopersicum) [18], citrus [19], cotton (Gossypium hirsutum) [20], and wheat (Triticum aestivum) [21]. One of the best expression systems for Cas12a uses two Pol II promoters to drive Cas12a and crRNA, where the crRNA is flanked by hammerhead (HH) ribozyme RNA and hepatitis delta virus (HDV) ribozyme RNA for precise crRNA processing [8]. Nearly 100% editing efficiency has been achieved using this system in transgenic rice [8]. To broaden the application of the Cas12a system, it has also been used for multiplexed genetic engineering. Multiplex strategies have been demonstrated in plants include using CRISPR arrays, CRISPR arrays flanked by HH and HDV ribozymes or tRNAs, as well as using tRNA processing [22–25]. Recently, we compared 12 different Cas12a multiplexing strategies in rice and found the most robust and efficient system is the tandem HH-crRNA-HDV system [26]. In this system, both Cas12a and crRNAs are driven by Pol II promoters, and each crRNA is flanked by HH and HDV ribozyme RNAs [26]. The editing efficiency reached 100% for targeting four genes simultaneously in rice [26]. In this chapter, we describe a module-based assembly method for the T-DNA vector construction of this highly efficient multiplexing system (Fig. 1). This protocol uses two maize ubiquitin 1 promoters (pZmUbi) for Cas12a and crRNA expression, respectively, and includes assembly strategies to multiplex up to 16 crRNAs. Different promoters and more than 16 crRNAs can be used for diverse plant species and projects using the same protocol.

2

Materials 1. DNA oligonucleotides for crRNAs. Genome sequences for targeted regions are required for crRNA design. CRISPR crRNA designing tools include CRISPR-P v2.0 [27], CHOPCHOP [28], CRISPR-DT [29] and Benchling (https://

Multiplexed CRISPR-Cas12a Genome Editing P

P

P

P

1

P

P

P

P

2

crRNA2

crRNA3

crRNA5

crRNA4

crRNA6

crRNA7

crRNA8

P

P

P

pYPQ131 pYPQ132 pYPQ133 pYPQ134 crRNA9

crRNA10

crRNA11

P

P

P

pYPQ131 pYPQ132 pYPQ133 pYPQ134 crRNA13

crRNA12

P

P

P

P P

P

P

P

P

pYPQ131 pYPQ132 pYPQ133 pYPQ134

pYPQ131 pYPQ132 pYPQ133 pYPQ134 crRNA1

P

P

P

P

P

P

P

P

P

43

crRNA14

crRNA15

crRNA16

pZmUbi attL2

attL5

attL2

attL5

attL2

attL5

pYPQ144

pYPQ144-ZmUbi-pT

attL2

attL5

pYPQ144

pYPQ144

pZmUbi attL2

crRNA1-4

attL5

crRNA5-8

attL5

pGG_1

attL2

attL2

crRNA9-12

attL5

pGG_3

pGG_2

attL2

crRNA13-16

attL5

pGG_4

SpeI

NcoI crRNA9-12

3

XbaI attL5

attL2

crRNA13-16

NcoI SpeI

NcoI crRNA5-8

AflII or BbsI

XbaI

pZmUbi attL5

attL5

SpeI

crRNA9-16

attL2

NcoI

crRNA1-4

XbaI attL2

crRNA5-16

AflII or BbsI pZmUbi attL2

crRNA1-16

attL5

crRNA entry vector pZmUbi

4

Cas12a

attL1

attR5

attR1

Cas12a entry vector

pZmUbi

ccdB

attR2

Destination vector

pZmUbi Cas12a

crRNA1-16

Final T-DNA vector

Fig. 1 T-DNA vector construction system for multiplexed CRISPR-Cas12a genetic engineering with 16 crRNAs. Step 1: construction of modular crRNA expression cassettes. Synthesized DNA oligonucleotides are phosphorylated, annealed, and cloned into linearized crRNA expression plasmids at the Eps3I (BsmBI) site. Step 2: assembly of multiple crRNAs. Modular crRNA expression cassettes are assembled with the corresponding recipient plasmids using the Golden Gate assembly method. Step 3: higher-order assembly of multiple crRNAs. crRNAs from different Golden Gate assembled plasmids are assembled together with multiple rounds of restriction enzyme digestion and ligation steps. Step 4: T-DNA assembly for multiplexed genome engineering. The crRNA entry vector, Cas12a entry vector and the destination vector are assembled using a three-way Gateway LR reaction

44

Yingxiao Zhang and Yiping Qi

Table 1 Golden Gate and Gateway compatible vectors for assembly of the multiplex CRISPR-Cas12asystem for plant genetic engineering Vector type

Vector name (Addgene #)

crRNA cloning pYPQ131-STU-Lb (#138096); pYPQ132-STU-Lb (#138099); vector pYPQ133-STU-Lb (#138102); pYPQ134-STU-Lb (#138105); pYPQ131-STU-As (#138094); pYPQ132-STU-As (#138097); pYPQ133-STU-As (#138100); pYPQ134-STU-As (#138103); pYPQ131-STU-Fn (#138095); pYPQ132-STU-Fn (#138098); pYPQ133-STU-Fn (#138101); pYPQ134-STU-Fn (#138104)

Reference [26]

Recipient vector

pYPQ142 (#69294); pYPQ143 (#69295); pYPQ144 (#69296) pYPQ142-ZmUbi (#138106); pYPQ143-ZmUbi (#138107); pYPQ144ZmUbi-pT (#138108)

[30] [26]

Cas12a entry vector

pYPQ230 (Lb editing; #86210); pYPQ220 (As editing; #86208); pYPQ233 (Lb repression; #86211); pYPQ223 (As repression; #86209) pYPQ239 (Fn editing; #108859)

[8] [11]

pYPQ203 (pZmUbi #86207); pYPQ202 (pAtUbi10 #86198)

[8]

Destination vector

benchling.com). Potential off-target sites can be predicted if the whole genome sequence is available. 2. Plasmids. All vectors included in this CRISPR-Cas12a multiplex toolbox are summarized in Table 1. They are all available from Addgene (https://www.addgene.org). 3. Sequencing primers: pTC14-F2 (50 -CAAGCCTGATTGGGA GAAAA -30 ), Ubi-intron-F1 (50 - CCCTGTTGTTTGGTGTT ACTTC -30 ), M13-F1 (50 0 0 TTCCCAGTCACGACGTTGTAAAAC-3 ), M13-R1 (5 - TT TGAGACACGGGCCAGAGCTGC-30 ). 4. Heating block or water bath, hotplate stirrer. 5. Temperature controlled shaker, incubator. 6. NanoDropTM One UV-Visible spectrophotometer or other equipment for DNA quantification. 7. Equipment and supplies for agarose gel electrophoresis. 8. QIAquick Gel Extraction Kit (Qiagen) or other gel extraction kit. 9. IBI scientific Hi-Speed Mini Plasmid Kit (IBI Scientific) or other plasmid Miniprep kit (see Note 1). 10. Restriction enzymes and their reaction buffers: Esp3I (BsmBI) (Thermo Fisher Scientific), BsaI, NcoI-HF, SpeI-HF, XbaI, AflII (or BbsI-HF), EcoRI-HF (New England Biolabs). 11. 10 mM DL-dithiothreitol (DTT).

Multiplexed CRISPR-Cas12a Genome Editing

45

12. T4 DNA Ligase and 10 T4 DNA Ligase Buffer (New England Biolabs). 13. T4 polynucleotide kinase (PNK) and 10 T4 PNK reaction buffer, 10 mM ATP (New England Biolabs). 14. Gateway™ LR Clonase™ II Enzyme Mix (Thermo Fisher Scientific). 15. LB liquid medium: dissolve 1% (w/v) tryptone, 0.5% (w/v) yeast extract, and 1% (w/v) sodium chloride (NaCl) in water and sterilize by autoclaving. 16. LB solid medium: dissolve 1% (w/v) tryptone, 0.5% (w/v) yeast extract and 1% (w/v) sodium chloride (NaCl) in water. Add 1.5% (w/v) agar before autoclaving. Cool autoclaved medium to about 60  C and add antibiotics. Pour medium into sterilized plates and leave them to solidify. 17. Antibiotic stock solutions (1000): 10 mg/mL tetracycline, 50 mg/mL spectinomycin, and 50 mg/mL kanamycin. Tetracycline is dissolved in 70% ethanol. Spectinomycin and kanamycin are dissolved in water and sterilized using 0.22μm syringe filter. Stock solutions are aliquoted to 2 mL tubes and stored at 20  C. 18. 20 mg/mL 5-bromo-4-chloro-3-indolyl β-D-galactopyranoside (X-gal). 19. 0.1 M isopropyl β-D-1-thiogalactopyranoside (IPTG). 20. 50% glycerol: mix equal amount of glycerol and water and sterilize by autoclaving. 21. 1 kb DNA ladder and 6 gel loading dye (New England Biolabs). 22. Chemically competent cells: E. coli strain DH5α for cloning and ccdB tolerance E. coli strain (such as DB3.1) for destination vector. Other E. coli strains can also be used for faster growth, plasmid stability, or large plasmid tolerance.

3

Methods

3.1 Construction of Modular crRNA Expression Cassettes

1. Design crRNAs for multiplexed genome editing. Design crRNAs at desired genomic regions using a CRISPR crRNA designing software. Use 50 -TTTV-30 PAM sequence for AsCas12a and LbCas12a while 50 -TTV-30 PAM sequence for FnCas12a. If other Cas12a orthologs are used, choose the corresponding PAM sequence for crRNA design. Choose crRNAs with high expected editing efficiency. Avoid crRNAs with extreme GC content, strong secondary structures and restriction enzyme sites that will be used later for cloning. Add 50 -TAGAT-30 to the forward oligonucleotide (50 -

46

Yingxiao Zhang and Yiping Qi

TAGATNNNNNNNNNNNNNNNNNNNNNNN -30 ) and 50 -GGCC-30 and 50 -A-30 to the reverse oligonucleotide (50 -G GCCNNNNNNNNNNNNNNNNNNNNNNNA -30 ) for crRNA cloning. 2. Synthesize crRNAs as duplexed DNA oligonucleotides. Dissolve lyophilized DNA oligonucleotides with DNase-free water (see Note 2). The final concentration of DNA oligonucleotides is 100μM. 3. Phosphorylate DNA oligonucleotides (Table 2). Mix each reaction and incubate at 37  C for 30 min. Reactions can be inactivated by incubating at 65  C for 20 min. Inactivation step can be ignored if reactions are immediately used for crRNA annealing. 4. Anneal duplexed DNA oligonucleotides. Place phosphorylated oligonucleotides in boiled water and remove the heat. When the samples are cooled to room temperature, dilute each sample 200 times. Annealed DNA oligonucleotides can be stored in 20  C freezer for repeated uses. 5. Choose empty crRNA cloning plasmids. Choose the corresponding crRNA scaffold for the Cas12 nuclease that will be assembled later. Choose As crRNA scaffold for AsCas12a; Lb crRNA scaffold for LbCas12a; Fn crRNA scaffold for all other Cas12a nucleases. The plasmids need to be used for cloning are listed in Table 3 for different numbers of crRNAs that will be multiplexed in one construct. 6. Digest crRNA cloning plasmids (Table 4). Mix each reaction and incubate at 37  C for at least one hour. Run digested plasmids on an 1% agarose gel. Excise the band with correct band size with a sharp scalpel. Recover digested plasmids using a gel extraction kit. Measure the concentration of recovered plasmids using a spectrophotometer (see Note 3).

Table 2 DNA oligonucleotides phosphorylation Component

Volume (μL)

crRNA forward oligo (100μM)

1

crRNA reverse oligo (100μM)

1

T4 PNK reaction buffer (10)

1

ATP (10 mM)

1

T4 PNK (10 U/μL)

0.5 (5 U)

Water

5.5

Total

10

Multiplexed CRISPR-Cas12a Genome Editing

47

Table 3 crRNA cloning plasmids crRNA numbers

2

3

4

5

6

7

pYPQ131-STU-Lb/As/Fn

√

√

√

√

√

√

pYPQ132-STU-Lb/As/Fn

√

√

√

√

√

√

√

√

√

√

√

pYPQ133-STU-Lb/As/Fn

√

pYPQ134-STU-Lb/As/Fn

√

Table 4 Empty crRNA cloning plasmid digestion Component

Volume (μL)

pYPQ131/2/3/4-STU-Lb/As/Fn

20 (2μg)

Buffer Tango (10)

5

DTT (10 mM)

5

Esp3I (BsmBI) (10 U/μL)

2 (20 U)

Water

18

Total

50

Table 5 Modular crRNA expression vector ligation Component

Volume (μL)

Esp3I (BsmBI) linearized pYPQ131/2/3/4-STU-Lb/As/Fn

2 (60 ng, 0.02 pmol)

Diluted annealed oligos (1:200 dilution)

2

T4 DNA ligase buffer (10)

2

T4 DNA ligase (400 U/μL)

1 (400 U)

Water

13

Total

20

7. Ligate phosphorylated, annealed, and diluted DNA oligonucleotides with digested crRNA cloning plasmids (see Table 5 and Note 4). The crRNAs should be ligated with their corresponding cloning plasmid, so that they can be used for Golden Gate assembly and higher-order assembly later. If more than four crRNAs will be assembled together for multiplexed genome engineering, divide them into groups of two to four

48

Yingxiao Zhang and Yiping Qi

crRNAs. The crRNAs from each group will be assembled together first using Golden Gate cloning, and all groups will be assembled together using the higher-order assembly method. One example of the cloning strategy is listed in Table 6 (see Note 5). Mix and incubate reactions at the room temperature (~25  C) for at least 10 min or at 16  C overnight (see Note 6). 8. Transform reactions into 50μL E. coli DH5α competent cells using the heat shock method (see Note 7). Spread E. coli cells onto selection LB solid plates supplemented with 10 mg/L tetracycline and incubate at 37  C overnight. 9. Pick two colonies from each plate. Inoculate 5 mL LB liquid medium supplemented with 10 mg/L tetracycline. After culturing at 37  C overnight, isolate plasmid DNA using the alkaline lysis method with a Miniprep kit or homemade solutions. 10. The successful cloning of crRNA can be confirmed by Sanger sequencing using primer pTC14-F2.

3.2 Assembly of Multiple crRNAs

1. Assemble 2–4 modular crRNA expression cassettes with the corresponding recipient plasmid using the Golden Gate assembly method (Table 7). One example of the cloning strategy is listed in Table 6 (see Note 5). Mix each reaction and incubate in a thermocycler (Table 8). 2. Transform reactions into E. coli DH5α competent cells using the heat shock method. For blue-white screen, spread 50μL X-gal (5-bromo-4-chloro-3-indolyl β-D-galactopyranoside) (20 mg/mL) and 50μL IPTG (isopropyl β-D-1-thiogalactopyranoside) (0.1 M) on LB plates supplemented with 50 mg/L spectinomycin. Dry the plates in a laminar flow hood for 10–30 min. Spread E. coli cells onto plates and incubate at 37  C overnight. 3. Pick two white colonies from each plate. Inoculate 5 mL LB liquid medium supplemented with 50 mg/L spectinomycin. After culturing at 37  C overnight, isolate plasmid DNA using the alkaline lysis method with a Miniprep kit or homemade solutions. 4. Confirm plasmids by the restriction enzyme digestion method followed by Sanger sequencing. Use primers Ubi-intron-F1 (50 -CCCTGTTGTTTGGTGTTACTTC-30 ) and M13-R1 (50 TTTGAGACACGGGCCAGAGCTGC -30 ) for plasmids with pZmUbi and primers M13-F1 (50 - TTCCCAGTCAC GACGTTGTAAAAC -30 ) and M13-R1 (50 - TTTGAGA CACGGGCCAGAGCTGC-30 ) for plasmids without pZmUbi.

crRNA3

pYPQ133STU-Lb/ As/Fn

5

crRNA5

pYPQ132STU-Lb/ As/Fn

pYPQ134STU-Lb/ As/Fn

pYPQ133STU-Lb/ As/Fn

crRNA4

crRNA4

crRNA3 crRNA3

crRNA2 crRNA2

crRNA1 crRNA1

4

pYPQ131STU-Lb/ As/Fn

pYPQ134STU-Lb/ As/Fn

crRNA2 crRNA2

3

pYPQ132STU-Lb/ As/Fn

2

crRNA1 crRNA1

pYPQ131STU-Lb/ As/Fn

Total crRNA numbers

crRNA6

crRNA5

crRNA4

crRNA3

crRNA2

crRNA1

6

8

crRNA8

crRNA7 crRNA7

crRNA6 crRNA6

crRNA5 crRNA5

crRNA4 crRNA4

crRNA3 crRNA3

crRNA2 crRNA2

crRNA1 crRNA1

7

Table 6 Multiplexed genetic engineering vector assembly strategy

crRNA7

crRNA6

crRNA5

crRNA4

crRNA3

crRNA2

crRNA1

9

crRNA8

crRNA7

crRNA6

crRNA5

crRNA4

crRNA3

crRNA2

crRNA1

10

crRNA8

crRNA7

crRNA6

crRNA5

crRNA4

crRNA3

crRNA2

crRNA1

11

crRNA8

crRNA7

crRNA6

crRNA5

crRNA4

crRNA3

crRNA2

crRNA1

12

crRNA8

crRNA7

crRNA6

crRNA5

crRNA4

crRNA3

crRNA2

crRNA1

13

crRNA8

crRNA7

crRNA6

crRNA5

crRNA4

crRNA3

crRNA2

crRNA1

14

crRNA8

crRNA7

crRNA6

crRNA5

crRNA4

crRNA3

crRNA2

crRNA1

15

crRNA8

crRNA7

crRNA6

crRNA5

crRNA4

crRNA3

crRNA2

crRNA1

16

pYPQ142

pYPQ142ZmUbi

2 crRNAs

pYPQ143

pYPQ143ZmUbi

3 crRNAs

pYPQ144

pYPQ144ZmUbipT

4 crRNAs

Recipient plasmid for Golden Gate assembly

(continued)

pGG_2

pGG_1

Golden Gate assembled plasmid

5

6

7

8

9 crRNA9

12

crRNA13

pYPQ132STU-Lb/ As/Fn

pYPQ134STU-Lb/ As/Fn

pYPQ133STU-Lb/ As/Fn

crRNA12

crRNA12

pYPQ134STU-Lb/ As/Fn

crRNA11

crRNA10

crRNA9

13

pYPQ131STU-Lb/ As/Fn

crRNA11 crRNA11

crRNA10 crRNA10

crRNA9

11

pYPQ133STU-Lb/ As/Fn

crRNA9

10

crRNA9 crRNA10

4

pYPQ132STU-Lb/ As/Fn

3 crRNA8

2

pYPQ131STU-Lb/ As/Fn

Total crRNA numbers

Table 6 (continued)

crRNA14

crRNA13

crRNA12

crRNA11

crRNA10

crRNA9

14

crRNA15

crRNA14

crRNA13

crRNA12

crRNA11

crRNA10

crRNA9

15

crRNA16

crRNA15

crRNA14

crRNA13

crRNA12

crRNA11

crRNA10

crRNA9

16

pYPQ142

pYPQ142

2 crRNAs

pYPQ143

pYPQ143

3 crRNAs

pYPQ144

pYPQ144

4 crRNAs

Recipient plasmid for Golden Gate assembly

pGG_4

pGG_3

Golden Gate assembled plasmid

Multiplexed CRISPR-Cas12a Genome Editing

51

Table 7 Golden Gate assembly of multiple crRNAs Volume for two crRNAs (μL)

Volume for three crRNAs (μL)

Volume for four crRNAs (μL)

pYPQ131-STU-As/Fn/ Lb-crRNA

1 (100 ng)

1 (100 ng)

1 (100 ng)

pYPQ132-STU-As/Fn/ Lb-crRNA

1 (100 ng)

1 (100 ng)

1 (100 ng)

1 (100 ng)

1 (100 ng)

Component

pYPQ133-STU-As/Fn/ Lb-crRNA pYPQ134-STU-As/Fn/ Lb-crRNA

1 (100 ng)

Recipient plasmid

1 (100 ng)

1 (100 ng)

1 (100 ng)

T4 DNA ligase buffer (10)

2

2

2

BsaI

2 (20 U)

2 (20 U)

2 (20 U)

T4 DNA ligase (400 U/μL) 2 (800 U)

2 (800 U)

2 (800 U)

Water

11

10

9

Total

20

20

20

Table 8 Golden Gate reaction program Temperature ( C)

Time (min)

Cycles

37

5

10

16

10

50

5

1

80

5

1

3.3 Higher-Order Assembly of Multiple crRNAs

1. If more than four crRNAs are used, higher-order assembly is required (see Note 8). Name all Golden Gate assembled plasmids as pGG_1, pGG_2,·. . ., pGG_N-1, pGG_N, according to the crRNA positions (Table 6). pGG_1 is the plasmid with pZmUbi. The crRNAs in pGG_1 should be located at the beginning of the crRNA expression cassette in the final crRNA entry vector. The crRNAs in pGG_N should be located at the end of the crRNA expression cassette. 2. To insert crRNAs in pGG_N-1 to pGG_N, digest pGG_N-1 with NcoI and SpeI, and digest pGG_N with NcoI and XbaI (Table 9). Run digested plasmids on a 1% agarose gel. Excise the bands containing crRNAs with a sharp scalpel. Recover

52

Yingxiao Zhang and Yiping Qi

Table 9 Golden Gate assembled plasmid digestion

Component

Volume for pGG_1 (μL)

Volume for pGG_N-1 (μL)

Volume for pGG_N (μL)

Plasmid

20 (2μg)

20 (2μg)

20 (2μg)

CutSmart buffer (10)

5

5

5

1 (20 U)

1 (20 U)

AflII (or BbsI-HF) (20 U/μ 1 (20 U) L) NcoI-HF (20 U/μL) SpeI-HF (20 U/μL)

1 (20 U)

1 (20 U)

XbaI (20 U/μL)

1 (20 U)

Water

23

23

23

Total

50

50

50

Table 10 Higher-order assembly ligation reaction Component

Volume (μL)

Digested pGG_1 or pGG_N-1

6 (0.06 pmol)

Digested pGG_N

2 (0.02 pmol)

T4 DNA ligase buffer (10)

2

T4 DNA ligase (400 U/μL)

1 (400 U)

Water

9

Total

20

digested plasmids using a gel extraction kit. Measure the concentration of recovered plasmids using a spectrophotometer. 3. Ligate digested plasmids fragments (Table 10). Mix and incubate reactions at room temperature (~25  C) for at least 10 min or at 16  C overnight. 4. Transform reactions into E. coli DH5α competent cells using the heat shock method. Spread E. coli cells onto selection LB solid plates supplemented with 50 mg/L spectinomycin and incubate at 37  C overnight. 5. Pick two colonies from each plate. Inoculate 5 mL LB liquid medium supplemented with 50 mg/L spectinomycin. After culturing at 37  C overnight, isolate plasmid DNA using the alkaline lysis method with a Miniprep kit or homemade solutions.

Multiplexed CRISPR-Cas12a Genome Editing

53

6. Confirm plasmids by restriction enzyme digestion method followed by Sanger sequencing using primers M13-F1 (50 -TTC CCAGTCACGACGTTGTAAAAC -30 ) and M13-R1 (50 TTTGAGACACGGGCCAGAGCTGC -30 ). If the full length of the crRNA expression cassette cannot be covered, DNA oligonucleotides used for crRNA annealing can be used as sequencing primers. 7. Repeat steps 2–5 to insert another group of crRNAs from the Golden Gate assembled plasmids. For crRNAs located in pGG_1, use AflII (or BbsI) and SpeI to digest the plasmid, so that both pZmUbi and crRNAs can be inserted. Confirm the final crRNA entry vector by restriction enzyme digestion method followed by Sanger sequencing. 3.4 T-DNA Assembly for Multiplexed Genome Engineering

1. Assemble the crRNA entry vector, the codon optimized Cas12a entry vector and the destination vector using a threeway Gateway LR reaction (Table 11). The promoter for Cas12a expression is included in the destination vectors, which also harbor resistance genes for the selection during transgenic plants regeneration. These elements in destination vectors can be optimized for different plant species. 2. Transform reactions into E. coli DH5α competent cells using the heat shock method. Spread E. coli cells onto selection LB solid plates supplemented with 50 mg/L kanamycin and incubate at 37  C overnight. 3. Pick two colonies from each plate to inoculate 5 mL LB liquid medium supplemented with 50 mg/L kanamycin. After culturing at 37  C overnight, isolate plasmid DNA using the alkaline lysis method with a Miniprep kit or homemade solutions. 4. Confirm plasmids by the restriction enzyme digestion method using EcoRI (see Note 9). E. coli cells harboring confirmed plasmids can be stored in 25% glycerol (mix cell culture and 50% glycerol at 1:1 ratio) at 80  C. These plasmids can be

Table 11 Three-Way Gateway LR reaction Component

Volume (μL)

Cas12a entry vector

1.5 (150 ng)

crRNA entry vector

1 (100 ng)

Destination vector

2 (200 ng)

LR Clonase II

1

Total

5.5

54

Yingxiao Zhang and Yiping Qi

used for Agrobacterium- or biolistic-mediated plant transformation, as well as polyethylene glycol (PEG)-mediated protoplast transformation.

4

Notes 1. Silica-membrane based miniprep kit is not required. Homemade solutions for alkaline lysis method can also be used for plasmid isolation. 2. All water used in the described protocol is DNase-free, sterilized molecular grade water. 3. Agarose gel electrophoresis of digested plasmids is not required if the cut-off fragments are too small to be purified by a gel extraction kit. However, purification of digested plasmids by gel electrophoresis can reduce the contamination of undigested plasmids, increasing the success rate of crRNA cloning. 4. Control reactions can be set using digested plasmids without annealed DNA oligonucleotides. A high colony number observed for control reactions indicates a high degree of incomplete digestion or a high chance of self-ligation. 5. The first column of Table 6 includes the corresponding crRNA cloning plasmids needed to assemble certain number of crRNAs into one construct. The recipient plasmids were listed on the right with their corresponding modular crRNA expression cassettes on the left. The last column includes the names of Golden Gate assembled plasmids. For example, to assemble 13 crRNAs into one construct for LbCas12a genome editing, clone crRNA1, crRNA5, crRNA9, and crRNA12 into pYPQ131-STU-Lb individually; Clone crRNA2, crRNA6, crRNA10, and crRNA13 into pYPQ132-STU-Lb individually; Clone crRNA3, crRNA7, and crRNA11 into pYPQ133-STULb individually; Clone crRNA4 and crRNA8 into pYPQ134STU-Lb individually. Modular expression cassettes for crRNA1–4 will then be assembled with pYPQ144-ZmUbi-pT using Golden Gate cloning and the assembled vector will be renamed as pGG_1. Modular expression cassettes for crRNA58 will be assembled with pYPQ144 and renamed as pGG_2. Modular expression cassettes for crRNA9-11 will be assembled with pYPQ143 and renamed as pGG_3. Modular expression cassettes for crRNA12 and crRNA13 will be assembled with pYPQ142 and renamed as pGG_4. pGG_1–4 will be assembled together using the higher-order assembly method. 6. If reactions are not immediately used for transformation after ligation, heat inactivate reactions by incubating at 65  C for

Multiplexed CRISPR-Cas12a Genome Editing

55

10 min. If faster ligation is needed, the Instant Sticky-end Ligase Master Mix (New England Biolabs) can be used. 7. Ligated plasmids can also be transformed into E. coli by electroporation. Electro-competent E. coli cells need to be prepared. Other E. coli strains can also be used for transformation if there are other preferences, such as fast growth rate, etc. 8. Modular crRNA cloning plasmids and recipient plasmids can be generated for the Golden Gate assembly for more than four crRNAs. The success rate of correct assembly may be negatively correlated with the number of insert plasmids used for the Golden Gate assembly. The higher-order assembly method described in this protocol is an efficient cloning method to assemble a high number of crRNAs without extra modular crRNA cloning plasmids and recipient plasmids. 9. No PCR steps are involved in this protocol, reducing the possibility to introduce random mutations into plasmids. Therefore, Sanger sequencing the final T-DNA vector is optional. It is usually sufficient to confirm the plasmids by EcoRI digestion.

Acknowledgments This work was supported by the National Science Foundation Plant Genome Research Program (award no. IOS-1758745 and IOS-2029889), the U.S. Department of Agriculture Biotechnology Risk Assessment Grant Program (award no. 2020-3352232274), Foundation for Food and Agriculture Research grant (award no. 593603), and Syngenta. References 1. Molla KA, Karmakar S, Islam MT (2020) Wide horizons of CRISPR-Cas-derived technologies for basic biology, agriculture, and medicine. In: Islam MT, Bhowmik PK, Molla KA (eds) CRISPR-Cas methods. Springer US, New York, NY, pp 1–23 2. Li J-F, Norville JE, Aach J et al (2013) Multiplex and homologous recombination-mediated genome editing in Arabidopsis and Nicotiana benthamiana using guide RNA and Cas9. Nat Biotechnol 31:688–691 3. Nekrasov V, Staskawicz B, Weigel D et al (2013) Targeted mutagenesis in the model plant Nicotiana benthamiana using Cas9 RNA-guided endonuclease. Nat Biotechnol 31:691–693 4. Shan Q, Wang Y, Li J et al (2013) Targeted genome modification of crop plants using a

CRISPR-Cas system. Nat Biotechnol 31:686–688 5. Zhang Y, Malzahn AA, Sretenovic S et al (2019) The emerging and uncultivated potential of CRISPR technology in plant science. Nat Plants 5:778–794 6. Ming M, Ren Q, Pan C et al (2020) CRISPR–Cas12b enables efficient plant genome engineering. Nat Plants 6:202–208 7. Endo A, Masafumi M, Kaya H et al (2016) Efficient targeted mutagenesis of rice and tobacco genomes using Cpf1 from Francisella novicida. Sci Rep 6:38169 8. Tang X, Lowder LG, Zhang T et al (2017) A CRISPR–Cpf1 system for efficient genome editing and transcriptional repression in plants. Nat Plants 3:17103

56

Yingxiao Zhang and Yiping Qi

9. Zetsche B, Gootenberg JS, Abudayyeh OO et al (2015) Cpf1 Is a single RNA-guided endonuclease of a Class 2 CRISPR-Cas system. Cell 163:759–771 10. Xu R, Qin R, Li H et al (2017) Generation of targeted mutant rice using a CRISPR-Cpf1 system. Plant Biotechnol J 15:713–717 11. Zhong Z, Zhang Y, You Q et al (2018) Plant genome editing using FnCpf1 and LbCpf1 nucleases at redefined and altered PAM sites. Mol Plant 11:999–1002 12. Yin X, Biswal AK, Dionora J et al (2017) CRISPR-Cas9 and CRISPR-Cpf1 mediated targeting of a stomatal developmental gene EPFL9 in rice. Plant Cell Rep 36:745–757 13. Hu X, Wang C, Liu Q et al (2017) Targeted mutagenesis in rice using CRISPR-Cpf1 system. J Genet Genomics 44:71–73 14. Malzahn AA, Tang X, Lee K et al (2019) Application of CRISPR-Cas12a temperature sensitivity for improved genome editing in rice, maize, and Arabidopsis. BMC Biol 17:9 15. Schindele P, Puchta H (2020) Engineering CRISPR/LbCas12a for highly efficient, temperature-tolerant plant gene editing. Plant Biotechnol J 18:1118–1120 16. Kim H, Kim S-T, Ryu J et al (2017) CRISPR/ Cpf1-mediated DNA-free plant genome editing. Nat Commun 8:14406 17. Lee K, Zhang Y, Kleinstiver BP et al (2019) Activities and specificities of CRISPR-Cas9 and Cas12a nucleases for targeted mutagenesis in maize. Plant Biotechnol J 17:362–372 18. Vu TV, Sivankalyani V, Kim E-J et al (2020) Highly efficient homology-directed repair using CRISPR/Cpf1-geminiviral replicon in tomato. Plant Biotechnol J 18:2133–2143 19. Jia H, Orbovic´ V, Wang N (2019) CRISPRLbCas12a-mediated modification of citrus. Plant Biotechnol J 17:1928–1937 20. Li B, Rui H, Li Y et al (2019) Robust CRISPR/Cpf1 (Cas12a)-mediated genome

editing in allotetraploid cotton (Gossypium hirsutum). Plant Biotechnol J 17:1862–1864 21. Liu H, Wang K, Jia Z et al (2020) Efficient induction of haploid plants in wheat by editing of TaMTL using an optimized Agrobacteriummediated CRISPR system. J Exp Bot 71:1337–1349 22. Wang M, Mao Y, Lu Y et al (2017) Multiplex gene editing in rice using the CRISPR-Cpf1 system. Mol Plant 10:1011–1013 23. Tang X, Ren Q, Yang L et al (2019) Single transcript unit CRISPR 2.0 systems for robust Cas9 and Cas12a mediated plant genome editing. Plant Biotechnol J 17:1431–1445 24. Hu X, Meng X, Li J et al (2020) Improving the efficiency of the CRISPR-Cas12a system with tRNA-crRNA arrays. Crop J 8:403–407 25. Wang M, Mao Y, Lu Y et al (2018) Multiplex gene editing in rice with simplified CRISPRCpf1 and CRISPR-Cas9 systems: Simplified single transcriptional unit CRISPR systems. J Integr Plant Biol 60:626–631 26. Zhang Y, Ren Q, Tang X, et al (2021) Expanding the scope of plant genome engineering with Cas12a orthologs and highly multiplexable editing systems. Nat Commun 12:1944 27. Liu H, Ding Y, Zhou Y et al (2017) CRISPR-P 2.0: an improved CRISPR-Cas9 tool for genome editing in plants. Mol Plant 10:530–532 28. Labun K, Montague TG, Krause M et al (2019) CHOPCHOP v3: expanding the CRISPR web toolbox beyond genome editing. Nucleic Acids Res 47:W171–W174 29. Zhu H, Liang C (2019) CRISPR-DT: designing gRNAs for the CRISPR-Cpf1 system with improved target efficiency and specificity. Bioinformatics 35:2783–2789 30. Lowder LG, Paul JW, Baltes NJ et al (2015) A CRISPR/Cas9 toolbox for multiplexed plant genome editing and transcriptional regulation. Plant Physiol 169:971–985

Chapter 5 CRISPR-dCas9-Based Targeted Manipulation of DNA Methylation in Plants Basudev Ghoshal and Jason Gardiner Abstract DNA cytosine methylation is an important epigenetic mark involved in the regulation of gene expression, transposon silencing, and genome integrity. In plants, targeted manipulation of DNA methylation is achieved via artificial zinc finger (ZF) or clustered regularly interspaced short palindromic repeats (CRISPR)-based tools. These tools can recruit various effectors, which can catalyze either the addition or removal of DNA methylation at a specific locus. The relatively low cost and ease of targeting specific regions within the genome by CRISPR-based systems make these tools an attractive option for targeted manipulation of DNA methylation. Here, we provide a detailed protocol for generating CRISPR-based constructs designed to add or remove DNA methylation in plants in a sequence-specific manner, using the SunTag system. We also discuss methods for analyzing DNA methylation data to validate the effectiveness and specificity of the construct. Our protocol will make these tools accessible to individuals interested in targeted manipulation of DNA methylation in plants for basic research or crop engineering. Key words Epigenetics, CRISPR-Cas9, DNA methylation, Targeting, SunTag, Arabidopsis thaliana, Gene silencing, RNA-directed DNA methylation (RdDM), Epigenome editing, Gene regulation

Abbreviations CRISPR-Cas RdDM

1

Clustered regularly interspaced short palindromic repeats-CRISPR associated RNA-directed DNA methylation

Introduction DNA cytosine methylation is an epigenetic mark that is usually associated with transcriptional gene silencing [1, 2]. In plants, DNA cytosine methylation occurs in all sequence contexts,

Basudev Ghoshal and Jason Gardiner contributed equally. M. Tofazzal Islam and Kutubuddin Ali Molla (eds.), CRISPR-Cas Methods: Volume 2, Springer Protocols Handbooks, https://doi.org/10.1007/978-1-0716-1657-4_5, © The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2021

57

58

Basudev Ghoshal and Jason Gardiner

commonly separated into CG, CHG, and CHH (H ¼ A, T, C) [3, 4]. Plants have several pathways that act to maintain existing methylation, add de novo methylation, or remove methylation [2, 5]. Until recently, studies of the function of DNA methylation relied heavily on either the mutation of components in these pathways or the application of chemicals that inhibit DNA methylation maintenance [6–9]. Although these approaches remain instrumental in studying the function of DNA methylation, they cause genome-wide changes in DNA methylation that are often accompanied by complex and indirect effects on gene expression and phenotype. Thus, the ability to directly add or remove DNA methylation at specific loci is key to advancing our understanding of the function of DNA methylation. In the past several years, numerous tools have revolutionized our ability for targeted modification of specific DNA sequences [10–14]. These systems recognize specific DNA sequences either via their protein structure (e.g., ZFs) or via a complementary RNA-molecule (CRISPR) [14]. While ZFs can effectively recognize their target sites, they are often not very specific and bind many off-target sites [15]. Designing novel ZFs to target new sites is also laborious and expensive, as a new target requires the development of an entirely new ZF protein [14]. Instead, the CRISPR system, where an endonuclease Cas9 is recruited to target loci by a complementary RNA-molecule called a guide RNA (gRNA), has emerged as the dominant technology for targeted genetic modification [16]. Targeting Cas9 to a new locus requires modifying a 20-bp sequence in the gRNA, making CRISPR cheap and easy to adapt for new target loci [17]. CRISPR systems can recruit effector proteins to specific target loci for applications beyond genome editing [11, 18, 19]. In these types of systems, an effector protein (e.g., a DNA methyltransferase) is fused to a catalytically inactive “dead” version of Cas9 (dCas9), which has lost its endonuclease activity but retains its DNA binding capacity [11, 18]. With this approach, each dCas9 recruits a single effector to the target locus. The use of the CRISPR-based “SunTag” system increases potency by enabling each dCas9 to recruit multiple copies of an effector protein to the same locus [20, 21]. The SunTag system consists of three expression cassettes: dCas9-fused to an amino acid tail containing repeating GCN4 epitope sites and linker sequences, a single-chain variable fragment (scFV) antibody derived from GCN4 fused to the effector protein, and a gRNA (Fig. 1) [21–23]. Thus, the SunTag system combines the targeting abilities of the dCas9 and the high affinity and specificity between antibody–epitope interactions to recruit multiple copies of the effector protein to a particular site in the genome, increasing the concentration of these effectors at the desired location.

Targeted Manipulation of DNA Methylation in Plants

59

Fig. 1 Schematic representation of the three modules that make up the SunTag system. Module 1 consists of a UBIQUITIN10 (UBQ10) promoter, the coding sequence of the deactivated spCas9 fused to a peptide containing 10 general control nondepressible 4 (GCN4) epitope sites separated by linkers that are 22 amino acids (aa) long, and an OCTOPINE SYNTHASE (OCS) terminator. Module 2 consists of a UBQ10 promoter, the coding sequence of the GCN4 Single-Chain Variable Fragment (scFV) fused to a superfolder green fluorescent protein (sfGFP), and either the catalytic domain of Nicotiana tabaccum DNA methyltransferase domains rearranged methyltransferase (NtDRMcd) or the catalytic domain of human ten-eleven translocation 1 (hTET1cd) followed by a NOPALINE SYNTHASE (NOS) terminator. Module 3 consists of a U6 promoter and the guide RNA (gRNA) sequence followed by a poly T signal

Recently, the CRISPR-based SunTag system was adapted for use in plants, using the catalytic domain of the Nicotiana tabaccum DNA methyltransferase domains rearranged methyltransferase (NtDRMcd) or the catalytic domain of human ten-eleven translocation 1 (hTET1cd) to target the addition or removal of DNA methylation, respectively [22, 23]. In this protocol, we will describe how to design and introduce custom gRNAs into the currently available NtDRMcd- or hTET1cd-based SunTag systems developed for targeted manipulation of DNA methylation in plants and will provide different strategies to screen plant lines for successful alterations of DNA methylation.

2

Materials

2.1

Plasmids

1. SunTag- hTET1cd/NtDRMcd plasmids from Addgene (Table 1).

2.2

Organisms

1. E. coli competent cells deficient in endA and recA such as NEB® stable Competent E. coli (Cat. # C3040I) (see Note 1). 2. Agrobacterium electro-competent cells such as AGL0 electrocompetent cells. 3. Arabidopsis thaliana plants (e.g., Columbia-0).

60

Basudev Ghoshal and Jason Gardiner

Table 1 Addgene ordering information

Plasmid

Addgene number

pEG302-SunTag-22aa-hTET1cd-FWAgRNA-4

115344

https://www.addgene.org/ 115344/

pEG302-SunTag-22aa-hTET1cd-no guide

115345

https://www.addgene.org/ 115345/

pEG302-SunTag-22aa-NtDRMcd-FWAgRNA-4

115486

https://www.addgene.org/ 115486/

pEG302-SunTag-22aa-NtDRMcd-FWAgRNA4,10,18

115487

https://www.addgene.org/ 115487/

pEG302-SunTag-22aa-NtDRMcd-no guide

115488

https://www.addgene.org/ 115488/

2.3

Reagents

Direct link

1. Synthesized primers (Table 2). 2. High fidelity polymerases such as NEB® Phusion® HighFidelity DNA Polymerase (Cat. # M0530S). 3. Ligation independent cloning kit such as Takara® In-Fusion® HD Cloning Plus (Cat. # 638910). 4. Restriction enzymes KpnI and McrBC. 5. Luria broth (LB) media. 6. LB agar plates containing appropriate antibiotics. 7. Rifampicin (working concentration ¼ 10 μg/ml). 8. Kanamycin (working concentration ¼ 50 μg/ml). 9. 5% sucrose. 10. Silwet L-77. 11. Agar plates containing 0.5 Murashige (MS) medium and the appropriate antibiotics.

and

Skoog

12. Cefotaxime (working concentration ¼ 100 μg/ml). 13. Hygromycin (working concentration ¼ 35 μg/ml). 14. Plant Cell Technology® Plant Preservative Mixture (Cat. # 100 PPM) (working concentration ¼ 0.1%). 15. DNA extraction kit such as Qiagen® QIAprep Spin Miniprep Kit (Cat. # 27104) or a commonly used protocol. 16. RNA extraction kit such as ZYMO Research® Direct-zol RNA Miniprep kit (Cat. # R2052) or a commonly used protocol. 17. cDNA synthesis kit such as Invitrogen™ SuperScript™ III First-Strand Synthesis System (Cat. # 18080051). 18. SYBR green for qPCR.

Targeted Manipulation of DNA Methylation in Plants

61

Table 2 List of primer sequences Guide

Sequence

Universal F1

GTCATCTATGTTACGAAGCTTTCGTTGAACAACGG

Universal R2

TCGTGCTCCACCATGGTACCAAAAAAAGCACCGAC TCGGTGC

Universal F1-alt

TCGGTGCTTTTTTTGAAGCTTTCGTTGAACAACGG

F2 for pEG302 vector In-Fusion cloning strategy

{Insert spacer sequence here}-GTTTTAGAGCTAGAAATAGC

R1 for pEG302 vector In-Fusion cloning strategy

{Insert reverse complement of spacer sequence here}-CAAT CACTACTTCGACTCTA

JP13199 (Genotyping primers)

GGCAGACAAACAAAAGAATGG

JP15049 (Forward Primers for qPCR after McrBC at FWA)

TTGGGTTTAGTGTTTACTTG

JP15050 (Forward Primers for qPCR after McrBC at FWA)

GAATGTTGAATGGGATAAGGTA

2.4

Instruments

1. Real-time quantitative PCR machine. 2. Electroporator. 3. Centrifuge. 4. Shaking incubator.

2.5 Horticultural Supplies

1. Plant growth chamber or facility. 2. Soil. 3. Plastic flats. 4. Pots. 5. Transparent plastic domes.

3

Methods

3.1 Description of the SunTag System Modules

The ability to recruit multiple copies of NtDRMcd or hTET1cd to a single target site makes the SunTag system highly efficient for targeted methylation editing. This system contains three core modules.

3.1.1 Module 1: dCas9-Fused to Epitope Tails

This module contains a dCas9 protein fused to an array of ten peptide epitope sequences recognized by the GCN4 antibody (Fig. 1). The epitopes are separated by linkers that are 22 amino

62

Basudev Ghoshal and Jason Gardiner

acids (aa) long, which are experimentally verified to work with both the NtDRMcd or hTET1cd SunTag systems in plants [22, 23]. A constitutive UBIQUITIN10 (UBQ10) promoter drives this module’s expression, and an OCTOPINE SYNTHASE (OCS) terminator causes transcriptional termination. 3.1.2 Module 2: GCN4 Single-Chain Variable Fragment Antibody Fused to NtDRMcd or hTET1cd

The second module contains the GCN4 single-chain variable fragment (scFV) antibody that recognizes the GCN4 epitope sequences in module 1 (Fig. 1). A fusion of this scFV antibody to a super folded GFP (sfGFP) followed by the catalytic domain of either NtDRMcd or hTET1cd can add or remove DNA methylation, respectively. A constitutive UBQ10 promoter drives this module’s expression, and an NOPALINE SYNTHASE (NOS) terminator causes transcriptional termination.

3.1.3 Module 3: gRNA Expression Cassette

The third module of this system is a standard U6-driven gRNA expression cassette used to direct module 1 to specific sites in the genome (Fig. 1). The module contains the gRNA sequence, consisting of a 20 bp sequence complementary to the target sequence (called the spacer sequence, or CRISPR RNA) and the dCas9 gRNA scaffold (trans-activating CRISPR RNA, or tracrRNA) required for binding to the dCas9. The U6 promoter, recognized by RNA polymerase III, drives the transcription of the gRNA, and a poly T termination signal terminates transcription. To target the SunTag system to a new region of interest requires adding a new gRNA expression cassette containing a spacer sequence that is complementary to the new target site. All other modules of the SunTag system remain static regardless of the target site. These three modules exist between the left and right T-DNA borders in a plant binary vector with a bacterial specific kanamycin resistance gene. The T-DNA region also contains a plant-specific hygromycin resistance gene for screening transgenic plants. Versions of this vector that do not have gRNAs are available to modify to develop custom targets (Table 1). After customization, these vectors are directly transformable into plants.

3.2

The initial development of the plant-specific SunTag system used the pMOA34 backbone [10, 12]. The SunTag system was transferred to the pEG302 backbone to improve plant transformation efficiency [12]. SunTag constructs using either the hTET1cd or the NtDRMcd are available through Addgene, a non-profit plasmid repository. To acquire these, visit Addgene.org and search for these plasmids using the plasmid number given in Table 1 or visit the corresponding web address listed in the same table.

Workflow

3.2.1 Step 1: Obtaining the SunTag System from Addgene

3.2.2 Step 2: Generating a Custom SunTag Vector

The steps for creating and inserting a single gRNA expression cassette into a no-guide SunTag vector are below:

Targeted Manipulation of DNA Methylation in Plants

63

Fig. 2 Depiction of PCR steps involved in generating a new gRNA expression cassette. PCR1 uses primers F1 or F1-alt combined with R1 to amplify the U6 promoter from an existing guide RNA (gRNA) expression cassette template while adding an In-Fusion overlap sequence to the 50 end and a new spacer sequence to the 30 end of the amplification product. PCR2 uses primers F2 and R2 to amplify the gRNA scaffold and poly T termination signal from an existing gRNA expression cassette template while adding a new spacer sequence to the 50 end and an In-Fusion overlap sequence to the 30 end of the amplification product. PCR3 uses the amplification products from PCR1 and PCR2 and the F1 and R2 primers to create the full-length gRNA expression cassette that can then be cloned into the SunTag system. All primers are listed in Table 2

1. The first step in generating a custom SunTag vector is designing a gRNA sequence. Many different online resources are available for designing gRNAs (see Note 2) [17]. These online resources will provide a ranked list of possible spacer sequences at a particular locus based on a set of criteria such as the number of off-target sites and sequence composition (see Note 3). Any current strategy to design gRNAs for genome editing using Cas9 is likely to work well for designing gRNAs for the SunTag system (see Notes 4 and 5). 2. After a spacer sequence is selected, primers containing this spacer sequence need to be designed following the R1 and F2 primer templates in Table 2. The resulting R1 and F2 primers along with F1 and R2 primers already provided in Table 2 need to be synthesized. The following steps for the generation of a new gRNA expression cassette are depicted in Fig. 2. 3. Set up two polymerase chain reactions (PCR). One using the F1 + R1 primers and the other using the F2 + R2 primers (Table 2) (Fig. 2). Both reactions use template DNA already containing a functioning gRNA, such as in the Addgene plasmid 115344 (Table 1). The F1 + R1 and F2 + R2 PCRs will produce a 485-bp and a 123-bp product, respectively. Product sizes should be checked on a 2% agarose gel and gel purified. 4. Using 10 ng of each of the purified products from the above step in place of template DNA, set up another PCR using F1 + R2 as primers (Table 2). The overlapping regions

64

Basudev Ghoshal and Jason Gardiner

produced from the R1 and F2 primers paired with the two F1 and R2 universal primers produce the full gRNA expression cassette (Fig. 1). This reaction should produce a 588-bp product. Product size should be checked on a 2% agarose gel and then gel purified. 5. Digest 3 μg of the pEG302-SunTag-22aa-{hTET1cd or NtDRMcd}–no-guide vector with KpnI (Table 1). As the KpnI site is unique in both the NtDRMcd and the hTET1cd SunTag vectors, gel purification is not needed. Run 10% of this reaction on a 0.8% agarose gel to confirm the plasmid is linearized and column purify the remaining 90%. 6. Insert the purified PCR product from step III into the KpnIdigested pEG302-SunTag-22aa-{hTET1cd or NtDRMcd} [12]–no-guide vector from step IV by In-Fusion (Takara) reaction using the manufacturer’s protocol (see Note 6). 7. Transform In-Fusion product into competent E. coli cells (see Notes 1 and 7) and plate onto bacterial media containing kanamycin (50 μg/ml). 8. Inoculate one 2-ml culture using LB media containing kanamycin (50 μg/ml) for up to 10 of the resulting colonies and incubate overnight in incubator while shaking. 9. Isolate plasmids from the overnight cultures using any plasmid purification kit or in-house protocol. 10. To confirm that the gRNA is inserted into the pEG302-SunTag-22aa-{hTET1cd or NtDRMcd}–vector, Sanger sequence the resulting products using either F1 or R2 primer. The use of F1 and R2 universal primers provided in Table 2 results in a final PCR product with a unique KpnI site at the 30 end of the gRNA cassette. This KpnI site can be used to sequentially insert additional gRNA cassettes if multiple gRNAs are to be used. Multiple individual U6-driven expression cassettes can be cloned in tandem by repeating steps 1–10 with the F1-alt universal primer in place of the F1 primer (Table 2) (see Notes 8 and 9).

Table 3 List of bioinformatic tools for DNA methylation analysis Bioinformatic tool

Links to the tool on GitHub

Bismark

https://github.com/FelixKrueger/Bismark

BSMAP

https://github.com/genome-vendor/bsmap

ViewBS

https://github.com/xie186/ViewBS

BSseeker2

https://github.com/BSSeeker/BSseeker2

Targeted Manipulation of DNA Methylation in Plants 3.2.3 Step 3: Generating and Screening Transgenic Arabidopsis T1 Plants

65

1. After confirmation of the insertion of the desired gRNA, transform the resulting plasmid into competent Agrobacterium tumefaciens cells [24]. 2. Transform Arabidopsis thaliana plants by standard floral dip method using the Agrobacterium tumefaciens cells harboring the gRNA containing plasmid [25]. 3. The pEG302-SunTag plasmids from Addgene contains a hygromycin resistance gene in the T-DNA. To select primary transformants, plate 550 μl of seeds on agar plates containing 0.5 MS media, hygromycin (35 μg/ml), plant preservative mixture (0.1%), and cefotaxime (100 μg/ml). 4. Stratify for 2–5 days at 4  C. 5. Put plates under light for 8 h followed by a 64- to 88-h dark treatment (or approximately 3–4 days) and then a 16/8 h light/dark cycle for the remainder of 1 week (approximately 80–104 h depending on dark treatment). 6. Primary transformants will display an elongated hypocotyl. 7. Transplant primary transformants to soil at the end of the 1-week period.

3.2.4 Step 4: Genotyping

Although we screen our transgenic plants using plant selection markers (hygromycin), we routinely confirm the presence of the transgene in our hygromycin resistant plants using a PCR-based assay. We use a combination of the Universal R2 primer and JP13199 primer listed in Table 2. These primers amplify Module 3 and part of Module 2, resulting in a 2519 bp product for the vector containing NtDRMcd and a 3671 bp product for the vector containing hTET1cd.

3.2.5 Step 5: Detection of DNA Methylation

After selecting and confirming primary transformants, the next step is to screen these transformants to identify plants that contain a change in methylation at the desired target site. For this, genomic DNA extracted from any tissue can be used. Several techniques are available to analyze DNA methylation. Here we describe three different methods to look at DNA methylation and the pros and cons of each. 1. McrBC-qPCR assays. Methylation-sensitive restriction-based assays are a cheap, easy, and fast way to determine a particular genomic region’s methylation status in one plant (experimental sample) relative to another plant (control sample). There are two steps in this assay: (1) Digestion of genomic DNA with the McrBC endonuclease and (2) quantitative PCR (qPCR) of the region of interest from the McrBC digested DNA. The McrBC endonuclease only cleaves DNA that contains methylated cytosines.

66

Basudev Ghoshal and Jason Gardiner

Regions of DNA that contain methylation are digested by McrBC and will be present at lower concentrations than the sites that do not contain methylation and are not digested by McrBC. These differences are quantifiable through qPCR. The cycle threshold (Ct) value of the experimental sample obtained through a qPCR can be compared with the Ct value from a mock digested sample where water is used in place of the McrBC enzyme and then to a transgene-free control using the ΔΔCt method. The DNA methylation status is calculated as the difference between digested DNA and mock digested DNA of a sample relative to a transgene-free sample (see Note 10). As a positive control, we have provided sequences for qPCR primers that specifically bind and amplify a methylated region of the FLOWERING WAGENINGEN gene (FWA) (Table 2). Although McrBC-qPCR-based assays are easy and inexpensive, a single methylated cytosine can lead to the digestion of the DNA. Thus, partial loss of DNA methylation is more difficult to see using McrBC-qPCR than the other techniques below. Additionally, this technique also does not provide sequence-context specific or single-nucleotide resolution DNA methylation data. 2. Bisulfite PCR sequencing. Bisulfite PCR (BSPCR) sequencing can be used to determine the methylation status of a particular region at singlenucleotide resolution with high coverage (several thousandfold, if using next-generation sequencing). This technique consists of three steps: (1) bisulfite conversion of genomic DNA, (2) PCR amplification of the region of interest, and (3) sequencing the PCR products by next-generation sequencing (NGS) or Sanger sequencing. In the first step, denatured genomic DNA is treated with sodium bisulfite, which deaminates unmethylated cytosines to uracil. In the next step, specially designed BSPCR primers amplify the target region of the bisulfite-treated DNA (see Notes 11 and 12). In the third step, the amplified PCR products are purified and sequenced. We sequence the PCR products using NGS platforms such as Illumina [15], which allows for high coverage data and multiplexing of different samples. In addition to the NGS techniques, the PCR products can be cloned into plasmids and sequenced using Sanger sequencing. The sequenced PCR products are then compared to the unconverted reference sequence. Since the unmethylated cytosines were converted to uracils, they will be annotated as thymine during sequencing and appear as a mismatch during alignment. Bases that remain annotated as cytosine were methylated, as they were not converted during the bisulfite treatment. This method is more

Targeted Manipulation of DNA Methylation in Plants

67

expensive than the McrBC assay and requires a sequencing core and some bioinformatics expertise. Table 3 provides links to useful bioinformatic tools for analyzing bisulfite converted NGS data. 3. Whole-genome bisulfite sequencing. While McrBC-qPCR and BSPCR are excellent for examining small target regions, they cannot be used to investigate off-target effects in the rest of the genome. This instead requires whole-genome bisulfite sequencing (WGBS). WGBS is very similar to BS-Seq and has two steps: (1) bisulfite conversion and (2) NGS. In contrast to BS-PCR, there is no regionspecific amplification; instead, the whole-genome bisulfitetreated genomic DNA is made into a library for NGS. WGBS libraries require a lot of starting DNA, as the bisulfite conversion process degrades DNA. WGBS also requires a deeper sequencing to get adequate coverage throughout the genome. The preparation of sequencing libraries may differ depending on the sequencing facilities. Table 3 provides links to useful bioinformatic tools for analyzing bisulfite converted NGS data. 3.2.6 Step 6: Analyzing the Heritability of DNA Methylation Changes Induced by the SunTag Systems

4

Targeted changes in DNA methylation can be stably maintained over generations, including in plants where the SunTag transgene has been segregated out. However, if there is only a partial addition or removal of DNA methylation in the first generation, maintaining the transgene in several subsequent generations of plants may be needed to cause sufficient changes in methylation for stable inheritance. To test if the gain or loss of methylation in a transgenic line is maintained in the absence of the transgene, plants that have lost the transgene can be identified in T2 and the subsequent generations by using a PCR-based assay (described in step 4). DNA methylation levels are then examined in plants that have lost the transgene. If plants without the transgene maintain the gain or loss of methylation, then this change is stable.

Conclusion To conclude, here we provide a systematic protocol for targeted manipulation of DNA methylation by using the CRISPR-based SunTag system. We use this protocol in our lab for the targeted manipulation of DNA methylation in Arabidopsis. We believe the CRISPR-based SunTag system is a robust tool that will enable further study into the function of DNA methylation in plants.

68

5

Basudev Ghoshal and Jason Gardiner

Notes 1. The pEG302-SunTag binary vector is a large plasmid containing numerous repeats. Because of this, unwanted degradation and recombination can occur. Using competent cells that are endA and recA deficient can help prevent these events from occurring. 2. We use the following online tools to design our gRNAs: http://crispr.hzau.edu.cn/CRISPR2/ or https://www. genome.arizona.edu/crispr2/CRISPRsearch.html. For more information on gRNA design, see Gerashchenkov et al. [17]. 3. The selection of spacer sequences from a ranked list is also a balancing act when manipulating DNA methylation at a particular locus. Ideal spacer sequences are those that are close to the region where DNA methylation needs to be manipulated but also balanced against other spacer sequence considerations, such as a minimal number of off-targets. A systematic study of optimal placement of gRNAs for the manipulation of DNA methylation in plants is not yet available. Studies to date have indicated that successful SunTag targeting may depend on several factors, including target-site specific factors (e.g., heterochromatic vs. euchromatic), the number of gRNAs used, and whether DNA methylation is being added or removed [22, 23]. For example, targeting SunTag constructs with a single gRNA to the FWA locus to remove methylation resulted in highly specific loss of methylation that was restricted to a small region while targeting the same construct to the CACTA locus resulted in the removal of methylation spanning a much larger (2 kb) region [22]. Similarly, targeting the addition of DNA methylation to the FWA locus with a single gRNA resulted primarily in a gain of CHH methylation over a small, specific region, while using multiple gRNAs spanning a region of approximately 300 bp resulted in the entire region gaining DNA methylation in all sequence contexts [23]. Thus, at this region, multiple gRNAs worked better for targeting the addition of DNA methylation; however, at present, it is unclear if this finding will apply to other sites. 4. When designing gRNAs, make sure the 30 end of the spacer sequence is adjacent to an NGG Protospacer Adjacent Motif (PAM) site. 5. The sequence used for the spacer should be directly adjacent but not include the PAM site. A common mistake when designing gRNAs for the first time is to include the PAM sequence in the final spacer sequence.

Targeted Manipulation of DNA Methylation in Plants

69

6. We use the standard In-Fusion (Takara) protocol to control the cassette’s directionality and allow for the insertion of multiple gRNA cassettes. However, a ligase-based cloning strategy is also a viable option for inserting a single gRNA expression cassette. For this, the 50 region of the F1 and R2 primers that overlap with the pEG302 backbone can be replaced by a 50 -N NNGGTACC-30 sequence. The gRNA expression cassette created using these modified primers can then be digested with KpnI and ligated into a KpnI digested SunTag vector. 7. The reagents used in In-Fusion reactions can be toxic to competent cells. Thus, it is important to follow the manufacturer’s instructions for the amount of the In-Fusion reaction to use when transforming during steps 2–7. 8. In-Fusion reactions rely on sequence overlap between the fragment being inserted and the vector. After cloning in a gRNA expression cassette into the pEG302-SunTag-22aa-{hTET1cd or NtDRMcd}–no-guide vector, the region upstream of the KpnI site becomes the end of the newly inserted gRNA cassette. The F1-alt primer containing a 50 overlap with this new region is used to clone in additional gRNAs. 9. MauBI and KpnI restriction endonucleases can be used to remove the gRNA(s) (module 3) from a pEG302 SunTag construct that already contains them. However, this also deletes a portion of the 30 end of the NOS terminator that should be reintroduced while designing new gRNAs. 10. The Delta-Delta Ct method is used to calculate DNA methylation in experimental plants relative to control plants using Ct values obtained from the McrBC-qPCR assays as follows: DNA methylation status ¼ 2^((Ct of digested DNA of experimental plants  Ct of undigested DNA of experimental plants)  (Ct of digested DNA of control plants  Ct of undigested DNA of control plants)). 11. The primer binding regions for BSPCR may contain cytosine. The cytosines in these regions can get converted to Uracils during bisulfite treatment of genomic DNA, depending on their methylation status. Therefore, during primer design, unspecified pyrimidine nucleoside (Y) or unspecified purine nucleosides (R) should be incorporated in the primers in the cytosine sites to avoid biases during the process of PCR amplification. 12. The following website (https://www.biocompare.com/ Bench-Tips/134334-Design-and-Testing-Tips-for-BisulfiteSpecific-PCR-Primer-Design/) provides further details about designing BSPCR primers [26].

70

Basudev Ghoshal and Jason Gardiner

Acknowledgments We thank Dr. Steven E. Jacobsen for his support as our postdoctoral supervisor and Dr. Varsha Desai, Dr. Yan Xue, Dr. Colette L. Picard, and Dr. Qikun Liu for editing the manuscript and their thoughtful comments. Finally, we would like to thank all the researchers who have worked with us to develop these tools for plants. References 1. Law JA, Jacobsen SE (2010) Establishing, maintaining and modifying DNA methylation patterns in plants and animals. Nat Rev Genet 11(3):204–220. https://doi.org/10.1038/ nrg2719 2. Du J, Johnson LM, Jacobsen SE, Patel DJ (2015) DNA methylation pathways and their crosstalk with histone methylation. Nat Rev Mol Cell Biol 16(9):519–532. https://doi. org/10.1038/nrm4043 3. Cokus SJ, Feng S, Zhang X, Chen Z, Merriman B, Haudenschild CD, Pradhan S, Nelson SF, Pellegrini M, Jacobsen SE (2008) Shotgun bisulphite sequencing of the Arabidopsis genome reveals DNA methylation patterning. Nature 452(7184):215–219. https:// doi.org/10.1038/nature06745 4. Lister R, O’Malley RC, Tonti-Filippini J, Gregory BD, Berry CC, Millar AH, Ecker JR (2008) Highly integrated single-base resolution maps of the epigenome in Arabidopsis. Cell 133(3):523–536. https://doi.org/10. 1016/j.cell.2008.03.029 5. Zhang H, Lang Z, Zhu JK (2018) Dynamics and function of DNA methylation in plants. Nat Rev Mol Cell Biol 19(8):489–506. https://doi.org/10.1038/s41580-018-0016-z 6. Kankel MW, Ramsey DE, Stokes TL, Flowers SK, Haag JR, Jeddeloh JA, Riddle NC, Verbsky ML, Richards EJ (2003) Arabidopsis MET1 cytosine methyltransferase mutants. Genetics 163(3):1109–1122 7. Taylor SM, Jones PA (1982) Mechanism of action of eukaryotic DNA methyltransferase. Use of 5-azacytosine-containing DNA. J Mol Biol 162(3):679–692. https://doi.org/10. 1016/0022-2836(82)90395-3 8. Griffin PT, Niederhuth CE, Schmitz RJ (2016) A comparative analysis of 5-azacytidine- and zebularine-induced DNA demethylation. G3 (Bethesda) 6(9):2773–2780. https://doi. org/10.1534/g3.116.030262

9. Lindroth AM, Cao X, Jackson JP, Zilberman D, McCallum CM, Henikoff S, Jacobsen SE (2001) Requirement of CHROMOMETHYLASE3 for maintenance of CpXpG methylation. Science 292 (5524):2077–2080. https://doi.org/10. 1126/science.1059745 10. Waryah CB, Moses C, Arooj M, Blancafort P (2018) Zinc fingers, TALEs, and CRISPR systems: a comparison of tools for epigenome editing. Methods Mol Biol 1767:19–63. https://doi.org/10.1007/978-1-4939-77741_2 11. Brocken DJW, Tark-Dame M, Dame RT (2018) dCas9: a versatile tool for epigenome editing. Curr Issues Mol Biol 26:15–32. https://doi.org/10.21775/cimb.026.015 12. Nitsch S, Mussolino C (2018) Generation of TALE-based designer epigenome modifiers. Methods Mol Biol 1767:89–109. https://doi. org/10.1007/978-1-4939-7774-1_4 13. Moradpour M, Abdulah SNA (2020) CRISPR/dCas9 platforms in plants: strategies and applications beyond genome editing. Plant Biotechnol J 18(1):32–44. https://doi.org/ 10.1111/pbi.13232 14. Adli M (2018) The CRISPR tool kit for genome editing and beyond. Nat Commun 9 (1):1911. https://doi.org/10.1038/s41467018-04252-2 15. Gallego-Bartolome J, Liu W, Kuo PH, Feng S, Ghoshal B, Gardiner J, Zhao JM, Park SY, Chory J, Jacobsen SE (2019) Co-targeting RNA polymerases IV and V promotes efficient de novo DNA methylation in Arabidopsis. Cell 176(5):1068–1082.e1019. https://doi.org/ 10.1016/j.cell.2019.01.029 16. Doudna JA, Charpentier E (2014) Genome editing. The new frontier of genome engineering with CRISPR-Cas9. Science 346 (6213):1258096. https://doi.org/10.1126/ science.1258096

Targeted Manipulation of DNA Methylation in Plants 17. Gerashchenkov GA, Rozhnova NA, Kuluev BR, Kiryanova OY, Gumerova GR, Knyazev AV, Vershinina ZR, Mikhailova EV, Chemeris DA, Matniyazov RT, Baimiev AK, Gubaidullin IM, Baimiev AK, Chemeris AV (2020) Design of guide RNA for CRISPR/Cas plant genome editing. Mol Biol (Mosk) 54(1):29–50. https://doi.org/10.31857/ S0026898420010061 18. Xu X, Qi LS (2019) A CRISPR-dCas toolbox for genetic engineering and synthetic biology. J Mol Biol 431(1):34–47. https://doi.org/10. 1016/j.jmb.2018.06.037 19. Brezgin S, Kostyusheva A, Kostyushev D, Chulanov V (2019) Dead Cas systems: types, principles, and applications. Int J Mol Sci 20(23). https://doi.org/10.3390/ijms20236041 20. Morita S, Noguchi H, Horii T, Nakabayashi K, Kimura M, Okamura K, Sakai A, Nakashima H, Hata K, Nakashima K, Hatada I (2016) Targeted DNA demethylation in vivo using dCas9-peptide repeat and scFv-TET1 catalytic domain fusions. Nat Biotechnol 34 (10):1060–1065. https://doi.org/10.1038/ nbt.3658 21. Tanenbaum ME, Gilbert LA, Qi LS, Weissman JS, Vale RD (2014) A protein-tagging system for signal amplification in gene expression and fluorescence imaging. Cell 159(3):635–646. https://doi.org/10.1016/j.cell.2014.09.039

71

22. Gallego-Bartolome J, Gardiner J, Liu W, Papikian A, Ghoshal B, Kuo HY, Zhao JM, Segal DJ, Jacobsen SE (2018) Targeted DNA demethylation of the Arabidopsis genome using the human TET1 catalytic domain. Proc Natl Acad Sci U S A 115(9):E2125–E2134. https://doi.org/10.1073/pnas.1716945115 23. Papikian A, Liu W, Gallego-Bartolome J, Jacobsen SE (2019) Site-specific manipulation of Arabidopsis loci using CRISPR-Cas9 SunTag systems. Nat Commun 10(1):729. https://doi.org/10.1038/s41467-01908736-7 24. den Dulk-Ras A, Hooykaas PJ (1995) Electroporation of Agrobacterium tumefaciens. Methods Mol Biol 55:63–72. https://doi.org/10. 1385/0-89603-328-7:63 25. Clough SJ, Bent AF (1998) Floral dip: a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant J 16(6):735–743. https://doi.org/10.1046/j. 1365-313x.1998.00343.x 26. Sasaki M, Anast J, Bassett W, Kawakami T, Sakuragi N, Dahiya R (2003) Bisulfite conversion-specific and methylation-specific PCR: a sensitive technique for accurate evaluation of CpG methylation. Biochem Biophys Res Commun 309(2):305–309. https://doi. org/10.1016/j.bbrc.2003.08.005

Chapter 6 Rapid Assembly of Multiplex Natural CRISPR Arrays Robert M. Cooper and Jeff Hasty Abstract One of the key advantages of CRISPR-Cas systems for biotechnology is that their nucleases can use multiple guide RNAs in the same cell. However, multiplexing with CRISPR-Cas9 and its homologs presents various technical challenges, such as very long synthetic targeting arrays and time-consuming assembly. Recently, other CRISPR-associated, single-effector nucleases such as Cas12a have been shown to process their own CRISPR arrays, enabling the use of much more compact natural arrays. Unfortunately, these highly repetitious arrays can be difficult to synthesize commercially or assemble in the lab. Here, we describe a simple method to accurately assemble completely natural, multiplex CRISPR arrays that can be completed in 1–2 days. This should be of great use both in prokaryotes with their own native CRISPR systems and in eukaryotes when paired with Cas12a or other CRISPR nucleases that also process their own arrays. Key words CRISPR, CRISPR-Cas, CRISPR arrays, Multiplexing, Cas12a

1

Introduction Natural CRISPR-Cas systems are inherently multiplex. Bacteria and archaea can encode hundreds of targeting spacers in very compact CRISPR arrays [1]. However, scaling up CRISPR for use by humans has been more difficult [2]. The majority of early work has used the single effector nuclease Cas9. Cas9 itself is very simple to port to other organisms, because it requires only a single gene. However, the simplicity of the coding gene comes at the expense of greater sequence length and complexity for the targeting array. Cas9 does not process its own arrays and requires a trans-activating CRISPR RNA (tracrRNA), so to port it to other organisms, scientists usually use synthetic tracrRNA-guide RNA (gRNA) fusions called single guide RNAs (sgRNAs), which are each expressed from an independent transcriptional unit. The resulting array complexity rapidly becomes a problem when using more than one guide RNA [2]. Performing multiplex targeting with Cas9 often requires many cloning steps and/or long sgRNA arrays that can exceed the length

M. Tofazzal Islam and Kutubuddin Ali Molla (eds.), CRISPR-Cas Methods: Volume 2, Springer Protocols Handbooks, https://doi.org/10.1007/978-1-0716-1657-4_6, © The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2021

73

74

Robert M. Cooper and Jeff Hasty

capacity of viral vectors. Another chapter in this book covers one solution for more compact multiplexing using the CRISPR-Cas9 system. More recently, the CRISPR-Cas12 system was shown to process its own CRISPR array using the same single enzyme that cleaves its target [3]. This system allows the best of both worlds for synthetic multiplexing applications—a compact single gene paired with a compact natural CRISPR array [4–6]. Unfortunately, the eponymous palindromic repetition of natural CRISPR arrays makes longer multiplex arrays difficult for commercial providers to synthesize and for individual researchers to assemble [2]. Thus, while Cas12 solves the array length problem of synthetic Cas9 systems, multiplexing with longer natural CRISPR arrays has still required either time-consuming cloning with each spacer added to the array one at a time [7–9], or sequence modifications to the ends of the spacers [10]. Here, we describe a technique that can accurately assemble a multiplex natural CRISPR array in just 1 day [11]. The technique requires no sequence modifications and uses only standard-length DNA oligos. We have used this strategy to assemble multiplex CRISPR arrays of up to 9 spacers and demonstrated them in bacteria, including arrays from both a Type I-F CRISPR system and a Cas12a system [11]. The key insight of our method is that it assembles only the top strand of the array using ligation, and then later fills in the bottom strand using PCR (Fig. 1). During annealing and ligation, the top

Vector

Repeat

Spacer 1

Rep-Spacer 1

Repeat

Spacer 2

Spacer 1-Rep-Spacer 2

Spacer 1 RC

Repeat

Spacer 3

Repeat

Vector

Spacer 2-Rep-Spacer 3

Spacer 2 RC

Spacer 3 RC

Vector F Rep-Spacer 1

Spacer 3 RC Vector R

Fig. 1 Array assembly strategy for insertion into the vector using a Golden Gate approach. Top: A desired 3-spacer CRISPR array. Middle: 3 top and 3 bottom oligos to be used in assembling the array. Note that only the top strand is continuous after oligo annealing and ligation; the bottom strand has gaps at the repeats to ensure correct ligation junctions and spacer order. Golden Gate adaptors at the terminal oligos are not shown here. Bottom: PCR amplified, digested DNA pieces to be used for insertion of the CRISPR array into the vector using Golden Gate assembly, along with primers used to generate the pieces. Four-base 50 overlaps are shown at the junctions, which are created during Golden Gate assembly via digestion by BsaI or another compatible enzyme. In this scheme, the Golden Gate overlaps are at the first 4 bases of the repeat at the 50 end, and the last 4 bases of the final spacer at the 30 end. (Adapted with permission from Cooper & Hasty, ACS Synthetic Biology [11]. Copyright 2020 American Chemical Society)

CRISPR Array Assembly

75

strand oligos are joined by shorter bottom oligos that only cover the spacer regions. This restricts ligation junctions to the unique spacer regions of the array, while leaving single-stranded gaps that cover the repeat portions of the array. In this way, the method avoids incorrect annealing, ligation junctions, or spacer order, which could otherwise result from annealing between repeat regions.

2

Materials 1. DNA oligos for array assembly, as described in Subheading 3. Standard quality desalted oligos in TE buffer or water have worked for us. 2. T4 DNA polynucleotide kinase. 3. T4 DNA ligase with buffer. 4. High-fidelity DNA polymerase (we used Q5 from New England Biolabs). 5. DpnI (if using a plasmid vector). 6. PCR tubes. 7. PCR thermocycler. 8. DNA electrophoresis machine for running gels. 9. PCR purification kit (we used Qiagen). 10. Gel purification kit (we used Qiagen). 11. Depending on your strategy for insertion into the vector, one of the following is used: (a) BsaI or another Golden Gate Assembly-compatible restriction enzyme. (b) Gibson Assembly master mix. 12. Vector template, which can be either a plasmid or linear DNA. 13. Competent cells.

3

Methods 1. Prepare your vector. One vector compatible with a broad range of hosts that we have had success with is pBAV1k (Addgene #26702) [12]. For plasmids, PCR the plasmid with compatible Golden Gate adaptors [13]. If using the restriction enzyme BsaI, append the Golden Gate adaptor sequence 50 -TTTGGT CTCA-30 to the 50 end of each primer (see Note 1). For the primer adjacent to the beginning of the array, after the Golden Gate adapter, add the reverse complement of the first four bases of the CRISPR repeat. For the primer adjacent to the end of

76

Robert M. Cooper and Jeff Hasty

the array, add the last four bases of the final spacer and then the full CRISPR repeat, after the Golden Gate adapter and before the vector sequence (see Note 2, Figs. 1, 2, and Table 1). Check your PCR on a gel, and if it looks good, purify it with a PCR purification kit. If the PCR product is significantly different in

Rep-Spacer 1

Spacer 1-Rep-Spacer 2

Spacer 2-Rep-Spacer 3

GTCTAAGAACTTTAAATAATTTCTACTGTTGTAGATCGGCGTCAATACGGGATAATACCGCGCCACATGTCTAAGAACTTTAAATAATTTCTACTGTTGTAGATGGAGCTGAATGAAGCCATACCAAACGACGAGCGTCTAAGAACTTTAAATAATTTCTACTGTTGTAGATAGCCGGAAGGGCCGAG

Vector

TCTAGCCGCAGTTATGCCCTATTATGGCGCGGTGTA

TCTACCTCGACTTACTTCGGTATGGTTTGCTGCTCG

TCTATCGGCCTTCCCGGCTCGCGTCTTCACCAGGAC

Spacer 1 RC

Spacer 2 RC

Spacer 3 RC

Repeat

Spacer 1

Repeat

Spacer 2

Repeat

Spacer 3

Repeat

Vector

GGGTTTTGTTTTGACTTAACTCTAGTCTAAGAACTTTAAATAATTTCTACTGTTGTAGATCGGCGTCAATACGGGATAATACCGCGCCACATGTCTAAGAACTTTAAATAATTTCTACTGTTGTAGATGGAGCTGAATGAAGCCATACCAAACGACGAGCGTCTAAGAACTTTAAATAATTTCTACTGTTGTAGATAGCCGGAAGGGCCGAGCGCAGAAGTGGTCCTGGTCTAAGAACTTTAAATAATTTCTACTGTTGTAGATCGGCCGGTAGAAAGGACA CCCAAAACAAAACTGAATTGAGATCAGATTCTTGAAATTTATTAAAGATGACAACATCTAGCCGCAGTTATGCCCTATTATGGCGCGGTGTACAGATTCTTGAAATTTATTAAAGATGACAACATCTACCTCGACTTACTTCGGTATGGTTTGCTGCTCGCAGATTCTTGAAATTTATTAAAGATGACAACATCTATCGGCCTTCCCGGCTCGCGTCTTCACCAGGACCAGATTCTTGAAATTTATTAAAGATGACAACATCTAGCCGGCCATCTTTCCTGT

Vector F CCTGGTCTAAGAACTTTAAATAATTTCTACTGTTGTAGATCGGCCGGTAGAAAGGACA

Rep-Spacer 1 GTCTAAGAACTTTAAATAATTTCTACTGTTGTAGATCGGCGTCAATACGGGA

TCTATCGGCCTTCCCGGCTCGCGTCTTCACCAGGAC

Spacer 3 RC CCCAAAACAAAACTGAATTGAGATCAGA

Vector R

Fig. 2 Array assembly strategy including sequence. The same array and its construction materials as shown in Fig. 1, but enlarged to include the DNA sequence. (Adapted with permission from Cooper & Hasty, ACS Synthetic Biology [11]. Copyright 2020 American Chemical Society). Note that Golden Gate Assembly adaptors are not shown here, but they must be included for insertion of the array into a vector

Table 1 Oligos for assembling a sample 3-spacer array for the Type I-F CRISPR-Cas system of Acinetobacter baylyi (Fig. 2) [11]. Lower case letters indicate Golden Gate assembly adaptors, including a 50 handle, the BsaI recognition site GGTCTC, and a single base spacer at the 30 end. Italicized portions indicate the repeat sequence. RC denotes reverse complement Category Oligo

Sequence

Array top Repeat-spacer 1

tttggtctca-GTCTAAGAACTTTAAATAATTTCTACTGTTGTAGAT-C GGCGTCAATACGGGA TAATACCGCGCCACATGTCTAAGAACTTTAAATAATTTCTACTGTTGTAGAT-GGAGCT GAATGAAGCC ATACCAAACGACGAGCGTCTAAGAACTTTAAATAATTTCTACTGTTGTAGAT-AGCCG GAAGGGCCGAG

Spacer 1-repeatspacer 2 Spacer 2-repeatspacer 3 Array Spacer 1 RC bottom Spacer 2 RC Spacer 3 RC

ATGTGGCGCGGTATTATCCCGTATTGACGCCG-ATCT GCTCGTCGTTTGGTATGGCTTCATTCAGCTCC-ATCT tttggtctca-CAGGACCACTTCTGCGCTCGGCCCTTCCGGCT-ATCT

Vector

tttggtctca-CCTGGTCTAAGAACTTTAAATAATTTCTACTGTTGTAGAT-CGGCC GGTAGAAAGGACA tttggtctca-AGAC-TAGAGTTAAGTCAAAACAAAACCC

Vector F

Vector R

CRISPR Array Assembly

77

size from the parent plasmid, you can gel extract the product to separate it from the parent plasmid and reduce background when cloning. 2. Design oligos to use in assembling your CRISPR array (Figs. 1, 2, and Table 1). For an array of n spacers, you will need n top oligos and n bottom oligos. Bottom oligos should simply be the reverse complement of each spacer, followed by the reverse complement of the last four bases of the repeat at their 30 ends (see Note 2). The bottom oligo for the final spacer in the array should also include a Golden Gate adaptor sequence at its 50 end. All top oligos except the first should begin halfway through one spacer, span the repeat, and end halfway through the next spacer. The first top oligo should begin at the first repeat, end halfway through the first spacer, and include the Golden Gate adaptor at its 50 end. Order standard desalted oligos and normalize to 100 μM in elution buffer, TE, or water. 3. Phosphorylate top oligos. Mix 1–2 μl of each top oligo (from 100 μM stock solutions), 1 μl T4 polynucleotide kinase, and T4 ligase buffer to 1 (see Note 3). Incubate at 37  C for an hour. Alternatively, you could order 50 phosphorylated top oligos. 4. Anneal oligos. Mix 2–6 μl of each bottom oligo, and then combine 1 part phosphorylated top oligos with 2–3 parts bottom oligos in a PCR tube. Heat to 85  C in a thermocycler, and then slowly cool back to 37  C at 0.1  C per second (see Note 4). 5. Ligate oligos. Add 1 μl T4 DNA ligase and fresh T4 DNA ligase buffer to 1. Incubate at 37  C for about an hour. Leaving the ligation overnight is fine. 6. Remove unligated oligos. Purify the ligation using a PCR purification column. 7. Fill in the bottom strand and amplify. PCR the ligation using the first top oligo and final bottom oligo as primers. We used Q5 DNA polymerase, annealed at 72  C (see Note 5), extended for 20 s, and ran for 20 cycles. 8. Purify the PCR product. For smaller, easier assemblies, purify the product using a PCR purification kit. For higher accuracy on difficult assemblies, instead run the ligation on a gel (after diluting to avoid overloading the wells), cut out the correct band, and purify the DNA using a gel extraction kit. If in doubt, run a test gel, and use gel extraction if the intended band is not the only clear product. 9. Insert the array into a vector. Combine 4 μl total of the vector and the PCR product at equimolar concentrations, 0.25 μl T4 DNA ligase, 0.25 μl BsaI, and 0.5 μl T4 DNA ligase buffer in a PCR tube. If your vector PCR came from a plasmid, also add 0.25 μl DpnI to cleave the parental plasmid. Incubate for

78

Robert M. Cooper and Jeff Hasty

Fig. 3 Sample PCR screen for 16 clones of a 9-spacer CRISPR array. The ladder on the end lanes goes from 100 bp to 1 kb in increments of 100 bp. The expected length is about 900 bp, with 11 of 16 clones having the correct number of spacers. (Reprinted with permission from Cooper & Hasty, ACS Synthetic Biology [11]. Copyright 2020 American Chemical Society)

30–50 cycles of 1 min each at 37  C and 24  C, followed by a final 10 min at 50  C to inactivate the enzymes. If you prefer to use Gibson Assembly [14] to insert the array into your vector rather than a Golden Gate strategy, see Note 6. 10. If your vector is linear DNA, PCR amplify the final product. 11. Transform the product into your competent cells using a protocol appropriate for those cells, and grow clonal transformants. 12. Pick several clones, extract their DNA using a protocol appropriate for your cells, and PCR and sequence across the array to verify correct assembly. For a representative screening PCR of clonal arrays, see Fig. 3. In this example, 11 of 16 clones had the correct number of spacers. Sequencing showed all of those 11 were assembled in the correct order. Seven of those were completely correct, and the remainder had small insertions, deletions, or substitutions.

4

Notes 1. The Golden Gate adaptor sequence 50 -TTT GGTCTC A-30 consists of three parts. The first three Ts simply extend the end of the DNA to help the restriction enzyme find its target site, and they could be replaced with any sequence. Here, we used BsaI with target site GGTCTC, but any other Golden Gatecompatible restriction enzyme would work as well. The final A is a spacer required because of the restriction enzyme’s offset cutting site. 2. The exact end points of the assembled array are not critically important, so long as they provide unique ligation junctions for insertion into the vector. In the design provided here, the final

CRISPR Array Assembly

79

repeat of the array is included in the vector PCR to reduce the length of the array to be assembled. The bottom oligo for the final spacer extends four bases into the repeat at its 30 end to provide a 20-base annealing sequence for the primer in the PCR amplification step. Our spacers were 32 base pairs long, and only half of each spacer is included in the top oligo, so we added four bases to the bottom oligo to reach an annealing length of 20 base pairs (see Figs. 1 and 2). If your spacers are longer or shorter, you should adjust the extension of the bottom oligo into the repeat to ensure a 20-base annealing region for PCR. This is only important for the final spacer in the array, but we suggest ordering all bottom oligos with the same design to make them compatible with potential alternate array designs you may wish to assemble. 3. T4 polynucleotide kinase buffer generally omits ATP to allow users to supply their own radiolabeled version. T4 ligase buffer works as well and does not require additional ATP. Without ATP, the kinase will not work. 4. If your thermocycler cannot be programmed for a slow cooling step, you could heat a volume of water to near boiling, place the PCR tube containing the oligos in it, place it in a 37  C water bath, and let it slowly come to equilibrium. 5. A high annealing temperature is critical for accurate amplification in this step. You can check the recommended annealing temperature for your primers when using Q5 at https:// tmcalculator.neb.com/. If using another DNA polymerase, check the maximum allowed annealing temperature for your primers. Note also that using too many PCR cycles can make the PCR product less clean. 6. We have also successfully used Gibson Assembly to insert assembled arrays into their vectors. We find Golden Gate to be more accurate than Gibson Assembly in general, but both can work. The Gibson variation uses the same top strand-only ligation strategy to assemble the actual array; it just uses a different method to insert the array into a final vector. To use the Gibson method, you will need to prepare your vector differently in Subheading 3, step 1, slightly change your oligo designs in Subheading 3, step 2, and use a different vector insertion method in Subheading 3, step 9. (a) In Subheading 3, step 1, the forward primer for the vector (at the end of the CRISPR array) should begin just after the terminal CRISPR repeat in your final design. The reverse primer for the vector (at the beginning of the array) will begin just before the initial repeat. Depending on the length of the repeat units in your array, you can extend the primers slightly into the terminal repeats to

80

Robert M. Cooper and Jeff Hasty

ensure a 20-base overlap with the assembled array from Subheading 3, step 8, for the final Gibson Assembly (see also below). Just be sure not to extend these overlaps so far into the repeats that the vector primers would anneal to each other. (b) In Subheading 3, step 2, you will now need n + 1 top oligos. The top oligo at the beginning of the array should begin 20 bases into the adjacent vector sequence, span the initial repeat, and end halfway through the first spacer. The top oligo at the end of the array should begin halfway through the last spacer, span the terminal repeat, and extend 20 bases into the adjacent vector sequence. The final bottom oligo should not include a Golden Gate adaptor sequence. You will also need an additional bottom oligo for PCR amplification in Subheading 3, step 7. This should be the reverse complement of the final 20 bases of the final top oligo. If its annealing temperature is too low, you can extend this oligo at its 3’ end. If desired, you can reduce the top oligo overlaps with the vector sequence to avoid overly long oligos, and instead place the overlaps on the vector primers as described above. (c) In Subheading 3, step 9, use Gibson Assembly to insert the assembled array into your vector. Combine 2 μl total of vector and array DNA at equimolar final concentrations in a PCR tube. Place in a thermocycler block preheated to 50  C and add 2 μl of 2 Gibson Assembly master mix. Incubate at 50  C for 1 h. References 1. Makarova KS, Wolf YI, Alkhnbashi OS et al (2015) An updated evolutionary classification of CRISPR–Cas systems. Nat Rev Microbiol 13:722–736 2. Adiego-Pe´rez B, Randazzo P, Daran JM et al (2019) Multiplex genome editing of microorganisms using CRISPR-Cas. FEMS Microbiol Lett 366:2307 3. Fonfara I, Richter H, Bratovicˇ M et al (2016) The CRISPR-associated DNA-cleaving enzyme Cpf1 also processes precursor CRISPR RNA. Nature 532:517–521 ˜ ez JK et al (2017) 4. Tak YE, Kleinstiver BP, Nun Inducible and multiplex gene regulation using CRISPR–Cpf1-based transcription factors. Nat Methods 14:1163–1166 5. Zetsche B, Heidenreich M, Mohanraju P et al (2017) Multiplex gene editing by CRISPR–Cpf1 using a single crRNA array. Nat Biotechnol 35:31–34

6. Campa CC, Weisbach NR, Santinha AJ et al (2019) Multiplexed genome engineering by Cas12a and CRISPR arrays encoded on single transcripts. Nat Methods 16:887–893 7. Gomaa AA, Klumpe HE, Luo ML et al (2014) Programmable removal of bacterial strains by use of genome-targeting CRISPR-Cas systems. mBio 5:e00928–13 8. Luo ML, Mullis AS, Leenay RT et al (2015) Repurposing endogenous type I CRISPR-Cas systems for programmable gene repression. Nucleic Acids Res 43:674–681 ¨ D, Guleria S et al (2015) 9. Cress BF, Toparlak O CRISPathBrick: modular combinatorial assembly of type II-A CRISPR arrays for dCas9mediated multiplex transcriptional repression in E. coli. ACS Synth Biol 4:987–1000 10. Liao C, Ttofali F, Slotkowski RA et al (2019) Modular one-pot assembly of CRISPR arrays enables library generation and reveals factors

CRISPR Array Assembly influencing crRNA biogenesis. Nat Commun 10:2948 11. Cooper RM, Hasty J (2020) One-day construction of multiplex arrays to harness natural CRISPR-Cas systems. ACS Synth Biol 9:1129–1137 12. Bryksin AV, Matsumura I (2010) Rational design of a plasmid origin that replicates

81

efficiently in both gram-positive and gramnegative bacteria. PLoS ONE 5(10):e13244 13. Engler C, Kandzia R, Marillonnet S (2008) A one pot, one step, precision cloning method with high throughput capability. PLoS One 3: e3647 14. Gibson DG (2011) Enzymatic assembly of overlapping DNA fragments. Methods Enzymol 498:349–361

Chapter 7 Assembly and Assessment of Prime Editing Systems for Precise Genome Editing in Plants Simon Sretenovic, Changtian Pan, and Yiping Qi Abstract Prime editing, a CRISPR-Cas9-derived precise genome editing strategy, was recently developed to introduce targeted indels and all 12 types of point mutations without DNA double-strand breaks or donor DNA. The prime editing systems have been adopted for precision genome editing in crops including rice, wheat, maize, and tomato, which substantially expands the scope and capabilities of precision plant breeding. Here, we describe a fast and efficient method for construction of prime editing vectors based on Gateway assembly and efficiency assessment of prime editors through transient expression analyses in rice protoplasts. Key words Prime editing, CRISPR-Cas9, Genome editing, Gateway assembly, Transient expression, Rice protoplasts

1

Introduction Genome editing can be defined as a specific introduction of desired edits in nucleotide sequence of genomic DNA and can be achieved by a collection of technologies like zinc finger nucleases (ZFN) [1], transcription activator-like effector nucleases (TALEN) [2], and clustered regularly interspaced short palindromic repeats (CRISPR) [3]. Among aforementioned technologies, CRISPR is revolutionizing genome editing in a variety of organisms due to its simplicity of DNA targeting and versatility of multiplexing. CRISPR-Cas9 protein/RNA complex creates a DNA doublestrand break (DSB) at the locus specified by the single guide RNA (sgRNA/gRNA) [3]. Different DNA repair pathways such as non-homologous end joining (NHEJ) [4], microhomologymediated end joining (MMEJ) [5], and homology-directed repair (HDR) [6] may be activated to repair the DSB. Error-prone NHEJ and MMEJ DNA repair pathways can disrupt targeted genes through introduction of insertions and deletions (indels),

M. Tofazzal Islam and Kutubuddin Ali Molla (eds.), CRISPR-Cas Methods: Volume 2, Springer Protocols Handbooks, https://doi.org/10.1007/978-1-0716-1657-4_7, © The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2021

83

84

Simon Sretenovic et al.

substitutions, or other DNA rearrangements at the DSB site [7, 8], while error-free HDR offers insertion of template DNA through homologous recombination [6]. However, HDR is not efficient in plant cells, which motivates the exploration of alternative precision genome editing technologies. The emerging base editing technologies such as C-to-T base editors [9], A-to-G base editors [10], and C-to-G base editors [11] collectively help introduce specific singlenucleotide variations (SNVs) in the target genome. Unfortunately, base editors cannot install all the possible SNVs, and they often introduce undesired SNVs and indel byproducts. Furthermore, base editors cannot install specific small indels in the genome. Prime editing, first introduced in 2019 [12], is a precise genome editing method that directly writes desired genetic information into a specified DNA target site using a Cas9 nickase (nCas9) fused to a reverse transcriptase (RT). RT is programmed with a prime editing guide RNA (pegRNA) that both specifies the target site and encodes the desired edit [12]. PegRNA is a modified sgRNA with 30 extension of RT template and primer binding site (PBS) sequences (Fig. 1a). The nCas9, Cas9 harboring H840A mutation in HNH domain, is used to nick the non-targeting strand of double-stranded DNA (dsDNA) at the target site. However, before the dsDNA is nicked, the nCas9 endonuclease must recognize the protospacer adjacent motif (PAM) sequence upstream of the target DNA sequence. Afterwards, the nicked strand is used for priming the reverse transcription of an edit-encoding extension (RT template) on the pegRNA directly into the target site [12]. This results in a branched intermediate consisting of two competing single stranded DNA (ssDNA) flaps. The 30 flap contains the edited sequence while the 50 flap contains the unedited sequence and is preferentially cleaved by structure-specific endonucleases like FEN1 [13] or 50 exonucleases such as Exo1 [14] (Fig. 1b). Ligation of the 30 flap incorporates the edited DNA strand into the heteroduplex DNA containing one edited strand and one unedited strand. Finally, in order to resolve the heteroduplex by copying the information from the edited strand to the complementary strand, DNA repair mechanisms permanently install the desired edit. Anzalone et al. in the seminal prime editing paper [12] introduced three versions of prime editing systems. Prime editor 1 (PE1) harbors Cas9(H840A) nickase with a C-terminal fusion of a wild-type Moloney Murine leukemia virus reverse transcriptase (M-MLV-RT). Prime editor 2 (PE2) incorporates engineered M-MLV-RT pentamutant (D200N/L603W/ T330P/T306K/W313F) with increased thermostability, processivity, DNA-RNA substrate affinity and inactivated RNaseH activity. Compared to PE1, PE2 has about threefold improvement in the editing efficiency in human cell lines [12]. Prime editor 3 (PE3) involves nicking the non-edited strand to direct DNA repair machinery to the nicked non-edited strand, using the edited strand

Prime Editing in Plants

A

PBS

RT template encoding edit

PBS

M-MLV-RT

3’

3’

tracrRNA 5’

RT template encoding edit

85

5’ 3’

nCas9(H840A)

5’

crRNA

pegRNA

PE2 prime editor

pegRNA

B

3’ Flap (contains edit)

5’ Flap (lacks edit)

5’

3’ 5’

Flap equilibration 5’

3’

3’

Ligation

Edited DNA 5’ 3’

5’ Flap cleavage

DNA repair

5’ 3’

Fig. 1 The PE2 prime editing system. (a) A pegRNA consists of CRISPR RNA (crRNA) that enables recognition of the target DNA sequence, trans activating crRNA (tracrRNA) that directs Cas9 nickase (nCas9) binding to DNA, RT template that encodes the desired edit, and primer binding site (PBS) that facilitates priming of reverse transcription. (b) After the nicking of dsDNA and reverse transcription of an edit-encoding extension on the pegRNA directly into the target site, the branched intermediate is formed. Branched intermediate consists of two competing single-stranded DNA flaps. 30 flap contains the edited sequence while 50 flap contains the unedited sequence and is preferentially cleaved by nucleases. Ligation of 30 flap incorporates the edited DNA strand into the heteroduplex DNA containing one edited strand and one unedited strand. Finally, to resolve the heteroduplex by copying the information from the edited strand to the complementary strand, DNA repair mechanisms permanently install the desired edit

as a template, thus further increasing editing efficiency two- to fourfold. A variant of PE3 system, Prime editor 3b (PE3b) minimizes the presence of concurrent nicks, therefore minimizing the formation of DSBs and indels by utilizing a sgRNA with a protospacer that matches the edited strand, but not the original allele. PE3b resulted in a 13-fold decrease in the average number of indels compared to PE3 in human cell lines without compromising editing efficiency [12]. Prime editors can introduce all 12 possible transition and transversion mutations, small indels as well as combinations thereof. Notably, the prime editing efficiency is also affected by the design of pegRNA.

86

Simon Sretenovic et al.

Prime editing has been demonstrated in multiple mammalian cell lines with varying efficiency [12]. It has been demonstrated in several plant species including rice [15–20], wheat [16], and tomato [21]. Interestingly, in rice, PE2 system on average outperformed PE3 systems probably due to differences in DNA repair mechanisms involved in prime editing in rice and human cell lines [15, 17]. In this chapter, a modular Gateway assembly is used to prepare prime editing reagents in a user-friendly and time-efficient manner. Relying on the Gateway recombination, three modules are required for the final T-DNA plasmid assembly: a promoterless nCas9 (H840A) with C terminally fused engineered M-MLV-RT entry clone with attL1 and attR5 recombination sites; a pegRNA entry clone with attL5 and attL2 sites; and a destination T-DNA vector with a promoter for nCas9-M-MLV-RT transcription, selection markers for bacteria as well as transgenic plants and attR1 and attR2 sites (Fig. 2). Each module can be modified independently to fit specific experimental goals in diverse organisms. Transient expression of T-DNA plasmids in protoplasts of a chosen plant species for rapid assessment of the assembled reagents is advised before using them to generate stable lines with the desired edits. Here, we demonstrated the construction of prime editing system 2 (PE2) for precise genome editing in plants. As an example, we edited the OsALS gene in rice (Fig. 3), and the editing efficiency is assessed using next-generation sequencing (NGS) of PCR amplicons.

2

Materials 1. Annotated genomic sequence of target gene(s). The genomic sequence information for the OsALS gene used in this study can be found at the National Center for Biotechnology Information (NCBI) (Table 1). 2. PegRNA design tools can be used to automatically design pegRNA for Cas9, including pegFinder [22], PrimeDesign [23], Primeedit [24], or manually with, for example, Benchling (https://benchling.com). The availability of the whole genome sequence can help minimize the off-target effects. 3. DNA oligonucleotides for pegRNA cloning (Table 2). 4. Plasmids. All plasmids used in this protocol are available from Addgene (https://www.addgene.org): pYPQ141D-peg (#141081), pYPQ166-OsPE2 (#141080), and pYPQ203 (#86207). 5. Molecular grade water for molecular reactions otherwise sterile deionized water.

Prime Editing in Plants

87

SpeR OsU3 or OsU6 attL5

crRNA

tracrRNA

RT temp

PBS

attL2

pegRNA entry clone

SpeR NosT

nCas9-PE2 entry clone attL1

OsU3 or OsU6

nCas9(H840A) – M-MLV-RT

attR5

pZmUbi

NosT ChlR

attR1

attR2

ccdB

HygR

Destination vector KanR

RB

LB

Gateway LR reaction NosT

pZmUbi

OsU3 or OsU6 NosT

OsU3 or OsU6 crRNA

nCas9(H840A) – M-MLV-RT

tracrRNA

RT temp

PBS HygR

T-DNA RB

KanR

LB

Fig. 2 Gateway assembly of the PE2 system. Two entry vectors and a destination vector are required for the final T-DNA plasmid assembly: a promoterless nCas9-PE2 entry clone with attL1 and attR5 recombination sites; a pegRNA entry clone with attL5 and attL2 sites; and a destination T-DNA plasmid with a pZmUbi promoter for nCas9-PE2 transcription, a kanamycin selection marker for bacteria and hygromycin for transgenic plants, and attR1, attR2 recombination sites

6. T4 polynucleotide kinase (PNK) and 10 PNK buffer, 10 mM ATP. 7. Heat block or water bath, heat plate magnetic stirrer, centrifuge, PCR cycler, temperature controlled orbital shaker and incubator, vacuum infiltration apparatus, pH meter. 8. 2 mL, 1.7 mL, or 1.5 mL micro centrifuge tubes, 0.2 mL PCR tubes, 50 mL and 15 mL conical tubes, autoclavable 330 mL culture vessels, Petri dish with 90 mm diameter, 12-well plates. 9. Weighing boats for dehusking rice, 0.22 μm syringe filters, Neubauer counting chamber, sterilized filter paper, sterile tweezers, razor blades. 10. Automatic pipettor with sterile pipette tips. When transferring protoplasts, cut the tip of pipette tips prior to sterilization.

88

Simon Sretenovic et al.

Fig. 3 Targeting site within the OsALS gene. The target site within OsALS gene is depicted with ALS-crRNA1, RT template and PBS sequences that together with crRNA and tracrRNA form pegRNA. RT template encodes a G-to-T transversion resulting in W548L amino acid change in OsALS Table 1 Information of the target gene in this study

Purpose

Gene

Full name

Gene locus

NCBI gene symbol

Introducing W548L mutation with prime editing

OsALS

Oryza sativa Acetolactate synthase

Os02g30630

LOC4329450

Table 2 DNA oligonucleotides to prepare the pegRNA Type

DNA oligonucleotides 50 !30

crRNA

50 -TGGCATTTGGGTATGGTGGTGCAA-30 50 -AAACTTGCACCACCATACCCAAAT-30

tracrRNA

50 -GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTT GAAAAAGTGGCACCGAGTCG-30 0 5 -GCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTT AACTTGCTATTTCTAGCTCTA-30

RT-PBS

50 -GTGCTATCCTCCaATTGCACCACCATACCC-30 50 -AAAAGGGTATGGTGGTGCAATtGGAGGATA-30

11. 70% (v/v) ethanol, 50% (v/v) commercial bleach (5.25% hypochlorite). 12. Restriction enzymes and their respective reaction buffers: Esp3I (BsmBI), BsaI, and EcoRI. 13. Silica column-based gel purification kit (e.g., QIAquick Gel Extraction Kit).

Prime Editing in Plants

89

14. Plasmid Miniprep kit (e.g., IBI scientific Hi-Speed Mini Plasmid Kit). Plasmid Midiprep kit (e.g., Qiagen® Midi Plasmid Kit). 15. LB medium: 1% (w/v) tryptone, 0.5% (w/v) yeast extract, 1% (w/v) sodium chloride, 1.5% (w/v) agar for preparing solid LB plates. For the preparation of liquid medium, omit the agar. 16. S.O.C medium: 2% (w/v) tryptone, 0.5% (w/v) yeast extract, 10 mM sodium chloride, 2.5 mM potassium chloride, 10 mM magnesium chloride, 10 mM magnesium sulfate, and 20 mM glucose. 17. MS medium: 4.33 g/L MS salts and vitamins, 100 mg/L myo-inositol, 30 g/L sucrose, 3 g/L gelrite. Adjust pH to 5.8. 18. Antibiotic stock solutions (1000): 50 mg/mL spectinomycin and 50 mg/mL kanamycin. Antibiotics are dissolved in water and filtered through 0.22 μm syringe filter. Stock solutions are aliquoted in 2-mL tubes and stored at 20  C. 19. DNA quantification equipment (e.g., NanoDrop™ One UV-Visible spectrophotometer). 20. Agarose gel electrophoresis equipment and supplies, DNA molecular markers, gel imaging system. 21. Chemically competent cells of Escherichia coli DH5α. Other E. coli strains can be used for cloning if faster growth rate is preferred. 22. GatewayTM LR ClonaseTM II Enzyme Mix.

3

Methods

3.1 T-DNA Vector Construction for Prime Editing with the PE2 System

1. Design pegRNA(s) to edit the target site(s). The pegRNA used in this study is designed to introduce W548L mutation into the OsALS gene through a T-to-G mutation. The pegRNA contains four major components (crRNA, tracrRNA, PBS, and RT template) and their sequences can be found in Table 3. A few principles should be considered when designing crRNAs: (a) Target sequence within the plant genome is between 18 and 22 nucleotides long and is followed by SpCas9 PAM sequence 50 -NGG-30 . The crRNA can target either strand of genomic DNA. (b) The crRNA editing efficiency can be predicted by a pegRNA design software. Strong secondary structures, extreme GC content (>30% or 14,633 bp) from the gel and purify it using a suitable gel purification kit. Store the plasmid at 20  C for long-term use. Component

Amount (μl)

1

ddH2O

38

2

10
buffer

5

3

KpnI

2.5

4

BglII

2.5

5

Plasmid of recombinant SK-gRNA fragment having guide sequence

2 (conc. 1000 ng/μl)

Total volume

50

Take the above amount of components three times for getting more concentration of the desired fragment after purification into a 1.5 ml tube and then incubate at 37  C for 2 h. Note: KpnI and BglII are incompatible restriction enzyme. Double digestion depends on common buffer supplied by company. Sequential digestion has to be performed in case of unavailability of a common buffer 3.3.6 Gel Electrophoresis and Purification

3.3.7 Ligation Reaction System

Add 2μl gel loading dye after digestion and run into 1% agarose gel using plasmid of recombinant SK-gRNA having guide sequence as a control. Collect the desired band (band size near to 527 bp) from the gel and purify it using a suitable gel purification kit. Store the plasmid at 20  C for long-term use. Component

Amount (μl)

1 ddH2O

7

2 10
DNA ligase buffer

1

3 T4 DNA ligase

1 (continued)

CRISPR-Cas9-Mediated Genome Editing in Rice: A Systematic Protocol for. . .

189

Component

Amount (μl)

4 Digested plasmid of pC1300-Cas9 vector

0.5 (conc. 50 ng/μl)

5 Digested plasmid of recombinant SK-gRNA fragment having guide sequence

0.5 (conc. 50 ng/μl)

Total volume

10

Take the above amount of components into a 100 μl tube and incubate at 16  C for 8 h. 3.3.8 Transformation of the Constructed Plasmid into Competent DH5α Cells

Perform transformation of the constructed plasmid into competent DH5α cells by the following protocol. 1. Thaw a tube of competent DH5α cells on ice until the last ice crystals disappear. Mix gently and carefully pipette 50μl of cells into a transformation tube on ice. 2. Add 5μl of the product of ligation reaction into 50μl competent DH5α cells and flick the tube gently. 3. Incubate on the ice for 30 min and then heat shock it at 42  C for 42 s. Return it immediately to ice for 2 min. 4. Add 500μl LB medium (without antibiotics) and then centrifuge for 1 h at 37  C and 150 rpm. 5. Warm Kan + LB culture plates to 37  C. Spread 50–100μl cell cultures onto plate and incubate overnight at 37  C. Alternatively, incubate at 30  C for 24–36 h or 25  C for 48 h.

3.3.9 Bacterial Colony Culture

3.3.10 Bacterial Colony PCR

Pick a single colony and mix with 1000μl Kan + LB into a 1.5 ml tube. Pick a total of 10–12 colonies from each plate and then culture for 4 h at 250 rpm, 37  C in an incubator shaker. Component

Amount (μl)

1

Bacteria culture

1

2

pC1300-F (designed from pC1300-Cas9 sequence) and g (R) primer

0.5 + 0.5

3

dNTPs

1

4

2
PCR buffer

5

5

Taq polymerase (1 U/μl)

0.1

6

ddH2O

1.9

Total volume

10

190

Hirendra Nath Barman

3.3.11 PCR Cycling Process

Temperature ( C)

Time

95

3 min

95 a 55 68

10 s 30 s 1 min

30–35 cycles

68 4

5 min 10 min

a

Depends on annealing temperature of the primer

3.3.12 Gel Electrophoresis

Add 1μl gel loading dye into each PCR tube and mix well, and then run into the gel using 2000 bp DNA ladder. Positive colonies will give a band near to 250 bp position.

3.3.13 Sequencing of Positive Colony

Select the positive colonies from the gel profile and perform DNA sequencing using a pC1300-F primer ( ACACTT TATGCTTCCGGCTC ) to verify the correctness of the guide sequence ligation with pC1300-Cas9. The schematic diagram of the whole process is shown in Fig. 4d–h.

3.4 Vector Construction for Two Target Sites Following Two-Step Methods

Add 100μl recombinant SK-gRNA having guide sequence 1 and SK-gRNA having guide sequence 2 separately into 25 ml Amp + LB solution, and culture for 12–15 h at 250 rpm, 37  C in an incubator shaker. Extract plasmid using a suitable plasmid extraction kit and store at 20  C for long-term use.

3.4.1 Culture of Recombinant SK-gRNA 3.4.2 A Double Digestion of Recombinant SK-gRNA Having Guide Sequence 1

Component

Amount (μl)

1

ddH2O

38

2

10
buffer

5

3

KpnI

2.5

4

BamHI

2.5

5

Plasmid of recombinant SK-gRNA having guide sequence 1

2 (conc. 1000 ng/μl)

Total volume

50

Take the above amount of components three times for getting more concentration of the desired fragment after purification into a 1.5 ml tube and then incubate at 37  C for 3 h.

CRISPR-Cas9-Mediated Genome Editing in Rice: A Systematic Protocol for. . . 3.4.3 Gel Electrophoresis and Purification

3.4.4 A Double Digestion of Recombinant SK-gRNA Having Guide Sequence 2

191

Add 2μl gel loading dye after digestion and run into 1% agarose gel using plasmid of recombinant SK-gRNA having guide sequence 1 as a control. Collect the desired band (band size larger than control, i.e., >3414 bp) from the gel and purify it using a suitable gel purification kit. Store the plasmid at 20  C for long-term use.

Component

Amount (μl)

1

ddH2O

38

2

10
uffer

5

3

KpnI

2.5

4

BglII

2.5

5

Plasmid of recombinant SK-gRNA having guide sequence 2

2 (conc. 1000 ng/μl)

Total volume

50

Take the above amount of components three times for getting more concentration of the desired fragment after purification into a 1.5 ml tube and then incubate at 37  C for 2 h. 3.4.5 Gel Electrophoresis and Purification

3.4.6 Ligation Reaction System

Add 2μl gel loading dye after digestion and run into 1% agarose gel using plasmid of recombinant SK-gRNA having guide sequence 2 as a control. Collect the desired band (band size near to 527 bp) from the gel and purify it using a suitable gel purification kit. Store the plasmid at 20  C for long-term use. Component

Amount (μl)

1

ddH2O

7

2

10
DNA ligase buffer

1

3

T4 DNA ligase

1

4

Digested plasmid of recombinant SK-gRNA vector having guide sequence 1

0.5 (conc. 50 ng/μl)

5

Digested plasmid of recombinant SK-gRNA fragment having guide sequence 2

0.5 (conc. 50 ng/μl)

Total volume

10

Take the above amount of components into a 100 μl tube and incubate at 16  C for 8 h. 3.4.7 Transformation of the Constructed Plasmid into Competent DH5α Cells

Follow the procedure of the Subheading 3.2.6.

192

Hirendra Nath Barman

3.4.8 Bacterial Colony Culture

Follow the procedure of the Subheading 3.2.7.

3.4.9 Bacterial Colony PCR

Component

Amount (μl)

1

Bacteria culture

1

2

T3-F (designed from SK-gRNA sequence) and g (R) primer of guide sequence 2

0.5 + 0.5

3

dNTPs

1

4

2
PCR buffer

5

5

Taq polymerase (1 U/μl)

0.1

6

ddH2O

1.9

Total volume

3.4.10 PCR Cycling Process

10

Temperature ( C)

Time

95

3 min

95 a 55 68

30–35 cycles

68 4

10 s 30 s 1 min 5 min 10 min

a

Depends on annealing temperature of the primer

3.4.11 Gel Electrophoresis

Add 1μl gel loading dye into each PCR tube and mix well, and then run into the gel using 2000 bp DNA ladder. Positive colonies will give a band near to 1000 bp position.

3.4.12 Sequencing of Positive Colony

Select the positive colonies from the gel and perform DNA sequencing using T3-F primer (ATTAACCCTCACTAAAGGGA) to verify the correctness of the guide sequence 2 ligation with recombinant SK-gRNA having guide sequence 1. The schematic diagram of the whole process is shown in Fig. 5a–e.

3.4.13 Culture of E. coli Cells Harboring pC1300-Cas9 Vector

Add 100μl pC1300-Cas9 into 25 ml Kan + LB solution and culture for 12–15 h at 250 rpm, 37  C in an incubator shaker. Extract plasmid using a suitable plasmid extraction kit and store at 20  C for long-term use.

3.4.14 Culture of Recombinant SK-gRNA

Add 100μl recombinant SK-gRNA having guide sequence 1 and guide sequence 2 into 25 ml Amp + LB solution, and culture for 12–15 h at 250 rpm, 37  C in an incubator shaker. Extract plasmid using a suitable plasmid extraction kit and store at 20  C for longterm use.

CRISPR-Cas9-Mediated Genome Editing in Rice: A Systematic Protocol for. . .

193

Fig. 5 Ligation of two-guide sequence into SK-gRNA. (a) Digestion of SK-gRNA having guide sequence 1 using KpnI and BamHI, (b) Digestion of SK-gRNA having guide sequence 2 using KpnI and BglII, (c) Digested SK-gRNA vector having guide sequence 1, (d) Digested SK-gRNA fragment having guide sequence 2, and (e) Recombinant SK-gRNA having two-guide sequence 3.4.15 A Double Digestion of pC1300-Cas9

Component

Amount (μl)

1

ddH2O

38

2

10
buffer

5

3

KpnI

2.5

4

BamHI

2.5

5

Plasmid of pC1300-Cas9 vector

2 (conc. 1000 ng/μl)

Total volume

50

194

Hirendra Nath Barman

Take the above amount of components three times for getting more concentration of the desired fragment after purification into a 1.5 ml tube and then incubate at 37  C for 3 h. 3.4.16 Gel Electrophoresis and Purification

3.4.17 A Double Digestion of Recombinant SK-gRNA Having Guide Sequence 1 and 2

Add 2μl gel loading dye after digestion and run into 1% agarose gel using plasmid of pC1300-Cas9 as a control. Collect the desired band (band size larger than control, i.e., >14,633 bp) from the gel and purify it using a suitable gel purification kit. Store the plasmid at 20  C for long-term use. Component

Amount (μl)

1 ddH2O

38

2 10
buffer

5

3 KpnI

2.5

4 BglII

2.5

5 Plasmid of recombinant SK-gRNA fragment having guide sequence 1 and guide sequence 2

2 (conc. 1000 ng/μl)

Total volume

50

Take the above amount of components three times for getting more concentration of the desired fragment after purification into a 1.5 ml tube and then incubate at 37  C for 2 h. 3.4.18 Gel Electrophoresis and Purification

3.4.19 Ligation Reaction System

Add 2μl gel loading dye after digestion and run into 1% agarose gel using plasmid of recombinant SK-gRNA having guide sequence 1 and guide sequence 2 as a control. Collect the desired band (band size near to 1050 bp) from the gel and purify it using a suitable gel purification kit. Store the plasmid at 20  C for long-term use. Component

Amount (μl)

1 ddH2O

7

2 10
DNA ligase buffer

1

3 T4 DNA ligase

1

4 Digested plasmid of pC1300-Cas9 vector

0.5 (conc. 50 ng/μl)

5 Digested plasmid of recombinant SK-gRNA fragment having guide sequence 1 and guide sequence 2

0.5 (conc. 50 ng/μl)

Total volume

10

Take the above amount of components into a 100 μl tube and incubate at 16  C for 8 h.

CRISPR-Cas9-Mediated Genome Editing in Rice: A Systematic Protocol for. . . 3.4.20 Transformation of the Constructed Plasmid into Competent DH5α Cells

Follow the procedure of Subheading 3.3.8.

3.4.21 Bacterial Colony Culture

Follow the procedure of Subheading 3.3.9.

3.4.22 Bacteria Colony PCR

195

Component

Amount (μl)

1 Bacteria culture

1

2 pC1300-F (designed from pC1300-Cas9 sequence) and g 0.5 + 0.5 (R) primer of guide sequence 1

3.4.23 PCR Cycling Process

3 dNTPs

1

4 2
PCR buffer

5

5 Taq polymerase (1 U/μl)

0.1

6 ddH2O

1.9

Total volume

10

Temperature ( C)

Time

95

3 min

95 a 55 68

30–35 cycles

68 4

10 s 30 s 1 min 5 min 10 min

a

Depends on annealing temperature of the primer

3.4.24 Gel Electrophoresis

Add 1μl gel loading dye into each PCR tube and mix well, and then run into the gel using 2000 bp DNA ladder. Positive colonies will give a band near to 750 bp position.

3.4.25 Sequencing of Positive Colony

Select the positive colonies from the gel and perform DNA sequencing using pC1300-F primer (ACACTTTATGCTTCC GGCTC) to verify the correctness of the guide sequence 2, g (R) primer of guide sequence 2 to correctness of the guide sequence 1. The schematic diagram of the whole process is shown in Fig. 6a–e.

196

Hirendra Nath Barman

Fig. 6 Vector construction of CRISPR-Cas9 system for two target sites following two-step method. (a) Digestion of pC1300-Cas9 using KpnI and BamHI, (b) Digestion of recombinant SK-gRNA having two-guide sequence using KpnI and BglII, (c) Digested pC1300-Cas9 vector, (d) Digested recombinant SK-gRNA fragment having two-guide sequence, and (e) Recombinant pC1300-Cas9 vector constructs

CRISPR-Cas9-Mediated Genome Editing in Rice: A Systematic Protocol for. . .

3.5 Vector Construction for Two Target Sites Following One-Step Methods

197

Add 100μl pC1300-Cas9 into 25 ml Kan + LB solution and culture for 12–15 h at 250 rpm, 37  C in an incubator shaker. Extract plasmid using a suitable plasmid extraction kit and store at 20  C for long-term use.

3.5.1 Culture of E. coli Cells Harboring pC1300-Cas9 Vector 3.5.2 Culture of Recombinant SK-gRNA

3.5.3 A Double Digestion of pC1300-Cas9

Add 100μl recombinant SK-gRNA having guide sequence 1 and SK-gRNA having guide sequence 2 separately into 25 ml Amp + LB solution, and culture for 12–15 h at 250 rpm, 37  C in an incubator shaker. Extract plasmid using a suitable plasmid extraction kit and store at 20  C for long-term use. Component

Amount (μl)

1

ddH2O

38

2

10
buffer

5

3

KpnI

2.5

4

BamHI

2.5

5

Plasmid of pC1300-Cas9 vector

2 (conc. 1000 ng/μl)

Total volume

3.5.4 Gel Electrophoresis and Purification

3.5.5 A Double Digestion of Recombinant SK-gRNA Having Guide Sequence 2

50

Take the above amount of components three times for getting more concentration of the desired fragment after purification into a 1.5 ml tube and then incubate at 37  C for 3 h. Add 2μl gel loading dye after digestion and run into 1% agarose gel using plasmid of pC1300-Cas9 as a control. Collect the desired band (band size larger than control, i.e., >14,633 bp) from the gel and purify it using a suitable gel purification kit. Store the plasmid at 20  C for long-term use. Component

Amount (μl)

1

ddH2O

38

2

10
buffer

5

3

KpnI

2.5

4

SalI

2.5

5

Plasmid of recombinant SK-gRNA fragment having guide sequence 2

2 (conc. 1000 ng/μl)

Total volume

50

198

Hirendra Nath Barman

Take the above amount of components three times for getting more concentration of the desired fragment after purification into a 1.5 ml tube and then incubate at 37  C for 2 h. 3.5.6 Gel Electrophoresis and Purification

3.5.7 A Double Digestion of Recombinant SK-gRNA Having Guide Sequence 1

Add 2μl gel loading dye after digestion and run into 1% agarose gel using plasmid of recombinant SK-gRNA having guide sequence 2 as a control. Collect the desired band (band size near to 517 bp) from the gel and purify it using a suitable gel purification kit. Store the plasmid at 20  C for long-term use. Component

Amount (μl)

1 ddH2O

38

2 10
buffer

5

3 XhoI

2.5

4 BglII

2.5

5 Plasmid of recombinant SK-gRNA fragment having guide sequence 1

2 (conc. 1000 ng/μl)

Total volume

50

Take the above amount of components three times for getting more concentration of the desired fragment after purification into a 1.5 ml tube and then incubate at 37  C for 2 h. 3.5.8 Gel Electrophoresis and Purification

3.5.9 Ligation Reaction System

Add 2μl gel loading dye after digestion and run into 1% agarose gel using plasmid of recombinant SK-gRNA having guide sequence 1 as a control. Collect the desired band (band size near to 511 bp) from the gel and purify it using a suitable gel purification kit. Store the plasmid at 20  C for long-term use. Component

Amount (μl)

1

ddH2O

6.5

2

10
DNA ligase buffer

1

3

T4 DNA ligase

1

4

Digested plasmid of pC1300-Cas9 vector

0.5 (conc. 50 ng/μl)

5

Digested plasmid of recombinant SK-gRNA fragment having guide sequence 2

0.5 (conc. 50 ng/μl)

6

Digested plasmid of recombinant SK-gRNA fragment having guide sequence 1

0.5 (conc. 50 ng/μl)

Total volume

10

Take the above amount of components into a 100 μl tube and incubate at 16  C for 8 h.

CRISPR-Cas9-Mediated Genome Editing in Rice: A Systematic Protocol for. . . 3.5.10 Transformation of the Constructed Plasmid into Competent DH5α Cells

Follow the procedure of Subheading 3.3.8.

3.5.11 Bacterial Colony Culture

Follow the procedure of Subheading 3.3.9.

3.5.12 Bacteria Colony PCR

3.5.13 PCR Cycling Process

199

Component

Amount (μl)

1

Bacteria culture

1

2

pC1300-F (designed from pC1300-Cas9 sequence) and g (R) primer of guide sequence 1

0.5 + 0.5

3

dNTPs

1

4

2
PCR buffer

5

5

Taq polymerase (1 U/μl)

0.1

6

ddH2O

1.9

Total volume

10

Temperature ( C)

Time

95

3 min

95 a 55 68

30–35 cycles

68 4

10 s 30 s 1 min 5 min 10 min

a

Depends on annealing temperature of the primer

3.5.14 Gel Electrophoresis

Add 1μl gel loading dye into each PCR tube and mix well, and then run into the gel using 2000 bp DNA ladder. Positive colonies will give a band near to 750 bp position.

3.5.15 Sequencing of Positive Colony

Select the positive colonies from the gel and perform DNA sequencing using pC1300-F primer (ACACTTTATGCTTCC GGCTC) to verify the correctness of the guide sequence 2 and g (R) primer of guide sequence 2 to correctness of the guide sequence 1. The schematic diagram of the whole process is shown in Fig. 7a–g.

3.6 Vector Construction for Three Target Sites

1. Perform double-digestion reaction of recombinant pC1300Cas9 having guide sequence 1 and guide sequence 2 using KpnI and BamHI. 2. Perform double-digestion reaction of recombinant SK-gRNA having guide sequence 3 using KpnI and BglII.

200

Hirendra Nath Barman

Fig. 7 Vector construction of CRISPR-Cas9 system for two target sites following one-step method. (a) Digestion of pC1300-Cas9 using KpnI and BamHI, (b) Digestion of recombinant SK-gRNA having guide sequence 2 using KpnI and SalI, (c) Digestion of recombinant SK-gRNA having guide sequence 1 using XhoI and BglII, (d) Digested pC1300-Cas9 vector, (e) Digested recombinant SK-gRNA fragment having guide sequence 2, (f) Digested recombinant SK-gRNA fragment having guide sequence 1, and (g) Recombinant pC1300-Cas9 vector constructs. Here digestion with KpnI in pC1300-Cas9 and SK-gRNA; SalI and XhoI in SK-gRNA; BamHI in pC1300-Cas9 and BglII in SK-gRNA generate compatible ends

3. Perform ligation reaction between digested recombinant pC1300-Cas9 having two-guide sequence and fragment of recombinant SK-gRNA having guide sequence 3. 4. Perform transformation of the ligation mixture into competent DH5α cells. 5. Spread 50–100μl cell cultures onto Kan + LB plate and incubate overnight at 37  C. 6. Pick a single colony and mix with 1000μl Kan + LB into a 1.5 ml tube and culture for 4 h at 250 rpm, 37  C in an incubator shaker.

CRISPR-Cas9-Mediated Genome Editing in Rice: A Systematic Protocol for. . .

201

Fig. 8 Vector construction of CRISPR-Cas9 system for three target sites. (a) Digestion of recombinant pC1300Cas9 having guide sequence 1 and guide sequence 2 using KpnI and BamHI, (b) Digestion of recombinant SK-gRNA having guide sequence 3 using KpnI and BglII, (c) Digested recombinant pC1300-Cas9 having guide sequence 1 and guide sequence 2, (d) Digested recombinant SK-gRNA fragment having guide sequence 3, and (e) Recombinant pC1300-Cas9 vector constructs

7. Select the positive colonies by PCR amplification using pC1300-Cas9-F and g (R) primer of guide sequence 3. 8. Perform DNA sequencing using pC1300-F primer (ACACTT TATGCTTCCGGCTC) to verify the correctness of the guide sequence 3, g (R) primer of guide sequence 3 to correctness of the guide sequence 2, and g (R) primer of guide sequence 2 to correctness of the guide sequence 1. The schematic diagram of the whole process is shown in Fig. 8a–e.

202

Hirendra Nath Barman

3.7 Vector Construction for Four Target Sites

1. Perform double-digestion reaction of recombinant pC1300Cas9 having guide sequence 1 and guide sequence 2 using KpnI and BamHI. 2. Perform double-digestion reaction of recombinant SK-gRNA having guide sequence 4 using KpnI and SalI. 3. Perform double-digestion reaction of recombinant SK-gRNA having guide sequence 3 using XhoI and BglII. 4. Perform ligation reaction among the digested recombinant pC1300-Cas9 having two-guide sequence, fragments of recombinant SK-gRNA having guide sequence 4 and fragments of recombinant SK-gRNA having guide sequence 3. 5. Perform transformation of the constructed plasmid into competent DH5α cells. 6. Spread 50–100μl cell cultures onto Kan + LB plate and incubate overnight at 37  C. 7. Pick a single colony and mix with 1000μl Kan + LB into a 1.5 ml tube and culture for 4 h at 250 rpm, 37  C in an incubator shaker. 8. Select the positive colonies by PCR amplification using pC1300-Cas9-F and g (R) primer of guide sequence 4. 9. Perform DNA sequencing using pC1300-F primer (ACACTT TATGCTTCCGGCTC) to verify the correctness of the guide sequence 4, g (R) primer of guide sequence 4 to correctness of the guide sequence 3, g (R) primer of guide sequence 3 to correctness of the guide sequence 2, and g (R) primer of guide sequence 2 to correctness of the guide sequence 1. The schematic diagram of the whole process is shown in Fig. 9a–g. Note: One gRNA is inserted into pC1300-Cas9 having four guide sequence following the protocol as stated in Subheading 3.6 to construct a vector with five guide sequence, and two gRNA is inserted into pC1300-Cas9 having four guide sequence following the protocol as stated in Subheading 3.7 to construct a vector with six guide sequence. The DNA sequencing is done using pC1300-F primer (ACACTTTATGCTTCCGGCTC) to verify the correctness of the guide sequence 6, g (R) primer of guide sequence 6 to correctness of the guide sequence 5, g (R) primer of guide sequence 5 to correctness of the guide sequence 4, g (R) primer of guide sequence 4 to correctness of the guide sequence 3, g (R) primer of guide sequence 3 to correctness of the guide sequence 2, and g (R) primer of guide sequence 2 to correctness of the guide sequence 1.

CRISPR-Cas9-Mediated Genome Editing in Rice: A Systematic Protocol for. . .

203

Fig. 9 Vector construction of CRISPR-Cas9 system for four target sites. (a) Digestion of recombinant pC1300Cas9 having guide sequence 1 and guide sequence 2 using KpnI and BamHI, (b) Digestion of recombinant SK-gRNA having guide sequence 4 using KpnI and SalI, (c) Digestion of recombinant SK-gRNA having guide sequence 3 using XhoI and BglII, (d) Digested recombinant pC1300-Cas9 having guide sequence 1 and guide sequence 2, (e) Digested recombinant SK-gRNA fragment having guide sequence 4, (f) Digested recombinant SK-gRNA fragment having guide sequence 3, and (g) Recombinant pC1300-Cas9 vector constructs 3.8 AgrobacteriumMediated Transformation in Rice

An Agrobacterium tumefaciens strain EHA105 is used for rice transformation. Agrobacterium-mediated transformation of the embryogenic calli is performed according to Hiei et al. [18]. Briefly, the hygromycin-containing medium is used to select hygromycinresistant calli, and then the hygromycin-resistant calli are transferred onto regeneration medium for the regeneration of transgenic plants.

3.9 Mutation Detection and Analysis of Transgenic Plants

Extract the genomic DNA from the leaves of transgenic T0 plants using the sodium dodecyl sulfate (SDS) method [19]. Perform the PCRs using primer pairs which generate an amplicon harboring the

204

Hirendra Nath Barman

Fig. 10 Homozygosity/heterozygosity for a mutated sequence. (a) The single peak represents homozygous mutation and (b) double peak represents heterozygous mutation

target site, and sequence the resulting amplicons using the Sanger method. Identify mutations by comparing the amplicon sequences derive from putative transgenic and wild-type templates. Homozygosity/heterozygosity for a mutated sequence is observed from the chromatogram trace (Fig. 10a, b). Heterozygous sequencing results will show double peaks in the chromatogram. The presence/absence of T-DNA is screened at T1 plants using a PCR assay directed to the hpt, Cas9, and gRNA sequence. The hpt, Cas9, and gRNA negative plants are considered T-DNA-free plants. The presence/absence of any off-target mutations are analyzed by predicted off-target sites in different chromosomes.

Acknowledgments The author would like to acknowledge the authority of the State Key Laboratory of Rice Biology, China National Rice Research Institute (CNRRI), Hangzhou for providing all facilities regarding CRISPR-Cas9-mediated genome editing work. References 1. Abdallah NA, Prakash CS, McHughen AG (2015) Genome editing for crop improvement: challenges and opportunities. GM Crops Food 6(4):183–205 2. Zhang H, Zhang J, Wei P et al (2014) The CRISPR/Cas9 system produces specific and homozygous targeted gene editing in rice in one generation. Plant Biotechnol J 12 (6):797–807 3. Molla KA, Karmakar S, Islam MT (2020) Wide horizons of CRISPR-Cas-derived technologies for basic biology, agriculture, and medicine. In: CRISPR-Cas Methods. Humana, New York, NY, pp 1–23

4. Duan YB, Li J, Qin RY et al (2016) Identification of a regulatory element responsible for salt induction of rice OsRAV2 through ex situ and in situ promoter analysis. Plant Mol Biol 90 (1–2):49–62 5. Wang Y, Cheng X, Shan Q, Zhang Y, Liu J, Gao C, Qiu JL (2014) Simultaneous editing of three homoeoalleles in hexaploid bread wheat confers heritable resistance to powdery mildew. Nat Biotechnol 32(9):947–951 6. Chilcoat D, Liu ZB, Sander J (2017) Use of CRISPR/Cas9 for crop improvement in maize and soybean. Prog Mol Biol Transl Sci 149:27–46

CRISPR-Cas9-Mediated Genome Editing in Rice: A Systematic Protocol for. . . 7. Li J, Zhang H, Si X, Tian Y, Chen K, Liu J, Chen H, Gao C (2017) Generation of thermosensitive male-sterile maize by targeted knockout of the ZmTMS5 gene. J Genet Genomics 44(9):465–468 8. Zhang J, Zhang H, Botella JR, Zhu JK (2018) Generation of new glutinous rice by CRISPR/ Cas9 -targeted mutagenesis of the Waxy gene in elite rice varieties. J Int Plant Biol 60 (5):369–375 9. Sun Y, Jiao G, Liu Z, Zhang X, Li J, Guo X, Du W, Du J, Francis F, Zhao Y, Xia LQ (2017) Generation of high-amylose rice through CRISPR/Cas9-mediated targeted mutagenesis of starch branching enzymes. Front Plant Sci 8:298 10. Shao G, Xie L, Jiao G, Wei X, Sheng Z, Tang S, Hu P (2017) CRISPR/CAS9-mediated editing of the fragrant gene Badh2 in Rice. Chin J Rice Sci 31(2):216–222 11. Chao S, Cai Y, Feng B, Jiao G, Sheng Z, Luo J, Tang S, Wang J, Wei X, Hu P (2019) Editing of the rice isoamylase gene ISA1 provides insights into its function in starch formation. Rice Sci 26(2):77–87 12. Wang F, Wang C, Liu P, Lei C, Hao W, Gao Y, Liu YG, Zhao K (2016) Enhanced rice blast resistance by CRISPR/Cas9-targeted mutagenesis of the ERF transcription factor gene OsERF922. PLoS One 11(4):e0154027 13. Sun Y, Zhang X, Wu C, He Y, Ma Y, Hou H, Guo X, Du W, Zhao Y, Xia LQ (2016) Engineering herbicide-resistant rice plants through

205

CRISPR/Cas9-mediated homologous recombination of acetolactate synthase. Mol Plant 9:628–631 14. Zhang A, Liu Y, Wang F, Li T, Chen Z, Kong D, Bi J, Zhang F, Luo X, Wang J, Tang J, Yu X, Liu G, Luo L (2019) Enhanced rice salinity tolerance via CRISPR/Cas9targeted mutagenesis of the OsRR22 gene. Mol Breeding 39:47 15. Zhen HX, Fang ZX, Rong LJ, Gang ZD (2017) Construction and analysis of tify1a and tify1b mutants in rice (Oryza sativa) based on CRISPR/Cas9 technology. J Agric Biotechnol 25:1003–1012 16. Barman HN, Sheng Z, Fiaz S, Zhong M, Wu Y, Cai Y, Wang W, Jiao G, Tang S, Wei X, Hu P (2019) Generation of a new thermo-sensitive genic male sterile rice line by targeted mutagenesis of TMS5 gene through CRISPR/Cas9 system. BMC Plant Biol 19:109 17. Li J, Zhang X, Sun Y, Zhang J, Du W, Guo X, Li S, Zhao Y, Xia LQ (2018) Efficient allelic replacement in rice by gene editing: a case study of the NRT1.1B gene. J Int Plant Biol 60(7):536–540 18. Hiei Y, Ohta S, Komari T, Kumashiro T (1994) Efficient transformation of rice (Oryza sativa L.) mediated by Agrobacterium and sequence analysis of the boundaries of the T-DNA. Plant J 6(2):271–282 19. Dellaporta SL, Wood J, Hicks JB (1983) A plant DNA minipreparation: version II. Plant Mol Biol Rep 1(4):19–21

Chapter 14 Generating Clonal Seeds from Hybrid Rice with CRISPR-Cas9 Chaolei Liu, Chun Wang, and Kejian Wang Abstract The application of heterosis in rice production greatly improves rice yield, but hybrid vigor cannot be preserved in the offspring of hybrids due to genetic segregation. Simultaneous editing of the REC8, PAIR1, and OSD1 genes turns meiosis into mitosis and ultimately produces clonal gametes, while knockout of the MTL gene induces formation of maternal haploid seeds. Genome editing of all these four genes in hybrid rice simultaneously could fix the heterozygosity and obtain clonal seeds from hybrid rice. Here, we describe a detailed method for generating clonal seeds from hybrid rice by using the multiplex CRISPRCas9 technology. Key words Clonal seeds, Hybrid rice, Heterosis, CRISPR-Cas9, Genome editing

1

Introduction The natural phenomenon that the hybrids from a cross between two different parental genotypes display improved performances than both their parents is defined as hybrid vigor [1]. Hybrid vigor has been widely exploited in agriculture for a long time because that many of the improved characteristics are directly related to important agronomic traits, such as adaptation, growth vigor or yield [1, 2]. For a successful example, hybrid rice with a yield advantage over conventional varieties greatly contributed to world food security since 1970s [3]. However, hybrid vigor of hybrid rice seeds cannot be preserved to the following generations due to genetic segregation [1]. Therefore, breeders and geneticists have been eager to explore methods to fix hybrid vigor in crops for decades. Apomixis, an asexual mode of reproduction bypassing meiosis process, shows the potential to preserve hybrid vigor in crops [4]. In apomictic plant species, the produced seeds are genetically identical to their mother plants [2, 4]. Thus, introduction of

M. Tofazzal Islam and Kutubuddin Ali Molla (eds.), CRISPR-Cas Methods: Volume 2, Springer Protocols Handbooks, https://doi.org/10.1007/978-1-0716-1657-4_14, © The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2021

207

208

Chaolei Liu et al.

apomixis into major crops to fix the heterozygosity and preserve hybrid vigor has long been suggested. Recently, two successful strategies have been developed to realize this goal in rice [5, 6]. First, both adopted the mitosis instead of meiosis (MiMe) strategy to turn meiosis into mitosis and generate clonal gametes [7]. Then, editing of the Matrilineal (MTL) gene through the CRISPR-Cas9genome editing system induced formation of haploid seeds [6, 8, 9], or ectopic expression of Baby Boom (BBM) genes caused somatic embryos [5, 10]. Therefore, combination of clonal gametes with haploid seeds or somatic embryos can lead to clonal seed production [5, 6]. Previously, we simultaneously edited Recombinant8 (REC8), Homologous Pairing Aberration in Rice Meiosis1 (PAIR1), Omission of Second Division (OSD1), and MTL in hybrid rice and obtained plants that could propagate clonally through seeds [6]. Here, we describe the protocol in detail to generate clonal seeds from hybrid rice with multiplex CRISPR-Cas9 system.

2

Materials

2.1

Plant

2.2

Plasmids

All solutions should be prepared with ultrapure water. All reagents should be stored at room temperature unless otherwise noticed. 1. Seeds of hybrid rice. Here, we use Chunyou 84 (CY84) as an example, an elite inter-subspecific hybrid rice from a cross between the maternal Chunjiang 16A (16A), a japonica malesterile line, and the paternal C84, an indica-japonica intermediate-type line [6]. 1. pC1300-Actin:Cas9 binary vector (see Fig. 1a). 2. SK-sgRNA vector (see Fig. 1b).

2.3 Bacterial Strain and Growth Medium

1. Competent cells of Escherichia coli DH5α and Agrobacterium tumefaciens strain EHA105. 2. LB medium: 10 g/L tryptone, 5 g/L yeast extraction, 10 g/L NaCl. 3. The selective LB agar plates supplemented with kanamycin with working concentration of 50μg/mL, and with ampicillin of 100μg/mL. Add antibiotic after autoclaving.

2.4 Chemicals, Buffers, and Solutions

1. Restriction enzymes AarI, BamHI, BglII, KpnI, SalI, NheI, XbaI, XhoI, and buffers (NEB). 2. T4 DNA ligase and buffer. 3. 2
Taq Master Mix (CoWin Biosciences). 4. 1% agarose gel. 5. KOD FX and buffer (Toyobo).

Generating Clonal Seeds from Hybrid Rice with CRISPR-Cas9

209

Fig. 1 Map of the pC1300-Actin:Cas9 binary vector (a) and SK-sgRNA vector (b)

6. DL2000 markers. 7. DNA gel extraction kit. 8. Plasmid miniprep kit. 9. 42  C water bath. 10. 37  C incubator. 11. Centrifuge tube with volume of 0.2, 1.5, and 2 mL. 12. 96-well PCR plates. 13. Isopropanol. 14. 70 and 100% ethanol. 15. 2
CTAB buffer (1 L): 100 mM/L Tris-HCl, 1400 mM/L NaCl, 20 mM/L EDTA, 20 g CTAB. 16. Sterile water. 17. LB01 buffer: 15 mM Tris, 2 mM disodium EDTA, 0.5 mM spermine tetrahydrochloride, 80 mM KCl, 20 mM NaCl, 0.1% (v/v) Triton X-100, 15 mM β-mercaptoethanol, pH 7.5, filtered through a 0.22-μm filter. 18. Propidium iodide (PI, Sigma P4170). 19. DNase-free RNase A (Sigma V900498). 2.5 Medium Used in Rice Transformation

1. N6D macro (20
): 56.6 g/L KNO3, 9.26 g/L (NH4)2SO4, 3.7 g/L MgSO4·7H2O, 3.32 g/L CaCl2·2H2O, 8 g/L KH2PO4. 2. N6D micro (200
): 0.88 g/L MnSO4·4H2O, 0.3 g/L ZnSO4·7H2O, 0.16 g/L KI, 0.32 g/L H3BO3. 3. MS organic (200
): 0.4 g/L glycine, 20 g/L inositol, 0.1 g/L nicotinic acid, 0.1 g/L VB6, 0.2 g/L VB1.

210

Chaolei Liu et al.

4. Fe-EDTA (200
): 5.56 g/L FeSO4.7H2O, 7.46 g/L Na2EDTA (seeNote 1). 5. MS macro (20
): 38 g/L KNO3, 33 g/L NH4NO3, 7.4 g/L MgSO4.7H2O, 8.8 g/L CaCl2.2H2O, 3.4 g/L KH2PO4. 6. MS micro (200
): 4.46 g/L MnSO4.4H2O, 1.72 g/L ZnSO4·7H2O, 0.166 g/L KI, 1.24 g/L H3BO3, 0.005 g/L CuSO4·5H2O, 0.005 g/L CoCl2·6H2O, 0.05 g/L Na2Mo4·2H2O. 7. RE/HF organic (200
): 0.4 g/L glycine, 20 g/L inositol, 0.1 g/L nicotinic acid, 0.1 g/L VB6, 0.02 g/L VB1. 8. AAM macro (20
): 60 g/L KCl, 5 g/L MgSO4.7H2O, 3 g/L CaCl2.2H2O, 3 g/L KH2PO4. 9. AAM micro (200
): 2 g/L MnSO4.4H2O, 0.4 g/L ZnSO4·7H2O, 0.15 g/L KI, 0.6 g/L H3BO3, 0.025 g/L CuSO4·5H2O, 0.025 g/L CoCl2·6H2O, 0.25 g/L Na2Mo4·2H2O. 10. AAM organic (200
): 1.5 g/L glycine, 20 g/L inositol, 0.2 g/L nicotinic acid, 0.2 g/L VB6, 2 g/L VB1. 11. AAM amino acid (10
): 1.767 g/L L-arginine, 9 g/L L-glutanine, 3 g/L L-aspartic acid. 12. Acetosyringone. 13. Carbenicillin. 14. Hygromycin B. 15. Kanamycin. 16. Rifampicin. 17. Tween 20. 18. 30% sodium hypochlorite solution. 19. N6D medium: 25 mL N6D macro (20
), 2.5 mL N6D micro (200
), 2.5 mL MS organic (200
), 2.5 mL Fe-EDTA (200
), 5 mL 2,4-D (200 mg/L), 0.15 g acid hydrolyzed casein, 1.439 g L-proline, 15 g sucrose, 2 g phytagel. Add ddH2O to 500 mL, pH 5.2. 20. N6DS medium (pH ¼ 5.2): the N6D medium with hygromycin B (80 mg/L) and carbenicillin (400 mg/L). 21. AAM: 34.25 g sucrose, 18 g glucose, 0.25 g acid hydrolyzed casein, 2.5 mL Fe-EDTA (200
), 50 mL AAM amino acid (10
), 25 mL AAM macro (20
), 2.5 mL AAM micro (200
), 2.5 mL AAM organic (200
). Add ddH2O to 500 mL, pH 5.2. 22. RE-III medium: 25 mL MS macro (20
), 2.5 mL MS micro (200
), 2.5 mL Fe-EDTA (200
), 2.5 mL RE/HF organic (200
), 15 g sucrose, 15 g sorbitol, 1 g acid hydrolyzed casein,

Generating Clonal Seeds from Hybrid Rice with CRISPR-Cas9

211

0.1 mL NAA (0.1 mg/mL), 200μL KT (5 mg/mL), 2 g phytagel. Add ddH2O to 500 mL, pH 5.8. 23. HF medium: 25 mL MS macro (20
), 2.5 mL MS micro (200
), 2.5 mL Fe-EDTA (200
), 2.5 mL RE/HF organic (200
), 15 g sucrose, 2 g phytagel. Add ddH2O to 500 mL, pH 5.8.

3 3.1

Methods Primer Design

1. Select target sequences in OSD1, PAIR1, REC8, and MTL, respectively. The target sites should be unique in the exon of the genes (see Fig. 2; seeNote 2) and can be present on either the sense or antisense strand. Several online software programs, such as CRISPERdirect and CRISPR-P2.0, can be employed to accomplish the gRNA design. 2. Check the potential off-target sites by BLAST searching of the rice genome database. Usually, gRNAs with two or more mismatches to other sequences will not result in off-targeting in rice. 3. Design primers to cover the target sites (see Table 1) and use KOD-FX to amplify target sequences with CY84 genomic

Fig. 2 The selected target sequences in OSD1, PAIR1, REC8, and MTL

212

Chaolei Liu et al.

Table 1 Primers for amplifying target sequences of OSD1, PAIR1, REC8, and MTL, respectively. The primers in bold font are used for sequencing Oligos

Primer sequence (50 to 30 )

Purpose

OSD1F

AAGTGAGAAATTCCGGCGGT

Genotype of OSD1 target site

OSD1R

CCTCGAACACAAGACCACCA

PAIR1F

TGCAATTGACACCCACCCTT

PAIR1R

TGAGTCTACCACCATCCCCA

REC8F

TGGAGTTGATTAGGCCGCTG

REC8R

CCGAGACACATCATCTGCGA

MTLF

CCATGACGCAGATCACCAAG

MTLR

GTTTCGCCGACCTAGCCTC

Genotype of PAIR1 target site

Genotype of REC8 target site

Genotype of MTL target site

Table 2 Oligos for four sgRNAs targetingOSD1, PAIR1, REC8, and MTL, respectively Oligos

Primer sequence (50 to 30 )

Purpose

OSD1g++

GGCACTGCCGCCGACGAGCAACA

1st gRNA targetingOSD1

OSD1g

AAACTGTTGCTCGTCGGCGGCAG

PAIR1g++

GGCAAAGCAACCCAGTGCACCGC

PAIR1g

AAACGCGGTGCACTGGGTTGCTT

REC8g++

GGCACGGAGAGCCTTAGTGCCAT

REC8g

AAACATGGCACTAAGGCTCTCCG

MTLg++

GGCAGGTCAACGTCGAGACCGGC

MTLg

AAACGCCGGTCTCGACGTTGACC

2nd gRNA targetingPAIR1

3rd gRNA targetingREC8

4th gRNA targetingMTL

DNA as template strands. Sequence the PCR products, and compare them to the referenced sequences (seeNote 3). 4. Design two complementary DNA strands for target sequences. Add 50 -GGCA-30 to the forward gRNA oligo and 50 -AAAC-30 for the reverse gRNA oligo (see Table 2). 3.2 Vector Construction

1. Digest 1–2μg SK-sgRNA vector with AarI in a 50μL of digestion reaction for 3–6 h at 37  C in incubator: 5μL 10
buffer, 1μL 50
oligonucleotide, 1μL AarI, 1–2μg SK-gRNA vector. Add ddH2O to 50μL. 2. Run the digested reaction in 1% agarose gel, and purify AarIdigested SK-gRNA vector using a DNA gel extraction kit.

Generating Clonal Seeds from Hybrid Rice with CRISPR-Cas9

213

3. Anneal the oligo pairs: Mix 10μL of 100μM of each oligo pair, and heat the reaction at 100  C for 5 min, and let them cool down to room temperature. 4. Set up a ligation reaction (10μL) at room temperature for 0.5–1 h: 20–50 ng AarI-digested SK-gRNA vector, 1μL 10
T4 ligase buffer, 7μL annealed oligonucleotides, 0.5μL T4 ligase. 5. Transfer the ligation reaction into 50μL of competent Escherichia coli DH5α, and then plate onto ampicillin (100μg/mL) LB plates. Incubate plates overnight at 37  C. 6. Conduct colony PCR assay (see Table 3) by using primer g (see Table 2) and T3 (50 -ATTAACCCTCACTAAAGGGA-30 ). Run the PCR products (fragment size is 476 bp) and DL2000 markers in 1% agarose gel. Further confirm the positive clones by sequencing with T7 (50 -TAATACGACTCACTATAGGG30 ). The confirmed plasmids are named as SK-gRNAOSD1, SK-gRNAPAIR1, SK-gRNAREC8, and SK-gRNAMTL, respectively. 7. The construction of pC1300-Actin:Cas9-gRNAREC8-gRNAPAIR1 -gRNAOSD1-gRNAMTLvector: see Fig. 3 for a scheme of cloning steps involved. First, digest 1–2μg SK-gRNAREC8 with KpnI and XhoI, 1–2μg SK-gRNAPAIR1 with SalI and XbaI, 1–2μg SK-gRNAOSD1 with NheI and BamHI, and 1–2μg SK-gRNAMTL with KpnI and BglII, respectively, in a 50μL of digestion reaction for 3–6 h at 37  C in incubator. Run them in 1% agarose gel, the size of the target bands were 3404 bp, 519 bp, 531 bp, and 549 bp, respectively. Purify them with DNA gel extraction kit. 8. Next, set up a ligation reaction to insert gRNAPAIR1, gRNAOSD1, and gRNAMTL into the KpnI and XhoI-digested SK-gRNAREC8vector to generate SK-gRNAREC8-gRNAPAIR1gRNAOSD1-gRNAMTL plasmid (see Table 4). Use the primer pair of MTLg and T3 (fragment size is 2052 bp) to screen the positive clones, and then confirm them by sequencing with

Table 3 PCR mixture for screening positive clones Template strands

Touch the clones

2
Taq Master Mix

5μL

g

0.2μL

T3

0.2μL

ddH2O

4.6μL

214

Chaolei Liu et al.

Fig. 3 The schematic of construction of pC1300-Actin:Cas9-gRNAREC8-gRNAPAIR1-gRNAOSD1-gRNAMTLvector. Arrows indicate restriction sites Table 4 The SK-gRNAREC8-gRNAPAIR1-gRNAOSD1-gRNAMTLvector ligation KpnI and XhoI-digested SK-gRNAREC8vector gRNA gRNA

30–50 ng

PAIR1

8 ng

OSD1

8 ng

gRNAMTL

8 ng

10
T4 ligase buffer

1μL

T4 ligase

0.5μL

ddH2O

Add to 10μL

primers T7, MTLg, simultaneously.

OSD1g,

and

PAIR1g,

9. After that, digest 1–2μg pC1300-Actin:Cas9 binary vector with KpnI and BamHI and digest 1–2μg SK-gRNAREC8gRNAPAIR1-gRNAOSD1-gRNAMTL plasmid with KpnI and BglII. BamH1 and BglII are isocandamers that can generate compatible sticky ends here. Run them in 1% agarose gel, the size of the target bands were 14,177 bp and 2116 bp, respectively. Purify them with DNA gel extraction kit.

Generating Clonal Seeds from Hybrid Rice with CRISPR-Cas9

215

Table 5 The pC1300-Actin:Cas9-gRNAREC8-gRNAPAIR1-gRNAOSD1-gRNAMTLvector ligation KpnI and BamHI-digested pC1300-Actin:Cas9 vector gRNA

REC8

-gRNA

PAIR1

-gRNA

OSD1

-gRNA

MTL

30–50 ng 10 ng

10
T4 ligase buffer

1μL

T4 ligase

0.5μL

ddH2O

Add to 10μL

10. Finally, set up a ligation reaction to insert the gRNAREC8gRNAPAIR1-gRNAOSD1-gRNAMTL into the KpnI and BamHI-digested pC1300-Actin:Cas9 binary vector (see Table 5). Use the primer pair of MTLg++ and pC1300F (50 ACACTTTATGCTTCCGGCTC-30 ) (fragment size is 924 bp) to screen the positive clones. Then sequence confirm with primers pC1300F, MTLg, OSD1g, and PAIR1g, simultaneously. 3.3 Rice Transformation and Detection of Genome Modifications

The transgenic rice plants are generated by Agrobacteriummediated transformation with the strain EHA105 (seeNote 4). 1. Prepare about 1000 newly harvested Chunyou 84 seeds and dehull them. 2. Sterilize the seeds with 70% ethanol for 1 min, and then wash three times in sterile water. 3. Further sterilize the seeds with 30% sodium hypochlorite containing one drop of Tween-20 per 50 mL for 15 min, and then wash five times in sterile water. 4. Further sterilize the seeds with 30% sodium hypochlorite for 15 min, vibrate and then wash five times in sterile water. 5. Dry the sterilized seeds and then culture them on N6D solid medium at 32  C under continuous light for about 15 days. 6. Transform the sequencing-confirmed vector into competent Agrobacterium tumefaciens strain EHA105. Culture one single colony in AAM medium at 28  C overnight. Measure and adjust the concentration of bacterium at OD600 ¼ 0.1–0.2, and then infect precultured calli for 1.5 min. 7. Transfer the infected calli on a sterilized filter paper and dry them for about 1–2 h to remove excess bacteria. Incubate at 25  C in the dark for 3 days. 8. Rapidly wash the calli three times with 0.4 mg/L carbenicillin sterilized water. Then soak them in the 0.4 mg/L carbenicillin sterilized water for 5 min and wash them. Repeat this twice.

216

Chaolei Liu et al.

Vibrate the calli in 0.4 mg/L carbenicillin sterilized water for 15 min at 120 r/min, and further soak for 30 min. 9. Blot dry the calli on a sterilized filter paper for 1–2 h, and then culture them on N6DS medium under continuous light at 32  C for 15–20 days. 10. Transfer the proliferating calli to RE-III medium containing 50μg/mL hygromycin B and 250μg/mL carbenicillin. Culture them under continuous light at 32  C for 15 days. 11. Transfer the plantlets to HF medium to induce roots at 32  C for more than 20 days. 3.4 Identification of Clonal Plants

1. Grow Chunyou84 (control plants) and T0 transgenic plants in a growth chamber. And extract their genomic DNA by CTAB method. 2. Amplify the target sequences and genotype for mutagenesis by Sanger method (seeNote 5). 3. Identify osd1 pair1 rec8 mtl quadruple T0 mutant lines (seeNote 6), and name them as Fix that for Fixation of hybrids. Transfer the Fix and CY84 (as control) into the soil. Grow them to maturity and harvest their seeds. The Fix plants show lower seed-setting rate than CY84 with no other morphological anomaly (see Fig. 4).

Fig. 4 Comparison of the plant morphology and panicles of CY84 and Fix grown in paddy fields. Scale bars, 5 cm

Generating Clonal Seeds from Hybrid Rice with CRISPR-Cas9

217

4. Germinate the seeds harvested from the T0 Fix plants in laboratory, and transfer the seedlings into the soil and grow them to maturity. 5. At maturity, identify the clonal plants from the T1 population by the morphological characteristics (seeNote 7). The tetraploid plants show less tillers than that of clonal plants. The seeds from tetraploid plants have long awns while that of the clonal plants with no awns (see Fig. 5). 6. Further confirm the clonal plants by flow cytometry. First, chop approximately 2 cm2 leaf tissue by using a new razor blade for 2–3 min in 1 mL LB01 buffer on ice. 7. Then filter the homogenate through a 40μm nylon, and collect the nuclei by centrifugation at 4  C (135
g, 5 min). 8. Next, discard the supernatant and resuspend the pellet in 450μL fresh LB01 buffer. Then add 25μL 1 mg/mL PI and

Fig. 5 Comparison of the plant morphology and panicles of clonal and tetraploid plants grown in paddy fields. Scale bars, 5 cm

218

Chaolei Liu et al.

Fig. 6 Ploidy analysis of the progeny of Fix by flow cytometry, diploid (left) and tetraploid (right). PI propidium iodide

25μL 1 mg/mL DNase-free RNase A to stain the DNA. Incubate samples on ice in darkness for 10 min before analysis. 9. Finally, analyze the samples by using a BD Accuri C6 flow cytometer with laser illumination at 552 nm and a 610/20 nm filter. See the ploidy of tetraploid and diploid plants in Fig. 6.

4

Notes 1. First, prepare the FeSO4·7H2O and Na2-EDTA solution separately, then mix them at 70  C for 2 h. Boil them until the solution turns to deep yellow and keep the solution in a brown bottle. 2. Search suitable PAM site in exons by using genome sequences. The length of target sequence can be 18–20 bp, with GC content between 35 and 75%. 3. The length of the PCR products can be designed as 500–750 bp, and make the target site at the middle region. There should be no mismatches between sequencing results and the referenced sequences at target sites. 4. Here, Chunyou 84 (CY84) is a japonicaclinous inter-subspecific hybrid rice. For some hybrid rice, they are indicaclinous. To improve efficiency, it is better to select japonicaclinous hybrid rice to perform the rice transformation.

Generating Clonal Seeds from Hybrid Rice with CRISPR-Cas9

219

5. We recommend Hi-TOM (available at www.hi-tom.net/hitom), an online tool to track the mutations with precise percentage for multiple samples and multiple target sites [11], to detect genome modifications when there are too many samples. 6. The fragments sequenced by the Sanger method can be decoded by the degenerate sequence decoding method [12]. In-frame deletion mutants at any of the four targets should be discarded, and chimera mutants at one target site can be used as Fix plants. 7. The rate of clonal seeds or plants is about 5.1–9.5%. To date, it is difficult to identify the clonal plants from progeny precisely at seeds or seedlings stage. References 1. Botet R, Keurentjes JJB (2020) The role of transcriptional regulation in hybrid vigor. Front Plant Sci 11:410 2. Wang KJ (2019) Fixation of hybrid vigor in rice: synthetic apomixis generated by genome editing. aBIOTECH 1:15–20 3. Cheng SH, Zhuang JY, Fan YY, Du JH, Cao LY (2007) Progress in research and development on hybrid rice: a super-domesticate in China. Ann Bot 100(5):959–966 4. Fiaz S, Wang X, Younas A, Alharthi B, Riaz A, Ali H (2019) Apomixis and strategies to induce apomixis to preserve hybrid vigor for multiple generations. GM Crops Food 12(1):57–70 5. Khanday I, Skinner D, Yang B, Mercier R, Sundaresan V (2019) A male-expressed rice embryogenic trigger redirected for asexual propagation through seeds. Nature 565 (7737):91–95 6. Wang C, Liu Q, Shen Y, Hua Y, Wang J, Lin J, Wu M, Sun T, Cheng Z, Mercier R, Wang K (2019) Clonal seeds from hybrid rice by simultaneous genome engineering of meiosis and fertilization genes. Nat Biotechnol 37 (3):283–286 7. Mieulet D, Jolivet S, Rivard M, Cromer L, Vernet A, Mayonove P, Pereira L, Droc G, Courtois B, Guiderdoni E, Mercier R (2016) Turning rice meiosis into mitosis. Cell Res 26 (11):1242–1254

8. Kelliher T, Starr D, Richbourg L, Chintamanani S, Delzer B, Nuccio ML, Green J, Chen Z, McCuiston J, Wang W, Liebler T, Bullock P, Martin B (2017) MATRILINEAL, a sperm-specific phospholipase, triggers maize haploid induction. Nature 542 (7639):105–109 9. Yao L, Zhang Y, Liu C, Liu Y, Wang Y, Liang D, Liu J, Sahoo G, Kelliher T (2018) OsMATL mutation induces haploid seed formation in indica rice. Nat Plants 4(8):530–533 10. Boutilier K, Offringa R, Sharma VK, Kieft H, Ouellet T, Zhang L, Hattori J, Liu CM, van Lammeren AA, Miki BL, Custers JB, van Lookeren Campagne MM (2002) Ectopic expression of BABY BOOM triggers a conversion from vegetative to embryonic growth. Plant Cell 14(8):1737–1749 11. Liu Q, Wang C, Jiao X, Zhang H, Song L, Li Y, Gao C, Wang K (2019) Hi-TOM: a platform for high-throughput tracking of mutations induced by CRISPR/Cas systems. Sci China Life Sci 62(1):1–7 12. Ma X, Chen L, Zhu Q, Chen Y, Liu YG (2015) Rapid decoding of sequence-specific nucleaseinduced heterozygous and biallelic mutations by direct sequencing of PCR products. Mol Plant 8:1285–1287

Chapter 15 CRISPR-Cas12a-Based DNA Detection for Fast Pathogen Diagnosis and GMO Test in Plants Yun-Mu Zhang, Yinong Yang, and Kabin Xie Abstract DNA test is widely used in plant pathogen diagnosis and genetically modified organism (GMO) administration. To date, a low-cost, user-friendly, and field-deployable DNA test method with high accuracy and sensitivity is still limited. Recently, the RNA programmable nuclease of CRISPR-Cas is engineered as a new nucleic acid detection platform, providing a novel and promising DNA test strategy for in-field crop disease diagnosis and GMO identification. In this study, we describe an all-paper-based DNA test method using CRISPR-Cas12a. This method combines filter-paper-based DNA purification, recombinase polymerase amplification, target gene detection with Cas12a, and lateral flow assay. Owing to its simplicity, efficiency, robustness, and low-cost, this all-paper-based Cas12a DNA test method could be easily applied in field for crop disease diagnosis and GMO test. Key words DNA test, CRISPR-Cas12a, Rice blast, Disease diagnosis, GMO test

1

Introduction Reliable and field-deployable DNA test method is of great value for plant disease diagnosis [1] and genetically modified organism (GMO) administration [2]. DNA testing relies on amplification of a specific gene using polymerase chain reaction (PCR) [3], loop-mediated isothermal amplification (LAMP) [4], or isothermal recombinase polymerase amplification (RPA) [5]. The amplified DNA molecules can be detected using gel imager, fluorescent probes with a fluorescence reader, nanoparticle based on colorimetric reaction and lateral flow assay (LFA) strip. PCR or quantitative real-time PCR is the golden standard for DNA test, but PCR-based detection requires a thermal cycler, and the detection result is read out using professional instruments like gel imager and real time PCR instrument. Therefore, it is difficult to deploy PCR-based DNA test in field. By contrast, LAMP and RPA have less requirement of instrument and enable on-site DNA testing, despite their

M. Tofazzal Islam and Kutubuddin Ali Molla (eds.), CRISPR-Cas Methods: Volume 2, Springer Protocols Handbooks, https://doi.org/10.1007/978-1-0716-1657-4_15, © The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2021

221

222

Yun-Mu Zhang et al.

detection sensitivity and accuracy are often less than PCR. Nonetheless, a rapid, accurate, instrument-free, and grower-friendly DNA test method is required to meet the growing demand of in-field crop disease diagnosis and GMO identification for agriculture. In recent years, the RNA programmed clustered regularly interspaced short palindromic repeats (CRISPR)-CRISPR associated nuclease (Cas) is engineered as a powerful and versatile tool for genome editing [6] and enables many innovative technologies for nucleic acid manipulations [7]. At least three Class II CRISPR-Cas systems, including CRISPR-Cas12, CRISPR-Cas13, and CRISPRCas14, have collateral nuclease activities and are leveraged to develop accurate, fast, and ultrasensitive nucleic acid detection methods [8–10]. These three Cas nucleases have distinct features for nucleic acid targeting. Cas12a (also named as Cpf1) cleaves double-stranded DNA (dsDNA) target, Cas14 cleaves singlestranded DNA (ssDNA) target, and Cas13 cleaves RNA target. For Cas12a-based gene editing, a crRNA (CRISPR RNA) directs Cas12a nuclease to cut the dsDNA target which is paired with the ~24 nt (nucleotide) guide sequences of crRNA (Fig. 1). A T-rich protospacer-adjacent-motif (PAM) next to the crRNA::DNA pairing region is also required for Cas12a recognition. After cleaving the dsDNA target, the collateral nuclease activity of Cas12a is activated to cleave ssDNA in a non-sequence-specific manner [8] (Fig. 1). Three Cas12a nucleases from Acidaminococcus sp. (AsCas12a), Lachnospiraceae bacterium ND2006 (LbCas12a), and Francisella novicida (FnCas12a) are characterized and engineered to efficient genome editing tool [11, 12]. Owing to its robust dual nuclease activities, LbCas12a with a proper designed ssDNA reporter are used to detect the presence of interested gene with ultrahigh sensitivity, providing a new DNA test strategy which attracts many attentions [8, 13–15]. We developed an all-paper-based DNA detection method using Cas12a for in-field pathogen diagnosis and GMO testing (Fig. 2a) [16]. In this method, a filter-paper dipstick is used for DNA purification at room temperature [17, 18]. The genomic DNA bound to dipstick is directly eluted to RPA mixture to amplify the target gene. Then the Cas12a, crRNA, and ssDNA reporter are added to the amplification mixture for target gene detection. Finally, the sample pad of LFA strip is dipped into the digestion mixture. The detection result is read out according to color development in testing and control lines of the LFA strip (Fig. 2b). In this assay, the DNA purification and LFA detection are performed at room temperature. The RPA and Cas12a/crRNA digestion is carried in one tube at human body temperature (37
C) (Fig. 2a). The reporter is an ssDNA oligo attached with fluorescein (FAM) at 50 -end and biotin at 30 -end (FB reporter, Fig. 2b). If the target gene is present, the collateral nuclease activity of Cas12a is

CRISPR-Cas12a-Based DNA Detection for Fast Pathogen Diagnosis and GMO Test. . .

223

Fig. 1 The schematics of dual nuclease activities of Cas12a to cleave targeted DNA and non-targeted ssDNA. Cas12a and crRNA recognizes and cleaves dsDNA target which is paired with the 30 -end guide sequence of crRNA. The cleavage of dsDNA target also triggers the collateral nuclease activity of Cas12a, which subsequently can cleave ssDNA in a non-sequence-specific manner. The PAM sequence for AsCas12a and LbCas12a is 50 -TTTV-30 (V ¼ A, G, C)

Fig. 2 Diagrams of all-paper-based DNA testing using Cas12a detection. (a) The overall procedure of DNA detection steps. (b) Detection of cleaved ssDNA reporter using a LFA strip. The gold particle labeled anti-FITC/ FAM antibodies bind to the FAM group of ssDNA reporter. The control line contains streptavidin to bind biotin. As a result, the intact ssDNA reporter with gold particles are captured in control line. If the ssDNA reporter is cleaved by Cas12a, the FAM-antibody-gold particle complexes continues migrating until they are captured by the anti-rabbit antibodies in the test line. The aggression of gold particles develops visible color in control and test lines. RT room temperature

activated. Then Cas12a cleaves the ssDNA reporter. As a result, a colored line will show up in the test line of LFA strip and testing result can be read out by naked eyes (Fig. 2b). This paper-based DNA testing method is rapid, accurate, and convenient for pathogen diagnosis and GMO testing. More importantly, the detection procedure is instrument free and can be readily deployed in the field.

224

Yun-Mu Zhang et al.

Here, we present a detailed protocol of all-paper-based DNA testing which combines filter-paper DNA purification, RPA, Cas12a, and LFA detection. In this study, the LbCas12a is used for targeted DNA cleavage and detection. We use this protocol to detect rice fungal pathogen Magnaporthe oryzae (M. oryzae) and transgenic rice (Bt-rice) expressing a synthetic Cry1c gene which encodes Bacillus thuringiensis (Bt) δ-endotoxin. Rice blast is one of the major rice diseases that threaten the production of rice worldwide [19]. Here, we selected the Scytalone dehydratase 1 (SDH1, MGG_05059) gene of M. oryzae as the target for detection. The Bt-rice is resistant to leaf folders (Cnaphalocrocis medinalis) and stemborers [20]. Apparently, the protocol described here could also be used to detect any other pathogens and GMOs.

2

Materials

2.1 RNA Synthesis and Purification

1. In vitro RNA synthesis: HiScribe T7 High Yield RNA Synthesis Kit (Cat. No. #2050) from New England Labs Inc (seeNote 1). 2. crRNA purification: RNA Clean & Concentrator™-5 from Zymo Research Corp. Before using this kit, add 96 ml of 100% ethanol to the RNA Wash Buffer concentrate and add equal volume of 95–100% ethanol to RNA Binding Buffer. 3. DNase I (RNase free, 2 U/μl) from New England Labs Inc. 4. The following DNA oligonucleotides are synthesized for in vitro transcription of crRNAs. Also see Subheadings 3.1 and 3.2 for crRNA design.t (a) T7-Top: 50 -GAAATTAATACGACTCACTATAGGG-30 . (b) crRNA-specific oligo: the oligo sequence includes T7 promoter (lowercase), crRNA direct repeat (uppercase without underline) and target-specific sequence (underlined uppercase). T7-crRNA-SDH1: 50 -AATCCAGACTTTAACAGCGACGAC ATCTACAA CAGTAGAAATTccctatagtgagtcgtattaatttc-30 . T7-crRNA-Cry1C: 50 -TGATGAGCTGTTCGATCTGAACGA ATCTACAA CAGTAGAAATTccctatagtgagtcgtattaatttc-30 .

2.2 Filter PaperBased DNA Isolation

1. Handheld dipsticks: Cut Whatman No.1 filter paper into 4  44 mm dipsticks. Coat the dipsticks with paraffin wax (Sangon Biotech, China) but remain a 4  4 mm nucleic acid binding zone (Fig. 3). A detailed procedure to make dipstick is well described by Mason and Botella [21].

CRISPR-Cas12a-Based DNA Detection for Fast Pathogen Diagnosis and GMO Test. . .

225

Fig. 3 Wax-coated dipstick for DNA isolation. The dipstick is made from filter paper strip, including a 4  4 mm nucleic acid binding zone and 4  40 mm wax-coated handle as described by Mason and Botella [21]

2. Lysis buffer: 20 mM Tris-HCl (pH 8.0), 25 mM NaCl, 2.5 mM EDTA, 0.05% SDS. 3. Washing buffer: 10 mM Tris-HCl (pH 8.0), 0.1% Tween-20. 4. Leaf samples: small leaf discs (approximate 1  1 cm) cut from M. oryzae infected rice plants and Bt-rice. 2.3 RPA Amplification

1. All RPA reagents except the gene-specific primers are in the TwistAmp® Basic kit from TwistDX Inc (seeNote 2). 2. The RPA primers used in this study: RPA primer oligos to amplify SDH1. RPA-SDH1-cR1-F: 50 - CCCACACCAAATCCAGACTTTAA CAGCGACGAC-30 . RPA-SDH1-cR1-R: 50 - CGTCGATCTTCTTGTACCAGT GAAGGTTTGCCG-30 . RPA primer oligos to amplify Cry1C.

226

Yun-Mu Zhang et al.

RPA-Cry1C-cR12-F: 50 - AGGAGGATTCCTTGTTGGACT TATCGACTT-30 . RPA-Cry1C-cR12-R: 50 TTCTCCGAAGATCACA GAATCTCTAAGGATAG-30 . 2.4 Lateral Flow Assay

1. ssDNA reporter: 50 -FAM-TTATT-Biotin-30 (FB-reporter). This DNA oligo is synthesized by Sangon Biotech, China. The FB-reporter is diluted to 1μM solution using nucleasefree H2O and stored at 20
C in dark. 2. LFA strip: HybriDetect-Universal Lateral Flow Assay Kit from Milenia Biotech. 3. Cas12a nuclease: LbCas12a (1μM) from New England BioLabs Inc.

3

Methods

3.1 Design of RPA Primer and crRNA 3.1.1 Select Target Gene for Detection

1. For pathogen detection, we suggest selecting a species-specific housekeeping gene as the detection target. In this protocol, M. oryzae SDH1 gene is the target for rice blast detection (Fig. 4). 2. For GMO testing, the transgene is the detection target. In this study, the Cry1C (NCBI Accession Number: HM107006) is the target for Bt-rice detection (Fig. 4). 3. Design crRNA for Cas12a. As shown in Fig. 4, any 24 bp sequences following 50 -TTTV-30 (PAM) in the target gene could be used for LbCas12a detection. To avoid off-target cleavage, the specificity of crRNA should be examined using CRISPR-Cas target selection programs (or sequence search tools like BLAST). Of note, the guide sequence is important for Cas12a/crRNA nuclease activities, and thus, we suggest testing 2–4 crRNAs for each gene and use the most active one in our all-paper-based DNA testing. 4. Design of RPA primers. For each crRNA targeting site, a pair of primers are required to amplify the gene fragment containing the crRNA targeting site. The RPA primers used in this protocol are shown in Subheading 2.3. When designing RPA primers, the following suggestions might be considered. (a) The length of primer oligos is 30–36 bases; the RPA amplicon size prefers 100–400 bp. (b) RPA primers should be specific to amplify target gene fragment (seeNote 3). The primer binding region should not overlap with the crRNA targeting sequence. (c) Most PCR primer design programs can be used for RPA primer designs, like Primer3 (http://bioinfo.ut.ee/ primer3/) and Primer-BLAST tool (https://www.ncbi.

CRISPR-Cas12a-Based DNA Detection for Fast Pathogen Diagnosis and GMO Test. . .

227

Fig. 4 The schematics of crRNA and targeted genes for M. oryzae (SDH1) detection and Bt-rice (Cry1c) detection. The crRNA consists of 50 -end direct repeat (blue cycles) and 30 -end guide sequence (green cycles). The PAM sequences are shown in red

nlm.nih.gov/tools/primer-blast) (seeNote 3). Besides, the PrimedRPA is developed particularly for RPA primer design (http://pathogenseq.lshtm.ac.uk/PrimedRPA. html) [22]. 3.2

crRNA Synthesis

3.2.1 In Vitro Transcription of crRNA

crRNA is synthesized with T7 RNA polymerase. In this protocol, a DNA oligo duplex is used as transcription template which contains a minimal T7 promoter (double-stranded DNA) and crRNA region (single-stranded DNA) for transcription (Fig. 5a). Because T7 RNA polymerase transcribes RNA from GGG, the final crRNA product has three additional Gs at 50 -end which would not affect crRNA activity. Here, we use the HiScribe T7 High Yield RNA Synthesis Kit and RNA Clean & Concentrator™-5 Kit to transcribe and purify crRNAs. 1. Design DNA oligos for crRNA transcription. A synthesized DNA oligo duplex are used as template for crRNA transcription with T7 RNA polymerase. For each crRNA, two PAGEpurified DNA oligonucleotides are synthesized (Fig. 5a): a T7-top oligo contains T7 promoter sequence; a T7-crRNAspecific oligo contains complementary sequences of T7

228

Yun-Mu Zhang et al.

Fig. 5 Diagram of in vitro RNA synthesis using T7 RNA polymerase. (a) Two oligos are annealed to generate a partially double-stranded DNA as the template for transcription. The minimal T7 promoter sequence is highlighted with dark background. The Ns indicate the target-specific guide sequence. DR direct repeat of crRNA. (b) Examination of purified crRNAs using 2% native agarose gel

promoter and target-specific crRNA. The crRNA consists of target-specific guide (24 nt) and direct repeat (19 nt) sequences. 2. Mix 5μl of T7-top (10μM), 5μl of T7-crRNA-specific oligo (10μM) in a PCR tube. 3. In a PCR machine, set up following program to anneal the two oligos to DNA duplex: 95
C 10 min, ramp to 25
C at 0.1/s; 25
C 10 min. 4. Prepare the following reaction in nuclease-free tubes. DNA oligo duplex

1μl

T7 RNA polymerase mix

2μl

NTP buffer mix

10μl (6.7 mM of each NTP final)

Nuclease-free water

Add to a final volume of 30μl

5. Incubate at 37
C for 8 h (seeNote 4). 6. Add 20μl of nuclease-free water and 2μl of DNase I (RNasefree) to the RNA transcription reaction. Incubate at 37
C for 15 min to degrade the DNA template. 3.2.2 Purification of crRNA

The RNA Binding Buffer, Zymo-Spin™ IC Column, RNA Prep Buffer, and RNA Wash Buffer are available in the RNA Clean & Concentrator™-5 Kit. Before use, see Subheading 2.1 for additional requirement of buffer preparation. 1. Add 100μl (2 volumes) of RNA Binding Buffer to the DNase I treated crRNA samples and mix thoroughly.

CRISPR-Cas12a-Based DNA Detection for Fast Pathogen Diagnosis and GMO Test. . .

229

2. Transfer the sample to the Zymo-Spin™ IC Column, centrifuge at 12,000 rpm for 30 s. Save the flow-through which contains small size RNAs (17–200 nt). 3. Add 150μl (1 volume) of 100% ethanol to the flow-through and thoroughly mix the solution. 4. Transfer the mixture to a new Zymo-Spin™ IC Column, centrifuge at 12,000 rpm for 30 s. Discard the flow-through. 5. Wash the column with 400μl of RNA Prep Buffer. 6. Wash the column with 700μl of RNA Wash Buffer. 7. Wash the column with 400μl of RNA Wash Buffer. 8. Centrifuge at 12,000 rpm for 1 min to completely remove wash buffer in the column. Transfer the column into a new nucleasefree tube. 9. Add 15μl nuclease-free water to the column. Elute the RNAs by centrifuging at 12,000 rpm for 30 s. 10. Determine the concentration of crRNA using a NanoDrop spectrophotometer. Typically, the yield of crRNA is 75–150μg. Dilute the crRNA to a final concentration of 60 ng/μl (approximate 2–3μM). 11. Incubate crRNAs at 95
C for 5 min and immediately cool on ice for at least 1 min. Store the crRNA in small aliquots at 80
C. 3.2.3 Examine the Quality and Activity of crRNA (Optional)

It is highly recommended to validate the Cas12/crRNA activities if the crRNA was designed and used for the first time (seeNote 5). The crRNAs used in this study have been examined as we described previously [16]. 1. Run approximate 100–200 ng of crRNA in 15% polyacrylamide gel or 2% agarose gel. A single 55 nt band should be clearly shown up after staining the gel with ethidium bromide (Fig. 5b). 2. Testing the target DNA cleavage efficiency of Cas12a/crRNA. The purified RPA or PCR products of targeted gene could be used as the cleavage substrate. 3. Testing the collateral nuclease activity of crRNA using a fluorescent ssDNA reporter. We normally use a ssDNA oligo (50 -FAM-TTATT-Quencher-30 ) and a plate reader to examine collateral nuclease activity of crRNAs [16].

3.3 All-Paper-Based Gene Detection Using Cas12a

Leaf samples could be collected freshly or stored in 20
C until use.

230

Yun-Mu Zhang et al.

1. Prepare three 1.5-ml tubes containing following reagents. Tube 1

Lysis buffer, 0.5 ml

Tube 2

Washing buffer, 0.5 ml

Tube 3

Ready-to-use RPA mixture

(a) Add 0.5 ml of lysis buffer and washing buffer in Tubes 1 and 2, respectively. (b) Prepare ready-to-use PRA mix by adding following reagents: 2.4μl of each RPA primers (10μM), 29.5μl of rehydration buffer from the TwistAmp® Basic kit and 9.7μl of nuclease-free H2O. Then transfer the solution to dissolve freeze-dried RPA enzyme powder from the TwistAmp® Basic kit. Pipette the mixture gently and avoid introducing bubbles. Place the mixture on ice until use. 2. Grind plant leaf samples in Tube 1 with a pestle. 3. Soak the nucleic acid binding zone of the dipstick into the leaf lysate in Tube 1 for 20 s (Fig. 6a). This will allow sufficient DNA binding to the filter paper. 4. Quickly dip the dipstick three times in the washing buffer of Tube 2 (Fig. 6b). 5. Soak the dipstick into the ready-to-use RPA mixture in Tube 3 for 20 s to elute DNA (Fig. 6c). Discard the dipstick. 6. Add 2.5μl of magnesium acetate (280 nM) into the RPA mixture of Tube 3 (seeNote 6). Gently pipette the mixture and avoid introducing bubbles during pipetting. 7. Incubate at 37
C for 10 min. 8. Add following reagents into RPA reaction in Tube 3. Pipette the mixture gently to avoid introducing bubbles. LbCas12a (1μM)

1μl

crRNA (60 ng/μl)

1.5μl (~100 ng)

FB-reporter (1μM)

1μl

9. Incubate at 37
C for 30 min. 10. Add 100μl of HybriDetect assay buffer to the RPA-Cas12a mixture and incubate at room temperature for 5 min. The HybriDetect assay buffer and LFA strip could be found in the HybriDetect-Universal Lateral Flow Assay Kit. 11. Dip a LFA strip in the reaction for 5–10 min until visible dark color show up in control line and/or testing lines. Examples of rice blast and Bt-rice detection results are shown in Fig. 6d, e, respectively.

CRISPR-Cas12a-Based DNA Detection for Fast Pathogen Diagnosis and GMO Test. . .

231

Fig. 6 Photos of DNA purification and detection results. (a–c) Rice leaf DNA purification with paper dipstick. (d, e) Photos of detection results of rice blast (d) and Bt-rice (e). P positive result of diseased leaf (d) and Bt-rice (e). N negative result using a healthy wild type rice leaf

4

Notes 1. In addition to in vitro transcription, chemically synthesized crRNA from commercial RNA synthesizers can also be used for Cas12a detection. 2. PCR and LAMP products can also be used as the substrate for Cas12a/crRNA detection. Both PCR and LAMP are compatible with paper-purified DNA template [18, 21]. 3. When PCR primer design program were used, following parameters should be set up for RPA primers. (1) Primer length: 30–36 nucleotides. (2) Primer sequence: GC content, 30–70%; Tm, 50–100
C; avoid repetitive sequences; avoid strong secondary structure and primer dimer. (3) Amplicon size: 100–400 bp. 4. Generally, it requires at least 4 h for short RNA synthesis using T7 RNA polymerase (1 kb), or the introduction of cDNAs in a safe harbor (a location in the genome that can be safely targeted without adverse cellular effects and that allows high expression of a transgene) for the generation of disease models and their isogenic controls or for mechanistic studies on gene regulation [10, 11]. The generation of isogenic controls is instrumental in the correction for differences in genetic backgrounds, which appear to be very large among humans [12, 13]. Other applications of gene editing in hiPSCs include the introduction of reporter constructs to monitor a biological process of interest, for example, by using fluorescent proteins and research in the field of regenerative medicine, in which patient-derived hiPSCs are gene corrected and its differentiated derivatives are transplanted into disease models with the aim to replace tissue that has been lost due the disease [3, 7, 14]. Here, we describe gene editing strategies applicable to hiPSCs utilizing CRISPR-Cas9 for the introduction of indels (using one single guide RNA (sgRNA)), the deletion of larger (>1 kb) regions (using two sgRNAs), and the insertion of large donor templates (using one sgRNA and a universal donor template) in a safe harbor while maintaining the integrity and differentiation potential of hiPSCs. A general timeline for gene editing of hiPSCs is shown in Fig. 1. The time required from target design to passaging of positive clones typically takes 19–33 days, depending on the application. On average, colonies can be picked around 14 days after nucleofection. Usually, DNA can be isolated and used for

Fig. 1 Timeline of gene editing in hiPSCs. This protocol is focused on the use of hiPSCs cultured in the presence of mouse embryonic fibroblasts (MEFs). However, with minor adjustments to the protocol provided at the end of this manuscript, this strategy can also be applied to hiPSCs cultured under feeder-free conditions

CRISPR-Cas9-Mediated Gene Editing in Human Induced Pluripotent Stem Cells

237

genotyping after 4–5 days, before the colonies need to be passaged, but an additional passaging step may be required to obtain sufficient material for genotyping.

2

Generation of the Targeting Plasmid The targeting plasmid contains the sgRNA that guides the Cas protein to the target sequence. In silico prediction tools should be used to identify the optimal target sequence, assessing both on- and off-target activity [10, 15]. Once the optimal target sequence has been determined in silico, the presence of this exact sequence should be verified by Sanger sequencing in the hiPSCs that will be used in the experiment. This is important because the presence of single-nucleotide polymorphisms (SNPs) in the target sequence will reduce targeting efficiency. Single-stranded oligonucleotides can then be ordered, annealed, and inserted into the plasmid containing two BbsI restriction sites for the sgRNA cloning (Fig. 2). Transcription of the sgRNA is driven by the U6 promotor. To allow efficient transcription, the 20th base of the guide sequence (50 from the PAM sequence) should be a guanine, if not substitute this base with a guanine. We have used the following targeting sequence for the insertion of a cDNA in the AAVS1 locus: 50 - GTCACCAATCCTGTCCCTAG -30 , using the donor construct described in Subheading 3 [16].

2.1

Materials

l

10 Annealing buffer (100 mM Tris, pH 7.5–8.0, 500 mM NaCl, 10 mM EDTA).

l

Forward oligonucleotide (the target sequence and ACCG overhang, see Fig. 2).

l

Reverse oligonucleotide (the target sequence and CAAA overhang, see Fig. 2).

l

Milli-Q water.

l

Cutsmart buffer (NEB, B7204S or supplied with BbsI-HF).

l

BbsI-HF (NEB, R3539).

l

pCRII-BbsI-sgRNA scaffold vector (Addgene, 159352).

l

Agarose (Sigma, A9539).

l

10 TAE Buffer (40 mM Tris, 20 mM acetic acid, 1 mM EDTA).

l

Gel extraction kit (Qiagen, 28704).

l

T4 DNA Ligase (NEB, B0202S).

l

T4 DNA Ligase Buffer (10) (NEB, M0202 or supplied with T4 DNA Ligase).

l

Heat shock competent cells (One Shot TOP10, Invitrogen, C4040).

238

Stijn L. M. in ’t Groen et al.

Fig. 2 Scheme for the cloning of the sgRNA sequence into the targeting plasmid. The DNA oligonucleotide duplex (in green) is formed by annealing two complementary single-stranded oligonucleotides containing the target sequence and an overhang. The 20th base of the guide sequence should be a guanine, indicated by the small g. Using the BbsI restriction enzyme, the pCRII-BbsI-sgRNA scaffold plasmid (we designed this plasmid based on Ran et al. [17]) is digested, producing two asymmetric overhangs (indicated with the scissors). This allows the oligonucleotide duplex to be inserted unidirectionally into the pCRII-BbsI-sgRNA scaffold

2.2

Procedure

2.2.1 Annealing of the Complementary Oligonucleotides to Form an Oligonucleotide Duplex

l

LB agar plates with 100μg/mL Ampicillin and/or 50μg/mL kanamycin selection.

l

M13 forward primer ( TGTAAAACGACGGCCAGT ) or T7 sequence primer (TAATACGACTCACTATAGGG).

l

Miniprep kit (Qiagen, 27106).

l

Midi or Maxiprep kit (Qiagen, 740410, or 740414). 1. Mix the two single-stranded oligonucleotides in equimolar concentrations as described below. Oligonucleotide annealing mix for one reaction XμL

Forward oligonucleotide (100μM final concentration)

XμL

Reverse oligonucleotide (100μM final concentration)

2μL

10 Annealing buffer

XμL

Milli-Q water

20μL

Total volume

CRISPR-Cas9-Mediated Gene Editing in Human Induced Pluripotent Stem Cells

239

2. Efficient annealing can be achieved by one of the two following methods: (a) Oligonucleotide annealing method 1: l Prepare and mix oligonucleotides in a 1.5-mL microfuge tube. l l

Heat to 95  C for 5 min in a heating block. Turn off the heating block and allow to slowly cool to room temperature (~45 min).

(b) Oligonucleotide annealing method 2: l Prepare and mix oligonucleotides in a PCR tube. l

Place the mixture in the thermocycler and use the following PCR program.

Annealing program (1)

95  C 5:00

(2)

95  C (ramp down @ 1  C/cycle) 2:00

(3)

20  C 1

(4)

End

3. The resulting oligonucleotide duplex can be stored at 4  C for short term (1 week) or at 20  C for long term (up to 12 months). 2.2.2 Digestion of the pCRII-BbsI-sgRNA Scaffold Plasmid

1. Perform a restriction reaction with the BbsI restriction enzyme on the pCRII-BbsI-sgRNA scaffold plasmid as described below: BbsI-HF restriction mix for one reaction X μL (~2μg)

pCRII-BbsI-sgRNA scaffold plasmid

5 μL

Cutsmart buffer

X μL

Milli-Q water

2 μL

BbsI-HF

50 μL

Total volume

2. Incubate the reaction mix for 60 min at 37  C. 3. Run the restriction reaction on a 0.75% agarose TAE gel. 4. Cut the linearized plasmid (size 4407 bp) from the gel using a scalpel. Note: use a low intensity UV source to visualize the DNA to prevent UV-induced damage.

240

Stijn L. M. in ’t Groen et al.

5. Perform a gel extraction to isolate the product following the manufacturer’s protocol. 6. Quantify the gel-purified DNA using a spectrophotometer. 2.2.3 Ligation of the Oligonucleotide Duplex into the pCRII-BbsI-sgRNA Scaffold Plasmid

1. Dilute the oligonucleotide duplex 200-fold in Milli-Q water. 2. Prepare and mix the T4 DNA ligation mix as described below: T4 DNA ligase reaction mix for one reaction 2 μL

T4 DNA Ligase Buffer (10)

X μL (50 ng)

Digested pCRII-BbsI-sgRNA scaffold plasmid

2 μL

200-fold diluted duplex oligonucleotide mix

15–X μL

Milli-Q water

1 μL

T4 DNA Ligase

20 μL

Total volume

3. Incubate for 60 min at room temperature or overnight at 16  C or over the weekend at 4  C (choose one of these three conditions; include a negative control ligation reaction that lacks the oligonucleotide duplex). 4. Transform 10μL of the ligation into competent cells using the heat shock method according to manufacturer’s protocol. 5. Plate the transformed cells onto LB agar plates with ampicillin (100μg/mL) and/or kanamycin (50μg/mL) selection and incubate overnight at 37  C. 6. After overnight incubation, check for the presence of colonies (typically very few colonies should be present in the negative control and hundreds of colonies in the ligation). 7. Pick colonies from the ligation plate and perform a miniprep DNA purification according to the manufacturer’s protocol. 8. Sequence the clones with the M13 forward primers or T7 primer to verify the correct insertion of the duplex oligonucleotide. 9. Colonies with a correct insertion can be used for a Midi or Maxi prep according to the manufacturer’s protocol. 10. The resulting targeting plasmid will be used for further downstream applications and can be stored at 4  C for short term (1 week) or at 20  C for long term (up to 12 months). See Note 1.

CRISPR-Cas9-Mediated Gene Editing in Human Induced Pluripotent Stem Cells

3

241

Generation of the Donor Construct To generate a large knock-in, the use of a donor construct is required. The efficiency of generating a large knock-in is significantly lower than generating an indel or deletion. Therefore, utilizing a selection cassette to select for the successfully targeted clones can reduce the number of negative colonies (Fig. 3).

3.1

Materials

l

Milli-Q water.

l

Cutsmart buffer (NEB, B7204S or supplied with restriction enzyme).

l

EcoRI-HF (NEB, R3101).

l

PacI (NEB, R0547).

l

NsiI-HF (NEB, R3127).

l

NotI-HF (NEB, R3189).

l

EF1a-cDNA-pCAG-Neo vector (the plasmid containing acid alpha-glucosidase cDNA and AAVS1 target sites can be used to clone the cDNA and target sites of interest [16] and is available upon request).

l

Agarose (Sigma, A9539).

l

10 TAE Buffer (40 mM Tris, 20 mM acetic acid, 1 mM EDTA).

l

Gel extraction kit (Qiagen, 28704).

l

T4 DNA Ligase (NEB, B0202S).

l

T4 DNA Ligase Buffer (10) (NEB, M0202 or supplied with T4 DNA Ligase).

l

Heat shock competent cells (One Shot TOP10, Invitrogen, C4040).

l

LB agar plates with 100μg/mL ampicillin and/or 50μg/mL kanamycin selection.

l

Sequence primers for insert.

l

Miniprep kit (Qiagen, 27106).

l

Midi or Maxiprep kit (Qiagen, 740410 or 740414).

Fig. 3 Map for cloning of the cDNA insert into the donor plasmid. The EF1a-cDNA-pCAG-Neo plasmid contains two KpnI recognition sites flanking the 50 homology arm and two HindIII recognition sites flanking the 30 homology arms [16]. The cDNA is expressed by the EF1a promoter and is flanked by 50 EcoRI and PacI and 30 NsiI and NotI recognition sites. The Neomycin selection is driven by the pCAG promotor and enables the selection of successful targeted cells with G418. If desired, the LoxP sites can be used to remove the Neomycin selection cassette by transient expression of Cre recombinase in the targeted iPSCs [18]

242

3.2

Stijn L. M. in ’t Groen et al.

Procedure

3.2.1 Digestion of the EF1a-cDNA-pCAG-Neo Plasmid

1. Perform a restriction reaction with the restriction enzymes on the EF1a-cDNA-pCAG-Neo plasmid as described below: Enzyme restriction mix for one reaction X μL (~2μg)

EF1a-cDNA-pCAG-Neo plasmid

5 μL

Cutsmart buffer

X μL

Milli-Q water

2 μL

EcoRI-HF or PacI

2 μL

NsiI-HF or NotI-HF

50 μL

Total volume

2. Incubate the reaction mix for 60 min at 37  C. 3. Run the restriction reaction on a 1% agarose gel. 4. Cut the linearized plasmid (size ~9100 bp) from the gel using a scalpel. Note: use a low-intensity UV source to visualize the DNA to prevent UV-induced damage. 5. Perform a gel extraction to isolate the product following the manufacturer’s protocol. 6. Quantify the gel-purified DNA using a spectrophotometer. 3.2.2 Ligation of the cDNA Insert into the EF1a-cDNA-pCAG-Neo Plasmid

Standard cloning techniques can be used to prepare the required cDNA insert with 50 EcoRI-HF or PacI and a 30 NsiI-HF or NotIHF overhangs (e.g., using PCR or ordered as gBlock (IDT)). 1. Prepare and mix the T4 ligation mix as described below: T4 Ligase reaction mix for one reaction 2μL

T4 DNA Ligase Buffer (10)

X μL (50 ng)

Digested EF1a-cDNA-pCAG-Neo plasmid

X μL

Digested cDNA insert

X μL

Milli-Q water

1μL

T4 DNA Ligase

20μL

Total volume

Use the following formula to calculate the required amount of insert in ng: ng of vector  size of insert in kb insert  molar ratio of vector size of vector in kb ¼ ng insert

CRISPR-Cas9-Mediated Gene Editing in Human Induced Pluripotent Stem Cells

243

2. Incubate 60 min at room temperature or overnight at 16  C or over the weekend at 4  C (choose one of these conditions; remember to include a negative control ligation reaction that lacks the cDNA insert). 3. Transform 10μL of the ligation into competent cells using the heat shock method according to manufacturer’s protocol. 4. Plate the transformed cells onto LB agar plates with ampicillin (100μg/mL) and/or kanamycin (50μg/mL) selection and incubate overnight at 37  C. 5. After overnight incubation, check for the presence of colonies on the agar plates (typically very few colonies should be present in the negative control and hundreds of colonies in the ligation). 6. Pick colonies from the ligation plate and perform a miniprep according to manufacturer’s protocol. 7. Sequence the clones with cDNA-specific primers to verify the successful insertion of the cDNA insert. Also sequence from the cDNA into the vector to verify correct ligation. 8. Colonies with a successful insertion can be used for a Midi or Maxi prep according to manufacturer’s protocol, the resulting targeting plasmid will be used for further downstream applications and can be stored at 4  C for short term (1 week) or at 20  C for long term (up to 12 months). See Notes 2 and 3.

4

Generation of Conditioned Media Conditioned medium from MEFs is used during and after nucleofection of the hiPSCs. Conditioned medium contains factors that are secreted by MEFs such as growth factors and extracellular proteins and is harvested every 24 h (Fig. 4). The conditioned medium is added immediately after plating to improve the recovery of hiPSCs from nucleofection.

4.1

Materials

l

Irradiated Mouse Embryonic Fibroblasts (MEFs).

l

2% gelatin solution (Sigma, G-1393).

l

PBS (Gibco, 70011044).

l

Fibroblast growth medium: – DMEM high glucose (Gibco, 11965092). – 10% fetal bovine serum (Hyclone, 11531831). – 1% penicillin-streptomycin-glutamine (P/S/G) (Gibco, 10378016).

l

Antibiotics free hiPSC medium:

244

Stijn L. M. in ’t Groen et al.

Fig. 4 The generation of conditioned medium. Antibiotics-free hiPSC medium is added to MEFs and harvested after 24 h for later use

– 390 mL DMEM/F12 (Invitrogen, 21331046). – 10% KO serum replacement (Invitrogen, 10828). – 1% non-essential amino acids (NEAA) (Gibco, 11140050). – 1% glutamine (Gibco, 25030024). – 1 mL β-mercaptoethanol (Invitrogen, 31350010). – 10 ng/mL basic fibroblast growth factors (bFGF) (Preprotech, 100-18B) (dissolved in 0.1% BSA/PBS, see manufacturer’s instructions).

4.2

Procedure

l

10 cm tissue culture plate (Greiner Bio-One, 664160).

l

0.45μm sterile cell culture filter (Millipore, SLHVR04NL). 1. Coat a 10-cm tissue culture plate with 5 mL 0.1% gelatin solution (diluted in PBS) and incubate for 15 min at 37  C. 2. Thaw a cryovial containing the MEFs in a 37  C water bath until almost completely thawed and gently transfer the MEFs to a 15-mL tube containing 9-mL fibroblast growth medium using a P1000 pipette. 3. Centrifuge one million MEFs at 1000 rpm (200  g) for 5 min, remove the excess medium and resuspend the pellet in 10-mL fibroblast growth medium. 4. Seed the MEFs onto the gelatin coated tissue culture plate and culture at 37  C/5% CO2. 5. Refresh the media after 8–24 h with antibiotics free hiPSC medium. 6. Harvest the media after 24 h and refresh the MEFs with antibiotics-free hiPSC medium. This step can be repeated for up to 5 days or until quality of the MEFs have been diminished as such they are no longer considered viable.

CRISPR-Cas9-Mediated Gene Editing in Human Induced Pluripotent Stem Cells

245

7. Filter the conditioned media with using a 0.45-μm sterile cell culture filter. 8. Store the sterile conditioned medium at 20  C for short-time storage of 80  C for long-time storage. See Note 4.

5

Preparation of the DNA Prep (1 Day in Advance) Depending on the method of plasmid preparation, an optional co-precipitation of the plasmids prior to transfection may be performed. This step is recommended to prevent microbial contamination.

5.1

5.2

Materials

Procedure

l

5 M NaCl.

l

Milli-Q water.

l

Ice-cold 100% ethanol.

l

Ice-cold 70% ethanol.

l

sgRNAtargeting plasmid (generated in Subheading 2).

l

pCas9_GFP plasmid (Addgene, 44719).

l

Optional: Donor template plasmid (available upon request). 1. Prepare and mix the DNA prep mix to a 1.5-mL Eppendorf tube as described below: Single sgRNA*

Double sgRNA**

Donor template insertion***

Cas9 plasmid

11.5μg (~2 pmol)

11.5μg (~2 pmol)

8.9μg (~1.5 pmol)

1st sgRNA plasmid

8.5μg (~3 pmol)

4.25μg (~1.5 pmol)

6.7μg (~2.25 pmol)

2nd sgRNA plasmid

–

4.25μg (~1.5 pmol)

–

Donor plasmid

–

–

4.4μg (~1 0.25 pmol)

NaCl (5 M)

2μL

2μL

2μL

Milli-Q water

X μL

X μL

X μL

Total volume

100μL

100μL

100μL

Components

*For generating one double-stranded DNA break, e.g., to create a knockout **For generating two double-stranded DNA breaks, e.g., to create a large deletion ***To insert a cDNA in a safe harbor

2. Add 250μL ice-cold 100% ethanol and precipitate the DNA for 15 min at 20  C.

246

Stijn L. M. in ’t Groen et al.

3. Centrifuge for 10 min at 14,000 rcf at 4  C and remove the ethanol, the plasmids will appear as a small translucent pellet. 4. Wash with 200μL ice-cold 70% ethanol and centrifuge for 10 min at 14,000 rcf at 4  C, repeat this once. 5. Remove the excess ethanol from the Eppendorf tube and allow the pellet to air dry for 15 min. 6. Add 20μL of sterile PBS onto the dry pellet, close the tube, and let the DNA resuspend overnight at room temperature. 7. Transfer 2μL of the DNA prep to a new 1.5-mL Eppendorf tube to quantify the DNA using a spectrophotometer. This is required to verify that the correct amount of DNA has been recovered from steps 2–6.

6

Plating MEFs After nucleofection, the hiPSCs are seeded on fresh MEFs (Fig. 5). To allow time for the MEFs to adhere to the plate, they have to be plated at least 8 h (preferably 24 h) prior to seeding the nucleofected hiPSCs. This protocol is for one 6-well plate but can be scaled accordingly (see Note 5).

6.1

Materials

l

Irradiated mouse embryonic fibroblasts (MEFs).

l

2% gelatin solution (Sigma, G-1393).

l

PBS (Gibco, 70011044).

l

Fibroblast growth medium. – DMEM high glucose (Gibco, 11965092). – 10% fetal bovine serum (Hyclone, 11531831). – 1% penicillin-streptomycin-glutamine (P/S/G) (Gibco, 10378016).

l

Six-well tissue culture plate (Thermo Scientific, 140675).

Fig. 5 Plating of mouse embryonic fibroblasts (MEFs). One million cells are divided over all wells of a 0.1% gelatin-coated six-well plate

CRISPR-Cas9-Mediated Gene Editing in Human Induced Pluripotent Stem Cells

6.2

247

1. Coat the six-well tissue culture plate with 1 mL 0.1% gelatin solution (diluted in PBS) per well and incubate for 15 min at 37  C.

Procedure

2. Thaw the cryovial containing the MEFs in a 37  C water bath until almost completely thawed and gently transfer the MEFs to a 15-mL tube containing 9 mL fibroblast growth medium using a P1000 pipette. 3. Centrifuge one million MEFs at 1000 rpm (200  g) for 5 min, remove the excess medium and resuspend the pellet in 12 mL fibroblast growth medium. 4. Seed 2 mL of the MEFs suspension per well onto the gelatincoated tissue culture plate and culture at 37  C/5% CO2.

7

Nucleofection of hiPSCs The plasmid DNAs for the sgRNA, Cas9 protein, and the donor vector (optional) are introduced into the hiPSCs using nucleofection (Fig. 6) (see Note 5).

7.1

Materials

l

hiPSC medium. – 390 mL DMEM/F12 (Invitrogen, 21331046). – 10% KO serum replacement (Invitrogen, 10828). – 1% Non-essential amino acids (NEAA) (Gibco, 11140050).

Fig. 6 Procedure for nucleofection of single-cell hiPSCs for CRISPR-Cas9-mediated gene editing. hiPSCs are dissociated into single cells and mixed with DNA. After nucleofection, cells are plated as single cells at different densities on MEFs

248

Stijn L. M. in ’t Groen et al.

– 1% penicillin-streptomycin-glutamine 10378016).

100

(Gibco,

– 1 mL β-mercaptoethanol (Invitrogen 31350010). – 10 ng/mL basic fibroblast growth factor (bFGF) (Preprotech, 100-18B) (Dissolved in 0.1% BSA/PBS, see manufacturer’s instructions).

7.2

Procedure

l

Nucleofector™ 2b Device (Lonza, AAB-1001).

l

Human Stem Cell Nucleofector™ Kit 2 (Lonza, VAPH-5022).

l

DNA prep (prepared in Subheading 5).

l

Conditioned medium from MEFs (prepared in Subheading 4).

l

Accutase (Gibco, A11105-01) or TrypLE (Gibco, 12605010).

l

PBS (Gibco, 70011044).

l

ROCK inhibitor Y-27632 (Hello Bio, HB2297) or Revitacell Supplement 100 (Gibco, A2644501).

l

Basic fibroblast growth factor (bFGF) (Preprotech, 100-18B) (Dissolved in 0.1% BSA/PBS, see manufacturer’s instructions).

l

G418 (InvivoGen, ant-gn-5). 1. 4 h before starting the nucleofection procedure: replace the medium on the hiPSCs with hiPSC medium supplemented with 10μM ROCK inhibitor or 1 Revitacell Supplement. 2. 30 min before starting the procedure: replace the medium on the MEFs with conditioned medium supplemented with 10 ng/mL bFGF and 10μM ROCK inhibitor or 1 Revitacell Supplement. 3. Transfer 9μg of the DNA prep to a new sterile 1.5-mL Eppendorf tube, prepare one tube for each nucleofection reaction. 4. Remove the hiPSC medium and wash the hiPSCs with 2 mL sterile PBS. 5. Incubate the cells with 500μL of warm Accutase or TrypLE at 37  C until the cells start to detach; this should take 5–10 min. 6. Using a 10-mL pipette, add 2 mL of hiPSC medium onto each well and detach the cells from the bottom of the well by pipetting the medium gently up and down the well. Transfer the cell suspension to a 50-mL tube. 7. Count the cells and transfer two million cells into a new 50-mL tube for each nucleofection reaction. 8. Centrifuge the cell suspension for 5 min at 1000 rpm (200  g) and carefully remove all medium. 9. Mix solutions A and B from the Human Stem Cell Nucleofector Kit 2; 100μL nucleofection mix is required per reaction, the rest of the mix can be stored up to 1 month at 4  C See Note 6.

CRISPR-Cas9-Mediated Gene Editing in Human Induced Pluripotent Stem Cells

249

10. Resuspend the pellet of two million cells in 100μL of the Human Stem Cell Nucleofector mix by pipetting up and down twice using a P1000 pipette. 11. Transfer the resuspended cells into the 1.5-mL Eppendorf containing the 9μg DNA prep. 12. Mix the resuspended cells and the DNA prep by pipetting up and down four times using a P1000 pipette. 13. Carefully transfer the mix to a Human Stem Cell Nucleofector Kit 2, make sure that no air bubbles are introduced. If any bubbles do appear in the cell suspension, gently tap the bottom of the cuvette on the surface of the cell culture hood to remove them. 14. Put the lid on the cuvette and place it into the Nucleofector™ 2b. Select program [B-016] and press enter. After 2 s, an [OK] message appears on the display of the device indicating that the program was successfully executed. A white layer containing dead cells will be formed on one side of the cuvette. 15. Bring the cuvette back into the cell culture hood and transfer the cell suspension using the plastic transfer pipette included in the kit to a 50-mL tube containing 2 mL of conditioned medium supplemented with 10 ng/mL bFGF and 10μM ROCK inhibitor or 1 Revitacell Supplement. Try to only transfer the suspension and avoid the white layer of dead cells. 16. Seed the hiPSCs on the prepared MEFs in conditioned medium and culture at 37  C/5% CO2. It is recommended to seed the hiPSCs at several dilutions (1/3, 1/6, 1/9) in order to generate single-cell colonies. 17. After 24 h, replace the conditioned medium with hiPSC medium and refresh the media daily. 18. The selection with G418 can be started 48 h after nucleofection if the donor template is used. 19. 7–21 days after nucleofection, single colonies can be picked (see Subheading 8). The time required to obtain a colony depends on the cell density, recovery speed of the cells, and the use of selection.

8

Picking Colonies Once the colonies are large enough to be passaged, the colonies are cut with a 23 gauge needle and split manually into two wells, of which one is used for genotyping and one to continue passaging after genotyping (Fig. 7) (see Note 5).

250

Stijn L. M. in ’t Groen et al.

Nucleofected colonies

Subculturing

DNA isolation

Fig. 7 Picking hiPSC colonies after nucleofection. hiPSC colonies are dissociated, cut from the plate using a 23 gauge needle, and passaged into a plate for DNA isolation and another plate for subculturing 8.1

Materials

l

hiPSC medium: – 390 mL DMEM/F12 (Invitrogen, 21331046). – 10% KO serum replacement (Invitrogen, 10828). – 1% non-essential amino acids (NEAA) (Gibco, 11140050). – 1% < penicillin-streptomycin-glutamine 100 (Gibco, 10378016). – 1 mL β-mercaptoethanol (Invitrogen 31350010). – 10 ng/mL basic fibroblast growth factors (bFGF) (Preprotech, 100-18B) (dissolved in 0.1% BSA/PBS, see manufacturer’s instructions).

l

Irradiated mouse embryonic fibroblasts (MEFs).

l

2% gelatin solution (Sigma, G-1393).

l

PBS (Gibco, 70011044).

CRISPR-Cas9-Mediated Gene Editing in Human Induced Pluripotent Stem Cells l

251

Fibroblast growth medium: – DMEM high glucose (Gibco, 11965092). – 10% fetal bovine serum (Hyclone, 11531831). – 1% penicillin-streptomycin-glutamine (P/S/G) (Gibco, 10378016).

8.2

Procedure

l

48-well tissue culture plate (Greiner bio-one, 677180).

l

1 mg/mL Collagenase IV (Invitrogen 17104-019) in KO DMEM/F12 (Invitrogen 21331046) (dissolve at 37  C for 10–15 min, filter through 0.2μM sterile filter (Millipore, SLFGR04NL).

l

23 gauge needle. 1. 24 h prior to picking: prepare two 48-well plates per nucleofection with MEFs (scale down from Subheading 6). One will be used for DNA isolation and one for passaging of the colonies. 2. Before picking colonies: Rinse MEFs with 1 mL PBS and add hiPSC medium. 3. Remove the hiPSC medium and wash with 1 mL PBS. 4. Add 1 mL collagenase IV (1 mg/mL) solution into each well. 5. Incubate the plate at 37  C for 5–15 min. (a) Monitor the cell detachment under microscope as more time might be needed. (b) The edge of the detached colonies should look slightly “curled” comparing to the attached ones. 6. Add 1 mL hiPSC medium into each well. 7. Cut the selected single colony into small pieces with a 23 gauge needle: (a) Hold needle in an upward direction of needle opening. (b) Scrape gently, avoid cutting the plastic surface. 8. Dissociate the selected colony from the plate with a P1000 and divide over two wells, one on each plate. 9. Repeat until all the selected single colonies are picked.

10. Refresh the media and monitor the colonies daily until passaging or harvesting DNA for genotyping.

9

Genotyping Normally, the genotyping can be finished before the sister colony has to be passaged, but if required it can also be performed on cells of a later passage. The method of genotyping will differ depending on the gene editing strategy (Fig. 8). For small indels and large

252

Stijn L. M. in ’t Groen et al.

Fig. 8 Genotyping methods to detect indels, large deletions, and template integrations. DNA is isolated from the hiPSC colonies and used for a PCR-based genotyping strategy. Method 1 uses Sanger sequencing to determine the indels, methods and 2 and 3 use agarose gel electrophoresis to identify successfully targeted colonies. Typical results for agarose gel electrophoresis are shown

deletions, a generic PCR can be performed using primers flanking the target sequence(s), and the genomic alteration of the target site can be determined by Sanger sequencing of the PCR product(s). For large deletions, a dual-PCR strategy can be used to determine the mono-allelic or bi-allelic presence of the deletion. For cDNA insertions mediated by a donor construct, a dual-PCR strategy can be used to determine whether the donor template has integrated at the target location. To determine copy number variations and to further examine genomic changes, Southern blotting and/or qPCR analysis of genomic DNA can be performed. Finally, it is important to monitor any off-target events resulting from the

CRISPR-Cas9-Mediated Gene Editing in Human Induced Pluripotent Stem Cells

253

CRISPR reaction. This is usually done by analyzing predicted off-target sites using PCR and Sanger sequencing, although this might not always be sufficient. For a more extensive discussion on off-target effects, see [10, 19–21]. Below we describe examples for the genotyping of indels, deletions, and template knock-ins. 9.1

DNA Isolation

l

Lysis buffer (Tris pH 8.5, 0.1 M, EDTA 5 mM, SDS 0.2%, NaCl 0.2 M; add 100μg/mL fresh protease K).

l

NaCl (5 M).

l

Isopropanol (Sigma, 59300).

l

70% ethanol (Sigma, 72032221).

l

Milli-Q water.

9.1.1 Materials

9.1.2 Procedure

1. Remove the hiPSC medium and wash the hiPSCs once with PBS. 2. Add 500μL lysis buffer to each well and incubate at 37  C for 1–18 h (in cell culture incubator). 3. Transfer the cell lysate to a 1.5-mL tube (optional: store lysate at 20  C). Subsequent steps are performed at room temperature, unless stated otherwise. 4. Add 260μL NaCl (5 M) and shake (do not vortex to avoid breaking the genomic DNA), a white protein precipitate forms. 5. Centrifuge for 5 min at maximum speed and transfer the supernatant to a new 1.5-mL tube, without touching the white pellet. 6. Add 532μL (0.7 volume) isopropanol, shake (do not vortex), a small piece of DNA should appear, if not shake again. 7. Centrifuge for 5 min at maximum speed. 8. Remove the supernatant and wash the pellet with 500μL 70% ethanol and centrifuge 5 min at maximum speed. 9. Remove the excess ethanol from the Eppendorf tube and allow the pellet to air dry for 15 min. 10. Dissolve the pellet in 40μL Milli-Q water and incubate for 1 h at 65  C. 11. Quantify the extracted DNA using a spectrophotometer.

9.2 Genotyping Method 1: Introduction of Indels (Nested DNA Sequencing)

For the genotyping of indels, a PCR with primers flanking the targeted area is used to amplify the DNA; this is subsequently sequenced to verify the introduction of indels (Fig. 9).

254

Stijn L. M. in ’t Groen et al.

Fig. 9 Genotyping of indels. Primers flanking the indel amplify the region, after which the indel can be determined by Sanger sequencing 9.2.1 Materials

l

Forward primer, located ~300 bp upstream the sgRNA sequence (stock: 10μM in 10 mM Tris).

l

Reverse primer, located ~200 bp downstream the sgRNA sequence (stock: 10μM in 10 mM Tris).

l

Sequence primer, located ~100 bp upstream the sgRNA sequence (stock: 10μM in 10 mM Tris).

l

Isolated DNA (isolated previously from individual hiPSC colonies).

l

Milli-Q water.

l

FastStart™ Taq DNA Polymerase (Roche, 12032902001).

l

10 PCR buffer + MgCl2 (supplied with FastStart Taq polymerase)

l

dNTPs (Invitrogen, 10297-018) (stock: 10 mM in 10 mM Tris pH 8.5 for each nucleotide).

l

BigDye™ Terminator v3.1 Cycle Sequencing Kit (Thermo Scientific, 4337458): – Exosap. – 5 sequencing buffer. – BigDye® Terminator v3.1 (BDT).

9.2.2 Procedure

1. Dilute the DNA samples to the required DNA concentration using Milli-Q water. 2. Perform a PCR as described below. Use a DNA sample from the unedited cell as a negative control. PCR mix for one reaction

PCR program

1.5 μL

10 PCR buffer + MgCl2

(1)

96  C, 4:00

0.5 μL

dNTPs (10 mM)

(2)

96  C, 0:20

0.5 μL

Forward primer (10μM)

(3)

55–65  C, 0:30

0.5 μL

Reverse primer (10μM)

(4)

72  C, 1:00 (continued)

CRISPR-Cas9-Mediated Gene Editing in Human Induced Pluripotent Stem Cells

PCR mix for one reaction

PCR program

1 μL

DNA (