Caffeinated and Cocoa Based Beverages: Volume 8. the Science of Beverages 9780128158647, 9780128158654, 0128158646

Citation preview

C A F F E I N AT E D A N D COCOA BASED BEVERAGES

This page intentionally left blank

C A F F E I N AT E D A N D COCOA BASED BEVERAGES Volume 8: The Science of Beverages Edited by

ALEXANDRU MIHAI GRUMEZESCU ALINA MARIA HOLBAN

An imprint of Elsevier

Woodhead Publishing is an imprint of Elsevier The Officers’ Mess Business Centre, Royston Road, Duxford, CB22 4QH, United Kingdom 50 Hampshire Street, 5th Floor, Cambridge, MA 02139, United States The Boulevard, Langford Lane, Kidlington, OX5 1GB, United Kingdom © 2019 Elsevier Inc. All rights reserved. No part of this publication may be reproduced or transmitted in any form or by any means, electronic or mechanical, including photocopying, recording, or any information storage and retrieval system, without permission in writing from the publisher. Details on how to seek permission, further information about the Publisher’s permissions policies and our arrangements with organizations such as the Copyright Clearance Center and the Copyright Licensing Agency, can be found at our website: www.elsevier.com/permissions. This book and the individual contributions contained in it are protected under copyright by the Publisher (other than as may be noted herein). Notices Knowledge and best practice in this field are constantly changing. As new research and experience broaden our understanding, changes in research methods, professional practices, or medical treatment may become necessary. Practitioners and researchers must always rely on their own experience and knowledge in evaluating and using any information, methods, compounds, or experiments described herein. In using such information or methods they should be mindful of their own safety and the safety of others, including parties for whom they have a professional responsibility. To the fullest extent of the law, neither the Publisher nor the authors, contributors, or editors, assume any liability for any injury and/or damage to persons or property as a matter of products liability, negligence or otherwise, or from any use or operation of any methods, products, instructions, or ideas contained in the material herein. Library of Congress Cataloging-in-Publication Data A catalog record for this book is available from the Library of Congress British Library Cataloguing-in-Publication Data A catalogue record for this book is available from the British Library ISBN: 978-0-12-815864-7 (print) ISBN: 978-0-12-815865-4 (online) For information on all Woodhead publications visit our website at https://www.elsevier.com/books-and-journals

Publisher: Andre Gerhard Wolff Acquisition Editor: Patricia Osborn Editorial Project Manager: Jaclyn Truesdell Production Project Manager: Sojan P. Pazhayattil Cover Designer: Matthew Limbert Typeset by SPi Global, India

CONTENTS Contributors . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . xi Series Preface . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . xv Preface . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . xix

Chapter 1 Functional and Medicinal Properties of Caffeine-Based Common Beverages . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1 Francine Carla Cadoná, Grazielle Castagna Cezimbra Weis, Charles Elias Assmann, Audrei de Oliveira Alves, Beatriz da Silva Rosa Bonadiman, Alencar Kolinski Machado, Marco Aurélio Echart Montano, Ivana Beatrice Mânica da Cruz 1.1 Coffee (Coffea arabica and Coffea canephora) . . . . . . . . . . . . . . . . 1 1.2 Black Tea (Camellia sinensis) . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 10 1.3 Black Tea as a Significant Bioactive Compound . . . . . . . . . . . . . . 13 1.4 Green Tea (Camellia sinensis) . . . . . . . . . . . . . . . . . . . . . . . . . . . . 18 1.5 Yerba Mate (Ilex paraguariensis) . . . . . . . . . . . . . . . . . . . . . . . . . . 25 1.6 Conclusion . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 33 References . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 33 Further Reading . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 45

Chapter 2 Quality and Safety Issues Related With the Presence of Biogenic Amines in Coffee, Tea, and Cocoa-Based Beverages. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 47 Donatella Restuccia, Monica Rosa Loizzo, Umile Gianfranco Spizzirri 2.1 Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2.2 BAs in Nervine Foods and Beverages . . . . . . . . . . . . . . . . . . . . . . 2.3 Analytical Determination of BAs in Tea, Coffee, and Cocoa Derivatives . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2.4 Tea . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2.5 Coffee . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

47 50 52 59 62 v

vi  CONTENTS

2.6 Cocoa . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2.7 Conclusions . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . References . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Further Reading . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

74 83 83 88

Chapter 3 Genetic and Phenotypic Diversity of Robusta Coffee (Coffea canephora L.). . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 89 Kahiu Ngugi, Pauline Aluka 3.1 The Genetic Diversity of Robusta Coffee (Coffea canephora L.) Assessed by Simple Sequence Repeat Molecular Markers . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 89 3.2 Phenotypic Diversity of Landraces of Robusta Coffee . . . . . . . 107 References . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 128 Further Reading . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 130

Chapter 4 Industrial Processing of CTC Black Tea. . . . . . . . . . . . . . . . . 131 K.R. Jolvis Pou, Sanjib K. Paul, Santanu Malakar 4.1 Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 4.2 Tea Statistics: Global Scenario . . . . . . . . . . . . . . . . . . . . . . . . . . 4.3 Types of Processed Tea . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 4.4 Composition of the Tea Shoot Components . . . . . . . . . . . . . . . . 4.5 Processing of CTC Black Tea . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 4.6 Conclusion . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . References . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

131 132 133 134 134 158 159

Chapter 5 Caffeinated Beverages, Behavior, and Brain Structure. . . . 163 O.J. Onaolapo, A.Y. Onaolapo 5.1 Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 5.2 Caffeinated Beverages: Sources, Plant Biology, Pharmacology, and Health Benefits . . . . . . . . . . . . . . . . . . . . . . 5.3 Caffeine . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 5.4 Conclusion . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . References . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Further Reading . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

163 168 179 192 192 207

CONTENTS  vii

Chapter 6 The Ability of Green Tea With Lowered Caffeine to Reduce Stress and Improve Sleep . . . . . . . . . . . . . . . . . . . 209 Keiko Unno, Yoriyuki Nakamura 6.1 Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 6.2 Green Tea . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 6.3 Low-Caffeine Green Tea (LCGT) . . . . . . . . . . . . . . . . . . . . . . . . . . 6.4 Discussion . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 6.5 Future Perspectives . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Acknowledgments . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . References . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Further Reading . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

210 211 215 225 227 228 228 234

Chapter 7 Caffeine and Kidney Diseases. . . . . . . . . . . . . . . . . . . . . . . . . 235 Paleerath Peerapen, Visith Thongboonkerd 7.1 Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 7.2 Caffeine and Renal Function . . . . . . . . . . . . . . . . . . . . . . . . . . . . 7.3 Caffeine in Kidney Diseases . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 7.4 Conclusions . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Acknowledgment . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . References . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

235 236 238 247 248 248

Chapter 8 Caffeine in Beverages: Cardiovascular Effects. . . . . . . . . . . 257 Anna Vittoria Mattioli, Matteo Ballerini Puviani, Alberto Farinetti 8.1 Caffeine and Mechanisms of Action . . . . . . . . . . . . . . . . . . . . . . 8.2 Caffeine and Risk Factors for Atherosclerosis . . . . . . . . . . . . . . 8.3 Caffeine Effects on Endothelial Function . . . . . . . . . . . . . . . . . . 8.4 Coffee and Coronary Artery Disease . . . . . . . . . . . . . . . . . . . . . . 8.5 Caffeine and Blood Pressure . . . . . . . . . . . . . . . . . . . . . . . . . . . . 8.6 Coffee and Arrhythmias . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 8.7 Caffeine and Energy Drinks . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 8.8 Coffee and Diabetes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . References . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Further Reading . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

257 262 266 267 270 271 273 276 278 284

viii  CONTENTS

Chapter 9 Analytical Approaches in Coffee Quality Control. . . . . . . . . 285 Elixabet Diaz-de-Cerio, Eduardo Guerra-Hernandez, Rosa Garcia-Estepa, Belén Garcia-Villanova, Vito Verardo 9.1 Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 9.2 Analytical Approaches to Assess Coffee Authenticity and Geographical Origin . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 9.3 Influence of Main Technological Processes on Coffee Quality . . 9.4 Sensorial Analysis and Electronic Devices . . . . . . . . . . . . . . . . . 9.5 Conclusions . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . References . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

285 292 304 322 328 329

Chapter 10 Spray-Freeze-Drying of Coffee. . . . . . . . . . . . . . . . . . . . . . . . . 337 C. Anandharamakrishnan 10.1 Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 10.2 Stages of Soluble Coffee Production by SFD Process . . . . . . . . 10.3 Quality Characteristics of Spray-Freeze-Dried Soluble Coffee . . . 10.4 Prospects for Future Research . . . . . . . . . . . . . . . . . . . . . . . . . . . 10.5 Conclusion . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . References . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Further Reading . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

337 340 351 362 362 363 366

Chapter 11 Nutrients in Caffeinated Beverages—An Overview . . . . . . 367 Sharvari Deshpande, Shubhi Singh, A. Panneerselvam, V. Devi Rajeswari 11.1 Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 11.2 Tea . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 11.3 Coffee . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 11.4 Soft Drinks . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 11.5 Alcoholic Beverages . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 11.6 Chocolate Drinks . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 11.7 Conclusion . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . References . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

367 371 375 378 382 383 386 386

CONTENTS  ix

Chapter 12 Effects of Coffee on Intestinal Microbiota, Immunity, and Disease. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 391 Mădălina Preda, Mircea Ioan Popa, Mara Mădălina Mihai, Teodora Cristiana Oţelea, Alina Maria Holban 12.1 Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 12.2 The Normal Human Gut Microbiota . . . . . . . . . . . . . . . . . . . . . . 12.3 Dysbiosis of the Human Gut Microbiota . . . . . . . . . . . . . . . . . . 12.4 Physiological Effects of Coffee Consumption . . . . . . . . . . . . . . 12.5 Coffee Consumption and Gut Microbiota . . . . . . . . . . . . . . . . . . 12.6 Human Health and Disease Related to Gut Dysbiosis and Coffee Consumption . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 12.7 Conclusions . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Acknowledgments . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Conflicts of Interest . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . References . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

391 393 394 396 399 400 414 416 416 416

Chapter 13 The Microbiology of Cocoa Fermentation. . . . . . . . . . . . . . . 423 Ionela Sarbu, Ortansa Csutak 13.1 Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 13.2 Cocoa Fermentation . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 13.3 Approaches for Improvement of Cocoa Fermentation . . . . . . . 13.4 Conclusions . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . References . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

423 424 437 441 441

Chapter 14 Genetic Engineering in Coffee. . . . . . . . . . . . . . . . . . . . . . . . . 447 Alexandra Simon-Gruita, Maria Daniela Pojoga, Nicoleta Constantin, Georgiana Duta-Cornescu 14.1 Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 447 14.2 Genetic Diversity of Coffea sp. as Revealed by the DNA Markers . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 449 14.3 Conventional Breeding of Coffee . . . . . . . . . . . . . . . . . . . . . . . . 451

x  CONTENTS

14.4 In Vitro Coffee Cultivation: Useful Tool for Genetic Transformation of Coffee . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 14.5 Genetic Transformation of Coffee . . . . . . . . . . . . . . . . . . . . . . . . 14.6 Methods Used in Genetic Transformation of Coffee . . . . . . . . . 14.7 Coffee Traits Subject to Genetic Engineering . . . . . . . . . . . . . . . 14.8 Updates on C. arabica Genome Sequencing and Final Remarks . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . References . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Further Reading . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

453 456 460 470 477 478 487

Chapter 15 Cocoa Industry—From Plant Cultivation to Cocoa Drinks Production. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 489 Gentiana Mihaela Iulia Predan, Daniela Anca Lazăr, Iulia Ioana Lungu 15.1 Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 15.2 General Description . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 15.3 Processing of Cocoa Beans . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 15.4 Composition . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 15.5 Uses . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 15.6 Chocolate Beverages . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 15.7 Health Effects of Cocoa . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 15.8 Conclusions . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . References . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Further Reading . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

489 489 493 496 497 498 498 503 504 506

Index . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 509

CONTRIBUTORS Pauline Aluka  National Agricultural Research Organization (NARO), National Coffee Resources Research Institute (NaCORI), Mukono, Uganda C. Anandharamakrishnan  Indian Institute of Food Processing Technology, Thanjavur, India Charles Elias Assmann  Biogenomics Laboratory; Graduate Program in Biological Sciences: Toxicological Biochemistry, Federal University of Santa Maria, Santa Maria, RS, Brazil Francine Carla Cadoná  Graduate Program in Biosciences and Health, University of the West of Santa Catarina, Joaçaba, SC, Brazil Nicoleta Constantin  Department of Genetics, University of Bucharest, Bucharest, Romania Ortansa Csutak  Faculty of Biology, Department of Genetics, University of Bucharest, Bucharest, Romania Ivana Beatrice Mânica da Cruz  Biogenomics Laboratory; Graduate Program in Biological Sciences: Toxicological Biochemistry; Graduate Program of Pharmacology, Federal University of Santa Maria, Santa Maria, RS, Brazil Beatriz da Silva Rosa Bonadiman  Biogenomics Laboratory; Graduate Program of Pharmacology, Federal University of Santa Maria, Santa Maria, RS, Brazil Audrei de Oliveira Alves  Biogenomics Laboratory; Graduate Program of Pharmacology, Federal University of Santa Maria, Santa Maria, RS, Brazil Sharvari Deshpande  Department of Biomedical Sciences, School of Biosciences and Technology, VIT University, Vellore, India V. Devi Rajeswari  Department of Biomedical Sciences, School of Biosciences and Technology, VIT University, Vellore, India Elixabet Diaz-de-Cerio  Department of Analytical Chemistry, University of Granada, Granada, Spain Georgiana Duta-Cornescu  Department of Genetics, University of Bucharest, Bucharest, Romania Alberto Farinetti  Surgical, Medical and Dental Department of Morphological Sciences Related to Transplant, Oncology and Regenerative Medicine, University of Modena and Reggio Emilia, Modena, Italy

xi

xii  Contributors

Rosa Garcia-Estepa  Department of Nutrition and Food Science, University of Granada, Granada, Spain Belén Garcia-Villanova  Department of Nutrition and Food Science, University of Granada, Granada, Spain Eduardo Guerra-Hernandez  Department of Nutrition and Food Science, University of Granada, Granada, Spain Alina Maria Holban  Faculty of Biology, Department of Microbiology, University of Bucharest; Department of Science and Engineering of Oxide Materials and Nanomaterials, Faculty of Applied Chemistry and Materials Science, University Politehnica of Bucharest, Bucharest, Romania K.R. Jolvis Pou  Department of Agricultural Engineering, Assam University, Silchar, India Daniela Anca Lazăr  Department of Botany and Microbiology, University of Bucharest, Bucharest, Romania Monica Rosa Loizzo  Department of Pharmacy, Health and Nutritional Sciences, University of Calabria, Arcavacata di Rende (CS), Italy Iulia Ioana Lungu  Department of Biomaterials and Medical Devices, University Politehnica of Bucharest, Bucharest, Romania Alencar Kolinski Machado  Franciscan University, Santa Maria, RS, Brazil Santanu Malakar  Department of Agricultural Engineering, Assam University, Silchar, India Anna Vittoria Mattioli  Surgical, Medical and Dental Department of Morphological Sciences Related to Transplant, Oncology and Regenerative Medicine, University of Modena and Reggio Emilia, Modena, Italy Mara Mădălina Mihai  Department of Oncologic Dermatology and Allergology, “Carol Davila” University of Medicine and Pharmacy; Department of Dermatology, “Elias” University Emergency Hospital, Bucharest, Romania Marco Aurélio Echart Montano  Graduate Program in Biosciences and Health, University of the West of Santa Catarina, Joaçaba, SC, Brazil Yoriyuki Nakamura  Tea Science Center, University of Shizuoka, Shizuoka, Japan Kahiu Ngugi  Department of Plant Sciences and Crop Protection, College of Agriculture and Veterinary Sciences, University of Nairobi, Nairobi, Kenya O.J. Onaolapo  Faculty of Basic Medical Sciences, Department of Pharmacology, Ladoke Akintola University of Technology, Osogbo, Nigeria

Contributors  xiii

A.Y. Onaolapo  Faculty of Basic Medical Sciences, Department of Anatomy, Ladoke Akintola University of Technology, Ogbomoso, Nigeria Teodora Cristiana Oţelea  Department of Dermatology, “Elias” University Emergency Hospital, Bucharest, Romania A. Panneerselvam  Department of Zoology, Thiruvalluvar University, Vellore, India Sanjib K. Paul  Department of Agricultural Engineering, Assam University, Silchar, India Paleerath Peerapen  Medical Proteomics Unit, Office for Research and Development, Faculty of Medicine Siriraj Hospital, Mahidol University, Bangkok, Thailand Maria Daniela Pojoga  Department of Genetics, University of Bucharest, Bucharest, Romania Mircea Ioan Popa  Faculty of Medicine, Department of Microbiology, “Carol Davila” University of Medicine and Pharmacy; The Cantacuzino National Medico-Military Institute for Research and Development, Bucharest, Romania Mădălina Preda  Faculty of Medicine, Department of Microbiology, “Carol Davila” University of Medicine and Pharmacy; The Cantacuzino National Medico-Military Institute for Research and Development, Bucharest, Romania Genţiana Mihaela Iulia Predan  Department of Botany and Microbiology, University of Bucharest, Bucharest, Romania Matteo Ballerini Puviani  Surgical, Medical and Dental Department of Morphological Sciences Related to Transplant, Oncology and Regenerative Medicine, University of Modena and Reggio Emilia, Modena, Italy Donatella Restuccia  Department of Pharmacy, Health and Nutritional Sciences, University of Calabria, Arcavacata di Rende (CS), Italy Ionela Sarbu  Faculty of Biology, Department of Genetics, University of Bucharest, Bucharest, Romania Alexandra Simon-Gruita  Department of Genetics, University of Bucharest, Bucharest, Romania Shubhi Singh  Department of Biomedical Sciences, School of Biosciences and Technology, VIT University, Vellore, India Umile Gianfranco Spizzirri  Department of Pharmacy, Health and Nutritional Sciences, University of Calabria, Arcavacata di Rende (CS), Italy Visith Thongboonkerd  Medical Proteomics Unit, Office for Research and Development, Faculty of Medicine Siriraj Hospital, Mahidol University, Bangkok, Thailand

xiv  Contributors

Keiko Unno  School of Pharmaceutical Sciences, University of Shizuoka, Shizuoka, Japan Vito Verardo  Department of Nutrition and Food Science, University of Granada, Granada, Spain Grazielle Castagna Cezimbra Weis  Biogenomics Laboratory; Graduate Program of Food Science and Technology, Federal University of Santa Maria, Santa Maria, RS, Brazil

SERIES PREFACE Food and beverage industry accounts among the most developed sectors, being constantly changing. Even though a basic beverage industry could be found in every area of the globe, particular aspects in beverage production, processing, and consumption are identified in some geographic zones. An impressive progress has recently been observed in both traditional and modern beverage industries and these advances are leading beverages to a new era. Along with the cutting-edge technologies, developed to bring innovation and improve beverage industry, some other human-related changes also have a great impact on the development of such products. Emerging diseases with a high prevalence in the present, as well as a completely different lifestyle of the population in recent years have led to particular needs and preferences in terms of food and beverages. Advances in the production and processing of beverages have allowed for the development of personalized products to serve for a better health of overall population or for a particular class of individuals. Also, recent advances in the management of beverages offer the possibility to decrease any side effects associated with such an important industry, such as decreased pollution rates and improved recycling of all materials involved in beverage design and processing, while providing better quality products. Beverages engineering has emerged in such way that we are now able to obtain specifically designed content beverages, such as nutritive products for children, decreased sugar content juices, energy drinks, and beverages with additionally added health-promoting factors. However, with the immense development of beverage processing technologies and because of their wide versatility, numerous products with questionable quality and unknown health impact have been also produced. Such products, despite their damaging health effect, gained a great success in particular population groups (i.e., children) because of some attractive properties, such as taste, smell, and color. Nonetheless, engineering offered the possibility to obtain not only the innovative beverages but also packaging materials and contamination sensors useful in food and beverages quality and security sectors. Smart materials able to detect contamination or temperature differences which could impact food quality and even pose a hazardous situation for the consumer were recently developed and some are already utilized in packaging and food preservation.

xv

xvi  Series Preface

This 20-volume series has emerged from the need to reveal the current situation in beverage industry and to highlight the progress of the last years, bringing together most recent technological innovations while discussing present and future trends. The series aims to increase awareness of the great variety of new tools developed for traditional and modern beverage products and also to discuss their potential health effects. All volumes are clearly illustrated and contain chapters contributed by highly reputed authors, working in the field of beverage science, engineering, or biotechnology. Manuscripts are designed to provide necessary basic information in order to understand specific processes and novel technologies presented within the thematic volumes. Volume 1, entitled Production and management of beverages, offers a recent perspective regarding the production of main types of alcoholic and nonalcoholic beverages. Current management approaches in traditional and industrial beverages are also dissected within this volume. In Volume 2, Processing and sustainability of beverages, novel information regarding the processing technologies and perspectives for a sustainable beverage industry are given. Third volume, entitled Engineering tools in beverage industry dissects the newest advances made in beverage engineering, highlighting cutting-edge tools and recently developed processes to obtain modern and improved beverages. Volume 4 presents updated information regarding Bottled and packaged waters. In this volume are discussed some wide interest problems, such as drinking water processing and security, contaminants, pollution and quality control of bottled waters, and advances made to obtain innovative water packaging. Volume 5, Fermented beverages, deals with the description of traditional and recent technologies utilized in the industry of fermented beverages, highlighting the high impact of such products on consumer health. Because of their great beneficial effects, fermented products still represent an important industrial and research domain. Volume 6 discusses recent progress in the industry of Nonalcoholic beverages. Teas and functional nonalcoholic beverages, as well as their impact on current beverage industry and traditional medicine are discussed. In Volume 7, entitled Alcoholic beverages, recent tools and technologies in the manufacturing of alcoholic drinks are presented. Updated information is given about traditional and industrial spirits production and examples of current technologies in wine and beer industry are dissected. Volume 8 deals with recent progress made in the field of Caffeinated and cocoa-based beverages. This volume presents the great variety of

Series Preface   xvii

such popular products and offers new information regarding recent technologies, safety, and quality aspects as well as their impact on health. Also, recent data regarding the molecular technologies and genetic aspects in coffee useful for the development of high-quality raw materials could be found here. In Volume 9, entitled Milk-based beverages, current status, developments, and consumers trends in milk-related products are discussed. Milk-based products represent an important industry and tools are constantly been developed to fit the versatile preferences of consumers and also nutritional and medical needs. Volume 10, Sports and energy drinks, deals with the recent advances and health impact of sports and energy beverages, which became a flourishing industry in the recent years. In Volume 11, main novelties in the field of Functional and medicinal beverages, as well as perspective of their use for future personalized medicine are given. Volume 12 gives an updated overview regarding Nutrients in beverages. Types, production, intake, and health impact of nutrients in various beverage formulations are dissected through this volume. In Volume 13, advances in the field of Natural beverages are provided, along with their great variety, impact on consumer health, and current and future beverage industry developments. Volume 14, Value-added Ingredients and enrichments of beverages, talks about a relatively recently developed field which is currently widely investigated, namely the food and beverage enrichments. Novel technologies of extraction and production of enrichments, their variety, as well as their impact on product quality and consumers effects are dissected here. Volume 15, Preservatives and preservation approaches in beverages, offers a wide perspective regarding conventional and innovative preservation methods in beverages, as well as main preservatives developed in recent years. In Volume 16, Trends in beverage packaging, the most recent advances in the design of beverage packaging and novel materials designed to promote the content quality and freshness are presented. Volume 17 is entitled Quality control in beverage industry. In this volume are discussed the newest tools and approaches in quality monitoring and product development in order to obtain advanced beverages. Volume 18, Safety issues in beverage production, presents general aspects in safety control of beverages. Here, the readers can find not only the updated information regarding contaminants and risk factors in beverage production, but also novel tools for accurate detection and control.

xviii  Series Preface

Volume 19, Biotechnological progress and beverage consumption, reveals novel tools used for advanced biotechnology in beverage industry production. Finally, Volume 20 entitled Nanoengineering in beverage industry take the readers into the nanotechnology world, while highlighting important progress made in the field of nanosized materials science aiming to obtain tools for a future beverage industry. This 20-volume series is intended especially for researchers in the field of food and beverages, and also biotechnologists, industrial representatives interested in innovation, academic staff and students in food science, engineering, biology, and chemistry-related fields, pharmacology and medicine, and is a useful and updated resource for any reader interested to find the basics and recent innovations in the most investigated fields in beverage engineering.

Alexandru Mihai Grumezescu Alina Maria Holban

PREFACE Cocoa and caffeine-based foods and beverages are a relatively recent example of a very productive industry. Cocoa-based drinks, coffee, and caffeinated teas are constantly consumed worldwide and in the last years numerous technologies have been developed to increase their production and variability. The aim of this book was to discuss recent advances in the field of production, processing, and properties of cocoa, coffee, and caffeine-related beverage products. Relevant information regarding the plant cultivation, genetic modifications in coffee, physicochemical composition, and also health impact of such beverages are thoroughly dissected in this work. This volume contains 15 chapters prepared by outstanding authors from Brazil, Italy, Kenya, India, Nigeria, Japan, Thailand, Spain, and Romania. The selected manuscripts are clearly illustrated and contain accessible information for a wide audience, especially food and beverage scientists, engineers, biotechnologists, biochemists, industrial companies, students, and also any reader interested in learning about the most interesting and recent advances in the field of beverage science. Chapter  1, Functional and medicinal properties of caffeine-based common beverages, by Francine Carla Cadoná et  al., describes the biomedical properties of common caffeine beverages, such as coffee (Coffea arabica), black/green tea (Camelia sinensis), and yerba mate (Ilex paraguariensis). These plants present several bioactive molecules in their chemical matrix that are responsible for therapeutic properties. These plants are able to increase neural activity and to promote welfare, besides presenting antiinflammatory, antitumor, thermogenic, and antioxidant capacities. In this sense, it seems that the frequent intake of these functional beverages can contribute to a healthier life. Chapter 2, Quality and safety issues related with the presence of biogenic amines in coffee, tea, and cocoa-based beverages, by Donatella Restuccia et al., aims to offer an updated image regarding the presence of biogenic amines (BAs) in tea, coffee, and cocoa and their derivatives as well as their analytical determination. The BAs are detrimental to health and originate in foods from decarboxylation of the corresponding amino acid and transamination of aldehydes and ketones. Tea, coffee, and cocoa, as well as their derivatives, have been considered as a source of BAs. The amines, can be present in raw materials and can take origin during the production process and/or they can be formed/accumulated during

xix

xx  Preface

storage although raw materials have been investigated much more in comparison with the corresponding beverages. Chapter  3, Exploiting genetic and phenotypic diversity of robusta coffee (Coffea canephora L.) land races to mitigate the effects of climate change, by Kahiu Ngugi et  al., assessed the genetic variability among cultivated Robusta coffee (Coffea canephora) that might be utilized to enhance productivity and quality and ultimately improve small-scale farmer earnings. The results of this study concluded that in certain geographical areas where wild populations of coffee are available (such as Uganda), a great genetic diversity occurs, which is constantly being enriched by the gene flow between the wild and cultivated populations. Chapter  4, Industrial processing of CTC black tea, by K. R. Jolvis Pou et al., describes the production, processing, and properties of tea obtained through crush, tear, and curl (CTC) method. Tea is rich in antioxidant activities and it is reported to have a great potential for the treatment of oral health problems, various types of cancers, heart diseases, and diabetes and also it improves urine and blood flow, improve the immune system, and have the ability to detoxify, and stimulate. To maintain quality in terms of inherent color, aroma, taste, appearance, and health benefits tea must be processed under controlled condition. Chapter 5, Caffeinated beverages, behavior and brain structure, by Onaolapo O.J. MBBS et al., consolidates our understanding of the effects of caffeinated beverages on the brain through a summary that draws from findings emanating from research and suggests further directions for caffeinated beverages research that may help to optimize human health from their consumption. Chapter 6, The ability of green tea with lowered caffeine to reduce stress and improve sleep, by Keiko Unno et al., describes a procedure to obtain green tea with a lowered caffeine content, low-caffeine green tea (LCGT) in which elution temperature was set to a low temperature to suppress the elution of EGCG. Aspects such as chemical content and health effects, empathizing on antistress properties, are highlighted in this work. Theanine, the major amino acid in green tea, has a significant antistress effect on animals and humans. However, this effect is blocked by caffeine and gallate-type catechins (e.g., EGCG), two other main components of tea. Chapter  7, entitled Caffeine and kidney diseases, by Paleerath Peerapen et  al., provides an overview of the effects of caffeine on renal function and summarizes relevant data related to its effects in various kidney diseases, including acute kidney injury (AKI), rhabdomyolysis-induced renal failure, glomerulosclerosis, chronic ­ kidney disease (CKD), diabetic nephropathy (DN), polycystic kidney disease (PKD), kidney stone disease, analgesic nephropathy, drug-­ induced nephrotoxicity, renal cell carcinoma (RCC), hemodialysis-­ induced restless legs syndrome (RLS), and kidney transplantation.

Preface  xxi

Chapter  8, Caffeine in beverages: Cardiovascular effects, by Anna Vittoria Mattioli et al., explores the cardiovascular effects of caffeine and of caffeinated beverages. Caffeine is one of the neuro-active beverages most prevalent in Western countries. Its cardiovascular effects, as well as the different cardiovascular responses reported in individuals who take caffeine from beverages and foods regularly than those who take it occasionally are well known. Chapter  9, Analytical approaches in coffee quality control, by Elixabet Diaz-de-Cerio et  al., summarizes the analytical strategies used for coffee quality control in the last lustrum (2013–17). The final quality is strictly related to the raw materials, the technological processes, and beverage preparation. In the last years, the use of advanced destructive and nondestructive methods brings the possibility to improve the quality control. On the one hand, advanced analytical techniques allow the determination of several compounds such as volatile chemicals, caffeine (CF), trigonelline (TG), phenolic compounds, carbohydrate, and lipid constituents, as well as those caused by technological processes, which could be healthy (i.e., melanoidins) or unhealthy compounds (i.e., polycyclic aromatic hydrocarbons, furan, and acrylamide). On the other hand, different spectroscopic (IR, NMR, fluorescence, and UV) and spectrometric techniques and statistical methods have been applied to this aim. Finally, different sensor devices (i.e., electronic tongue and nose) have also been used to establish a relationship between consumer acceptance and coffee quality. Chapter  10, Spray-freeze-drying of coffee, by C. Anandharamakrishnan, intends to explain the different stages involved in the production of soluble coffee by the spray-freeze-drying process. Also, a detailed description of the quality characteristics of spray-freeze-dried coffee is provided highlighting its merits over the conventional spray dried and freeze dried products. Chapter  11, Nutrients in caffeinated beverages—An overview, by Sharvari Deshpande et al., gives a wide outline on the diverse set of nutrients present in these caffeinated drinks, with a mention of the negative effects of certain nutrients on the human body. In addition, the authors concentrate on the measure of nutrients present in the extensive variety of beverages present under the different categories of caffeinated drinks mentioned. Chapter  12, Effects of coffee on intestinal microbiota, immunity and disease, by Mădălina Preda et  al., offers a global perspective on recently acquired knowledge regarding alterations in the composition of human gut microbiota, coffee consumption and their relation with various pathologies such as: allergic diseases, autoimmune diseases, inflammatory bowel disease, obesity, type 2 diabetes mellitus, neurodegenerative diseases, and carcinogenesis. The elucidation of the complex interplay between coffee and the human gut microbiota in

xxii  Preface

health-promoting or disease-causing processes could lead to new prophylactic and therapeutic strategies. Chapter  13, The microbiology of cocoa fermentation, by Ionela Sarbu et  al., presents the main aspects concerning cocoa beans fermentation: microbial dynamics and diversity, the chemical changes during the process as well as some of the developments aimed to improve the process, and the sensory characteristics of the final products. The postharvested cocoa beans have an unpleasant flavor. In order to obtain the unique sensory characteristics of cocoa and its processed product, the chocolate, the cocoa beans undergo treatments including fermentation, drying, and roasting. After the cocoa beans are extracted from the pods they suffer major changes due to spontaneous fermentation produced by indigenous microorganisms such as yeasts, lactic acid and acetic bacteria, bacilli, and fungi. Chapter  14, Genetic engineering in coffee, by Alexandra SimonGruita et al., presents the progress of the previous years in coffee genetic modification, accomplished to overcome some of the difficulties that coffee growers are facing in the present context of climacteric changes and with respect to food safety regulations. The coffee genetic transformation using genetic engineering aims to obtain new cultivars with disease and pest resistance, tolerance to drought and frost, enhanced cup quality, and low caffeine content. A lot of methods are used to improve coffee traits, starting with simple selection through which individuals with superior characteristics are selected and propagated over time. Based on in vitro coffee propagation (which is a useful tool for coffee genetic engineering), different methods such as electroporation, microprojectile bombardment or Agrobacterium system, and RNAi technology are used to introduce foreign genes into the coffee genome. Chapter 15, Cocoa industry—From plant cultivation to cocoa drinks production, by Genţiana Mihaela Iulia Predan et al., is an explicit overview on the cocoa tree cultivation and properties, empathizing on recent advances made in the production and processing of cocoa-based beverage industry. Alexandru Mihai Grumezescu University Politehnica of Bucharest, Bucharest, Romania Alina Maria Holban Faculty of Biology, University of Bucharest, Bucharest, Romania

FUNCTIONAL AND MEDICINAL PROPERTIES OF CAFFEINEBASED COMMON BEVERAGES

1

Francine Carla Cadoná⁎, Grazielle Castagna Cezimbra Weis†,‡, Charles Elias Assmann†,§, Audrei de Oliveira Alves†,¶, Beatriz da Silva Rosa Bonadiman†,¶, Alencar Kolinski Machado‖, Marco Aurélio Echart Montano⁎, Ivana Beatrice Mânica da Cruz†,§,¶ ⁎

Graduate Program in Biosciences and Health, University of the West of Santa Catarina, Joaçaba, SC, Brazil †Biogenomics Laboratory, Federal University of Santa Maria, RS, Brazil ‡Graduate Program of Food Science and Technology, Federal University of Santa Maria, Santa Maria, RS, Brazil §Graduate Program in Biological Sciences: Toxicological Biochemistry, Federal University of Santa Maria, Santa Maria, RS, Brazil ¶Graduate Program of Pharmacology, Federal University of Santa Maria, Santa Maria, RS, Brazil ‖Franciscan University, Santa Maria, RS, Brazil

1.1  Coffee (Coffea arabica and Coffea canephora) 1.1.1  Coffee Chemical Constituents and Main Biological Activities Coffee was discovered in Ethiopia in the 6th century; later, it was taken to Arabia and subsequently to Europe around the 1500s. Coffee was transferred to Central and South America around the 1700s. The Brazilian culture of coffee began in 1727; nowadays, this country is considered the main coffee producer, promoting a huge social and economic impact (Yanagimoto et al., 2004) (Fig. 1.1). Coffee is considered an energetic and functional beverage, made from two main species (Coffea arabica and Coffea canephora). Coffea arabica has superior quality and aroma, representing ~70% of the

Caffeinated and cocoa based beverages. https://doi.org/10.1016/B978-0-12-815864-7.00001-5 © 2019 Elsevier Inc. All rights reserved.

1

2  Chapter 1  Functional and Medicinal Properties of Caffeine-Based Common Beverages

Fig. 1.1  Coffee drink (A) and coffee grain (B).

­ roduction around the world, while Coffea canephora presents a more p bitter taste than Coffea arabica and it is consumed mainly as instant coffee and in espresso blends, involved in “crema” formation (Crozier et al., 2012). Coffee intake represents a common habit; it is considered the most consumed beverage around the world. This fact is explained by coffee having a great aroma and taste as well as previous studies suggesting several health benefits of this plant due to the bioactive molecules present in its chemical matrix composition (Natella et al., 2002; Somoza et al., 2003; Okamura et al., 2005). In this sense, several chemical substances are present in coffee, including carbohydrates, lipids, vitamins, minerals, alkaloids, and phenolics compounds. However, the chemical composition of this plant depends on the coffee variety, culture weather, processing, roasting, and milling conditions (Crozier et al., 2012). Green coffee beans, before roasting, are composed of 6.5%–10% CGA, 1.2%–2.2% caffeine, 10%–16% lipids with special diterpenes (cafestol and kahweol), 0.7%– 1.0% trigonelline, 45%–52% carbohydrate, 11% protein, and 4.2%–4.4% minerals. However, roast coffee presents 2.7%–3.1% CA, 1.2%–2.4% caffeine, 23% melanoidins, 11%–17% lipids, 38%–42% carbohydrate, 10% protein, and 2.4%–2.5% aliphatic acids. These molecules are responsible for a special aroma, flavor, and color (Pan et  al., 2016a,b) (Table 1.1). Coffee has different micronutrients, such as magnesium, potassium, niacin, and vitamin E, that present a positive health effect (Higdon and Frei, 2006; Fig.  1.2). Moreover, the rich bioactive molecules present in the chemical matrix of coffee are associated with health benefits; including – Caffeine (1,3,7-trimethylxanthine): It is a purine alkaloid that acts by inhibiting the receptors of adenosine A1 and A2A, A2B, and A3 to stimulate neural activity and promote vasoconstriction. Neural

Chapter 1  Functional and Medicinal Properties of Caffeine-Based Common Beverages   3

Table 1.1  Main Biological Activities and Bioactive Molecules of Coffee (Coffea arabica) Biological activity

Antioxidant Antiinflammatory Antitumor

Neuroprotective

Chemical composition

Chlorogenic acid caffeine Lipids—cafestol and kahweol Trigonelline Carbohydrate Proteins Minerals

Fig. 1.2  Main biological properties of coffee.

Jung et al. (2017) Kempf et al. (2010), Akash et al. (2014), and Freedman (2012) Mut-Salud et al. (2016), Michaud et al. (2010), Jiang et al. (2013), and Liu et al. (2015) Davis et al. (2003), Smith (2002), Joghataie et al. (2004), and Arendash et al. (2006) Pan et al. (2016a,b)

4  Chapter 1  Functional and Medicinal Properties of Caffeine-Based Common Beverages

activity promotes an increase of adrenaline release by the adrenal gland and it results in increase of arterial pressure, respiratory capacity, and energetic metabolism. Moreover, caffeine increases dopamine levels, assuring better cognition capacity and pleasure sensation (Goel, 2017). – Chlorogenic acid (CGA): CGAs are five main groups of phenolic compounds and their isomers, formed mainly by the esterification of quinic acid with one of the following acids derived from hydroxycinnamic acids: caffeic acid, ferulic acid (FA), or ρ-cumaric acid (ρ-CoA). CGA is considered a remarkable antioxidant and antiinflammatory molecule, since it is able to scavenge free radicals (Crozier et al., 2012). – Cafestol and Kahweol: These molecules are diterpenes that have an important role in coffee quality and aroma. Cafestol and Kahwelol present antiinflammatory activity. Cafestol is able to reduce the cholesterol produced by inhibiting hydroxy methyl glutaryl coenzyme A reductase (HMG-CoA reductase), Lipoprotein lipase (LPL), and LDL receptors (B/E receptors) expression (Higdon and Frei, 2006). In this sense, Ross et al. (2000) performed a study involving 8000 Japanese and American men, who were investigated about coffee intake for 30 years. The findings suggested that consumption of coffee prevents Parkinson disease since the results showed 3–5 times lower incidence of this disease in men who consumed at least one cup of coffee regularly. Moreover, coffee intake is associated with lower suicide indices. This result was found in a study involving 43,599 men enrolled in the Health Professionals Follow-up Study (HPFS, 1988–2008), 73,820 women in the Nurses' Health Study (NHS, 1992–2008), and 91,005 women in the NHS II (1993–2007) (Lucas et al., 2014). Besides, the study of Hoffman et  al. (2006) reported the thermogenic effect of coffee, since this plant increases basal metabolism and consequently promotes weight loss. This effect is attributable to caffeine present in coffee, because this result is not found in decaffeinated coffee (Hoffman et al., 2006). Coffee is considered a remarkable antioxidant plant. Hori and collaborators analyzed the 8-deoxiguanosine levels, a DNA damage marker, in subjects who consumed daily two or more cups of coffee. The results showed that these subjects presented lower levels of DNA damage than others who did not consume coffee (Hori et al., 2014).

1.1.2  Antitumor Coffee Activity Coffee presents in its chemical matrix several bioactive molecules that are able to decrease cancer cell proliferation, inhibit angiogenesis and metastasis processes, and activate the apoptosis pathway (MutSalud et al., 2016).

Chapter 1  Functional and Medicinal Properties of Caffeine-Based Common Beverages   5

In this sense, Michaud et al. (2010) analyzed 33 cases of glioma and 245 cases of meningioma in nine countries. The analyses showed a direct association between 100 mL of coffee daily consumed and lower risk of glioma. This association was more frequently observed in men than in women (Michaud et al., 2010). Moreover, a metaanalysis involving 966,263 subjects and 59,018 cases of breast cancer suggested that coffee and caffeine decrease the risk of this disease in postmenopausal women. Breast cancer risk decreased around 2% for two cups of coffee and 1% for 200 mg per day of caffeine (Jiang et al., 2013). Another investigation performed by Liu et  al. (2015), involving 539,577 subjects and 34,105 cases of prostate cancer, suggested that coffee intake decreased the risk of this disease and advanced type of prostate cancer. Prostate cancer risk decreased 2.5% in individuals who consumed two cups of coffee daily (Liu et al., 2015). A study also investigated the coffee effect in lung cancer. A metaanalysis was performed with 8 cohort studies and 13 control cases involving 19,892 patients with lung cancer and 623,645 controls. However, the results were not conclusive since the findings can be confounded by tobacco smoking (Galarraga and Boffetta, 2016). Besides, 22 studies, 9 cohorts and 13 case-controls, involving 7631 cases and 1,019,693 controls significantly showed that coffee consumption reduced stomach cancer risk. The findings suggest an inverse relation between coffee intake and stomach cancer, since high coffee consumption was associated to lower stomach cancer risk (Xie et al., 2016). Moreover, another investigation was performed to analyze coffee intake and colorectal cancer. Five cohorts and nine case-control studies were identified, and a systematic review was performed with metaanalysis to verify coffee consumption and the colorectal cancer risk. The cohort results showed a strong inverse association only in women, while 3 case-controls showed a strong inverse association in men and women in both colon and rectal cancer. In the metaanalysis, high coffee consumption was not associated with colorectal cancer risk in cohort studies, while it was significantly associated with lower colon cancer and rectal cancer risk in case-control studies. Evidence was insufficient to conclude whether consumption and coffee increase or decrease the risk of colorectal cancer, indicating further investigations to clarify that (Akter et al., 2016). On the other hand, a study performed by Gan et al. (2017), which was a wide metaanalysis involving 2,046,575 participants and 22,629 patients with colorectal cancer in 19 cohort prospective studies showed that 7% decreased colon cancer risk in subjects who consumed four cups of coffee every day (Gan et al., 2017). Besides, 11 important studies including 2795 cases of hepatocellular carcinoma and 340,749 controls were investigated. A metaanalysis

6  Chapter 1  Functional and Medicinal Properties of Caffeine-Based Common Beverages

suggested an inverse association between coffee consumption and hepatocellular carcinoma risk; quantitative evidence indicates that higher consumption ensures greater protection (Bai et al., 2016). Furthermore, the antitumor coffee effect was revealed in pancreatic cancer. A metaanalysis involving 20 cohort studies indicated that high coffee consumption is associated with a lower pancreatic cancer risk. There was no significance for each increment of 1 cup of coffee on disease risk in nine studies (Ran et al., 2016). The same was found in the study performed by Liu et al. (2016) that investigated the antitumor effect of coffee in two case-control studies (846 melanoma patients and 843 controls) and five cohort studies (844,246 participants and 5737 melanomas). The results showed that caffeinated coffee decreases malignant melanoma risk, when comparing the highest intake with the lowest intake. There was a dose response relationship. Decaffeinated coffee did not interfere with the disease risk (Liu et al., 2016).

1.1.3 Neuromodulatory Coffee Effects Coffee is considered a remarkable neuromodulator beverage; for instance, it is widely used to increase the alert and cognitive state. Caffeine, the main bioactive molecule found in the chemical matrix of coffee, is responsible for this action. Caffeine acts by antagonizing the effects of adenosine, a brain chemical (neurotransmitter) that causes sleep. It can bind to adenosine receptors by blocking them. Thus, the inhibitory action of adenosine is prevented, and the effect of caffeine is consequently stimulating (Davis et al., 2003). However, caffeine consumption can adversely affect motor control and sleep quality, as well as cause irritability in individuals with anxiety disorders (Smith, 2002). Some authors have concluded that the efficacy of caffeine in relieving headaches induced by its deprivation (leading to cerebral vasodilation) reflects its vasoconstricting properties at the central level. In other types of headache, such as tension headaches, caffeine seems to play an active role in pain relief, being the dose-dependent effect (Baratloo et al., 2016). Moreover, coffee has been associated to Parkinson's disease prevention (Ascherio et  al., 2003; Sääksjärvi et  al., 2008). Parkinson’s disease is the second most common cause of neurodegenerative disturbance. This disease affects around 1%–3% of the subjects above 65 years (Ross et al., 2000). Parkinson's disease is directly associated with the elderly and it is more prevalent in men (Wooten, 2004). The neuropathologic disorders present in Parkinson’s involve dopaminergic neuron loss in the substantia nigra with subsequent depletion of the dopamine levels in the striatum. Consequently, severe loss of dopamine is associated with debilitating motor disorders associated

Chapter 1  Functional and Medicinal Properties of Caffeine-Based Common Beverages   7

with parkinsonism (Joghataie et  al., 2004). Several prospective and retrospective epidemiological studies have demonstrated an inverse relationship between coffee and caffeine consumption and the risk of developing Parkinson's disease (Ross et al., 2000; Prediger, 2010). The study performed by Ross et  al. (2000) suggested an inverse association between coffee consumption and the risk of developing Parkinson's disease, involving 8004 Japanese-American men over 30 years. In this study, the risk for Parkinson's disease was five times higher among men who reported not consuming coffee than among those who reported a daily intake of ~800 mL of coffee or seven small cups (Ross et al., 2000). In addition, coffee also has exhibited a neuroprotective effect against the development of Alzheimer's disease. However, the mechanism responsible for such protection is not clear yet. A study performed in animal nerve cell cultures suggests that adenosine A2A receptor antagonism protects nerve cells against β-amyloid ­protein-induced neurotoxicity. In another study, the daily intake of 1.5 mg of caffeine (equivalent to a daily human consumption of 500 mg) per mouse caused a decrease in the production of β-amyloid protein levels, protecting the cognitive ability of animals (Maia and De Mendonc, 2002; Dall’lgna et al., 2003; Arendash et al., 2006). Some authors reported that increased oxidative stress in the brain has a very important role in the development of Alzheimer's disease (Huang et al., 2016; Perry et al., 2002). In this sense, the bioactive molecules present in coffee, such as caffeine and CGAs, ensure a remarkable antioxidant activity, reducing oxidative stress by reactive oxygen species (ROSs) neutralization (You et al., 2011).

1.1.4  Coffee Drinking and Lower Risk of Suicide Coffee presents antidepressant-like activity since this beverage is able to increase dopamine levels and, consequently, able to cause pleasure sensation (Szopa et al., 2016). In this sense, coffee has been directly associated to lower risk of suicide (Higdon and Frei, 2006; Lucas et al., 2014). This association was evaluated in the study performed by Lucas et al. (2014), involving 43,599 men enrolled in the Health Professionals Follow-up Study (HPFS, 1988–2008), 73,820 women in the Nurses’ Health Study (NHS, 1992–2008), and 91,005 women in the NHS II (1993–2007). Consumption of caffeine, coffee, and decaffeinated coffee was evaluated for 4 years. Besides, deaths from suicide were determined by physician review of death certificates. The results suggested a direct association between caffeine intake and lower risk of suicide. Moreover, in a study performed for 10 years, involving more than 128,000 men and women participating in a California health, the

8  Chapter 1  Functional and Medicinal Properties of Caffeine-Based Common Beverages

f­ indings showed a lower risk of suicide in 13% for every cup of coffee consumed daily (Klatsky et al., 1993).

1.1.5  Antiinflammatory Coffee Effects The coffee chemical matrix is rich in bioactive molecules that present important biological activities, such as antiinflammatory and antioxidant (Jung et al., 2017). In this sense, coffee consumption promotes a lower risk of clinical conditions reducing inflammation and oxidative stress and increasing serum levels of antiinflammatory factors, such as adiponectin (Kempf et al., 2010; Wedick et al., 2011) and interleukins 4 and 10 (Akash et al., 2014). Consequently, regular coffee consumption is associated with reducing the development of some diseases involving with these processes, for instance, cardiovascular disease (Kleemola et  al., 2000), certain types of cancer, obesity (Greenberg et al., 2006), type 2 diabetes (Sartorelli et al., 2010; Ding et al., 2014), and metabolic syndrome (Shang et al., 2016). Moreover, moderate coffee consumption is able to increase longevity rates (Freedman, 2012). In addition, coffee has been associated with gene expression modulation involved in innate immune regulation. [Interferon gamma-­ induced protein 10; C-X-C motif chemokine 11; C-X-C motif chemokine 12; and chemokine (C-C motif) ligand 4.] This fact was observed by microarray gene expression, which suggested a direct association between regular coffee intake and the chemokine signaling pathway. A study reported that inflammatory genes were upregulated in native human macrophages by lipopolysaccharide (LPS) stimulation and downregulated by coffee treatment. These genes are associated with biological functions such as cell and leukocyte migration, suggesting the interference of coffee in the chemotactic response of activated macrophages, reducing leukocyte migration (Vissiennon et al., 2017). The potential bioactive molecules found in coffee that present antioxidant and antiinflammatory activity are caffeic acid and quinic acid-ester CGA (Yasuko et al., 1984). Previous investigations reported this effect by inhibiting phosphorylase kinase and protein kinase A and C (Nardini et al., 2000) as well as suppression of NF-κB and MAPKs (Feng et al., 2005). Moreover, a study showed that caffeic acid directly suppresses IL-1 receptor-associated kinase 1 and 4 (IRAK1 and IRAK4); these molecules are involved in downstream toll-like receptor 4 signaling, which promotes chemokine signaling (Yang et al., 2013). Furthermore, a study performed by Jung et al. (2017) analyzed the antiinflammatory effect of coffee extracts using lipopolysaccharidetreated RAW 264.7 macrophage cells. The gene expression decreased for the inflammatory markers tumor necrosis factor-alpha and ­interleukin-6 in cells exposed to coffee extract. Taking this into

Chapter 1  Functional and Medicinal Properties of Caffeine-Based Common Beverages   9

a­ ccount, these findings suggest that coffee has an antiinflammatory action, reducing inflammation markers in RAW 264.7 macrophage cells (Jung et al., 2017).

1.1.6  Coffee and Prevention of Type 2 Diabetes Mellitus Type 2 diabetes is a current global problem as it presents growing prevalence, complications, and mortality. Insulin resistance and pancreatic beta cell dysfunction that are presented in type 2 diabetes lead to hyperglycemia. This condition is associated with an increase of oxidative stress and activation of inflammatory pathways (Odegaard et al., 2016). Since coffee has antiinflammatory and antioxidant activities, this beverage has been associated with improving and avoiding type 2 diabetes development (Sartorelli et  al., 2010; Ding et  al., 2014). In this context, several recent studies show an inverse association between coffee intake and incidence of type 2 diabetes mellitus (T2DM) (Sartorelli et al., 2010). Data obtained in Finland, the country with the most consumption of coffee in the world, corroborate this fact (Pereira et al., 2006). A study performed by Yamaji et al. (2004) reported that daily consumption of ~150 mL of coffee promote lower levels of postprandial and fasting glucose (1.5% and 4.3% respectively). In addition, glucose resistance decreases with coffee consumption (Yamaji et al., 2004). Moreover, pieces of evidence indicated that coffee presents an antiobesogenic action since it is considered a thermogenic beverage (Hoffman et  al., 2006; Pimentel et  al., 2009). In this sense, Pimentel et al. (2009) reported greater weight loss in coffee consumers than in nonconsumers. Since obesity is a main factor in the development of T2DM, this is an important finding to control this dysfunction. Furthermore, coffee also influences the secretion of incretin hormones, such as glucagon-like peptide-1 (GLP-1) and glucose-­ dependent insulinotropic peptide (GIP), decreasing the absorption of glucose in the small intestine, activating anorexigenic peptides such as pro-opio-melanocortin and regulation of transcripts by cocaine and amphetamine (POMC/CART), and inhibiting orexigenic peptides as agouti-related protein and neuropeptide Y (AgRP/NPY) (Fujii et al., 2015). Several epidemiological investigations showed that total caffeine from coffee and other sources is associated with a decreased risk of T2DM and that this association takes place after regular coffee consumption (Yamaji et  al., 2004; Pimentel et  al., 2009; Sartorelli et  al., 2010). This effect is the stimulation of pancreatic secretion, basal

10  Chapter 1  Functional and Medicinal Properties of Caffeine-Based Common Beverages

e­ nergy metabolism, stimulation of lipid oxidation, mobilization of glycogen in muscle, and weight loss (Zhang et al., 2011). In addition, Yamauchi et al. (2010) reported that caffeine influences the metabolism of carbohydrates. Caffeine acts as an antagonist of A1 and A2A adenosine receptors by the inhibition of phosphodiesterases and the mobilization of calcium. Since adenosine is a neurotransmitter responsible for decreased cerebral activity, therefore caffeine increases in brain activity. Consequently, the gland is stimulated to release adrenaline, provoking stimulatory effects. A stimulation of the central and autonomic nervous system is observed, as is elevation of blood pressure, an increase in the metabolic rate, and an increase in diuresis. Adrenaline, one of the hormones involved in the stimulation of thermogenesis, inhibits glycogenesis and stimulates glycogenolysis and lipolysis. In addition, adrenaline promotes the formation of cyclic adenosine monophosphate (CAMP) in the cells, initiating a cascade of chemical reactions that lead to the activation of the enzyme phosphorylase, allowing the release of glucose residues, available for use as a power source. In lipolysis, caffeine inhibits phosphodiesterases, enzymes responsible for converting cAMP into adenosine monophosphate (AMP), which leads to the increase of cAMP in the tissues, leading to a greater stimulation of lipolysis. Triglycerides, stored in the adipocytes, are then degraded into fatty acids and glycerol, which can be used as a power source. Consequently, metabolism reduction is increased in the size and number of adipocytes, total body fat and, body weight loss (Yamauchi et al., 2010). Caffeine is commonly associated with risk of hypertension, heart disease, osteoporosis, or hypercholesterolemia. However, Pimentel et al. (2009) reported that with a moderate intake of caffeine (~400 mg/ day) this association is not verified (Pimentel et al., 2009).

1.2  Black Tea (Camellia sinensis) 1.2.1  Black Tea (Camellia sinensis), Main Characteristics and Chemical Matrix Tea is one of the oldest beverages consumed worldwide that also is an important contributing factor to economic parameters on the food and beverage trade (Dufresne and Farnworth, 2001; Luczaj and Skrzydlewska, 2005; Lahiry et al., 2010). Commonly, teas are intaken in three different forms, including nonfermented, semifermented, or fully fermented, that are obtained through specific processes of preparation (Malongane et al., 2017). China was the first country to introduce tea intake as a traditional medicine alternative (Camargo, 2011). Currently, different teas are consumed and produced in several countries; however, China is still the main one in terms of cultivation and

Chapter 1  Functional and Medicinal Properties of Caffeine-Based Common Beverages   11

Fig. 1.3  Black tea (A) and black tea powder (B).

trade (Engelhardt, 2013; Chang, 2015). Of all types of tea, those ones that are made from Camellia sinensis are the main ones (Malongane et al., 2017; Fig. 1.3). Camellia sinensis tea is a shrub-type perennial plant that belongs to the Theaceae family. This plant is originally from China but its consumption was widespread to India and Japan and lately to European countries and Russia. This tea plant can reach 3–4 m high and, usually, its leaves are used to prepare different teas (Camargo, 2011). Black tea is one of the most consumed teas made by Camellia sinensis leaves, corresponding to about 80%. However, apart from black tea it is possible to prepare other kinds of tea from this same tea plant, including green tea and white tea, for example. Actually, because of its biological properties, green tea intake is increasing, but currently it is also known that black tea has a lot of different positive effects on human cells, tissues, and organisms (Bhattacharya and Giri, 2013). The main difference between black tea and other types of Camellia sinensis tea is the way that their leaves are harvested and the method of preparation. The leaves used for black tea preparation are initially washed and dried for 1 day; then, they are wrapped and fermented for 6 h; a second drying step is performed later (Camargo, 2011; Engelhardt, 2013). All these processes are carried out to transform an integral part of natural leaves into a consumable product that is highly commercialized in several oriental countries and that is advancing in the Western market (Sharangi, 2009). Considering the chemical composition, it has already been described that Camellia sinensis’ leaves have lipids, carbohydrates, and proteins that are not present in the tea infusion (Camargo, 2011). On the other hand, there are several molecules present in its leaves as part of the chemical matrix, such as polyphenols, caffeine, theobromine, vitamin C, some metals, as well as fluoride ions, that are consumed by drinking its tea. These molecules when intaken

12  Chapter 1  Functional and Medicinal Properties of Caffeine-Based Common Beverages

could positively interact with some cells and induce positive effects (Barcirova, 2010). Despite the leaves’ fermentation, black tea presents significant levels of preserved polyphenols, as well as organic compounds and specific molecules known as theaflavins and thearubigins. Theaflavin 3-gallate, theaflavin 3′-gallate, and theaflavin 3,3′-gallate are the most important theoflavins found in black tea (Dufresne and Farnworth, 2001; Luczaj and Skrzydlewska, 2005; Lahiry et al., 2010). These molecules are responsible for the taste and color of black tea (Santos-Buelga and Scalbert, 2000; Ngure et  al., 2009). In addition, thearubigins are found in high amounts in black tea; however, their chemical structure is not completely understood (Haslam, 2003; Ngure et al., 2009). In addition, most of the biological properties related to black tea (Pinto, 2013; Senanayake, 2013), described further are associated with its chemical matrix composition (Table 1.2 and Fig. 1.4).

Table 1.2  Main Biological Activities and Bioactive Molecules of Black Tea (Camellia sinensis) Biological activity

Antioxidant

Antiinflammatory Antitumor Neuroprotective Chemical composition

Polyphenols Theaflavins and derivatives: Theaflavin 3-gallate

Salah et al. (1995), Zandi and Gordon (1999), Vinson and Dabbargh (1998), Wiseman et al. (1997), Chan et al. (2011), and Yang et al. (2008) Wu et al. (2012) and Bedran et al. (2015) Nomura et al. (2000), Sharma et al. (2017), Pan et al. (2017), and Charehsaz et al. (2017) Chaturvedi et al. (2016), Zhang et al. (2016), and Qi et al. (2017) Dufresne and Farnworth (2001) Luczaj and Skrzydlewska (2005) Lahiry et al. (2010)

Theaflavin 3′-gallate Theaflavin 3,3′-gallate Thearubigins Polyphenols Caffeine Theobromine Vitamins

Barcirova (2010)

Chapter 1  Functional and Medicinal Properties of Caffeine-Based Common Beverages   13

Mitochondrial function recovering in neurons associated to antioxidant effect

O2+ SOD

H2O2 2GSH

Fe++

CAT

Fe+++

OH

GPx

GR

+

GSSG

H2O

Antioxidant enzyme modulation Antiinflammatory effect through pathogenic agents elimination and proinflammatory cytokines control Tumor cells proliferation decreasing via promoter gen inhibition and cell cycle arresting Antioxidant capacity by free radicals and ROS scavenging

Fig. 1.4  Main biological properties of black tea.

1.3  Black Tea as a Significant Bioactive Compound 1.3.1  Antioxidant: The Main and More Explored Bioactive Property of Black Tea The oxidative metabolism is an important system linked to mitochondrial function (Malkus et  al., 2009; Streck et  al., 2013). Mitochondria are responsible for energy production via ATP synthesis through the mitochondrial electron transport chain (MTC) (Twig et  al., 2008; Santo-Domingo and Demaurex 2010; Atkin et  al., 2011; Rizzuto et  al., 2012; Liesa and Shirihai 2013). However, during ATP synthesis some electrons escape from the chain and they are able to reduce, especially, the molecular oxygen (O2)-producing superoxide radical (O•−). Fortunately, this reactive molecule is metabolized by the superoxide dismutase enzyme, releasing hydrogen peroxide (H2O2). Still inside the mitochondria, H2O2 is converted to O2 and H2O, or it can happen through catalase enzyme in the cytoplasmic space (Goldstein et al., 1993; Kirkinezos and Moraes 2001; Valko et al., 2007).

14  Chapter 1  Functional and Medicinal Properties of Caffeine-Based Common Beverages

This metabolism is physiological in the same time that free radicals and reactive oxygen species (ROS) are necessary for some intra and extracellular signaling (Gough and Cotter 2011; Rupérez et al., 2014). However, there are some situations where the free radical and ROS production exceed the endogenous antioxidant enzyme amount. In this sense, an imbalance called oxidative stress is established (Kirkinezos and Moraes 2001; Valko et al., 2007). As a consequence of oxidative stress, cells can suffer several damages such as lipid peroxidation, protein oxidation, and DNA damage, completely losing cellular homeostasis (Rupérez et al., 2014). In addition, several research studies worldwide have shown that oxidative metabolism imbalance could be found in subjects with some chronic nontransmissible diseases as part of their pathophysiology, such as cancer (Da Costa et al., 2012) diabetes, and heart diseases (Valko et  al., 2007), as well as neuropsychiatric illness (Wang et  al., 2009; Andreazza et al., 2010; Brown et al., 2014). In this sense, numerous studies have been performed to find alternatives of treatment that could recover this imbalance and prevent its damages. Studies with natural products are in highlight in this field of interest. It is due to the chemical matrix of these functional foods or beverages, for example, black tea (Pinto 2013; Senanayake, 2013). Camellia sinensis is a tea plant strongly known for its antioxidant properties. According to Salah et  al. (1995) and Zandi and Gordon (1999), the extract of black tea leaves has antioxidant capacity mainly due to the presence of flavonoids acting as free radical scavengers. In addition, Vinson and Dabbargh (1998) have already reported that polyphenols found in black tea have antioxidant properties. In addition, Wiseman et al. (1997) also showed black tea’s antioxidant ability and its cellular protective effects since it was able to reduce lipid peroxidation under black tea exposure. In an experimental study, Chan et al. (2011) evaluated the antioxidant capacity of different teas made from Camellia sinensis (green, black, and herbal teas). It was shown that green tea has higher antioxidant capacity compared to all of them, followed by black tea, and finally herbal tea. The authors emphasize that it is in accordance with the way that each tea is made, since theoretically green tea has more conserved molecules, such as epigallocatech gallate (EGCG) than black tea, for example. On the other hand, this study also described that black tea’s antioxidant capacity is strongly related to functional molecules that are part of this plant, corroborating previous publications reinforcing the aspect that natural products with biological capacities, as black tea, owe their properties to the chemical matrix. More recently, Yang et  al. (2008) showed the ability of theaflavins and their gallate esters against oxidative damage induced in the HPF-1 cell line, acting as an antioxidant agent through free radical ­scavenging. Moreover, Qi et al. (2017) showed through an in vitro study

Chapter 1  Functional and Medicinal Properties of Caffeine-Based Common Beverages   15

that ­polyphenols from different teas, including black tea, are able to protect neurons from an oxidative exposure and recover mitochondrial dysfunction by an antioxidant mechanism controlling both protein and gene expression of cellular metabolism. In addition, Khanum et al. (2017) showed that different types of black tea present antioxidant effects by free radical scavenging activity and this response was proportional to the number of polyphenols present in each infusion. In this sense, black tea and/or its main compounds could be great alternatives for research development about new alternatives of therapy or even prevention of several chronic diseases related to oxidative metabolism imbalance, such as diabetes, cancer, and neuropsychiatric illness, previously commented upon in this section.

1.3.2 Upstream Pathways of Black Tea Controlling Inflammatory Activation The immune system is a complex and very important organization responsible for an organism’s protection against pathogenic agents, such as bacteria, viruses, and parasites (Medzhitov 2008; Cruvinel et al., 2010). The immunological response is linked to inflammatory activation since it is made by cellular and protein mediators, leukocytes, and cytokines, respectively (Cruvinel et al., 2010; Rabolli et al., 2016). In addition, it is already known that the inflammatory response can be activated by sterile agents released by tissues that are under stressor agents, damaging the cells. Cellular-released molecules include ATP, for example (Takeuchi and Akira, 2010; Chen and Nuñez, 2010), and some current publications have described that excessive EROs also could activate the inflammatory cascade through inflammasome protein complex formation (Zhou et al., 2011; Kim et al., 2016). Despite the importance of the inflammatory response, it must be controlled. After harmful agent elimination, both cellular and protein mediators must be attenuated and returned to basal physiological conditions (Bettelli et al., 2006; Ivanov et al., 2006; O’Connell et al., 2010). However, there are different chronic diseases where the inflammatory response is continuous and persistent, characterizing chronic inflammatory activation, mediated mainly by cytokines (Basha et al., 2016). In this sense, important efforts have targeted at this field of understanding. Similar to antioxidant capacity, the antiinflammatory effect is one of the most explored effects of black tea. There are many interesting studies developed in this field that indicate the black tea beverage as a potential antiinflammatory agent, specially associating this characteristic with atherosclerosis and heart-protection properties (Da Silva, 2013; Hayat et al., 2015). Wu et  al. (2012), in an in  vivo experimental evaluation, extracted theoflavins from black tea. In this study, rats were cigarette ­inhalation-induction exposed and concomitantly treated with

16  Chapter 1  Functional and Medicinal Properties of Caffeine-Based Common Beverages

t­heaflavins. While rats from the cigarette inhalation positive control group presented high mucous secretion, the animals treated with theaflavins from black tea showed inhibition of airway mucous hypersecretion. The authors suggest that this significant effect is due to the antiinflammatory effect induced by theaflavin exposure. More recently, Bedran et al. (2015) through an experimental model showed that black tea extract is capable of causing antibacterial activity against pathogens causing periodontal infection as well as it was able to attenuate the secretion of interleukin (IL-8) in oral cells, suggesting that this extract has not only antimicrobial activity but also antiinflammatory ability that could be used as a tool against oral infections and inflammation. In this sense, black tea or its main compounds could be potent alternatives for antiinflammatory pharmacological research targeting drug development against chronic inflammation.

1.3.3  Black Tea as a Preventive and Potential Natural Therapy Alternative for Cancer Cancer is be a chronic disease associated with aging due to loss of cellular repair capacity and cumulative DNA damages. However, different cancer types have been found increasingly in young subjects. In this sense, currently it is reported that cancer is a genetic multifactorial disease with several known causes and consequences that lead to its classification as a huge global public-health problem (Torre et al., 2015). It is already known that there are many agents able to induce cancer development, such as chemical substances, radiation, virus, by activation of proto-oncogenes causing loss or gain of function specially related to intense cellular proliferation, apoptosis resistance, and cell cycle impairment (Balkwill and Mantovani, 2012; Kidane et al., 2014). In addition, some studies have described the relationship between cancer development and oxidative stress, as well as immune system dysfunction (Da Costa et al., 2012). Then, substances or compounds capable of avoiding or treating these conditions with reduced side effects have been the focus of cancer therapy research (Cadoná et  al., 2017). Again, natural products are in the limelight because of their positive biological effects for more than 50 years (Newman and Cragg, 2016) and black tea is one of these functional beverages that have been evaluated for antitumor ability. In an experimental study performed by Nomura et al. (2000) it was shown that theaflavins from black tea are able to inhibit ultraviolet B-induced AP1 activation. AP1 is a cancer promotor that is activated under radiation exposure, being related to skin cancer development and progression. According to Sharma et al. (2017), tea polyphenols could prevent ultraviolet damage in skin cells since there is some

Chapter 1  Functional and Medicinal Properties of Caffeine-Based Common Beverages   17

research showing this potential: Nichols and Katiyar (2010) and Sang et al. (2011), for example. Despite chemotherapy side effects, another huge problem about cancer therapy is tumor cell chemotherapy resistance (Cadoná et al., 2017). An example of this situation is found in some cases of ovarian cancer. Traditional pharmacological ovarian cancer therapy is based on cisplatin chemotherapeutic. Pan et al. (2017) performed an in vitro experimental study where cisplatin-resistant ovarian cancer cells were exposed to different concentrations of theaflavin-3/3′-gallate, found in high concentrations in black tea infusion. This molecule was able to decrease cellular proliferation, showing the inhibitory effect of cellular cisplatin resistance through apoptosis induction and cell cycle arrest. Moreover, Charehsaz et al. (2017) showed that black tea presents antimutagenic and anticlastogenic effects through in vitro and in vivo assays and its activities were again associated with theaflavins and thearubigins levels that were capable of modulating TA98 and TA100 genes. In addition, Mbuthia et al. (2017) also demonstrated the antitumor action of Camellia sinensis infusions; moreover, the authors also proved that this plant has the capacity to ameliorate metastatic breast cancer. In this regard, it is clear that black tea or even similar teas have antitumor potential and could be used as natural alternatives of cancer prevention.

1.3.4 Neuroprotective Effect of Black Tea is Associated With Mitochondrial Function Recovery Neuropsychiatric and neurodegenerative diseases have affected many patients worldwide (Murray and Lopez, 1996). Currently, the most intriguing aspect of these illnesses is that we still do not have a complete understanding of their pathophysiology and progressing characteristics (Judd et al., 2008; Emsley et al., 2013). However, there are some research studies showing that individuals with neuropsychiatric illnesses, such as bipolar disorder, schizophrenia, and major depression, as well as neurodegenerative illness, including Alzheimer’s diseases, present oxidative imbalance and/or chronic inflammatory activation (Andreazza et al., 2007, 2013). The oxidative stress found in neurons and in the peripheral blood of subjects with neuronal illness is associated with a mitochondrial dysfunction in the electron transport chain, specifically at complex I or IV. This mitochondrial impairment decreases ATP synthesis while increasing free radical and EROs production, followed by cellular homeostasis loss. On the other hand, the inflammatory activation in these subjects happens through cytokine gene and protein overexpression. In addition, some studies have demonstrated that there is a relationship between mitochondrial dysfunction and inflammatory chronic activation

18  Chapter 1  Functional and Medicinal Properties of Caffeine-Based Common Beverages

in these subjects that happens through NLRP3 inflammasome overexpression and protein complex formation (Zhou et al., 2011; Kim et al., 2016). Then, mitochondrial recovery at neurons with any neuronal disease has been the theme of scientific speculation looking forward to find new methods that could improve imbalanced cellular. In 2006, Chaturvedi et al., published one of the first papers showing the neuroprotective modulation of black tea through an in  vivo evaluation. The authors performed a Parkinson’s disease model using 6-hydroxydopamine. Black tea extract was shown to be proficient to modulate rat behavioral parameters as well as recover enzymatic and oxidative metabolism conditions compared to negative control accessed via ex vivo experiments. Zhang et al. (2016), in an experimental research with PC12 cells, proved that theaflavin monomers from black tea present neuroprotective effects against oxidative stress-induced apoptosis. In this research, the authors showed that theaflavins at 10 μM are able to protect neuronal cells against H2O2 apoptosis induction by positive modulations of pro- and antiapoptotic gene expression, also increasing SOD and CAT antioxidant enzyme activity, while decreasing total level of ROS and lipid peroxidation. In addition, Qi et  al. (2017) proved that tea polyphenols can ameliorate redox parameters and mitochondrial dysfunction of neurons via Bmal1, a circadian key protein. All these findings suggest that black tea has significant neuroprotective effects, especially under induced damage neuronal conditions mainly through a mitochondrial effect as well as antioxidant capacity. The set of information about black tea and its chemical matrix strongly suggests that this kind of beverage has several bioactive effects, characterizing it as a functional natural product, which has been the theme of different investigations. In addition, all these biological capacities appear to be associated with the chemical composition of black tea, especially theaflavins that are specific molecules found in black tea. However, more experimental and scientific evaluations are needed to elucidate some aspects that are not completely clear yet as well as to demonstrate the mechanism by which all functions occur.

1.4  Green Tea (Camellia sinensis) 1.4.1 Green Tea Chemical Constituents and Main Biological Activities Green tea, made from Camellia sinensis (Kuntze, Theaceae), is a famous herb, and its extract has been extensively used in the traditional Chinese medicinal system. All true tea comes from a single species of plant, Camellia sinensis, including black, green, oolong, and white tea (Cooper, 2012; Saeed et al., 2017). Green tea may be consumed in the form of a brewed beverage or capsular extract. In some countries, tea is

Chapter 1  Functional and Medicinal Properties of Caffeine-Based Common Beverages   19

Fig. 1.5  Green tea (A) and green tea powder (B).

used as a dietary supplement. Successful tea cultivation requires moist, humid climates provided most ideally by the slopes of Northern India, Sri Lanka, Tibet, and Southern China. This type of tea is consumed predominantly in China, Japan, India, and a number of countries in North Africa and the Middle East (Cooper, 2012; Qadir, 2017; Fig. 1.5). After water, green tea is the most popular flavored and healthy beverage in the world (Jiang et  al., 2013; Chuang et  al., 2017). Different varieties of green tea are available. The main differences between the varieties are due to harvesting time, production procedures, and horticulture (Qadir, 2017). Unlike black tea, which is fermented, green tea is produced in a nonfermented process. After the leaves are picked, they may or may not undergo some processes, which determine whether or not the tea will be green, white, oolong, or black (Cooper, 2012). Archeological evidence actually predates this legend and suggests that tea was first consumed during the early Paleolithic period (about 5000 years ago) (Cooper, 2012). Many people today are taking advantage of the benefits of green tea, which has been used as both a beverage and a medicine historically in most of Asia, China, Japan, Vietnam, Korea, and Thailand. Asians have used green tea to control bleeding, heal wounds, regulate body temperature and blood sugar, and promote digestion (Nakachi et al., 1998; Qadir, 2017). Studies show that the main constituents of green tea are catechin (C), epicatechin (EC), epigallocatechin (EGC), epicatechingallate (ECG), epigallocatechin gallate (EGCG), gallic acid (GA), caffeine, gallocatechin gallate (GCG), theaflavin (TF); theaflavin-3-gallate (TF-3-G), and theaflavin-30-gallate (TF-30-G) (Kao et  al., 2000; Chuang Zhu et al., 2017). Green tea also contains carotenoids; tannins (flavonols); theophylline; theobromine; fats; wax; saponins; essential oils; carotene; vitamins C, A, B1, B12, K, and P; fluoride; iron; magnesium; calcium; strontium; nickel; and copper (Suzuki et  al., 2009; Chuang Zhu et al., 2017).

20  Chapter 1  Functional and Medicinal Properties of Caffeine-Based Common Beverages

EGCG, the main flavonoid in green tea and the most abundant of all the catechins, receives the most attention because it is the main ingredient providing the health benefits of green tea (Zhong et  al., 2001; Qadir, 2017). Green tea has a strong antioxidant property by acting through multiple mechanisms, including free radical scavenging, metal sequestration, and against lipid peroxidation (Fraga et al., 2010; Chuang Zhu et al., 2017; Table 1.3 and Fig. 1.6).

Table 1.3  Main Biological Activities and Bioactive Molecules of Green Tea (Camellia sinensis) Biological activity

Antitumor

Neuroprotective Against diabetes and cardiovascular diseases

Chemical composition

Against age-related macular degeneration Catechin Epicatechin Epigallocatechin Epicatechingallate Epigallocatechin gallate Gallic acid Caffeine Gallocatechingallate Theaflavin and derivatives: Theaflavin-3-gallate Theaflavin-30-gallate Carotenoids Tannins—flavonols Theophylline Theobromine Saponins, essential oils, carotene, and vitamins Minerals

Yang et al. (2009), Yuan (2013), Yiannakopoulou (2014), Rathore and Wang (2012), Rathore et al. (2012), Zeng et al. (2014), Zhou et al. (2014), Cerezo-Guisado et al. (2015), Khan et al. (2009), Connors et al. (2012), and Wang et al. (2014, 2015) Fuso (2013), Nicolia et al. (2015), Mandel et al. (2008), Weinreb et al. (2004), Pinto et al. (2015), and Schimidt et al. (2017) Fraga et al. (2010), Del Rio et al. (2013), Galleano et al. (2013), Abdulkhaleq et al. (2017), Chen et al. (2015), and Grassi et al. (2008) Pan et al. (2016a,b) Kao et al. (2000) and Chuang Zhu et al. (2017)

Suzuki et al. (2009) and Chuang Zhu et al. (2017)

Chapter 1  Functional and Medicinal Properties of Caffeine-Based Common Beverages   21

Fig. 1.6  Main biological properties of green tea.

1.4.2 Green Tea and Cancer One of the most studied beneficial aspects of green tea regarding human health is the case of cancer. Cancer is one of the leading causes of death in the world. It is characterized by the uncontrolled growth of cells in the affected body part where it begins, essentially as a result of mutations that occur in genes that are involved either in cell survival and proliferation, which basically give the cancer cell immortality, or these alterations can affect genes that are implicated in DNA repair, for example. The incidence of new cancer cases is dramatically increasing worldwide in the past decades, especially in the Western world, and modern treatments still deal with a lot of side effects, which give space to studies involving dietary factors as chemopreventive agents or assistants in the case of cancer management. It is well known that dietary components can considerably influence human cancer risk and many of those compounds have been reported to have anticancer or cancer-preventive activities. Green tea has been widely investigated for its protective roles, especially against cancer development. Many studies using several animal models have addressed the inhibitory activities of isolated green tea polyphenols and/or green tea extract against tumorigenesis at diverse organ sites (Yang et  al., 2009). Mechanisms of action of tea polyphenols,

22  Chapter 1  Functional and Medicinal Properties of Caffeine-Based Common Beverages

­ articularly EGCG, have been broadly explored for numerous cancer p types in vitro and in vivo, such as breast, prostate, lung, and colon cancers (Yuan, 2013). Several studies have postulated that especially catechins, found in high amounts in green tea, could modulate breast cell carcinogenesis (Yiannakopoulou, 2014). These results were found based on in vitro studies in which immortalized human MCF10A breast epithelial cells were exposed to very small concentrations of environmental carcinogens to induce carcinogenesis. Further, these cells were also treated with green tea catechins at physiologically levels and it was shown that these phytochemicals were able to suppress chronically induced cellular carcinogenesis due to a combination of biological activities, such as blockage of DNA damage, cell proliferation, and carcinogen-induced ROS elevation (Rathore and Wang, 2012; Rathore et al., 2012). Isolated EGCG, the major component of green tea, was shown to increase cell death and inhibit cell proliferation of breast cancer cells in vitro (Zeng et al., 2014). In addition, EGCG modulation of microRNA (miRNA) seems to play a key role in the inhibition of tobacco ­carcinogen-induced lung tumors in  vivo, suggesting that miRNA-­ mediated regulation is involved in the major aspects of the anticancer activity of EGCG in mice (Zhou et al., 2014). EGCG could potentially be used as a chemotherapeutic agent for colon cancer treatment: EGCG induced cancer cell death by inhibiting Akt, ERK1/2, or alternative p38MAPK activity in vitro (Cerezo-Guisado et al., 2015). There are also some literature data available especially in the past decade, regarding both in  vivo and in  vitro approaches that investigated the effect of green tea or EGCG on DNA methylation and gene expression of enzymes involved in epigenetic modifications such as DNA methyltransferase 1 (DNMT1), suggesting that green tea and its constituents could be exerting their biological effects, such as anticancer activity, through epigenetic modulations (Henning et  al., 2013). The inhibition of growth factor signaling pathways, modification of epigenetic factors, and modulation of oxidative stress for green tea was also observed in animal models of prostate cancer, showing some encouraging chemopreventive effects of green tea and its catechins against prostate cancer (Khan et al., 2009; Connors et al., 2012). Green tea and its main constituents have shown some positive effects as adjuvants in cancer therapy (Fujiki et al., 2015). Currently, despite many treatment efforts, multidrug resistance is still one of the major challenges concerning cancer management. To overcome this issue, there is a growing interest in the use of combinations of natural products to target multiple mechanisms concomitantly. In fact, an increase in anticarcinogenic action was observed when quercetin and green tea were combined in a prostate cancer xenograft mouse model

Chapter 1  Functional and Medicinal Properties of Caffeine-Based Common Beverages   23

(Wang et al., 2014). Another study, performed with castration-resistant prostate cancer cells, showed that green tea and quercetin were able to sensitize and, consequently, enhance the chemotherapeutic effect of docetaxel on those cells through multiple mechanisms including the downregulation of chemoresistance-related proteins (Wang et al., 2015). Taking this information into account, the use of green tea or its isolated compounds could alleviate the deleterious side effects of conventional cancer therapies as well as increase their action through additive or synergistic effects (Lecumberri et al., 2013). Despite the many encouraging results towards the use of green tea and its main phytochemicals for chemopreventive purposes, still further investigations need to be performed in order to clarify the proposed mechanisms of action for each cancer type (Lambert, 2013).

1.4.3 Neuroprotective Effects of Green Tea Neurodegenerative diseases represent nowadays a heavy burden for public health worldwide in the sense of socioeconomic costs, once they affect an individual’s functioning and result in disabilities or limit activities, increasing the necessity for medical and personal care. Alzheimer’s and Parkinson’s diseases, among various others, exemplify a difficult challenge in terms of health promotion and disease prevention. In this scenario, many efforts come from the scientific community to discover the underlying mechanisms of these disorders and so new treatment strategies (Alonso et  al., 2011). Increasing evidence suggests that actually environmental factors, such as dietary habits could interfere with neurodegenerative processes through, for example, epigenetic regulation of genes and DNA methylation (Fuso, 2013; Nicolia et al., 2015). Green tea is among the most traditional beverages consumed around the world. Although not every country has the habit of consuming it, other functional beverages, such as black tea, coffee, and yerba mate, are ingested by the population and present very similar basal chemical matrices, rich in catechins and polyphenols. Taking this into consideration, some studies came up with the idea that dietary elements like green tea could be beneficial for the prevention of some neurodegenerative diseases (Mandel et  al., 2008; Weinreb et al., 2004). In a recent study, green tea and its main catechins, EC, and EGCG, were shown to protect against a Parkinson’s disease model in rats. The results indicated that both had the capacity of reverting behavioral changes induced by the Parkinson’s disease model and showed an overall neuroprotective effect by increasing locomotor activity, cognitive functions, and antidepressive outcomes of the disease (Pinto et al., 2015).

24  Chapter 1  Functional and Medicinal Properties of Caffeine-Based Common Beverages

More recently, another investigation explored the neuroprotective effects of green, red, and black tea in an Alzheimer-like rat model. Green and red tea were effective in avoiding memory deficits in an Alzheimer-like model, but green tea also avoided oxidative stress and damage in the hippocampus. However, green tea was more effective in rats with Alzheimer-induced disease than red and black teas (Schimidt et al., 2017).

1.4.4 Green Tea, Diabetes, and Cardiovascular Diseases Diabetes mellitus (DM) is currently one of the main public health challenges, because the number of people with this disorder has more than doubled worldwide in the past three decades. In this sense, there are a lot of concerns about DM, as the cases of T2DM and prediabetes are increasing dramatically among children, adolescents, and younger adults (Chen et al., 2012). Studies show that 90% of diabetes cases belong to T2DM, a chronic metabolic disorder characterized by insulin resistance and high blood glucose levels (hyperglycemia) (WHO, 2000; Kahn et al., 2006). Green tea and its main constituents, such as EC, are being suggested to improve insulin resistance. In fact, some studies suggested the beneficial effects of EC consumption, proposing various cellular mechanisms including insulin-sensitivity adjustment (Fraga et  al., 2010). In addition, EC showed to be helpful to decrease blood pressure. By reducing both insulin resistance and blood pressure, the consumption of EC-containing foods could help to prevent the onset of T2DM and many cardiovascular diseases (Del Rio et al., 2013; Galleano et  al., 2013; Abdulkhaleq et  al., 2017). However, the development of cardiovascular diseases due to insulin sensitivity (as an independent risk factor) is still under debate (Chen et  al., 2015). Nevertheless, EC consumption is indicated to decrease systolic blood pressure and EC-rich green tea was shown to exhibit in vivo antiplatelet effect, a ­cardiovascular-associated risk factor, as determined in a murine model and human subjects (Grassi et al., 2008; Del Rio et al., 2013; Abdulkhaleq et al., 2017).

1.4.5 Green Tea and Age-related Macular Degeneration Aging can cause several age-related disorders such as age-related macular degeneration (AMD). In fact, AMD is the most common cause of visual loss among elderly people in developed countries. The number of AMD cases increases considerably because of aging, affecting about 8.5% to 27.9% of the population more than 75 years

Chapter 1  Functional and Medicinal Properties of Caffeine-Based Common Beverages   25

of age (Soubrane et  al., 2002; Torres et  al., 2009). The incidence of this pathology has dramatically increased in the past decades, about 30%–40%, despite other ophthalmic diseases such as glaucoma and cataracts, reaching the same population range, having shown a reduction in their records (Evans and Wormald, 1996; Torres et al., 2009). Estimates show that by 2020, about 196 million people will be affected worldwide, coming to an estimated number of 288 million people by 2040 (Torres et al., 2009; Wong et al., 2014; Marazita et al., 2016). Some studies suggest that oxidative stress, arising from the excessive production or inefficient neutralization of ROS, caused, for example, due to the exposure to environment factors, could exert a great influence on the retinal pigment epithelium (RPE) and so, to the pathophysiology of AMD (Datta et al., 2017). Green tea is known for its many beneficial biological properties, due to the presence of many constituents with high antioxidant capacity, for example, catechins. In this sense, the effect of green tea consumption and visual impairment in the elderly was analyzed by an epidemiological study performed by Pan et al. (2016a,b). Data obtained from this investigation with 4579 older adults (>60 years) living in a rural community in Eastern China have shown lower occurrence of visual impairment associated with the intake of three or more glasses of green tea per day. These results demonstrate that green tea could be a powerful ally in the prevention of ocular diseases, such as AMD, promoting a better quality of life for elderly people.

1.5  Yerba Mate (Ilex paraguariensis) 1.5.1  Yerba Mate Chemical Constituents and Main Biological Activities Ilex paraguariensis is a plant localized in South America, belonging to the Aquifoliaceae family. It is a dioecious evergreen tree, which can grow to a height of up to 8–15 m. The 8-cm long olive-green leaves are perennial, alternate, coriaceous, obovate with slightly crenate dentate margins and obtuse apex, and have a wedge-shaped base. The petioles are up to 15 mm long. The flowering stage occurs during the spring season, producing small, unisexual flowers with four white petals. In some tropical or subtropical species, the number of petals may be five, six, or seven. These may be clustered in groups of 1–15 flowers that appear in the axils of the leaves. The fruits are red-colored berries containing four to five seeds (Bracesco et al., 2011; Fig. 1.7). Starting with yerba leaves, a powder is produced from which a nonalcoholic beverage with very regional characteristics, called “chimarrão” in the south of Brazil, “tereré” in Paraguay, and “mate” in Argentina and Uruguay is originated. This drink is consumed by the

26  Chapter 1  Functional and Medicinal Properties of Caffeine-Based Common Beverages

Fig. 1.7  Yerba mate tea (A) and chimarrão mate tea (B).

population in these countries, with huge cultural, economic, and social importance (Mejia et  al., 2010). Besides, it is used as an energy source, to improve energy for daily activities and as a therapeutic agent due to its pharmacologic properties (Bracesco et al., 2011). The production process of yerba mate involves the harvest of the older leaves of I. paraguariensis, which are dried over a fire, milled, stored, and packed for their commercialization. The industrialization process involves the stages of harvesting, roasting, drying, milling, aging, and final preparation. Especially in the first stages of processing, the leaves could suffer important alterations in the profile and concentration of bioactive compounds, which could modify the biological activities of yerba (Isolabella et al., 2010). The interest on yerba mate has increased mainly because of its phytochemistry composition and biological activities (Cardozo Junior and Morand, 2016). The chemical composition of I. paraguariensis includes several constituents that may be responsible for the numerous recognized biological and pharmacological activities. The compounds found in high quantities are purine alkaloids (methylxanthines such as caffeine and theophylline), polyphenols (CGAs and its derivatives), saponins, and flavonoids (Heck and De Mejia, 2007; Bracesco et al., 2011). The alkaloids, specially methylxanthines, such as caffeine and theobromine (Meinhart et al., 2010) are responsible for the stimulant activity of yerba mate on the brain and increasing the utilization of fat as an energy source (Silva et al., 2011). The saponins found in yerba mate are responsible for the decrease of cholesterol (Ferreira et al., 1997). The phenolic compounds, responsible for the antioxidant activity of yerba mate, are the major constituents and more studied in this plant. These compounds are secondary metabolites, normally involved in defense against UV radiation or aggression of pathogens (Manach et al., 2004). The polyphenol levels in I. paraguariensis extracts are higher than those of green

Chapter 1  Functional and Medicinal Properties of Caffeine-Based Common Beverages   27

tea and parallel to those of red wines (Gugliucci et al., 2009). The phenolics are present, mostly in the form of phenolic acids, as CGAs and flavonoids (Bravo et al., 2007). In a study in 2009, Marques identified esters of CGA in samples of green and toasted yerba mate such as 5-cafeoilquinic, 4-cafeoilquinic, 3-cafeoilquinic, 3,5-dicafeoilquinic, 3,4-dicafeoilquinic, and 4,5-dicafeoilquinic acids. Although the phenolic compounds are being present in the aqueous extract of yerba mate, the bioavailability of these compounds is unknown. In this way, some studies have verified the action of CGAs present in coffee in humans and, due to the similarity with those found in both, extrapolated the action for yerba mate (Monteiro et al., 2007; Duarte and Farah, 2011). The intrinsic activity is low, and they could be absorbed in the intestines or be quickly metabolized and excreted (Manach et al., 2004). When they are absorbed, the phenolics are conjugated in the small intestine and, after this, in the liver, in a process that includes methylation, sulfatation, and glucuronidation (Scalbert and Williamson, 2000; Manach et al., 2004). The bioavailability is variable between phenolics. The metabolites present in blood, results of digestion are, most of the time, different from the intact compounds (Manach et al., 2005). Oliveira et al. (2016) evaluated the metabolization of CGAs from yerba mate in rats and verified that a little parcel of these compounds was sent to the bloodstream; and the cafeoilquinic and dicafeoilquinic acids of yerba mate are absorbed by cells of the gastrointestinal tract, and could be active in these tissues. Besides that, cafeoilquinic acid and intact metabolites of yerba are presents in stomach, small and large intestine, liver, kidneys, muscles, plasma, and urine. Monteiro et  al. (2007) investigated the CGAs bioavailability after the acute consumption of coffee and found six intact types in the plasma, among them being 3-cafeoilquinic acid, 4-cafeoilquinic acid, 5-cafeoilquinic acid, 3,5-dicafeoilquinic acid, 3,4-dicafeoilquinic acid, and 4,5-dicafeoilquinic acid. The authors also observed that urine is not an excretion route for intact CGAs. Although the bioavailability and the effects of each of the I. paraguariensis compounds in plasma and tissues have not yet been clarified in the literature, several biological properties are reported. Among them are antioxidant and antiinflammatory (Miranda et  al., 2008; Berté et  al., 2011; Borges et  al., 2013), regulation of adipogenesis (Arçari et al., 2013), weight reduction and antiobesity properties (Arçari et al., 2009, 2011a; Borges et al., 2013), and reduction of blood lipid levels and atherosclerosis risk factors (Mosimann et  al., 2006; Gao et al., 2013). Some studies have demonstrated significant biological effects in traditional medicine for the treatment of arthritis, rheumatism, and other inflammatory diseases, headache, hypertension,

28  Chapter 1  Functional and Medicinal Properties of Caffeine-Based Common Beverages

hepatic, and digestive disorders (Mosimann et al., 2006), and research has demonstrated its benefits for cardiovascular health (Balzan et al., 2013; Table 1.4 and Fig. 1.8).

1.5.2 Effects of Yerba Mate Extracts on Obesity, Diabetes, and Cardiovascular Health I. paraguariensis has been studied due to its potential beneficial effects on obesity, diabetes, and cardiovascular health, mainly for regulation of oxidative markers and lipid metabolism.

Table 1.4  Main Biological Activities and Bioactive Molecules of Yerba Mate (Ilex paraguariensis) Biological activity

Against obesity, diabetes, and cardiovascular diseases

Antiinflammatory Antitumor

Neuroprotective

Chemical composition

Caffeine Theophylline Saponins Flavonoids Polyphenols—chlorogenic acids and derivatives: 5-cafeoilquinic acid 4-Cafeoilquini acid 3-Cafeoilquinic acid 3,5-Dicafeoilquinic acid 3,4-Dicafeoilquinic acid 4,5-Dicafeoilquinic acid

Yu et al. (2015), Menini et al. (2007), Gugliucci and Bastos (2009), Kim et al. (2015), Gao et al. (2013), Arçari et al. (2011b, 2013), Fujii et al. (2014), Kang et al. (2012), Lima et al. (2014), and Boaventura et al. (2013) Puangpraphant and Mejía (2009), Schubert et al. (2007), Luz et al. (2016), and Carmo et al. (2013) Bracesco et al. (2003), Miranda et al. (2008), Ronco et al. (2016, 2017), and de Mejía et al. (2010) Milioli et al. (2007), Reis et al. (2014), Branco et al. (2013), Colpo et al. (2007), Prediger et al. (2008), Vignes et al. (2006), and Park et al. (2010) Heck and De Mejia (2007) Bracesco et al. (2011) Meinhart et al. (2010) Manach et al. (2004) Marques and Farah (2009) and Bravo et al. (2007)

Chapter 1  Functional and Medicinal Properties of Caffeine-Based Common Beverages   29

Fig. 1.8  Main biological properties of yerba mate.

Yerba mate plays a role in the regulation of several indices of haemorheology, nailfold microcirculation, and platelet aggregating factors (Yu et al., 2015). Studies with I. paraguariensis uncovered a strong protection of ex  vivo human low-density lipoprotein (LDL) from oxidation as well as protection of paraoxonase activity regarding high-density lipoprotein (HDL) (Menini et al., 2007; Gugliucci and Bastos, 2009). Paraoxonase 1 (PON1) is an antioxidant enzyme carried by HDL, which has an atheroprotective effect (Menini et al., 2007; Gugliucci and Bastos, 2009). Besides this, yerba mate may modulate positively the mRNA expression and activity of paraoxonase 2 (PON-2), an intracellular antioxidant enzyme, in monocytes and macrophages, protecting against oxidative stress and the formation of foam cells (Fernandes et al., 2012). Kim et  al. (2015) conducted a randomized, double-blind, ­placebo-controlled trial with obese Korean subjects. For 12 weeks, the subjects were daily supplemented with capsules of yerba mate. The results showed significant decreases in body fat mass, percent body fat, and the waist-hip ratio in the supplemented group compared to the placebo group, suggesting an antiobesogenic effect of I. paraguariensis. In vivo and ex vivo studies reported decreased serum lipid levels in the hyperlipidemic hamster model (Gao et al., 2013) and humans supplemented with yerba mate aqueous extract (Arçari et al., 2011b).

30  Chapter 1  Functional and Medicinal Properties of Caffeine-Based Common Beverages

In the first study, besides this reduction, it was observed that yerba mate treatment increased antioxidant enzyme activity, improved LPL and hepatic lipase activities in serum and liver, and modulated the expression levels of genes involved in lipid oxidation and lipogenesis. In the same way, Arçari et al. (2011b) showed that after 60 days, the yerba mate extract was able to decrease lipid peroxidation products and increase serum total antioxidant status and enzymatic activity of superoxide dismutase (Cu-Zn SOD) for both groups supplemented with yerba mate tea. Aqueous extracts of yerba mate and its major bioactive compounds could modulate adipogenesis and obesity. Arçari et al. (2013) demonstrated that yerba mate extract downregulated the expression of genes that regulate adipogenesis, such as Creb-1 and C/EBPa, and upregulated the expression of genes related to the inhibition of adipogenesis, including Dlk1, Gata2, Gata3, Klf2, Lrp5, Pparc2, Sfrp1, Tcf7l2, Wnt10b, and Wnt3a. In the same way, Pimentel et al. (2013) showed that yerba mate extract intake blunted the pro-inflammatory effects of diet-induced obesity in rats by reducing the phosphorylation of hypothalamic IKK and NFκBp65 expression and increasing the protein levels of IκBα, the expression of adiponectin receptor-1, and consequently the amount of IRS-2. Fujii et al. (2014) reported that treatment of I. paraguariensis dried aqueous extract in male Wistar rats fed with high-fat diet (HFD) reduced body weight gain and total blood cholesterol in comparison to the nontreated group. Besides, yerba mate tea decreased the ratio between phosphorylated and total kinase inhibitor of kB (IKK), increased the ratio of phosphorylated total form of protein kinase B (AKT), and reduced NF-kB phosphorylation in the liver of the HFD group, suggesting a beneficial role of I. paraguariensis in improving metabolic dysfunctions induced by a HFD. In  vivo research showed that I. paraguariensis has positive effects on metabolic alterations, a consequence of obesity, including reductions in serum cholesterol, serum triglycerides, and glucose concentrations (Kang et al., 2012; Lima et al., 2014). Important effects of I. paraguariensis have been reported in diabetes due to increase in the erythrocyte antioxidant glutathione peroxidase (GSH) and a decrease of serum lipid peroxidation, glycemia, and the HbA1c gene in prediabetic subjects (Boaventura et al., 2013). The increase of total antioxidant levels as well as antioxidant enzyme gene expression by yerba mate extract suggests that regular consumption could improve antioxidant defenses by multiple mechanisms, not only by increasing circulating bioactive compounds, but by upregulation of cellular enzymatic machinery to counter oxidative stress.

Chapter 1  Functional and Medicinal Properties of Caffeine-Based Common Beverages   31

1.5.3 Effects of Yerba Mate Extracts on Inflammation In traditional medicine, I. paraguariensisis is used to treat many diseases including inflammatory-related diseases. However, the mechanism and the compounds involved in this effect are not yet known precisely. Some studies reported that the combination of quercetin and saponins of yerba mate resulted in synergistic interaction inhibiting both nitric oxide and prostaglandin 2 (PGE2) production (Puangpraphant and Mejía, 2009; Schubert et al., 2007). In a study performed by Luz et  al. (2016), the antiinflammatory property of I. paraguariensis (crude extract—CE) and its related fractions—buthanolic (BF) and aqueous residue (ARF)—and its major compounds caffeine (CAF), rutin (RUT), and CGA were tested in an in vivo model of pleurisy. All the fractions were able to reduce leukocyte migration, concentration of myeloperoxidase (MPO), adenosine desaminase (ADA) activities, and nitric oxide levels. Moreover, I. paraguariensis also inhibited the release of Th1/Th17 pro-inflammatory cytokines, while increasing IL-10 production and improving the histological architecture of inflamed lungs. In addition, its major compounds decreased p65 NF-κB phosphorylation. On the same hand, Carmo et al. (2013) investigated the effects of yerba mate consumption on the hematological response and the production of inflammatory and antiinflammatory interleukins by bone marrow cells from Wistar rats fed with HFD. The data showed that yerba mate reduced pro-inflammatory interleukines IL-1α, IL-6, and TNF-α production by the cells. Similar results were found with macrophages of rats submitted to HFD and HFD plus yerba mate (Borges et al., 2013).

1.5.4 Effects of Yerba Mate Extracts on Mutagenesis Conversely, many studies in cell culture models as well as in animals seem to converge to show an antimutagenic and DNA-protecting effect for I. paraguariensis extracts and its major components CGA, rutin, and quercetin (Bracesco et al., 2003; Miranda et al., 2008). The regular ingestion of yerba mate tea increased the resistance of DNA to hydrogen peroxide-induced DNA strand breaks and improved DNA repair after hydrogen peroxide challenge in liver cells, independently of the dose ingested. These results suggest that yerba mate could protect against DNA damage and enhance DNA repair activity. Protection may be attributed to the antioxidant activity of the yerba mate bioactive compounds CGA, rutin, and quercetin (Bracesco et al., 2003; Miranda et al., 2008).

32  Chapter 1  Functional and Medicinal Properties of Caffeine-Based Common Beverages

In recent case-control studies, strong inverse associations between high “mate” intake and breast cancer were reported (Ronco et  al., 2016, 2017). Besides this, an in  vitro study showed that yerba mate tea inhibited 50% of net growth of human colorectal adenocarcinoma cells CaCo-2 and HT-29 when compared with the CCD-33Co normal colon fibroblast cell line. Yerba mate inhibited in  vitro colon cancer cell proliferation possibly mediated via pro-oxidant activities; therefore, it represents a potential source of chemopreventive agents (de Mejía et al., 2010). However, some epidemiological studies indicate that there is an association between hot water mate consumption and oropharyngeal and esophagus cancers (Loria et  al., 2009; Dasanayake et  al., 2010; Stefani et al., 2011). The effects may be related mainly to the temperature of the infusion (Ramirez-Mares et  al., 2004). At the same time, high levels of carcinogenic polycyclic aromatic hydrocarbons (PAH) have been found in yerba mate tea due to the manufacturing process of leaves (drying) using firewood (Kamangar et al., 2008; Dasanayake et al., 2010; Golozar et al., 2012).

1.5.5 Effects of Yerba Mate Extracts on Neurological Health Although I. paraguariensis preparations are traditionally and widely used as stimulating beverages, many neuropharmacological properties are reported such as antiparkinsonian-like (Milioli et  al., 2007), antidepressant-like (Reis et al., 2014), anticonvulsant (Branco et  al., 2013), neuroprotection of memory impairment (Colpo et  al., 2007), and cognitive enhancer (Prediger et al., 2008). The renowned effects of I. paraguariensis are mainly attributed to the levels of caffeine in this plant species, this substance being described as anxiogenic (El Yacoubi et al., 2000), although it appears contradictory that a beverage containing caffeine, a stimulant compound, would have anxiolytic-like features. In this regard, studies demonstrated that the known stimulant plant Panax ginseng promoted an anxiolytic-like effect attributed to saponin constituents (Carr et al., 2006). Plant extracts comprise hundreds of substances and it is possible that compounds as flavonoids (Herrera-Ruiz et al., 2008) and saponins (Wei et  al., 2007) could be responsible for the anxiolytic activity of I. paraguariensis, surpassing the anxiogenic effect of caffeine. In addition, the polyphenol (-)-EGCG present in I. paraguariensis was described as an anxiolytic molecule and is able to antagonize the anxiogenic effect of caffeine (Vignes et al., 2006; Park et al., 2010).

Chapter 1  Functional and Medicinal Properties of Caffeine-Based Common Beverages   33

1.6 Conclusion Many functional and medicinal beverages have been studied to treat several diseases. Coffee (Coffea arabica), black/green tea (Camellia sinensis), and yerba mate (Ilex paraguariensis) are remarkable functional and medicinal beverages, since they present many bioactive molecules in their chemical matrix. Previous studies reported that these plants present several biological activities. For instance, caffeine is able to decrease the production of β-amyloid protein levels and increase dopamine levels. Moreover, it presents anticancer activity by stimulating the apoptosis pathway, antioxidant activity by reducing oxidative stress, insulin sensitivity adjustment, and modulates the immune system. In addition, black and green tea are considerate remarkable antioxidant plants by neutralizing EROs, as well as they present anticancer activity, antiplatelet effect, insulin sensitivity adjustment and avoid memory deficits, oxidative stress, and damage in the hippocampus. In addition, yerba mate avoids memory deficits, acts as an antidepressant and anticonvulsant, inhibits nitric oxide, prostaglandin 2 (PGE2), and pro-inflammatory cytokines production, decreases LDL, increases HDL and antioxidant enzymes, protects against DNA damage and enhances DNA repair activity, as well as downregulates the expression of genes that modulate adipogenesis. Therefore, the frequent intake of these functional beverages can contribute to a healthier life.

References Abdulkhaleq, L.A., Assi, M.A., Noor, M.H.M., Abdullah, R., Saad, M.Z., Taufiq-Yap, Y.H., 2017. Therapeutic uses of epicatechin in diabetes and cancer. Vet. World 10 (8), 869–872. Akash, M.S.H., Rehman, K., Chen, S., 2014. Effects of coffee on type 2 diabetes mellitus. Nutrition 30 (7–8), 755–763. Akter, S., et al., 2016. Coffee drinking and colorectal cancer risk: an evaluation based on a systematic review and meta-analysis among the Japanese population. Jpn. J. Clin. Oncol. 46 (8), 781–787. Alonso, J., et al., 2011. Days out of role dueto common physical and mental conditions: results from the WHO World Mental Health surveys. Molecular Psychiatry 16 (12), 1234–1246. Andreazza, A.C., Frey, B.N., Erdtmann, B., Salvador, M., Rombaldi, F., Santin, A., Gonçalves, C.A., Kapczinski, F., 2007. DNA damage in bipolar disorder. Psychiatry Res. 153, 27–32. Andreazza, A.C., Shao, L., Wang, J.-F., Young, L.T., 2010. Mitochondrial complex I activity and oxidative damage to mitochondrial proteins in the prefrontal cortex of patients with bipolar disorder. Arch. Gen. Psychiatry 67, 360–368. Andreazza, A.C., Wang, J.F., Salmasi, F., Shao, L., Young, L.T., 2013. Specific subcellular changes in oxidative stress in prefrontal cortex from patients with bipolar disorder. J. Neurochem. 127 (4), 552–561. Arçari, D.P., Porto, V.B., Rodrigues, E.R.V., Martins, F., de Lima, R.J., Sawaya, A.C.H.F., Ribeiro, M.L., Carvalho, P.O., 2009. Antiobesity effects of yerba maté extract (Ilex paraguariensis) in highfat diet-induced obese mice. Obesity 17 (12), 2127–2133.

34  Chapter 1  Functional and Medicinal Properties of Caffeine-Based Common Beverages

Arçari, D.P., Porto, V.B., Rodrigues, E.R.V., Martins, F., de Lima, R.J., Sawaya, A.C.H.F., Ribeiro, M.L., Carvalho, P.O., 2011a. Anti-inflammatory effects of yerba maté extract (Ilex paraguariensis) ameliorate insulin resistance in mice with high fat diet-­ induced obesity. Mol. Cell. Endocrinol. 335 (2), 110–115. Arçari, D.P., Porto, V.B., Rodrigues, E.R.V., Martins, F., de Lima, R.J., Sawaya, A.C.H.F., Ribeiro, M.L., Carvalho, P.O., 2011b. Effect of mate tea (Ilex paraguariensis) supplementation on oxidative stress biomarkers and LDL oxidisability in normo and hyperlipidaemic humans. J. Funct. Foods 3, 190–197. Arçari, D.P., Santos, J.C., Gambero, A., Ribeiro, M.L., 2013. The in vitro and in vivo effects of yerba mate (Ilex paraguariensis) extract on adipogenesis. Food Chem. 141 (2), 809–815. Arendash, G.W., et al., 2006. Caffeine protects Alzheimer’s mice against cognitive impairment and reduces brain beta-amyloid production. Neuroscience 142 (4), 941–952. Ascherio, A., et  al., 2003. Caffeine, postmenopausal estrogen, and risk of Parkinson’s disease. Neurology 60 (5), 790–795. Atkin, T.A., Macaskill, A.F., Brandon, N.J., Kittler, J.T., 2011. Disrupted in Schizophrenia-1 regulates intracellular trafficking of mitochondria in neurons. Mol. Psychiatry 16, 122–124. Bai, K., et  al., 2016. Coffee consumption and risk of hepatocellular carcinoma: a ­meta-analysis of eleven epidemiological studies. Onco. Targets Ther. 9, 4369–4375. Balkwill, F.R., Mantovani, A., 2012. Cancer-related information: common themes and therapeutic opportinities. Semin. Cancer Biol. 22, 33–40. Balzan, S., Hernandes, A., Reichert, C.L., Donaduzzi, C., Pires, V.A., Gasparotto, A.J., Cardozo, E.J., 2013. Lipid lowering effects of standardized extracts of Ilex paraguariensisin high-fat-diet rats. Fitoterapia 86, 115–122. Baratloo, A., et al., 2016. The role of caffeine in pain management: a brief literature review. Anesth. Pain Med. 6 (3), 33193. Barcirova, M., 2010. Comparison of the antioxidant capacity and the antimicrobial activity of black and green tea. Food Res. Int. 43, 1379–1382. Basha, S.J., Shetty, N.R., Devarbhavi, H., 2016. Pernicious anaemia with gastric carcinoids. J. Assoc. Physicians India 64, 76–77. Bedran, T.B.L., Morin, M., Spolidorio, D.P., Grenier, D., 2015. Black tea extract and its theaflavin derivatives inhibit the growth of periodonto pathogens and modulate interleukin-8 and β-Defensin secretion in oral epithelial cells. PLoS One 10 (11), e0143158. Berté, K.A., Beux, M.R., Spada, P.K., Salvador, M., Hoffmann-Ribani, R., 2011. Chemical composition and antioxidant activity of yerba-mate (Ilex paraguariensis A.St.-Hil., Aquifoliaceae) extract as obtained by spray drying. J. Agric. Food Chem. 59, 5523–5527. Bettelli, E., Carrier, Y., Gao, W., Korn, T., Strom, T.B., Oukka, M., Weiner, H.L., Kuchroo, V.K., 2006. Reciprocal developmental pathways for the generationof pathogenic effector TH17 and regulatory T cells. Nature 442, 235–238. Bhattacharya, U., Giri, A.K., 2013. Antimutagenic activities of tea and its polyphenols, in bacterial test systems, in bacterial test systems. Tea Health Dis. Prev. 45, 539–550. Boaventura, B.C.B., Di Pietro, P.F., Klein, G.A., Stefanuto, A., Morais, E.C., Andrade, F., Wazlawik, E., da Silva, E.L., 2013. Antioxidant potential of mate tea (Ilex paraguariensis) in type 2 diabetic mellitus and pre-diabetic individuals. J. Funct. Foods 5, 1057–1064. Borges, M.C., Vinolo, M.L., Nakajima, K., Castro, I.A., Bastos, D.L.M., Borelli, P., Fock, R.A., Tirapegui, J., Curi, R., Rogero, M.M., 2013. The effect of mate tea (Ilex paraguariensis) on metabolic and inflammatory parameters in high-fat diet-fed Wistar rats. Int. J. Food Sci. Nutr. 64 (5), 561–569.

Chapter 1  Functional and Medicinal Properties of Caffeine-Based Common Beverages   35

Bracesco, N., Dell, M., Rocha, A., Behtash, S., Menini, T., Gugliucci, A., Nunes, E., 2003. Antioxidant activity of a botanical extract preparation of Ilex paraguariensis: prevention of DNA double-strand breaks in Saccharomyces cerevisiaeand human low-density lipoprotein oxidation. J. Altern. Complement. Med. 9 (3), 379–387. Bracesco, N., Sanchez, A.G., Contreras, V., Menini, T., Gugliucci, A., 2011. Recent advances on Ilex paraguariensisresearch: mini review. J. Ethnopharmacol. 136 (3), 378–384. Branco, C.S., Scola, G., Rodrigues, A.D., Cesio, V., Laprovitera, M., Heinzen, H., Dos Santos, M.T., Fank, B., de Freitas, S.C., Coitinho, A.S., Salvador, M., 2013. Anticonvulsant, neuroprotective and behavioral effects of organic and conventional yerba mate (Ilex paraguariensis St. Hil.) on pentylenetetrazol-induced seizures in Wistar rats. Brain Res. Bull. 92, 60–68. Bravo, L., Goya, L., Lecumberri, E., 2007. LC/MS characterization of phenolic constituents of mate (Ilex paraguariensis, St. Hil.) and its antioxidant activity compared to commonly consumed beverages. Food Res. Int. 40, 393–405. Brown, N.C., Andreazza, A.C., Young, L.T., 2014. An updated meta-analysis of oxidative stress markers in bipolar disorder. Psychiatry Res. 218, 61–68. Cadoná, F.C., Machado, A.K., Montano, M.A.E., Assmann, C.E., Cruz, I.B.M., 2017. Overview of locally advanced breast cancer: a huge challenge to science. Int. J. Women Health Wellness 3, 1–5. Camargo, L.E.A., 2011. Avaliação das atividades antioxidante e antifúngica da Camellia sinensis (L.) Kuntze obtida por diferentes formas de produção. Dissertação (Mestrado em Ciências Farmacêuticas) Universidade Estadual do Centro-Oeste do ParanáGuarapuava. Cardozo-Junior, E.L., Morand, C., 2016. Interest of mate (Ilex paraguariensis A. St.-Hil.) as a new natural functional food to preserve human cardiovascular health—a review. J. Funct. Foods 21, 440–454. Carmo, L.S., Rogero, M.M., Cortez, M., Yamada, M., Jacob, P.S., Bastos, D.H.M., Borelli, P., Fock, R.A., 2013. The effects of yerba maté (Ilex paraguariensis) consumption on IL-1, IL-6, TNF-αand IL-10 production by bone marrow cells in wistar rats fed a high-fat diet. Int. J. Vitam. Nutr. Res. 83 (1), 26–35. Carr, M.N., Bekku, N., Yoshimura, H., 2006. Identification of anxiolytic ingredients in ginseng root using the elevated plus-maze test in mice. Eur. J. Pharmacol. 531, 160–165. Cerezo-Guisado, M.I., Zur, R., Lorenzo, M.J., Risco, A., Martín-Serrano, M.A., AlvarezBarrientos, A., Cuenda, A., Centeno, F., 2015. Implication of Akt, ERK1/2 and alternative p38MAPK signalling pathways in human colon cancer cell apoptosis induced by green tea EGCG. Food Chem. Toxicol. 84, 125–132. Chan, E.W.C., Soh, E.Y., Tie, P.P., Law, Y.P., 2011. Antioxidant and antibacterial properties of green, black, and herbal teas of Camellia sinensis. Pharm. Res. 3, 266–272. Chang, K., 2015. World Tea Production and Trade: Current and Future Development. Food and Agriculture Organization of the United Nation (FAO), Rome. Charehsaz, M., Sipahi, H., Giri, A.K., Aydin, A., 2017. Antimutagenic and anticlastogenic effects of Turkish Black Tea on TA98 and TA100 strains of Salmonella typhimurium (in vitro) and mice (in vivo). Pharm. Biol. 55, 1202–1206. Chaturvedi, R.K., Shukla, K., Seth, S., Chauhan, C., Sinha, Y., Shukla, Y., Agrawal, A.K., 2016. Neuroprotective and neurorescue effect of black tea extract in 6-­hydroxydopamine-lesioned rat model of Parkinson’s disease. Neurobiol. Dis. 22, 421–434. Chen, G.Y., Nuñez, G., 2010. Sterile inflammation: sensing and reacting to damage. Nat. Rev. Immunol. 10, 826–837. Chen, L., Magliano, D.J., Zimmet, P.Z., 2012. The worldwide epidemiology of type 2 diabetes mellitus—present and future perspectives. Nat. Rev. Endocrin. 8, 228–236. Chen, L., Chen, R., Wang, H., Liang, F., 2015. Mechanisms linking inflammation to insulin resistance. Int. J. Endocrinol. 508409.

36  Chapter 1  Functional and Medicinal Properties of Caffeine-Based Common Beverages

Chuang, Z., et al., 2017. Comparative effects of green and black tea extracts on lowering serum uric acid in hyperuricemic mice. Pharm Biol. 55 (1), 2123–2128. Colpo, G., Trevisol, F., Teixeira, A.M., Fachinetto, R., Pereira, R.P., Athayde, M.L., Rocha, J.B., Burger, M.E., 2007. Ilex paraguariensis has antioxidant potential and attenuates haloperidol induced orofacial dyskinesia and memory dysfunction in rats. Neurotox. Res. 12, 171–180. Connors, S.K., Chornokur, G., Kumar, N.B., 2012. New insights into the mechanisms of green tea catechins in the chemoprevention of prostate cancer. Nutr. Cancer 64 (1), 4–22. Cooper, R., 2012. Green tea and theanine: health benefits. Int. J. Food Sci. Nutr. 63 (S1), 90–97. Crozier, T.W.M., et al., 2012. Espresso coffees, caffeine and chlorogenic acid intake: potential health implications. Food Funct. 3 (1), 30–33. Cruvinel, W.M., et al., 2010. Immune system – Part I. Fundamentals of innate immunity with emphasis on molecular and cellular mechanisms of inflammatory response. Rev. Bras. Reumatol. 50 (4). Da Costa, L.A., Badawi, A., El-Sohemy, A., 2012. Nutrigenetics and modulation of oxidative stress. Ann. Nutr. Metab. 60, 27–36. Da Silva, P.M., 2013. Tea: a new perspective on health benefits. Food Res. Int. 53, 558–567. Dall’lgna, O.P., et  al., 2003. Neuroprotection by caffeine and adenosine a 2A receptor blockade of β-amyloid neurotoxicity. Br. J. Pharmacol. 138 (7), 1207–1209. Dasanayake, A.P., Silverman, A.J., Warnakulasuriya, S., 2010. Maté drinking and oral and oro-pharyngeal cancer: a systematic review and meta-analysis. Oral Oncol. 46, 82–86. Datta, S., Cano, M., Ebrahimi, K., Wang, L., Handa, J.T., 2017. The impact of oxidative stress and inflammation on RPE degeneration in non-neovascular AMD. Prog. Retin. Eye Res. 17, 30012–30015. Davis, J.M., et al., 2003. Central nervous system effects of caffeine and adenosine on fatigue. Am. J. Physiol. Regul. Integr. Comp. Physiol. 284 (2), R399–R404. de Mejía, E.G., Song, Y.S., Heck, C.I., Ramírez-Mares, M.V., 2010. Yerba mate tea (Ilex paraguariensis): phenolics, antioxidant capacity and in  vitro inhibition of colon cancer cell proliferation. J. Funct. Foods 2, 23–34. Del Rio, D., Rodriguez-Mateos, A., Spencer, J.P., Tognolini, M., Borges, G., Crozier, A., 2013. Dietary (poly) phenolics in human health: structures, bioavailability, and evidence of protective effects against chronic diseases. Antioxid. Redox Signal. 18 (14), 1818–1892. Ding, M., et al., 2014. Caffeinated and decaffeinated coffee consumption and risk of type 2 diabetes: a systematicreview and a dose-response meta-analysis. Diabetes Care 37 (2), 569–586. Duarte, G.S., Farah, A., 2011. Effect of simultaneous consumption of milk and coffee on chlorogenic acids bioavailability in humans. J. Agric. Food Chem. 59 (14), 7925–7931. Dufresne, C.J., Farnworth, E.R., 2001. A review of latest research findings on the health promotion properties of tea. J. Nutr. Biochem. 12, 404–421. El Yacoubi, M., Ledent, C., Menard, J.F., Parmentier, M., et al., 2000. The stimulant effects of caffeine on locomotorbehaviour in mice are mediated through its blockade of adenosine A(2A) receptors. Br. J. Pharmacol. 129, 1465–1473. Emsley, R., Chiliza, B., Asmal, L., Harvey, B.H., 2013. The nature of relapse in schizophrenia. BMC Psychiatry 13 (1), 50. Engelhardt, U.H., 2013. Chemistry of Tea, in Reference Module in Chemistry, Molecular Sciences and Chemical Engineering. Elsevier, Braunschweig, pp. 1–29. Evans, J., Wormald, R., 1996. Is the incidence of registrable age-related macular degeneration increasing? Br. J. Ophthalmol. 80 (1), 9–14. Feng, R., et al., 2005. Inhibition of activator protein-1, NF-κB, and MAPKs and induction of phase 2 detoxifying enzyme activity by chlorogenic acid. J. Biol. Chem. 280 (30), 27888–27895.

Chapter 1  Functional and Medicinal Properties of Caffeine-Based Common Beverages   37

Fernandes, E.S., Machado, M.E.O., Becker, A.M., de Andrade, F., Maraschin, M., da Silva, E.L., 2012. Yerba mate (Ilex paraguariensis) enhances the gene modulation and activity of paraoxonase-2: in vitro and in vivo studies. Nutrition 28 (11–12), 1157–1164. Ferreira, F., Vásquez, A., Guntner, C., Moyna, P., 1997. Inhibition of the passive diffusion of cholic acid by the Ilex paraguariensis A. St. Hil. saponins. Phytother. Res. 11, 79–81. Fraga, C.G., Litterio, M.C., Prince, P.D., Calabró, V., Piotrkowski, B., Galleano, M., 2010. Cocoa flavanols: effects on vascular nitric oxide and blood pressure. J. Clin. Biochem. Nutr. 48 (1), 63–67. Freedman, N.D., Park, Y., Abnet, C.C., Hollenbeck, A.R., Sinha, R., 2012. Association of coffee drinking with total and cause-specific mortality. N. Engl. J. Med. 366 (20), 1891–1904. Fujii, T.M.M., Jacob, P.S., Yamada, M., Borges, M.C., Norde, M.M., Pantaleão, L.C., Oliveira, D.M., Tirapegui, J., Castro, I.A., Borelli, P., Fock, R.A., Rogero, M.M., 2014. Yerba Mate (Ilex paraguariensis) modulates NF-kappaB pathway and AKT expression in the liver of rats fed on a high-fat diet. Int. J. Food Sci. Nutr. 65 (8), 967–976. Fujii, Y., et al., 2015. Ingestion of coffee polyphenols increases postprandial release of the active glucagon-like peptide-1 (GLP-1(7-36)) amide in C57BL/6J mice. J. Nutr. Sci. 4, e9. Fujiki, H., Sueoka, E., Watanabe, T., Suganuma, M., 2015. Synergistic enhancement of anticancer effects on numerous human cancer cell lines treated with the combination of EGCG, other green tea catechins, and anticancer compounds. J. Cancer Res. Clin. Oncol. 141 (9), 1511–1522. Fuso, A., 2013. The ‘golden age’ of DNA methylation in neurodegenerative diseases. Clin. Chem. Lab Med. 51 (3), 523–534. https://doi.org/10.1515/cclm-2012-0618. Galarraga, V., Boffetta, P., 2016. Coffee drinking and risk of lung cancer—a meta-­analysis. Cancer Epidemiol. Biomark. Prev., 25 (6), 951–957. Galleano, M., Bernatova, I., Puzserova, A., Balis, P., Sestakova, N., Pechanova, O., Fraga, C.G., 2013. (–)-Epicatechin reduces blood pressure and improves vasorelaxation in spontaneously hypertensive rats by NO-mediated mechanism. IUBMB Life 65 (8), 710–715. Gan, Y., et al., 2017. Association of coffee consumption with risk of colorectal cancer: a meta-analysis of prospective cohort studies. Oncotarget 8 (12), 18699–18711. Gao, H., Long, Y., Jiang, X., Liu, Z., Wang, D., Zhao, Y., Li, D., Sun, B.L., 2013. Beneficial effects of Yerba Mate tea (Ilex paraguariensis) on hyperlipidemia in high-fat-fed hamsters. Experim. Geront. 48, 572–578. Goel, N., 2017. Neurobehavioral effects and biomarkers of sleep loss in healthy adults. Curr. Neurol. Neurosci. Rep. 17 (11), 89. Goldstein, S., Meyerstein, D., Czapski, G., 1993. The fenton reagents. Free Radic. Biol. Med. 15, 435–445. Golozar, A., Fagundes, R.B., Etemadi, A., Schantz, M.M., Kamangar, F., Abnet, C.C., Dawsey, S.M., 2012. Significant variation in the concentration of carcinogenic polycyclic aromatic hydrocarbons in yerba mate samples by brand, batch, and processing method. Environ. Sci. Technol. 46 (24), 13488–13493. Gough, D.R., Cotter, T.G., 2011. Hydrogen peroxide: a Jekyll and Hyde signalling molecule. Cell Death Dis. 2 (10), e213. Grassi, D., Desideri, G., Necozione, S., Lippi, C., Casale, R., Properzi, G., Ferri, C., 2008. Blood pressure is reduced and insulin sensitivity increased in glucose-intolerant, hypertensive subjects after 15 days of consuming high-polyphenol dark chocolate. J. Nutr. 138 (9), 1671–1676. Greenberg, J.A., Boozer, C.N., Geliebter, A., 2006. Coffee, diabetes, and weight control. Am. J. Clin. Nutr. 84 (4), 682–693. Gugliucci, A., Bastos, D.H., 2009. Chlorogenic acid protects paraoxonase 1 activity in highdensity lipoprotein from inactivation caused by physiological concentrations of hypochlorite. Fitoterapia 80, 138–142.

38  Chapter 1  Functional and Medicinal Properties of Caffeine-Based Common Beverages

Gugliucci, A., Bastos, D.H., Schulze, J., Souza, M.F., 2009. Caffeic and chlorogenic acids inIlex paraguariensis extracts are the main inhibitors of AGE generation by methylglyoxal in model proteins. Fitoterapia. 80 (6), 339–344. Haslam, E., 2003. Thoughts on thearubigins. Phytochemistry 64, 61–73. Hayat, K., Iqbal, H., Malik, U., Bilal, U., Mushtaq, S., 2015. Tea and its consumption: benefits and risks. Crit. Rev. Food Sci. Nutr. 55, 939–954. Heck, C.I., de Mejia, E.G., 2007. Yerba mate tea (Ilex paraguariensis), a comprehensive review on chemistry, health implications, and technological considerations. J. Food Sci. 72, 138–151. Henning, S.M., Wang, P., Carpenter, C.L., Heber, D., 2013. Epigenetic effects of green tea polyphenols in cancer. Epigenomics 5 (6), 729–741. Herrera-Ruiz, M., Roman-Ramos, R., Zamilpa, A., Tortoriello, J., Jimenez-Ferrer, J.E., 2008. Flavonoids from Tiliaamericana with anxiolytic activity in plus-maze test. J. Ethnopharmacol. 118, 312–317. Higdon, J.V., Frei, B., 2006. Coffee and health: a review of recent human research. Crit. Rev. Food Sci. Nutr. 46 (2), 101–123. Hoffman, J.R., et al., 2006. Thermogenic effect from nutritionally enriched coffee consumption. J. Int. Soc. Sports Nutr. 3 (1), 35. Hori, A., et al., 2014. Coffee intake is associated with lower levels of oxidative DNA damage and decreasing body iron storage in healthy women. Nutr. Cancer 66 (6), 964–969. Huang, W., Zhang, X., Chen, W., 2016. Role of oxidative stress in Alzheimer’s disease (review). Biomed. Rep., 4 (5), 519–522. Isolabella, S., Cogoi, L., López, P., Anesini, C., Ferraro, G., Filip, R., 2010. Study of the bioactive compounds variation during yerba mate (Ilex paraguariensis) processing. Food Chem. 122, 695–699. Ivanov, I.I., Mckenzie, B.S., Zhou, L., Tadokoro, C.E., Lepelley, A., Lafaille, J.J., Cua, D.J., Littman, D.R., 2006. The orphan nuclear receptor RORgammat directs the differentiation program of proinflammatory IL-17+ T helper cells. Cell 126, 1121–1133. Jiang, W., Wu, Y., Jiang, X., 2013. Coffee and caffeine intake and breast cancer risk: an updated dose-response meta-analysis of 37 published studies. Gynecol. Oncol. 129 (3), 620–629. Joghataie, M.T., et  al., 2004. Protective effect of caffeine against neurodegeneration in a model of Parkinson’s disease in rat: behavioral and histochemical evidence. Parkinsonism Relat. Disord. 10 (8), 465–468. Judd, L.L., Schettler, P.J., Akiskal, H.S., Coryell, W., Leon, A.C., Maser, J.D., Solomon, D.A., 2008. Residual symptom recovery from major affective episodes in bipolar disorders and rapid episode relapse/recurrence. Arch. Gen. Psychiatry 65 (4), 386–394. Jung, S., et al., 2017. Cellular antioxidant and anti-inflammatory effects of coffee extracts with different roasting levels. J. Med. Food 20 (6), 626–635. Kahn, S.E., Hull, R.L., Utzschneider, K.M., 2006. Mechanisms linking obesity to insulin resistance and type 2 diabetes. Nature 444, 840–846. Kamangar, F., Schantz, M.M., Abnet, C.C., Fagundes, R.B., Dawsey, S.M., 2008. High levels of carcinogenic polycyclic aromatic hydrocarbons in mate drinks. Cancer Epidemiol. Biomark. Prev. 17, 1262–1268. Kang, Y.R., Lee, H.Y., Kim, J.H., Moon, D.I., Seo, M.Y., Park, S.H., Choi, K.H., Kim, C.R., Kim, S.H., Oh, J.H., Cho, S.W., Kim, S.Y., Kim, M.G., Chae, S.W., Oh, H.G., 2012. Antiobesity and anti-diabetic effects of yerba mate (Ilex paraguariensis) in C57Bl/6J mice fed a high-fat diet. Lab. Anim. Res. 28, 23–29. Kao, Y.H., Hiipakka, R.A., Liao, S., 2000. Modulation of endocrine systems and food intake by green tea epigallocatechin gallate. Endocrinology 141 (3), 980–987. https:// doi.org/10.1210/endo.141.3.7368. Kempf, K., Herder, C., Erlund, I., 2010. Effects of coffee consumption on subclinical inflammation and other risk factors for type 2 diabetes: a clinical trial. Am. J. Clin. Nutr. 91 (2), 950–957.

Chapter 1  Functional and Medicinal Properties of Caffeine-Based Common Beverages   39

Klatsky, A.L., Armstrong, M.A., Friedman, G.D., 1993. Coffee, tea, and mortality. Ann. Epidemiol. 3 (4), 375–381. Khan, N., Adhami, V.M., Mukhtar, H., 2009. Review: green tea polyphenols in chemoprevention of prostate cancer: preclinical and clinical studies. Nutr. Cancer 61 (6), 836–841. Khanum, H., Faiza, S., Sulochanamma, G., Borse, B.B., 2017. Quality, antioxidant activity and composition of Indian black teas. J. Food Sci. Technol. 54, 1266–1272. Kidane, D., Chae, W.J., Czochor, J., Eckert, K.A., Glazer, P.M., Bothwell, A.L., Sweasy, J.B., 2014. Interplay between DNA repair and inflammation, and the link to cancer. Crit. Rev. Biochem. Mol. Biol. 49, 116–139. Kim, S.Y., Mi-Ra, O., Kim, M.G., Chae, H.J., Chae, S.W., 2015. Anti-obesity effects of Yerba Mate (Ilex paraguariensis): a randomized, double-blind, placebo-controlled clinical trial. Complement. Altern. Med. 15, 338. Kim, H.K., Andreazza, A.C., Elmi, N., Chen, W., Young, L.T., 2016. Nod-like receptor pyrin containing 3 (NLRP3) in the post-mortem frontal cortex from patients with bipolar disorder: a potential mediator between mitochondria and immune-­activation. J. Psychiatr. Res. 72, 43–50. Kirkinezos, I.G., Moraes, C.T., 2001. Reactive oxygen species and mitochondrial diseases. Semin. Cell Dev. Biol. 12, 449–457. Kleemola, P., et al., 2000. Coffee consumption and the risk of coronary heart disease and death. Arch. Intern. Med. 160 (22), 3393. Lahiry, L., Saha, B., Chakraborty, J., Adhikary, A., Mohanty, S., Hossain, D.M., Banerjee, S., Das, K., Sa, G., Das, T., 2010. Theaflavins target Fas/caspase-8 and Akt/pBad pathways to induce apoptosis in p53-mutated human breast cancer cells. Carcinogenesis 31 (2), 259–268. Lambert, J.D., 2013. Does tea prevent cancer? Evidence from laboratory and human intervention studies. Am. J. Clin. Nutr. (October 30). https://doi.org/10.3945/ ajcn.113.059352. Lecumberri, E., Dupertuis, Y.M., Miralbell, R., Pichard, C., 2013. Green tea polyphenol epigallocatechin-3-gallate (EGCG) as adjuvant in cancer therapy. Clin. Nutr. 32 (6), 894–903. Liesa, M., Shirihai, O.S., 2013. Mitochondrial dynamics in the regulation of nutrient utilization and energy expenditure. Cell Metab. 17, 491–506. Lima, N.S., Franco, J.G., Peixoto-Silva, N., Maia, L.A., Kaezer, A., Felzenszwalb, I., de Oliveira, E., de Moura, E.G., Lisboa, P.C., 2014. Ilex paraguariensis (yerba mate) improves endocrine and metabolic disorders in obese rats primed by early weaning. Eur. J. Nutr. 53, 73–82. Liu, H., et  al., 2015. Coffee consumption and prostate cancer risk: a meta-analysis of cohort studies. Nutr. Cancer 5581, 1–9. Liu, J., et al., 2016. Higher caffeinated coffee intake is associated with reduced malignant melanoma risk: a meta-analysis Study. PLoS One 11 (1), 1–14. Loria, D., Barrios, E., Zanetti, R., 2009. Cancer and yerba mate consumption: a review of possible associations. Rev. Panam. Salud Publica 25, 530–539. Lucas, M., et  al., 2014. Coffee, caffeine, and risk of completed suicide: results from three prospective cohorts of American adults. World J. Biol. Psychiatry. 15 (5), 377–386. Luczaj, W., Skrzydlewska, E., 2005. Antioxidative properties of black tea. Prev. Med. 40, 910–918. Luz, A.B.G., da Silva, C.H.B., Nascimento, M.V.P.S., Facchin, B.M.C., Baratto, B., Fröde, S., Reginatto, F.H., Dalmarco, E.M., 2016. The anti-inflammatory effect of Ilex paraguariensis A. St. Hil (Mate) in a murine model of pleurisy. Int. Immunopharmacol. 36, 165–172. Maia, L., De Mendonc, A., 2002. Does caffeine intake protect from Alzheimer’s disease? Eur. J. Neurol. 9 (4), 377–382.

40  Chapter 1  Functional and Medicinal Properties of Caffeine-Based Common Beverages

Malkus, K.A., Tsika, E., Ischiropoulos, H., 2009. Oxidative modifications, mitochondrial dysfunction, and impaired protein degradation in Parkinson’s disease: how neurons are lost in the Bermuda triangle. Mol. Neurodegener. 4, 1–16. Malongane, F., Mcgaw, L.J., Mudau, F.N., 2017. The synergistic potential of various tea herbs and therapeutic drugs in health improvement: a review. J. Sci. Food Agric. 97, 4679–4689. Manach, C., Scalbert, A., Morand, C., Rémésy, C., Jimenéz, L., 2004. Polyphenols: food sources and bioavailability. Am. J. Clin. Nutr. 79, 727–747. Manach, C., Williamson, G., Morand, C., Scalbert, A., Rémésy, C., 2005. Bioavailability and bioefficacy of polyphenols in humans. I. review of 97 bioavailability studies. Am. J. Clin. Nutr. 81, 230–242. Mandel, S.A., Amit, T., Kalfon, L., Reznichenko, L., Youdim, M.B., 2008. Targeting multiple neurodegenerative diseases etiologies with multimodal-acting green tea catechins. J. Nutr. 138 (8), 1578S–1583S. Marazita, M.C., et  al., 2016. Oxidative stressinduced premature senescence dysregulates VEGF and CFH expression in retinal pigment epithelial cells: Implications for age-related macular degeneration. RedoxBiology 7, 78–87. Marques, V., Farah, A., 2009. Chlorogenic acids and related compounds in medicinal plants and infusions. Food Chem. 113, 1370–1376. Mbuthia, K.S., Mireji, P.O., Ngure, R.M., Stomeo, F., Kyallo, M., Muoki, C., Wachira, F.N., 2017. Tea (Camellia sinensis) infusions ameliorate cancer in 4TI metastatic breast cancer model. BMC Complement. Altern. Med. 17, 202. Medzhitov, R., 2008. Origin and physiological roles of inflammation. Nature 454, 428–435. Mejia, E.G., Song, Y.S., Heck, C.I., Ramirez-Mares, M.V., 2010. Yerba-mate tea (Ilex paraguariensis): phenolics, antioxidant capacity and in vitro inhibition of colon cancer cell proliferation. J. Funct. Foods. 2 (1), 23–34. Meinhart, A.D., et  al., 2010. Methylxanthines and phenolics content extracted during the consumption of mate (Ilex paraguariensis St. Hil) beverages. J. Agric. Food Chem. 58, 2188–2193. Menini, T., Heck, C., Schulze, J., de Mejía, E., Gugliucci, A., 2007. Protective action of Ilex paraguariensis extract against free radical inactivation of paraoxonase-1 in high-density lipoprotein. Planta Med. 73, 1141–1147. Michaud, D.S., et  al., 2010. Coffee and tea intake and risk of brain tumors in the European Prospective Investigation into Cancer and Nutrition ( EPIC ) cohort study 1–3. Education 92 (5), 1145–1150. Milioli, E.M., Cologni, P., Santos, C.C., Marcos, T.D., Yunes, V.M., Fernandes, M.S., et al., 2007. Effect of acute administration of hydroalcohol extract of Ilex paraguariensis St Hilaire (Aquifoliaceae) in animal models of Parkinson’s disease. Phytother. Res. 21, 771–776. Miranda, D.D., Arçari, D.P., Pedrazzoli, J.J., Carvalho, P.O., Cerutti, S.M., Bastos, D.H., Ribeiro, M.L., 2008. Protective effects of mate tea (Ilex paraguariensis) on H2O2induced DNA damage and DNA repair in mice. Mutagenesis 23, 261–265. Monteiro, M., Farah, A., Perrone, D., Trugo, L.C., Donangelo, C., 2007. Chlorogenic acid compounds from coffee are differentially absorbed and metabolized in humans. J. Nutr. 137, 2196–2201. Mosimann, A.L.P., Wilhelm-Filho, D., da Silva, E.L., 2006. Aqueous extract of Ilex paraguariensis attenuates the progression of atherosclerosis in cholesterol-fed rabbits. Biofactors 26 (1), 59–70. Murray, C.J.L., Lopez, A.D. (Eds.), 1996. The Global Burden of Disease: A Comprehensive Assessment of Mortality and Disability From Diseases, Injuries, and Risk Factors in 1990 and Projected to 2020. Harvard School of Public Health on behalf of the World Health Organization and the World Bank, Cambridge, MA. Mut-Salud, N., et al., 2016. Antioxidant intake and antitumor therapy: toward nutritional recommendations for optimal results. Oxidative Med. Cell. Longev. 1–19.

Chapter 1  Functional and Medicinal Properties of Caffeine-Based Common Beverages   41

Nakachi, K., Suemasu, K., Suga, K., Takeo, T., Imai, K., Higashi, Y., 1998. Influence of drinking green tea on breast cancer malignancy among Japanese patients. J. Cancer Res. Ther. 89, 254–261. Nardini, M., et al., 2000. In vitro inhibition of the activity of phosphorylase kinase, protein kinase C and protein kinase A by caffeic acid and a procyanidin-rich pine bark (Pinus marittima) extract. Biochim. Biophys. Acta 1474 (2), 219–225. Natella, F., et al., 2002. Coffee drinking influences plasma antioxidant capacity in humans. J. Agric. Food Chem. 50 (21), 6211–6216. Newman, D.J., Cragg, G.M., 2016. Natural products as sources of new drugs from 1981 to 2014. J. Nat. Prod. 79 (3), 629–661. Ngure, F.M., Wanyoko, J.K., Mahungu, S.M., Shitandi, A.A., 2009. Catechins depletion patterns in relation to theaflavin and thearubigins formation. Food Chem. 115, 8–14. Nichols, J.A., Katiyar, S.K., 2010. Skin photoprotection by natural polyphenols: anti-­ inflammatory, antioxidante and DNA repair mechanisms. Arch. Dermatol. Res. 302, 71–83. Nicolia, V., Lucarelli, M., Fuso, A., 2015. Environment, epigenetics and neurodegeneration: focus on nutrition in Alzheimer’s disease. Exp. Gerontol. 68, 8–12. Nomura, M., Ma, W.Y., Huang, C., Yang, C.S., Bowden, G.T., Miyamoto, K., Dong, Z., 2000. Inhibition of ultraviolet B-induced AP-1 activation by theaflavins from black tea. Mol. Carcinog. 28, 148–155. Odegaard, A.O., et  al., 2016. Oxidative stress, inflammation, endothelial dysfunction and incidence of type 2 diabetes. Cardiovasc. Diabetol. 15 (1), 51. Okamura, S., et al., 2005. The effects of coffee on conjugation reactions in human colon carcinoma cells. Biol. Pharm. Bull. 28 (2), 271–274. Oliveira, D.M., Sampaio, G.R., Pinto, C.B., Catharino, R.R., Bastos, D.H., 2016. Bioavailability of chlorogenic acids in rats after acute ingestion of mate tea (Ilex paraguariensis) or 5-caffeoylquinic acid. Eur. J. Nutr. 1, 1–16. Pan, C.W., Qian, D.J., Sun, H.P., Ma, Q., Xu, Y., Song, E., 2016a. Visual impairment among older adults in a rural community in eastern China. J. Ophthalmol. 1, 1–6. Pan, M.-H., et al., 2016b. Molecular mechanisms of the anti-obesity effect of bioactive compounds in tea and coffee. Food Funct. 7 (11), 4481–4491. Pan, H., Wang, F., Rankin, G.O., Rojanasakul, Y., Tul, Y., Chen, Y.C., 2017. Inhibitory ­effect of black tea pigments, theaflavin-3/3’-gallate against cisplatin-resistant ovarian cancer cells by inducing apoptosis and G1 cell cycle arrest. Int. J. Oncol. 51, 1508–1520. Park, K.S., Oh, J.H., Yoo, H.S., Lee, M.K., Hong, J.T., Oh, K.W., 2010. (-)-Epigallocatechin3-O-gallate (EGCG) reverses caffeine-induced anxiogenic-like effects. Neurosci. Lett. 481, 131–134. Pereira, M.A., Parker, E.D., Folsom, A.R., 2006. Coffee consumption and risk of type 2 diabetes mellitus. Arch. Intern. Med. 166 (12), 1311. Perry, G., Cash, A.D., Smith, M.a., 2002. Alzheimer disease and oxidative stress. J. Biomed. Biotechnol. 2 (3), 120–123. Pimentel, G.D., et al., 2009. Does long-term coffee intake reduce type 2 diabetes mellitus risk? Diabetol. Metab. Syndr. 1 (1), 6. Pimentel, G.D., Lira, F.S., Rosa, J.C., Caris, A.V., Pinheiro, F., Ribeiro, E.B., Oller do Nascimento, C.M., Oyama, L.M., 2013. Yerba mate extract (Ilex paraguariensis) ­attenuates both central and peripheral inflammatory effects of diet-induced obesity in rats. J. Nutr. Biochem. 24 (5), 809–818. Pinto, M.S., 2013. Tea: a new perspective on health benefits. Food Res. Int. J. 53, 558–567. Pinto, N.B., Alexandre, B.S., Neves, K.R.T., Silva, A.H., Leal, L.K.A.M., Viana, G.S.B., 2015, 1–12. Neuroprotective properties of the standardized extract from Camellia sinensis (green tea) and its main bioactive components, epicatechin and epigallocatechin gallate, in the 6-OHDA model of Parkinson’s disease. Evidence-Based Complem. Altern. Med. 2015 (161092), 1–12.

42  Chapter 1  Functional and Medicinal Properties of Caffeine-Based Common Beverages

Prediger, R.D.S., 2010. Effects of caffeine in Parkinson’s disease: from neuroprotection to the management of motor and non-motor symptoms. J. Alzheimers Dis. 20 (Suppl.1), S205–S220. Prediger, R.D., Fernandes, M.R., Rial, D., Wopereis, S., Pereira, V.S., Bosse, T.S., da Silva, C.B., Carradore, R.S., Machado, M.S., Cechinel-Filho, V., Costa-Campos, L., 2008. Effects of acute administration of the hydroalcoholic extract of mate tea leaves (Ilex paraguariensis) in animal models of learning and memory. J. Ethnopharmacol. 120, 465–473. Puangpraphant, S., de Mejia, E.G., 2009. Saponins in yerba mate tea (Ilex paraguariensis A. St.-Hil) and quercetin synergistically inhibit iNOS and COX-2 in lipopolysaccharideinduced macrophages through NFkappaB pathways. J. Agric. Food Chem. 57 (19), 8873–8883. Qadir, M.I., 2017. Role of green tea flavonoids and other related contents in cancer prevention. Crit. Rev. Eukaryot. Gene Expr. 27 (2), 163–171. Qi, G., Mi, Y., Fan, R., Zhao, B., Ren, B., Liu, X., 2017. Tea polyphenols ameliorates neural redox imbalance and mitochondrial dysfunction via mechanisms linking the key circadian regular Bmal. Food Chem. Toxicol. 110, 189–199. Rabolli, V., Lison, D., Huaux, F., 2016. The complex cascade of cellular events governing inflammasome activation and IL-1β processing in response to inhaled particles. Part. Fibre Toxicol. 13, 40. Ramirez-Mares, M.V., Chandra, S., de Mejía, E.G., 2004. In vitro chemopreventive activity of Camellia sinensis, Ilex paraguariensis and Ardisia compressa tea extracts and selected polyphenols. Mutat. Res. 554, 53–65. Ran, H.-Q., Wang, J.-Z., Sun, C.-Q., 2016. Coffee consumption and pancreatic cancer risk: an update meta-analysis of cohort studies. Pak. J. Med. Sci. 32 (1), 253–259. Rathore, K., Wang, H.C., 2012. Green tea catechin extract in intervention of chronic breast cell carcinogenesis induced by environmental carcinogens. Mol. Carcinog. 51 (3), 280–289. Rathore, K., Choudhary, S., Odoi, A., Wang, H.C., 2012. Green tea catechin intervention of reactive oxygen species-mediated ERK pathway activation and chronically induced breast cell carcinogenesis. Carcinogenesis 33 (1), 174–183. Reis, E.M., Screiner Neto, F.W., Cattani, V.B., Peroza, L.R., Busanello, A., Leal, C.Q., Boligon, A.A., Lehmen, T.F., Libardoni, M., Athayde, M.L., Fachinetto, R., 2014. Antidepressant-like effect of Ilex paraguariensis in rats. Biomed. Res. Int. 958209. Rizzuto, R., De Stefani, D., Raffaello, A., Mammucari, C., 2012. Mitochondria as sensors and regulators of calcium signalling. Nat. Rev. Mol. Cell Biol. 13, 566–578. Ronco, A.L., Stefani, E.D., Mendoza, B., Vazquez, A., Abbona, E., Sanchez, G., Rosa, A.D., 2016. Mate and tea intake, dietary antioxidants and risk of breast cancer: a case-control study. Asian Pac. J. Cancer Prev. 17 (6), 2923–2933. Ronco, A.L., Espinosa, E., Calderon, J.M., Lasalvia-Galante, E., De Rosa, A., Sanchez, G., 2017. ‘Mate’ intake, hormone-based risk factors and breast cancer: a case-control study. Asian Pac. J. Cancer Prev. 18 (4), 941–948. Ross, G., et al., 2000. Association of coffee and caffeine intake with the risk of Parkinson disease. JAMA 283 (20), 2674–2679. Rupérez, A.I., Gil, A., Aguilera, C.M., 2014. Genetics of oxidative stress in obesity. Int. J. Mol. Sci. 60, 147–156. Sääksjärvi, K., et  al., 2008. Prospective study of coffee consumption and risk of Parkinson’s disease. Eur. J. Clin. Nutr. 62 (7), 908–915. Saeed, M., Naveed, M., Arif, M., Kakar, M.U., Manzoor, R., Abd El-Hack, M.E., Alagawany, M., Tiwari, R., Khandia, R., Munjal, A., Karthik, K., Dhama, K., Iqbal, H.M.N., Dadar, M., Sun, C., 2017. Green tea (Camellia sinensis) and l-theanine: medicinal values and beneficial applications in humans—a comprehensive review. Biomed Pharmacother 95 (September 18), 1260–1275.

Chapter 1  Functional and Medicinal Properties of Caffeine-Based Common Beverages   43

Salah, N., Miller, N.J., Parganga, G., Tifburg, L., Bolwell, G.P., Rice Evan, C., 1995. Polyphenolic flavonols as scavengers of aqueous phase radicals and as chain-­ breaking antioxidants. Arch. Biochem. Biophys. 322, 339–346. Sang, S., Lambert, J.D., Ho, C.T., Yang, C.S., 2011. The chemistry and biotransformation of tea constituents. Pharmacol. Res. 64, 87–99. Santo-Domingo, J., Demaurex, N., 2010. Calcium uptake mechanisms of mitochondria. Biochim. Biophys. Acta 1797, 907–912. Santos-Buelga, C., Scalbert, A., 2000. Proanthocyanidins and tannin-like compounds— nature, occurrence, dietary intake and effects on nutrition and health. J. Sci. Food Agric. 80, 1094–1117. Sartorelli, D.S., et al., 2010. Differential effects of coffee on the risk of type 2 diabetes according to meal consumption in a French cohort of women: the E3N/EPIC cohort. Am. J. Clin. Nutr. 91 (4), 1002–1012. Scalbert, A., Williamson, G., 2000. Dietary intake and bioavailability of polyphenols. J. Nutr. 130, 2073–2085. Schimidt, H.L., Garcia, A., Martins, A., Mello-Carpes, P.B., Carpes, F.P., 2017. Green tea supplementation produces better neuroprotective effects than red and black tea in Alzheimer-like rat model. Food Res. Int. 100 (Pt 1), 442–448. Schubert, A., Pereira, D.F., Zanin, F.F., Alves, S.H., Beck, R.C., Athayde, M.L., 2007. Comparison of antioxidant activities and total polyphenolic and methylxanthine contents between the unripe fruit and leaves of Ilex paraguariensis A. St. Hil. Pharmazie. 62, 876–880. Senanayake, S.P.J.N., 2013. Green tea extract: Chemistry, antioxidant properties and food applications – A review. J. Funct. Foods. 5 (4), 1529–1541. Shang, F., Li, X., Jiang, X., 2016. Coffee consumption and risk of the metabolic syndrome: a meta-analysis. Diabetes Metab. 42 (2), 80–87. Sharangi, A.B., 2009. Medicinal and therapeutic potentialities of tea (Camellia sinensis L.)—a review. Food Res. Int. 42, 529–535. Sharma, P., de Oca, M.K.M., Alkeswani, A.R., Mcclees, S.F., Das, T., Elmets, C.A., Afaq, F., 2017. Tea polyphenols for the prevention of UVB-induced skin cancer. Photodermatol. Photoimmunol. Photomed. 2017, 1–27. Silva, R.D., Bueno, A.L.C., Gallon, C.W., Gomes, L.F., Kaiser, F., Pavei, C., Ortega, G.G., Kucharski, L.C., Jahn, M.P., 2011. The effect of aqueous extract of gross and commercial yerba mate (Ilex paraguariensis) on intra-abdominal and epididymal fat and glucose levels in male wistar rats. Fitoterapia 82 (6), 818–826. Smith, A., 2002. Effects of caffeine on human behavior. Food Chem. Toxicol. 40 (9), 1243–1255. Somoza, V., et al., 2003. Activity-guided identification of a chemopreventive compound in coffee beverage using in  vitro and in  vivo techniques. J. Agric. Food Chem. 51 (23), 6861–6869. Soubrane, G., Haddad, W.M., Coscas, G., 2002. Age-related macular degeneration. Presse Med. 31 (27), 1282–1287. Stefani, E.D., Moore, M., Aune, D., Deneo-Pellegrini, H., Ronco, A.L., Boffetta, P., Correa, P., Acosta, G., Mendilaharsu, M., Luaces, M.E., Silva, C., Landó, G., 2011. Maté consumption and risk of cancer: a multi-site case-control study in Uruguay. Asian Pac. J. Cancer Prev. 12 (4), 1089–1093. Streck, E.L., Czapski, G.A., Gonçalves, D.A., Silva, C., 2013. Neurodegeneration, mitochondrial dysfunction, and oxidative stress. Oxidative Med. Cell. Longev. 2013, 1–2. Suzuki, J., Isobe, M., Morishita, R., Nagai, R., 2009. Tea polyphenols regulate key mediators on inflammatory cardiovascular diseases. Mediat. Inflamm. 2009, 494928. Szopa, A., et  al., 2016. Caffeine enhances the antidepressant-like activity of common antidepressant drugs in the forced swim test in mice. Naunyn Schmiedeberg’s Arch. Pharmacol. 389 (2), 211–221.

44  Chapter 1  Functional and Medicinal Properties of Caffeine-Based Common Beverages

Takeuchi, O., Akira, S., 2010. Pattern recognition receptors and inflammation. Cell 140, 805–820. Torre, L.A., Bray, F., Siegel, R.L., Ferlay, J., Lortet-Tieulent, J., Jemal, A., 2015. Global cancer statistics, 2012: global cancer statistics, 2012. CA Cancer J. Clin. 65 (2), 87–108. Torres, R.J.A., et al., 2009. Modifiable risk factors for age-related macular degeneration. Arq. Bras Oftalmol. 72 (3). Twig, G., Elorza, A., Molina, A.J., Mohamed, H., Wikstrom, J.D., Walzer, G., Stiles, L., Haigh, S.E., Katz, S., Las, G., Alroy, J., Wu, M., Py, B.F., Yuan, J., Deeney, J.T., Corkey, B.E., Shirihai, O.S., 2008. Fission and selective fusion govern mitochondrial segregation and elimination by autophagy. EMBO J. 27, 433–446. Valko, M., Leibfritz, D., Moncol, J., Cronin, M.T.D., Mazur, M., Telser, J., 2007. Free radicals and antioxidants in normal physiological functions and human disease. Int. J. Biochem. Cell Biol. 39, 44–84. Vignes, M., Maurice, T., Lante, F., Nedjar, M., Thethi, K., Guiramand, J., Récasens, M., 2006. Anxiolytic properties of green tea polyphenol (-)-epigallocatechingallate (EGCG). Brain Res. 1110, 102–115. Vinson, J.A., Dabbargh, Y.A., 1998. Effect of green and black tea supplementation on lipids, lipid oxidation and fibrinogen in the hamster: mechanisms for the epidemiological benefits of tea drinking. FEBS Lett. 433, 44–46. Vissiennon, C., et al., 2017. Mechanisms on spasmolytic and anti-inflammatory effects of a herbal medicinal product consisting of myrrh, chamomile flower, and coffee charcoal. Wien. Med. Wochenschr. 167 (7–8), 169–176. Wang, J.-F., Shao, L., Sun, X., Young, L.T., 2009. Increased oxidative stress in the anterior cingulate cortex of subjects with bipolar disorder and schizophrenia. Bipolar Disord. 11, 523–529. Wang, P., Vadgama, J.V., Said, J.W., Magyar, C.E., Doan, N., Heber, D., Henning, S.M., 2014. Enhanced inhibition of prostate cancer xenograft tumor growth by combining quercetin and green tea. J. Nutr. Biochem. 25 (1), 73–80. Wang, P., Henning, S.M., Heber, D., Vadgama, J.V., 2015. Sensitization to docetaxel in prostate cancer cells by green tea and quercetin. J. Nutr. Biochem. 26 (4), 408–415. Wedick, N.M., et al., 2011. Effects of caffeinated and decaffeinated coffee on biological risk factors for type 2 diabetes: a randomized controlled trial. Nutr. J. 10 (1), 93. Wei, X.Y., Yang, J.Y., Wang, J.H., Wu, C.F., 2007. Anxiolytic effect of saponins from Panaxquinquefolium in mice. J. Ethnopharmacol. 111, 613–618. Weinreb, O., Mandel, S., Amit, T., Youdim, M.B., 2004. Neurological mechanisms of green tea polyphenols in Alzheimer’s and Parkinson’s diseases. J. Nutr. Biochem. 15 (9), 506–516. Wiseman, S.A., Balentine, D.A., Frei, B., 1997. Antioxidants in tea. Crit. Rev. Food Sci. Nutr. 37, 705–718. Wong, W.L., et al., 2014. Global prevalence of age-related macular degeneration and disease burden projection for 2020 and 2040: a systematic review and meta-­analysis. Lancet Glob. Health. 2 (2), e106–e116. Wooten, G.F., 2004. Are men at greater risk for Parkinson’s disease than women? J. Neurol. Neurosurg. Psychiatry 75 (4), 637–639. World Health Organization (WHO), 2000. Obesity: Preventing and Managing the Global Epidemic. 894, 1–252. Wu, H., Li, Q., Zhou, X., Kolosov, V.P., Perelman, J.M., 2012. Theaflavins extracted from black tea inhibit airway mucous hypersecretion induced by cigarettesmoke in rats. Inflammation 35, 271–279. Xie, Y., et  al., 2016. Coffee consumption and risk of gastric cancer: an updated ­meta-analysis. Asia Pac. J. Clin. Nutr. 25 (3), 578–588. Yamaji, T., et al., 2004. Coffee consumption and glucose tolerance status in middle-aged Japanese men. Diabetologia 47 (12), 2145–2151.

Chapter 1  Functional and Medicinal Properties of Caffeine-Based Common Beverages   45

Yamauchi, R., et al., 2010. Coffee and caffeine ameliorate hyperglycemia, fatty liver, and inflammatory adipocytokine expression in spontaneously diabetic KK-Ay mice. J. Agric. Food Chem. 58 (9), 5597–5603. Yanagimoto, K., et al., 2004. Antioxidative activities of fractions obtained from brewed coffee. J. Agric. Food Chem. 52 (3), 592–596. Yang, Z.Y., Jie, G.L., Dong, F., Xu, Y., Naoharu, W., Tu, Y.Y., 2008. Radical-scavenging abilities and antioxidant properties of theaflavins and their gallate esters in H2O2-mediated oxidative damage system in the HPF-1 cells. Toxicol. In Vitro 22, 1250–1256. Yang, C.S., Wang, X., Lu, G., Picinich, S.C., 2009. Cancer prevention by tea: animal studies, molecular mechanisms and human relevance. Nat. Rev. Cancer 9 (6), 429–439. Yang, W.S., et  al., 2013. IRAK1/4-targeted anti-inflammatory action of caffeic acid. Mediat. Inflamm. 2013, 518183. Yasuko, K., et al., 1984. Caffeic acid is a selective inhibitor for leukotriene biosynthesis. Biochim. Biophys. Acta (BBA)/Lipids and Lipid Metab. 792 (1), 92–97. Yiannakopoulou, E., 2014. Effect of green tea catechins on breast carcinogenesis: a systematic review of in-vitro and in-vivo experimental studies. Eur. J. Cancer Prev. 23 (2), 84–89. You, D.-C., et  al., 2011. Possible health effects of caffeinated coffee consumption on Alzheimer’s disease and cardiovascular disease. Toxicol. Res. 27 (1), 7–10. Yu, S., Yue, S.W., Liu, Z., Zhang, T., Xiang, N., Fu, H., 2015. Yerba mate (Ilex paraguariensis) improves microcirculation ofvolunteers with high blood viscosity: a randomized, doubleblind, placebo-controlled trial. Experim. Geront. 62, 14–22. Yuan, J.M., 2013. Cancer prevention by green tea: evidence from epidemiologic studies. Am. J. Clin. Nutr. 98 (6 Suppl), 1676S–1681S. Zandi, P., Gordon, M.H., 1999. Antioxidant activity of extracts from old tea leaves. Food Chem. 64, 285–288. Zeng, L., Holly, J.M., Perks, C.M., 2014. Effects of physiological levels of the green tea extract epigallocatechin-3-gallate on breast cancer cells. Front. Endocrinol. (Lausanne) 5 (May 7), 61. Zhang, Y., et al., 2011. Coffee consumption and the incidence of type 2 diabetes in men and women with normal glucose tolerance: the Strong Heart Study. Nutr. Metab. Cardiovasc. Dis. 21 (6), 418–423. Zhang, J., Cai, S., Li, J., Xiong, L., Tian, L., Liu, J., Huang, J., Liu, Z., 2016. Neuroprotective effects of theaflavins against oxidative stress-induced apoptosis in PC12 cells. Neurochem. Res. 41, 3364–3372. Zhong, L., Goldberg, M.S., Gao, Y.T., Hanley, J.A., Parent, M.E., Jin, F., 2001. A ­population-based case-control study of lung cancer and green tea consumption among women living in Shanghai. China Epidemiol. 12, 695–700. Zhou, R., Yazdi, A., Menu, P., Tschopp, J., 2011. A role for mitochondria in NLRP3 inflammasome activation. Nature 469, 221–225. Zhou, H., Chen, J.X., Yang, C.S., Yang, M.Q., Deng, Y., Wang, H., 2014. Gene regulation mediated by microRNAs in response to green tea polyphenol EGCG in mouse lung cancer. BMC Genomics 15 (Suppl.11), S3.

Further Reading Cruvinel, W.M., Mesquita, J.R.D., Araujo, J., Salmazi, K., Kallas, E., Rabolli, V., Lison, D., Huaux, F., 2015. The complex cascade of cellular events governing inflammasome activation and IL-1β processing in response to inhaled particles. Part. Fibre Toxicol. 13, 40.

46  Chapter 1  Functional and Medicinal Properties of Caffeine-Based Common Beverages

Hanahan, D., Weinberg, R.A., 2011. Hallmarks of cancer: the next generation. Cell 144, 646–674. Hinokio, Y., Suzuki, S., Hirai, M., Chiba, M., Hirai, A., Toyota, T., 1999. Oxidative DNA damage in diabetes mellitus: its association with diabetic complications. Diabetologia 42 (8), 995–998. O’Connell, R.M., Kahn, D., Gibson, W.S., Round, J.L., Scholz, R.L., Chaudhuri, A.A., Kahn, M.E., Rao, D.S., Baltimore, D., 2010. MicroRNA-155 promotes autoimmune inflammation by enhancing inflammatory T cell development. Immunity 33, 607–619. Vuong, Q.V., 2014. Epidemiological evidence linking tea consumption to human health: a review. Crit. Rev. Food Sci. Nutr. 54, 523–536. Yu, J., Song, P., Perry, R., Penfold, C., Cooper, A.R., 2017. The effectiveness of green tea or green tea extract on insulin resistance and glycemic control in type 2 diabetes mellitus: a meta-analysis. Diabetes Metab. J. 41, 251–262.

QUALITY AND SAFETY ISSUES RELATED WITH THE PRESENCE OF BIOGENIC AMINES IN COFFEE, TEA, AND COCOABASED BEVERAGES

2

Donatella Restuccia, Monica Rosa Loizzo, Umile Gianfranco Spizzirri Department of Pharmacy, Health and Nutritional Sciences, University of Calabria, Arcavacata di Rende (CS), Italy

2.1 Introduction Tea, coffee, and cocoa are among the most important agricultural commodities in the world. They originated from Asia, Africa, and Latin America, respectively, but currently commercial production takes place in many other tropical countries. They are perennial trees or shrub crops that can remain economically viable on the same land for 30–50 years after planting for cocoa and coffee, and more than 100 years for tea. They have been domesticated over time and selected for different production environment and constraints (Diby et al., 2017). Currently, the production takes place essentially within 20°N and 20°S of the equator in different climate conditions. This production occurs largely in the developing world (with the exception of tea in China), while the consumption happens mainly in the developed economies. The yields are very much varied worldwide due to different environmental conditions and management practices. For each of these commodities, more than 50% of the production is in only three countries, but unlike other products such as crude oil the market price is regulated by consumption countries. The economy of many growing countries depends heavily on the earnings from these crops which support directly or indirectly millions of people in both producing and consuming countries. The production system is extensive and dominated by smallholder farms. It is also characterized by the mono-­ cropping practices that raise some environmental concerns. However, Caffeinated and cocoa based beverages. https://doi.org/10.1016/B978-0-12-815864-7.00002-7 © 2019 Elsevier Inc. All rights reserved.

47

48  Chapter 2  QUALITY AND SAFETY ISSUES

in recent years, to support the expansion of the demand, diversification into other segments of the market has been widely encouraged, with greater attention to the sustainability. In this regard, major standards active in the sector include Fair Trade International, Organic, Rainforest Alliance, the Ethical Tea Partnership, and UTZ Certified (Méndez et al., 2010; Jacobi et al., 2014; FAO, 2013). Tea, coffee, and cocoa are cultivated for their leaves, cherries, and beans, respectively, from which popular beverages are made and drunk worldwide. Tea is the most popular beverage, and it is liked by 65% of the world’s population, while 2 billion coffee cups are consumed daily worldwide; ate the same time nearly 4-kg cocoa bean equivalent is eaten per capita annually in developed countries (FAO, 2013). Moreover, in addition to being used as beverage, cocoa is essentially eaten as chocolate confectionery products. Many beneficial health effects have been related to nervine foods/ beverages consumption mostly attributable to their bioactive constituents. Numerous studies have been published in recent years, mainly regarding their polyphenolic constituents that deeply influence antioxidative, antiinflammatory, antimicrobial, anticarcinogenic, antihypertensive, and neuroprotective properties of tea, coffee, and cocoa (Butt and Sultan, 2011; Vuong, 2014; Badrie et al., 2015). In addition, it has been reported that simple and complex polyphenols provide taste and color characteristics (Crozier et al., 2012). Among secondary metabolites, key compounds are also the purine alkaloids caffeine, theophylline, and theobromine, responsible of the stimulating effects of all three beverages. However, it is important to state that coffee, tea, and cocoa can contain less positive bioactive compounds, such as biogenic amines (BAs). These molecules are detrimental to health and originate in foods from decarboxylation of the corresponding amino acid and transamination of aldehydes and ketones by the activity of exogenous enzymes released by various microorganisms (EFSA, 2011). The decarboxylation process can be related with the activity of decarboxylase enzymes which are widely distributed in spoilage and other microorganisms, for example, in naturally occurring and/ or artificially added lactic acid bacteria involved in food fermentation. Moreover, it has been reported that the oxidative decarboxylation of corresponding amino acid can be also obtained during thermal processing of foods, suggesting a new “thermogenic” formation pathway of BAs (Zamora et al., 2015). Natural polyamines are present at low levels in microorganisms, plants, animals, and humans where they are implicated in important physiological functions. Within the body, BAs function as potent, short-lived, receptor-mediated intercellular signaling molecules that modulate cell growth, hormone release, and neuronal activity (Kalač, 2009). Although BAs are required for some physiological functions,

Chapter 2  QUALITY AND SAFETY ISSUES   49

the circulation of high levels in the organism is directly related with toxicological consequences since following ingestion, BAs could be detected in the gut, systemic circulation, and a number of organs (EFSA, 2011). Oxidation is the main route of BA detoxification following ingestion by mono- (MAO A and B) or diamino (DAO) oxidases at the gut level (Kalač, 2009). MAO-A predominates in the stomach, intestine, and placenta and has polar aromatic amines as preferred substrates. MAO-B predominates in the brain and selectively deaminates nonpolar aromatic amines. Low concentrations of BA are usually tolerated by the human body, once they are efficiently detoxified by mono- and diamine oxidase in the intestinal tract. Nevertheless, these biological produced amines can have adverse effects when present at high concentrations and pose a health risk for sensitive individuals (Silla-Santos, 1996). Histamine (HIS) is responsible for most of the serious intoxication reactions such as rash, edema, headache, and vomiting. Although commonly associated with the consumption of scombroid-type fish, other foods such as cheese have also been associated with outbreaks of HIS poisoning. Tyramine (TYR) and phenylethylamine (PHE) have been identified as the initiators of hypertension during treatment with monoamino oxidase inhibitor (MAOI) drugs and of dietary-induced migraine in susceptible individuals (cheese-reaction for TYR in particular). Putrescine (PUT) and cadaverine (CAD) although not being toxic themselves, can cause a depreciation in wine aroma and enhance the toxicity of other BAs by interacting with catabolic enzymes (EFSA, 2011). The severity of clinical symptoms depends on the amount and type of BA ingested and the correct functioning of the detoxification system. This last aspect could be influenced by human susceptibility, genetic disorder, smoking, contemporary consumption of medication, alcohol, and other BAs rich foods or beverages, etc. As the consumption of food containing large amounts of these amines can have toxicological consequences, it is generally assumed that they should not be allowed to accumulate. However, the determination of BAs in foods is of great interest not only due to their toxicity, but also because they can be exploited as quality indexes in relation with food spoilage, processing, and shelf-life. In this regard, considerable research has been undertaken in recent years to evaluate the presence of these compounds in various fermented, seasoned, or conserved foodstuffs (EFSA, 2011). Also tea, coffee, and cocoa, as well as their derivatives, have been considered as a source of BAs, although few studies are present in the literature, mainly regarding raw materials (Cirilo et  al., 2003; Casal et al., 2004; Vasconcelos et al., 2007; Palavan-Unsal et al., 2007; Oracz and Nebesny, 2014). Profiles and concentrations are reported to be very much varied as these molecules can be formed/accumulated

50  Chapter 2  QUALITY AND SAFETY ISSUES

in relation with the type and quality of raw materials, their origin and processing which in turn is driven by manufacturing technology, agronomic conditions, trading, blend, storage, and distribution of these commodities (Dias et  al., 2012; Zhang et  al., 2014; Restuccia et  al., 2016; CarmoBrito et al., 2017). Moreover, in each phase of the production process, external contamination can always occur resulting in a further increase of the BAs content. In this context, the goal of this chapter is a critical evaluation of the studies present in the literature regarding the presence of BAs in tea, coffee, and cocoa raw materials and derivatives including beverages. The analytical determination of BAs as well as their formation during production processes and beverage preparation will be also taken into consideration.

2.2  BAs in Nervine Foods and Beverages BAs are organic bases that can be divided in several groups according to their chemical structure such as aromatic (TYR and PHE), aliphatic (PUT and CAD), or heterocyclic [HIS and tryptamine (TRP)], or according to the number of amino groups into monoamines (TYR and PHE), diamines (HIS, PUT, CAD), and polyamines [spermine (SPE) and spermidine (SPD)]. They can also be classified into volatile (PHE) and nonvolatile [HIS, CAD, PUT, SPE, agmatine (AGM), TRP, and TYR] BAs (Fig. 2.1). BAs formation of food requires the presence of precursor’s free amino acids (FAAs), the existence of decarboxylase positive microorganisms and suitable environmental conditions allowing bacterial growth, bacterial activity decarboxylase, and synthesis. Factors associated with the raw material (food composition, hygienic, and handling conditions, etc.) directly affect the availability of FAAs, whereas the presence of the enzyme is closely linked with microbiological aspects (bacterial species and strain, bacterial growth, etc.); on the contrary, suitable conditions are mainly related with environmental parameters such as pH, temperature, oxygen, humidity, etc. All these factors are obviously interdependent and are further influenced by the technological processes associated with the type of food under investigation as well as the storage conditions. It follows, that the total amount of the different amines is strongly variable as aminogenesis processes depend on multiple and complex variables, all of which interact, implying that it is difficult to characterize the effects of each factor on BAs formation during each food/beverage production process. Generally, speaking, the longer is the food production cycle, storage, trade, processing, and handling the higher is the BAs total amount as each phase at each stage can contribute to BAs accumulation ­either by technological treatments or spoilage phenomena (Naila et al., 2010).

Chapter 2  QUALITY AND SAFETY ISSUES   51

OH N

NH2

NH2 N H

NH2

H N

H N

NH2

HO

OH

H2N

HO

NH2

NH2

Buthylamine (BU)

NH2

H2N

Spermidine (SPD)

Fig. 2.1  Structures and abbreviations of main food BAs.

H N

Spermine (SPM)

H N

H2N

3-Methylbutylamine (3-MBU)

N H

H 2N

Putrescine (PUT)

H N

Pirrolidine (PYR)

Propylamine (PR)

NH2

Isopropylamine (IPR)

NH2

NH2

Dimethylamine (DIM)

NH2

Ethanolamine (ETL)

Cadaverine (CAD)

H N

Ethylamine (ET)

OH

H2N

Triptamine (TRP)

NH2

Methylamine (ME)

H2N

H 2N

Serotonine (SER)

Dopamine (DOP)

Octopamine (OCT)

Phenilethylamine (PHE)

Tyramine (TYR)

Histamine (HIS)

NH2

HO

HO

NH2

NH2

52  Chapter 2  QUALITY AND SAFETY ISSUES

All these aspects are particularly critical for commodities like tea, coffee, and cocoa whose production, processing and trade are very complex, involving many stakeholders, partners, and competitors in different parts of the world. In particular, cultivation and first handling of green coffee, tea, and cocoa beans are limited to tropical countries, where quality and safety standards are often very different from those adopted in developed countries where further processing generally take place (Figs. 2.2–2.4). As far as trade structure is concerned, coffee and tea share characteristics (Figs. 2.5 and 2.6), but also differ, for example, in the role of warehouses and auctions, while the cocoa trade, with its four main products of cocoa beans, paste, butter, and powder and its industrial focus, has an entirely different trade structure (Fig. 2.7). Furthermore, an increasing proportion of cocoa is processed in developing countries and processed cocoa products are then exported to the EU market. This processing can be conducted by local manufacturers, but is also often conducted by international processing companies and chocolate manufacturers. This happens far less in the tea and coffee sectors, for which blending and roasting, respectively, predominately take place in the EU.

2.3  Analytical Determination of BAs in Tea, Coffee, and Cocoa Derivatives Inexpensive, rapid, reliable, and simple analytical methods are usually required to satisfy the increasing demand of BA ­determinations in food matrices. In recent years, different analytical methods have been proposed to tackle this objective (Erim, 2013). Some advances are focused on improving figures of merit such as precision, accuracy, sensitivity, and detection limits. Complementary issues such as simplicity, cost, and speed of analysis, environmental concerns, etc., are also taken into account to cover the fast-growing demand of controls of food products (Onal et  al., 2013). For the separation of BAs, various chromatographic techniques such as thin-layer chromatography, gas chromatography, LC as well as capillary electrophoretic methods are used (Daniel et  al., 2015). Because amines are very polar, commonly a derivatization of the amino group is performed to reduce their polarity and also, to provide a chromophore for UV or fluorescence detection. The most common derivatization agents for LC analysis are benzoyl chloride (Erim, 2013), dansyl chloride (Mazzucco et al., 2010), ­dabsyl chloride (De Mey et al., 2012), o-phthalaldehyde (Xiao et  al., 2017), fluorescein isothiocyanate (Başkan et  al., 2010), 9-­fluorenylmethylchloroformate (Hernández-Cassou and Saurina, 2011), and phenyl isothiocyanate (Juraj et  al., 2017). In particular,

Chapter 2  QUALITY AND SAFETY ISSUES   53

Fig. 2.2  Coffee production process.

54  Chapter 2  QUALITY AND SAFETY ISSUES

Fig. 2.3  Tea production process.

the introductions of ultrahigh-performance liquid chromatography (UHPLC) (Sentellas et al., 2012), and high-resolution mass spectrometry (Mayr and Schieberle, 2012) have opened excellent possibilities to improve the figures of merit of the analytical methods. Mass spectrometry detection with or without a previous derivatization step have also been developed to quantify BAs (Millan et al., 2007), in particular, to increase the reliability of amine identification. However, a severe matrix effect has been reported either for reversed phase with electrospray ionization LC-MS/MS method or for hydrophilic interaction liquid chromatography LC-MS/MS method with atmospheric pressure chemical ionization (Gianotti et al., 2008). Recently, LC coupled with evaporative light scattering detector was proposed as an innovative analytical method able to overcome derivatization step and ensure the analysis of BAs in different foodstuffs (Restuccia et al., 2017). However, while a great number of studies are present in the literature dealing with the optimization of the derivatization reaction and/or with the improving of the chromatographic performances of the methods, less attention is generally devoted to the pretreatment procedure of food samples, which is very important in BAs analysis as well. Precleanup protocol comprises extraction of BAs from the sample with a suitable

Chapter 2  QUALITY AND SAFETY ISSUES   55

Fermented and dried cocoa beans

Cleaning and roasting Breaking and winnowing Nib

Shells

Milling

Germ separation

Chocolate liquor

Addition of sugar, flavour, milk, cocoa butter, etc.

Fat pressing

Cocoa butter

Mixing and Refining

CHOCOLATE MANUFACTURE

COCOA MANUFACTURE

Alkalization

Conching

Presscake

Tempering Breaking, griding and sifting Cocoa powder

Molding Chocolate

Fig. 2.4  Cocoa and chocolate production processes.

Enrobing Chocolate-coated products

Smallholder

Plantations

Growers’ Association Cooperative Collector Local roaster

Exporter EU Border

Local consumer Broker/Agent

Importer

Roaster

Fig. 2.5  Coffee trade structure.

Supermarkets Speciality Coffee shops Organic shops

Retail channel

Catering channel

Institutions Restaurants Coffee bars Vending machines

Plantations

Small holder

Growers’ Association Cooperative Collector

Bought leaf factory

Estate factories

Exporter

Broker

Local subsidiaries of blender

EU Border

Trader distributor Blender packer

Fig. 2.6  Tea trade structure.

Supermarkets Speciality Coffee shops Organic shops

Retail channel

Catering channel

Institutions Restaurants Coffee bars Vending machines

Chapter 2  QUALITY AND SAFETY ISSUES   57

Plantations and large farm

Small holder cocoa grower member of association or cooperative

Growers’ Association Cooperative Collector

Exporters

Local grinders

Local end-product manufactures

EU Border Local consumers

Trader Import merchants

Storage companies

Processors Butter

Powder Paste butter

Cosmetics industry

Chocolate manufactures

Other food companies using cocoa products

Retail channel

extracting solvent. The complexity of the varied food matrices is the most critical aspect to take into consideration during the solvent selection in order to obtain adequate recoveries for all amines. Moreover, the different handling of the food matrix makes an effective comparison of the literature data quite difficult. Reported extraction procedures consist of the use of acids (trichloroacetic acid, hydrochloric, perchloric, thiodipropionic, or methanesulfonic acids) and solvents (petroleum ether, chloroform, or methanol) depending on the matrix (Onal et al., 2013). Generally speaking, analytical determination of BAs in tea, coffee, and cocoa was performed employing different methodologies. For

Fig. 2.7  Cocoa and chocolate trade structure.

58  Chapter 2  QUALITY AND SAFETY ISSUES

what it concerns BAs determination in tea leaves and beverages, LC coupled with UV (Spizzirri et  al., 2016a,b), DAD (Shen et  al., 2017), or fluorescence detectors (Brückner et al., 2012; Okamoto et al., 1997; Nishimura et al., 2006) were proposed for different teas (Black, green, oolong, instant). Acidic medium by HCl, TCA, or perchloric acid was employed in the extraction steps, while all the chromatographic techniques required a derivatization protocol performed with dansyl chloride, benzoyl chloride, o-phthalaldehyde, or 9-fluorenylmethyl chloroformate. Perchloric acid and TCA were proposed for the extraction of BAs from coffee beans and beverages, while the extract were analyzed by LC coupled with a fluorimeter after postcolumn derivatization with o-phthalaldehyde (Cirilo et  al., 2003; Leite da Silveira et  al., 2007; Oliveira et al., 2005; Vasconcelos et al., 2007) or an UV or DAD detectors after precolumn derivatization with benzoyl or dansyl chloride (Dias et  al., 2012; Ozdestan, 2014; Restuccia et  al., 2015a,b; Sridevi et  al., 2009). Recently, Cunha et  al. (2017) proposed a dispersive ­liquid-liquid microextraction with simultaneous derivatization using isobutyl chloroformate from different coffee liquors and the extracts were analyzed by GC-MS. The extraction of BAs from cocoa beans and cocoa derivatives was accomplished usually employing perchloric acid 0.6 M. Only CarmoBrito et al. (2017) suggested TCA for the extraction performed on fermented and unfermented cocoa beans. Analytical determination was done by LC coupled with an UV (Restuccia et al., 2015a,b) detector or a fluorescence detector after postcolumn derivatization with o-phthalaldehyde (CarmoBrito et  al., 2017; Lavizzari et  al., 2006). Interestingly, Baranowska and Plonka (2015) proposed a chromatographic methodology based on the simultaneous use of fluorimeter and DAD detectors for the determination of BAs in fermented and unfermented cocoa beans. LC-coupled MS, after extraction by organic solvents such as n-hexane and dichloromethane and precolumn derivatization with dansyl chloride, was proposed for the analysis of cocoa beans (Granvogl et al., 2006). The introductions of UHPLC have opened excellent possibilities to improve the figures of merit of the analytical methods. In this way, UHPLC allows excellent separations in shorter analysis time compared to those obtained by conventional LC. However, the direct separation of BAs is difficult in reversed-phase mode so that precolumn derivatization has usually been performed in UHPLC methods (Oracz and Nebesny, 2014). Finally, LC-ELSD methodology showed accurate and precise determination of up to eight BAs in organic and fair trade cocoa-based products without the need of the derivatization step with time saving and with good values of recovery and precision (Restuccia et al., 2016; Spizzirri et al., 2016a,b).

Chapter 2  QUALITY AND SAFETY ISSUES   59

2.4 Tea 2.4.1  BAs in Tea Leaves Tea is obtained from Camellia sinensis (L.) O. Kuntze leaves. It is possible to obtain different types of tea depending on manufacturing process. When the leaves are uncured and unfermented it is c­ lassified as “white tea”; if tea leaves are nonfermented tea is called “green tea”; a semifermented products is the Oolong tea, while black or red tea is obtained by leaves “postharvest fermented” before drying and steaming (Melgarejo et al., 2010). In plant SPD, SPM, and PUT act as grow factors so it is not surprising that in dried green tea leaves, only SPD, SPM, PUT occurred in significant amounts such as 28–89 μg/g tea leaves, 20–35 μg/g tea leaves, and 7–26 μg/g tea leaves, respectively. High amount of PUT and SPD were detected also by Okamoto et al. (1997) in Oolong tea leaves (24 and 10 extracted polyamine/g of dried tea leaves, respectively) and black tea (12 and 12 extracted polyamine/g of dried tea leaves, respectively). Black tea leaves contain also a concentration of SPM  GTL > F. This pathway could be explained by the antimicrobial polyphenols and particularly catechins of tea. During tea fermentation, catechins are condensed to give catechins derivatives such as epigallocatechin gallate that can inhibit nitration reactions (Zhao et al., 2011). Twenty-one samples (14 black and 7 green) of tea leaves from Kenia, China, Tanzania, India, and Sri Lanka were investigated for the content of SPM, SPD, PUT, HIS, TYR, PHE, CAD, and serotonine (SER) (Spizzirri et al., 2016a,b). Different extraction procedures were applied. The total BAs content ranging from 4.29 to 11.24 μg/g for black teas and from 2.23 to 4.17 for green teas. No geographical influence was observed. TYR is always absent. CAD, HIS, TYR, and SPM were not detected in green tea leaves samples. This different data could be explained by the different processing applied to green and black tea leaves. For green tea production, leaves were subjected to heating or steam and fast-drying process, while for black tea production the C. sinensis leaves were firstly subject to a series of procedures for the destruction of plant tissues followed by enzymatic maturation, and final drying. In green tea production, the total enzyme inactivation and no oxidative reactions that are normally responsible of the BAs formation and/or increase could not take place. Palavan-Unsal et al. (2007) found that during the manufacture of black tea SPM content decreased significantly, while PUT and SPD levels temporarily increased during withering and rolling, and then decreased during fermentation and drying (Palavan-Unsal et al., 2007). The obtained data on black teas confirmed this consideration. Spizzirri et  al. (2016a,b) investigated also some decaffeinated black and instant green teas that showed BAs lower content than regular black and green sample probably due the industrial processes involved in the soluble tea technology and decaffeination. A lower BAs content was observed also in black and green organic teas. This observation is in agreement with those reported on the low concentration of FAAs precursor of BAs in organic products (Han et al., 2013).

2.4.2  BAs in Tea Infusions and Beverages Tea is one of the most consumed beverages. Although the presence of BAs is investigated in several types of beverages, a perusal analysis of the literature revealed that tea infusion is a poorly investigated matrix. Brückner et al. (2012) evaluated the presence of BAs in black teas (14), green teas (5), Oolong tea (1), and instant tea (1), harvested in different regions (Sri Lanka, China, India). Generally, a low amount of

Chapter 2  QUALITY AND SAFETY ISSUES   61

BAs was detected in samples with values in the range from 0 to 401 μg/ mL for black tea, from 83 to 431 μg/mL for green tea, and 105 μg/mL for instant tea. None of the investigated aqueous infusions examined contained HIM or octopamine (OCP) while PUT, SPD, SPM, and TYR were detected. No geographical correlation could be found between origin and BAs presence, in fact TYR was detected in all teas from Ceylon and Assam (India) while at least in only three out of eight teas from Darjeeling (India), and in none of the black or green teas from China. At the same time, CAD was found in only one out of two teas from black tea for China. Black teas from Assam (India) and Darjeeling (India) are characterized by high level of SPM and TYR with values of 336.9 and 103.1 μg/ BA/L tea infusion and 205.0 and 186.9 μg/ BA/L tea infusion, respectively. A different pattern was observed in data from green tea in which the following trend was observed TYP> SPM> PUT. This different pattern between black and green tea could be explained on the basis of the different process (enzymatic and chemical processes). Black tea is characterized by high amount of tyrosin a precursor of TYP in comparison to green tea (Neumann and Montag, 1983). In instant tea SPD are predominant (53.8 μg/ BA/L tea infusion) followed by TYR (33.1 μg/BA/L tea infusion). Previously, Okamoto et al. (1997), using a different derivatization agent quantified PUT, SPD, SPM, and CAD/ HIS in black, green, and Oolong teas (ratio dry tea leaves to water 1:50, g/v; 85°C for 4 min). The following trend was observed in black tea: SPM>SPD>PUT. Differently in green tea SPD>PUT> SPM while in Oolong tea PUT>SPD with no CAD and HIS. These data are in agreement with those reported by Nishimura et al. (2006) that investigated one sample of black tea and one of green tea (1 g tea and 5 mL of water). The comparison of the content of BAS and particularly of ME, ET, and TRP in F and PP Pu’er tea leaves infusion (soaked in boiling water for 90 min for three times) revealed that all searched BAS are present while in sun-cured greenness tea samples (PP) TRP is absent (Shen et al., 2017). The infusion obtained by soaking black and green tea leaves with double boiling distilled water for 20 min leads the same trend of BAs of the corresponding untreated samples but with lowest concentration caused by the dilution of the BAs amount with water (Spizzirri et al., 2016a,b). The total BAs content neither exceeded the 80.71 and 32.9 g/L for black and green teas, respectively, with TYR always absent. Among black tea, except for one sample for Kenia PHE is always under the limit of detection. In black tea leaves infusions BAs distribution varied as follows: PUT (0.47–0.96 μg/L), CAD (0–0.70 μg/L), HIS (0–1.0 μg/L), SPD (0.33–0.56 μg/L), SER (0–0.71 μg/L), and SPM (0–0.52 μg/L). In green tea leaves infusion neither PHE, CAD, HIS, TYR, and SPM were detected. PUT was quantified in the range from 0 to 0.77 μg/L. The highest content of SPD was found in one sample

62  Chapter 2  QUALITY AND SAFETY ISSUES

from China and one from Sri Lanka with value of 0.52 μg/L for both samples while the highest value of SER was found in one sample from Kenia (0.58 μg/L). Taking into account the different characteristics of investigated samples and the different applied analytical approach these data are in agreement with those reported by Brückner et  al. (2012), and in the same order of magnitude of Okamoto et al. (1997) and Nishimura et al. (2006). Collectively analysis of data regarding tea infusion demonstrated that in beverage the following trend regarding BAS content could be observed conventional teas > black teas ≥ decaffeinated ≥ instant ≥ organic tea.

2.5 Coffee 2.5.1  BAs in Coffee Beans and Ground Coffee The two most commercially important species grown are varieties of Coffea arabica (Arabicas) and Coffea canephora (Robustas). Among coffee botanical species, the arabica has been reported as the most aromatic cultivar and it is commonly used for the production of superior quality coffee brews. The quality of coffee used for beverage is related to the chemical composition of the roasted beans, which, in turn, is affected by the chemical composition of the green beans and by postharvesting processing conditions (drying, storage, roasting, and grinding). Few studies can be found in the literature describing the presence of BAs in green coffee. Sridevi et al. (2009) measured polyamines profiles in coffee to determine their evolution fruit formation. It was found that PUT, SPM, and SPD are the predominant polyamines during the ontogeny and their level increased during fruit development. More recently, Dias et  al. (2012) observed that the processing conditions of unripe coffee beans influence the resulting concentrations of BAs, particularly SPM, SPD, HIS, and CAD. In particular, the de-pulping of unripe beans seems to reduce fermentation and supports uniform drying, resulting in a reduced formation of BAs. Moreover, natural processing methods produce lower levels of total BAs as well as defective beans. Other studies linked some BAs with coffee origins. It was found that robusta origins were associated with levels of TYR; at the same time, significant differences were recorded in coffees from Angola and other countries (Casal et  al., 2004). BAs concentrations values have also been included in a metabolomic approach by Choi et al. (2010) to identify the origins of the coffee (i.e., Asia, South America, and Africa). It is well known that roasting green coffee is an essential step in the production process, inducing chemical reactions triggered at a~190°C, with a dramatic impact on product composition and flavor (Homma, 2001).

Chapter 2  QUALITY AND SAFETY ISSUES   63

It follows that the effect of roasting on BAs total amounts and distributions has been much more investigated by authors. Values present in the literature about total BAs concentrations and profiles in roasted coffee samples are generally in the order of magnitude of few ppm. However, depending on the study, much higher amounts can also be found (Table 2.1). In particular, the highest BAs total concentrations were recorded by Ozdestan (2014) in Turkish ground coffee, with a total amine level ranging from 126.0 to 352.2 ppm. In comparison with the previous studies, also Restuccia et  al. (2015a) obtained higher quantities of total BAs (range from 25.80 to 88.85 ppm) during the analysis of 20 commercial samples of roasted ground coffees. Anyway, there is a general agreement on the finding that PUT followed by spermidine, can be regarded as the most abundant amine in both Robusta and Arabica coffee. Moreover, most of the obtained data seem to support the idea that the more severe is the roasting process the more drastic is the total BAs reduction. This effect can be ascribed to the involvement of BAs in the Maillard cascade. Although the molecular mechanisms remain not completely understood, it was reported that BAs can contribute to the Maillard reaction (Valisek, 2013) not only at first stages, but also in melanoidins formation as the amount of nitrogen in coffee was found to be closely related to that of melanoidin level (Bekedam et al., 2006). The decrease of BAs contents after roasting was underlined many years ago by Amorim et al. (1977). Authors detected only small quantities of PUT (2 ppm) in coffee roasted at 240°C for 9–10 min and did not find any polyamines after 12 min roasting. Lately, Oliveira et  al. (2005) analyzed in terms of BAs profiles some Arabica green coffee samples previously classified by cup as soft (high quality) and rio (low quality). Samples were then roasted at 220°C and bean samples were collected every 4 min during roasting. There was a significant decrease in total amine content during roasting. After 4 min, total amine levels decreased by ~44%, for both samples. After 8 min, amine levels were ~20% and 5% of the original values, for the soft and rio samples, respectively. The decrease of PUT, SPM, HIS, and TYR occurred mostly during the drying stage while degradation of SPD was shown to take place at a slower rate. Moreover, authors found that HIS, tryptamine, and CAD were detected in coffees of low cup quality and in defective coffee beans (black, immature, and sour). Also Vasconcelos et al. (2007) showed that after roasting to a light degree, only traces of SER were obtained and no amines were detected after roasting to medium and dark degrees. The same trend was underlined by Casal et al. (2004) who evaluated the levels of BAs (PUT, CAD, SER, TYR, SPD, and SPM) in robusta and arabica coffees. PUT was the most abundant amine in both species, followed by SPD, SPM, and SER. They also detected small amounts of CAD and TYR. All the major BAs were still present

Table 2.1  Main Results and Experimental Conditions Applied for the Determination of BAs in Tea Leaves and Infusions

N Samples

BAs

Extraction/ Purification

Analytical Method

Total BAs Content (μg/g for Leaves and μg/L for Infusion)

Organic black tea Organic green tea Instant green tea Decaffeinated black tea Black tea Green tea Pu’er tea (F) Pu’er tea (GTL) Pu’er tea (PP)

2 2 2 5

Spermine, spermidine, putrescine, histaminetyramine, phenyl ethylamine, cadaverine, and serotonin

TCA 5% and centrifugation (10,000g for 20 min). SPE (C18 sorbent). Derivatization using dansyl chloride

RP-LC-UV with gradient elution (solvents water and acetonitrile)

5.67a 3.41a 3.20a 4.29–5.38

Black tea Green tea Instant tea

19 5 1

Black tea Oolong tea

1 1

Sample

References

Leaves

7 3 10 11 7

Methylamine, ethylamine, tryptamine, putrescine, cadaverine, histamine, tyramine, and spermidine Cadaverine, histamine, octopamine, phenylethylamine, putrescine, spermidine, spermine, and tyramine Putrescine, spermidine, spermine, cadaverine, and histamine

6.07–9.16 3.75–4.02 41.5–1515 830–2947 536.5–1938

Spizzirri et al. (2016a, b)

0.1 M HCl and centrifugation (3000g for 10 min × 2 time). Derivatization using dansyl chloride 0.1 M HCl. Derivatization using 9-fluorenylmethyl chloroformate

RP-LC-DAD with elution (acetonitrile/ water 65:35 flow rate 1.2 mL/min)

Shen et al. (2017)

HPLC with L-7480 fluorescence detector

0.8–25.3 4.2–21.6 5.3

Brückner et al. (2012)

TCA 5% and centrifugation. Treatment with cationic ion-exchange resin column

HPLC with fluorescence detector

357a 681a

Okamoto et al. (1997)

Black tea

Infusion Organic black tea Organic green tea Instant green tea Decaffeinated black tea Black tea Green tea Pu’er tea (F) Pu’er tea (PP)

10

Putrescine, spermidine, spermine, histamine, and cadaverine

10% Perchloric acid and centrifugation (15,000g for 30 min). Derivatization using benzoyl chloride

RP-LC-UV with gradient elution (solvents water and acetonitrile)

55–150

2 2 2 2

Spermine, spermidine, putrescine, histamine, tyramine, cadaverine, phenylethylamine, and serotonine

TCA 5% and centrifugation (10,000g for 20 min). SPE (C18 sorbent). Derivatization using dansyl chloride

RP-LC-UV with gradient elution (solvents water and acetonitrile)

43.35a 27.60a 24.85a 21.9–40.8

7 3 1 1

Black tea Green tea Instant tea

19 5 1

Black tea Green tea

1 1

Black tea Oolong tea

1 1

a

Mean value.

Methylamine, ethylamine, and tryptamine

Cadaverine histamine, octopamine, phenylethylamine, putrescine spermidine, spermine, and tyramine Putrescine, spermidine, spermine, cadaverine, and agmatine

Putrescine, spermidine, spermine, cadaverine, and histamine

HCl and centrifugation (3000g for 10 min × 2 time). Derivatization using dansyl chloride 0.1 M HCl. Derivatization using 9-fluorenylmethyl chloroformate

RP-LC-DAD with elution (acetonitrile/ water 65:35 flow rate 1.2 mL/min) HPLC with L-7480 fluorescence detector

TCA 5% and centrifugation (4000g for 10 min) Derivatization with o-phthalaldehyde TCA 5% and centrifugation. Treatment with cationic ion-exchange resin column

41.4–80.70 30.40–32.30 655.5 1438

Spizzirri et al. (2016a, b)

Shen et al. (2017)

15.6–401.0 83.1–431.3 105.7

Brückner et al. (2012)

HPLC with fluorescence detector

468.0 927.0

Nishimura et al. (2006)

HPLC with fluorescence detector

24a 94a

Okamoto et al. (1997)

66  Chapter 2  QUALITY AND SAFETY ISSUES

after roasting arabica coffee at 160–220°C during 14 min, but in quite small quantities. However, an opposite trend has also been reported by Cirilo et al. (2003) who studied profiles and levels of BAs in green and roasted coffee. The green coffee was roasted at 2 degrees, American and French (300°C for 6 and 12 min, respectively). The prevailing amine in roasted coffee was SER, followed by SPD. PUT and SPM were not detected in roasted coffee while the presence of AGM was detected in French roasted coffee. American roasted coffee had lower amine levels than French, which indicated that the stronger the degree of roasting, the higher were the total levels of amines. This contradictory result was probably due to the thermal decarboxylation of the precursor amino acids. This pointed out a new “thermogenic” BAs formation. This effect was recently underlined during cocoa beans roasting (Oracz and Nebesny, 2014), although the temperatures involved (110–150°C) were quite different from those applied during coffee thermal treatment. Strecker degradation seems to be responsible for the formation of BAs by thermal decarboxylation of amino acids in the presence of α-dicarbonyl compounds formed during the Maillard reaction (Granvogl et  al., 2006) or lipid peroxidation products (Hidalgo and Zamora, 2016). As far as instant and decaffeinated coffee is concerned, it was found that they show much lower BAs amounts, in comparison with their untreated counterparts. This is probably in relation with the industrial processes involved in the decaffeination and the soluble coffee technology. The use of water/vapor before and after caffeine extraction with solvents can generate the loss of coffee flavor components as well as BAs (soluble in hot water) while during instant coffee production, the same effect can be related with the coffee drying method (i.e., spray drying). Leite da Silveira et al. (2007) reported the total values of BAs in instant coffee samples varying widely, from 2.8 to 27.6 ppm. Although with different BAs profiles, these values are in agreement with concentrations reported by Restuccia et al. (2015a). In the same study, for the first time, decaffeinated coffee samples have also been evaluated, showing total BAs quantities ranging from 39.81 to 13.30 ppm.

2.5.2  BAs in Coffee Brews Coffee relevance is mainly due to the coffee brew which is one of the most popular and widely consumed beverages throughout the world (Crozier et al., 2012) with strong economic, social, and cultural impact. When hot water interacts with ground coffee, a number of phenomena occur. Firstly, the highly soluble components dissolve in the water phase and are extracted. Secondly, less soluble or physically entrapped

Chapter 2  QUALITY AND SAFETY ISSUES   67

compounds are forced out by physical mechanisms. Thirdly, heat leads thermal degradation making select components more soluble and therefore more available for extraction, and finally running water lifts and migrates coffee fines and emulsifies coffee oil into suspension. When predicting the extraction of a compound from roasted and ground coffee, the main driving forces to be considered are the brewing mechanisms (water/coffee ratio, temperature, pressure, brewing time, etc.) and the physical structure of the coffee (coffee grind in particular). The preparation technique has a significant influence on the taste, aroma, and composition of coffee brews. In particular, the extraction degree during brew preparation, even on soluble compounds, gives rise to a diversified pool of bioactive compounds in the coffee beverage and generally, speaking, BAs concentrations found in coffee brews and beverages are much lower than those obtained from coffee beans (Table 2.2). In this regard, Restuccia et al. (2015a) evaluated the influence of coffee brew preparation (i.e., espresso machine, mocha, capsule or pod espresso machines, direct solubilization in water, and automatic dispenser) on concentrations of BAs. It was found that PUT was the prevailing amine followed in decreasing order by SPM, TYR, CAD, SPD, PHE, HIS, and SER with a drastic reduction of BAs moving from ground coffees to coffee brews with total contents ranging from 9.88 to 3.04 ppm depending on the sample. Beverages prepared by espresso, capsule, and pod machines had the lowest BAs contents, as a result of the thermal and physical stress imposed on ground coffee by these methods, while mocha contained the highest BAs amounts owing to lower pressure and longer brewing time. Moreover, inside each class, the same distinctions evaluated for coffee powders could be generally recognized, meaning that, being the same the preparation technique, beverages made with highly roasted coffees showed less amount of BAs than those obtained with medium-roasted coffees and, at the same time, decaffeinated coffee beverages contained less BAs than other coffee brews. Ozdestan (2014) found in Turkish brewed coffee total amine levels in the range 5.67–48.88 ppm. PUT, CAD, TYR, and SER were detected in all coffee samples, with SER being the prevailing bioactive amine. As already stated for ground coffee, BAs values in coffee infusions obtained in this study are lower than those reported for Turkish coffee with a different distribution, probably due to different coffee samples. Bioactive amine contents of brewed Turkish coffee were lower than those of ground coffee, and this reduction was related to the preparation method, with a thick layer of sludgy grounds at the bottom of the cup retaining most of the bioactive amines. On the other hand, for instant coffees brews, the BAs total content found in this study are much higher than those obtained by Leite da Silveira et al. (2007) who found BAs values never exceeding 0.5 ppm, with SER, CAD, and TYR

68  Chapter 2  QUALITY AND SAFETY ISSUES

Table 2.2  Main Results and Experimental Conditions Applied for the Determination of BAs in Coffee Beans and Coffee Derivatives Sample

N Samples

BAs

Extraction/Purification

Unripe coffee cherries

1

Green coffee beans Green coffee beans Green coffee beans

2

Putrescine, cadaverine, histamine, tyramine, spermidine, spermine, and serotonin Putrescine, spermidine, spermine

TCA 5% and centrifugation (4000g for 10 min). Ion-pair cleanup with bis(2-ethylhexyl) phosphate. Derivatization using dansyl chloride TCA 5%. Cleanup with Dowex-50 W-X8 resi (20–50 mesh). Derivatization using dansyl chloride Cold HClO4 5%, centrifugation (15,000g for 25 min). Derivatization with benzoylchloride TCA 5%, centrifugation (10,000g for 5 min) and filtration (0.45 μm). Postcolumn derivatization with o-phthalaldehyde

Green coffee beans

30

Green coffee beans

Not reported

Green coffee beans

2

Roasted coffee beans

5

5 1

Putrescine, spermidine, spermine, cadaverine, tyramine, tryptamine Putrescine, spermidine, spermine, agmatine, cadaverine, serotonin, histamine, tyramine, tryptamine, and phenylethylamine Putrescine, cadaverine, serotonin, tyramine, spermidine, and spermine (free, acid-soluble conjugates and acid-insoluble conjugates)

Putrescine, spermidine, spermine, agmatine, cadaverine, serotonin, histamine, tyramine, tryptamine, and phenylethylamine Putrescine, spermidine, spermine agmatine, cadaverine, serotonin, histamine, tyramine, tryptamine, and phenylethylamine Putrescine, spermidine, spermine, cadaverine, tyramine, and tryptamine

TCA 5% free biogenic amines: determined directly from the supernatant. Conjugated amines: extracted by hydrolyzing an aliquot of the supernatant with 12 M HCl acid-insoluble conjugates: residue was washed two times with 5% TCA and neutralized with 1.0 M NaOH. An aliquot of the resuspended residue was then hydrolyzed as described above. The hydrolyzed suspensions were filtered (0.45 μm), taken to dryness under a nitrogen stream (50°C), and resuspended in 1.0 mL of 5% TCA ionpair cleanup with bis(2-ethylhexyl) phosphate. Derivatization using dansyl chloride TCA 5%, centrifugation (10,000g for 5 min) and filtration (0.45 μm). Postcolumn derivatization with o-phthalaldehyde TCA 5%, centrifugation (1000g for 5 min) and filtration (0.45 μm). Postcolumn derivatization with o-phthalaldehyde Cold HClO4 5%, centrifugation (15,000g for 25 min). Derivatization with benzoylchloride

Chapter 2  QUALITY AND SAFETY ISSUES   69

Analytical Method

Total BAs Content (ppm)

RP-LC-DAD with gradient elution (solvents 0.05 M phosphoric acid and methanol/ acetonitrile)

71.8–80.0 depending on the processing method

Dias et al. (2012)

250 μm thick TLC with fluorimetric detection (solvents cyclohexane/ethylacetate) RP-LC-UV with isocratic elution (solvents water and methanol)

60–84

Amorim et al. (1977)

31.82

Sridevi et al. (2009)

Ion-pair RP-LC withfluorimetric detection (excitation 340 nm and emission 445 nm). Gradient elution (solvents 0.2 M sodium acetate and 15 mM 1-octanesulfonic acid sodium salt, adjusted to pH 4.9 with acetic acid, and acetonitrile) RP-LC fluorimetric (excitation 252 nm, emission 500 nm) and DAD detection with gradient elution (solvents 0.05 M phosphoric acid and methanol/ acetonitrile)

120a

Vasconcelos et al. (2007)

Free 65.3 (Arabica)a 31.0 (Robusta)a Acid-soluble conjugates 10.5 (Arabica)a 13.4 (Robusta)a Acid-insoluble conjugates 9.7 (Arabica)a 7.2 (Robusta)a

Casal et al. (2004)

Ion-pair RP-LC fluorimetric detection (excitation 340 nm and emission 445 nm). Gradient elution (solvents 0.2 M sodium acetate and 15 mM 1-octanesulfonic acid sodium salt, adjusted to pH 4.9 with acetic acid, and acetonitrile) Ion-pair RP-LC fluorimetric detection (excitation 340 nm and emission 445 nm). Gradient elution (solvents 0.2 M sodium acetate and 15 mM 1-octanesulfonic acid sodium salt, adjusted to pH 4.9 with acetic acid, and acetonitrile) RP-LC-UV with isocratic elution (solvents water and methanol)

30.3–44.4

Cirilo et al. (2003)

84–137

Oliveira et al. (2005)

1.5a

Sridevi et al. (2009)

References

Continued

70  Chapter 2  QUALITY AND SAFETY ISSUES

Table 2.2  Main Results and Experimental Conditions Applied for the Determination of BAs in Coffee Beans and Coffee Derivatives—cont’d Roasted coffee beans

30

Putrescine, cadaverine, serotonin, tyramine, spermidine, and spermine (free acid-soluble conjugates acidinsoluble conjugates)

Roasted coffee beans

Not reported

Ground roasted coffees

16

Instant coffees

68

Instant coffees

4

Turkish coffees

10

Coffee brews

16

Instant coffee brews

4

Putrescine, spermidine, spermine, agmatine, cadaverine, serotonin, histamine, tyramine, tryptamine, and phenylethylamine Spermine, spermidine, putrescine, histamine, tyramine, serotonin phenylethylamine, and cadaverine, Serotonin, cadaverine, tyramine, spermidine, putrescine, histamine, agmatine, phenyletylamine, and spermine Spermine, spermidine, putrescine, histamine, tyramine, phenylethylamine, cadaverine, and serotonin Cadaverine, tryptamine, phenylethylamine, spermidine, spermine, histamine, serotonin, and tyramine Spermine, spermidine, putrescine, histamine, tyramine, phenylethylamine, cadaverine, and serotonin Spermine, spermidine, putrescine, histamine, tyramine, phenylethylamine, cadaverine, and serotonin

TCA 5%. Free biogenic amines: determined directly from the supernatant. Conjugated amines: extracted by hydrolyzing an aliquot of the supernatant with 12 M HCl Acid-insoluble conjugates: residue was washed two times with 5% TCA and neutralized with 1.0 M NaOH. An aliquot of the resuspended residue was then hydrolyzed as described above. The hydrolyzed suspensions were filtered (0.45 μm), taken to dryness under a nitrogen stream (50°C), and resuspended in 1.0 mL of 5% TCA ionpair cleanup with bis(2-ethylhexyl) phosphate. Derivatization using dansyl chloride TCA 5%, centrifugation (10,000g for 5 min) and filtration (0.45 μm). Postcolumn derivatization with o-phthalaldehyde TCA 5%, SPE (C18 sorbent). Derivatization using dansyl chloride TCA 5% and filtration (0.45 μm). Postcolumn derivatization with o-phthalaldehyde

TCA 5%, SPE (C18 sorbent). Derivatization using dansyl chloride TCA 5%, centrifugation (10,400g/10 min) and filtration [Whatman (42)]. Derivatization with benzoylchloride TCA 5%, SPE (C18 sorbent). Derivatization using dansyl chloride TCA 5%, SPE (C18 sorbent). Derivatization using dansyl chloride

Chapter 2  QUALITY AND SAFETY ISSUES   71

RP-LC fluorimetric (excitation 252 nm, emission 500 nm) and DAD detection with gradient elution (solvents 0.05 M phosphoric acid and methanol/acetonitrile)

Free 4.6 (Arabica)a 6.5 (Robusta)a

Casal et al. (2004)

Ion-pair RP-LC fluorimetric detection (excitation 340 nm and emission 445 nm). Gradient elution (solvents 0.2 M sodium acetate and 15 mM 1-octanesulfonic acid sodium salt, adjusted to pH 4.9 with acetic acid, and acetonitrile) RP-LC-UV with gradient elution (solvents water and acetonitrile)

2.8 (French roasted)a 6.1 (American roasted)a

Cirilo et al. (2003)

32.45–85.85

Restuccia et al. (2015a,b)

Ion-pair RP-LC fluorimetric detection (excitation 340 nm and emission 445 nm). Gradient elution (solvents 0.2 M sodium acetate and 15 mM 1-octanesulfonic acid sodium salt, adjusted to pH 4.9 with acetic acid, and acetonitrile) RP-LC-UV with gradient elution (solvents water and acetonitrile)

2.8–27.6

Leite da Silveira et al. (2007)

13.30–19.75

Restuccia et al. (2015a,b)

RP-LC-DAD with gradient elution (solvents methanol and acetate buffer)

126.0–325.2

Ozdestan (2014)

RP-LC-UV with gradient elution (solvents water and acetonitrile)

3.04–9.88

Restuccia et al. (2015a,b)

RP-LC-UV with gradient elution (solvents water and acetonitrile

3.43–4.23

Restuccia et al. (2015a,b)

Continued

72  Chapter 2  QUALITY AND SAFETY ISSUES

Table 2.2  Main Results and Experimental Conditions Applied for the Determination of BAs in Coffee Beans and Coffee Derivatives—cont’d Instant coffees brews

68

Turkish coffee brews

10

Coffee liqueurs

5

a

Mean value.

Serotonin, cadaverine, tyramine, spermidine, putrescine,histamine, agmatine, phenyletylamine, and spermine Cadaverine, tryptamine, phenylethylamine, spermidine, spermine, histamine, serotonin, and tyramine Methylamine, dimethylamine, ethylamine, diethylamine, morfoline, amylamine, isobuthylamine, isoamylamine, piperidine, 2-methylbutylamine, isopropylamine, pyrrolidine, phenylethylamine, 1.3-diaminopropane, putrescine, cadaverine, histamine, and tyramine

TCA 5% and filtration (0.45 μm). Postcolumn derivatization with o-phthalaldehyde

TCA 5%, centrifugation (10,400g/10 min) and filtration [Whatman (42)]. Derivatization with benzoylchloride Dispersive liquid-liquid microextraction (DLLME) with simultaneous derivatization using isobutyl chloroformate

Chapter 2  QUALITY AND SAFETY ISSUES   73

Ion-pair RP-LC fluorimetric detection (excitation 340 nm and emission 445 nm). Gradient elution (solvents 0.2 M sodium acetate and 15 mM 1-octanesulfonic acidsodium salt, adjusted to pH 4.9 with acetic acid, and acetonitrile) RP-LC-DAD with gradient elution (solvents methanol and acetate buffer)

0.08–0.572

Leite da Silveira et al. (2007)

5.68–48.88

Ozdestan (2014)

GC-MS with DB-5MS capillary column. Carrier gas: helium with a constant flow of 1 min/mL and gradient temperature

0.35–4.35

Cunha et al. (2017)

74  Chapter 2  QUALITY AND SAFETY ISSUES

as prevailing amines. In this case, the reduced BAs concentrations in brews could be related to an incomplete solubilization of BAs from instant coffee. In fact, although BAs in ground coffee are mostly in the free form, their conjugated forms should be taken into account since they are not water soluble (Casal et al., 2005). In instant coffee analysis, TCA was added directly to the powder, while in this case, water was added first to the ground coffee and then the infusion was subjected to acid extraction. More recently Cunha et al. (2017) evaluated the presence of 18 BAs in different liqueurs, including 5 coffee liqueurs. For these kind of samples, it was found a mean total BAs content never exceeding 1.75 ppm with the volatile amines ME, ET, and dimethylamine showing the higher mean content followed by nonvolatile amines morpholine and PUT. Overall, coffee, honey, and fruits liqueurs had significantly higher levels of BA than those found in milk and herb liqueurs. The variability observed between samples was influenced by the type of components as well as by the different modes of production (homemade or industrial) as homemade sample had significantly higher amounts of BA than industrial samples.

2.6 Cocoa 2.6.1  BAs in Cocoa Beans Cocoa beans are harvested from the Theobroma trees and available in the market after fermentation and drying processes. According to the literature, different subspecies can be identified and classified within three cultivars: Criollo (fine or flavor), Forastero (bulk), and their natural hybrid Trinitario (fine or flavor) (Belščak et  al., 2009). However, it should be underlying as in the recent years, a number of new hybrid varieties have been developed in order to obtain beneficial sensory traits or/and more resistant to adverse environmental conditions (Lachenaud et al., 2007). The appropriate climate for the cocoa trees growth can be found in quite a limited region (10°N and 10°S of the Equator) making the global production of cocoa highly concentrated in West African, South America, and Asia (ICCO, 2016). In particular, the world leaders in cocoa beans production are Ivory Coast, Ghana, Indonesia, Nigeria, Cameroon, Brazil, Ecuador, Dominican Republic, and Malaysia, supplying about 90% of the world production (Bordiga et al., 2015; Jahurul et al., 2013; Table 2.3). Recently, cocoa has become the target of increased scientific research as consequence of its beneficial properties for human health strictly related to the abundance of some phenolic compounds with relevant antioxidant potential, such as epicatechin, catechin, and procyanidins (Ellam and Williamson, 2013). Different cocoa varieties as

Chapter 2  QUALITY AND SAFETY ISSUES   75

well as geographical region of cultivation and manufacture processes may affect the chemical composition of cocoa seeds and cocoa derivatives (Bertazzo et al., 2011). Cocoa beans represent the raw material used in the manufacture of finial products for consumption such as cocoa powder, chocolate, and other derivatives highly valued by consumers (Belščak et al., 2009). Low concentration of BAs is important to human health; however, high levels of some amines cause adverse effects. Low levels of PHE in cocoa products are desirable due to its associated aphrodisiac effects and the presence of PHE and N-acylethanolamine in cocoa and chocolate is always associated to the mood lifting and heightened sensitivity (Afoakwa, 2008). In addition, hypertensive crisis can be associated to high levels of TYR, TRP, while HIS can induce allergic-type reactions and headache (Glória, 2005). The high concentration of proteins found in cocoa supplies provides the substrate that can be easily hydrolysable by yeasts, filamentous fungi, lactic acid, and acetic acid bacteria. This biological pathway, providing FAAs undergoing decarboxylase reactions, leads to the BA synthesis (Granvogl et al., 2006). The pH during fermentation processes also influence the decarboxylase activity of enzymes that is amplified at low values, due to the protection mechanism of bacteria against the acid medium (Oracz and Nebesny, 2014). Literature data report on an optimum pH for the activity of amino acid decarboxylases in the range of 4.0–5.5 (Shukla et al., 2010). The quality of cocoa derivative products appears strongly influenced from technological operations, and fermentation of cocoa beans and the sanitary conditions prevalent during cocoa processing can affect levels and profiles of BAs. For this reason, fermentation and roasting can represent a crucial point in the increase of BAs concentration and/or in the formation of new ones. In particular, roasting represents the treatment that more determine the concentration of bioactive compounds in the final products. The consequence of roasting treatments on flavor, color intensity, and texture changes make this process important for the organoleptic characteristics of the commercial products (Oliviero et al., 2009). In fact, during roasting the temperatures in the range 110–160°C and the duration of the treatments substantially affected the omnidirectional transformations of biomolecules, leading to both degradation and formation of new substances (Farah and Zaibunnisa, 2012). Recently, it has been reported that in cocoa beans the amino acid oxidative decarboxylation can also be obtained during food processing (Ormanci and Colakoglu, 2017), suggesting a new chemical, heat-induced formation of BAs. It follows that, in addition to the amino acid catabolism produced by microorganisms, amino acids can also be degraded chemically as a consequence of thermal treatment of foods (Hidalgo and Zamora, 2016).

76  Chapter 2  QUALITY AND SAFETY ISSUES

Table 2.3  Main Results and Experimental Conditions Applied for the Determination of BAs in Cocoa Beans and Cocoa Derivatives Sample

N Samples

BAs

Extraction/Purification

Unfermented cocoa beans Fermented (7 days) cocoa beans Roasted cocoa beans Fermented (7 days) and roasted cocoa beans

2

Phenylethylamine, 2methylpropilamine, 2-methylbutilamine, 3-methylbutilamine

Roasted (150°C and 5% humidity) cocoa beans

8

Phenylethylamine, tyramine, trypatamine, serotonine, dopamine

Unfermented cocoa beans Fermented cocoa beans (7 days)

1

Cocoa bean Cocoa powder Dark chocolate

2 1 1

Milk chocolate

1

Spermine, spermidine, putrescine, agmantine, tryptamine, tyramine, cadaverine, serotonine, histamine, phenylethylamine Norepinephine, tyramine, dopamine, serotonine, normetanephrine, levodopa Tyramine, histamine, phenylethylamine, serotonine, octopamine, dopamine, tryptamine, putrescine, cadaverine, agatine, spermine, spermidine

Proteins precipitation was carried out with K4[Fe(CN)6] (15 wt%), followed by Zn(CH3COO)2 (23 wt%), the suspension was centrifuged (15,000 rpm for 10 min). The sample was extracted with n-hexane and to the aqueous phase was added sodium hydrogen carbonate (0.5 mol/L, 40 mL), and the pH was adjusted to 10 with NaOH. After derivatization with dansyl chloride the solution was extracted with dichloromethane. The residue was dissolved in a mixture of acetonitrile and aqueous formic acid and analyzed by LC-MSMS The samples were defatted with 20 mL of petroleum ether (10 min at 6000 rpm). Dried and defatted sample was extracted 0.2 M perchloric acid in an ultrasonic bath, and then centrifuged (45 min at 6000 rpm). Derivatization was accomplished employing dansyl chloride Cocoa bean was extracted with 5% TCA (5 min followed by centrifugation at 11,180g at 4°C for 10 min)

2 2 2

1

Extraction was accomplished with perchloric acid (0.2 M). The samples were then centrifuged for 20 min (4000 rpm) and filtered

Extraction was accomplished with 0.6 M perchloric acid. The samples were then centrifuged (30,000g at 4°C for 20 min). The pellet was further extracted twice with 0.6 M perchloric acid, stirred for 20 min and centrifuged again

Chapter 2  QUALITY AND SAFETY ISSUES   77

Analytical Method

Total BAs Content (ppm)

References

LC-MSMS. Flow rate 0.2 mL/min. Solvent system composed of (A) formic acid in water (0.1%, w/v) and (B) formic acid in acetonitrile (0.1%, w/v). The mass spectrometer was operated in the positive electrospray ionization mode (ESI+) with a spray needle voltage of 3.5 kV and a spray current of 5 A

0.412–0.684

Granvogl et al. (2006)

UHPLC coupled with MS [using an electrospray ionization interface in positive ionization mode (ESI+)] and DAD (254 nm) detectors. The mobile phase was consisted of acetonitrile (solvent A) and water (solvent B) at a flow rate of 0.3 mL/min Chromatographic analysis was performed by ion-pair RP-HPLC coupled with a fluorimetry (340 and 445 nm of excitation and emission, respectively), after postcolumn derivatization with o-phthalaldehyde. The gradient elution of 0.2 mol/L sodium acetate and 15 mmol/L sodium octane sulfonate with pH adjusted to 4.9 (mobile phase A) and acetonitrile (mobile phase B) LC coupled with a fluorimetry (excitation wavelength of λEX= 285 nm and emission wavelength of λEM=315 nm) and a DAD detectors. Gradient elution with acetate buffer (pH = 4.66) (A) and methanol (B) was applied and flow rate of 1.0 mL/min LC coupled with a fluorimetry after postcolumn derivatization with o-phthalaldehyde. The mobile phase consisted of the eluent A as a solution of 0.1 M sodium acetate and 10 mM sodium octane sulfonate adjusted to pH 5.23 with acetic acid; and eluent B was a mixture of solvent B-acetonitrile (6.6:3.4), where solvent B was a solution of 0.2 M sodium acetate and 10 mM sodium octane sulfonate solution adjusted to pH 4.5 with acetic acid

8.03–33.46

Oracz and Nebesny (2014)

12.8

CarmoBrito et al. (2017)

1.412–2.718 1.893–2.062 19.599–30.079

22.3

60.05–345.83 154.27 172.1

Baranowska and Plonka (2015)

3.8

Lavizzari et al. (2006)

Continued

78  Chapter 2  QUALITY AND SAFETY ISSUES

Table 2.3  Main Results and Experimental Conditions Applied for the Determination of BAs in Cocoa Beans and Cocoa Derivatives—cont’d Sample

N Samples

BAs

Extraction/Purification

Conventional cocoa powders Organic cocoa powders Conventional chocolate Organic chocolate Conventional cocoa derivatives Organic cocoa derivatives Cocoa powders Chocolate Cocoa derivatives

1

Tyramine, histamine, phenylethylamine, serotonine, putrescine, cadaverine, spermine, spermidine

Extraction was accomplished with perchloric acid 0.6 M. The mixture was homogenized (vortex at 40 Hz for 5 min), centrifuged (9000g for 15 min), filtered (syringe filter 0.45 μm), collected in a plastic vial and purified by SPE on a C18 sorbent. Derivatization was accomplished employing dansyl chloride

Extraction was accomplished with perchloric acid 0.6 M. The mixture was homogenized (vortex at 40 Hz for 5 min), centrifuged (9000g for 15 min), filtered (syringe filter 0.45 μm), and purified by SPE on a C18 sorbent

Conventional cocoa powders Organic cocoa powders Conventional chocolate Organic chocolate Conventional cocoa derivatives Organic cocoa derivatives

3

Tyramine, histamine, phenylethylamine, serotonine, putrescine, cadaverine, spermine, spermidine Tyramine, histamine, phenylethylamine, serotonine, putrescine, cadaverine, spermine, spermidine

2 7 3 11 2 3 8 4

3 12 13 10 7

Extraction was accomplished with perchloric acid 0.6 M. The mixture was homogenized (vortex at 40 Hz for 5 min), centrifuged (9000g for 15 min), filtered (syringe filter 0.45 μm), and purified by SPE on a C18 sorbent

Chapter 2  QUALITY AND SAFETY ISSUES   79

Analytical Method

Total BAs Content (ppm)

References

LC interfaced with a UV detector operating at 254 nm. Two solvent reservoirs containing (A) purified water and (B) acetonitrile were used to separate all the BAs with an LC elution programme. Flow was kept constant at 1.2 mL/min

72.3

Restuccia et al. (2015a,b)

5.7–7.0 18.4–65.1 7.7–48.2 29.8–79.0 15.3–20.3

LC interfaced with an ELS detector was employed. The mobile phase were composed by (A) acetonitrile/water 20/80 (v/v) mixture containing trifluoroacetic acid (0.05%, v/v) and (B) acetonitrile/water 20/80 containing trifluoroacetic acid (0.35%, v/v). Flow was kept constant at 0.7 mL/min

5.81–6.94 8.62–18.56 15.36–20.43

Spizzirri et al. (2016a,b)

LC interfaced with an ELS detector was employed. The mobile phase were composed by (A) acetonitrile/water 20/80 (v/v) mixture containing trifluoroacetic acid (0.05%, v/v) and (B) acetonitrile/water 20/80 containing trifluoroacetic acid (0.35%, v/v). Flow was kept constant at 0.7 mL/min

48.9–72.3

Restuccia et al. (2016)

5.7–7.0 30.2–75.3 7.7–48.2 29.8–79.0 15.3–38.1

80  Chapter 2  QUALITY AND SAFETY ISSUES

Interestingly, literature offers an interesting study analyzing the formation of BAs and their changes in cocoa beans during 7 days of traditional fermentation (CarmoBrito et al., 2017). In particular, the authors detected two BAs (TRP and TYR) and two polyamines (SPD and SPM) during the fermentation of cocoa beans. The presence of SPD and SPM in the cocoa beans is expected since these BAs are inherent to plants and all living organisms as they are involved in cell growth, renewal, and metabolism. The collected data displayed as spermidine increased up to the 3rd fermentation day, maintaining the contents throughout fermentation. SPD becomes the predominant BAs from the second day until the end of fermentation. The concentration of TYR increased up to the 4th fermentation day, decreasing afterwards to initial contents. Other BAs, such as PHE, SER, DOP, and HIS which were not found in this study, were reported in the literature for fresh cocoa beans (Guillen-Casla et  al., 2012). These differences can be a consequence of various cultivars, region of cultivation, growing conditions, degree of ripening, postharvest processes, and storage conditions. This work also underlines the relationship between the BAs profile and total phenolic compounds, anthocyanins contents and the scavenging capacity against ABTS radical. In particular, three stages can be pointed out during the fermentation. At the beginning high levels of TRP, phenolics, and scavenging capacity was observed. During the fermentation, the level of BAs increase, while at the end of the procedure the highest SPD levels and total acidity was observed but this is associated to the lowest total phenolic compounds and anthocyanins contents. The BAs [TYR, PHE, TRP, SER, and dopamine (DOP)] were also identified and quantified in different varieties of raw cocoa beans from selected geographic regions (Forastero, Nacional, Trinitario, UAF hybrid, and T × UAF hybrid cultivars) (Oracz and Nebesny, 2014). The recorded BA profiles appear quite similar, but considerable variations in concentrations of individual species were found. In particular, Trinitario beans from Papua New Guinea exhibited the highest total content of BAs, followed by UAF hybrid from Ghana, while Forastero from Brazil contained the lowest amounts of these compounds, justifying these differences as a consequence of various cultivars as well as growing conditions employed (Bertazzo et al., 2011). The most prevalent amine in fermented and dried cocoa beans was TYR, while considerable amounts of TRP and PHE were also found. This study also displayed the relationship between pH and BAs content and the total BA content and pH values. It was observed that the pH of tested cocoa beans ranged from 5.10 to 6.19, and these results are consistent with the literature data (Emmanuel et al., 2012). According to the literature data, the obtained results revealed that the samples with pHs in the range of 5.10–5.29 had a significantly higher content of BAs, compared to samples with pH above 5.58 (Shukla et al., 2010).

Chapter 2  QUALITY AND SAFETY ISSUES   81

Furthermore, the impact of roasting processes on the profile and levels of BAs was evaluated. In particular, raw cocoa beans were roasted at different temperatures (ranging from 110 to 150°C) and air humidities (0.3%–5.0%), and the data clearly show that as in all samples the roasting parameters influenced the levels of each BAs. Roasted cocoa beans contained mainly PHE, followed by TYR, TRP, SER, and DOP, and the highest amount of BAs was detected at the highest temperatures and in the air with increased humidity. Chemical modification of FAAs caused by the treatment at high temperature can be recognized as the principal cause of this effect. Studies carried out in cocoa or in model systems with the amino acids asparagine, phenylalanine, and histidine confirming the production of the corresponding amines by Strecker degradation in the presence of α-dicarbonyl compounds formed during the Maillard reaction or lipid peroxidation (Granvogl et  al., 2006; Zamora et  al., 2012; Hidalgo et  al., 2013). In this regard, pH, amount of oxygen, time, temperature, as well as the presence of other compounds, such as amino acids or antioxidants have a key role in the production of the reactive carbonyl compounds (Hidalgo and Zamora, 2016). In particular, additional amino acids were shown to play an important role in the preferential formation of either Strecker aldehydes or amino acid-derived amines usually increasing the formation of the amine and reducing the formation of the Strecker aldehyde (Hidalgo and Zamora, 2016).

2.6.2  BAs in Cocoa-Based Products The cocoa derivatives supply chain is very long, complex and includes many different actors. The cocoa beans from several local farmers are collected and often mixed by local buyers, traders, local buying stations, and exporters until they reach the cocoa-derivatives manufacturing, mostly located in Europe and North America (Saltini et al., 2013). Cocoa derivatives are prepared by specific technological processes starting from raw cocoa beans materials but in this case, the determination and the comparison of BAs concentration as well as the reading of the results is more complicated because the technological parameters and the raw materials are quite different. In effect in the literature, there are very few studies with great heterogeneity of the samples and with different analyzed BAs. Mayr and Schieberle (2012) monitored BAs concentration in chocolate (75% cocoa) showing as SPD, ethanolamine, TYR, and PHE were the most abundant BAs. However, quite a long spontaneous fermentation process usually go through by cocoa, the concentrations of BAs were lower when compared to other fermented foodstuffs (salami and cabbage), but in the same order of magnitude.

82  Chapter 2  QUALITY AND SAFETY ISSUES

An extensive analysis was carried out by Restuccia et al. (2015a,b) reporting the distribution of BAs in different commercial cocoa-based samples. In particular, the quantities of total BAs ranged from 5.7 to 79.0 μg/g, with wide variations depending on the analyzed samples. BAs present in all samples were HIS and TYR, while PUT, SPD, and SPM were present in most of the samples at lower concentrations. CAD was present only in some samples as this BA is not considered a cocoa quality marker, being related more to hygienic conditions of animal products such as meat, fish, and cheese (Loizzo et al., 2013). Surprisingly, two typical cocoa amines (SER and PHE) are present only in few samples due to the employing of other components in the preparation of derivatives. In effect, a further increase of BAs was observed as a consequence of the presence of other ingredients, such as hazelnut, milk powder, corn syrup, or coffee containing relevant BAs quantities by themselves. Considering total BA concentrations, it should be underlined that the obtained results are quite different from previous researches (Mayr and Schieberle, 2012; Oracz and Nebesny, 2014) due to the differences regarding to region of cultivation, growing conditions, degree of ripening, technological processes, and storage conditions. Interestingly, the same authors reported a comparison with BAs profiles between several samples of conventional, organic, and fairtrade cocoa-derivatives (Restuccia et al., 2016; Spizzirri et al., 2016a,b). Generally speaking, for all product categories lower amounts of BAs for the organic samples were detected with respect to their conventional counterparts, as a consequence of the different agricultural practices employed in the production of both organic or conventional cocoa seeds. It could be hypothesized that organic farming rules coupled with the strict quality control of the single-source cocoa limit the accumulation of BAs. Regarding this aspect, as well as the hygienic conditions of raw material, fermentation, and postharvest processes (roasting in particular), in relation with BA formation and increase are the key points. In effect, organic farming requires rigorous application of prescribed standards with strict credible certification and inspection regimes. It follows that there is general consensus among chocolate industry experts that the market for fair trade and organic cocoa will be increasingly restricted to producers of high-quality cocoa. Moreover, organic cacao is typically shade grown, meaning it is grown under the canopy of other rainforest plants rather than in deforested swaths, producing cacao plants much more resistant to disease. In general, the concentrations of BAs seem to increase when passing from cocoa to chocolate and finally to confectionary, reaching the highest values for powers used to prepare cocoa desserts both for organic and conventional products. In effect, every step in the technological processes can be a source of new contaminates and/or the

Chapter 2  QUALITY AND SAFETY ISSUES   83

temperature applied during each phase can promote BA thermogenic formation. This general trend could indicate that the most complex is the production process, and the longer the list of ingredients the higher is the value of total BAs, as already stated for other foods (Saccani et al., 2005). This is particularly true for conventional products, while is less pronounced for organic ones, where not only cocoa beans but also most of the other ingredients and additives are certified as organic.

2.7 Conclusions BA accumulation in foods is a multifactorial phenomenon affected by many factors interacting with each other, the combinations of which are numerous, variable, and product specific. As BAs are mainly formed by amino acid decarboxylase-positive microorganisms, amines can accumulate in many foods and beverages supporting the microbial growth and activity during manufacture, handling, and/or storage. It follows that high amounts of BAs may be found in foods as a consequence of the use of poor-quality raw materials, microbial contamination, and inappropriate conditions during processing, as well as microbial contamination and inadequate conditions during storage. In particular, tea, coffee, and cocoa undergo very complex production processes involving many stakeholders, partners, and traders in different parts of the world sometimes applying diverse quality and safety standards. Although coffee and tea infusions generally showed low BAs concentrations, they can be consumed in large amounts during the day and, at the same time, other BAs containing foods can be ingested as well. On the contrary, cocoa-based products and mostly chocolate, contained higher BAs quantities. Considering that chocolate is one of the most craved food, BAs intake coming from this product should not be neglected. All these aspects justify the efforts of the food industry to reduce the occurrence of BAs in these kinds of products. This can be achieved mainly by the assurance and maintenance of high hygienic quality of raw materials and production processes in order to limit the contamination with aminogenic microorganisms. At the same time, it should be necessary the application of specific conditions and/or production techniques aiming either to inhibit/eliminate microorganisms with aminogenic potential or to prevent the growth and minimize the decarboxylase activity of microorganisms.

References Afoakwa, E.O., 2008. Cocoa and chocolate consumption—are there aphrodisiac and other benefits for human health? South Afr. J. Clin. Nutr. 21, 107–113.

84  Chapter 2  QUALITY AND SAFETY ISSUES

Amorim, H.V., Basso, L.C., Crocomo, O.J., Teixeira, A.A., 1977. Polyamines in green and roasted coffee. J. Agric. Food Chem. 25, 957–958. Badrie, N., Bekele, F., Sikora, E., Sikora, M., 2015. Cocoa agronomy, quality, nutritional, and health aspects. Crit. Rev. Food Sci. Nutr. 55, 620–659. Başkan, S., Tezcan, F., Köse, S., Öztekin, N., Erim, F.B., 2010. Non-ionic micellar electrokinetic chromatography with laser-induced fluorescence: a new method tested with biogenic amines in brined and dry-salted fish. Electrophoresis 31, 2174–2179. Baranowska, I., Płonka, J., 2015. Simultaneous determination of biogenic amines and methylxanthines in foodstuff-sample preparation with HPLC-DAD-FL analysis. Food Anal. Methods 8, 963–972. Bekedam, E.K., Schols, H.A., Van Boekel, M.A.J.S., Smit, G., 2006. High molecular weight melanoidins from coffee brew. J. Agric. Food Chem. 54, 7658–7666. Belščak, A., Komes, D., Horžić, D., Ganić, K., Karlović, D., 2009. Comparative study of commercially available cocoa products in terms of their bioactive composition. Food Res. Int. 42, 707–716. Bertazzo, A., Comai, S., Brunato, I., Zancato, M., Costa, C.V.L., 2011. The content of protein and non-protein (free and protein-bound) tryptophan in Theobroma cacao beans. Food Chem. 124, 93–96. Bordiga, M., Locatelli, M., Travaglia, F., Coïsson, J.D., Mazza, G., Arlorio, M., 2015. Evaluation of the effect of processing on cocoa polyphenols: antiradical activity, anthocyanins and procyanidins profiling from raw beans to chocolate. Int. J. Food Sci. Technol. 50, 840–848. Brückner, H., Flassig, S., Kirschbaum, J., 2012. Determination of biogenic amines in infusions of tea (Camellia sinensis) byHPLC after derivatization with 9-­fluorenylmethoxycarbonyl chloride (FMOC-Cl). Amino Acids 42, 877–885. Butt, M.S., Sultan, M.T., 2011. Coffee and its consumption: benefits and risks. Crit. Rev. Food Sci. Nutr. 51, 363–373. CarmoBrito, B.D.N., Campos Chisté, R., da Silva Pena, R., Abreu Gloria, M.B., Santos Lopes, A., 2017. Bioactive amines and phenolic compounds in cocoa beans are affected by fermentation. Food Chem. 228, 484–490. Casal, S., Mendes, E., Alves, R.M., Alves, R.C., Oliveira, M.B.P.P., Ferreira, M.A., 2004. Free and conjugated biogenic amines in green and roasted coffee beans. J. Agric. Food Chem. 52, 6188–6192. Casal, S., Mendes, E., Oliveira, M.B.P.P., Ferreira, M.A., 2005. Roast effects on coffee free and conjugated polyamines. Electron. J. Environ. Agric. Food Chem. 4, 1063–1068. Choi, M.-Y., Choi, W., Park, J.H., Lim, J., Kwon, S.W., 2010. Determination of coffee origins by integrated metabolomic approach of combining multiple analytical data. Food Chem. 121, 1260–1268. Cirilo, M.P.G., Coelho, A.F.S., Araujo, C.M., Goncalves, F.R.B., Nogueira, F.D., Gloria, M.B.A., 2003. Profiles and levels of bioactive amines in green and roasted coffee. Food Chem. 82, 397–402. Crozier, A., Hiroshi, A., Tomàs-Barbéran, F., 2012. Teas, Cocoa and Coffee Plant Secondary Metabolites and Health. Wiley-Blackwell, John Wiley & Sons, Chichester, West Sussex. Cunha, S.C., Lopes, R., Fernandes, J.O., 2017. Biogenic amines in liqueurs: influence of processing and composition. J. Food Compos. Anal. 56, 147–155. Daniel, D., dos Santos, V.B., Vidal, D.T.R., do Lago, C.L., 2015. Determination of biogenicamines in beer and wine by capillary electrophoresis-tandem mass spectrometry. J. Chromatogr. A 1416, 121–128. De Mey, E., Drabik-Markiewicz, G., De Maere, H., Peeters, M.-C., Derdelinckx, G., Paelinck, H., Kowalska, T., 2012. Dabsylderivatisation as an alternative for dansylation in the detection of biogenic amines in fermented meat products by reversed phase high performance liquid chromatography. Food Chem. 130, 1017–1023.

Chapter 2  QUALITY AND SAFETY ISSUES   85

Dias, E.C., Pereira, R.G.F.A., Borem, F.M., Mendes, E., de Lima, R.R., Fernandes, J.O., Casal, S., 2012. Biogenic amine profile in unripe arabica coffee beans processed according to dry and wet methods. J. Agric. Food Chem. 60, 4120–4125. Diby, L., Kahia, J., Kouamé, C., Aynekulu, E., 2017. Tea, coffee, and cocoa. In: Encyclopedia of Applied Plant Sciences. second ed.. vol. 3. Academic Press, Cambridge, MA, pp. 420–425. Ellam, S., Williamson, G., 2013. Cocoa and human health. Annu. Rev. Nutr. 33, 105–128. Emmanuel, O.A., Jennifer, Q., Agnes, S.B., Jemmy, S.T., Firibu, K.S., 2012. Influence of pulp-pre conditioning and fermentation on fermentative quality and appearance of Ghanaian cocoa (Theobroma cacao) beans. Int. Food Res. J. 19, 127–133. Erim, F.B., 2013. Recent analytical approaches to the analysis of biogenic amines in food samples. TrAC Trends Anal. Chem. 52, 239–247. European Food Safety Authority (EFSA), 2011. Scientific opinion on risk based control of biogenic amine formation in fermented foods. EFSA J. 9 (2393), 1–12. Farah, D.M.H., Zaibunnisa, A.H., 2012. Optimization of cocoa beans roasting process using response surface methodology based on concentration of pyrazine and acrylamide. Int. Food Res. J. 19, 1355–1359. Food and Agriculture Organization of the United Nations (FAO), 2013. FAOStat. Available from: http://faostat.fao.org/. Gianotti, V., Chiuminatto, U., Mazzucco, E., Gosetti, F., Bottaro, M., Frascarolo, P., Gennaro, M.C., 2008. A new hydrophilicinteractionliquidchromatography tandem mass spectrometrymethod for the simultaneousdetermination of sevenbiogenicamines in cheese. J. Chromatogr. A 1185, 296–300. Glória, M.B.A., 2005. Bioactive amines. In: Hui, H., Nollet, L.L. (Eds.), Handbook of Food Science, Technology and Engineering. 1. Taylor & Francis, New York, pp. 13–32. Granvogl, M., Bugan, S., Schieberle, P., 2006. Formation of amines and aldehydes from parent amino acids during thermal processing of cocoa and model systems: new insights into pathways of the Strecker reaction. J. Agric. Food Chem. 54, 1730–1739. Guillen-Casla, V., Rosales-Conrado, N., Leon-Gonzalez, M.E., Perez-Arribas, L.V., Polo-Diez, L.M., 2012. Determination of serotonin and its precursors in chocolate samples by capillary liquid chromatography with mass spectrometry detection. J. Chromatogr. A 1232, 158–165. Han, W.-Y., Xu, J.-M., Wei, K., Shi, R.-Z., Ma, L.-F., 2013. Soil carbon sequestration, plant nutrients and biological activities affected by organic farming system in tea (Camellia sinensis (L.) O. Kuntze) fields. Soil Sci. Plant Nutr. 59, 727–739. Hernández-Cassou, S., Saurina, J., 2011. Derivatization strategies for the determination of biogenic amines in wines by chromatographic and electrophoretic techniques. J. Chromatogr. B 879, 1270–1281. Hidalgo, F.J., Zamora, R., 2016. Amino acid degradations produced by lipid oxidation products. Crit. Rev. Food Sci. Nutr. 56, 1242–1252. Hidalgo, F., Navarro, J.L., Delgado, R.M., Zamora, R., 2013. Histamine formation by lipid oxidation products. Food Res. Int. 52, 206–213. Homma, S., 2001. Chemistry II: non-volatile compounds, part II. In: Clarke, R.J., Vitzthum, O.G. (Eds.), Coffee, Recent Developments. Blackwell Science, Oxford, pp. 50–67. ICCO, 2016. Quarterly Bulletin of Cocoa Statistics. Available from: http://www.icco.org/ statistics/quarterlybulletin-cocoa-statistics.html. [(Accessed May 31, 2016)]. Jacobi, J., Andres, C., Schneider, M., Calizaya, M.P.P., Rist, S., 2014. Carbon stocks, tree diversity, and the role of organic certification in different cocoa production systems in Alto Beni Bolivia. Agrofor. Syst. 288, 1117–1132. Jahurul, M.H.A., Zaidul, I.S.M., Norulaini, N.A.N., Sahena, F., Jinap, S., Azmir, J., Omar, A.K.M., 2013. Cocoa butter fats and possibilities of substitution in food products concerning cocoa varieties, alternative sources, extraction methods, composition, and characteristics. J. Food Eng. 117, 467–476.

86  Chapter 2  QUALITY AND SAFETY ISSUES

Juraj, Č., Cviková, P., Peter, H., Miroslava, K., Simona, K., Lukáš, H., Marek, B., Lenka, T., Bučko, O., Jana, T., 2017. The proteinsdegradation in dry curedmeat and methods of analysis: a review. J. Microbiol. Biotechnol. Food Sci. 7, 209–220. Kalač, P., 2009. Recent advances in the research on biological roles of dietary polyamines in man. J. Appl. Biomed. 7, 65–74. Lachenaud, P., Paulin, D., Ducamp, M., Thevenin, J.-M., 2007. Twenty years of agronomic evaluation of wild cocoa trees (Theobroma cacao L.) from French Guiana. Scientia Hort. 113, 313–321. Lavizzari, T., Veciana-Nogués, T.M., Bover-Cid, S., Mariné-Font, A., Vidal-Carou, C.M., 2006. Improved method for the determination of biogenic amines and polyamines in vegetable products by ion-pair high-performance liquid chromatography. J. Chromatogr. A 1129, 67–72. Leite da Silveira, T.M., Tavares, E., Gloria, M.B.A., 2007. Profile and levels ofbioactive amines in instant coffee. J. Food Compos. Anal. 20, 451–457. Loizzo, M.R., Menichini, F., Picci, N., Puoci, F., Spizzirri, U.G., Restuccia, D., 2013. Technological aspects and analytical determination of biogenic amines in cheese. Trends Food Sci. Technol. 30, 38–55. Mayr, C.M., Schieberle, P., 2012. Development of stable isotope dilution assays for the simultaneous quantitation of biogenic amines and polyamines in foods by LC-MS/ MS. J. Agric. Food Chem. 60, 3026–3032. Mazzucco, E., Gosetti, F., Bobba, M., Marengo, E., Robotti, E., Gennaro, M.C., 2010. High-performance liquid chromatography-ultraviolet detection method for the simultaneous determination of typical biogenic amines and precursor amino acids. J. Agric. Food Chem. 58, 127–134. Melgarejo, E., Urdiales, J.L., Sánchez-Jiménez, F., Medina, M.A., 2010. Targeting polyamines and biogenic amines by green tea epigallocatechin-3-gallate. Amino Acids 38, 519–523. Méndez, V.E., Bacon, C.M., Olson, M., Petchers, S., Herrador, D., Carranza, C., Trujillo, L., Guadarrama-Zugasti, C., Cordón, A., Mendoza, A., 2010. Effects of fair trade and organic certifications on small-scale coffee farmer households in Central America and Mexico. Renew. Agric. Food Syst. 25, 236–251. Millan, S., Sampedro, M.C., Unceta, N., Goicolea, M.A., Barrio, R.J., 2007. Simple and rapid determination of biogenic amines in wine by liquid chromatography-­ electrospray ionization ion trap mass spectrometry. Anal. Chim. Acta 584, 145–152. Naila, A., Flint, S., Fletcher, G., Bremer, P., Meerdink, G., 2010. Control of biogenic amines in food: existing and emerging approaches. J.Food Sci. 75, R139–R150. Neumann, K., Montag, A., 1983. Beitrag zur Kenntnis einiger Stickstof-fsubstanzen des Tees (Camelia sinensis). Dtsch. Lebensm. Rundsch. 79, 160–164. Nishimura, K., Shiina, R., Kashiwagi, K., Igarashi, K., 2006. Decrease in polyamines with aging and their ingestion from food and drink. J. Biochem. 139, 81–90. Okamoto, A., Sugi, E., Koizumi, Y., Yanagida, F., Udaka, S., 1997. Polyamine content of ordinary foodstuffs and various fermented foods. Biosci. Biotechnol. Biochem. 61, 1582–1584. Oliveira, S.D., Franca, A.S., Gloria, M.B.A., Borges, M.L.A., 2005. The effect ofroasting on the presence of bioactive amines in coffees of different qualities. Food Chem. 90, 287–291. Oliviero, T., Capuano, E., Cammerer, B., Fogliano, V., 2009. Influence of roasting on the antioxidant activity and HMF formation of a cocoa bean model systems. J. Agric. Food Chem. 57, 147–152. Onal, A., Tekkeli, S.E.K., Onal, C., 2013. A review of the liquidchromatographicmethods for the determination of biogenicamines in foods. Food Chem. 138, 509–515. Oracz, J., Nebesny, E., 2014. Influence of roasting conditions on the biogenic amine content in cocoa beans of different Theobroma cacao cultivars. Food Res. Int. 55, 1–10. Ormanci, H.B., Colakoglu, F.A., 2017. Changes in biogenic amines levels of lakerda (salted atlantic bonito) during ripening at different temperatures. J. Food Process. Preserv. 41, e12736.

Chapter 2  QUALITY AND SAFETY ISSUES   87

Ozdestan, O., 2014. Evaluation of bioactive amine and mineral levels in Turkish coffee. Food Res. Int. 61, 167–175. Palavan-Unsal, N., Arisan, E.D., Terzioglu, S., 2007. Polyamines in tea processing. Int. J. Food Sci. Nutr. 58, 304–311. Restuccia, D., Spizzirri, U.G., Parisi, O.I., Cirillo, G., Picci, N., 2015a. Brewing effect on levels of biogenic amines in different coffee samples as determined by LC-UV. Food Chem. 175, 143–150. Restuccia, D., Spizzirri, U.G., Puoci, F., Picci, N., 2015b. Determination of biogenic amine profiles in conventional and organic cocoa-based products. Food Addit. Contam. A 32, 1156–1163. Restuccia, D., Spizzirri, U.G., De Luca, M., Parisi, O.I., Picci, N., 2016. Biogenic amines as quality marker in organic and fair-trade cocoa-based products. Sustainability 8, 856–866. Restuccia, D., Spizzirri, U.G., Puoci, F., Clodoveo, M.L., Picci, N., 2017. LC with evaporative light-scattering detection for quantitative analysis of organic acids in juices. Food Anal. Methods 10, 704–712. Saccani, G., Tanzi, E., Pastore, P., Cavalli, S., Rey, M., 2005. Determination of biogenic amines in fresh and processed meat by suppressed ion chromatography-mass spectrometry using a cation-exchange column. J. Chromatogr. A 1082, 43–50. Saltini, R., Akkerman, R., Frosch, S., 2013. Optimizing chocolate production through traceability: a review of the influence of farming practices on cocoa bean quality. Food Control 29, 167–187. Sentellas, S., Núñez, Ó., Saurina, J., 2012. Recent advances in the determination of biogenic amines in food samples by (U)HPLC. J. Agric. Food Chem. 60, 3026–3032. Shen, N.Y., Zheng, S.Y., Wang, X.Q., 2017. Determination of biogenic amines in Pu-erh tea with precolumnderivatization by high-performance liquid chromatography. Food Anal. Methods 10, 1690–1698. Shukla, S., Park, H.K., Kim, J.K., Kim, M., 2010. Determination of biogenic amines in Korean traditional fermented soybean paste (Doenjang). Food Chem. Toxicol. 48, 1191–1195. Silla-Santos, M.H., 1996. Biogenic amines: their importance in foods. Int. J. Food Microbiol. 29, 213–231. Spizzirri, U.G., Parisi, O.I., Picci, N., Restuccia, D., 2016a. Application of LC with evaporative light scattering detector for biogenic amines determination in fair trade ­cocoa-based products. Food Anal. Methods 9, 2200–2209. Spizzirri, U.G., Picci, N., Restuccia, D., 2016b. Determination of biogenic amines in tea leaves and infusions extraction efficiency of different solvents and LC-UV. J. Anal. Met. Chem. 8715287, 1–10. Sridevi, V., Giridhar, P., Ravishankar, G.A., 2009. Endogenous polyamine profilesin different tissues of Coffea sp., and their levels during the ontogeny of fruits. Acta Physiol. Plant. 31, 757–764. Valisek, J., 2013. The Chemistry of Food. John Wiley & Sons, New York. Vasconcelos, A.L.S., Franca, A.S., Gloria, M.B.A., Mendonca, J.C.F., 2007. A comparative study of chemical attributes and levels of amines in defective green and roasted coffee beans. Food Chem. 101, 26–32. Vuong, Q.V., 2014. Epidemiological evidence linking tea consumption to human health: a review. Crit. Rev. Food Sci. Nutr. 54, 523–536. Xiao, M.-W., Bai, X.-L., Xu, P.-L., Zhao, Y., Yang, L., Liu, Y.-M., Liao, X., 2017. Rapid determination of gizzerosine in fish meals using microchip capillary electrophoresis with laser-inducedfluorescencedetection. Food Add. Cont. Part A 34, 760–765. Zamora, R., Delgado, R.M., Hidalgo, F.J., 2012. Formation of β-phenylethylamineas a consequence of lipid oxidation. Food Res. Int. 46, 321–325. Zamora, R., León, M.M., Hidalgo, F.J., 2015. Oxidative versus non-oxidative decarboxylation of amino acids: conditions for the preferential formation of either Strecker aldehydes or amines in amino acid/lipid-derived reactivecarbonyl model systems. J. Agric. Food Chem. 63, 8037–8043.

88  Chapter 2  QUALITY AND SAFETY ISSUES

Zhang, M., Fan, H., Fu, Z., Shen, N., Sheng, Q., Wang, X., Zhan, J., Huang, W., 2014. Determination of eight different biogenic amines in Pu’er tea by HPLC. FMFI 3, 66–71. Zhao, H., Zhang, M., Zhao, L., Ge, Y.K., Sheng, J., Shi, W., 2011. Changes of constituents and activity to apoptosis and cell cycle during fermentation of tea. Int. J. Mol. Sci. 12, 1862–1875.

Further Reading Hidalgo, F.J., León, M.M., Zamora, R., 2016. Amino acid decarboxylations produced by lipid-derived reactive carbonyls in amino acid mixtures. Food Chem. 209, 256–261.

GENETIC AND PHENOTYPIC DIVERSITY OF ROBUSTA COFFEE (COFFEA CANEPHORA L.)

3

Kahiu Ngugi⁎, Pauline Aluka† ⁎

Department of Plant Sciences and Crop Protection, College of Agriculture and Veterinary Sciences, University of Nairobi, Nairobi, Kenya †National Agricultural Research Organization (NARO), National Coffee Resources Research Institute (NaCORI), Mukono, Uganda

3.1  The Genetic Diversity of Robusta Coffee (Coffea canephora L.) Assessed by Simple Sequence Repeat Molecular Markers Robusta coffee germplasm that contribute 60% of Uganda’s foreign earnings is under threat from abiotic, biotic, and population pressures. This study assessed the genetic variability among cultivated Robusta coffee (Coffea canephora) that might be utilized to enhance productivity and quality and ultimately improve small-scale farmer earnings. A total of 349 diverse accessions of C. canephora were evaluated using 18, simple sequence repeats markers (SSRs) present in C. canephora linkage groups. Genetic diversity and the F-statistics were estimated with the GenAlEx 6.41 statistical package. Unweighted Pair Group Arithmetic Mean (UPGMA) was used to derive Darwin Neighbor Joining tree. The dissimilarity matrix table of accessions was calculated from principal component analysis (PCA). Analysis of molecular variance (AMOVA) was estimated by Arlequin software. Populations gave a mean allele range of 3–10 and the genetic diversity over loci range was 0.53–0.78. The accessions were grouped into three and had a mean genetic distance of 0.60. Within populations variability was 81.87%, whereas diversity within individuals was 54.05% and that between populations was 17.03%. The inbreeding index was lower than 50% suggesting that outcrossing was prevalent in C. canephora accessions. These results indicated that C. canephora from Uganda has tremendous genetic diversity, which is constantly being enriched Caffeinated and cocoa based beverages. https://doi.org/10.1016/B978-0-12-815864-7.00003-9 © 2019 Elsevier Inc. All rights reserved.

89

90  Chapter 3  GENETIC AND PHENOTYPIC DIVERSITY IN ROBUSTA COFFEE

by the gene flow between the wild and cultivated ­populations. The ­emergence of two predominantly farmer selected landraces of nganda and erecta that differ distinctly in their plant types is also an indication that disruptive selection force of natural selection was key to the evolution of this diversity.

3.1.1 Introduction Robusta coffee contributes 80% of total production in Uganda and is grown on estimated 270,000 hectares (UCDA Annual reports, 2001– 2003). This production has earned the country about 388.4 million US dollars for its 8 million farmers (UCDA Annual reports, 2007–2008). Robusta coffee also known as Coffea canephora contributes 30% of the world’s production. C. canephora is a diploid parent hybridized with Coffea eugenioides to produce Coffea arabica, an allotetraploid (Combes et  al., 2000). There are two predominant forms of C. canephora found in Uganda: the erect type of Robusta coffee, known as erecta (also known as Coffea quillou) and nganda or Coffea ugandae, the spreading type. These two types of Robusta are cultivated together in mixtures and cross easily between themselves (Thomas, 1935). These semiwild forms of coffee with diverse phenotypic characteristics are reported to have tolerance to a number of pests and diseases, besides being high yielding (Prakash et  al., 2005). In recent times, C. canephora has undergone extensive genetic erosion imposed by biotic, abiotic, and human settlement factors which has led to decreased heterozygosity in the germplasm that now faces extinction and needs urgent conservation. DNA molecular markers such as microsatellites or simple sequence repeats (SSRs) are powerful tools that could be utilized to quicken the improvement of marketable traits such as yield and cup quality. SSRs are the molecular markers of choice in marker-assisted selection (MAS) of most crops because, they are widely found in the genome, are codominant, can be multiplexed and easily automated when compared to other marker systems such as AFLP (amplified fragment length polymorphism), RFLPs (restriction fragment length polymorphisms), or RADPs (random amplified DNA polymorphisms) (Aga et al., 2003; Leroy et al., 2005; Prakash et al., 2005). The most recent coffee genetic maps have been extensively constructed using SSR, RFLP, and SNP (single nucleotide polymorphism) markers (Dufour et  al., 2001). SSR markers linked to important agronomic traits of C. canephora would be useful tools in the development of coffee cultivars with superior market-driven traits that are urgently needed to raise coffee production in Uganda. In this study 18 SSR markers were used, of which 14 were from C. canephora clone 126 genetic library (Dufour et al., 2001; Pouncet

Chapter 3  GENETIC AND PHENOTYPIC DIVERSITY IN ROBUSTA COFFEE   91

et al., 2007), three were from C. arabica var “Cattura” (Combes et al., 2000; Rovelli et al., 2000), and one was obtained from a bacterial artificial chromosome (BAC) library (Leroy et  al., 2005). These SSRs were developed at the Centre for International Agricultural Research Development, France (CIRAD) (Billotte et al., 1999) and the primers were synthesized by Eurogentec of South Africa.

3.1.2  Materials and Methods 3.1.2.1  Germplasm Collection In this study, the C. canephora L. germplasm screened included cultivated landraces and gene-bank accessions (Table 3.1). DNA from young leaves of 84 accessions, which included 19 erecta types, 20 nganda types, 18 from Entebbe Botanical Gardens, 15 from crosses, 7 parental materials of the crosses, and 5 controls were selected and screened with 9 SSRs markers as shown in Table 3.4 and in Fig.  3.5A. The accessions from Entebbe Botanical Gardens, the crosses, and their parental materials were regarded as improved germplasm. DNA from 231 leaf samples of Robusta local landraces was also extracted from 14 coffee growing districts as shown in Fig. 3.1. Also, eight elite commercial clones, seven accessions from West and Central Africa and two Ugandan wild types were included. One nganda type was used as the control DNA. Nganda accessions were identified in the field as the spreading trees with weaker upright stems, whereas trees erecta types were the trees with stronger stems and bigger berries. Landraces in districts near forests were sampled after every 5 km in order to minimize duplication (Fig. 3.1 and Table 3.2).

3.1.2.2  DNA Extraction and Amplification Leaf DNA was extracted using mixed alkyltrimethylammonium bromide (MATAB) buffer as explained by Risterucci et  al. (2000) at CIRAD laboratory. DNA quality was improved by the genomic DNA purification Promega Wizard Kit and readjusted to 0.5 ng/μL after calculating the concentration with cocoa standard DNA concentrations in agarose gel. The PCR amplification of SSR loci shown in Table 3.1 was conducted in a 10.0 μL final volume. The volume was made up of 5.0 μL of 0.5 ng/μL genomic DNA, and 5.0 μL of the master mix. The contents and concentrations of the mix were as follows: 10 mM tris-HCL, 50 mM KCl, 0.1% triton X-100, 1.5 nM of Mgcl2, 0.2 pmol of primer, and 0.2 nM of dNTPs (dCTP, dGTP, and dTTP). The primers included 0.01 nM of dATP (reverse primer) and 0.8 nCl [33P]-dATP (forward primer tailed with M13 sequence manufactured by Amersham Pharmacia, Piscataway, NJ). A 0.5 μL Taq DNA polymerase from

Table 3.1  Landraces and Gene-Bank Accessions Assessed for Genetic Diversity Source

Agroecological Zone/Germplasm

Landraces

Western highlands

Lake-Albert Crescent

Southern drylands South East Gene-bank and conserved collections

Lake-Victoria Crescent

Controls

Ugandan wild “nganda” types West and Central Africa controls

Total

Origin

Location Code

Gene-Bank and Controls

Landraces and Controls

Bundibugyo Kabarole Kamwenge Kyenjojo Hoima Kibale Kiboga Kayunga Mubende Mukono Mpigi Rakai Jinja Kamuli Kawanda Hybrids Entebbe Kawanda Kawanda Kibale forest Kawanda West and Central Africa

BU KB KW KJ HM KI KG KY MB MK MP RK JJ KM UC UH EB UE UN UW UN C&G

– – – – – – – – – – – – – – 15 6 12 19 20 7 – 5

11 31 34 37 24 20 8 8 13 4 11 15 3 12 16 8 – – – 2 1 7

84

265

Key: BU, Bundibudyo; HM, Hoima; JJ, Jinja; KB, Kabarole; KG, Kiboga; KI, Kibale; KJ, Kyenjojo; KM, Kamuli; KW, Kamwenge; KY, Kayunga; MB, Mubende; MK, Mukono; MP, Mpigi; RK, Rakai; UC, controlled crosses; UH, hybrids; EB, Entebbe botanical gardens; UE, erecta types; UN, nganda types; C&G, West and Central Africa controls; UW, UN, Ugandan wildand nganda-type controls. Reproduced with permission from Aluka, P., 2013. PhD thesis, University of Nairobi.

Chapter 3  GENETIC AND PHENOTYPIC DIVERSITY IN ROBUSTA COFFEE   93

Fig. 3.1  Map of Uganda showing sites where Robusta coffee germplasm was collected. Reproduced with permission from Aluka, P., 2013. PhD thesis, University of Nairobi.

Promega, Madison, WI, was finally added to the mixture. The whole PCR reaction was denaturated, annealed, and elongated in a PTC-200 thermocycler (MJ and Appendorf Research, Westbury, New York) using a touchdown.

3.1.2.3  Electrophoresis and Allele Coding The PCR products were loaded in a LICOR 4300 automated sequencer (LI-COR Biosciences, Lincoln, Nebraska) in the capillary comb radioactively labeled with a 10-base pair (bp) ladder that migrated in a 25 cm plate in the denaturing polyacrylamide gel. ­ The image bands were labeled as alleles based on fragment size (bp)

Table 3.2  Eighteen SSR Markers Used to Evaluate the Genetic Diversity of the 265 Cultivated C. canephora Accessions SSR Primer

Estimated Allele Position Min

Max

Repeat Type

DL026

No.

Motif

17 A

355

1 15

170

212

TG

265

321

CA

82

112

A

166

210

TG

263

276

AC

137

161

TG

181

206

A

211

245

CA

283

297

AC

358

2 11

364

2 21

368

1 13

384

2 10

394

2 9

429

2 13

442

1 19

445

2 10 2

Primer Sequences (5→3′) F:CGAGACGAGCATAAGAA R:GTGGAATGAAGAATGTAG F:CTATGATGTCTTCCAACCTTCTAAC R:GGTCCAATTCTGTTTCAATTTC F:CATGCACTATTATGTTTGTGTTTT R:TCTCGTCATATTTACAGGTAGGTT F:AGAAGAATGAAGACGAAACACA R:TAACGCCTGCCATCG F:CACATCTCCATCCATAACCATTT R:TCCTACCTACTTGCCTGTGCT F:ACGCTATGACAAGGCAATGA R:TGCAGTAGTTTCACCCTTTATCC F:GCCGTCTCGTATCCCTCA R:GAAGCCCAGAAAGTAGTCACATAG F:CATTCGATGCCAACAACCT R:GGGTCAACGCTTCTCCTG F:CGCAAATCTGAGTATCCCAAC R:TGGATCAACACTGCCCTTC F:CCACAGCTTGAATGACCAGA R:AATTGACCAAGTAATCACCGACT

Sequence Origin

Primer Origin

Species Origin

Leroy 2005

Leroy 2005

C. canephora, clone 126

Dufour 2001

Poncet 2007

C. canephora, clone 126

Dufour 2001

Poncet 2007

C. canephora, clone 126

Dufour 2001

Poncet 2007

C. canephora, clone 126

Dufour 2001

Poncet 2007

C. canephora, clone 126

Dufour 2001

Poncet 2007

C. canephora, clone 126

Dufour 2001

Poncet 2007

C. canephora, clone 126

Dufour 2001

Poncet 2007

C. canephora, clone 126

Dufour 2001

Poncet 2007

C. canephora, clone 126

Dufour 2001

Poncet 2007

C. canephora, clone 126

456

14 273

313

AC

88

124

AC

305

339

CT

135

181

TG

283

321

CA

126

158

GT TG, GA

116

138

230

290

461

2 9

471

2 12

501

2 8

753

2 15

790

2 21

837 477

AC

2 16, 11 16

2 2

F:TGGTTGTTTTCTTCCATCAATC R:TCCAGTTTCCCACGCTCT F:CGGCTGTGACTGATGTG R:AATTGCTAAGGGTCGAGAA F:TTACCTCCCGGCCAGAC R:CAGGAGACCAAGACCTTAGCA F:CACCACCATCTAATGCACCT R:CTGCACCAGCTAATTCAAGC F:GGAGACGCAGGTGGTAGAAG R:TCGAGAAGTCTTGGGGTGTT F:TTTTCTGGGTTTTCTGTGTTCTC R:TAACTCTCCATTCCCGCATT F:CTCGCTTTCACGCTCTCTCT R:CGGTATGTTCCTCGTTCCTC F:CGAGGGTTGGGAAAAGGT R:ACCACCTGATGTTCCATTTGT

Reproduced with permission from Aluka, P., 2013. PhD thesis, University of Nairobi.

Dufour 2001

Poncet 2007

C. canephora, clone 126

Dufour 2001

Poncet 2007

C. canephora, clone 126

Dufour 2001

Poncet 2007

C. canephora, clone 126

Dufour 2001

Poncet 2007

C. canephora, clone 126

Rovelli 2000

Poncet 2004

C. canephora, “Caturra”

Rovelli 2000

Poncet 2004

C. canephora, “Caturra”

Rovelli 2000

Poncet 2004

C. canephora, “Caturra”

Dufour 2001

Poncet 2007

C. canephora, clone 126

96  Chapter 3  GENETIC AND PHENOTYPIC DIVERSITY IN ROBUSTA COFFEE

in the SAGA Generation 2 computer program as described by Combes et al. (2000). As a diploid C. canephora was expected to record a maximum of two alleles per individual.

3.1.2.4  Data Analysis The mean between and within population molecular diversity was estimated with Arlequin version 2 as shown in Tables 3.3 and 3.4 (Schneider et al., 1999). The mean population heterozygosity over loci and F-statistics as shown in Tables 3.3 and 3.4, respectively, were calculated with Gen-Al-Ex 6.41 statistical package (Peakall and Smouse, 2006). The genetic distance dissimilarity was calculated with Darwin4 software developed by CIRAD based on the Dice index (1945) which is equivalent Nei and Li (1979) genetic distance. This is calculated 2 n1,1 as: SG = , where n1,1 is the number of bands shared 2 n1,1 + n1,0 + n 0 ,1 ) by the individuals I and j, n1,0 is the number of bands observed for I and missing for j, and number n0,1 the number of bands observed for j and missing for I. When both I and j were missing, the information given was not considered. The genetic distance were represented graphically as a tree by the factorial analysis of dissimilarity table (FADT) calculated using the Darwin Neighbor Joining UPGMA method as described by Saitou and Nei (1987) shown in Fig. 3.3. The dendrogram shown in Fig.  3.4 was derived from FADT. FADT was also used to generate the geographical distribution of the genetic variation in the form of the linear and nonparametric patterns of PCA, (Fig. 3.5A and B) using the XLSTAT version 2011.2.05 statistical package. The reliability of the tree was evaluated by a bootstrap, 1000 repeated data analysis.

3.1.3 Results The 18 SSR markers were polymorphic as shown by the allelic polymorphism at two loci that differed in fragment size in Fig. 3.2. Kyenjojo (74) populations had the highest total gene copies, followed by Kamwenge (68) and Kabarole (62) districts but the lowest counts came from Jinja (6), Mukono (8), and from DNA controls (6–8) (Table  3.3). Kyenjojo (70), Kamwenge (64.11), and Kabarole (57.44) also had the highest usable gene copies which were also lowest among DNA controls (5.33–5.67). The lowest number of usable (4) and polymorphic loci (4) was recorded in Kamuli population. Jinja district accessions had the most usable loci of 17.0. The highest number of 16 polymorphic loci was found in Kibale district, despite the population having the lowest gene diversity of over 0.50. Kiboga accessions (0.78) had the highest gene diversity over loci, followed by hybrids (0.72) and Kamwenge accessions (0.71). Kamwenge had the highest number of

Table 3.3  Population Diversity Parameters of 265 C. canephora Accessions Estimated According to Nei and Li (1979) for 18 Loci at 50% Level of Missing Data Heterozygosity

Pop

Total Gene Copies

Usable Loci

Poly Loci

Gene Diversity Over Loci

Usable Gene Copies

Alleles

Obs (Ho)

Exp (He)

BU C G UG HM JJ KB KG KI KJ KM KW KY MB MK MP RK UC UH

22 8 6 6 48 6 62 16 40 74 24 68 16 26 8 22 30 32 16

14 16 13 15 15 17 14 7 16 12 4 11 14 8 15 13 11 12 5

14 15 13 12 14 13 14 7 16 12 4 11 14 8 12 13 11 12 5

0.61 0.70 0.67 0.53 0.59 0.53 0.53 0.78 0.50 0.68 0.63 0.71 0.61 0.68 0.56 0.62 0.61 0.62 0.72

20.11 7.33 5.33 5.67 44.56 5.67 57.44 14.33 38.67 70.00 20.78 64.11 14.89 23.78 7.56 21.00 27.78 29.44 13.89

5.11 3.72 2.61 2.56 6.39 2.44 5.78 4.94 6.22 7.94 5.44 9.56 4.39 6.06 2.94 5.50 5.67 5.44 4.72

0.40 0.44 0.23 0.42 0.39 0.33 0.28 0.38 0.38 0.37 0.47 0.42 0.47 0.41 0.47 0.46 0.44 0.41 0.50

0.56 0.73 0.58 0.55 0.58 0.50 0.52 0.70 0.56 0.67 0.66 0.72 0.59 0.66 0.60 0.64 0.62 0.60 0.68

Key: BU, Bundibudyo; HM, Hoima; JJ, Jinja; KB, Kabarole; KG, Kiboga; KI, Kibale; KJ, Kyenjojo; KM, Kamuli; KW, Kamwenge; KY, Kayunga; MB, Mubende; MK, Mukono; MP, Mpigi; RK, Rakai; UC, controlled crosses; UH, hybrids; C, G, UG, controls (Ugandan wild, nganda, Congolese). Reproduced with permission from Aluka, P., 2013. PhD thesis, University of Nairobi.

Table 3.4  Mean Population Heterozygosity Over Loci in 265 Cultivated Accessions and 77 Germplasm Collections Germplasm

Pop

N

Na

Ne

I

Ho

He

UHe

F

Pa

Cultivated C. canephora

C G UN UW BU HM JJ KB KG KI KJ KM KW KY MB MK MP RK UC UH Mean C EB UC UE UH UN UP Mean

4 3 1 2 11 24 3 31 8 20 37 12 34 8 13 4 11 15 16 8 13.25 4 10 13 18 5 20 7 11

3.83 2.89 1.50 1.83 5.33 6.67 2.50 6.06 5.56 6.61 8.50 6.22 10.06 4.61 6.61 3.11 5.78 6.06 5.78 5.44 5.25 4.15 4.65 4.35 5.35 3.35 5.55 4.70 4.59

2.97 2.61 1.50 1.67 3.23 3.19 2.14 2.76 3.85 3.32 4.12 3.63 4.88 3.03 3.97 2.58 3.39 3.08 3.15 3.66 3.14 3.43 3.14 2.96 3.26 2.74 3.49 3.44 3.21

1.11 0.93 0.35 0.48 1.17 1.24 0.71 1.11 1.43 1.25 1.55 1.44 1.71 1.16 1.45 0.93 1.32 1.29 1.24 1.41 1.16 1.29 1.24 1.17 1.32 1.03 1.35 1.32 1.25

0.36 0.20 0.50 0.31 0.40 0.39 0.33 0.28 0.35 0.36 0.36 0.40 0.40 0.44 0.38 0.43 0.43 0.39 0.40 0.43 0.38 0.47 0.53 0.55 0.59 0.55 0.59 0.66 0.56

0.59 0.56 0.25 0.32 0.55 0.57 0.42 0.52 0.69 0.55 0.69 0.68 0.73 0.59 0.67 0.53 0.62 0.61 0.60 0.69 0.57 0.69 0.64 0.62 0.67 0.58 0.67 0.68 0.65

0.67 0.67 0.50 0.43 0.58 0.59 0.50 0.53 0.74 0.57 0.69 0.71 0.74 0.63 0.70 0.60 0.65 0.63 0.62 0.74 0.62 0.80 0.68 0.65 0.69 0.65 0.69 0.73 0.70

0.39 0.68 −1.00 0.01 0.33 0.34 0.26 0.50 0.52 0.34 0.47 0.43 0.46 0.32 0.49 0.19 0.35 0.41 0.43 0.40 0.32 0.33 0.17 0.14 0.12 0.10 0.12 0.03 0.14

15 13 2 3 4 8 nd 4 2 3 11 6 22 nd 4 nd 3 3 2 4 6.41 15 7 2 1 1 8 nd 5.67

C. canephora germplasm collection

Key: N, no. of genotypes; Na, no. of alleles; Ne, no. of effective alleles; I, Shannon Diversity Index; Pa, rare alleles; Ho, observed heterozygosity; He, expected heterozygosity; UHe, unbiased expected heterozygosity; F, fixation index; nd, not detected; UB, Entebbe botanical gardens; UP, parents. Reproduced with permission from Aluka, P., 2013. PhD thesis, University of Nairobi.

Chapter 3  GENETIC AND PHENOTYPIC DIVERSITY IN ROBUSTA COFFEE   99

Allele

Ladder

94 accessions

Ladder

Fig. 3.2  SSR polymorphism for 96 accessions of C. canephora. Reproduced with permission from Aluka, P., 2013. PhD thesis, University of Nairobi.

alleles (9.56), followed by Kyenjojo (7.94), Hoima (6.39), Kibale (6.22), and Mubende (6.06) (Table 3.3). Populations with the lowest total gene copies, also had the lowest number of alleles and these were Jinja (2.44), Ugandan control (2.56), Guinea (2.61), and Mukono (2.94). Hybrids had the higher observed heterozygosity (Ho,0.50) than the Guinea population (Ho 0.23); however these values were less than the expected heterozygosity (He) in all the populations. The Congolese and Kamwenge accessions had the highest expected heterozygosity at 0.73 and 0.72, respectively, but these values ranged from 0.50 in Jinja to 0.70 in Kiboga. Table 3.4 shows a comparison of the mean heterozygosity of cultivated and germplasm collection of C. canephora population. Most alleles were found in cultivated populations of Kamwenge (10.06) and Kyenjojo (8.50) districts and the least were found among the nganda control (1.50) and Jinja (2.50) populations. In the germplasm, allelic values ranged between 3.35 in the hybrids and 5.55 in nganda types. In cultivated Robusta, effective alleles ranged between 1.50 in the nganda control to 4.88 in the Kamwenge accessions and between 2.74 in the hybrids to 3.49 in the nganda types in the germplasm collection (Table 3.4). The germplasm collections observed heterozygosity values ranged from 0.47 in the Congolese control to 0.66 in the parent materials but in the cultivated accessions the highest values of 0.50 was given by nganda DNA control while the lowest value of 0.20 was given by the Guinean DNA control. Expected heterozygosity in cultivated accessions was highest in the districts of Kamwenge (0.73), Kyenjojo (0.69), and Kiboga (0.69) whereas in the germplasm collections, He values ranged from 0.58 in the hybrids to 0.69 in the Congolese populations. Nganda control had low expected unbiased heterozygosity values of 0.25 and 0.43. Accessions with high fixation values found in Kiboga (0.52), Kabarole (0.50), Mubende (0.49), Kamwenge (0.46) were a

100  Chapter 3  GENETIC AND PHENOTYPIC DIVERSITY IN ROBUSTA COFFEE

r­ eflection of high genetic diversity within these populations than was the case in the parent materials (UP) (0.03) and in the Entebbe botanical gardens collections (0.17). Most rare alleles of about 22 were found in the Kamwenge accessions but were lowest in the hybrids and erecta types. In the Jinja, Kayunga, Mukono, and parental (UP) populations (Table 3.4), no rare alleles were found. In the two land races, nganda types had more rare alleles than erecta types (Table 3.4). The Ugandan cultivated Robusta coffee accessions were clustered into three diversity groups (Figs. 3.3 and 3.4). Accessions from

Fig. 3.3  Neighbor Joining tree for 265 genotypes derived from factorial analysis of dissimilarity matrix. Key codes can be found in Table 3.1. Reproduced with permission from Aluka, P., 2013. PhD thesis, University of Nairobi.

Chapter 3  GENETIC AND PHENOTYPIC DIVERSITY IN ROBUSTA COFFEE   101

Fig. 3.4  Dendrogram of 265 on farm accessions and 24 elite selections derived from factorial analysis of dissimilarity table. Key codes can be found in Table 3.1. Reproduced with permission from Aluka, P., 2013. PhD thesis, University of Nairobi.

West and Central Africa formed a group of their own. As shown in Figs.  3.3 and 3.4, genotypes from Kabarole, Bundibugyo (Western highlands region), and Hoima (Lake Albert Crescent region) located in Western Uganda formed one group while genotypes from Kyenjojo, Kamwenge (Western highlands), Kiboga (Lake Victoria Crescent bordering Lake Albert Crescent region), and Kamuli formed the second group and a mixture of accessions from different locations; Kayunga, Mpigi, Mubende, Rakai, Mukono from Lake Victoria Crescent, and Kamwenge from Western highlands formed the third group. Table 3.5 shows that out of 81.87% within population variability, 54.05% was contributed by individual accessions, whereas 28.92% was by among individuals within populations, 17.03% of the variation was shared among individuals. The inbreeding index (FIS) was 0.35 indicating that there was 65% outcrossing. The FIT value of 0.46 indicated that there was 54% outcrossing among genotypes from different locations whereas the genetic differentiation value (FST) of 0.17 showed the level of polymorphism that occurred over generations.

102  Chapter 3  Genetic and Phenotypic Diversity of Robusta Coffee (Coffea canephora L.)

Table 3.5  Analysis of Molecular Variance (AMOVA) for 265 Cultivated Robusta Coffee Accessions Source of Variation Among populations Among individuals within populations Within individuals Within populations Total

df

Sums of Squares

Variance Components

Percentage of Variation

18 246

434.68 1161.60

0.72 1.22

17.03 28.92

265 511 529

604.50 1766.10 2200.78

2.28 3.46 4.22

54.05 81.87

FIS

FIT

FST

0.35

0.46

0.17

Reproduced with permission from Aluka, P., 2013. PhD thesis, University of Nairobi.

Table 3.6 shows that after 10,000 permutations, the population differentiation (FST) and inbreeding index (FIS) had an average ­population differentiation index of 0.18. Most of the populations had 0.18 or 0.19 differentiation indices rating except for Kamwenge where it was 0.17. Guinea control population had the highest inbreeding index value of 0.81 whereas the Ugandan control population had the lowest inbreeding value of 0.02. The other populations had inbreeding indices that ranged from 0.20 to 0.49. Observed inbreeding indices in 12 districts were more or less the same. There was no significant differences between randomly observed inbreeding indices for the Guinean and Ugandan controls and those of collections from Jinja and Mukono locations but there were significant differences among observed inbreeding indices for Congolese types, hybrids, and those of genotypes from Kayunga. Fig.  3.5A, PCA, showed that all genotypes were widely distributed and were not consolidated into distinct groups. Genotypes from Kabarole, Bundibugyo, and Hoima (Fig.  3.5B) were grouped with controlled crosses (UC in red). The hybrids (UH in blue) were grouped with accessions from Kayunga, Mpigi, Mubende, Rakai, Mukono from Lake Victoria Crescent, and Kamwenge from Western highlands, but were separated by a genetic distance of about 0.58 from controlled hybrids. Kyenjojo, Kamwenge, Kiboga, and Kamuli populations were separated from the control DNA (UC in black) by a genetic distance of 0.55. The nganda and erecta types were spread in all the three genetic diversity groups at an average genetic distance of 0.6.

Chapter 3  GENETIC AND PHENOTYPIC DIVERSITY IN ROBUSTA COFFEE   103

Table 3.6  F-Statistics Indices in 19 Population Indices (After 10,100 Permutations With Significance Tests of 1023 Permutations) No.

Populations

FST

FIS

P (Random FIS≥Observed FIS

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19

Bundibugyo Congolese controls Guinea controls Ugandan controls Hoima Jinja Kabarole Kiboga Kibale Kyenjojo Kamuli Kamwenge Kayunga Mubende Mukono Mpigi Rakai Crosses Hybrid

0.18 0.18 0.19 0.18 0.18 0.19 0.18 0.18 0.19 0.18 0.18 0.17 0.18 0.18 0.18 0.18 0.18 0.18 0.18

0.29 0.49 0.81 0.02 0.32 0.33 0.44 0.46 0.26 0.38 0.22 0.43 0.24 0.35 0.20 0.30 0.31 0.26 0.22

0 0.01 0.06 0.32 0 0.12 0 0 0 0 0 0 0.0008 0 0.13 0 0 0 0.01

0.18

0.33

Mean

Reproduced with permission from Aluka, P., 2013. PhD thesis, University of Nairobi.

3.1.4 Discussion The 265 accessions evaluated by 18 microsatellite markers were genetically diverse as shown in Fig. 3.2. Accessions from Kamwenge (KW), Kyenjojo (KJ), and Kabarole (KB) districts, respectively, had the highest diversity as shown by the high values in total gene copies (68, 74, 62), allele numbers (9.56, 7.94, 5.78), and expected gene diversity (0.72, 0.66, 0.52) (Table 3.3). Accessions from Jinja, Guinean, Ugandan, and Mukono populations gave lower genetic diversity parameters (Table  3.3). Populations from Kamwenge, Kyenjojo, and Kabarole close to Kibale forest exchanged gene flow

104  Chapter 3  GENETIC AND PHENOTYPIC DIVERSITY IN ROBUSTA COFFEE

Fig. 3.5  Principal Component Analyses of dissimilarity matrix for (A) germ-plasm collections and (B) cultivated Robusta coffee. Key codes as in Table 3.1. Reproduced with permission from Aluka, P., 2013. PhD thesis, University of Nairobi.

(Continued)

between wild and cultivated C. canephora. In these populations, natural selection seems to be the major evolutionary forces. But for accessions from urban districts of Jinja and Mukono farmer selection pressures would be responsible for the higher fixation indices shown in Table  3.3 and reduced genetic diversity. Some accessions such as those from Kibale displayed a different scenario. These accessions had the highest number of polymorphic loci (16) but also the lowest gene diversity over the loci perhaps ­indicating that only a few of the polymorphic loci might have been fixed. In these accessions, it is likely that there was little gene flow from the wild populations but there was outcrossing within

Chapter 3  GENETIC AND PHENOTYPIC DIVERSITY IN ROBUSTA COFFEE   105

Fig. 3.5, Cont’d

the populations. Gene flow between cultivated and wild Robusta forms evidently contributed to the higher genetic diversity in accessions that were cultivated closer to the forests since semiurban and elite cultivars had lower number of alleles such as those from Jinja (2.44), Ugandan controls (2.61), nganda, and Mukono (2.56, 2.94) as shown in Table 3.3. This pattern is clearly demonstrated by the diversity data presented in this study. Kamwenge and Kyenjojo accessions that are closer to the forests where wild C. canephora grows naturally, had higher different alleles with a mean of 5.25 and with a range of 1.50– 10.06 whereas gene bank collections had a mean of 4.29 as shown in Table 3.4. Cultivated accessions had expected (He) heterozygosity of 0.57 whereas that in the germplasm accessions was 0.65 suggesting that among the farmer accessions the rate of outcrossing was higher but among the germplasm accessions, there was more inbreeding. The FST and FIS mean values of 0.19 and 0.33, respectively, confirms

106  Chapter 3  GENETIC AND PHENOTYPIC DIVERSITY IN ROBUSTA COFFEE

the outbreeding nature of Robusta populations as shown in Table 3.6. The presence of more rare alleles in the local landraces also reaffirmed that cultivated accessions may have acquired genes from wild populations through gene flow. The almost similar Shannon index and fixation values shown in Table 3.4 are an indication that both artificial and natural selections have influenced the genetic diversity found in cultivated Robusta. Within populations (81.87%) and within individuals (54.05%) variations contributed the highest diversity (Table 3.5) suggesting that this is the genetic variation that breeders should exploit. Other data such as the low inbreeding indices in Table 3.5, go a step further to confirm that outbreeding is about 65% in C. canephora as has always been suggested (Musoli et  al., 2009) and contributes higher diversity values as shown by landraces in Tables 3.3 and 3.4. Such accessions as from the gene bank at Kawanda, Entebbe botanical gardens, and Kituza that lost most of their trees due to old age, pest, and diseases attack had lesser genetic diversity (Table 3.4; Fig. 3.5A) (Wrigley, 1988). Populations from Kamwenge (1.71) and Kyenjojo (1.55) gave higher Shannon Diversity Index (I) values (Table 3.3) than those of nganda (0.35), Ugandan wild (0.48), Guinean (0.93) controls, and Mukono (0.93) suggesting that these populations are well established. Again, the presence of rare alleles among the Kamwenge (10), Kyenjojo (8), and bordering Kibale forest was a confirmation of the extent of gene flow. This constant gene flow between cultivated and wild types of Robusta is the most likely source for genes to improve bean quality, biotic, and abiotic stress in Robusta coffee. There is a likelihood that similar gene flow is present among unselected and random mating populations in the Congolese, Guinean populations, and nganda populations. The genotypes from the germplasm collections (Fig.  3.5A) were widely distributed and were not confined into distinct groups, an indication that they are a representative of the gene pool. The formation of three diversity groups shown in Figs. 3.3–3.5B, confirmed how reliable and precise the two diversity methods used in the analysis were and also how closely related accessions were as placed in their respective groups. Some nganda or erecta type accessions did not cluster separately but were distributed within the three genetic diversity groups. This is probably because of increased outcrossing among these types making it difficult to differentiate them clearly at genetic level (Fig. 3.5A). In Fig. 3.5B, the hybrids (UH) grouped with accessions from Kayunga, Mpigi, Mubende, Rakai, Mukono from Lake Victoria Crescent, and Kamwenge from Western highlands that possibly provided their parents. Controlled crosses and improved hybrids and varieties from research organizations grouped into separate clusters, with a genetic distance of 0.58 implying their genetic base was narrow.

Chapter 3  GENETIC AND PHENOTYPIC DIVERSITY IN ROBUSTA COFFEE   107

The study showed there was genetic diversity in both nganda and erecta cultivated C. canephora populations (Tables 3.5 and 3.6 and Figs. 3.3–3.5A and B) but most of this diversity was found among the nganda local landraces which have continued to exchange gene flow with the wild forms. The cultivated nganda landraces have experienced both natural and artificial forms of selection. The genetic diversity that has accrued from gene flow between cultivated and wild Robusta types is closer or similar to that found in West Africa, Congo, and Guinea and there is reason to believe that these later populations could have been earlier progenitors of the C. canephora landraces found in Uganda. Genetic drift and other evolutionary forces of selection might have created nganda and erecta types that outcrosses more with wild Robusta populations.

3.1.5 Conclusion Most of the genetic variability in C. canephora in Uganda is within populations and within individuals, implying that diverse cultivars are widely distributed countrywide. Almost all the current C. canephora landraces in Uganda are panmictic, highly outcrossing and their adaptation in various agroecological zones is most likely under both natural selection through gene flow and human selection. The outcrossing nature of the cultivated Robusta coffee has also created an effective gene exchange mechanism between the cultivated nganda and erecta types with the wild types continuously enriching the local germplasm with genetic variability for traits such as disease resistance, yield, and coffee cup quality.

3.2  Phenotypic Diversity of Landraces of Robusta Coffee 3.2.1 Introduction In the past, the International Plant Genetic Resources Institute (IPGR, 1997) developed coffee descriptors that were used to identify highly productive cultivars commercial Robusta coffee varieties in Uganda (Kibirige-Sebunya et  al., 1996; Leakey, 1970; Wrigley, 1988). Aga et al. (2003) argued that there is considerable phenotypic variance that is heritable despite the combined effects of the genotype, growth stages, and environment. As in other food products, Robusta coffee bean has physical characteristics such as weight, volume, size, shape, color, solubility, moisture content, and texture that determine quality. The quality characteristics inside the coffee green bean are influenced by genotypic and

108  Chapter 3  GENETIC AND PHENOTYPIC DIVERSITY IN ROBUSTA COFFEE

e­ nvironmental factors (Leroy et  al., 2006a,b). According to Charrier and Berthaud (1988) the size, shape, color, chemical composition, and flavor of the Robusta bean are controlled largely by the genotype. Farm management practices are the main environmental factors that influence the variability of physical characters and biochemical composition of the green bean (Lashermes et al., 2000; Clifford, 1985). Coffee beans from higher altitude for instance are known to be smaller, denser, and harder and have more acidity, quality aroma, and flavor than those from lower altitudes. Bean physical characteristics preferred by different markets are dictated by the size homogeneity, the regularity, and reliability of the production. Bean size from a commercial point of view is related to the coffee grade and therefore tied to the price (Leroy et al., 2006a,b). Roasted bean with moisture content of 12.5% and above are normally discarded. Phenotypic diversity displayed at the farm level is an important component of a Robusta coffee improvement program (Van der Vossen, 1985). Morphological and bean physical characters diversity is important in the design of conservation measures of the germplasm and in the mitigation of genetic erosion and climatic effects. Morphological traits are the tools exploited in the conventional plant breeding in the selection of parental materials or in the advancement of progenies arising from hybridization (Charrier and Berthaud, 1985). But even modern MAS and or marker-assisted breeding (MAB), do make use of both morphological and DNA markers to hasten improvement of targeted traits (Montagnon et al., 1998). Phenotypic and morphological traits have hardly been utilized in the breeding of Robusta coffee. Earlier efforts, to assess phenotypic variation in Ugandan Robusta coffee landraces by Thomas (1940) and Maitland (1926) did not have enough information to conduct the selection and the germplasm targeted was of narrow genetic base (Leakey, 1970). The few gene bank accessions available at Kawanda do not represent the wide genetic diversity in the country. There is need therefore to characterize the physical bean variability in hybrids and commercial cultivars and in erecta’ and nganda local landraces from across the agroecological zones where Robusta coffee is grown in Uganda (Fig. 3.6).

3.2.2  Materials and Methods 3.2.2.1  Tree and Site Selection Accessions from six traditional Robusta growing agro-ecological zones, ranging from, Lake Victoria crescent to Southern highlands were collected (Fig.  3.7). They included 21 on-farm landraces and 3 germplasm collections from Kawanda, Kituza, and Entebbe botanical gardens (Table 3.7). In the 21 districts, which included those closer to

Chapter 3  GENETIC AND PHENOTYPIC DIVERSITY IN ROBUSTA COFFEE   109

Fig. 3.6  Map showing areas the various agro-ecological zones where Robusta coffee is grown.

the forests, collections of green beans were done at a distance of every 5 km. The sample size consisted of 25–30 trees per population and only trees that were older than 10  years were sampled as they were considered to be adapted as landraces. Field records were used to select 59 trees at Kawanda based on whether the coffee types were nganda, erecta or hybrid. In all, 10 trees were selected at Entebbe botanical gardens (Wrigley, 1988) whereas at Kituza, 16 controlled crosses planted were selected.

110  Chapter 3  GENETIC AND PHENOTYPIC DIVERSITY IN ROBUSTA COFFEE

21 20.5 20 19.5 19 18.5 18 17.5 17 16.5 16

Girth (cm)

(A)

s rid

Age (years)

LL (cm)

(B)

PC (numbers)

Fruits (numbers)

IL (cm)

s rid H yb

a nd N ga

ta

al ci er C om

m

ec

nd

2

H yb

C om

H yb

rid

s

a nd N ga

ta ec Er

C om

m

er

ci

al

m

er

ci

5

a

3 al

15

4

N ga

25

5

ta

35

ec

45

6

Er

55

7

Er

75 65

Stems

(C)

Fig. 3.7  Comparison of Robusta coffee types morphological attributes of 476 genotypes. PC, production capacity; IL, inter node length (cm); LL, leaf length (cm). Reproduced with permission from Aluka, P., 2013. PhD thesis, University of Nairobi.

3.2.2.2  Morphological Data Scoring The quantitative descriptors scored are as shown in Table 3.8. Tree age was estimated by comparing the observed age with perceived age, where the farmer did not know the true age. The following morphological traits were measured from a mean of 25 trees; 10 randomly ripe cherry clusters randomly selected; inter node length was measured as the mean distance of two nodes in a primary branch in centimeters (cm) from 10 branches per tree. Leaf length was measured as the mean distance from the base of a leaf petiole to the apex in centimeters from 10 leaves per tree. Leaf width was measured as the distance between two widest points of a leaf at half-length in centimeters from 10 leaves per tree. Tree production capacity and vigor were scored on a 1–5 scale; where 1 was—very few berries present in the tree; 5 was—very many berries in the tree and 1 was—unhealthy tree growth; 5 was— healthy tree growth, respectively. Data were recorded by Geographical Position Systems (GPSs).

3.2.2.3  Harvesting and Drying Robusta Coffee Ripe Cherry All the 206 tagged Robusta coffee trees had at least 2 kg of their ripe cherry harvested and scored as shown in Table  3.1. The cherry was poured into a water container, the debris was removed and the beans sun dried in wire mesh boxes. The moisture content of about 50% in the cherry was reduced to less than 12.5% by evenly spreading the beans in a layer of about 1.5 cm thickness (Clifford, 1985). The cherry was sun dried for a month and later stored in a dry well-aerated room. After drying, the cherry was carefully hulled with a metal tray. Defective cherries and bean hulls were separated from the clean beans by use of density and the cleaned beans were later stored in polythene bags in a well-aerated room for physical evaluation.

Table 3.7  Agroecological Information From the 23 Locations Where the C. canephora Samples Were Collected for Phenotypic Evaluation Altitude Range (m a s l) Region

Agro-Ecology

District

Code

No. of Phenotypes

Min

Max

East

South east

Mayuge Bugiri Jinja Mubende Kamuli Iganga Mukono Kayunga Kiboga Masaka Kalangala Masindi Hoima Kibaal Kyenjojo Kabarole Kamwenge Bundibidyo Bushenyi Rakai Mbarara Rukungiri Kawanda Entebbe Kituza Controls

MY BG JJ MB KM IG MK KY KG MA KL MS HM KI KJ KB KW BU BS RK MR RG KA EB KZ CN

18 17 18

1181 1080 1124

1217 1120 1184

22 17 15 20 21 18 18 12 26 21 23 18 26 16 19 18 19 18 50 10 16

1080

1120

1122 1088 1136 1202 1028 1152 1101 1110 1372 1009 1242 687 1015 1212 1383 1015 1177 1177 1200

1176 1105 1373 1283 1239 1180 1295 1247 1517 1568 1325 1017 1654 1230 1478 1559 1177 1177 1200

Central

Lake Victoria crescent

West

Lake Albert crescent

Western highlands

Southwest

Southern Drylands S. highland On station germplasm

476 Reproduced with permission from Aluka, P., 2013. PhD thesis, University of Nairobi.

112  Chapter 3  GENETIC AND PHENOTYPIC DIVERSITY IN ROBUSTA COFFEE

Table 3.8  Quantitative Morphological Characters Scored in the 206 Accessions of Robusta Coffee Parameter

Character Description

Measure

Acronym Use

1. Tree

Number of stems Tree age Tree girth Production capacity Vigor Primary internode length Leaf length Leaf width Fruit number/axil

Counts Centimeters Centimeters Rating Rating Centimeters Centimeters Centimeters Counts

SN TA TG PC VG IL LL LW FN

2. Primaries 3. Leaves 4. Fruits

Key: Rating for production capacity and vigor: PC: 1—few berries present i; 5—many berries. Vigor: 1—unhealthy growth; 5—healthy growth. Reproduced with permission from P. Aluka, PhD thesis, University of Nairobi, 2013.

3.2.2.4  Evaluating Green Bean Physical Characteristics In all, 300 g of cheery beans were randomly collected from each of the 206 farms in 21 Robusta growing districts, which included Kawanda and Kituza Robusta germplasm collections. Grading of the beans was done according to the size with specified screens of sizes that varied as: (A) ≥18 (7.0 mm), large; (B) ≥15–17 (6.0–6.75 mm), medium; and (C) 15 (6.0 mm), small. Roasted and green beans were weighed with an analytical balance and measured in grams while the volume in cubic milliliters was measured by a volumetric cylinder. Total roast time was divided with total weight of green beans roasted to produce, roast time per gram (RTPG) in seconds. Green bean percentage weight loss gave the percentage weight decrease of roasted beans. Roasted beans volume increase in percentage was calculated as a percentage, of the difference between green and roasted bean volumes.

3.2.2.5  Data Analysis Multivariate analysis was conducted using PCA and the geometric representation for the main factors plotted using XLSTAT version 2011.2.05 (Addinsoft, Paris, France). Before estimating the PCA, the Bartlett's test (XLSTAT version 2011.2.05 statistical program) was conducted to establish if significant differences from zero existed in correlated phenotypic variables. Genetic distances between accessions were estimated using the Euclidean straight-line method (Mohammadi

Chapter 3  GENETIC AND PHENOTYPIC DIVERSITY IN ROBUSTA COFFEE   113

and Prasanna, 2003). In order to refine the principal component plot, Varimax rotation (XLSTAT version 2011.2.05) statistical program was applied (Mohammadi and Prasanna, 2003). Genotypes with the highest attribute variance were then assigned to the principal components. Mahalanobis and Fisher intergroup distances at 95% probability were calculated using factorial step discriminant analyses. The efficiency of genotype placement among groups was done using the confusion matrix. The distance of each phenotypic character from the average calculated similarity index between phenotypic characters of the various genotypes explained the origin of the accessions in relation to the populations. Descriptive statistics were used to compare the group means, medians, variances, and interquartile range in form of box plots.

3.2.3 Results 3.2.3.1  Morphological Traits As shown in Fig. 3.7A nganda and erecta types had older trees than the commercial and hybrid cultivars (Fig. 3.7A). The nganda types had the highest mean stem number (6.63), second was erecta (5.09), and the hybrids with a mean of 3.25 (Fig.  3.7C) had the lowest. The hybrids leaves were the longest with a mean of 19.94 cm and next to them were the commercial cultivars with a mean of 19.17 cm but nganda with a mean of 17.89 cm was the smallest. The hybrids had the most narrow leaves with a mean of 6.96 cm followed by nganda of 7.36 cm, and erecta types with a mean of 7.47 cm. Commercial cultivars had the highest number of fruits with a mean of 21.93 but hybrids had the lowest of 16.49 (Fig. 3.7B; Table 3.9). The ranges of all morphological values were highest in nganda and erecta types indicating high variability in all the traits measured in the two landraces. The overall mean values were almost similar among the nganda and erecta types. Tree girth increased with tree age (Fig. 3.8A) whereas vigorous trees were the most productive ones. Hybrids and landraces were unrelated in tree morphology, as is the case with nganda plant type (Fig. 3.8B). Hybrids and commercial cultivars were neither related to one another (Fig. 3.8B) but the commercial types were more closely related to erecta than to nganda types. However, the erecta and nganda types were closely related to each other. Commercial types had the longest, internodes and leaves, highest number of fruits but fewer stems. Hybrids had the youngest trees, were the most vigorous and highest producers. Most of the variability was defined by hybrids, followed by commercial types and then by erecta. The information shown in Fig.  3.8A and B is confirmed by the genetic distances in Table  3.10. Mahalanobis genetic distance was longest ­ between hybrids and nganda but was shorter between

Table 3.9  Morphological diversity of 476 cultivated Robusta coffee types shown in Fig 3.7 Types

Statistic

Age

Girth

PC

Vigour

Stems

IL

LL

LW

Fruits

Com No. 44

Range Mean s.e. Range Mean s.e. Range Mean s.e. Range Mean s.e. Range Mean s.e.

30 11.68 1.41 0 12 0 76 37.01 1.58 75 37.39 1.49 76 33.95 1.03

68 46.55 2.72 25 47 2.90 159 69.77 2.25 205 74.30 2.39 205 68.93 1.52

3 3.73 0.10 2 3.56 0.16 4 3.30 0.05 4 3.26 0.05 4 3.33 0.03

2 3.55 0.09 2 3.56 0.16 4 3.23 0.04 4 3.18 0.04 4 3.24 0.03

10 4.09 0.30 3 3.25 0.21 21 5.32 0.24 27 6.63 0.26 27 5.76 0.16

4.7 6.39 0.19 1.6 5.09 0.12 6.8 6.21 0.09 5.9 5.98 0.07 6.8 6.08 0.05

14.3 19.17 0.40 7.8 19.94 0.43 21.2 18.35 0.19 13.7 17.89 0.15 21.2 18.26 0.11

5.2 7.38 0.16 3 6.96 0.21 6.8 7.47 0.08 9.5 7.36 0.08 3.1 7.39 0.05

18.3 20.93 0.56 10.1 16.49 0.60 27.8 20.62 0.36 31.4 19.92 0.30 31.4 20.19 0.21

Hybrids no. 16 Erecta no. 191 nganda no. 224 All types No.476

Key: com-commercial types; s.e, standard error; PC, production capacity (scale 1–5); IL, inter node length (cm); LL, leaf length (cm); LW, leaf width (cm). Reproduced with permission from Aluka, P., 2013. PhD thesis, University of Nairobi.

Chapter 3  GENETIC AND PHENOTYPIC DIVERSITY IN ROBUSTA COFFEE   115

2

Stems

1

IL Fruits Vigour PC

Commercial

F2 (26.01%)

F2 (21.38%)

Tree age Girth

LL LW

erecta

0

–1

nganda

0

1

Hybrids

–1

(A)

F1 (24.48%)

(B)

2

–2 F1 (69.40%)

Centroids

Fig. 3.8  PCA relationships between (A) morphological characters and (B) cultivars. Reproduced with permission from Aluka, P., 2013. PhD thesis, University of Nairobi.

erecta and nganda. Hybrids were distinct populations from nganda and erecta landraces as they had significantly longer Mahalanobis genetic distances of 4.40 and 4.06, respectively, from the two landraces. Commercial types and hybrids had a Mahalanobis genetic distance with a value of 2.79 close to 3.0, which nearly categorized the two as distinct populations. Mahalanobis distances between the landraces erecta and nganda of 0.20, that between commercial and erecta types of 0.84 and that between commercial types and nganda of 1.50, were not significant and therefore, all the three types did not qualify to be classified as separate populations. Equally, Fisher estimates showed that the longest distance just as with Mahalanobis, was between the hybrids and nganda, while the shortest was between erecta and nganda. The probability that any two groups were significantly different from each other is indicated by the Fisher estimates (Table 3.10). Tree diameter increased with age (Fig. 3.9A). Younger trees of 11– 20 years old had slightly less longer leaves than those of 61–70-yearold trees. Throughout the tree life, stems increased with age but trees that were 60–70 years old had fewer leaves and the longest internode length. Trees grew faster at elevation 1101–1200 m above sea level (Fig.  3.9B). Productive and vigorous trees that produced more fruits were found at 1301–1400 m above sea level. At 1101–1200 m above sea level, trees were less productive and vigorous but had the longest leaves.

3

Table 3.10  Mahalanobis and Fisher Distances Estimated in Robusta Types Grown in Uganda Mahalanobis Distance Commercial erecta Hybrids nganda

p-Values for Fisher Distances

Fisher Distance

Commercial erecta Hybrids nganda Commercial erecta Hybrids nganda

Commercial

erecta

Hybrids nganda

0 0.84 2.79 1.50

1