at all. Taxonomic studies on some leuconostoc-like organisms from fermented sausages: description of a new genus Weissella for the Leuconostoc paramesenteroides group of species

Citation preview

zyxwvutsrq zyxwvuts

Journal of Applied Bacteriology 1993,75,595-603

Taxonomic studies on some leuconostoc-like organisms from fermented sausages: description of a new genus Weissella for the Leuconostoc paramesenteroides group of species

zyxwvu zyxwvutsrq

M.D. Collins, J. Samelisl, J. Metaxopoulos’ and S. Wallbanks

AFRC Institute of Food Research, Department of Microbiology, Reading Laboratory, Reading, UK and ’Agricultural University of Athens, Department of Food Science and Technology, Athens, Greece 4509/03/93:accepted 3 July 1993

zyxw

M.D. COLLINS, J. S A M E L I S , J. M E T A X O P O U L O S A N D s. W A L L B A N K S . 1993. Taxonomic studies were performed o n some unknown Leuconostoc-like organisms from fermented Greek sausage. Comparative 16s r R N A sequence analysis showed the unidentified organisms represent a new line within t h e Leuconostoc pararnesenteroides group of species. O n t h e basis of the results of this and earlier phylogenetic investigations, it is proposed that Leuconostoc paramesenteroides and related species be reclassified in a new genus Weissella. I n addition a new species, Weissella hellenica, is proposed for t h e isolates from fermented sausage.

zyxwvutsrqpo zyxw zyxwvuts

INTRODUCTION

Leuconstocs are a diverse group of Gram-positive catalasenegative cocci which share many characteristics with the genus Lactobacillus and other ‘lactic acid bacteria’. Apart from their typically irregular coccoid morphology, leuconostocs are distinguished from gas-forming heterofermentative lactobacilli primarily by their inability to produce ammonia from arginine and the formation of only D( -)-lactate from glucose (Garvie 1986). Some atypical species of heterofermentative lactobacilli, however, e.g. Lactobacillus viridescens and Lact. fructosus do not deaminate arginine and form predominantly D( -)-lactate. The reliable differentiation of leuconostocs from such heterofermentative lactobacilli by phenotypic criteria is currently very difficult. Furthermore, recent molecular systematic investigations have revealed these taxa are phylogenetically intermixed, In particular, 16s rRNA sequencing studies show leuconostocs comprise three distinct genetic lines : the genus Leuconostoc sensu stricto, the Leuconostoc paramesenteroides group (which includes the atypical lactobacilli Lact. confusus, Lact. minor, Lact. kandleri, Lact. halotolerans and Lact. viridescens) and the species Leuc. oenos (Yang and Woese 1989; Martinez-Murcia and Collins 1990, 1991; Collins et al. 1991). In the course of a survey of the lactic acid flora of dry naturally-fermented Greek sausage, we isolated a group of Leuconostoc-like organisms. The sausage isolates resembled leuconostocs in producing D( -)-lactic Correspondence to: Dr M . D . Collms, A F R C Institute of Food Research, Microbiology Department, Reading Laboratory, Earley Gate, Whiteknights Road, Reading R G 6 Z E F , UK.

acid but differed from currently-recognized species in a number of biochemical tests. In this paper we describe the phenotypic characteristics of these isolates and the results of a comparative 16s rRNA phylogenetic analysis. MATERIALS AND METHODS

Bacterial strains

Strains were isolated from dry, naturally-fermented Greek sausage on MRS agar (De Man et al. 1960) incubated at 30°C for 3 d under anaerobic conditions. Two representative strains have been deposited in the National Collection of Food Bacteria (NCFB 2973 = LV346; NCFB 2972 = LV338). Biochemical tests

Strains were tested for Gram reaction and catalase production (Harrigan and McCance 1976). Growth at different temperatures was observed in MRS broth after incubation at 15°C for 5 d, 37°C and 45°C for 5 d, and at 4°C and 10°C for 10 d. Growth in the presence of 8% and 10% NaCl was observed in MRS broth at 30°C for 5 d. The ability to grow at p H 3.9 was tested in MRS broth adjusted with HCl to p H 3.9. Strains were tested for the ability to grow on acetate agar (Rogosa et al. 1951) adjusted to pH 5.6 as described by Shaw and Harding (1984). Production of hydrogen peroxide was tested on manganese dioxide agar (MRS agar supplemented with 0.75% manganese dioxide and with 0.5% xanthan gum) (Whittenbury 1964). Gas (CO,) production from glucose was determined in MRS broth with diammonium citrate replaced by ammonium

zyxwvutsrqpon zyxwvutsrqp zyxwvutsrqponm

zyxwvutsrqp

596 M . D . COLLINS ET A L .

sulphate (Hitchener et al. 1982). T h e fermentation of carbohydrates was tested according to Sharpe (1979) by the miniplate method described by Jayne-Williams (1976). Sugar fermentation was also tested with the API 50 C H L system. The configuration of lactic acid formed from glucose was tested enzymatically by D-laCtate and L-lactate dehydrogenase (Boehringer Mannheim). Production of acetoin from glucose was tested by Voges-Proskauer test (Barritt’s modification; Harrigan and McCance 1976). Hydrolysis of arginine was tested in MRS broth without meat extract but containing 0.05% glucose and 0.3% arginine, and 0.2% sodium citrate replacing ammonium citrate (Shaw and Harding 1984). Production of dextran (slime) from sucrose was observed on MRS agar in which glucose was replaced by 5% sucrose (Hitchener et al. 1982). DNA base composition

Chromosomal DNA was isolated as described by Pitcher et al. (1989). DNA base composition was estimated by thermal denaturation in standard saline citrate as described by Garvie (1978) with DNA from Escherichia coli NCDO 1984 (K12) (51.5 mol% G C) as standard.

tinguish the genus Weisseila from leuconostocs was synthesized by the phosphoramidite method on a model 391 DNA synthesizer (Applied Biosystems, Warrington, UK). T h e probe was labelled with fluorescein with the ECL 3’ end labelling and detection kit (Amersham International, UK) according to the manufacturer’s instructions. rRNA gene products for hybridizations were generated with two primers pA (sequence 5’ GAGAGTTTGATCCTGGCTCAGGA) and pE* (sequence 5’ TTCGAATTAAACCACATGC). Amplified rDNA products (ca 1 p g ) were denatured by boiling for 5 rnin and applied to Hybond N + nylon membrane (Amersham International) with the Bio-Rad slot-blot apparatus (Bio-Rad, Hemel Hempstead, UK) as described by the manufacturer. DNA was fixed to the membrane by placing it on 3 mm paper (Whatman Laboratory Division, Maidstone, UK) soaked in 0.4 mol I - ’ NaOH, followed by 2 x 15 rnin washes in 2 x SSC (standard saline citrate). Prehybridization, hybridization, post-hybridization washing and immunological detection of the probe were performed according to the ECL kit manufacturer’s instructions (Amersham International). Hybridizations were performed for 2 h at 42°C and probes were used at a concentration of 20 ng m l ~ Post-hybridization stringency washes (2 x 15 min) were performed in 1 x SSC containing 0.1% SDS at 47°C. After incubation with detection reagents, membranes were exposed to autoradiography film (Fuji, Genetic Research Instrumentation Ltd, Dunmow, UK) for 1-3 min. Stripping of membranes for re-probing with 16s rRNA universal probe (sequence 5’ TTACCGCGGCTGCTGGCACGT 3’) was achieved by boiling in 0.5% SDS for 8 min followed by washing in 2 x SSC for a further 5 min.

zyxwvutsr

+

16s rRNA gene sequence determination and analysis

Approximately 2.5 p g of chromosomal DNA was subjected to PCR amplification in a total volume of 100 p1 containing 1 unit of Tag polymerase (Amersham International). The reaction involved 36 cycles of denaturation at 92°C for 2 min, primer annealing a t 55°C for 1 min and primer extension at 72°C for 1.5 min. DNA was extracted with chloroform and purified with the Geneclean I1 kit (BIO 101, Inc.) according to the manufacturer’s instructions. Qualitative analysis of the DNA fragments was performed by agarose gel electrophoresis. Sequencing of the amplified product was performed with L Y - ~ ~dATP S and SEQUENASE version 2.0 sequencing kit (USB) as described previously by Hutson et al. (1993). Reaction products were separated on 55 cm wedge shaped (0.2-0.6 mm) 6% acrylamide-7 mol I - ’ urea gels at 55°C with an LKB Macrophor 2010 sequencing unit operated at 50 W per gel. Sequences were aligned and similarity values were determined with the Wisconsin Molecular Biology package (Devereux et al. 1984). Nucleotide substitution rates (K,,,, values) were calculated, and an unrooted phylogenetic tree was produced by using the algorithm of Fitch and Margoliash (1967) contained in a program written by Felsenstein (1982).

zyxwvutsrqpo zyxwvut

Oligonucleotide probe hybridizations

Oligonucleotide probe Wgp (sequence 5’ CCTACCTCTTAG(C/T)(A/G)GGGGATAA 3’) designed to dis-

RESULTS AND DISCUSSION

All 11 sausage isolates were found to be phenotypically homogeneous and formed large coccoid (but sometimes lenticular) cells occurring in pairs or chains. The strains were Gram-positive, catalase-negative, facultative anaerobes. All grew slowly in MRS broth but failed to grow on acetate agar (pH 5.6) or in 10% NaCl. They were all heterofermentative although gas production was relatively poor. The strains were similar to leuconostocs in producing D( -)-lactate. T h e partial 16s rRNA gene sequences of representative strains of the sausage bacterium were investigated to determine their relationship with known leuconostocs and other lactic acid bacteria. T h e 165 rRNA gene sequence of strain LV346 determined by direct sequencing of amplified products is shown in Fig. 1. The sequence consisted of a continuous stretch of 1525 nucleotides representing approximately 98% of the total 16s rRNA gene. Two frag-

zyxw zy

MOLECULAR SYSTEMATICS OF LEUCONOSTOCS 597

CCUGGCUCAGGAUGAACGCUGGCGGCGUGCCAAUACAUGC~GUCGAAUGGGACCGCUUUGUGCUU~UUGAUAUGACGAGCUUGCUCUGAUUUGAUUUUUUGAUU UCAAAGAGUGGCGAACGGGUGAGUAACACGUGGGUAACCUACCUCUUAGCAGGGGAUAACAUUUGG~CAAGUGCUAAUACCGUAUAAUACCAACAACC GCAUGGUUGUUGGUUGAAAGAUGGUUCUGCUAUCACUAAGAGAUGGACCCGCGGUGCAUUAGCUAGUUGGU~GGUAAUGGCUUACCAAGGCAAUGAUGC AUAGCCGAGUUGAGAGACUGAUCGGCCACAAUGGGACUGGGACUGAGACACGGCCCAUACUCCUACGGGAGGCAGCAGUAGGG~UCUUCCACAAUGGGCGCAAGC

CUGAUGGAGCAACGCCGCGUGUGUGAUGAAGGGGUUUCGGCUCGU~CACUGUUAUAAGAGAAGAACGGCACUGAGAGU~CUGUUCAGUGUGUGACGG UAUCUUACCAGAAAGGAACGGCUAAAUACGUGCCAGCAGCCGCGGU~UACGUAUGUUCC~GCGUUAUCCGGAUUUA~GGGCGU~GCGAGCGCAGA C G G U U A U U U A A G U C U G A A G U G A A A G C C C U C A G C C C U G C U C C A U G U G UAGCGGUGAAAUGCGUAGAUAUAUGGAAGAACACCAGUGGCGAAGGCGGCUUUCUGGACUGUAACUGACGUUGAGGCUCG~GUGUGGGUAGC~CAG GAUUAGAUACCCUGGUAGUCCACACCGUAAACGAUGAGUGCUAGAUGUUCGAGGGUUUCCGCCCUUGAGUGUCGCAGCU~CGCAUUAAGCACUCCGCCU GGGGAGUACGACCGCAAGGUUGAAAGCCCUCACUCAAAGGAAUUGACGGGGACCCGCAC~GCGGUGGAGCAUGUGGUUU~UUCG~GCAACGCGAAGAACCUUAC CAGGUCUUGACAUCCCUUGACAACGCUAGAAAUAGCGCGUUCCCUUCGGGGACAAGGUGACAGGUGGUGCAUGGUUGUCGUCAGCUCGUGUCGUGAGAUG UUGGGUUAAGUCCCGCAACGAGCGCAACCCCUUAUUAUUAGUUGCCAGCAUUCAGUUGGGCACUCUAGUGAGACUGCCGGUGAU~CCGGAGGAAGGUGG

z z

zyxwvutsr zyxwvutsr

GGAUGACGUCRAAUCAUCAUGCCCCUUAUGACCUGGGCUACACACGUGCUACAUGGCAUAUACAACGAGUCGCUAACCCGCGAGGGUACGCUAAUCUCU

UAAAGUAUGUCUCAGUUCGGAUUGUAGGCUGCAACUCGCCUACAUG~GUCGGAAUCGCUAGUAAUCGCGGAUCAGAACGCCGCGGUG~UACGUUCCCG

GGUCUUGUACACACCGCCCGUCACACCAUGAGAGUUUGUACACCCAAAGCCGGUGGGGUAACCUUUUAGGAGCCAGCCGUCUAAGGUGGGACAGAUGAU UAGGGUGAAGUCGUAACAAGUAGCCGU Fig. 1 Nucleotide sequence of derived 16s rRNA of Weissellu heNenica (NCFB 2973)

ments (approx. positions 50 to 200 and 900 to 1100, which includes variable regions V1 and V6, nomenclature of Neefs et al. 1990) of the 16s rRNA genes of two other strains (LV338, LV315) were sequenced and found to be identical to that of LV346, thereby demonstrating genetic homogeneity of the unknown isolates. Similarity values for a 1330 nucleotide region (ranging from positions 107 to 1410 of the Escherichia coli numbering system) of the 16s rRNA sequence from strain LV346 and homologous sequences of over 100 reference strains from the major phylogenetic lines within the lactic acid bacteria were determined. Approximately 100 nucleotides proximal to the 5’ end of the rRNA gene were omitted from the similarity calculations in order to remove alignment problems arising from considerable variation in the length of the V1 region (see Neefs et al. 1990 for nomenclature) between species. A matrix of representative sequence similarities is shown in Table 1. Strain LV346 exhibited very high sequence relatedness (98.6%) to Leuc. paramesenteroides. Relatively high sequence similarities were also shown with other species of the Leuc. paramesenteroides group of organisms (ca 94-97 %), although significantly lower values were displayed with members of Leuconostoc sensu stricto (ca 89-91 %). Evolutionary distance (KnUc) values between the sausage isolates, leuconostocs and other representative lactic acid bacteria were calculated, and a distance matrix tree constructed from these data is shown in Fig. 2. The branching pattern of the tree reinforced the high phylogenetic affinity between the unknown strain and the Leuc. paramesenteroides group of species. In the present study we have characterized a new group of Leuconostoc-like organisms from dry fermented Greek sausage. It was evident from both 16s rRNA similarity calculations and results of the distance matrix analysis that the closest phylogenetic relative of the unknown bacterium is Leuc. paramesenteroides. The number of nucleotide differ-

ences (18 mismatches, four unmatched for a comparison of 15 18 bases) between these two taxa, however, is significantly greater than that observed between strains of the same species. The presence of characteristic ‘signatures’ within the 16s rRNA of the unknown organism provides further evidence of its genospecific separatedness. Most notable of these is diagnostic sequences in helix 1007/1022 of variable region V6 which readily distinguishes the unknown bacterium from all known species of the Leuc. paramesenteroides group (Table 2). Earlier 16s rRNA sequencing studies (Yang and Woese 1989; MartinezMurcia and Collins 1990, 1991) demonstrated that Leuc. paramesenteroides and related species (viz. Lact. confusus, Lact. kandleri, Lact. minor, Lact. halotolerans, Lact. virzdescens) form a natural phylogenetic group, separate from Leuconostoc sensu stricto and other lactic acid bacteria. A recent comparative study of 23s rRNA gene sequences (Martinez-Murcia et al. 1993) confirmed the phylogenetic distinctiveness of the Leuc. paramesenteroides cluster and it is now evident that this grouping merits separate generic status. Therefore, based upon the results of the present and earlier phylogenetic investigations, we propose Leuc. paramesenteroides and related species be reclassified in a new genus for which we propose the name Weissella. We further propose the unknown bacterium from fermented sausage be recognized as a new species with the name Weissella hellenica .

zy

zyxw

Description of Weisseiia gen. nov.

(Weissellu M. L. dim. fem. n. named after Norbert Weiss, a German microbiologist, known for his many contributions to the lactic acid bacteria). Cells are generally short rods with rounded to tapered ends or coccoid in shape occurring singly, in pairs or in short chains. Cells are Gram-positive and non-motile. Endospores are not formed. Catalase and

I S

zyxwvutsrqponmlkjihgfedcbaZ zyxwvutsrqpon .r

0

-t

r-,

N

zyxwvutsrqpon

zy

zy zyxwvutsrqpo zyxwvutsrqp zyxwvutsrqpon MOLECULAR SYSTEMATICS OF LEUCONOSTOCS 599

Fig. 2 Unrooted tree showing the phylogenetic interrelationshipsof members of the genus Weissella and some other lactic acid bacteria. The tree is based on a comparison of ca 1330 nucleotides. A, Aerococcus ;C, Carnobacterium;E, Enterococcus ;Lb, Lactobacillus;Lc, Lactococcus ;Leu, Leuconostoc; P, Pediococcus ;S , Streptococcus; V , Vagococcus;W, Weissella

Leu. mnas

W bolotolerans

zyxwv zyxwvutsrq W wridescens W. Xandferi

Lb. fermentum

\

Leu follax

Leu cornosum

Leu pseudomesenteroides

Leu lochs

Lb ocidaphtlus Lb bomsteri

Lb delbrubckii

LC IOCtlS

\ Lc gorvteoe

cytochromes are not produced. Chemo-organotrophs, having complex nutritional requirements. Heterofermentative. With the exception of Weissella paramesenteroides and W . hetlenica (which produce D( -)-lactic acid) species of the genus generally produce DL lactate from glucose. Acidoduric. Growth occurs at 15°C; growth does not occur at 45°C (with the exception of some strains of W . confusa). Strains o f some species hydrolyse arginine. T h e cell wall peptidoglycan is based upon lysine; the interpeptide bridge contains alanine, or serine and alanine, as typical constituents. The guanine plus cytosine content of DNA is 37-47 mol%. T h e type species is W . vzrzdescens.

Description of Welssella h8lotolerans (Kandier, Schillinger and Welss) comb. nov.

zyxwvu A detailed species description may be found in Kandler et al. (1983) and Kandler and Weiss (1986).

Description Of weissell8 k8ndleri (HolzaPfel and van WYk) comb- nov-

A detailed species description may be found in Holzapfel and van Wyk (1982) and Kandler and Weiss (1986).

Description of Weissella confus8 (Holzapfel and Kandier) comb. nov.

Description of Weissell8 mlnor (Kandler, Schllllnger and Weiss) comb. nov.

A detailed species description may be found in Holzapfel and Kandler (1969) and Kandler and Weiss (1986).

A detailed species description may be found in Kandler et al. (1983) and Kandler and Weiss (1986).

Table 2 Diagnostic sequences of Weitsella spp. in helix 1007/1022 of variable region

V6 of 16s rRNA

zyxwvut

W . paramesenteroides W . hellenica sp. nov. W . confusa W . halotolerans W . kandleri W . minor W . viridescens

UUGCUAAUCCUAGAAAUAGGACGGUUCC UUGACAACGCUAGAAAUAGCGCG.UUCC

UUGACNACUCCAGAGAGGAG.CG.UUC

UUGACCACCUCAGAGAUGAGGC.UUUCC UUGACCACUCCAGAGAUGG AGC.UUUCC UUGACCACUUCAGAG AUGAAGC.UUUC UUGACCACUUCAGAGAUGAAGC.UUUC

Paired nucleotides are shown underlined.

D

Lys-Ala, ; Lys-Ser-Ala, Spherical or lenticular cells

DL

Lys-Ala

+ +

Ly s-Ala-Ser

+

Irregular rods

Cell morphology

Irregular short or coccoid rods

~

more than 25% of total lactic acid is L( +); NT, not tested.

~

D,

Short rods thickened at one end

zyxwvutsrqponmlkjihgfedcbaZYXWVUTSRQPONMLKJIHGFEDCBA f , 90% or more of strains positive; -, 90% or more strains negative; d, 1I-89% of the strains positive; ( ), delayed reaction;

Irregular short coccoid rods with rounded to tapered ends

Lys-Ser-Ala,

Ly s- Ala-Ser

Lys- Ala-Gly- Ala,

Small irregular rods

DL

DL

DL

NH, from arginine Dextran formation Lactic acid configuration Murein type

~

d

+ +

d NT

+

+ +

d (4

W . paramesenteroides

DL

+

W . confusa

NT

-

W . halotolerans

NT

W . viridescens

+ +

W . kandleri

D

W . hellenica sp. nov.

90% or more of the lactic acid is D( -);

DL,

Large spherical or lenticular cells

Lys-Ala-Ser

zyxwvutsrqpon

Acid produced from: L-Ara binose Cellobiose Galactose Maltose Melibiose Rafinose Ribose Sucrose Trehalose Xylose

Characteristic W . minor

zyxwvutsrqp zyxwvutsrqpon zyxwvutsrqp zyxwvuts zy

Table 3 Differential characteristics of species of the genus Weissella

z zyxwvutsrqpon zyxwvutsr zyxwvutsrqp MO L EC U L AR SYSTEMATICS OF LEUCONOSTOCS

601

Table 4 Differential characteristics of species of the genus Leuconostoc

Leuc. carnosum

Characteristic

Acid produced from: L- Arabinose Cellobiose Galactose Maltose Melibiose Rafinose Ribose Sucrose Trehalose Xylose NH, from arginine Dextran information Lactic acid configuration Murein type

d d d

+

d -

+ + d

Leuc. lactis

Leuc. mesenteraides Leuc. subsp. cremoris oenos

+ + + +

+ +

-

d

+ + d + + +

d -

d -

d d

d

+ +

-

+ d

d

-

Leuc. pseudomesenteroides

+ + + + + + + + + +

+ +

d

zyxwvu

-

-

-

-

-

NT

D

D

D

D

Lys-Ser-Ala,

Lys-Ser-Ala,

Lys-Ser, ; Lys-Ala-Ser

Lys-Ser-Ala,

-

-

NT

d

-

d

-

+

D

D

D

D

NT

NT

NT

Lys-Ala,

zyxwvutsrq

+, 90% or more strains positive; D(

Leuc. Leuc. citreum gelidum

Leuc. mesenteroades subsp. mesenteroides

-, 90% or more strains negative; d, 11-89% of strains positive;

D,

90% or more of the lactic acid is

-); NT, not tested.

Description of Weissella paramesenteroldes (Garvle) comb. nov.

A detailed species description may be found in Garvie

(1967, 1986). Description of Weissella viridescens (Niven and Evans) comb. nov.

A detailed species description may be found in Niven and Evans (1957) and Kandler and Weiss (1986). Description of Weissella hellenica sp. nov.

(Gr. adj. Hellenikos, Greek; N.L. fern. adj. hellenica, Greece, from where the bacterium was first isolated). Gram-positive, non-motile, non-sporeforming, spherical but sometimes lenticular cells usually occurring in pairs or short chains, with a tendency to form clusters. Growth in MRS broth is slow with cells tending to precipitate. Colonies are small, often pin-point, smooth, round and greyish white. No growth occurs at 37°C. All strains grow at 10°C and 4°C (delayed). Heterofermentative but gas production is relatively poor. All strains produce more than 98% D( -)-lactate. Catalase-negative. Arginine is not hydrolysed. Growth occurs in 8% NaCI, but not in 10% NaCl or on acetate agar (pH 5.6). All strains fail to acidify Lacto-

bacillus broth below p H 44-50. Slime is not produced from sucrose. Voges-Proskauer test negative. Hydrogen peroxide is produced. Acid is produced from L-arabinose, glucose, fructose, mannose, a-methyl-D-glucoside, Nacetyl-glucosamine, maltose, sucrose, trehalose, D-arabitol and gluconate. Acid is not produced from glycerol, erythritol, D-arabinose, ribose, xylose, adonitol, P-methyl-xyloside, L-sorbose, rhamnose, dulcitol, inositol, mannitol, sorbitol, a-methyl-D-mannoside, amygdalin, arbutin, salicin, cellobiose, lactose, inulin, melezitose, D-raffinose, amidon, glycogen, xylitol, fl-gentiobiose, D-lyxose, D-tagatose, fucose, L-arabitol, 2-ceto-gluconate and 5-ceto-gluconate. A very weak and delayed reaction with galactose, D-tUranOSe and melibiose may be observed. T h e cell wall murein is type Lys-L-Ala-L-Ser(L-Ala). T h e DNA base compositions of strains LV346 and LV338 were 39-4 and 40.0 mol% G C (T,) respectively. T h e type strain is NCFB 2973 ( = LV346). Isolated from fermented sausages.

+

Differentiation of the genus Weissella from the other lactic acid taxa

Members of the genus Weissella may be distinguished readily from homofermentative lactobacilli, pediococci, enterococci, lactococci and streptococci by the formation of gas from carbohydrates. A cell wall murein based upon lysine with an interpeptide bridge containing alanine, or

z

zyxwvutsrqpo

602 M . D . COLLINS E T A L .

( 0 )

zyxwvutsrqponmlkji zyxwvutsrqpon zyxwvutsrq I

2

3

4

5

6

CCTACCTCTTAG(C/T)(A/G)GGGGATAA 3’) directed

against PCR-amplified 16s rDNA also provides an unequivocal means of distinguishing species of the genus Weissella from Leuconostoc sensu stricto (see Fig. 3). Differentlation of Welssella hellenlca from other Welssella species

zyxwvutsrqponmlkjihgfe zyxwvutsrqponm Weissella hellenica can be distinguished from other species of the genus Weissella by the characteristics shown in Table 3.

ib) I

2

3

4

5

6

ACKNOWLEDGEMENTS

Fig. 3 Autoradiograph of slot-blot hybridizations to amplified 16s rRNA gene fragments of row A : 1, Werssella paramesenterordes (NCDO 803); 2, W . confusa (NCDO 1586); 3, W . vrrrdescens (NCDO 1655); 4, W . minor (NCDO 1973); 5, W . kandleri (NCDO 2753); 6, W . halotolerans (NCFB 2781); row B : 1, W . hellenrca (NCFB 2793); 2, Leuc. mesenterordes (NCDO 523); 3, Leuc. lactrs (NCDO 533); 4, Leuc. pseudomesenterordes (NCDO 768); 5, Leuc. oenos (NCDO 1674); 6, L e u . crtreum (NCDO 1837); row C: 1, Leuc. gelrdum (NCFB 2775); 2, Leuc. carnosum (NCFB 2776); 3, Leuc. arnelobiosurn (NCFB 2787); 4, Leuc. fallax (NCFB 2796); 5, Lact. caser (NCDO 161); 6, Lact. sharpeae (NCDO 2590); row D : 1, Lact. acetotolerans (NCFB 2798); 2, Lact. buchnerr (NCDO 110); 3, Lact. rhamnosus (NCDO 243); 4, Lact. hrlgardrr (NCDO 264); 5, Ped. pentosaceus (NCDO 990); 6, Ped. dextrrnrcus (NCDO 1561). (a) Hybridized with Weissella

probe Wgp; (b) hybridized with the universal probe alanine plus serine or glycine distinguishes Weissella from heterofermentative lactobacilli. T h e differentiation of the genus Weissella from Leuconostoc is more problematic and requires the use of a combination of characters for particular species. For example, several species (viz. W . confusa, W . halotolerans, W . kandleri and W . minor) can be distinguished from leuconostocs by their ability to hydrolyse arginine and by the formation of DL-lactate. T h e remaining species, W . paramesenteroides, W . hellenica and W . viridescens, possess characteristic phenotypic profiles and can be identified by a battery of biochemical tests (Garvie 1986; Kandler and Weiss 1986; Tables 3 and 4). Species of the genus Weissella form a distinct phylogenetic group which can be distinguished from members of Leuconostoc sensu stricto by ‘signature’ bases in the 16s rRNA (Yang and Woese 1989; Martinez-Murcia and Collins 1990, 1991). A hybridization probe (sequence 5’

M.D. Collins and S. Wallbanks gratefully acknowledge the support of the Ministry of Agriculture and Fisheries and Food. We are grateful to Professor T.O. MacAdoo (Virginia Polytechnic Institute and State University, USA) for deriving the species name and to D r N. Weiss (Deutsche Sammlung von Mikroorganismen, Germany) for providing murein composition. REFERENCES Collins, M.D., Rodrigues, U., Ash, C., Aguirre, M., Farrow, J.A.E., Martinez-Murcia, A,, Phillips, B.A., Williams, A.M. and Walibanks, S. (1991) Phylogenetic analysis of the genus Lactobacillus and related lactic acid bacteria as determined by reverse transcriptase sequencing of 16s rRNA. F E M S Microbiology Letters 77, 5-12. De Man, J.C., Rogosa, M. and Sharpe, M.E. (1960) A medium for the cultivation of lactobacilli. Journal of Applied Bacteriology 23, 13&135. Devereux, J., Haeberli, P. and Smithers, 0. (1984) A comprehensive set of sequence analysis programs for the VAX. Nucleic Acids Research 12, 387-395. Felstenstein, J. (1982) Numerical methods for inferring evolutionary trees. Quarterly Review of Biology 57, 379-404. Fitch, W.M. and Margoliash, E. (1967) Construction of phylogenetic trees: a method based on mutation distances as estimated from cytochrome c sequences is of general applicability. Science 155, 279-284. Garvie, E.I. (1967) The growth factor and amino acid requirements of species of the genus Leuconostoc including Leuconostoc paramesenteroades (sp. nov.) and Leuconostoc oenos. Journal of General Microbiology 48,439-447. Garvie, E.I. (1978) Streptococcus raflnolactis (Orla-Jensen and Hansen); a group N streptococcus found in raw milk. International JournaI of Systematic Bacteriology 28, 19&193. Garvie, E.I. (1986) Genus Leuconostoc. In Bergey’s Manual of Systematic Bacteriology, Vol. 2, ed. Sneath, P.H.A., Mair, N.S., Sharpe, M.E. and Holt, J.G. pp. 1071-1075. Baltimore: Williams and Wilkins. Harrigan, W.F. and McCance, M.E. (1976) Laboratory Methods in Food and Dairy Microbiology (revised ed.). London : Academic Press.

zyx

zyxwvut

zy zyxwvutsrqpon zyxwvutsrqp zyxwvutsr zyxwvutsr zyxwvut M O L E C U L A R S Y S T E M A T I C S OF L E U C O N O S T O C S 603

Hitchener, B.J., Egan, A.F. and Rogers, P.J. (1982) Characteristics of lactic acid bacteria isolated from vacuum-packaged beef. Journal of Applied Bacteriology 52, 3 1-37. Holzapfel, W.H. and Kandler, 0. (1969) Zur Taxonomie der Gattung Lac~obacillus Beijerinck. VI Lactobaciflus coprophilus subsp. confusus nov. subsp., eine neue Unterart der Untergattung Betabacterium. Zentralblatt f i r Bakteriologie, Mikrobiologie und Hygiene I I . Abt. 123, 657-666. Holzapfel, W.H. and van Wyk, E.P. (1982) Lactobacillus kandleri sp. nov., a new species of the subgenus Betabacterium with glycine in the peptidoglycan. Zentralblatt f i r Bakteriologie, Mikrobiologie und Hygiene. I . Abt. Orig. C3,495-502. Hutson, R., Thompson, D.E. and Collins, M.D. (1993) Genetic interrelationships of saccharolytic Clostridium botulinum types B, E and F and related clostridia as revealed by small-subunit rRNA gene sequences. F E M S Microbiology Letters 108, 103110.

Jayne-Williams, D.J. (1976) The application of miniaturized methods for characterization of various organisms isolated from the animal gut. Journal of Applied Bacteriology 40, 189-200. Kandler, 0. and Weiss, N. (1986) Genus Lactobacillus. In Bergey’s Manual of Systematic Bacteriology, Vol. 2, ed. Sneath, P.H.A., Mair, N.S., Sharpe, M.E. and Holt, J.G. pp. 12091234. Baltimore: Williams and Wilkins. Kandler, O., Schillinger, U. and Weiss, N. (1983) Lactobacillus halotolerans sp. nov., nom. rev. and Lactobacillus minor sp. nov., nom. rev. Systematic and Applied Microbiology 4, 28& 285. Martinez-Murcia, A.J. and Collins, M.D. (1990) A phylogenetic analysis of the genus Leuconostoc based on reverse transcriptase sequencing of 16s rRNA. F E M S Mic~obiology Letters 70, 73-84. Martinez-Murcia, A.J. and Collins, M.D. (1991) A phylogenetic analysis of an atypical leuconostoc : description of Leuconostoc fallax sp. nov. F E M S Microbiology Letters 82, 55-60.

Martinez-Murcia, A.J., Harland, N.M. and Collins, M.D. (1993) Phylogenetic analysis of some leuconostocs and related organisms as determined from large-subunit rRNA gene sequences : assessment of congruence of small- and largesubunit rRNA derived trees. Journal of Applied Bacteriology 74, 532-541. Neefs, J.M., Van de Peer, Y., Hendriks, L. and De Wachter, R. (1990) Compilation of small ribosomal subunit RNA sequences. Nucleic Acids Research 18, 2237-2242. Niven, C.F. and Evans, J.B. (1957) Lactobacillus viridescens nov. spec., a heterofermentative species that produces a green discoloration of cured meat pigments. Journal of Bacteriology 73, 758-759. Pitcher, D.G., Saunders, N.A. and Owen, R.J. (1989) Rapid extraction of bacterial genomic DNA with guanidium thiocyanate. Letters in Applied Microbiology 8, 151-156. Rogosa, M., Mitchell, J.A. and Wiseman, R.F. (1951) A selective medium for the isolation and enumeration of oral and fecal lactobacilli. Journal of Bacteriology 62, 132-133. Sharpe, M.E. (1979) Identification of the lactic acid bacteria. In Identrjication Methods f o r Microbiologists ed. Skinner, F.A. and Lovelock, D.W. pp. 233-259. Society for Applied Bacteriology Technical Series No. 14, 2nd edn. London: Academic Press. Shaw, B.G. and Harding, C.D. (1984) A numerical taxonomic study of lactic acid bacteria from vacuum-packed beef, pork, lamb and bacon. Journal of Applied Bacteriology 56, 2540. Whittenbury, R. (1964) Hydrogen peroxide formation and catalase activity in the lactic acid bacteria. Journal of General Microbiology 35, 13-26. Yang, D. and Woese, C.R. (1989) Phylogenetic structure of the “leuconostoc” : an interesting case of a rapidly evolving organism. Systematic and Applied Microbiology 12, 145-149.