Adolescent Brain Development 9781615046423, 9781615046430

Citation preview

Series ISSN: 2159-5194

Series Editor: Margaret M. McCarthy, University of Maryland School of Medicine

Adolescent Brain Development Lisa Wright, Dalhousie University Stan Kutcher, Dalhousie University

ADOLESCENT BRAIN DEVELOPMENT

This book is the foundation of unlocking one of the greatest mysteries mankind has faced throughout history…the teen brain. The teen brain is fundamentally different from the brain of an adult or of a child, so this book provides a starting point for understanding how young people think and act. It summarizes the differences succinctly by capturing the most relevant and current research findings on adolescent brain and behavior development and putting them into the context of our current society and its demands; so we can better understand our teens’ and their thinking! Adolescent Brain Development also provides insight into ongoing changes in health and education policies that reflect a better understanding of adolescent brain development. Adolescent Brain Development is for a broad audience and assumes at least some background knowledge in biology, neuroscience, or psychology. It is a valuable resource for educators in designing engaging and appropriate lesson material for teens, as well as for understanding developmental behavior changes in teens. There are important practical applications within for health care personnel, particularly in the mental health field as well as for policy makers who want to make informed decisions in health and education policies. Researchers and students will benefit greatly from this broad overview which includes extensive examples from both authors’ experience. Parents and their teenagers will also find this book an excellent resource for why these changes happen.

WRIGHT • KUTCHER

Colloquium Lectures on The Developing Brain

About Morgan & Claypool Publishers

store.morganclaypool.com

morgan & claypool

This volume is a printed version of a work that appears in the Colloquium Digital Library of Life Sciences. Colloquium books provide concise, original presentations of important research topics, authored by invited experts. All books are available in digital & print formats. For more information, visit store.morganclaypool.com

LIFE SCIENCES

Adolescent Brain Development

Lisa Wright Stan Kutcher

Colloquium Lectures on The Developing Brain Series Editor, Margaret M. McCarthy

Adolescent Brain Development

ii

Colloquium One liner Chapter Title Digital Library of Life Sciences The Colloquium Digital Library of  Life Sciences is an innovative information resource for researchers, instructors, and students in the biomedical life science community, including clinicians. Each PDF e-book available in the Colloquium Digital Library is an accessible overview of a fast-moving basic science research topic, authored by a prominent expert in the field. They are intended as time-saving pedagogical resources for scientists exploring new areas outside of their specialty. They are also excellent tools for keeping current with advances in related fields, as well as refreshing one’s understanding of core topics in biomedical science. For the full list of available titles, please visit: colloquium.morganclaypool.com Each book is available on our website as a PDF download. Access is free for readers at institutions that license the Colloquium Digital Library. Please e-mail [email protected] for more information.

iii

Colloquium Series on The Developing Brain Editor Margaret M. McCarthy, PhD, Professor and Chair Department of Pharmacology University of Maryland School of Medicine The goal of this series is to provide a comprehensive state-of-the-art overview of how the brain develops and those processes that affect it. Topics range from the fundamentals of axonal guidance and synaptogenesis prenatally to the influence of hormones, sex, stress, maternal care, and injury during the early postnatal period to an additional critical period at puberty. Easily accessible expert reviews combine analyses of detailed cellular mechanisms with interpretations of significance and broader impact of the topic area on the field of neuroscience and the understanding of brain and behavior. Published titles (for future titles please see the website, http://www.morganclaypool.com/toc/dbr/1/1)

Copyright © 2016 by Morgan & Claypool Life Sciences All rights reserved. No part of this publication may be reproduced, stored in a retrieval system, or transmitted in any form or by any means—electronic, mechanical, photocopy, recording, or any other except for brief quotations in printed reviews, without the prior permission of the publisher. Adolescent Brain Development Lisa Wright and Stan Kutcher www.morganclaypool.com ISBN: 9781615046423 paperback ISBN: 9781615046430 ebook DOI: 10.4199/C00133ED1V01Y201602DBR012 A Publication in the COLLOQUIUM SERIES ON THE DEVELOPING BRAIN Lecture #12 Series Editor: Margaret M. McCarthy, University of Maryland School of Medicine Series ISSN ISSN 2159-5194

print

ISSN 2159-5208

online

Adolescent Brain Development Lisa Wright and Stan Kutcher Dalhousie University

COLLOQUIUM SERIES ON THE DEVELOPING BRAIN #12

vi

Abstract Adolescent brain development is a fascinating, newly developing field that has so much to offer almost anyone interested in learning more. Adolescence has only come to be established as a unique developmental phase in the last few decades or so. We now know that the human brain undergoes dramatic developmental changes in the postnatal period, not only early after birth but also extending all the way into adulthood. These changes are not uniform, in that the brain regions undergoing the most change during adolescence are not the same as the regions that changed most in the early life period, and the processes of change also differ as we age. Some of the most important changes that we see during the adolescent period are: 1) pruning (or removal) of excessive neural connections, 2) increases in white matter, the portion of brain matter that allows different regions to communicate with one another, and 3) thinning of the cortex, which is comprised of the outer layers of brain matter. Compared with other areas of the brain, the frontal and temporal cortices undergo the most protracted changes in their structure, implying that developments in these areas play a large role in providing the foundation for adolescent behavioural changes. In this book, we compare adolescent behavioural changes with ongoing changes in the brain and discuss potential implications for health and educational policy-making.

Key words adolescence, brain development, teen brain, prefrontal cortex, frontal cortex, temporal cortex, protracted brain development, neural pruning, white matter, cortical thinning, health policy, education policy.

vii

Contents 1.

Introduction........................................................................................................1 1.1 Overview.............................................................................................................. 2 1.2 The Nature/Nurture Interaction: Genes, Development, and Epigenetics............ 4 1.3 Physical Development........................................................................................ 11 1.3.1 Prenatal Growth..................................................................................... 12 1.3.2 Postnatal Growth.................................................................................... 16 1.4 Brain Development............................................................................................ 18

2.

Adolescent Brain Development.......................................................................... 23 2.1 Overview............................................................................................................ 23 2.2 Grey Matter Peaks and Declines, White Matter Increases, and Cortical Thinning............................................................................................... 25 2.3 Changes in Neurotransmitter Levels.................................................................. 28 2.4 Protracted Brain Development of the Frontal and Temporal Cortex................. 31 2.5 Regional Specificity and Lateralization of Brain Function................................. 33 2.6 Functional Integration and Gains in Network Efficiency................................... 34 2.7 Sex Differences................................................................................................... 35

3.

Adolescent Behavior........................................................................................... 37 3.1 Overview............................................................................................................ 37 3.2 Behavioral Changes............................................................................................ 37 3.2.1 Changes in Activity Patterns.................................................................. 38 3.2.2 Changes in Intellectual Capacity and Abstract Reasoning Abilities....... 40 3.2.3 Changes in Emotional Regulation......................................................... 44 3.2.4 Impulsivity and Risk-taking................................................................... 47

4.

Adolescent Social Dynamics............................................................................... 51 4.1 Taking a Look at Teen Ostracism....................................................................... 51 4.2 Resilience vs. Susceptibility................................................................................ 55

viii  Adolescent Brain Development

5.

Links to Underlying Brain Development............................................................. 59 5.1 Activity and Related Brain Development........................................................... 59 5.2 Cognition and Related Brain Development....................................................... 62 5.3 Emotion, Risk-taking, Impulsiveness, and Related Brain Development............ 66 5.4 Mental Disorders that Arise in Adolescence...................................................... 72

6.

Putting it All in Context..................................................................................... 75 6.1 Implications for Health and Social Policy.......................................................... 75 6.2 Implications for Education Policy...................................................................... 76 6.3 Promoting Adolescent Development in the Community................................... 78 6.4 Concluding Remarks.......................................................................................... 80

References.................................................................................................................. 81 Author Biographies................................................................................................... 103



chapter 1

Introduction Do you recall how you felt and behaved during the days of your youth? What was it like to leave childhood behind and become a teenager? How did your life and you change across the teen years, and when do you think you finally reached adulthood? Some of us may say age 18, while others may say not until 35. Many of us have fond memories of the adolescent period as a time to explore life’s possibilities, have fun with friends, and not worry too much about the future. For some adolescents, however, due to life circumstances such as living in poverty, being exposed to persistent violence, or experiencing major negative life challenges (such as the death of a parent), this time in life may not hold so many fond memories as it does for others. However, even given such negative circumstances, adults will often joke and laugh about the trouble they caused or experienced as a teen, even though it may have been no laughing matter at the time. Yet, it often seems that social norms expect teens never to be in or cause trouble. Maybe, however, causing or experiencing trouble as a teen is actually a typical, normative part of adolescent development. The term “trouble” is subjective and there is a big difference between the types of impact “trouble” can have. Selling an illegal drug, getting home very late at night, drinking too much, drinking and then driving, failing an examination, cheating on an examination, wearing sandals to a funeral or shorts to school in winter, bullying someone, or stealing a car (etc.) are all examples of things that can cause “trouble” for a teen. However, the examples surely are not the same—or, could they be more alike than we think? Could all these “troubles” be different types and degrees of expression of the same brain developmental processes that we consider to create the defining characteristics of this period in life? And, if that could be the case, what other impacts could these brain changes have? For example, could they also be the foundation of the innovation, exploration, idealism, creativity, and energy that teens are known for? Here we will explore those possibilities. Our main objectives for this book are two-fold: first, we’ll examine how behavior, emotions, and cognition typically change during the adolescent period and also what we know about developmental processes going on in the brain at this time that may be the foundations underlying those changes; second, we’ll try to understand what makes some individuals vulnerable to a negative developmental outcome, while other individuals are resilient or flourish in similar environments.

  Adolescent Brain Development

A better understanding of what factors may lead to positive life outcomes may go a long way in efforts to develop better interventions and treatment strategies for adolescents experiencing social, emotional, and behavioral difficulties, or who have developed a mental disorder. Perhaps this understanding may also foster the creation of healthier families and communities. Thus, it goes without saying that this is an exciting endeavor!

1.1

Overview

The overall goal of this book is to provide a description of   what is currently known about adolescent development, in terms of changes in emotions, cognition, and behavior, as well as related changes in the brain. How does what we now know about the way people’s brains grow and develop during adolescence explain what we refer to as the psychology of adolescence? However, before we attempt this task we need to keep two important caveats in mind. First, what we know about the adolescent brain is still very much limited by the nature of the tools we have to study it, the sophistication of the research methods we have used, and the length of time we have been studying it. Thus, as science and technology develop and our research capabilities improve, our information about how the teen brain develops may change, and we may end up discarding what we consider to be good explanations in favor of better or different explanations. Therefore, we should refrain from getting too confident that we know all that we need to know about the teen brain! Indeed, we expect that perhaps in ten years a part of what we today think is correct will turn out to be incorrect. Unfortunately, we don’t know which part that will be! Second, while there may be strong correlations between certain brain changes and the emergence of different kinds and degrees of teen behaviors, that does not mean that those changes directly lead to those behaviors, nor does it mean that those changes necessarily lead to those behaviors. We are aware that co-relation does not equal causality and also that ongoing environmental influences on how teens’ brains grow and develop may have substantial impacts on their emotions, cognitions, and behaviors. Simply put, the circumstances of adolescence may have strong impacts on the development of adolescents. Therefore, we start this exploration of adolescent psychology, not with certainty but with humility and the willingness to change what we think is correct as the scientific evidence develops over time. In conjunction with our scientific training and expertise, we also carry with us the awareness that cultural knowledge (or indigenous or traditional knowledge) also provides different useful information that is very important to consider in gaining a big-picture perspective.

Introduction  

Many of us may not really be comfortable in our knowledge of what the word “psychology” means, even though we may use it on a regular basis. In the sciences, psychology is most commonly defined as the study of   behavior and/or mental states and processes. Notice the euphemistic “and/or” conjunction here, which seems to denote that studying either behavior OR mental states and processes should be classified under the general umbrella term of   “psychology.” Many colleagues in uni­­ versity departments of psychology would argue that, at its core, psychology is the study of   behavior, and it must always relate primarily to behavior. They may argue that the measurable output of our mental processes is the effect that it has on behavior, an effect that can be observed and quantified and studied directly. From a clinical perspective, this approach holds a degree of promise; it provides normative behavioral data to doctors and other healthcare workers and can help us develop predictive models of future behaviors. It thus allows us to develop a better understanding of environmental factors involved in generating certain behavioral outcomes. This then can help us better determine what kinds of interventions may be helpful in increasing the probability of better health outcomes. One important consequence of this kind of reasoning has been the recognition that interventions for children who are exhibiting behavioral difficulties that begin early in life and use specific types of environmental manipulations may be more effective than either interventions beginning later in life or different types of interventions. Both timing and type of intervention may each play an important role in levels of effectiveness. Despite these merits and well-demonstrated impacts, this idea that psychology is simply the study of   behavior leaves some burning questions. (1) What goes on INSIDE the mind—just because we can’t see it with our eyes doesn’t mean processes aren’t going on INSIDE our brains. What is going on in there when we express a behavior? (2) How do mental processes relate to ongoing behavior? Why are only SOME mental processes predictive of a change in behavior, whereas other mental processes do not seem to induce an observable behavioral change? Also, for those suffering from psychological problems or mental disorders, the major challenges that they are facing may not be behavioral problems but rather inappropriate, unwanted, and often distressing thoughts and emotions. Inevitably then, the study of   behavior is inextricable from the processes that regulate it. Given the current state of the field of neurobiology, we know that the organ most responsible for regulating behavior is the brain. We have a solid basic understanding of how nerves function in their control of various emotional, cognitive, and behavioral functions, although we are still learning a great deal about many aspects of the brain circuits and systems involved. Thus, we now understand the brain to be both the organ that creates the mind and the place from which our emotions,

  Adolescent Brain Development

cognitions, and behaviors originate. Those who study how brain function relates to behavior or who study brain circuits and processes in their own right are said to be in the field of neuroscience, and these approaches help us better understand the brain in health and in illness and how to intervene to help build healthy brains and help heal those that are not functioning well. Our book is based on this understanding, and it is from this perspective that we approach the topic of adolescent brain development and adolescent psychology. A teenager is not just a bundle of   behaviors but a complex organism with complicated and interwoven emotions, cognitions, and behaviors. We need to try and understand all these at the same time. The overarching theme of our book is that, by attempting to link adolescent brain development with changing adolescent psychology, we may gain important insights about how behavior, emotions, and cognition are all regulated by the brain and about what distinguishes the regulation of adolescent psychology from that of adults or younger children. We will begin with a general consideration of   human brain development across the lifespan and of adult brain function. From there, we’ll move in Chapter 2 to a more focused look at brain development during the adolescent period. In Chapter 3, we will describe patterns of adolescent psychological changes, and in Chapter 4 we’ll take a look at teen social dynamics. In Chapter 5, we will attempt to link these behavioral observations to what is known about ongoing developmental changes in brain function. In the final chapter, Chapter 6, we will consider how our knowledge of adolescent psychology should be applied, in terms of legal, educational, and medical policies and current practice guidelines.

1.2

The Nature/Nurture Interaction: Genes, Development, and Epigenetics

As with so many other books on psychology, development, or the brain and behavior, we must start by considering, in the most basic sense, what makes an individual an individual. Well, okay, sexual intercourse is the usual way in which a new individual is made, but we’re not talking sex education here—what we’re interested in is: How does the individual grow from the point of conception into a fully formed adult? And, of course, we know that this individual growth and change does not end at adulthood either. Also, what makes some individuals develop differently than others, even if they experience very similar environments? It is these kinds of questions that we will keep in mind here as we briefly review what we currently know about how genes work, how they are regulated over time, and how the environment impacts gene function. Historically, we have spent a long time arguing over the presumed different impacts of genes (called nature) and the environment (called nurture). Today,

Introduction  

most of us realize that this argument has been a colossal waste of time. It is not nature vs. nurture that is the issue here. The argument is actually a question: How do genes and the environment interact to determine the growth and development of an individual? When we are able to answer this question we will have moved forward in our understanding of ourselves and of our species. And, with a bit of luck and lots of   hard work, we may be able to learn how to create better outcomes for everyone. The significance of the nature/nurture dichotomy originates in the historical division of development theorists into two categories: those who believed our genes determine who we become as adults (the nature side of the debate) and those who believed that nothing about our psychology is determined at birth—that we are born as “blank slates” (Latin: tabula rasa) and only experience will determine who we become (the nurture side of the debate). Looking back historically we see that many people spent much time, energy, and effort on this topic, including some famous philosophers and university professors! And, we are only too aware of some of the social, economic, and cultural conflicts and chaos that have arisen as a result of these ideas. With the rapid knowledge we have accumulated over the last few decades we are now comfortable in saying that the “blank slate” theories are wrong, but also that theories that only considered the role of inheritance are also incorrect. Findings of experimental research have shown time and again that the genes we inherit most certainly play an important role in shaping who we are and who we become. Compellingly, results from twin studies, adoption studies, and other family studies all show that the more genetically related two individuals are, the more similar they are in adulthood on a number of physical, emotional, cognitive, and behavioral dimensions, regardless of whether or not they were raised in the same environment [1–4]. For example, identical twins, born with almost the exact same genetic sequences, can be raised apart and they still end up more similar in adulthood than fraternal twins or other sets of full siblings who were raised together. Fraternal twins and other full siblings (same biological mother and father) generally share approximately 50% of the genetic sequence in common. Furthermore, fraternal twins or other full siblings who were raised apart are more similar than adopted siblings who were raised together. In addition to these family studies, there are other major pieces of evidence for which the “blank slate” theories do not provide useful explanations. Fetuses already start behaving in certain ways even before an individual is born, and there is evidence to suggest that prenatal behavior may be predictive of later behavior. For example, fetal reactivity in the third trimester of a pregnancy (months 6 through 9) is predictive of infant reactivity at six weeks of age [5]. Also, some individuals inherit problematic gene sequences that result in an illness, regardless of what sort of environment the individual is raised in. Examples of relatively simple genetic disorders with this pattern of inheritance include Tay-Sachs disease, hemophilia, and cystic fibrosis.

  Adolescent Brain Development

From all of this evidence and more, we now understand that genes indeed do play a major role in determining who we are and who we become. But, and this is a very important “but,” who we are and who we become does not only depend on our genes! It is not only nurture nor only nature. Indeed, there are clear findings that genes do not play the ONLY role in guiding development—in many different studies, the environmental context has been shown to contribute significantly to developmental outcomes. Genetically identical individuals DO show behavioral, cognitive, and emotional differences in adulthood, and this is attributed mainly to their differential personal experience, although slight variations in some genes may also have an impact, as even with identical twins, no two people have the exact same genetic sequence throughout their genome (e.g., infrequent mutations in the code). As we can see, this is becoming very complicated! We now know that numerous features of the environment may impact on an individual’s development and affect who they are and what they will become. These environmental factors can be substantive and even life threatening (such as living in a war zone or severe and persistent stressors in early childhood, such as neglect or abuse), or they may be subtler (such as whether your mother held you most often on her left or right arm [6])! We also know that some of these influences can start impacting how brains develop while a person is still in the womb, i.e., maternal starvation or malnourishment for the mother (severe life stressor), smoking, or living in poverty (subtler stressors). Just as there can be negative environmental stressors (a neural stressor could be considered anything that impacts the brain from outside the brain, such as sounds, chemicals, touch, social interactions, a drug, etc.) that can impact on how a person’s brain develops, there can be other kinds of environmental influences on the brain that lead to positive outcomes, even in the presence of negative stressors (for example, the availability of loving, positive, and reliable adult support for a child exposed to severe stress early in life). So, time and again, as this evidence accumulates, scientists are led to the conclusion that BOTH genes and environment make significant contributions to the regulation of how development unfolds. Put simply, both genes (nature) and environment (nurture) are important to who we are and who we become. This is a much more complex and nuanced understanding of human development than either of the two competing historically prevenient theories. It also leads us to be wary of simple theories or simple explanations of complex human psychology. And, just to be more complicated, the outcomes of this gene/environment interaction may be different for different people and for when during the life span (for example, in the womb, in the first three years of   life, in adolescence, etc.) the environmental impact occurred. A final consideration is that recent research shows that there seem to be a number of different genes (that everybody has) whose purpose seems to be to help us adapt to whatever environmental conditions that we are in. The more we learn

Introduction  

about these genes (and their different varieties, which can be different in different people) the more we are coming to understand that unique combinations of these so-called “adaptability genes” seem to be very important in how different people adapt (whether they show resilience or failure) to the environments that they are in. Since genes are so important in regulating the process of how we develop (who we are and who we will become), we should briefly review what we know today about genes and how they work. Recognizing that our knowledge is rapidly changing, it is possible that what we think is correct today may turn out to be less correct next year. So now we will recapitulate important lessons of genes and their work, lessons that we have only come to recognize in the last couple of decades. We’ll tackle a few important questions here; namely: (1) Where are our genes? (2) What are they? (3) What do they really do? In answer to our first question, our genes are located in every cell of our bodies—that is, a full set of all of our genes is located in each and every cell of the body (except sperm cells and egg cells, which, through a special cell division process called meiosis, end up with only half a set or one of each pair). This is quite amazing, really, when you think about it. When we were conceived, we were originally only one cell, receiving half of our genes from our mother and the other half from our father. The genes in that one cell had all the information needed to create us, a multicellular entity with cells that have unique and special functions that all work in concert (though not always harmoniously) with each other. The genes in that one cell gave rise to our brains, our hearts, our fingers, our bones, our eyes, and everything else we are. And, wherever in the world we live, that same genetic mechanism works the same way. It does not matter if you are in Brunei, Bangladesh, Brighton, or Boston—you have a heart, a stomach, a kidney, and a brain. And as you grew from that one cell, over time, regardless of   where you are at certain times in your development, you are the same. So at 5 months in the womb or at 3 years of age or at age 15, your different body parts are similar—everywhere in the world. Although we have an abundance of different kinds of cells making up our bodies, they generally all have a central compartment called the nucleus, and this is where the genes are stored, in tightly wound bundles called chromosomes. Humans have 23 pairs of chromosomes, whereas other species have different numbers. Not everything in a chromosome is a gene however! We will come back to that later. With respect to our second question above, well, really our genes are nothing more than strings of chemicals called nucleotide bases joined end to end. These are the components of what we call the DNA. The nucleotide bases act as the characters of the genetic code, like the 26 letters of the English alphabet. The DNA is structured in the now famous and well-known “double helix” format. This genetic code, however, is made up of only four characters and instead of forming

  Adolescent Brain Development

legible words it forms gene sequences that can be “read” by tiny biological molecules that gain access to the stands of DNA. These molecules, which are made up of proteins found in the cell, “translate” the code—essentially, they use it as a blueprint in the production of new protein molecules. The characters are known as A, C, T, and G. These abbreviations stand for adenine, cysteine, tyrosine, and guanine, the four nucleotide bases present in DNA. An example of the way that we represent a gene sequence would be: AATGAAAAAGCAGATTTTTTTATTATGATGTTTCTCCATATTTGGCATTG. This particular combination is the first part of a real gene, the NR3C1 gene [7], which provides the code to make glucocorticoid receptors, protein molecules that play an important role in the body’s response to stressors, as well as a number of other functions. Some genes have allelic variants, meaning that particular sites within the gene sequence vary among individuals. That means that while everyone has the same gene, different people can have different varieties of that gene. For example, think of bread as a gene and its alleles as its varieties (rye, whole wheat, bran, etc.). And, just like the varieties of bread can give us different tastes, the varieties in the genes can modify how that gene works. The issue is complicated, however, by the fact that the DNA packaged in the nucleus of each cell is not single-stranded; it is actually double-stranded. The example sequence from the NR3C1 gene is the sequence found on only one of the strands, called the positive (coding) strand or sense strand. The other side, called the negative or antisense strand, is lined up alongside the sense strand and joined to it at every one of the nucleotide bases, with G bases always joined to C bases, and A bases always joined to T bases (Figure 1). The sequence of the antisense strand that would pair up alongside the sense strand shown above would read: TTACTTTTTCGTCTAAAAAAATAATACTACAAAGAGGTATAAACCGTAAC. To tackle our third question about genes—“What do they really do?”—the double-stranded structure has to be taken into consideration, as do some other aspects of the way the DNA is packaged in cell nuclei. As we can see, this is becoming pretty complicated already, and we are not yet even close to finishing this explanation. Remember that we said that genes are actually a code, each consisting of a readable sequence of nucleotide base pairs that can range anywhere from 500–500,000 or more nucleotides in length. These readable segments of DNA are interspersed amongst long sections that are not part of the genes, called untranslated regions. Some people call this “junk DNA.” Not so long ago

Introduction  

Figure 1: (a) A representation of the structure of DNA showing how the sense strand is joined to the antisense strand by chemical bonds between the nucleotide bases of each strand (S—sugar group, P—phosphate group, A—adenine, T—thymine). (b) Detailed structure of the four nucleotide bases in DNA showing how they form bonds with the sugar-phosphate backbone. Reprinted with permission from M.H. Johnson [17].

10  Adolescent Brain Development

we thought that this DNA was not important, but recently we are learning that we may have been too hasty in that conclusion. What exactly that “junk” does we are not sure, but maybe it’s not junk after all. In general, each gene encodes instructions for the production of a certain protein molecule, such as the glucocorticoid receptor protein encoded by the NR3C1 gene. Everything our bodies are made up of and all of the processes that go on within them involve protein molecules; thus, there is a huge number of different protein molecules encoded for within the genes. It’s the proteins that do all the hard work making things such as brains, hearts, and lungs! They also maintain the ongoing functions of these organs over time. Each gene has a “start” spot near the beginning of its sequence, and these start positions, called promoter regions, attract biological molecules that attach to the DNA and carry out the actual “reading” of the DNA code. Once the biological machinery attaches to a promoter site, the gene is said to be turned “on” and construction of the protein that the gene codes for is initiated through a series of steps that we will not go into here, except to say that they ultimately represent what is called “gene expression”—the in vivo production of proteins. Often, many copies of a protein molecule will be made at a time, while the gene is turned “on,” and the proteins act in conjunction with other proteins in the body in dynamic, complex ways to carry out different kinds of biological activity. So, the complexity increases. It’s not as simple as the protein is made and off to work it goes! What and how it works may be impacted by how much is made and who its co-workers (other proteins it interacts with) are. Notice that DNA is not read from start to finish. Only particular segments are meaningful, and even in these meaningful bits some segments will need to be used more often than other segments. This is because the body needs more of some proteins than others. How does the body decide which genes to turn on, when, and how much expression should occur before the gene is turned back off  ? It is this area of genetics that researchers are currently struggling to study and understand, and it is very complex. Perhaps even more complex than all we have already discovered. However, this is very important. Understanding the factors that regulate gene expression is key to understanding the nature/nurture interaction, because we now know that many environmental factors regulate gene expression. For example, referring again to the example of the NR3C1 gene, if an individual is in an environment filled with many stressors, they will require a different level of expression of this gene than someone who is not living in such stressful circumstances. This of course is one of the untapped mysteries of the brain, but it helps us understand just how well suited the brain is to adapting to the environment that it is in. After all, that is perhaps its most important function: helping us adapt to our environments, so that our species will continue over time. Of course, we also create our environments to a large degree, so it is hard to escape the conclusion that we are likely to become what we have previously done.

Introduction  11

Putting this into a big-picture context, consider two hypothetical individuals who are not related. They would have different allelic variants of the same genes at many sites within their genome, and these differences in their gene sequences would be responsible for some of the differ­ ences in phenotype (how they look, behave, and think) between the two individuals. However, the two individuals would also show different levels of gene expression of all the genes they have in common (as well as the genes that vary), and this is regulated on an ongoing basis according to both internal and external cues, cues that would be different for the two individuals based on their personal experiences. Thus, the environment actually plays a constant role in regulating gene expression, and many of the behavioral, emotional, or cognitive (taken together as psychological) differences between the two individuals are attributable more to their varying levels of gene expression than to their specific DNA base pair sequence (i.e., how they are using their genes, not what specific allelic coding sequence they possess). Studying such regulation of gene expression by environmental factors is the task of researchers in the newly emerging field of epigenetics. (“Epi” means “over” or “above” in Greek and is intended to represent a top-down regulation over gene expression in this context— regulation that involves limiting or opening up accessibility of the genes to the biological machinery that will read the code, whereas traditional genetics relates more to individual differences in the se­­ quence of the code.) So, the complexity continues. And to make it even more complicated, many different genes are involved in the creation, maintenance, and modulation of the multiple neural circuits that make up each of these complex brain functions. By the way, did we mention that these circuits are all linked to each other, and that activities in one can impact activities in many others? More on that later. In essence, the emergence of the field of epigenetics represents the inevitable marriage of nature to nurture. It is not, as we have said above, nature vs. nurture. It is understanding how nature and nurture work together to make us who we are and who we will become. And remember, the environments that we live in (nurture) are often shaped by or chosen by us—so the interaction is not one way! Our environments change us, and we change our environments, and on it goes over time. Acceptance that nature and nurture are inextricably linked has been one of the more important theoretical milestones in our understanding of our species and us. It will be crucial to apply this understanding to our study of adolescent brain development as our knowledge about how this interplay works itself out continues to grow.

1.3

Physical Development

In this section, we’ll review the basics of what is known about human development, in terms of the timeline of physical development from conception to maturity. Although this book is about the

12  Adolescent Brain Development

adolescent brain, it is not possible to separate the brain from the body. The brain acts on the body (for example: through the hormone signals that begin the onset of puberty; through the peripheral nervous system that sends signals directly from the brain to all parts of the body) and the body acts on the brain (the oxygen and glucose needed to drive this amazing organ are delivered through what the body does).

1.3.1 Prenatal Growth The first step in human development happens at conception (Figure 2), which occurs through the joining of an egg cell and a sperm cell, usually by means of engaging in sexual intercourse. Typically, an egg is released about once a month in an alternating fashion from one of the two female ovaries and moves down the corresponding fallopian tube toward the uterus, a process called ovulation. If intercourse occurs around the time of ovulation, a sperm cell may find and penetrate the egg, thereby fertilizing it.

Figure 2: A Schematic representation of   human conception and the early events that follow. Adapted from D. Boyd and H. Bee [8]. The authors acknowledge assistance from Ms. Kate Elliot in producing this figure.

Introduction  13

Figure 3: (a) A schematic representation of a “crossing over” event occurring during cell meiosis. Assuming this individual is female, each resultant chromosome comprises the genetic material for one egg cell. Each of the two egg cells would contain genetic material from both the mother and the father of the individual in a unique combination! The same would be true if the individual was male, except the resultant two chromosomes would comprise genetic material for two sperm cells. (b) A representation of the 23 chromosome pairs in the human genome. Original drawing by L. Wright.

Each egg and sperm cell has a single set of 23 chromosomes contained within, and these combine together to form a brand new, complete set of   23 pairs of chromosomes with a totally origi­ nal package of DNA with its own combination of genes and allelic variants. In addition to the new random pairings of chromosomes, a complex process called “crossing over” that occurs during meiosis ensures that the single chromosome set contributed by each of the egg and sperm cell is made up of an entirely unique gene sequence. In other words, each chromosome isn’t simply passed down “as is” from either one grandparent or the other, but rather, each chromosome inherited from either parent will contain a combination of the genetic sequences of his or her own parents (Figure 3a).

14  Adolescent Brain Development

Essentially, there is much ado about introducing genetic variation into each new generation. Nature rolls its dice, and you never know for sure what you’re going to get! The sex of the individual is inherited via the sex chromosomes, one of the 23 pairs of chromosomes in human cells. The sex chromosomes are the only pair that can be made up of two different types of chromosome, X and Y chromosomes, whereas each of the other pairs has two copies of a single type that are numbered Chromosome 1 up to Chromosome 22 (Figure 3b). If the sperm cell contributes a Y chromosome, then the individual will be male. If the sperm cell contributes an X chromosome, on the other hand, the individual will be female. The egg cell will always contribute an X chromosome, because, women, who make the eggs, have two X chromosomes for their sex chromosome pair. Thus, when making eggs, women only have the option of contributing an X chromosome to the single set of chromosomes that will be contained in each, whereas males have an X chromosome and a Y chromosome for their sex chromosome pair and can therefore contribute either type of sex chromosome to each sperm cell during sperm production. The fertilization process results in a zygote, a single cell with a full set of genes, which subsequently multiplies into all the myriad cell types that make up the human body. Once in a while, the zygote duplicates itself into two separate individuals that become identical twins. However, most twins are the result of two separate eggs being fertilized by two separate sperm cells, which produces a set of fraternal twins (approximately 2/3 of all twins [8]). Due in part to the use of fertility treatments in the western world, approximately 3% of births here result in more than one baby, most of which are twins [9]. As the single-celled zygote begins to multiply, it also moves from the location of fertilization down the fallopian tube to the uterus. By the time it reaches the uterine wall (~3–5 days), it is called a blastocyst and has begun to subdivide into an inner and an outer layer of cells. The outer layer facilitates implantation into the uterine wall; the inner layer becomes the embryo. Implantation is usually complete by the second week after conception. After this, the embryo begins to form the rudimentary basis for all of its organs, and, following six weeks of growth, the basis for all of the organ systems is in place [8]. At this point, approximately two months into pregnancy, the embryo becomes a fetus. The following seven months of pregnancy is called the fetal stage and involves further development, growth, and refinements of all of the organ systems (Table 1). The fetus starts off weighing only about a ¼ oz and measuring 1 inch in length, but by birth the new baby weighs on average about 7 lb and measures 20 inches in length. When born, unless there are birth-related complications, the baby’s organs are all fully developed. All except for the brain, that is. Much of the brain’s growth happens after birth. That is why young children’s heads grow so much faster than the rest of them. Figure 4 shows the progression of prenatal brain development.

Introduction  15

TABLE 1:  Milestones of the Fetal Stage Period

What Develops

Weeks 9–12

Fingerprints; grasping reflex; facial expressions; swallowing and rhythmic “breathing” of amniotic fluid; urination; genitalia appear; alternating periods of physical activity and rest

Weeks 13–16

Hair follicles; responses to mother’s voice and loud noises; 8–10 inches long; weighs 6 ounces

Weeks 17–20

Fetal movements felt by mother; heartbeat detectable with stethoscope; lanugo (hair) covers body; eyes respond to light introduced into the womb; eyebrows; fingernails; 12 inches long

Weeks 21–24

Vernix (oily substance) protects skin; lungs produce surfactant (vital to respiratory function); viability becomes possible, although most born now do not survive

Weeks 25–28

Recognition of mother’s voice; regular periods of rest and activity; 14–15 inches long; weighs 2 pounds; good chance of survival if   born now

Weeks 29–32

Very rapid growth; antibodies acquired from mother; fat deposited under skin; 16–17 inches long; weighs 4 pounds; excellent chance of survival if delivered now

Weeks 33–36

Movement to head-down position for birth; lungs mature; 18 inches long; weighs 5–6 pounds; virtually 100% chance of survival if delivered

Weeks 37+

Full-term status; 19–21 inches long; weighs 6–9 pounds

16  Adolescent Brain Development

Figure 4: Pictorial representation of prenatal development of the human brain. The small images underneath the labels 25 days, 35 days, 40 days, 50 days, and 100 days show the brain development at the same size scale as the images in the row below. Reprinted with permission from M.H. Johnson [17].

1.3.2 Postnatal Growth The early childhood period is characterized by rapid physical growth. In the first year of   life, a baby usually adds approximately 10–12 inches to his/her birth height and triples his/her birth weight [8]. By age two, the baby has become a toddler and is approximately half as tall as he/she will be in adulthood [8]! Growth slows down somewhat at this age, and the individual begins to add only about 2–6 inches in height and 6 pounds per year for the remainder of childhood. There are also some notable changes in body composition and proportion that occur across childhood and adolescence. The head of a newborn baby is proportionately very large relative to

Introduction  17

his/her body as a whole; however, the head becomes proportionately smaller across development, as it undergoes much less growth than the body core and extremities after the first few years of life. In terms of   body composition, the major changes involve fat, muscle, and bone. The subcutaneous fat layer peaks at approximately 9 months of age and then declines until the early school years (6–7 years of age), at which point it begins to increase again. For girls, the proportion of   body weight made up of fat continues to increase across the adolescent period, and the proportion made up of muscle decreases, whereas the pattern observed in boys is just the opposite. This results in a clear sex difference in body composition by adulthood. During adolescence, there is a marked “strength spurt” in both boys and girls, but especially in boys, and this results in a large sex difference in adult strength as well (see [10]). Also, the composition of muscle itself, as well as that of bone, changes across development. Both the muscles and bones of an infant have a high water content, relative to those of an adult. The water ratio of muscle decreases at a steady rate throughout childhood. Similarly, bones undergo a steady process of hardening as they age, and they are not considered fully ossified until after puberty. The skull bone and bones of the hand, wrist, ankle, and foot are not fully formed at birth. At birth, the skull is made up of a number of separate pieces that later fuse into a single bone [8]. The spaces, called fontanels, allow the head to be compressed slightly during childbirth without injury to the brain. The fontanels may also play a similar protective role during the early childhood period, in the event of falls or other accidents involving the head. The fontanels have usually closed over by 12–18 months of age, once the individual has gained an increased capacity for self-protection from head injury. The hands, wrists, ankles, and feet, in contrast, develop additional bones after birth, and these become increasingly articulated across development; also, this process occurs slightly earlier in girls than in boys, constituting another sex difference. Puberty, although a hallmark of adolescence, is not synonymous with it. Some people think of the two terms as signifying the same thing, but reaching puberty means that someone is going through the changes necessary to become capable of reproduction, whereas reaching adolescence denotes a period of transition from childhood to adulthood. Puberty, therefore, involves biochemical, physiological, and behavioral changes. It usually marks the beginning part of adolescence. Adolescence, on the other hand, involves not only pubertal changes, but also cognitive, emotional, and social changes, many of which are described throughout this book. Many, if not all, of the changes of puberty are guided by massive hormone changes in the body’s neuroendocrine system. The gonads (testes in males; ovaries in females) become functional endocrine (hormone) organs through the establishment of the hypothalamic-pituitary-gonadal (HPG) axis. The HPG axis is the brain-body system that allows the brain to regulate the production and secretion of gonadal (or sex) hormones, such as estrogen, progesterone, and testosterone. Once

18  Adolescent Brain Development

in the bloodstream, the gonadal hormones are distributed throughout the body and act on various different steroid receptors located in organs and tissues. Activation of these receptors modulates a variety of   bodily processes and also creates negative feedback loops within the HPG axis itself. Although the hormone cascades of puberty are complex and beyond the scope of this book, they have been studied for several decades and are fairly well understood. The initiation of the HPG axis is jumpstarted by a change in the release pattern of luteinizing hormone (LH) from the pituitary gland. Specifically, LH begins to be released in a pulsatile fashion at this time, and this initiates the cascade of other changes. The timing of these changes is not fully understood, although it is thought to involve two major factors: (1) changes in the sensitivity of the HPG axis’s negative feedback loop and (2) changes in the brain’s opioid system and its modulation of the neurosecretory cells of the pituitary gland, where LH is made and released. Interestingly, as the pituitary first starts to release LH in a pulsatile fashion, it happens only during the nighttime before becoming pulsatile all the time, suggesting an important connection to the sleep-wake cycle. The timing of puberty can also be influenced significantly by a number of different environmental, experiential, or lifestyle factors, most importantly weight/eating habits and stress, indicating that the pubertal process is programmed to be somewhat flexible with respect to timing. While this section is meant to provide a broad overview of physical development, a more detailed coverage of pubertal and adolescent physical development can be found in Chapter 5 of “Stress and the Developing Brain” [10].

1.4

Brain Development

Now that we’ve had a chance to review human physical development generally, we’ll focus on brain development specifically and consider how it fits into the overall developmental timeline. It is assumed that you, the reader, have a basic understanding of the general principles of how nerve cells communicate. These principles can be reviewed in some detail in Chapter 2 of  “Stress and the Developing Brain” [10]. Basically, brain neurons communicate with each other through the release of chemicals called neurotransmitters into small spaces (synapses) between neurons. Neurons are arranged in networks or circuits that act in concert with other circuits to initiate and control all brain functions. Other kinds of cells in the brain, such as glial cells, support neuron activity and have other functions as well, including production of the myelin sheaths that wrap around neuron projections called axons and assist them in their functioning. This section will provide an overview of   human brain development. This will set up a framework for studying the changes that occur during adolescence.

Introduction  19

As mentioned previously, the foundation for all of the organ systems of a newly developing individual, including the nervous system, is already in place two months after conception, when the embryo becomes a fetus. Some of the cells of the developing embryo will by now have differentiated into neurons, the specialized cells that will go on to develop into brain matter. From about two and a half to five months into the pregnancy, there is a rapid burst of cell division that generates new neurons, a process known as neuronal proliferation. Interestingly, the vast majority of neurons that make up the brain are all formed by cell division in two particular regions (proliferative zones), called the ventricular zone and the subventricular zone. The cell bodies of the neurons that make up the adult brain have all been created by approximately seven months in utero (excluding a relatively small number of neurons that will be made later on in particular brain regions that are capable of creating new cells later in life, a process known as adult neurogenesis). Following neuronal proliferation, the neurons must then move to the specific part of the brain where they will reside in the fully developed individual, and they do not reach anatomical maturity until this process, called neuronal migration, is complete. That is to say, it is not until a neuron reaches its final destination that it sprouts an axon and dendrites, the anatomical structures that allow neurons to communicate with one another (Figure 5). The process by which neurons communicate involves the generation of synapses—points of near contact between two neurons, through which information can travel using chemical neurotransmission. Interestingly, the brain overproduces neurons during the prenatal period and then scales back the number that it keeps for the adult brain. It does this through a process of programmed cell death called apoptosis, whereby some neurons are marked to be degraded in a controlled fashion. This procedure begins before birth but continues on into postnatal life and is now understood to be an important aspect of child development, particularly regarding its role in shaping neural networks that involve the complex circuits within the cerebral cortex [11], the part of the brain most associated with human-specific attributes. Furthermore, the concept of human brains developing more than what is necessary and then scaling back to keep only what is needed in adulthood seems to be a biological strategy that applies also to other aspects of brain development as well. For example, the number of communication points between neurons and the number of neuronal receptors (locations that receive chemical messages) both undergo a similar pruning process during development, especially in adolescence. Synapses begin to form among neurons after they have been created and have migrated to their destinations in the brain. We call this process synaptogenesis. Also, specialized glial cells begin to wrap sheaths of myelin, a fatty, insulating substance, around the axons of neurons in a process called myelination, which increases the speed at which messages can be sent along neurons. Synaptogenesis and myelination begin in the womb, are both highly active around the time of birth and in early life,

20  Adolescent Brain Development

Figure 5: Pictorial representation of a mature neuron showing its dendrites and axon. Reprinted with permission from M.H. Johnson [17].

and then each taper off at some later point. Myelination is thought to extend into the adolescent period, and it is during this time that nerve cells develop their maximum message velocities. As for synaptogenesis, it begins with neurons sprouting a great number of dendrites that initially contact many other cells, but, over time, through the process of synaptic pruning, many of these connections are then removed, leaving relatively stable neural circuits that underpin all brain activities. At the time of birth, the brain exhibits a very high degree of plasticity, meaning that it has the capacity to achieve a number of different possible developments that will impact on how it functions. This is accomplished in numerous different manners, including neurogenesis and synaptogenesis.

Introduction  21

As described above, the usual mechanism is for the brain to produce more than what is needed and then to scale back on the amount, selecting those that are most useful for the present environmental circumstances. Other mechanisms for plasticity exist as well, some that we are only just beginning to understand, such as the epigenetic regulation of gene expression by small ribonucleic acid (RNA) molecules. Some of these mechanisms continue into adulthood, albeit in a limited way. This enables the brain to continue to exhibit plasticity for a relatively long period of time during the life span, a much longer period of time than was previously known. A depiction of the concept of neural plasticity across development is provided in Figure 2 of  “Stress and the Developing Brain” [10]. Notice that the different mechanisms for neural plasticity will be most significant at different times during development. For example, neurogenesis occurs earlier than synaptogenesis, and different parts of the brain progress through these stages at different rates. Removal of synapses and their receptors can continue in some parts of the brain into the adolescent period, suggesting that these brain regions are more likely to be shaped by the adolescent’s environment than others. In the next chapter, we will focus more specifically on adolescent brain development. • • • •

23

chapter 2

Adolescent Brain Development 2.1

Overview

The how, what, why, and when of human brain development during adolescence is the key to our being able to better understand this period of the life span and how it influences future growth and development. We are trying to understand how adolescent behavior is related to ongoing developmental changes in the brain. To begin this journey, we need to become better informed about exactly what changes in the brain actually occur. Historically, adolescence was not viewed as a unique developmental period. While it was recognized that physical changes occurred as children became adults, these were thought to be reflective of a general aging process, a kind of   linear cumulative progression ongoing from the time of birth to the time of death. The relationship of   brain development to the physical changes that were observed was neither known nor hypothesized. For example, most adolescents reach their adult height many years before their brain has completed the features of   brain development that we now know occur during these years. It was assumed that since the body seemed to complete its growth during adolescence, the same happened to the brain. This observational disconnect is understandable, as what is occurring within the brain could not until very recently be observed. There were no MRI’s available for most of   human history! Until about 100 years ago, there was no special developmental status given to this period com­­ pared to the way that we now view adolescence. In some social contexts, adolescents were thought of as small adults (and legally treated as such). In others, they were thought of as children transitioning to adulthood, but the transition was understood to be more of a social rite of passage rather than a period of   biological developmental change (see [12, 13]). We now know that the brain is under­ going dynamic developmental changes at this time, and some particular regions undergo very drastic adolescent changes. Cultural and some psychological theories of adolescent development (e.g.. [14–16]) will need to be discarded or substantially modified to accommodate our growing understanding of neural development across this period. There are two major strategies applied to the study of how the brain changes during adolescence: one is to use animal models, and the other, more recently developed technique, is to use

24  Adolescent Brain Development

Figure 6: An illustration of the development of the dendritic arbors of neurons within the human visual cortex, based on Golgi stained preparations from Conel (1939–1967). Reprinted with permission from M.H. Johnson [17].

neuroimaging technologies to collect data directly from human research participants. Due to the obvious ethical issues involved, the direct study of   human brain tissue is rare, especially with respect to adolescent brains. However, some studies based on brains donated as the result of early death have been undertaken, and despite the challenges, approaches that allow human brain tissue to be studied directly have provided crucial, foundational information, with respect to brain development during this time. For example, in the seminal work by Conel (1939–1967), changes in neuronal dendrites and synapses were studied using Golgi staining of post mortem brain tissue [17]. After painstakingly collecting data over a thirty-year period, he was able to show the pattern of change over time of the dendritic arbor of neurons in the visual cortex (Figure 6). However, it was not until the advent of modern brain imaging technologies that our ability to simultaneously study both the structure and functioning of the human brain emerged. Beginning with computerized axial tomography (CAT) and expanding to positive emission topography (PET) and functional magnetic resonance imaging (f  MRI) and other techniques, neuroscientists,

Adolescent Brain Development  25

psychologists, and others interested in human growth and development were finally able to begin to unravel how the changing brain was related to the physical, emotional, cognitive, and behavioral characteristics of this period. And, we expect that as technology continues to improve, we will learn more and more that over time will again better inform how we think about the adolescent years.

2.2

Grey Matter Peaks and Declines, White Matter Increases, and Cortical Thinning

With the use of more and more sophisticated neuroimaging techniques, we have learned a great deal about the structure and functioning of the human brain. From an anatomical perspective, there are a number of features of adolescent brain development that stand out prominently. The first is an overall “rise and fall” pattern of change in grey matter volume. In general, grey matter is comprised of neurons, whose alignment in circuits are considered to be the units of neural communication, so changes in grey matter are likely to have important ramifications for emotions, cognition, and behavior. Research using MRI techniques has revealed that there are increases in gray matter volumes that occur during childhood, followed by declines beginning in early adolescence [18–21]. These grey matter changes, however, are not uniformly distributed across the developing brain. On the contrary, there are substantial differences in how grey matter increases or decreases in different parts of the brain over time. So that while overall the brain’s grey matter volume shows a pattern of gradual rise and then gradual fall between birth and adulthood, some brain regions mature (reach adult patterns) earlier than other regions (Figure 7). This is nicely illustrated in a large-scale cross-sectional magnetic resonance imaging study conducted by Ostby et al. [22], and others [23–26]. In this research, brain regions showing the greatest impact of age on their development were the frontal and parietal cortex, brainstem, and amygdala, a brain region known to be involved in emotional learning, the processing of fear responses, and the control of negative emotions. Since these brain regions support different components of   brain functioning, this pattern of regional differences in development may underlie the emotional, cognitive, and behavioral changes we observe during these years. Another area of research has focused on changes in brain white matter that occur over this time. Overall, white matter continues to increase in amount over the adolescent years. Since white matter is associated with myelination of neuronal axons, which is related to improvements in the speed of inter-cellular communication, this finding represents a strengthening of connections among brain cells. This continued increase in white matter is thought to have important implications for the integrity and efficiency of information processing in and amongst neural networks (see Section 2.6).

26  Adolescent Brain Development

Figure 7: Regression plots showing changes with age of brain volumes of (a) thalamus, (b) cerebral cortex, (c) cerebral white matter, (d) cerebellum grey matter, (e) brainstem, (f ) cerebellum white matter, (g) caudate, (h) putamen, (i) the accumbens area, ( j) pallidum, (k) amygdala, and (l) hippocampus. Age is on the horizontal axis, and corrected volume in z-scores on the vertical axis. Reprinted with permission from Y. Ostby et al. [22].

Adolescent Brain Development  27

The frontal and temporal cortices in particular seem to show especially large increases in white matter. This may reflect the increasing capability of   young people to regulate their emotions, cognitions, and behaviors in response to complex social situations. A third major feature of adolescent brain development, as identified in structural MRI studies, is a decrease in the thickness and, to a lesser extent, the surface area of the cerebral cortex across this period. This thinning pattern is understandable, given the characteristic reduction in grey matter volume described above. Although it might at first seem surprising that the cortex of a mature brain would have thinned out relative to a developing brain, this finding is congruent with the concepts of  “neuron pruning” and “synapse pruning” that are now understood to be integral parts of long-term brain development. Neuron pruning results in a reduction in the number of neurons, and it occurs in most brain regions during late in utero and in early childhood. It is generally followed by synapse pruning, which is a reduction in synaptic connections between neurons, a process that occurs primarily soon after birth but continues in some late-developing regions all the way into adulthood. The grey matter reductions and cortical thinning that occur during adolescence appear to be the result of developmental processes that fine-tune the adolescent’s brain in response to the environment they will increasingly experience as an adult. Of particular importance may be the enhancement of   brain functions related to the navigation of complex social relationships, learning to read and respond to subtle nuances in social signaling, and the enhancement of executive brain functioning (for example: planning, emotional regulation, complex reasoning, etc.). Cortical thinning is thought to reflect pruning processes, as synaptic connections either strengthen or die away, and processing efficiency is increased as networks become sparser. Although there is a clear pattern of thinning when examining the adolescent cerebral cortex as a whole, there is a great deal of  heterogeneity among different regions, and some regions may not show thinning at all. For example, some investigators have observed cortical thickening in grey matter regions around the Sylvian fissure, areas important for reading and other language skills. The reasons for this are not yet understood. One of the challenges that neuroscientists are now facing is that, while current technologies can provide us with much new information about the structure of the brain and some information about how different parts of the brain may function in certain circumstances, current technology cannot tell us what we need to know about the mechanisms of how these changes in structure and function come about. We know that the brain communicates using neurotransmitter systems, but we know surprisingly little about how the adolescent brain changes in the many different neuronal circuits that use similar types of neurotransmitters. For example, many different brain circuits use dopamine as a neurotransmitter, yet we do not currently know how each one of these circuits

28  Adolescent Brain Development

changes during the teen years, nor how changes in one part of the system may specifically affect the activity of other parts. Using f  MRI, we currently can tell whether or not a certain brain region is activated to complete a specific task, but, when we see that the region is in fact being used to complete the task, we do not yet know what specific neurotransmitter(s) is/are being used. At this time, research attempting to answer this level of detail is underway in animal subjects. Exactly how those findings will translate to humans is not yet clear, although using a comparative biology approach has provided crucial information about the functioning of brain tissue and neural circuits in general. So it is obvious that we still have much to learn, and that as technology advances, we will have the opportunity to learn more. A further caveat is that, while what we are finding is true of teenagers as a group, different individuals may exhibit different variations within the group parameters that have been discovered. If inter-individual variation within the brain is as great as inter-individual variation is in other organs (such as the liver or the heart, for example) the brain development of any one individual may or may not closely approximate that found in the group. How these kinds of potential differences are then related to individual adolescents’ emotions, cognition, and behavior will then need to be sorted out. So, we have learned so much, but we are aware that there is still so much more to learn.

2.3

Changes in Neurotransmitter Levels

When thinking about the developmental changes that occur in adolescents, we often consider the impact of   hormones. The secretion of the sex hormones is of course controlled by brain function, and puberty begins when the brain signals for the increases in sex hormones that then lead to what we can see as the maturing individual (see Section 1.3.2). The impacts of   hormonal secretion on the physical characteristics of a teenager are well known. Much less is known about how these hormones that are secreted in response to brain development act on the brain itself. What we do know is that it is not “hormones” that cause the emotional, cognitive, and behavioral changes that we typically associate with adolescence. While some hormones (secreted either directly by the brain or in response to those secreted from the brain) do impact brain function, it is primarily the changes in brain development that occur at this time in the life span that lead to both the hormonal changes we relate to puberty and the emotional, cognitive, and behavioral characteristics of the adolescent years. Hormones transmit chemical messages from one location in the body to another location by way of the bloodstream and thus are very important in the regulation of most body functions. They

Adolescent Brain Development  29

can also impact on how the brain functions, either directly or indirectly. In many ways, neurotransmitters are indistinguishable from hormones (and indeed a number of molecules act as both), with the main differences being that neurotransmitters transmit chemical messages within the brain instead of outside it, and they do not use the blood circulation to travel to target cells, as hormones do. Therefore, the neurotransmitters are considered to be even more important in regulating emotions, cognition, and behavior than are the hormones, but they are much more difficult to study. Circulating levels of   hormones can be assayed in blood or saliva samples, but these methods of sampling are at least somewhat invasive, and a high level of technical expertise is required to run the assays with accuracy and precision. Studying neurotransmitter levels is fraught with even greater challenges of invasiveness and technical difficulty. Consequently, despite their importance for understanding emotions, cognition, and behavior, the changes that take place in the various neurotransmitter systems of the brain across the adolescent period are still poorly characterized, and much of what is known has been learned through the study of animal models. It is probable that developmental changes happen during adolescence in many or all of the brain’s neurotransmitter systems. However, neuroscientists have not yet had the time or resources to be able to study all these brain circuits and how they have been developing in the teen brain. Because our evidence-based information is still so limited, we will acknowledge that much is yet unknown and focus our discussion here on what is known about adolescent changes in the dopamine system. The brain circuits that use dopamine as a primary neurotransmitter are known to undergo dramatic changes during adolescence. Furthermore, we know that developmental changes in dopamine supported brain circuits appear to be directly related to adolescent period changes in reward seeking and in incentive-driven and risktaking behaviors, common to this period of life. The brain’s dopamine supply is produced mainly in two small side-by-side regions called the ventral tegmental area and the substantia nigra. It then gets distributed from these production zones to various target regions throughout the brain in two separate tracts—the mesocorticolimbic tract and the mesostriatal tract (Figure 8). During adolescence, there is a shift in the balance of mesocortical and mesolimbic dopamine drive, with cortical dopamine starting to predominate [27]. Cortical dopamine has an overall inhibitory effect in most prefrontal regions [27]. Therefore, brain regions known to be important for the cognitive regulation of   behavior and emotions (see the next section) tend to be more easily inhibited during adolescence. A number of researchers have interpreted these changes in the capacity of the adolescent cortex to act as a “brake” as a basis for the observation that adolescents’ often exhibit poor decision-making, a greater drive to seek rewards, and increased engagement in exciting but risky behaviors. Changes between adolescents and adults in this so-called “dopamine tone” involve an adolescent increase in dopamine concentration and fiber

30  Adolescent Brain Development

Figure 8: Depiction of the neurotransmitter pathways of three very important amine neurotransmitters used by the brain. The mesocorticolimbic dopamine system (ventral tegmental area to the cortex, as well as to the nucleus accumbens and the hippocampus) and the mesostriatal dopamine system (substantia nigra to the striatum) are represented together by the black pathway. The yellow pathway and blue pathway represent the serotonin and norepinephrine pathways, respectively. Adapted from C.L. Hart, C. Ksir, A.L.O. Hebb, R.W. Gilbert, and S. Black [244]. The authors acknowledge assistance from Ms. Kate Elliot in producing this figure.

density in prefrontal cortex, as well as an overproduction and subsequent elimination of dopamine receptors in both striatal and prefrontal regions [27]. Also, increased cortical dopamine may be linked to changes in the norepinephrine neurotransmitter system, since dopamine is often coreleased at noradrengeric terminals (points of release of norepinephrine) [28]. Although they are as yet not as well understood as dopamine system changes during this part of the life span, it is likely that in addition to the dopamine system changes described above,

Adolescent Brain Development  31

concurrent changes in other neurotransmitter systems known to be related to behavior, cognition, and emotions (such as serotonin and norepinephrine, also called noradrenaline) also occur. Just how these changes are related to the behavioral, cognitive, and emotional characteristics that are commonly observed during adolescence is not yet known, but is the focus of active research.

2.4

Protracted Brain Development of  the Frontal  and  Temporal Cortex

Before the explosion in brain research that has occurred over the last decade or so, it was not appreciated that as the human brain grew and developed, it did not do so in a uniform fashion. What we now know is that different brain regions develop at different rates. This is important because even though the different parts of the brain work together as a whole to regulate behavior, each brain region has its own specific job and thus influences behavior differentially over time (see Section 2.5). Therefore, some aspects of   behavior, cognition, and emotions develop earlier than other aspects. And, there are different rates of development of each of these three components. One of the last aspects of behavior regulation to develop, for example, is inhibitory control, a cognitive function mediated by specific regions of the prefrontal cortex. In Sections 3.2.2 and 5.2, we will discuss cognitive development more specifically and also take a look at what goes on with respect to maturation of related brain areas. One of the overall patterns of adolescent brain development identified in the previous section is a general “rise-and-fall” in numbers of neurons, neuronal connections, and grey matter in general. While this is true for the brain overall, it is important to understand that the age at which the rise turns to fall (peak in number of neurons or neuronal connections) is different for different brain regions, as is the age when the most dramatic change is occurring (time of greatest slope). These unique regional differences can be missed if we just look at the brain overall, without focusing on what is happening in different parts of the brain at the same time. For example, in a study that used a whole-brain segmentation approach (looking at different brain regions at the same time), Ostby et al. [22] found that frontal and parietal cortex, brainstem, and amygdala undergo the most dramatic changes in grey matter volumes across the adolescent and early adult periods. For frontal and parietal cortex, the overall direction of change during this time is a decrease in grey matter volume, as these areas have already reached their peaks in grey matter volume in childhood and are on the decline. The dorsolateral prefrontal cortex is one of the last regions to attain peak grey matter volume, which occurs in the early 20’s [20], and this region has been shown in numerous studies to play an important role in cognition and in the regulation of complex behaviors and emotions [29–33]. For example, the dorsolateral prefrontal cortex is selectively

32  Adolescent Brain Development

activated when a person is actively trying to solve an ill-defined problem and, by so doing, come up with an effective solution. Furthermore, this process is lateralized, with the left and right sides each playing a distinct role [29, 30]. As more research is undertaken, we expect that similar complexities about how unique brain regions develop over time will be discovered. Unlike most brain regions, the brainstem and amygdala continue to increase their grey matter volumes up until age 31 [22], suggesting a very different pattern of change in these areas during adolescence. As discussed previously, the amygdala plays an important role in emotion processing; it is therefore likely that some of the change seen in emotional regulation during adolescence is related to the distinct pattern of grey matter changes observed here. How these changes are related to the increased emotionality of early adolescence and the development of greater emotional regulation that occurs in later adolescence is not yet known. Clearly, much more research is needed. The prefrontal cortex may show peculiarities with respect to the typical pattern of white matter development that is usually observed in the brain. Nagel et al. [34] found a decline in prefrontal white matter volumes across the late adolescent period, particularly in females, a pattern at odds with the usual increases in white matter described above. Even though parts of the prefrontal cortex appear to mature very late in development, evidence suggests that cortical thinning and white matter increases are even more protracted in temporal relative to frontal lobes overall [20, 35]. Despite this, the frontal cortex gets the bulk of the attention in the study of human cognition, and, indeed, there is a plethora of evidence supporting the importance of the different subregions of prefrontal cortex in regulation of numerous different types of cognitive functions [29–33, 36]. However, we should not box our thinking into only considering the idea that human cognition is strictly a function of the frontal lobes or of the prefrontal cortex. Parts of the slowly developing temporal cortex also appear to be very important and the relative importance of this brain region to cognitive deployment may increase over time. The right temporo-parietal junction, for example, has been shown to play an important role in regulating the empathetic behavior of   humans [37]. Specifically, this region allows a person to consider the intentions of someone else when making a judgment or decision about how to relate to the other person. This is one of the specific features considered to be a part of the concept known as “theory of mind” and is thought to be a very important personal competency that develops during adolescence and is necessary for human beings to have in order to be able to live in mutually supportive and collaborative groups. The construct “social cognition” has been used to describe this complex component of   brain function [37–39]. In further support of this finding is the related observation that impairment in the function of the right temporo-parietal junction may lead to difficulties in social cognition [40]. Thus, as we can see from the available research, when trying to understand adolescent brain development we need to consider BOTH the development of the brain as a whole and also the

Adolescent Brain Development  33

unique trajectories of change seen in the various subregions of the brain. Just to make it even more complicated, we need to understand how these differences in regional neurodevelopment impact the functioning of the brain as a whole and what role differences in the development of connections amongst the regions play. It is complicated, and at this time only part of the story is known. What this does tell us is that there is no simple answer to the questions of   how the teenager’s brain develops and what does that mean for understanding his/her behavior, thinking, or feelings.

2.5 Regional Specificity and Lateralization of Brain Function Given that the brain is so complex, and that it changes over time, it’s no wonder we’re still grappling to discover and understand many of the features of its protracted development. “Regional specificity” and “lateralization of   brain function” are two hallmark concepts found in neuroscience research, but our understanding of these and how they develop and change over time is still quite limited. Regional specificity of the brain means that different parts of the brain are specialized to perform different kinds of tasks. Lateralization of   brain function refers to the fact that the two sides of the brain (called hemispheres) are not the same and do not always function the same way. Although they appear similar anatomically, they each develop their own specialized functions, such as the example of the left hemisphere being highly specialized for language functions [41, 42]. This classic example has become a model for understanding lateralization of brain function, but there are many other, subtler examples in both the right and left hemispheres. Facial processing (recognition of faces and extraction of meaning from facial features) is typically done in the right hemisphere. The highly popular (but not really factually correct) idea of an emotional left-brain and a rational right-brain is a reflection of this idea. Unfortunately for pop-psychology, this left-brain/right-brain distinction is not how the brain actually works. Both regional specificity and lateralization of the brain are thought to develop over time as a person matures, but how this happens and the time (age of the person) that this happens is not well understood for many brain functions. Some brain functions, such as audition (hearing), are already lateralized by mid-childhood [43], but it is likely that a number of brain regions continue to become more specialized and lateralized as the brain develops during the adolescent period. The corpus collosum, a large white fiber tract that relays information between the two hemispheres, continues to show increases in volume (size) from early adolescence into the mid 20’s [44]. These very important white fiber tracts are made up of myelinated axons that run from one hemisphere to the other, linking the two hemispheres together. Thus, this finding is consistent with the

34  Adolescent Brain Development

general pattern of adolescent increases in white matter volume described in the section above and seems to indicate that the connections between the two hemispheres are strengthening, allowing easier integration of   left-brain and right-brain information. Along similar lines, overall white matter increases across adolescence are thought to correspond to an improved capacity for connections throughout the entire brain. Simply put, many brain regions seem to become better connected between the ages of 14 and 25 years. We do not fully understand what these changes mean to the development and deployment of human thinking, feeling, and behavior. One possibility is that a person’s brain becomes much more efficient as it gets older and that functions that would have been done by one part only early in life may become supported by the activities of other parts of the brain as a person gets older. This would suggest that if there was a developmentally determined problem with a particular type of emotion, cognition, or behavior, that this might be ameliorated by the recruitment of other brain regions acting to influence the functioning of the region initially affected. Perhaps this increasing network capability of the developing brain may explain why some young people seem to “grow out of ” demonstrated challenges in cognition (such as difficulty in sustaining attention) or behavior (such as impulsivity). Another (and not mutually exclusive possibility) is that unique brain regions become more entrenched in their specific function and are less able to “take on” other activities that may have been possible in earlier years. For now, we have to accept that much further research will be needed to help us untangle these complexities.

2.6

Functional Integration and Gains in Network Efficiency

Many neuroscientists who study adolescent development interpret the changes observed in the teen brain as a reflection of improvements in neural network efficiency, operating in specific neural networks [45, 46]. This is based on Donald Hebb’s grounding principle of neuroscience that neurons that fire together wire together. In other words, neural connections within and among different brain regions that end up getting used more frequently will grow stronger and signal more efficiently, while connections that are activated less frequently are pruned out of the system. Another way to say this is: “use it or lose it.” Consistent with this understanding, brain activation patterns in functional neuroimaging studies are observed to become more focalized and less diffuse as an individual matures [47], and the overall amount of activation increases [19]. As a person grows out of childhood and moves toward full brain maturity, grey matter volumes increase up to a certain point and then decline, with different brain regions showing different temporal dynamics of the “rise and fall,” and the brains of most

Adolescent Brain Development  35

people show this same general pattern [20]. There is also an overall thinning of the cortex [48]. These changes in grey matter are thought to reflect cortical pruning, as the system gains network efficiency and removes connections it deems to be unnecessary to maintain. At the same time, white matter volume increases, and this is thought to reflect the myelination of axons as neural signaling becomes faster [20, 49]. It is important to put this set of changes into context. Because of the “use it or lose it” phenomenon, the environment in which an adolescent lives can theoretically have a great impact on how the brain of a young person develops. Simply put, an environment that requires empathic problem solving and the management of complex social interactions for example may be expected to “pull” for the development of brain networks that facilitate the cognitions, emotions, and behavior to achieve those ends. On the contrary, an environment that demands aggressive and immediate responses to threats could “pull” for the development of brain networks that facilitate those ends. Interestingly, females generally attain their peak grey matter volumes before males [50], although not in all brain regions [20]. Could this explain some of the differences in behaviors, cognition, or emotions seen between males and females? In the next section, we will touch briefly on other sex differences in the brains of adolescents.

2.7

Sex Differences

Studying the differences (and similarities) between the sexes is, and continues to be, a fascinating topic. Entire books are written about it from various perspectives. As expected, some are better than others. Most all of them make some reference to brain structures and functions. Some may give the impression that we clearly understand how the brain is different or similar when taking sex into account. However, we are only just beginning to gain a scientifically supported appreciation for the sex differences that exist in the brains of males versus females and how these differences relate to male and female patterns of   behavior, cognition, and emotions, such as the different ways in which males and females may express aggression for example (see Section 4.1). It is also important to point out that while there are differences between groups (male vs. female) there are also large differences within groups (within males and within females). Indeed, some studies suggest that there are larger within group differences in specific domains than between group differences in those domains. So we need to be careful not to generalize to all males or to all females from aggregate group data. People do not necessarily perfectly reflect their group, regardless of how the group that they are in is defined. And, while we are still in the process of figuring out many of the differences/similarities between adult male and female brains, we need to keep in mind that we know even less about how the

36  Adolescent Brain Development

sexual differentiation process occurs across development. A number of research laboratories have ongoing research programs dedicated to the study of sexual differentiation of the brain. Here, we will touch only briefly on what is known today about sex differences in the adolescent brain. Remember that similar to all the information we are sharing in this book, our knowledge and understanding of this topic is expected to improve and change over time. The most consistent sex difference found in adolescent brains is a larger total brain volume in males relative to females [22, 50, 51], as well as a larger white matter to whole brain volume ratio [34]. Simply put, male brains are overall larger and have proportionally more neural pathway capacity. Differences have also been reported for regional cortical thicknesses in males and females, but it is unknown exactly when these differences arise. Sowell et al. [51], for example, found much thicker cortical volumes in females in posterior temporal and inferior parietal regions, even after correction for differences in brain or body size, and this difference appeared to already be established prior to adolescence. What is not currently clear is how these findings relate to differences in sex-linked behaviors, emotions, or cognition, and this research is ongoing. What we have learned, however, must not be put into ideological boxes or used as a basis to define social values that compare the qualities of males to those of females. Differences in brain structures or regional functions do not necessarily translate into differences in capacity, competency, or any other behavioral, cognitive, or emotional factors. For example: (1) adolescent males and females can show different patterns of neural activation while performing a cognitive task and still do equally well in terms of their performance scores [50]; and (2) bigger does not necessarily mean better, nor does smaller mean more efficient! We also do not know if regional differences in brain development or the pattern of connections as they link different regions together provide different capacities in brains as they relate to various types of environments. Simply put, we do not know if being male or female makes a difference, as far as a person’s brain works in relationship to the environment that the person is in. So, while we appreciate that there may be differences in how male and female brains develop and how they may develop differently in relationship to different environments, we need to be clear that at this time we do not really know how these complex interactions occur or how they create the behavior, cognition, and emotional features that are both similar and different amongst the sexes. We simply do not know enough yet to draw conclusions and thus need to avoid giving simple sociological answers to complex biological processes. • • • •

37

chapter 3

Adolescent Behavior 3.1

Overview

In the previous chapter, we considered the overall changes that the brain goes through during adolescent development. The brain is the body’s organ that is predominantly responsible for controlling behavior, cognition, and emotions. The person is what their brain does! All of us are the products of our brains. In this chapter, we will discuss a number of important behavioral, cognitive, and emotional changes that occur in adolescence (Section 3.2), and then in Chapter 5 we will describe how they relate to the ongoing changes occurring in the brain. Prior to this, in Chapter 4, we’ll contemplate adolescent vulnerability vs. resilience, in order to understand how changes at this developmental phase could lead to either positive or negative outcomes for mental health. In Chapter 5 we’ll also consider some of the mental disorders that can commonly be diagnosed during the adolescent period. In the last chapter, we’ll discuss how our new knowledge of adolescent brain development could be used to address youth mental health and mental illness from the perspective of well-being interventions, treatments, healthcare, education, and legal issues.

3.2

Behavioral Changes

Here, we’ll consider some of the behavioral aspects of a teen’s life. This is by no means meant to be a description of all teens during their adolescent phase of development, as there are many individual differences in all kinds of behaviors. As we have discussed above, any one person may exhibit most or even almost none of the specific features that are commonly found in any group. So, while the behaviors we will be discussing are considered to be prominent features of adolescents compared to adults or children, any one adolescent may or may not exhibit these or may exhibit them in various degrees of intensity or frequency. We may all be members of a group, but we are at the same time all individuals.

38  Adolescent Brain Development

3.2.1 Changes in Activity Patterns Activity patterns change across the life span. As early as the third month in utero, the fetus begins to demonstrate alternating periods of sleep and wakefulness ([8]: see Table 1). By birth, a “sleepwake” cycle is well established, but this is very different from that of an adult. Infants require on average 12–18 hr of sleep per day and therefore sleep more overall than adults do, who require on average only 7–8 hr of sleep [52]. Infants, however, sleep in shorter bouts that are interspersed with periods of wakefulness, whereas most adults sleep in one long bout through the night (although short awakenings are common). In addition to a greater overall amount of sleep, infants also show differences in their sleep structure, relative to adults [53, 54]. At birth, infants spend about half of their time asleep in rapid eye movement (REM) sleep, which is characterized by dreaming and by beta waves on an electroencephalograph (EEG). However, the proportion of sleep time spent in the REM stage decreases with age (Figure 9). In contrast, the proportion of time spent in slow wave

Non-REM Sleep

REM Sleep

20

Hours per Day

16 12 8 4 0

Newborn

6 Months

4 Years

11 Years

25 Years

60 Years

Figure 9: Graphical representation of the number of hours spent in non-REM and in REM sleep, as well as the total number of hours of sleep, at different ages across the life span. In the newborn, about half of all sleep time is spent in REM sleep, whereas in the aged population the proportion of sleep time spent in REM sleep declines to about 20%. Adapted from A.J. Younger et al. [53].

Adolescent Behavior  39

sleep (SWS) increases with age. Slow wave sleep represents periods of what is called recuperative sleep and is characterized by delta waves on an EEG. So what happens during the adolescent period? Adolescents require about 8.5–9.25 hr of sleep per day [52], which is usually consolidated by this age into a single nightly sleep episode. Adolescents therefore require more sleep than an adult but less than school-aged children, who still usually require about 10–11 hr of sleep per day. Only about 1/5th of the nightly sleep time of an adolescent is spent in the REM stage [53], demonstrating a dramatic change in sleep structure from infancy. One interesting change in the adolescent sleep pattern is a phase shift in the circadian rhythm (the sleep/wake cycle pattern), with sleep onset occurring later in the evening hours and arousal occurring later in the morning [55]. This means that the phase of the circadian rhythm during which sleep onset naturally occurs changes, with adolescents now naturally moving the time of sleep onset later into the evening than children. Thus, we say that youth demonstrate a phase shift. This happens naturally and is thought to be a reflection of brain development. This is known in the sleep research literature as displaying an “evening chronotype” [56]. This naturally occurring sleep phase shift (sleep onset beginning later in the evening) is exacerbated by the conveniences of modern life. Electric lights, computers, electronic communication devices, and television all tend to push this developmental phase shift even farther into the evening. Put simply, adolescents are by nature going to sleep later, but their environments tend to push this later sleep onset even later. However, the social structure of the school day has remained relatively similar, with classroom attendance expected early in the morning. At the same time, adolescents still require on average about nine hours of sleep a night. Consequently, adolescents can become vulnerable to sleep deprivation, since they go to sleep later at night but still require more sleep than an adult and are usually required to rise at an early morning hour for school. When they arrive for school they have not had enough sleep, and consequently they are sleepy and not at their best during morning classes. Indeed, research shows that as a group teenagers are more tired at 10 AM than they are at 10 PM! This illustrates a very important aspect of sleep—the timing at which it occurs is a meaningful determinant of its recuperative effects. In order for a sleep episode to induce maximal restorative effects in an adult, it should occur within a particular circadian timeframe. Specifically, its onset should occur several hours before the body reaches its lowest core temperature, and circulating me­­latonin levels should peak between the middle of the sleep episode and awakening [57]. We still do not fully understand the dynamic changes that are observed in adolescents’ sleep structure [54], such as how it impacts their need or drive for recuperative sleep and when during the night they achieve maximal recuperative effects from sleep. This changing circadian rhythm, however, is likely to be

40  Adolescent Brain Development

a factor in several behavioral features characteristic of adolescents. For example, taking on a more evening chronotype means that teens are generally more active in the evening hours when it is dark and there is more risk of danger. In the mornings when they wake up they may often demonstrate the irritability or grumpiness that is characteristic of not having had enough sleep. Teens are often not at their academic best in early classroom periods and on the weekends they tend to sleep in, be­­ cause their brains are trying to catch up on the sleep that they lost during the week. In Section 5.1, we will discuss what is known about the neural underpinnings of these changes in sleep/wake patterns during adolescence.

3.2.2 Changes in Intellectual Capacity and Abstract Reasoning Abilities One of the most important aspects of human development is the development of cognition. Cognition is commonly defined as the act or process of knowing and thus involves acquiring and storing information, translating that into knowledge, and making use of this in meaningful ways. According to this definition, cognition relates more to mental processes going on inside the brain as one is acquiring, storing, or using knowledge, rather than to the behavioral output exhibited by the in­­ dividual. However, behaviors do not usually occur without some input from cognitive processes. And what we see as an individual’s behavior is the outward manifestation of a complex interplay of nu­­ merous types of cognitive and emotional processing that is ongoing in the brain. These behaviors are then applied to the individual’s environment and result in environmental responses. These responses then further elicit both cognitive and emotional components. All these factors are then processed and further behaviors are then applied. As a person develops, their behavioral, cognitive, and emotional repertoires change. They are said to have learned. For example, having a tantrum is a classic behavioral strategy for a 2-year-old, not so much a useful one for a 20-year-old. Later (Section 5.2), we will attempt to link the changes that we observe at the behavioral level to underlying brain development. Virtually every textbook on developmental psychology includes Jean Piaget’s theory of cognitive development, which describes a series of four stages that children move through, in terms of the predominant way in which they acquire information. Piaget held that children always move through the stages in order, without skipping over any stages, although some children may progress through stages faster than other children. The names of Piaget’s stages are not necessarily the easiest to remember, but they serve their purpose. They are: (1) sensorimotor stage (ages birth to 18–24 months); (2) preoperational stage (ages 18–24 months to 7 years); (3) concrete operational (ages 7–12 years); and (4) formal operational (ages 12–adulthood [58]). Each stage is characterized primarily by a different main way in which the individual learns through interactions with his or her

Adolescent Behavior  41

surroundings. Important to note are the ages at which a transition occurs, which are given here as rough estimates. (There is much individual variability among children.) In the sensorimotor stage, babies learn primarily through trial-and-error by interacting directly with their physical surroundings [58]. The first cognitive shift happens as one enters the preoperational stage, at which point toddlers become able to think symbolically and use language; they tend to problem solve through the use of intuition rather than logical reasoning, and it is not until the next cognitive shift into the concrete operational stage that children fully begin to display logical reasoning abilities [58]. Not all individuals advance very far (or at all) into Piaget’s final stage, the formal operational stage. This stage is marked by the ability to think abstractly and hypothetically, such as the ability to design a scientific experiment [58]. A major reason why Piaget’s theories have been so influential is because he framed them in a way that allowed hypotheses about them to be developed and tested by researchers in the field. For example, a major marker that a child has reached the end of the sensorimotor phase is the development of object permanence, which is an understanding that objects continue to exist even when they cannot be seen, touched, or heard. Piaget developed tests that in­­ volved showing an object to a child and then partially or fully occluding it from the child’s view to see his or her reaction. In this way, he was able to demonstrate the development of object permanence in young children during the sensorimotor phase. The development of object permanence is thought to reflect the ability to engage working memory functions of the brain; therefore, object permanence is one of the earliest tests of executive function [59]. Experiments like those of Piaget allow for evidence to accumulate that either supports or refutes the theory on which they are based, and much of the evidence collected to date is in support of Piaget’s major propositions. His view is generally considered a tenet in the field of child development, and childcare workers are taught to expect children to progress through a series of cognitive stages as they grow. One problem with Piaget’s theory is that some aspects of development, such as object permanence, have been highlighted much more than other aspects. Experimental paradigms that began to generate evidence in support of the theory have been used extensively in many different contexts, whereas aspects of development not captured early by such a paradigm have continued to go unnoticed and are not as well studied or understood. Another related problem with Piaget’s theory is that it focuses heavily on the cognitive development of young children and does not seem to effectively capture the typical pattern of cognitive changes that happen across the periods of adolescence and young adulthood. In fact, Piaget himself did not believe that there were any further cognitive shifts beyond the transition to the formal operational stage [58]. The experimental paradigms used in children are most often highly simplified and thus are unable to capture the complicated kinds of cognitive shifts that occur in adolescence, as individuals become more and more proficient in abstract and logical reasoning abilities,

42  Adolescent Brain Development

long-term planning, goal-setting, and learning in general. We all know that a 17-year-old can typically learn new skills and thus face new demands much more proficiently than an 11-year-old can; however, this can be surprisingly difficult to show in a laboratory setting with many of the Piagetian experimental paradigms. This is because they are so simplified that there is a ceiling effect on performance, with older children typically performing very well. However, more recent theoretical work posits that, similar to children, adolescents also go through a relatively typical progression of cognitive changes. The progression outlined by one of these theorists, William Perry, involves transitioning through the following stages: (1) dualism, (2) relativism, and (3) commitment [60]. During the “dualism” stage, learning is approached from a ‘right-or-wrong’ perspective. Adolescents in this stage tend to perceive most information to be either right or wrong (factual), and, where uncertainty exists, it is attributed to differences in authority. Eventually, adolescents at this stage accept that there are areas where experts do not yet know all the answers; however, they still operate under the assumption that right and wrong answers do exist and will eventually be somehow determined. The overlapping “relativism” stage involves a cognitive shift, at which point adolescents begin to understand that knowledge may be contextually valid and the utility of knowledge is found in its application. This shift in cognitive strategy allows recognition that there can be many different answers to some questions and raises the epistemological question of  “How do I know?” In this stage, however, there still exists a tacit assumption that there is “truth” or a “right answer.” Adolescents at this stage may still not have developed objective standards for assessing the validity of a particular solution to a problem and are often not aware of what criterion they or others are using to evaluate information, but they have begun to accept a certain degree of ambiguity and uncertainness, and this change is considered to represent advancement in moral and intellectual development. At the “commitment” stage, the adolescent  /adult “commits” to a specific set of “ideal” standards. Adopting a set of standards allows the individual to develop his or her own strategy for reasoning through problems and deciding on solutions without requiring the expertise of an authority. But this does not mean that the standard any person has chosen is the most useful or most valid standard that exists. Perhaps ironically, some individuals in the commitment stage also begin to accept the validity of other sets of standards, despite their commitment to one particular set. This does not mean, however, that all people agree on what the standard for evaluation (overall or within a specific context) is or should be. For some it can be “it feels good,” for others it can be “the group is doing it,” for others it can be utilitarian outcomes, etc. Some take much longer than others to progress through Perry’s stages of intellectual development, and some never progress to the later stages. As described above, it can be very difficult to demonstrate this typical progression of intellectual changes in a lab setting, since it would involve presenting participants with very complex problems to tackle, instead of highly simplified experi-

Adolescent Behavior  43

mental tasks that tap specific cognitive processes. The points of cognitive transition in Perry’s model are less obvious than in Piaget’s, since they have more to do with shifts in attitude, which itself can be influenced by knowledge and experience, than with overt shifts in behavior. Nonetheless, Perry’s model appears to be representative of the typical pattern of change that is observed across adolescence and young adulthood, and it is similar to schemes of intellectual development outlined by others. So how does the typical pattern of cognitive development relate to behavior? It is presumed that, as one becomes increasingly capable of more and more sophisticated strategies of learning and reasoning, behavior should become more and more rational, well-thought-out, and goal-oriented. In teens, however, this presumption does not always pan out. While we might expect that decisionmaking skills should improve linearly into adulthood, and in some cases they do [61], many experts in fields related to adolescent development describe something more along the lines of a U-shaped pattern, where decision-making and reasoning skills generally improve across childhood, suffer some inadequacies in gain during the adolescent period, and then resume improving in adulthood [62, 63]. Of course, this pattern does not describe the development of every adolescent. For example, those who are better able to use cognitive reasoning abilities also show better decision-making skills [64]. Still, the widespread recognition of poor teen decision-making seems to suggest that many teens encounter difficulties in using good judgment at this time, and this is most apparent in social or emotionally charged situations. With respect to behavior, poorer-than-expected decision-making in adolescence is thought to be closely associated with developmental increases in risk-taking and impulsive behaviors commonly observed during this period—the “what were you thinking?” phenomenon that is so well known to parents and teachers alike (see Section 3.2.4). As risk-taking and/or impulsive behavior increases, reasoning and decision-making skills do not seem to correspondingly improve. What is going on in the teen brain to account for this is not fully understood, but many authors theorize that it can be best explained by differences in the developmental timeline of different brain regions or circuits [46, 65], where brain circuits that drive craving behaviors (for example: pleasure seeking; the desire to be part of the social group, etc.) become more dominant before the complex decisionmaking capacity of cognition has been fully developed. This differential maturation is thought to lead to a shift in the strength of activation in the circuits, leading to changes in their ability to in­ fluence behavior. The specific facets of brain function underlying the developmental changes are un­­ known, but a number of authors point to changes in dopamine signaling as a primary candidate. This will be described in Section 5.3. Returning for now to the topic of adolescent changes in behavior, one other aspect of  behavior regulation seems to play a prominent role in the overall pattern of changes observed across the adolescent period; that is, emotional regulation.

44  Adolescent Brain Development

3.2.3 Changes in Emotional Regulation Strictly speaking, the term “emotion” represents a set of internal processes that cannot be directly observed. It relates primarily to how we feel about things and to our own perception of our conscious experience of the inner sensations that we call feelings or emotions. Emotions can be identified, inferred by, or concealed from others, making it difficult or sometimes even impossible for another person to determine how someone else is feeling. However, although emotion is not actually behavior, behavior is most definitely influenced by emotion (and the other way around as well—for example, you may feel relaxed when you are jogging), and we often express our emotions through our behavior. Emotions are also closely linked to cognition—how we think. Thoughts can sometimes drive emotion (for example, you may feel excited thinking about your upcoming holiday or unhappy remembering a sad event in your life) and vice versa, emotions can also drive thoughts (you are feeling unhappy and you think that nobody cares for you). As we can see, things are becoming complicated. While we talk or write about emotions, thoughts, and behavior as if they were separate domains (and they are), each of these domains is also closely linked to every other domain—in numerous and complicated inter-relationships. And just to make things even more complex, these interrelationships can be congruent (meaning that they all reflect a common construct, i.e., feeling sad, thinking life is meaningless and sitting slumped in a chair) or dis-congruent (for example, feeling sad, thinking life is meaningless but standing up, smiling, and greeting your boss when she comes into the room). No wonder it can sometimes be so challenging to do neuroscience research! We often conceal emotion in daily life, sometimes without even thinking about it, as if by habit. At the same time, emotions can be “expressed” to varying degrees, meaning that particular behaviors are exhibited or altered by the emotion. Sometimes emotional expression is voluntary (e.g., stomping one’s feet when excited), and sometimes it is involuntary (e.g., blushing when excited), but in all cases it involves behavior or an observable physiological reaction. One of the major tasks of adolescent development is learning how to understand this very complex and inter-woven set of relationships between emotions, cognitions, and behavior, both within you as a person, within others as persons and amongst others in groups. No wonder teenagers sometimes get these things wrong! This kind of learning often involves quite a bit of trial and error. Overall, adolescents are generally considered to be more emotional than adults. Consider the euphemism “raging hormones of adolescence,” which is often used to explain away the behaviors of a teen. The term “raging” indicates an uncontrollable or violent expression of emotion, and the reference to hormones suggests that such extreme emotion is related to increases in pubertal hormones. Are adolescents really more emotional than adults, though, and, if so, is there evidence supporting the idea that this enhanced emotionality is due to increases in pubertal hormones? As we

Adolescent Behavior  45

are learning, there are also many developmental changes going on in the brain during adolescence. Since the brain actually controls behavior (as well as emotions and cognitions), it is likely that the changes in adolescent emotional regulation are related more directly to changes in brain function rather than changes in hormone levels, although changes in hormone levels most certainly play some role, as they not only are secreted in response to brain activity but after they are secreted they can impact the activity of the brain, which in turn can then impact the secretion of the hormones (this is what we call a feedback loop). In Section 5.3, we will review some of the evidence of adolescent developmental plasticity in brain regions important for emotional regulation. Studying emotional expression is challenging, since emotion is such a complex, multicomponent human process. For example, there are many potential reasons why an adolescent might be considered more emotional than an adult. A teen might actually experience a greater intensity of emotions, or she might just be less able to control the expression of emotion. Or his or her emotions might change more frequently than an adult’s would. Those who have a mood that changes frequently or who are particularly reactive in emotional situations are said to be “emotionally labile.” In this section, we will explore some of the published research findings on emotional regulation during adolescence. Remember, while we are discussing emotions, there is no such thing as emotion as a phenomenon completely separate from cognition or behavior. Laboratory measures of emotional reactivity provide a reasonable estimate of emotional intensity. A number of different behavioral and /or physiological measures have been used to measure emotional intensity, for example cortisol levels in the blood or pupillary dilation in the eyes [66, 67]. Using these and other measures, researchers have shown that advanced pubertal status can predict affective reactivity to stimuli of both negative valence (stimuli that elicit a negative emotional response, such as unhappiness) [66–68] and positive valence (stimuli that elicit a positive emotional response, such as happiness) [69]. These findings support the idea that emotional intensity heightens during adolescence. However, the association between pubertal status and emotional reactivity is sometimes weak or inconsistent, such as when a facial expression paradigm is used [70, 71], suggesting that the relationship between pubertal hormones and emotional reactivity may be indirect, or alternatively that adolescents are not very good at understanding facial cues related to different emotional states. It may take quite a bit of time and practice to be able to understand and put into social context the meaning of facial expressions. Emotional decoding can be difficult (i.e., a smile can mean happiness or anger or be simply part of a greeting ritual). One intriguing way to investigate emotional regulation experimentally is to examine measures of reward processing (how you feel when something good or not so good happens or may happen), and another way is to look at measures of threat sensitivity (how you feel when you are threatened). Both of these measures are particularly useful in characterizing the changes observed

46  Adolescent Brain Development

during adolescent development. Reward processing involves the appraisal of potentially rewarding stimuli, including an assessment of the effort or risk required to attain a reward. Threat sensitivity is usually measured behaviorally by examining the expression of emotion(s), such as fear or anxiety, in a risky situation [72, 73]. Thus, reward and threat sensitivity both heavily involve emotional regulation and are also intricately related to risk-taking and impulsive behaviors, which are known to show developmental increases during adolescence (Section 3.2.4). Examining both threat and reward sensitivities gives us different pieces of information about the regulation of behavior in risk versus reward scenarios; thus, we will examine adolescent changes in each. There is mounting evidence of increases in reward sensitivity during the adolescent period. For example, adolescents engage more frequently in incentive-driven behavior, despite the potential for negative consequences [74], and their performance can be influenced more readily by monetary rewards, compared with other age groups [75, 76]. This means that as a group (because not every teen is the same), teenagers are more likely to take risks when they perceive the reward (often social status) to be high, even if the risk for a negative outcome is high (for example, getting into a car whose driver has been drinking, if all your friends are getting into the car). Adolescents are also more likely to self-report higher levels of reward sensitivity [77]—meaning that compared to adults they have greater positive or negative responses to the same reward and are also more sensitive to positive feedback [78], relative to other age groups (meaning that receiving praise from others is very important for teens). It has also been shown that those who choose highly rewarding yet risky options in an experimental setting also endorse highly risky behavior in the real world, demonstrating good experimental validity of the risk/reward paradigms that are used [79]. Urosevic et al. [80] found that pubertal status (but not chronological age) had a significant positive relationship with reward sensitivity in both boys and girls ages 9–18. Altogether, these findings together demonstrate an inverted-U pattern of development in reward sensitivity, such that adolescence is the peak time of sensitivity to rewards, with relative declines in childhood and adulthood. This pattern suggests that the general idea that, as a group, teenagers are more emotional may have some validity. But, we cannot forget that within the group of teens there is considerable variation. Some teens may show extreme reward responses and some may show more muted reward responses. This may reflect individual variations in the genetically determined control of the brain’s stimulus-reward system. A period of increased threat sensitivity during adolescence is not as evident, although there are a few studies showing differences in adolescent vs. adult stress responding in animal models [81, 82] or in prepubertal versus adult stress responding [83, 84]. In some of our own work using a rat mammalian model, a predator odor exposure paradigm was used to test threat sensitivities in adolescent versus adult males and females. We found that our adolescent animals showed greater behavioral sensitivity to the potential threat of predation (meaning that they were more likely to

Adolescent Behavior  47

react to the possibility that they could be harmed), relative to adults, and we also found that those exposed repeatedly to this stressor across the adolescent period had developed a keener sensitivity to it by adulthood (meaning that the more the animal was exposed to this situation the more this type of response continued into adulthood). This suggests that the brain systems regulating threat sensitivity are still highly plastic during adolescence [73, 81, 85]—meaning that how they develop can be strongly impacted by the environment. Work done in humans is sparse. Urosevic et al. [80] found evidence in their study that adolescent females (but not males) are more sensitive to threat with age (but not pubertal status). We also need to keep in mind that people are not rats, and that the frontal cortex (the thinking brain) has a very important role in influencing both the experience and expression of emotions and that people have quite a much larger thinking brain than rats do. The commonalities and differences found when investigating reward and threat sensitivities in adolescence gives us hints about the underlying neural circuitry that controls these processes, which we will explore in Section 5.3. In the next section, we will draw our attention more specifically to adolescent changes in risk-taking behavior.

3.2.4 Impulsivity and Risk-taking Compared with children or adults, adolescents show increases in both impulsiveness and risktaking, which are related but distinct behavioral measures [86], and this pattern is observed across mammals [27, 87]. A leading cause of injury and death in teens is getting into a car crash, for example, and the potential for these outcomes increases hugely with risky driving behavior [88]. Adolescents also engage more frequently in risky sex and drug-related behaviors, compared with other age groups. To behave impulsively means to act in an unplanned and unpredictable manner, which often involves risky behavior. However, more deliberate forms of risk-taking are also increased during adolescence and young adulthood. Risk-taking involves behaving in a manner that potentially exposes oneself to harm, endangerment, or some other negative consequence. As we have discussed in the preceding sections, adolescents and young adults are still taking fairly early steps in their cognitive growth at this point (e.g., they may still be in Perry’s “dualism” stage of learning), and they are still immature in their cognitive ability to regulate their emotions. The ongoing development in cognitive and emotional domains has been linked to risk-taking behavior in adolescents by a number of authors, leading to the emergence of a neurodevelopmental theoretical framework in which increased frontal lobe development is associated with less impulsive and high-risk behavior [89–91]. Ongoing work is testing some of the hypothetical predictions generated from this framework. For example, in their recent study, Sonntag et al. [92] studied the levels of the D1 dopamine receptor in the prefrontal cortex (the thinking brain) of adult rats. The result of these studies supported the

48  Adolescent Brain Development

idea that activity in the dopamine system (particularly associated with the D1 receptor) in the prefrontal cortex plays an important role in controlling risky decision-making during adolescence [92]. In Sections 5.2 and 5.3, we will discuss what is known about normative adolescent development in some of the brain regions considered to be most important for cognitive and emotional regulation of risk-taking behavior. Impulsive and risky behaviors often result in negative consequences, so why do adolescents express them to a greater extent than children do? The ability to reason logically continues to improve from childhood through to adulthood, so shouldn’t decision-making also continue to improve across adolescence? Although decision-making is a cognitive process, as we have discussed earlier, it is also highly influenced by emotion, so adolescent emotional regulation is an important factor in how adolescent cognition works. Remember, emotions impact cognition, and cognition impacts emotions. We have good evidence that adolescent brains process rewards, an emotional process, differently than adults do [46, 89–91]. For an adolescent, the lure of a reward might be strong enough to cause him or her to risk harm or to disregard longer-term goals, whereas an adult would not place the same high value on the reward and thus would be less willing to behave impulsively and recklessly to attain it. This reward sensitive type of behavior may be what underlies the greater drive for and resulting greater risk for negative outcomes with sexual and substance use behaviors in teenagers. Both of these types of behaviors over time are tempered in their expression, likely as a result of cognitive maturation. In everyday language, we call this “growing up.” Another reason why adolescents more frequently exhibit risky behaviors involves a shift in their social cognition, that is, their ability to understand the complexities of social situations and to modify their behaviors accordingly. As we will discuss in more detail in Chapter 4, adolescents tend to focus much more on what their peers think than on what their parents or other adults think. One reason for this is that the reward of being part of the group may be more intense (emotional) or more important (cognitive) to teens than to adults. Accordingly, adolescents are more susceptible to peer pressure than are other age groups. For example, they have been shown to increase risky driving behaviors in response to the influence of peers [88, 93], even though they are aware of the negative consequences. Altogether, these differences are believed to be responsible for the increased propensity of adolescents to engage in risky or impulsive behaviors in order to attain rewards. From an evolutionary perspective, increased risky behavior during adolescence, especially in combination with increased social affiliation among peers, is thought to promote the independenceseeking phase of this developmental transition [27]. Risky behavior by definition can result in negative consequences; however, sometimes impulsive behavior or risk-taking can result in positive consequences, such as when a teenager capitalizes on an opportunity to ask out an attractive potential

Adolescent Behavior  49

Video 1: https://www.youtube.com/watch?v=_ed8EnOvsCE This short video clip of David Suzuki’s “The Nature of  Things,” called “Surviving The Teenage Brain: Secret of  Our Success” begins with Stan Kutcher describing why the adolescent brain was so important for human evolution and goes on to include input from other experts in the field who also explain why the teen brain is thought to be a major factor in the long lifespan of humans.

sexual partner who has just given him a small smile (even if that small smile may have been alternatively perceived as a signal to “leave me alone”). Impulsive or high-risk behaviors also can lead to unexpected rewards, such as discoveries that change our world. Steve Jobs, Mike Zukerberg, and Bill Gates were not in their 40s when they changed the world, nor was North America “discovered” by elderly sea-farers who methodically determined the best course of action! Indeed, when impulsive behavior is viewed in a positive light, it is often seen as an indicator of braveness, courageousness, spontaneity, or quickness [94]. When adolescence is considered in this light, as a time of exploration and boundary breaking, where the emotional/cognitive development of the adolescent brain actually encourages bold, non-traditional behaviors that can be initiated and sustained in same-age social groups, we can begin to see this phase of the life span in a different way (Video 1). Considered this way, the adolescent years seem to be a necessary component of the

50  Adolescent Brain Development

continued evolution and development of the human species. (Use the following link to see a slideshow all about the teen brain: http://teenmentalhealth.org/learn/the-teen-brain/). In the next chapter, we will discuss in more depth some of the changes in social cognition teens experience as their brains mature. We will also consider teen ostracism, a process not well studied but one that could be highly impactful on understanding the behavior and development of teens. We will also explore the concepts of “resilience” and “susceptibility” as applied to teen development. • • • •

51

chapter 4

Adolescent Social Dynamics There are generally profound changes to one’s social landscape during the teen years. Often, it is the first time individuals are granted the freedom to choose their own companions, including some who may be outside the approved circle of school friends or friends from extracurricular activities chosen by parents. Choosing friends and new people to interact with can be wonderfully liberating for many teens, as they explore new things and different ways of life. However, some teens have a very difficult time navigating their social environment, likely due in part to the changing social de­­ mands and enhanced importance placed on peer acceptance at this time.

4.1

Taking a Look at Teen Ostracism

In this section, we will consider the social dynamics of living in a teen world. Adolescents across the range of mammalian species begin to affiliate more with peers than with family members [27]. Even very young children can be highly social. Many parents of children who attend daycares and preschools will attest to this, as parents often find that their children love to be together with other children throughout their day. A major difference, though, between children and adolescents is that children still primarily gain their cues of acceptance and personal worth from their parents and other family members and adults in charge. They can blow off insults from peers much more easily than an adolescent can. Even if a temper tantrum is thrown, two arguing children can be best friends five minutes later. Adolescent peer insults cut much more deeply, as adolescents begin to gain their primary cues of acceptance and self-worth from peers instead of family. Since responses to peer interactions are so important during adolescent development, here we will focus on ways that adolescents behave aggressively toward one another. We’ll also describe adolescent ostracism, a process by which teens select an individual who will be deliberately excluded from peer activity and camaraderie. As today’s teens navigate their way through the adolescent period, they each experience individual challenges and hurdles. A major common goal, however, is the establishment of a role for oneself amongst peers in school and in the community. As a young person enters the teen years,

52  Adolescent Brain Development

the scale, scope, and complexity of his or her peer interactions naturally increase [95], and peer acceptance starts to gain more importance [96, 97]. Many teens accomplish this developmental stage smoothly and easily find a peer group to which they belong and in which they predominately socialize. Some, however, struggle with the process of shifting from a family focus to a peer focus, especially if cues that they receive from peers are discordant with cues they receive at home. For instance, take the following two social stories as examples. •

•

At home, 11-year-old Ellie is Mommy’s favorite little girl—she is a fantastic help with her little brother and an excellent swimmer, making her the best one to supervise the younger children at the beach, but at school she is not quite “cool enough” to hang out with the popular girls at recess, so when try-outs for the swim team start, Ellie is unsure of herself. Twelve-year-old Bobby, on the other hand, is constantly berated at home for being “always in the way” and “never any help,” so when two younger boys move in across the street and start to look up to him at school, he takes to ordering them around so he can finally be the one in charge!

Those who struggle still usually manage to find a role for themselves within a peer group, a place in which they feel that they belong. Although teens as a group are very socially influenced, there are also individual variations in how important groups are to different young people. Some crave peer acceptance from many or from just one or two individuals, while others prefer to strike out on their own. One of the challenging tasks of adolescence is the balancing of peer influences with an individual’s own values, choices, and preferences. Peer relationships are both drivers of social skills but also impact individual identity development. Early in adolescence, the drive for peer acceptance may be very intense, but in later adolescence this drive becomes tempered significantly as greater comfort in what constitutes individual identity becomes consolidated. The nature and purpose of peer relationships also change over time, from those driven in large part by the want for social acceptance to those based more on friendship and shared values, activities, and intimacy. A small but significant number of adolescents, however, do not gain peer acceptance but in­­ stead endure a period of social rejection and even ostracism (deliberate social rejection). Because social rejection can be highly stressful for most teens, being ostracized during adolescence can be a form of repeated stress exposure, and this may have profound effects on the course of the adolescent’s development [46]. Its effects may be long lasting and far reaching, especially if the adolescent is unable to overcome the period of ostracism to eventually establish him or herself in a peer group. The topic area of adolescent ostracism has received very little research attention from either a developmental or a medical standpoint. This seems surprising, given its huge impact on the health

Adolescent Social Dynamics  53

of adolescents and its relatively common occurrence—a rough estimate would be that between 1/10 and 1/20 adolescents are ostracized through a significant portion of their teen life (meaning they experience extreme levels of deliberate social rejection from their peer group). It seems to occur most prominently during early adolescence [96, 98, 99]. One of the challenges in studying teen ostracism is that the boundary between ostracism and bullying is not well defined, and validated measures of ostracism are still largely in development [100]. Social exclusion in adolescent females often involves covert acts of   verbal aggression [101]. Teen ostracism may be more common among females, and an ostracism-associated type of aggressive behavior displayed usually by females is called “relational aggression” [102]. Although difficult to identify and observe, this behavior is in fact classified as a form of   bullying. So how do we know if a child is facing bullying by peers, or if he or she simply does not get along well with her classmates? Bullying by definition involves the use of force, threats, or coercion to abuse or intimidate someone else. The major prerequisite that distinguishes bullying from gen­ eral conflict is that, in the case of   bullying, the bully (or others) must perceive himself—or herself—to be in a position of power over the victim, either physically or socially. In other words, there needs to be an imbalance of physical or social power, with the bully outranking the victim. Bullying behavior is classified as falling into one of four different forms: physical (e.g., hitting, punching, kicking), verbal (e.g., name-calling, taunting), relational (e.g., destroying friendships or other relationships), or cyberbullying (e.g., attacking someone using electronic means, such as texting, e-mailing, or posting on social media). In 2013, the very first law against cyberbulling was passed in Nova Scotia. Entitled the Cyber Safety Act, it was designed to protect victims of online abuse and harassment and was considered to be a major step in the bullying prevention movement. At this time, it is unclear as to the best evidence supported interventions that can be applied to effectively address cyber-bullying. The lack of emotional feedback that distinguishes electronic from face-to-face interactions may have implications for the development and perpetuation of negative social interactions. The natural development in adolescence of a peer-based social dominance hierarchy (social status), which also exists in other mammals in this developmental phase, may play an important role in understanding adolescent bullying and ostracism [101]. However, this same process may be related to positive behaviors as well [103]. Social status also appears to fluctuate over the adolescent years. Thus, it may be more fluid than it is in adulthood [104]. Additionally, the role of pubertal hormones, timing of puberty, sexuality, cultural, economic, social, geographic, family of origin, individual personality traits, or cross-cultural factors in adolescent social status determinations (such as the appearance and disappearance of social cliques) are not well understood [105–109]. It is likely that one or even two of these factors will not explain such complex behaviors as social hierarchy interactions. As well, different factors may be at play in different situations or may have greater

54  Adolescent Brain Development

salience in males than females and vice versa. At this time, as researchers work to better understand this complexity, it is very important not to “put all our eggs in one basket” and prematurely decide on one or another explanation for this complexity. The relationship of these complex developments in the creation of social hierarchies during adolescence to the onset of some of the mental disorders that occur during this period of the life span (such as depression or social phobia), acts of self-harm, suicidal ideation, and suicide behaviors is not well understood. It may be that substantial, sustained, and significant negative social experiences during this phase of the life span are causally related to the onset of these mental disorders and negative behaviors. However, the presence of a mental disorder may also independently produce a negative impact on any young person’s ability to successfully navigate this period of social challenges. That is, the disorder may be a reason for poor social integration. At this time, the best we can say is that there is some degree of co-relation between onset of some mental disorders and other difficulties and negative social hierarchy experiences for some teens. The causal relationship is unlikely to be consistently unidirectional, and it is unlikely that a simple social or other explanation can adequately capture this complexity. Unraveling this complexity will take the collaboration of neuroscientists, sociologists, historians, and anthropologists, to name only a few of the disciplines who will need to bring their collective knowledge to bear on this issue. In many ways, the social landscape of teens resembles the social landscape of adults. During these formative years, however, the teen is learning how to interpret and navigate these complex social interactions. The adult has already passed through that intensive learning period, and yet, many adults still continue to learn, albeit perhaps with fewer miss-steps, throughout their life span. The importance of peer acceptance, while still important in adulthood, is often tempered by better development of one’s sense of self and the presence of intimate partner bonds that can serve to modify that impact. Thus, although similarities exist, the novelty and intensity of social relationships are more pronounced in young people. Additionally, since the prefrontal cortex is still developing during these years, adolescents do not as yet have a long-range perspective, in terms of anticipating and planning for the future. Teens are more likely to exist in a moment-to-moment world, in which emotionally driven importance is placed on friendships, the opinions of peers, and the content of everyday social encounters. Teens are more likely than adults to go along with the opinions of their peers, instead of asserting their own direction. In adulthood, many may move through a day at work or at home with limited social contact with friends or colleagues. In adolescence, however, to stand alone through recess or lunch can be excruciatingly stressful. Exclusion from the peer group may thus have more negative impact in adolescence than in adulthood. With the advent and surge in usage of online social networking sites in the mid 2000s, the effects of adolescent social aggression and ostracism have become more public. Online communica-

Adolescent Social Dynamics  55

tion fits in perfectly with teens’ needs to be highly socially interconnected and to seek popularity through social recognition. They also use their phones for texting or instant messaging at a very high rate [110], with some sources reporting that they send an average of 100 text messages per day! For young people, texting and electronic social interaction sites are used in both alliance building and ostracism events. Since online communication can occur 24/7, youth who are experiencing peer hostility may have limited respite from these interactions, and, because this technology is far reaching, potentially more adversaries can become involved over a short period of time. The impact of these new technologies on youth emotional, cognitive, and social development is not yet well understood, and research is still in its early stages. Institutional (such as school) and legislative or regulatory responses, such as the Cyber Safety Act described above, are gradually being developed to address these issues. The most appropriate frameworks for the delivery of interventions designed to modify negative impacts of these types of behaviors are also not yet known, but it is likely that multiple different yet intersecting types of interventions will develop over time as our societies grapple with addressing the social impacts of novel technology in young people.

4.2 Resilience vs. Susceptibility Research underway in the fields of development and adolescence has led to a converging body of literature on resilience [111, 112]. The term “resilience” can mean a variety of different things in different contexts. In development jargon, to be resilient means to be relatively impervious to harmful effects of the environment [113]. Let’s take, for example, negative consequences of repeated stress responding. Prolonged exposure to high levels of glucocorticoids has been shown to be neurotoxic [114, 115]. It was once believed by some that exposure to stress is damaging and should be arduously avoided. This belief no longer can hold credibility given what is now known about stress and the stress response. The entire concept of stress is much better understood now, and we recognize features of the stress response that are actually invigorating, stimulating, and rewarding [116]. It turns out that an active stress response is actually an important part of a healthy lifestyle when the neurobiological system governing that response is functioning properly and appropriately. There are many parts to the stress response system as a whole, and, when it is functioning properly, checks and balances are put into place that offset negative effects of glucocorticoid exposure. Stress is an everyday part of life, but we still think of stress during development (i.e., childhood or adolescence) as a bad thing, since it has the potential to damage a system that is not yet fully mature. Indeed, many of the brain’s systems do appear to be vulnerable to alteration by developmental stress exposure [117, 118]. Interestingly, however, there is a great deal of individual variability in the impact of severe and prolonged stress on growth and development, and, contrary to

56  Adolescent Brain Development

much popular opinion (and pop psychology), outcomes of even those individuals who are exposed to severe and prolonged stress do not always seem to be negative. For example, some adolescents seem to be resilient in the face of   peer rejection, while others are more vulnerable [96]. While some are influenced greatly by any experience, stressful or otherwise, some individuals are much less influenced, and it seems that exposure to some level of adversity during development produces a hardier adult than no exposure to adversity. It is essential to consider the timing and nature of the stressor(s) or aversive events to which an individual is exposed. It is also essential not to confuse the potentially negative impacts of severe and prolonged stress (often called “toxic” stress) with the much more common and ubiquitous stresses that everyone faces in their daily lives. The “usual slings and arrows of outrageous fortune” do not lead to poor outcomes. On the contrary, they are necessary for normal growth and development. Adaptation is the hallmark of the success of human beings, as a species and as individuals. Put in a different way, our brains are wired to be adaptable, and the stress response is a signal to the brain that adaptation is necessary in a given circumstance. There are a number of factors that influence the development of resilience. Genetics is a major factor, but one we have little control over. The early childhood environment has also been shown to play an important role in determining developmental outcomes. For example, regular physical contact is necessary to ensure proper development [119], and lack of it is considered to have negative consequences. Usually, babies are exposed to physical contact with the mother, father, and/or siblings during their early life experiences; however, there have been many situations in which infants were raised without regular physical contact. A prime example of this would be the case of children raised in Romanian orphanages where infants were not cradled, rocked, or handled other than to clothe or move them. These infants did not develop normally, particularly in the social and cognitive domains [120, 121]. While this is an extreme example, the forces guiding development in the early life environment are envisioned to exist on a continuum. We expect, for example, that there is an optimal level of physical contact one could encounter in his or her early world. Indeed, a consistent finding in animal models that was initially surprising to researchers is that repeated brief separations of offspring from their mother leads to the development of a stress response system in these offspring that is most consistent with high levels of resilience [122, 123]. These findings led us and other researchers to conduct similar experiments in animals that were already weaned but still developing. In these experiments, animals were repeatedly exposed to a relatively mild stressor during the adolescent period, and they too were found to be more resilient in the face of future stress exposure in adulthood [72, 73, 81, 85, 124]. What this means is that stress is needed to promote healthy human development. Conversely, stress avoidance or interventions designed to dampen down the stress response without promoting adaptive learning as a technique to dampen down the response may result in decreased resilience (i.e., a “coddling” effect).

Adolescent Social Dynamics  57

To increase resilience in our teen population, we first need to identify what factors have the potential to guide positive emotional, cognitive, and behavioral development (e.g., [125, 126]), and then we can try to enable application of these factors in usual life circumstances. We also need to be able to recognize signs of resilience in adolescents who have been exposed to substantial developmental risk factors (such as severe and prolonged stress in childhood) and try to learn what factors have pushed these young people into a positive developmental trajectory [127]. In our previous example, we discussed how early physical contact with a caregiver is essential for proper development, and there is general consensus that the presence of a constant trusted and caring adult in childhood can buffer the negative impact of severe and prolonged stress. (For more information, see http:// developingchild.harvard.edu/key_concepts/toxic_stress_response/). However, the developmental challenges of infancy and childhood may be very different from those of adolescence. Teens are in a normal developmental phase of high novelty seeking; they are taking risks, pushing boundaries, and testing their (and their parents/communities) limits. They need to be able to exercise a certain level of control over their own decisions as part of this normative developmental process. To provide a safe yet challenging environment for a teen to grow in and learn from, this reality must all be taken into account and “letting go” takes the place of “bringing under the wing.” Exploration and independence can be encouraged in many positive ways in teens, and this will provide a much-needed outlet for them. Otherwise, they may be more likely to turn to methods of novelty-seeking that lead to negative consequences, such as unprotected sex and other dangerous “rush” activities, such as speeding or drugs. In Section 6.3, we will present some recommendations for promoting adolescent resilience in the community. In the next chapter, we will explore how ongoing brain development could be related to the adolescent behavior patterns that we have described. Furthermore, since environmental factors can influence how brains develop, we will try to address how both negative and positive environments in which young people live can impact how they develop emotionally, cognitively, and behaviorally. • • • •

59

chapter 5

Links to Underlying Brain Development In Chapter 3, we addressed some of the emotional, cognitive, and behavioral changes that occur during adolescence. Here, we will examine what is currently known about underlying adolescent brain development and how the changes in the teen brain are related to the changes in emotions, cognition, and behavior that adolescents exhibit.

5.1

Activity and Related Brain Development

As discussed in Section 3.2.1, there is a general pattern of change in brain activity observed during the adolescent period. One important feature of this development is a change in the sleep-wake cycle, characterized by an overall phase-delay shift [56, 128]. In other words, adolescents display later sleep times and later morning awakenings (or grumpier earlier awakenings!) than they did in childhood. In the sleep research literature, being late to rise and late to go to bed is called “evening chronotype,” whereas being early to rise and early to bed is called “morning chronotype.” Those who show an evening chronotype have peak activity levels later in the day than those who show a morning chronotype. So, as a result of usual brain development, adolescents display a relatively more eve­­ning chronotype than children, and this pattern is apparent across a variety of historical periods [129] and cultural contexts [130]. Of course, as with all of these usual developments, individuals will differ, with some teenagers being more definitely “evening” and others more clearly “morning” people. Despite staying awake longer into the evening hours, adolescents still require at least 1–2 extra hours of sleep per night, relative to adults [131, 132]. This is difficult to accomplish, since they usually have to get up early for school. Daytime tiredness is thus common and another widely recognized feature of adolescence. For example, adolescents often complain that they feel tired during the day and are notorious for falling asleep in class. Such chronic tiredness could simply be the result of sleep deprivation, since adolescents are often unable to sleep enough hours to achieve a full night’s rest. However, experiments in which adolescents are allowed to sleep for ten hours still reveal

60  Adolescent Brain Development

a late afternoon dip in arousal and wakefulness [132, 133], supporting the idea that it is difficult for adolescents to maintain daytime wakefulness, regardless of nighttime sleep patterns. These studies also show relatively late day peaks in activity after a full night’s rest [132, 133], providing further support for the emergence of an evening chronotype during the adolescent period. Interestingly, a cross-species comparison revealed that those mammals that sleep polyphasically (i.e., those that sleep in multiple bouts separated by periods of   wakefulness, such as a laboratory rat) show a phase-advance shift in activity during adolescence, instead of a delay [128]. This difference provides a hint at the processes regulating adolescent changes in sleep patterns and should be kept in mind when using animal models to study adolescence. This difference also suggests that these adolescent changes in sleep/wake activity have deep evolutionary roots. There are also adolescent developmental changes observed in sleep structure [128]. Although we cycle through the different stages of sleep at all ages, changes are seen in the amount of time spent in each stage (such as the REM stage) and in the pattern of the cycling between different sleep stages during adolescence. In general, adult humans start out the night spending a relatively longer period of time in the slow-wave or non REM sleep stages, but, after a number of cycles, more time is spent in REM sleep [128]. Adolescents show a similar pattern of cycling, except they consistently show a relative decline in slow-wave brain activity, a finding thought to be attributable to adolescent cortical thinning [128]. Interestingly, there is actually a reduced output of    brain waves in all frequency ranges during this period [54, 134–136], suggesting a fundamental developmental change in the way EEG waves are generated [128]. This finding makes it difficult to interpret the large decrease in slow-wave activity observed during adolescence, but it could reflect a lower sensitivity to processes of sleep regulation, since, in adults, levels of slow-wave activity are directly related to prior hours of   wakefulness (i.e., the longer one is awake, the greater the slow-wave output once he or she falls asleep [128, 137]). Many brain regions are involved in the regulation of the sleep-wake cycle, making it difficult to know where to start in looking for connections between adolescent changes in activity levels and underlying brain development. Some regions, in particular the locus coeruleus and the suprachiasmatic nucleus of the hypothalamus, have been identified as playing crucial roles [138]. The locus coeruleus regulates arousal using the neurotransmitter norepinephrine [139–141], which it produces and distributes to many other brain regions through its various efferent (outgoing) connections. Its afferent (or incoming) connections are mainly from the hypothalamus, the hormonal control center of the brain. As such, the locus coeruleus is considered to be a major regulator of body functions. The suprachiasmatic nucleus of the hypothalamus is the major biological timekeeper of the body and creates oscillations in a number of physiological and behavioral processes, known as circadian rhythms [142, 143]. If it is damaged or destroyed, these rhythms are largely lost [144–147]. DeCoursey et al. (1997) inadvertently demonstrated how important circadian rhythms are for health and survival in their study on the behavior of squirrels with suprachiasmatic nuclei lesions [144].

Links to Underlying Brain Development  61

Sixty percent of the lesioned animals were preyed upon in a nighttime attack on their outdoor enclo­ sure by a feral cat, whereas only about one third of the control animals were lost [144]. The most widely accepted theory of sleep regulation is a dual process model. The two processes involved are: (1) homeostatic regulation of sleep drive, based on previous hours of wakefulness, and (2) circadian rhythms, based on circadian routines and cues. Therefore, it makes sense to examine changes in the locus coeruleus and the suprachiasmatic nucleus, the two brain regions that primarily underlie these functions, during adolescence. We’ll first consider the locus coeruleus. Since it is the brain’s main producer of norepinephrine, any developmental alterations here could impact norepinephrine signaling, thereby influencing arousal and activity (see Figure 8). Work in animal models has affirmed that adolescence is a time of neuronal plasticity in the locus coeruleus [148, 149]. Therefore, exposure to different environmental contexts at this time can lead to the unfolding of different developmental patterns. Repeated social stress or exposure to anabolic steroids during early adolescence, for example, can lead to changes in the spontaneous discharge rates of neurons in the locus coeruleus [148, 149], thereby changing patterns of norepinephrine output and levels of arousal. Specifically, social stress during early adolescence increases discharge rates of locus coeruleus neurons and decreases levels of arousal,  as in­­dicated by a diminished response to sensory stimuli, and this effect appears to be mediated by corticotrophin-releasing factor receptors [148]. Repeated exposure to an anabolic steroid also increases discharge rates of adrenergic neurons of the locus coeruleus, suggesting that this manipulation may also decrease overall levels of arousal, an idea supported by the finding of increased depression-like behavior in adulthood in the sample exposed to steroids during adolescence [149]. Adolescent development of the locus coeruleus is also influenced by endocannabinoid signaling at this time [150]. Interestingly, increased endocannabinoid signaling during adolescence leads to a long-lasting enhancement of cannabinoid receptor 1 binding in locus coerulues (but instead leads to an opposite pattern of diminished cannabinoid receptor 1 binding in a number of other brain regions, including the nucleus accumbens and hippocampus [150]). These results imply that adolescent marijuana use could have long-term consequences for the development of the arousal system, as well as other neural systems. Altogether, these findings demonstrate that the locus coeuruleus is still plastic during the adolescent period, and therefore its function as a homeostatic regulator could be permanently altered by adolescent experiences, such as prolonged stress or drug use. Turning now to a consideration of the suprachiasmatic nucleus of the hypothalamus, it accomplishes its role as the biological timekeeper using the neuromodulators vasopressin and vasoactive intestinal peptide [143, 151, 152], which are the two signaling molecules produced there. Vasopressin-producing neurons show both diurnal and seasonal patterns of activity in humans [153, 154]. Little is known about the plasticity of the suprachiasmatic nucleus during adolescence. It is difficult to study in animal models, as the adult circadian rhythm appears to be fully established by

62  Adolescent Brain Development

weaning in rapidly developing rodents such as rats. When examined in a more slowly developing rodent, though, it was observed that establishment of the mature circadian rhythm correlated with the appearance of steroid receptors in the suprachiasmatic nucleus [155]. Although adolescent development of the suprachiasmatic nucleus is poorly understood, it does appear that sex differences in structure and function emerge in this region during puberty in humans [156], and this process of sexual differentiation is dependent on gonadal hormones [155]. Clearly, further investigation into patterns of adolescent development of both the locus coeruleus and the suprachiasmatic nucleus are necessary to elucidate the role that each of these regions play in mediating adolescent changes in activity levels and patterns of sleep-wake cycling. What we can say at this time is that both the locus coeruleus, as the center of homeostatic regulation of arousal, and the suprachiasmatic nucleus, or biological timekeeper of the brain, seem to undergo processes of adolescent development involving a sensitive period, and these processes appear to op­­ erate relatively independently. Of interest, sleep is tightly regulated by homeostatic drive at the beginning of the night, when a sleep episode starts. This is indicated by a direct positive correlation between slow-wave EEG activity and prior hours of wakefulness at the beginning of a sleep episode [56]. Early morning sleep, on the other hand, may be more sensitive to circadian cues [56]. This suggests that the tendencies of adolescents to stay up late and to sleep in late may be separately influenced by changes going on in the locus coeruleus-norepinephrine system and in the suprachiasmatic nucleus, with the locus-coeruleus exerting effects more specifically on evening sleep, and the suprachiasmatic nucleus affecting morning sleep more specifically. Whether this supposition holds true or not remains to be shown directly and needs to be further investigated. How all these different brain changes relate to the onset of some mental disorders during adolescence that are characterized by different sleep architecture profiles is not yet known. Some studies have described differences in REM latency (the time between entering stage 1 sleep and the onset of the first REM period) between groups of depressed teens and those with no psychiatric disorder [157– 160]. Differences in the REM latency measure in young females at high risk for depression when found in the euthymic state predicted onset of a depressive episode [161]. Once again, the complexity of the interaction between brain development, normative changes in human physiology, and the onset of disorders of brain function—the mental illnesses, during this phase of the life span is illustrated.

5.2

Cognition and Related Brain Development

The overall concept of cognition seems easy to understand: our ability to make sense of the world around us, using logical reasoning, abstract thought, planning, and problem-solving. It’s a big part

Links to Underlying Brain Development  63

of what makes us human, after all. It’s our conscious and unconscious perception of our surroundings and our use of the information in order to predict and plan for the future. It is likely one of the most important competencies humans have developed and may be considered as key to our evolutionary success compared to other human-like species (such as Neanderthals, Homo-erectus, etc.). Experimentally, on the other hand, cognition is an extremely complicated concept, as many different types of tasks can be said to tap similar or closely related cognitive abilities, including those termed “executive function” tasks or “working memory” tasks. At the level of brain function, cognition involves the integration of brain activity in many different brain regions, both cortical and subcortical. The prefrontal cortex is classically known to play a large role in cognition and will be discussed in more detail below. Development of higher-order cognitive capabilities occurring during adolescence is related to increased prefrontal cortex development; however, this does not account for all of the cognitive gain that takes place as individuals enter adulthood. Cognitive gain observed during the adolescent period may arise in large part from changes in the connections among different brain regions. Traditionally, researchers have studied changes within the regions; now there is a movement to focus more on studying changes in connection patterns among regions, and this is being accomplished in humans using diffusion tensor imaging, a form of MRI that measures changes in white matter [162, 163]. Within the prefrontal cortex, connections among subregions can also be studied in this way. White matter is made up predominantly of myelin, and in fact measures of white matter are routinely used to estimate myelin content in brain tissue. However, white matter itself undergoes changes across development. Although grey matter in the brain is known to be made up predominantly of cells (neurons), white matter also has a cellular component, made up mostly of the cell bodies of glial cells, including both oligodendrocytes (those that myelinate neuronal axons) and astrocytes (those that play support roles and that modulate signaling). These brain components are essential for all brain functions. So, how does the brain’s white matter content change across development? First of all, the water content is very high immediately after birth, when there is still almost no myelination of neuronal axons. The process of myelination continues through childhood, adolescence, and even into adulthood [164], but the number of cell bodies in the white matter does not increase appreciably beyond the age of three years [163]. This signifies a slow unfolding of the developmental events carried out by the oligodendrocytes, as they myelinate neuronal connections (Figure 10). Therefore, myelination is an important developmental process ongoing during adolescence. It has a major impact on connections among brain regions, as it increases the speed of neuronal conduction and signaling efficiency. This likely plays a major role in improving cognition, although there is still limited empirical evidence linking myelination to cognition [165]. We predict that future studies

64  Adolescent Brain Development

Figure 10: Pictorial representation of an oligodendrocyte myelinating a neuron by (a) making initial contact with the axon of the neuron, (b) engulfing and surrounding the axon, (c) beginning to wrap around itself, and finally (d) spiraling a number of times around the axon to form the myelin sheath. Reprinted with permission from M.H. Johnson [17].

Links to Underlying Brain Development  65

will further delineate relationships between myelination and cognition, as well as investigate other adolescent period changes in white matter, such as changes in astrocyte structure or function. Work by Menzies et al. [166] has demonstrated effects of puberty on measures of white mat­­ ter that are distinct from effects of chronological age. In their study, pubertal status in males, as measured using the Tanner scale, was related to white matter mean diffusivity in a number of   brain regions (but not to fractional anisotropy [166]). It is yet to be determined whether this holds true during female puberty. This raises the issue of the impact of sex hormones on brain development— an area of research that requires much additional study. With respect to the functioning and development of specific brain regions, there is one region that consistently stands out as being especially important for cognition and for differentiating human cognition from animal cognition. That region is the prefrontal cortex [167, 168]. Although the entire cortex plays an important role in cognition, the prefrontal cortex is especially critical in theory of mind, decision-making, and the regulation of complex social behaviors [168, 169]. Furthermore, these different functions of prefrontal cortex are separable into two distinct neural tracts, one involving ventromedial prefrontal cortex, and the other involving dorsomedial prefrontal cortex [168, 169]. The most anterior part of the prefrontal cortex is used to hold a goal in mind while an individual is working on secondary tasks/goals [167]. A full review of   what is known about the func­­ tion of each prefrontal subregion is beyond the scope of this chapter; suffice is to say that much of the detail is still being investigated. Gaining a better understanding of the role of prefrontal cortical subregions in cognition could have a number of important applications. For example, there are currently clinical applications in development. One such application would allow measurement of activity levels in specific parts of the prefrontal cortex to be used to predict who is more likely to relapse during a “quit smoking” at­­ tempt [170]. In this case, altered activity in one subregion of prefrontal cortex during smoking with­­ drawal is thought to reflect the degree of cognitive disruption that takes place during a quit attempt and is related to the likelihood of relapse [170]. Whether this finding is unique to smoking or has wider impact on other substances of abuse is not yet known. There is evidence to suggest that prefrontal cortex has evolved an increased white matter content in the human lineage [171]. Within an individual, it is one of the very last brain regions to complete maturation, often not until the mid-20s or even later. Myelination is a process that occurs in a wave from more proximal to more distal brain regions and in a caudo-cephalic (back to front) direction [163]; therefore, the prefrontal cortex is last to achieve full myelination. The cortex as a whole develops in an inside-out fashion, such that the neurons in the outermost layers of cortex are the youngest cells, compared with the inner layers [17]. Neurons of the prefrontal cortex may continue to show some developmental changes well into the third decade of life [163].

66  Adolescent Brain Development

At the level of neurotransmitter signaling, there are important changes in the dopamine system that take place in prefrontal cortex during development [172]. Specifically, dopamine receptor pruning occurs here significantly later than in other parts of the dopamine circuits, such as the striatum [173–175], which likely has broad functional significance. “Pruning” denotes that the dopamine receptor levels increase until they reach a peak, and then they show a protracted decline into adulthood. There are also changes in levels of expression of dopamine receptor genes [172]. Although we know that dopamine plays a unique role in reward evaluation, it is also well recognized that dopamine signaling is involved in numerous variant cognitive processes [176, 177], as well as in regulation of sleep and wakefulness [178] and the stress response [179–181]. With respect to cognition, there is evidence that dopamine signaling in the hippocampus and striatum may be even more important than dopamine signaling in the prefrontal cortex for some types of tasks [176]. Indeed, a recent theoretical model posits that the neural circuit subserving cognition is dissociable from that subserving affective (or emotional) mental states, but both circuits engage subregions of prefrontal cortex and both use dopamine signaling [177]. This may explain the relationship between intense emotional experiences, development of long-term memories, and variability in cognitive evaluation (including risk and outcome appraisal) of complex information. The protracted changes that take place in the dopamine system, particularly in prefrontal cortex, may be a common underlying mechanism of adolescent changes within many behavioral domains [182]. Furthermore, there is evidence that the dopamine system still has some degree of developmental plasticity in adolescence and can be altered by experience, such as stress exposure [85]. Dopamine signaling is heavily involved in risk-taking and sensation-seeking behavior, behaviors that are increased during adolescence, via its roles in reward evaluation and regulation of stress responding. Adolescent changes in the dopamine system are thus tied to behavioral changes in all of these areas, in both cognitive and affective circuits [177, 182]. In Section 5.3, we will look more deeply into what is known about neural changes that take place across development in the affective circuit.

5.3

Emotion, Risk-taking, Impulsiveness, and Related Brain Development

In Chapter 3, which focused on behavioral changes of adolescence, we examined changes related to emotional processing separately from those related to risk-taking and impulsiveness. Risk-taking and impulsiveness are distinct measures [86, 183], tapping behavioral patterns that are related but driven by different types of motivation and incentives. Despite these important behavioral distinctions, many of the same structures and circuits are involved in both emotional processing and in evaluating risk or controlling impulsiveness [86]. Some of the brain structures involved are: the hip-

Links to Underlying Brain Development  67

pocampus, the amygdala, the nucleus accumbens, and the prefrontal cortex [23, 184–190]. We are still learning much of the detail regarding the molecular underpinnings of adolescent development in these brain structures and the circuits they are part of. Here, we will review some selected findings that currently inform our best theoretical models of adolescent development. The striatum is a region of the brain that plays important roles in emotional processing, risktaking, and impulsiveness [189]. In particular, the ventral striatum houses a structure called the nu­­ cleus accumbens, which is known as the “reward center,” since it is active during reward seeking behavior [23]. The nucleus accumbens is heavily implicated in reward processing/evaluation [23, 191] and is thus important for risk-taking and emotional processing more generally. For example, the nucleus accumbens is considered to be very important in regulating addiction behaviors [192], such as repeated cocaine use. Beyond the scope of drug use, the nucleus accumbens is important for our everyday regulation of reward seeking, as well. It is considered to be a major locus for the translation of motivational tendencies into approach behavior [193], particularly via its connections with the amygdala [23]. An examination of this structure or of the ventral striatum more generally is almost always included in animal studies of brain circuitry underlying addiction or reward. A few human studies have focused on adolescent developmental change in striatum, nucleus accumbens, or other structures considered to be important in reward and emotional processing, although some research is now emerging (e.g., 184]). In neuroimaging research, activity of the ventral striatum is often examined in investigations of reward sensitivity [194–196], and, in these studies, adolescents show increased ventral striatal activity relative to adults using various reward paradigms (e.g., 197, 198]), including unexpected reward feedback [199]. However, the differences between adolescents and adults in reward processing do not always manifest as increases in activation; in one study, contrary to other findings, decreased ventral striatal activation was noted during reward evaluation [200]. More research work is needed to fully understand the bases for these differences in activation patterns. In addition to these functional changes across adolescence, structural imaging has revealed changes in size of the nucleus accumbens, with peak volumes being reached at this time [77]. This is interesting, given that the surrounding striatum continues to increase in size into adulthood [201, 202]. Urosevic et al. [80] found that puberty status influences left nucleus accumbens volume in a sex-dependent manner, whereby females have smaller but males tend to have larger left nuclei as puberty progresses [80]. The meaning of these findings is not clear, and it is at this time not certain if there are important emotional or behavioral regulation differences that are the result of either differences in structure, size, or between structures on left or right sides of the brain. One challenge that must be addressed when examining the effects of pubertal status on brain volumes is sorting out the confounding effects of chronological age. Everyone is also getting older as they move through puberty, despite the fact that the tempo and timing of puberty can vary sub­ stantially among individuals. That means that individuals of the same age may be at different stages

68  Adolescent Brain Development

of puberty. Urosevic et al. [80] addressed the effects of pubertal status in their study, which was designed to examine the effects of puberty on reward and threat sensitivities and volumes of relevant brain regions. In order to tease apart the effects of puberty from those of chronological age, they used two separate measures of pubertal status, both the Tanner scale and a self-report measure [80]. The Tanner scale is used to rate individuals’ pubertal status based on the development of primary and secondary sex characteristics. Individuals at any specific adolescent age (i.e., 12 years) could fall into one of many different Tanner stages. Validated self-report measures can be used as an additional pubertal stage assessment tool [80]. In their study, Urosevic et al. found that, of the brain region volumes they examined (i.e., amygdala, caudate, hippocampus, nucleus accumbens, pallidum, putamen, and thalamus), only the left nucleus accumbens volume was affected by puberty status [80]. Specifically, they obtained a significant interaction effect of sex and puberty status on left nucleus accumbens volume, with males showing increased volumes and females showing decreased volumes with advanced puberty status [80]. Swagerman et al. [203] also found decreases in nucleus accumbens (both left and right), as well as in caudate and putamen (right side only in girls). A pattern of shrinking of any brain structure across adolescence is noteworthy, since total brain volume continues to grow in both males and females [204]. The left nucleus accumbens, in particular, may hold especially important clues to understanding individual differences in reward-related behavior. In the study by Swagerman et al. [203], which was a twin study utilizing a later childhood-early adolescent sample (ages 9–12), heritability ratios were estimated for the volumes of a number of subcortical brain regions that are important in emotional regulation. Of the seven regions examined, all regions showed high heritability estimates, except left nucleus accumbens [203], a finding also reported by others [205–207]. This suggests that the size of the left nucleus accumbens may be more amenable to the influence of environmental  /experiential factors than are the sizes of other brain regions. However, other reasons are also plausible. Parenthetically, possibility of measurement error also should be considered. The nucleus accumbens is usually the smallest brain structure included in volumetric studies, making it more difficult than other regions to measure with precision [203]. Nevertheless, taken together, these studies pinpoint the left nucleus accumbens as a region of interest, with respect to adolescent development and changes in risk-taking behavior. The amygdala is another brain region that has been shown to play an important role in emotional processing [184, 189]. Its role in fear processing is well established, and as such, it clearly also plays a significant part in assessing risk. The hippocampus, in addition to its known roles in memory, spatial navigation, and negative feedback of the hypothalamic-pituitary-adrenal stress response, also serves important purposes in emotional processing [187]. The hippocampus plays a primary role in the encoding of emotional memories, via its connections with the amygdala [188].

Links to Underlying Brain Development  69

While few human studies have focused on adolescent development of either the amygdala or the hippocampus, there is evidence that pubertal status can influence their overall sizes. However, the nature or direction of the influence is unclear, as there appear to be sex differences and unexplained discrepancies in findings emerging from different laboratories. Neufang et al. [208] found that amygdala volumes increased in both boys and girls, but hippocampus volumes decreased in girls only, as puberty progressed. Bramen et al. [209], on the other hand, found that both amygdala and hippocampus volumes increased in boys but decreased in girls with advanced pubertal status. Although these discrepancies are difficult to account for at this time, it does seem clear that the sizes of the amygdala and hippocampus can be differentially influenced by puberty in the two sexes, and some of these changes may be related to individual differences in sex hormone levels [208]. Given the limitations of current knowledge, it is nonetheless reasonable to report that the nucleus accumbens and amygdala are two brain regions that undergo substantial changes during the adolescent period and both are important in regulating emotions. The relationship to these observed volumetric changes and the impact of hormonal, environmental, or genetic factors associated with the development of emotional regulation, however, are not yet understood. The prefrontal cortex undergoes significant microstructural and functional alterations during adolescent development and is also involved in regulating emotions [185, 189, 190]. It is understood to exert a mainly inhibitory role over emotional processing in adulthood, but the neural connections supporting this role are changing during adolescence [190]. As described in the preceding section, one very important function of the prefrontal cortex is to process cognitive information and to adjust behavior accordingly. A mature prefrontal cortex, for example, is able to dampen down a negative emotional response (and its behavioral outcome) that may arise if one perceives a subtle social slight by a peer or colleague, effectively inhibiting the immediacy of the influence of emotion on behavior and making the behavioral response a more reasoned one. One developing brain change that is thought to be particularly significant in acquiring rational control over emotion is a shift in dopamine tone (i.e., changes in basal levels of dopamine and/or dopamine receptors) in prefrontal cortex and striatal regions. Although the mature prefrontal cortex can dampen down emotional reactivity, it is too simplistic to view it’s overall role as being inhibitory, since there are contexts in which it actually facilitates emotional processing, such as in the formation of emotional memories [186]. A more useful view might be that, as adolescence progresses, it becomes easier for the prefrontal cortex to exert cognitive control over emotion, via connections that could serve to either enhance emotional impact on behavior or to diminish it. So far, we have focused in on adolescent changes in volumes of   various brain regions that are involved in emotion and risk-taking. Examining these associations is interesting, but clearly much more knowledge is needed to better understand the complex relationships between the various brain

70  Adolescent Brain Development

development processes and the emergence of emotional, cognitive, and behavioral inter-relationships that characterize the adolescent years. Neuroscientists are still trying to make sense of much of the data that we are seeing. Many of the tools now available and being applied to this research are new (e.g., diffusion tensor imaging) and their potential and limitations are not fully known. New technologies are being created and introduced at a rate unforeseen a decade ago and at a rate unpredictable for the decades upcoming. We have learned much, but there is so much more to learn. For example, researchers have reported a decrease in volume in some brain regions important for emotional processing, such as the amygdala and nucleus accumbens, even though the overall size of the brain continues to increase across adolescence. One explanation for this posits that, as the brain matures, some regions decrease in volume as their neural activation patterns become more focalized. In other words, signaling becomes condensed into smaller “hot spots” of activity, increasing overall efficiency of the involved networks. This explanation is also consistent with enhanced network efficiency, as neural connections become increasingly myelinated across development [164]. Yet, this still remains a hypothesis, awaiting further study before it can be accepted or rejected. In any case, we are only just beginning to unravel the mysteries of developmental change in the adolescent brain, and while we have some comfort in understanding how the teen brain grows and develops based on what has been found to date, it is important not to consider this to be the “final word” on the topic. Apart from changes in the size and shape of brain structures, there are changes that occur within those structures that also matter to how the teen brain is functioning. Another very important domain of brain function to consider is neurotransmission, that is—what changes in chemical signaling emerge during adolescence? Here too, there is a wealth of evidence demonstrating developmental change occurring in the brain during adolescence. With respect to risk-taking and impulsive behaviors, the most profound example found to date is developmental change in the brain’s dopamine modulated functions. While the majority of the brain’s dopamine is manufactured in one deep region, it can then either be used for signaling in subcortical regions, via the mesostriatal tract, or for signaling in the cortex, via the mesocorticolimbic tract (see Figure 8). A significant change within each of these tracts takes place during adolescence, and the overall effect on emotions, cognition, and behavior is thought to be due primarily to their different rates of maturation [65]. The deeper, subcortical brain regions have already undergone most of their maturational change by adolescence, but, as we have discussed previously, the prefrontal cortex is still relatively under-developed. In adulthood, most dopamine drive in prefrontal cortex is considered to be inhibitory over behavior, which is supported by a high concentration of D2 dopamine receptors (inhibitory receptors) in the prefrontal cortex. Therefore, a less mature mesocortical drive manifests as less behavioral inhibition. Mesolimbic dopamine function appears to be enhanced, making

Links to Underlying Brain Development  71

behavior more drive-oriented in response to signaling arising from deeper situated regions such as the nucleus accumbens. Additionally, as we have also noted above, important white matter changes are also occurring during this time. We are only just beginning to scratch the surface in understanding the pattern of adolescent development for many microstructural changes, such as changes in white matter content of the brain. Since white matter subserves the neural connections among brain regions, we can study changes in white matter structure as a means of measuring changes in connectivity and  /or functional integration of cognitive and emotional information (e.g., [164]). As we have discussed previously, many of the changes in the adolescent brain are changes in connections between regions, such as between the amygdala and hippocampus, which is related to emotional learning [188], or between the prefrontal cortex and striatum, which is related to impulse control [190]. In a recent meta-analysis of the literature, Peters et al. [162] found that the most consistent change in white matter across development was a bilateral strengthening of the connections in the superior longitudinal fasciculus, a bidirectional tract of neural fibers extending all the way from the front to the back of the brain and connecting the frontal, parietal, temporal and occipital cortices. Why are we working so hard to understand what is changing and what these changes may mean? Our biggest motivation for better understanding of adolescent brain development is to establish what is the normative process of brain development occurring during this time. Understanding the brain will help us better understand emotions, cognition, and behavior. If we truly understand what teens are experiencing developmentally, we can perhaps begin to learn how to better impact those developments to assist every young person in optimization of their lives. Part of that understanding is recognizing when things may have gone awry and implementing helpful interventions to help get things back on track, but part of that is also recognizing when certain behavioral patterns or outcomes are to be expected—normative. This is an approach much different from historical ideas that saw teens as chronically disturbed (consider the famous phrase from Anne Freud: “to be normal in adolescence is itself abnormal”) or that ignored the importance of disturbances in brain function as underlying mental illnesses or that separated psychology from neuroscience. We are learn­­ ing that the mind is what the brain does. One of the challenges in developing our understanding is that young people themselves are evolving as our species evolves over time. As our social contexts change, as our technologies change, so do the brains of   young people who are living in that epoch. In some considerations, then, we are constantly trying to hit a moving target, yet there seem to be some constants that span generations and indeed can be seen across the footprints of history. Young people are forever coming up with innovative new ways to undertake risky behaviors, and adolescent development of affective and social neural networks makes teens much more susceptible to influence by their peers, relative to

72  Adolescent Brain Development

adults. These characteristics have spanned historical time and are likely the impetus for exploration and experimentation that have made us what we are today. How these characteristics will play out in the future is unknown, but what is known is that they will have a very important impact on how that future unfolds. We also do not well understand how specific social stimuli that may impact adolescent brain development may contribute to long term emotional, cognitive, and behavioral outcomes of   young people. Take social exclusion occurring in adolescence. Moor et al. [210] identified a network of brain regions involved in the experience of social exclusion; it includes parts of the prefrontal cortex and the anterior cingulate cortex, as well as the insula. These regions seem to be age-specific with younger teens showing increased sensitivity, relative to older teens and young adults. Others have shown that teens are more susceptible than adults to experiencing negative affect (or bad feelings) in response to social exclusion [211, 212]. As a result, the impact of social exclusion in some young people may lead them to exhibit increased rates of risk-taking behaviors in certain social contexts (trying to fit in), or in others, may be related to an increased risk for depressed mood or social anxiety [212]. How individual differences impact on each of these potential trajectories is also important to understand. Not every teenager who experiences social exclusion will demonstrate a similar longterm outcome. The type, duration, and availability of other kinds of supports (for example: role of the family; a trusted companion; the presence of a unique competency, such as artistic talent; etc.) may also modify or otherwise shape a young person’s trajectory into and through adulthood. Clearly, although much is being discovered, it is premature to come to conclusions. In the next chapter, based on what we do know about the teen brain at this time and aware that there are more things that we do not know than things we do, we will make a number of suggestions that we as a society should consider to try and create conditions that will support and facilitate optimal adolescent development.

5.4

Mental Disorders that Arise in Adolescence

Just before we reach the final chapter of the book, we’ll take a brief foray into the world of teen mental illness. The main objective of this book is to take an overall look at what we know about normal adolescent brain development. A great way to study a normal developmental process, though, is to see what happens when the process is interrupted or disturbed. Indeed, many of the most profound discoveries in psychology have come from case studies of individuals that have brain damage in a particular brain region or neural system. The famous case of H.M., for example—the man who could not form new memories—was the result of a bilateral medial temporal lobe resection, an operation that removed his hippocampus and some surrounding areas, including the amygdala, on

Links to Underlying Brain Development  73

both sides [213]. The neurosurgery was an experimental procedure intended to alleviate H.M.’s epilepsy, but, while his seizures were indeed controlled, he lost his ability to form new memories [213]. He was carefully studied by Brenda Milner, who found that, despite still having his perceptual and cognitive abilities intact, H.M. could not form memories of new people, places, or events since the time of his surgery [213]. This intriguing situation demonstrated that there is a region within the medial temporal lobe crucial for new memory formation, a region separate and distinct from the areas used to perceive or store information. This classic work is one of the most cited articles in the field of neuroscience and still continues to be cited frequently [213]. Today, however, with modern neuroimaging techniques, we can study much more subtle changes in brain functioning related to less spectacular circumstances, for example: how the brain processes cognitive information if a person has schizophrenia, compared to that same activity in a person with no mental illness. So to understand normal adolescent development, it is useful to consider situations in which we know development is not proceeding normally [214]. A number of mental disorders have a usual age of diagnosis during the adolescent period [215], implicating the adolescent development process in their etiology. Some disorders can appear before, during, or after adolescence, but they may present differently, depending on when the symptoms began. Age of onset can be a crucial factor in determining disorder subtype or expected progression [216]. Some examples of disorders that can be diagnosed most commonly during adolescence are schizophrenia, bipolar disorder, major depressive disorder, substance use disorder, and eating disorders [217–219]. Schizophrenia is characterized by deficits in the cognitive and social domains and marked by periods of psychosis (delusions and hallucinations). Its neurobiological basis is still not well understood, but it is known to involve dysregulation of the dopamine system in a number of brain circuits that are important in the control of cognition, perception, and behavior, and the firstline medications used to treat schizophrenia are dopamine blockers [220]. It is unclear at this point exactly what goes wrong with the functioning dopamine system in patients with schizophrenia, but it seems likely that a problem may arise in the ongoing development of that system, particularly in the prefrontal cortex. Perhaps the shift from an enhanced mesolimbic to an enhanced mesocortical dopamine drive sets off the disorder. Neuroimaging studies have implicated differences in various brain regions in schizophrenia and have raised the possibility that one of the important brain development processes of adolescence (pruning of receptors) may explain part of this picture [221, 222]. Substance use disorder is a behavioral disturbance characterized by excessive, unnecessary, and non-therapeutic use of a substance. It typically begins in adolescence and its onset can be tied to the risk-taking features of adolescence, as similar brain circuits are involved [223]. Some research also suggests that adolescents may have a greater tolerance for alcohol, compared with adults, a difference that possibly contributes to the higher propensity of the adolescent to engage in risky drinking patterns, such as binge drinking [224]. Interestingly, though, it seems as though alcohol

74  Adolescent Brain Development

consumption serves a social function in adolescence, as it has been found in at least one population that the most sociable and confident young teens are also those who consume the highest levels of alcohol [225], and even in animal models adolescents are more sensitive than adults to the social facilitation effects of alcohol [224]. Therefore, early teen drinking cannot always be taken as a sign of problems; rather, it may play a role in normal teen rites of passage [226]. The challenge for young people, their parents, and society in general is how to limit the harm that alcohol over-use or alcohol misuse can cause. Eating disorders may also be tied to some of the developmental features of adolescent environments, such as boundary-setting and increased peer identification, relative to family identification. However, and possibly primarily, the changes that occur in the complex biological control of eating/satiety signaling mechanisms during puberty are also involved [227, 228]. All teens are exposed to social influences, but only a small minority develops an eating disorder. In these disorders, a primary drive—eating  —is a focal point that is dysregulated. Many of these teens go through phases of binge eating and then not eating or barely eating for long periods, or they binge and purge. This is the classic eating disorder called bulemia nervosa. A small number (less than 0.4%) develop a food-restricting pattern called anorexia nervosa. These patterns suggest an inability to properly regulate incentive driven behavior; the teens are either “all over” the primary reward (i.e., food) in the binge phase, or else they are in an overly inhibitory mode during the anorexic phase. These problems with reward evaluation and regulation of inhibitory control may also be related to the changes in dopamine signaling that arise during development, although changes in serotonin signaling are also thought to play a key role [227, 228]. All adolescent mental disorders, including those mentioned here, arise from a complex interplay between genes and environmental impacts that begin at the time of conception. It is the epigenetic mechanisms arising in the context of normal brain development that provide the link between these influences. These complex interactions will result in different outcomes in different individuals because of their genetic and experiential differences. Understanding that mental disorders are the result of dysregulation in normal brain development and unraveling the complex interplay between genetic predisposition and environmental influences (for example: presence of a specific variant of the COMT gene, which encodes for an enzymatic protein that degrades dopamine; the use of marijuana during adolescence, and the emergence of schizophrenia) will help us better understand how to treat and maybe even prevent these illnesses. In the final chapter, we will summarize the main features of adolescent development and discuss a number of public domains whose policies should take these features into account. • • • •

75

chapter 6

Putting it All in Context Adolescence is a unique life phase, just as all life phases are. Although there is a great deal of individual variability among young people, there are particular emotional, cognitive, and behavioral features that in general can be considered to characterize this life phase. While all of these features may not be observed in every teen, there are general patterns of change that occur between childhood and adolescence in behavioral, cognitive, and emotional domains, as well as changes in general levels and patterns of daily activity. For example: the physically active and alert phase in the adolescent is shifted to later in the day, relative to adults and younger children. Unlike children, socially, adolescents familiarize and identify more with their teen peers than with family. Compared to children, cognitively, their abilities are increasing and learning strategies are becoming more com­­ plex. All these general differences characterize this life phase; however, there is a great deal of individual variability with respect to timing, amount, and duration of change. For example: some individuals are slow to achieve peak cognitive abilities but end up attaining very advanced levels of cognitive capabilities, while others achieve their peaks earlier on but may not attain advanced levels of cognition. Occurring simultaneously with these cognitive changes in the adolescent are emotional changes that may be happening according to an entirely different developmental schedule. Adolescents enjoy seeking out novelty and engage in more risk-taking and sensation-seeking behaviors than do adults or young children. They process rewards differently than adults do, in most cases appearing to require greater amounts of stimulation in order to achieve equal amounts of   brain activity in reward circuits. Many of these changes can be attributed to the slower development of the prefrontal cortex (cognition) in the adolescent, compared to changes in the overall tone of the dopamine system in the mesocorticolimbic part of the brain.

6.1

Implications for Health and Social Policy

Given all of the developmental change occurring during adolescence, healthcare requirements are clearly likely to be different for teens, relative to children or adults. Furthermore, teens are at an age during which the healthcare choices they make set up a precedent for healthcare routines they will practice throughout their lives, making it a particularly crucial period for young people to develop

76  Adolescent Brain Development

healthy self-care habits [229]. This is true for all of a teen’s healthcare needs, but especially so for teen mental health. For example, mental disorders such as depression and bipolar disorder in young people increase the risk for a variety of negative health outcomes. Mental disorders are related to: early all-cause mortality; death by suicide; and high rates of diabetes, obesity, cardiac, and other diseases [230–232]. Up until very recently, however, our healthcare system in Canada and globally did not recognize adolescents as being part of a unique life transition phase, or, at least, it did not differentiate young people in terms of their healthcare needs. In most jurisdictions, artificial age cut-off dates (such as age 16 years) have been set to stream young people either into pediatric (children) or adult health care systems. Such brain-less health policy is particularly problematic for young people (ages 13–25 years) who develop a first onset mental illness during this time. Neither pediatric nor adult mental health care services are well positioned to provide effective, comprehensive, and integrated care that meets the needs of this population. The importance of developing interventions specifically targeted to this need have only recently been recognized, primarily through the creation of first onset psychosis programs. These considerations are now increasingly being applied in policy discussions under the framework of “Transitional age Youth” or “Emerging Adults.” The development of   youth specific mental health care policy and application of interventions, infrastructure, and appropriately trained human resources to effectively address youth mental health care needs remains one of the important challenges facing our health care system today. In Canada, while health care is a provincial jurisdictional responsibility, national leadership in addressing this issue has been taken by the Mental Health Commission of Canada. Throughout this developing policy framework is interwoven the need for enhanced mental health literacy for health care and human services providers. This would have the effect of improving mental health literacy (MHL), which could address the need for better understanding of teen brain development, as well as the four pillars of MHL: understanding how to obtain and maintain good mental health; understanding mental disorders and their treatments; decreasing stigma; and enhancing help-seeking efficacy [233, 234].

6.2

Implications for Education Policy

In addition to the healthcare system, policies and interventions based on our understanding of adolescent brain development should apply to education systems as well. First of all, considering the general activity pattern (sleep-wake cycle) of the adolescent, it has been suggested that school hours could be shifted to better match the evening chronotype displayed by adolescents [235]. Also, the

Putting it All in Context  77

integration of more physical activity into their daily schedules may promote earlier bedtimes and/or more restorative sleep [128]. While school authorities may be aware of these findings, however, few have made changes in school schedules or structures in accordance with this knowledge. In those schools where later start times have been implemented, benefits are being shown [236]. Other aspects of teen brain development, in particular understanding the impact of how and when risk  /reward brain system processes mature, could be applied within education systems. For example: understanding reward immediacy should lead to developing reward responses that occur soon after the behavior that initiates their application. When linked to the praise response as reward phenomenon, educators should consider immediate praise focused acknowledgements of positive achievements as part of usual classroom pedagogy. Furthermore, providing weekly feedback through pop-tests or end of week assessments may provide better incentives for ongoing engagement with the learning environment and subject matter than mid-term and final examinations. Unfortunately, these and other similar pedagogic interventions have not become commonplace in usual school classrooms. When examining aspects of adolescent brain development, it has become apparent that many of these processes are not complete until the third decade of   life. This means that most young people enrolled in higher education are still developing their prefrontal cortices while they are completing their undergraduate degrees! University and college students, then, are still moving through many of the cognitive and emotional changes we’ve discussed. Yet, many post-secondary education programs do not necessarily take this into account. The development of problem solving skills and the application of formalized reasoning techniques, such as logic or the scientific method to material is not often the focus of many professors. Such a problem-based learning approach that requires individual searching for information, critical evaluation of information found, synthesis of information into useful quanta, and applying that to solve the problem at hand is a pedagogic process that differs greatly from both top down lecturing or encouragement of emotional acceptance of opinion as knowledge acquisition models. Indeed, some of the evolution of pedagogic approaches in professional school education programs over the last two decades has begun to move in that direction. Problem-based learning can also be incorporated into secondary school programs; indeed, some high schools are already doing this. The most popular problem-based learning models afford students more opportunities to work as teammates, which has both advantages and disadvantages. On the one hand, it may appeal to adolescents to be able to work more closely with their peers, and thus their interest may be drawn more into the learning process. On the other hand, peer learn­­ing can be problematic from an evaluation standpoint. It is difficult as an evaluator to know which teammates contributed most effectively to solving a group problem—some may do all the work, while others are carried along. Also, adolescents may be overly concerned with fitting into a peer

78  Adolescent Brain Development

group, at the expense of learning or performing well academically. If one cares more about what the other students think than about the learning process itself, the goals of the assignment could become confusing. Additionally, teamwork, while it has many positive components, may also encour­age “group-think,” where the necessity for individual challenge of ideas shared by groups is discouraged. Certainly, the creation and deployment of  well-constructed research studies informed by brain development to examine these various pedagogical approaches should be a priority for educators, in order to determine which types of educational frameworks may provide the greatest developmental benefits.

6.3

Promoting Adolescent Development in the Community

This book has had two major objectives. First and foremost, we aimed to examine what is known about adolescent brain development and related emotional, cognitive, and behavioral changes. Secondarily, we have attempted to discuss this information in a way that might bring about positive changes for the lives of teens. How can we make our communities as accepting of teens (and their behaviors) as possible, in a manner that can help young people channel their growth and development into positive directions? In short, how can our social structures promote the development of citizenship, with all the rights, responsibilities, and obligations that the construct of citizenship demands? One challenging task in this regard is that of how we can help young people better take on individual and social responsibilities in the face of novel electronic technologies. This is made even more challenging by the lack of adult understanding of this technology. The impact of this new electronic world on the social  /cognitive /  behavioral aspects of adolescent brain development is not yet understood, but the negative impacts of unskilled and socially unregulated use of a new technology (such as cyberbullying) are becoming known. It will be imperative that adults and young people learn how to harness these new and rapidly developing technologies to better youth development rather than derail youth development [237, 238]. We need to start by doing a better job of building the adolescent life phase into the societal structure. In too many instances, we seem to go straight from a protocol meant for a child to a protocol meant for an adult. We have discussed the example of the healthcare system, but also the legal system does not seem to do an adequate job of incorporating a separate set of rules for adolescents. Adolescents need to be treated like adults when it comes to what constitutes acceptable behaviors but not necessarily the same when it comes to punishments for rule-breaking, since adolescents are more liable to make a poor decision that they will later regret. Thus, the use of some popular ap­­

Putting it All in Context  79

plications such as mandatory minimum sentencing may not be a useful tool in the promotion of re­­ habilitation for young people charged with a crime. We need more programs and resources available that are built on an understanding of teen norms, not adult norms. We also need better monitoring systems in place for identifying early when a teen is running into trouble [239]. Because teens identify more with friends and peers than with family, and they are also taking more risks than usual and testing boundaries, we expect some amount of distancing from parents and some behaviors that may seem out of character. It makes it difficult to recognize, however, when a teen is having serious problems. A victim of peer ostracism, for example, can undergo years of severe suffering, often undetected before he or she gets help or finds a way to overcome the problem. Similarly, since most mental disorders can be diagnosed prior to age 25 years, are generally mild to moderate when they begin, and respond well to evidence-based treatment, it is essential that schools and primary healthcare settings be horizontally integrated with mental health services to promote early identification, triage, referral, care, and support. This approach requires good mental health literacy of teachers, educators, youth, and health services providers. It also requires the development and application of integrated pathways to care that cut across currently existing silos. Evidence-based components of such an approach already exist and have been applied in numerous provinces [233, 240–242], but this simple and effective approach is still not widely distributed. Another consideration is the development and application of peer-mentoring or peer education activities. When properly applied, these models may facilitate growth in both the youth who are participating and those who are leading. Research on optimal designs and supports to these types of activities is still developing, and can be expected to help direct how, when, and where these approaches can be best applied. One priority for policy consideration grows out of all the above examples. That is, investment in properly designed and applied research into the developmental phase of adolescence. Too often in today’s society, decisions are made regarding interventions or the application of social structures for young people without the evidence base needed to be able to tell us if what we are doing is likely to be helpful, neutral, or even possibly harmful. For example, recent rigorous systematic research has demonstrated that popular suicide prevention programs applied in schools do not have the evidence that they actually prevent suicide. On the contrary, some evidence that they may cause harm exists, and in Canada the recent uptick in suicide rates in young people (mostly girls) following decades of decline is co-related to the widespread dissemination of such interventions [243]. Good intentions are not enough. We need the science to be able to guide us toward a path of dealing better with teen suicide. Similar considerations should guide educators in their enthusiastic application of simple solution approaches to youth development that may lead to unforeseen problems. While based on good intentions, it was not based on good experimental science, and this approach may have created

80  Adolescent Brain Development

more problems than good. Popular school-based interventions of today (such as mindfulness and other stress-reduction focused interventions) need to be properly evaluated in this age group as to their later outcomes prior to widespread enthusiastic applications to all students. While these interventions show a lot of promise, most of the work evaluating their effects has been conducted in adult samples. Looking at adolescent development from a neuroscience perspective, we know that neurobiological systems can be made more resilient to the negative effects of stress if they are built to cope with stress through development of strategies that are designed to solve the environmental challenges that have created the stress. For example, individuals exposed to intermittent stressors during development end up showing lower levels of stress responding as adults. In other words, those who grow up dealing with some level of stress on a regular basis and who learned how to problem solve and adapt to the stressor end up coping better with stress later on. This same principle can be applied to adolescent development—the more we can present adolescents with opportunities to make adult decisions using their own reason and judgment, helping them with the decision-making process, allowing them to learn from both their successes and failures, the more we may be able to assist them growing into strong, resilient adults.

6.4

Concluding Remarks

The unfolding of adolescent development is a complex set of processes driven by both internal (e.g., genetic) and external (e.g., environmental) regulators. We are now coming to understand that this life phase in humans is marked by specific patterns of behavioral change, such as a more evening chronotype, increases in peer-directed social behavior and risk-taking behaviors, and a relative weakness in emotional regulation, considering the cognitive maturation of an adolescent. Meanwhile, active neural development is ongoing in many brain regions. A major example is the prefrontal cortex, which continues to develop up until at least 30 years of age and is responsible for regulating inhibitory control over the stress response and over emotionally driven behaviors. We believe that most of the general behavioral changes adolescents go through are the direct result of ongoing developmental changes in the brain. These changes should be studied rigorously, so that we can better understand the links between brain and behavior and better adapt our societal policies accordingly. • • • •

81

References [1] [2]

[3]

[4]

[5]

[6]

[7] [8] [9]

[10] [11]

R. Plomin, “The role of inheritance in behavior,” Science, vol. 248 (no. 4952), pp. 183–8, Apr 13 1990. doi:10.1126/science.2183351 A.M. Costa, L. Breitenfeld, A.J. Silva, A. Pereira, M. Izquierdo, and M.C. Marques, “Genetic inheritance effects on endurance and muscle strength: an update,” Sports Medicine, vol. 42 (no. 6), pp. 449–58, Jun 1 2012. doi:10.2165/11650560-000000000-00000 P. Pinel and S. Dehaene, “Genetic and environmental contributions to brain activation during calculation,” NeuroImage, vol. 81, pp. 306–16, Nov 1 2013. doi:10.1016 /j.neuroimage.2013.04.118 B.M. Hicks, B.D. Schalet, S.M. Malone, W.G. Iacono, and M. McGue, “Psychometric and genetic architecture of substance use disorder and behavioral disinhibition measures for gene association studies,” Behavior Genetics, vol. 41 (no. 4), pp. 459–75, Jul 2011. doi:10 .1007/s10519-010-9417-2 J.A. DiPietro, M.M. Ghera, and K.A. Costigan, “Prenatal origins of temperamental reactivity in early infancy,” Early Human Development, vol. 84 (no. 9), pp. 569–75, Sep 2008. doi:10.1016/j.earlhumdev.2008.01.004 M.P. Vervloed, A.W. Hendriks, and E. van den Eijnde, “The effects of mothers’ past infant-holding preferences on their adult children’s face processing lateralisation,” Brain and Cognition vol. 75 (no. 3), pp. 248–54, Apr 2011. C. International Human Genome Sequencing, “Finishing the euchromatic sequence of the human genome,” Nature, vol. 431 (no. 7011), pp. 931–45, Oct 21 2004. D. Boyd and H. Bee, The Developing Child, Edition 13: Pearson Education, Inc., 2012. J.A. Martin, B.E. Hamilton, P.D. Sutton, S.J. Ventura, T.J. Mathews, S. Kirmeyer, and M.J. Osterman, “Births: final data for 2007,” National vital statistics reports: from the Centers for Disease Control and Prevention, National Center for Health Statistics, National Vital Statistics System, vol. 58 (no. 24), pp. 1–85, Aug 9 2010. L. Wright and T. Perrot, Stress and the Developing Brain: Morgan & Claypool Life Sciences, 2013. J.M. Gohlke, W.C. Griffith, and E.M. Faustman, “Computational models of neocortical

82  Adolescent Brain Development

[12] [13] [14] [15]

[16]

[17] [18]

[19] [20] [21]

[22]

[23]

[24]

neuronogenesis and programmed cell death in the developing mouse, monkey, and human,” Cereb Cortex, vol. 17 (no. 10), pp. 2433–42, Oct 2007. doi:10.1093/cercor/bhl151 D. Bainbridge, Teenagers: A Natural History: Portobello Books Ltd., 2010. doi:10.1007 /978-3-8274-2374-0 P. Aries, Centuries of Childhood, New York: Vintage Books, 1962. A. Freud, “Adolescence,” Psychoanal St Child, vol. 13, pp. 255–78, 1958. J. Rosales-Ruiz and D.M. Baer, “Behavioral cusps: a developmental and pragmatic concept for behavior analysis,” Journal of  Applied Behavioral Analysis, vol. 30 (no. 3), pp. 533–44, Fall 1997. doi:10.1901/jaba.1997.30-533 J.J. Arnett, “Emerging adulthood. A theory of development from the late teens through the twenties,” American Psychology, vol. 55 (no. 5), pp. 469–80, May 2000. doi:10.1037/0003 -066X.55.5.469 M.H. Johnson, Developmental Cognitive Neuroscience, Chichester: Wiley-Blackwell, 2011. L.R. Ment, S. Kesler, B. Vohr, K.H. Katz, H. Baumgartner, K.C. Schneider, S. Delancy, J. Silbereis, C.C. Duncan, R.T. Constable, R.W. Makuch, and A.L. Reiss, “Longitudinal brain volume changes in preterm and term control subjects during late childhood and adolescence,” Pediatrics, vol. 123 (no. 2), pp. 503–11, Feb 2009. doi:10.1542/peds.2008-0025 J.N. Giedd, “The teen brain: insights from neuroimaging,” Journal of Adolescent Health, vol. 42 (no. 4), pp. 335–43, Apr 2008. doi:10.1016/j.jadohealth.2008.01.007 J.N. Giedd, “Structural magnetic resonance imaging of the adolescent brain,” Annals of the New York Academy Science, vol. 1021, pp. 77–85, Jun 2004. doi:10.1196/annals.1308.009 J.N. Giedd, “The anatomy of mentalization: a view from developmental neuroimaging,” Bulletin of the Menninger Clinic, vol. 67 (no. 2), pp. 132–42, Spring 2003. doi:10.1521 /bumc.67.2.132.23445 Y. Ostby, C.K. Tamnes, A.M. Fjell, L.T. Westlye, P. Due-Tonnessen, and K.B. Walhovd, “Heterogeneity in subcortical brain development: A structural magnetic resonance imaging study of brain maturation from 8 to 30 years,” Journal of Neuroscience, vol. 29 (no. 38), pp. 11772–82, Sep 23 2009. doi:10.1523/JNEUROSCI.1242-09.2009 G.D. Stuber, D.R. Sparta, A.M. Stamatakis, W.A. van Leeuwen, J.E. Hardjoprajitno, S. Cho, K.M. Tye, K.A. Kempadoo, F. Zhang, K. Deisseroth, and A. Bonci, “Excitatory transmission from the amygdala to nucleus accumbens facilitates reward seeking,” Nature, vol. 475 (no. 7356), pp. 377–80, Jul 21 2011. doi:10.1038/nature10194 E.L. Malin and J.L. McGaugh, “Differential involvement of the hippocampus, anterior cin­­gulate cortex, and basolateral amygdala in memory for context and footshock,” Pro­ ceedings of the National Academy Science U S A, vol. 103 (no. 6), pp. 1959–63, Feb 7 2006. doi:10.1073/pnas.0510890103

References  83

[25]

[26]

[27]

[28]

[29]

[30]

[31]

[32]

[33]

[34]

[35]

C.S. Monk, R.G. Klein, E.H. Telzer, E.A. Schroth, S. Mannuzza, J.L. Moulton, 3rd, M. Guardino, C.L. Masten, E.B. McClure-Tone, S. Fromm, R.J. Blair, D.S. Pine, and M. Ernst, “Amygdala and nucleus accumbens activation to emotional facial expressions in children and adolescents at risk for major depression,” American Journal of   Psychiatry, vol. 165 (no. 1), pp. 90–8, Jan 2008. doi:10.1176/appi.ajp.2007.06111917 H. Kim, L.H. Somerville, T. Johnstone, A.L. Alexander, and P.J. Whalen, “Inverse amygdala and medial prefrontal cortex responses to surprised faces,” Neuroreport, vol. 14 (no. 18), pp. 2317–22, Dec 19 2003. doi:10.1097/00001756-200312190-00006 L.P. Spear, “The adolescent brain and age-related behavioral manifestations,” Neuroscience & Biobehavioral Reviews, vol. 24 (no. 4), pp. 417–63, Jun 2000. doi:10.1016/S0149-7634(00) 00014-2 P. Devoto and G. Flore, “On the origin of cortical dopamine: is it a co-transmitter in noradrenergic neurons?,” Current Neuropharmacology, vol. 4 (no. 2), pp. 115–25, Apr 2006. doi:10.2174/157015906776359559 S.J. Gilbert, T. Zamenopoulos, K. Alexiou, and J.H. Johnson, “Involvement of right dorsolateral prefrontal cortex in ill-structured design cognition: an f   MRI study,” Brain Research, vol. 1312, pp. 79–88, Feb 2 2010. doi:10.1016/j.brainres.2009.11.045 N. Ruh, B. Rahm, J.M. Unterrainer, C. Weiller, and C.P. Kaller, “Dissociable stages of  prob­­ lem solving (II): first evidence for process-contingent temporal order of activation in dorsolateral prefrontal cortex,” Brain and Cognition, vol. 80 (no. 1), pp. 170–6, Oct 2012. doi:10.1016/j.bandc.2012.02.012 A.G. Sanfey, J.K. Rilling, J.A. Aronson, L.E. Nystrom, and J.D. Cohen, “The neural basis of economic decision-making in the Ultimatum Game,” Science, vol. 300 (no. 5626), pp. 1755–8, Jun 13 2003. doi:10.1126/science.1082976 Y. Yang, C.D. Paspalas, L.E. Jin, M.R. Picciotto, A.F. Arnsten, and M. Wang, “Nicotinic alpha7 receptors enhance NMDA cognitive circuits in dorsolateral prefrontal cortex,” Pro­ ceedings of the National Academy of Science U S A, vol. 110 (no. 29), pp. 12078–83, Jul 16 2013. doi:10.1073/pnas.1307849110 L. Strathearn, J. Li, P. Fonagy, and P.R. Montague, “What’s in a smile? Maternal brain responses to infant facial cues,” Pediatrics, vol. 122 (no. 1), pp. 40–51, Jul 2008. doi:10.1542/ peds.2007-1566 B.J. Nagel, K.L. Medina, J. Yoshii, A.D. Schweinsburg, I. Moadab, and S.F. Tapert, “Agerelated changes in prefrontal white matter volume across adolescence,” Neuroreport, vol. 17 (no. 13), pp. 1427–31, Sep 18 2006. doi:10.1097/01.wnr.0000233099.97784.45 G. Bartzokis, M. Beckson, P.H. Lu, K.H. Nuechterlein, N. Edwards, and J. Mintz, “Agerelated changes in frontal and temporal lobe volumes in men: a magnetic resonance imaging

84  Adolescent Brain Development

[36]

[37]

[38]

[39]

[40]

[41]

[42]

[43]

[44]

[45] [46] [47]

study,” Archives of General Psychiatry, vol. 58 (no. 5), pp. 461–5, May 2001. doi:10.1001/ archpsyc.58.5.461 A.E. Skerry and R. Saxe, “A common neural code for perceived and inferred emotion,” Journal of Neuroscience, vol. 34 (no. 48), pp. 15997–6008, Nov 26 2014. doi:10.1523/JNEUROSCI.1676-14.2014 R. Saxe, S. Carey, and N. Kanwisher, “Understanding other minds: linking developmental psychology and functional neuroimaging,” Annual Review of   Psychology, vol. 55, pp. 87–124, 2004. doi:10.1146/annurev.psych.55.090902.142044 R. Saxe and N. Kanwisher, “People thinking about thinking people. The role of the temporo-parietal junction in “theory of mind,” NeuroImage, vol. 19 (no. 4), pp. 1835–42, Aug 2003. doi:10.1016/S1053-8119(03)00230-1 R. Saxe and A. Wexler, “Making sense of another mind: the role of the right temporoparietal junction,” Neuropsychologia, vol. 43 (no. 10), pp. 1391–9, 2005. doi:10.1016/j.neuro psychologia.2005.02.013 M.V. Lombardo, B. Chakrabarti, E.T. Bullmore, M.A. Consortium, and S. Baron-Cohen, “Specialization of right temporo-parietal junction for mentalizing and its relation to social impairments in autism,” NeuroImage, vol. 56 (no. 3), pp. 1832–8, Jun 1 2011. doi:10.1016 /j.neuroimage.2011.02.067 D.V. Bishop, “Cerebral asymmetry and language development: cause, correlate, or consequence?,” Science, vol. 340 (no. 6138), pp. 1230531, Jun 14 2013. doi:10.1126/science .1230531 I. Kaufer, J. Morais, and P. Bertelson, “Lateral differences in tachistoscopic recognition of bilaterally presented verbal material,” Acta Psychologica, vol. 39 (no. 5), pp. 369–76, Oct 1975. doi:10.1016/0001-6918(75)90028-1 B.W. Johnson, G. McArthur, M. Hautus, M. Reid, J. Brock, A. Castles, and S. Crain, “Lateralized auditory brain function in children with normal reading ability and in children with dyslexia,” Neuropsychologia, vol. 51 (no. 4), pp. 633–41, Mar 2013. J. Pujol, P. Vendrell, C. Junque, J.L. Marti-Vilalta, and A. Capdevila, “When does human brain development end? Evidence of corpus callosum growth up to adulthood,” Annals of Neurology, vol. 34 (no. 1), pp. 71–5, Jul 1993. doi:10.1002/ana.410340113 M.C. Stevens, “The developmental cognitive neuroscience of functional connectivity,” Brain and Cognition, vol. 70 (no. 1), pp. 1–12, Jun 2009. doi:10.1016/j.bandc.2008.12.009 L.P. Spear, “Adolescent neurodevelopment,” Journal of Adolescent Health, vol. 52 (no. 2 Suppl 2), pp. S7–13, Feb 2013. doi:10.1016/j.jadohealth.2012.05.006 S. Durston and B.J. Casey, “What have we learned about cognitive development from

References  85

[48]

[49]

[50] [51]

[52]

[53] [54] [55]

[56]

[57]

[58]

neuroimaging?,” Neuropsychologia, vol. 44 (no. 11), pp. 2149–57, 2006. doi:10.1016/j.neuro psychologia.2005.10.010 J.N. Porter, P.F. Collins, R.L. Muetzel, K.O. Lim, and M. Luciana, “Associations between cortical thickness and verbal fluency in childhood, adolescence, and young adulthood,” Neuro­ Image, vol. 55 (no. 4), pp. 1865–77, Apr 15 2011. doi:10.1016/j.neuroimage.2011.01.018 E. Fornari, M.G. Knyazeva, R. Meuli, and P. Maeder, “Myelination shapes functional activity in the developing brain,” NeuroImage, vol. 38 (no. 3), pp. 511–8, Nov 15 2007. doi:10.1016/j.neuroimage.2007.07.010 R.K. Lenroot and J.N. Giedd, “Sex differences in the adolescent brain,” Brain and Cogni­ tion, vol. 72 (no. 1), pp. 46–55, Feb 2010. doi:10.1016/j.bandc.2009.10.008 E.R. Sowell, B.S. Peterson, E. Kan, R.P. Woods, J. Yoshii, R. Bansal, D. Xu, H. Zhu, P.M. Thompson, and A.W. Toga, “Sex differences in cortical thickness mapped in 176 healthy individuals between 7 and 87 years of age,” Cerebral Cortex, vol. 17 (no. 7), pp. 1550–60, Jul 2007. doi:10.1093/cercor/bhl066 M. Hirshkowitz, K. Whiton, S.M. Albert, C. Alessi, O. Bruni, L. DonCarlos, N. Hazen, J. Herman, E. Katz, L. Kheirandish-Gozal, D.N. Neubauer, A.E. O’Donnell, M. Ohayon, J. Peever, R. Rawding, R. Sachdeva, B. Setters, M.V. Vitiello, J.C. Ware, and P.J. Adams Hillard, “National Sleep Foundation’s sleep time duration recommendations: methodology and results summary,” Sleep Health, vol. 1, pp. 40–43, 2015. A.J. Younger, S.A. Adler, and R. Vasta, Child Psychology: A Canadian Perspective, Third Edi­ tion: John Wiley & Sons Canada, Ltd., 2012. O.G. Jenni and M.A. Carskadon, “Spectral analysis of the sleep electroencephalogram during adolescence,” Sleep, vol. 27 (no. 4), pp. 774–83, Jun 15 2004. M.H. Hagenauer, J.I. Perryman, T.M. Lee, and M.A. Carskadon, “Adolescent changes in the homeostatic and circadian regulation of sleep,” Developmental Neuroscience, vol. 31 (no. 4), pp. 276–84, 2009. doi:10.1159/000216538 M.H. Hagenauer and T.M. Lee, “The neuroendocrine control of the circadian system: adolescent chronotype,” Frontiers in Neuroendocrinology, vol. 33 (no. 3), pp. 211–29, Aug 2012. doi:10.1016/j.yfrne.2012.04.003 J.K. Wyatt, A. Ritz-De Cecco, C.A. Czeisler, and D.J. Dijk, “Circadian temperature and melatonin rhythms, sleep, and neurobehavioral function in humans living on a 20-h day,” American Journal of Physiology, vol. 277 (no. 4, Pt 2), pp. R1152–63, Oct 1999. K.C. Wood, H. Smith, and D. Grossniklaus, “Piaget’s stages of cognitive development,” in Emerging Perspectives on Learning, Teaching, and Technology, M. Orey ed.: Association for Educational Communications and Technology, 2001.

86  Adolescent Brain Development

[59]

[60] [61]

[62]

[63]

[64]

[65]

[66]

[67]

[68]

[69]

J. Lowe, P.C. MacLean, M.L. Shaffer, and K. Watterberg, “Early working memory in children born with extremely low birth weight: assessed by object permanence,” Journal of Child Neurology, vol. 24 (no. 4), pp. 410–5, Apr 2009. doi:10.1177/0883073808324533 W.G. Perry, Forms of Intellectual and Ethical Development in the College Years: A Scheme: Jossey-Bass, 1998. D.J. Paulsen, M.L. Platt, S.A. Huettel, and E.M. Brannon, “Decision-making under risk in children, adolescents, and young adults,” Frontiers in Psychology, vol. 2, pp. 72, 2011. doi:10.3389/fpsyg.2011.00072 I.N. Defoe, J.S. Dubas, B. Figner, and M.A. van Aken, “A meta-analysis on age differences in risky decision making: Adolescents versus children and adults,” Psychological Bulletin, vol. 141 (no. 1), pp. 48–84, Jan 2015. doi:10.1037/a0038088 D.G. Smith, L. Xiao, and A. Bechara, “Decision making in children and adolescents: impaired Iowa Gambling Task performance in early adolescence,” Developmental Psychology, vol. 48 (no. 4), pp. 1180–7, Jul 2012. doi:10.1037/a0026342 M.A. Donati, A. Panno, F. Chiesi, and C. Primi, “A mediation model to explain decision making under conditions of risk among adolescents: the role of fluid intelligence and probabilistic reasoning,” Journal of Clinical and Experimental Neuropsychology, vol. 36 (no. 6), pp. 588–95, 2014. doi:10.1080/13803395.2014.918091 L.H. Somerville, R.M. Jones, and B.J. Casey, “A time of change: behavioral and neural correlates of adolescent sensitivity to appetitive and aversive environmental cues,” Brain and Cognition, vol. 72 (no. 1), pp. 124–33, Feb 2010. doi:10.1016/j.bandc.2009.07.003 L.R. Stroud, E. Foster, G.D. Papandonatos, K. Handwerger, D.A. Granger, K.T. Kivlighan, and R. Niaura, “Stress response and the adolescent transition: performance versus peer rejection stressors,” Developmental Psychopathology, vol. 21 (no. 1), pp. 47–68, Winter 2009. doi:10.1017/S0954579409000042 M.R. Gunnar, S. Wewerka, K. Frenn, J.D. Long, and C. Griggs, “Developmental changes in hypothalamus-pituitary-adrenal activity over the transition to adolescence: normative changes and associations with puberty,” Developmental Psychopathology, vol. 21 (no. 1), pp. 69–85, Winter 2009. doi:10.1017/S0954579409000054 K.M. Quevedo, S.D. Benning, M.R. Gunnar, and R.E. Dahl, “The onset of puberty: effects on the psychophysiology of defensive and appetitive motivation,” Developmen­ tal Psychopathology, vol. 21 (no. 1), pp. 27–45, Winter 2009. doi:10.1017/S09545794090 00030 J.S. Silk, G.J. Siegle, D.J. Whalen, L.J. Ostapenko, C.D. Ladouceur, and R.E. Dahl, “Pubertal changes in emotional information processing: pupillary, behavioral, and subjective

References  87

[70]

[71]

[72]

[73]

[74]

[75]

[76]

[77]

[78]

evidence during emotional word identification,” Developmental Psychopathology, vol. 21 (no. 1), pp. 7–26, Winter 2009. doi:10.1017/S0954579409000029 W.E. Moore, 3rd, J.H. Pfeifer, C.L. Masten, J.C. Mazziotta, M. Iacoboni, and M. Da­ pretto, “Facing puberty: associations between pubertal development and neural responses to affective facial displays,” Social Cognitive and Affective Neuroscience, vol. 7 (no. 1), pp. 35–43, Jan 2012. doi:10.1093/scan/nsr066 E.E. Forbes, M.L. Phillips, J.S. Silk, N.D. Ryan, and R.E. Dahl, “Neural systems of threat processing in adolescents: role of pubertal maturation and relation to measures of negative affect,” Developmental Neuropsychology, vol. 36 (no. 4), pp. 429–52, 2011. doi:10.1080/8756 5641.2010.550178 L.D. Wright, K.E. Hebert, and T.S. Perrot-Sinal, “Investigating adolescence as a sensitive period for stress response programming,” in Psychoneuroendocrinology Research Trends, M. T. Czerbska ed.: Nova Publishers, 2007. L.D. Wright, K.E. Muir, and T.S. Perrot, “Stress responses of adolescent male and female rats exposed repeatedly to cat odor stimuli, and long-term enhancement of adult defensive behaviors,” Developmental Psychobiology, vol. 55 (no. 5), pp. 551–67, Jul 2013. doi:10.1002 /dev.21060 D.K. Eaton, L. Kann, S. Kinchen, J. Ross, J. Hawkins, W.A. Harris, R. Lowry, T. McManus, D. Chyen, S. Shanklin, C. Lim, J.A. Grunbaum, and H. Wechsler, “Youth risk behavior surveillance—United States, 2005,” The Journal of   School Health, vol. 76 (no. 7), pp. 353–72, Sep 2006. doi:10.1111/j.1746-1561.2006.00127.x M.G. Hardin, E. Schroth, D.S. Pine, and M. Ernst, “Incentive-related modulation of cognitive control in healthy, anxious, and depressed adolescents: development and psychopathology related differences,” Journal of Child Psychology and Psychiatry, and Allied Disciplines, vol. 48 (no. 5), pp. 446–54, May 2007. doi:10.1111/j.1469-7610.2006.01722.x S. Jazbec, M.G. Hardin, E. Schroth, E. McClure, D.S. Pine, and M. Ernst, “Age-related influence of contingencies on a saccade task,” Experimental Brain Research, vol. 174 (no. 4), pp. 754–62, Oct 2006. doi:10.1007/s00221-006-0520-9 S. Urosevic, P. Collins, R. Muetzel, K. Lim, and M. Luciana, “Longitudinal changes in be­­ havioral approach system sensitivity and brain structures involved in reward processing during adolescence,” Developmental Pyschology, vol. 48 (no. 5), pp. 1488–500, Sep 2012. E. Cauffman, E.P. Shulman, L. Steinberg, E. Claus, M.T. Banich, S. Graham, and J. Woolard, “Age differences in affective decision making as indexed by performance on the Iowa Gambling Task,” Developmental Pyschology, vol. 46 (no. 1), pp. 193–207, Jan 2010. doi:10.1037/a0016128

88  Adolescent Brain Development

[79]

[80]

[81]

[82]

[83]

[84]

[85]

[86]

[87] [88]

U. Rao, T. Sidhartha, K.R. Harker, A.S. Bidesi, L.A. Chen, and M. Ernst, “Relationship between adolescent risk preferences on a laboratory task and behavioral measures of risk-taking,” Journal of  Adolescent Health, vol. 48 (no. 2), pp. 151–8, Feb 2011. doi:10.1016 /j.jadohealth.2010.06.008 S. Urosevic, P. Collins, R. Muetzel, K.O. Lim, and M. Luciana, “Pubertal status associations with reward and threat sensitivities and subcortical brain volumes during adolescence,” Brain and Cognition, vol. 89, pp. 15–26, Aug 2014. L.D. Wright, K.E. Muir, and T.S. Perrot, “Enhanced stress responses in adolescent versus adult rats exposed to cues of predation threat, and peer interaction as a predictor of adult defensiveness,” Developmental Psychobiology, vol. 54 (no. 1), pp. 47–69, Jan 2012. doi:10 .1002/dev.20575 C.M. McCormick and I.Z. Mathews, “HPA function in adolescence: role of sex hormones in its regulation and the enduring consequences of exposure to stressors,” Pharmacology, Biochemistry, and Behavior, vol. 86 (no. 2), pp. 220–33, Feb 2007. doi:10.1016/j.pbb.2006 .07.012 R.D. Romeo, S.J. Lee, and B.S. McEwen, “Differential stress reactivity in intact and ovariectomized prepubertal and adult female rats,” Neuroendocrinology, vol. 80 (no. 6), pp. 387– 93, 2004. doi:10.1159/000084203 R.D. Romeo, I.N. Karatsoreos, and B.S. McEwen, “Pubertal maturation and time of day differentially affect behavioral and neuroendocrine responses following an acute stressor,” Hormones and Behavior, vol. 50 (no. 3), pp. 463–8, Sep 2006. doi:10.1016/j.yhbeh.2006 .06.002 L.D. Wright, K.E. Hebert, and T.S. Perrot-Sinal, “Periadolescent stress exposure exerts long-term effects on adult stress responding and expression of prefrontal dopamine receptors in male and female rats,” Psychoneuroendocrinology, vol. 33 (no. 2), pp. 130–42, Feb 2008. doi:10.1016/j.psyneuen.2007.10.009 K. Panwar, H.J. Rutherford, W.E. Mencl, C.M. Lacadie, M.N. Potenza, and L.C. Mayes, “Differential associations between impulsivity and risk-taking and brain activations underlying working memory in adolescents,” Addictive Behaviors, vol. 39 (no. 11), pp. 1606–21, Nov 2014. doi:10.1016/j.addbeh.2013.12.007 L.P. Spear, “Adolescent brain development and animal models,” Annals of the New York Academy of Science, vol. 1021, pp. 23–6, Jun 2004. doi:10.1196/annals.1308.002 E.B. Falk, C.N. Cascio, M.B. O’Donnell, J. Carp, F.J. Tinney, Jr., C.R. Bingham, J.T. Shope, M.C. Ouimet, A.K. Pradhan, and B.G. Simons-Morton, “Neural responses to exclusion predict susceptibility to social influence,” Journal of  Adolescent Health, vol. 54 (no. 5 Suppl), pp. S22–31, May 2014. doi:10.1016/j.jadohealth.2013.12.035

References  89

[89]

J.M. Bjork, A.R. Smith, G. Chen, and D.W. Hommer, “Adolescents, adults and rewards: comparing motivational neurocircuitry recruitment using fMRI,” PloS One, vol. 5 (no. 7), pp. e11440, 2010. doi:10.1371/journal.pone.0011440 [90] C. Geier and B. Luna, “The maturation of incentive processing and cognitive control,” Pharmacology, Biochemistry, and Behavior, vol. 93 (no. 3), pp. 212–21, Sep 2009. doi:10 .1016/j.pbb.2009.01.021 [91] J.M. Richards, R.C. Plate, and M. Ernst, “Neural systems underlying motivated behavior in adolescence: implications for preventive medicine,” Preventive Medicine, vol. 55 Suppl, pp. S7–S16, Nov 2012. doi:10.1016/j.ypmed.2011.11.016 [92] K.C. Sonntag, H.C. Brenhouse, N. Freund, B.S. Thompson, M. Puhl, and S.L. Andersen, “Viral over-expression of D1 dopamine receptors in the prefrontal cortex increase high-risk behaviors in adults: comparison with adolescents,” Psychopharmacology (Berl), vol. 231 (no. 8), pp. 1615–26, Apr 2014. doi:10.1007/s00213-013-3399-8 [93] J.L. Shepherd, D.J. Lane, R.L. Tapscott, and D.A. Gentile, “Susceptible to social influence: risky “driving” in response to peer pressure,” Journal of Applied Social Psychology, vol. 41 (no. 4), pp. 773–98, 2011. doi:10.1111/j.1559-1816.2011.00735.x [94] S.J. Dickman, “Functional and dysfunctional impulsivity: personality and cognitive correlates,” Journal of  Personality and Social Psychology, vol. 58 (no. 1), pp. 95–102, Jan 1990. doi:10.1037/0022-3514.58.1.95 [95] A. Ralph, “Measuring peer interactions using the adolescent social interaction profile,” Journal of  Applied Developmental Psychology, vol. 18 (no. 1), pp. 71–86, 1997. doi:10.1016 /S0193-3973(97)90015-0 [96] B. Platt, K. Cohen Kadosh, and J.Y. Lau, “The role of peer rejection in adolescent depression,” Depression and Anxiety, vol. 30 (no. 9), pp. 809–21, Sep 2013. doi:10.1002/da.22120 [97] M.J. Prinstein and J.W. Aikins, “Cognitive moderators of the longitudinal association between peer rejection and adolescent depressive symptoms,” Journal of  Abnormal Child Psy­ chology, vol. 32 (no. 2), pp. 147–58, Apr 2004. doi:10.1023/B:JACP.0000019767.55592.63 [98] F. Stenseng, J. Belsky, V. Skalicka, and L. Wichstrom, “Preschool social exclusion, aggression, and cooperation: a longitudinal evaluation of the need-to-belong and the socialre­connection hypotheses,” Personality & Social Psychology Bulletin, vol. 40 (no. 12), pp. 1637– 47, Dec 2014. doi:10.1177/0146167214554591 [99] H. Pharo, J. Gross, R. Richardson, and H. Hayne, “Age-related changes in the effect of ostracism,” Social Influence, vol. 6 (no. 1), pp. 22–38, 2011. doi:10.1080/15534510.2010 .525852 [100] C.F. Saylor, S.A. Nida, K.D. Williams, L.A. Taylor, W. Smyth, K.A. Twyman, M.M. Macias, and E.G. Spratt, “Bullying and ostracism screening scales (BOSS): Development

90  Adolescent Brain Development

[101] [102]

[103]

[104]

[105]

[106]

[107]

[108]

[109] [110]

[111]

and applications,” Children’s Health Care, vol. 41 (no. 4), pp. 322–43, 2012. doi:10.1080 /02739615.2012.720962 R. Simmons, Odd Girl Out: The Hidden Culture of  Aggression in Girls, Wilmington: Mariner Books, 2011. M. Zimmer-Gembeck, R.E. Pronk, B. Goodwin, S. Mastro, and N. Crick, “Connected and isolated victims of relational aggression: Associations with peer group status and differences between girls and boys,” Sex Roles, vol. 68 (no. 5), pp. 363–77, 2013. doi:10.1007 /s11199-012-0239-y K. Jonkmann, U. Trautwein, and O. Ludtke, “Social dominance in adolescence: the moderating role of the classroom context and behavioral heterogeneity,” Child Development, vol. 80 (no. 2), pp. 338–55, Mar  –Apr 2009. doi:10.1111/j.1467-8624.2009.01264.x A.P. Williford, D. Brisson, K.A. Bender, J.M. Jenson, and S. Forrest-Bank, “Patterns of aggressive behavior and peer victimization from childhood to early adolescence: a latent class analysis,” Journal of   Youth and Adolescence, vol. 40 (no. 6), pp. 644–55, Jun 2011. doi:10 .1007/s10964-010-9583-9 K.A. Rosvall, “Proximate perspectives on the evolution of female aggression: good for the gander, good for the goose?,” Philosophical transactions of the Royal Society of   London. Series B, Biological Sciences, vol. 368 (no. 1631), pp. 20130083, 2013. doi:10.1098/rstb.2013.0083 A.D. Pellegrini, C.M. Bohn-Gettler, D. Dupuis, M. Hickey, C. Roseth, and D. Solberg, “An empirical examination of sex differences in scoring preschool children’s aggression,” Journal of   Experimental Child Psychology, vol. 109 (no. 2), pp. 232–8, Jun 2011. D.F. Hay, “The gradual emergence of sex differences in aggression: alternative hypotheses,” Psychological Medicine, vol. 37 (no. 11), pp. 1527–37, Nov 2007. doi:10.1017/S0033 291707000165 D.A. Kreager and J. Staff, “The Sexual Double Standard and Adolescent Peer Acceptance,” Social Psychology Quarterly, vol. 72 (no. 2), pp. 143–164, Jun 2009. doi:10.1177/019027250 907200205 K.A. Kuvalanka, L.A. Leslie, and R. Radina, “Coping with sexual stigma,” Journal of   Ado­ lescent Research, vol. 29 (no. 2), pp. 241–70, 2014. M.K. Underwood, L.H. Rosen, D. More, S.E. Ehrenreich, and J.K. Gentsch, “The BlackBerry project: capturing the content of adolescents’ text messaging,” Developmental Pyschol­ ogy, vol. 48 (no. 2), pp. 295–302, Mar 2012. M.D. Seery, E.A. Holman, and R.C. Silver, “Whatever does not kill us: cumulative lifetime adversity, vulnerability, and resilience,” Journal of Personality and Social Psychology, vol. 99 (no. 6), pp. 1025–41, Dec 2010. doi:10.1037/a0021344

References  91

[112] S. Jackson, M. Born, and M.N. Jacob, “Reflections on risk and resilience in adolescence,” Journal of   Adolescence, vol. 20 (no. 6), pp. 609–16, Dec 1997. doi:10.1006/jado.1997.0114 [113] A.J. Hunter and G.E. Chandler, “Adolescent resilience,” Image—The Journal of Nursing Scholarship, vol. 31 (no. 3), pp. 243–7, 1999. doi:10.1111/j.1547-5069.1999.tb00488.x [114] P. Aden, I. Goverud, K. Liestol, E.M. Loberg, R.E. Paulsen, J. Maehlen, and J. Lomo, “Low-potency glucocorticoid hydrocortisone has similar neurotoxic effects as high-potency glucocorticoid dexamethasone on neurons in the immature chicken cerebellum,” Brain Re­ search, vol. 1236, pp. 39–48, Oct 21 2008. doi:10.1016/j.brainres.2008.07.095 [115] J. Lu, D. Goula, N. Sousa, and O.F. Almeida, “Ionotropic and metabotropic glutamate re­­ ceptor mediation of glucocorticoid-induced apoptosis in hippocampal cells and the neuroprotective role of synaptic N-methyl-D-aspartate receptors,” Neuroscience, vol. 121 (no. 1), pp. 123–31, 2003. doi:10.1016/S0306-4522(03)00421-4 [116] M.D. Seery, “Challenge or threat? Cardiovascular indexes of resilience and vulnerability to potential stress in humans,” Neuroscience & Biobehavioral Reviews, vol. 35 (no. 7), pp. 1603– 10,  Jun 2011. doi:10.1016/j.neubiorev.2011.03.003 [117] E. McCrory, S.A. De Brito, and E. Viding, “Research review: the neurobiology and genetics of maltreatment and adversity,” Journal of Child Psychology and Psychiatry, and Allied Disci­ plines, vol. 51 (no. 10), pp. 1079–95, Oct 2010. doi:10.1111/j.1469-7610.2010.02271.x [118] A. Feder, E.J. Nestler, and D.S. Charney, “Psychobiology and molecular genetics of resilience,” Nature Reviews Neuroscience, vol. 10 (no. 6), pp. 446–57, Jun 2009. doi:10.1038 /nrn2649 [119] D.D. Francis and M.J. Meaney, “Maternal care and the development of stress responses,” Current Opinion in Neurobiology, vol. 9 (no. 1), pp. 128–34, Feb 1999. doi:10.1016/S0959 -4388(99)80016-6 [120] S.R. Kaler and B.J. Freeman, “Analysis of environmental deprivation: cognitive and social development in Romanian orphans,” Journal of Child Psychology and Psychiatry, and Allied Disciplines, vol. 35 (no. 4), pp. 769–81, May 1994. doi:10.1111/j.1469-7610.1994 .tb01220.x [121] H.T. Chugani, M.E. Behen, O. Muzik, C. Juhasz, F. Nagy, and D.C. Chugani, “Local brain functional activity following early deprivation: a study of postinstitutionalized Romanian orphans,” NeuroImage, vol. 14 (no. 6), pp. 1290–301, Dec 2001. doi:10.1006 /nimg.2001.0917 [122] S. Macri, G.J. Mason, and H. Wurbel, “Dissociation in the effects of neonatal maternal separations on maternal care and the offspring’s HPA and fear responses in rats,” European Journal of   Neuroscience, vol. 20 (no. 4), pp. 1017–24, Aug 2004.

92  Adolescent Brain Development

[123] S. Macri and H. Wurbel, “Developmental plasticity of HPA and fear responses in rats: a critical review of the maternal mediation hypothesis,” Hormones and Behavior, vol. 50 (no. 5), pp. 667–80, Dec 2006. doi:10.1016/j.yhbeh.2006.06.015 [124] L. Suo, L. Zhao, J. Si, J. Liu, W. Zhu, B. Chai, Y. Zhang, J. Feng, Z. Ding, Y. Luo, H. Shi, J. Shi, and L. Lu, “Predictable chronic mild stress in adolescence increases resilience in adult­­ hood,” Neuropsychopharmacology, vol. 38 (no. 8), pp. 1387–400, Jul 2013. doi:10.1038/npp .2013.67 [125] S. Drapeau, M.C. Saint-Jacques, R. Lepine, G. Begin, and M. Bernard, “Processes that contribute to resilience among youth in foster care,” Journal of Adolescence, vol. 30 (no. 6), pp. 977–99, Dec 2007. doi:10.1016/j.adolescence.2007.01.005 [126] L. Rozemberg, J. Avanci, M. Schenker, and T. Pires, “[Resilience, gender and family during adolescence],” Ciencia & Saude Coletiva, vol. 19 (no. 3), pp. 673–84, Mar 2014. [127] N.R. Leonard, M.V. Gwadz, C.M. Cleland, P.C. Vekaria, and B. Ferns, “Maternal substance use and HIV status: adolescent risk and resilience,” Journal of  Adolescence, vol. 31 (no. 3), pp. 389–405, Jun 2008. doi:10.1016/j.adolescence.2007.07.001 [128] M.H. Hagenauer and T.M. Lee, “Adolescent sleep patterns in humans and laboratory animals,” Hormones and Behavior, vol. 64 (no. 2), pp. 270–9, Jul 2013. doi:10.1016 /j.yhbeh.2013.01.013 [129] T. Roenneberg, T. Kuehnle, P.P. Pramstaller, J. Ricken, M. Havel, A. Guth, and M. Merrow, “A marker for the end of adolescence,” Current Biology : CB, vol. 14 (no. 24), pp. R1038–9, Dec 29 2004. doi:10.1016/j.cub.2004.11.039 [130] M. Gradisar, G. Gardner, and H. Dohnt, “Recent worldwide sleep patterns and problems during adolescence: a review and meta-analysis of age, region, and sleep,” Sleep Medicine, vol. 12 (no. 2), pp. 110–8, Feb 2011. doi:10.1016/j.sleep.2010.11.008 [131] M.A. Carskadon, “Sleep in adolescents: the perfect storm,” Pediatric Clinics of   North Amer­ ica, vol. 58 (no. 3), pp. 637–47, Jun 2011. doi:10.1016/j.pcl.2011.03.003 [132] M.A. Carskadon, K. Harvey, P. Duke, T.F. Anders, I.F. Litt, and W.C. Dement, “Pubertal changes in daytime sleepiness,” Sleep, vol. 2 (no. 4), pp. 453–60, 1980. [133] M.A. Carskadon and C. Acebo, “Regulation of sleepiness in adolescents: update, insights, and speculation,” Sleep, vol. 25 (no. 6), pp. 606–14, Sep 15 2002. [134] F.C. Baker, S.R. Turlington, and I. Colrain, “Developmental changes in the sleep electroencephalogram of adolescent boys and girls,” Journal of Sleep Research, vol. 21 (no. 1), pp. 59–67, Feb 2012. doi:10.1111/j.1365-2869.2011.00930.x [135] A. Buchmann, M. Ringli, S. Kurth, M. Schaerer, A. Geiger, O.G. Jenni, and R. Huber, “EEG sleep slow-wave activity as a mirror of cortical maturation,” Cereb Cortex, vol. 21 (no. 3), pp. 607–15, Mar 2011. doi:10.1093/cercor/bhq129

References  93

[136] H. Gaudreau, J. Carrier, and J. Montplaisir, “Age-related modifications of NREM sleep EEG: from childhood to middle age,” Journal of Sleep Research, vol. 10 (no. 3), pp. 165–72, Sep 2001. doi:10.1046/j.1365-2869.2001.00252.x [137] C. Cirelli, R. Huber, A. Gopalakrishnan, T.L. Southard, and G. Tononi, “Locus ceruleus control of slow-wave homeostasis,” Journal of Neuroscience vol. 25 (no. 18), pp. 4503–11, May 4 2005. doi:10.1523/JNEUROSCI.4845-04.2005 [138] C. Schmidt, F. Collette, Y. Leclercq, V. Sterpenich, G. Vandewalle, P. Berthomier, C. Berthomier, C. Phillips, G. Tinguely, A. Darsaud, S. Gais, M. Schabus, M. Desseilles, T.T. Dang-Vu, E. Salmon, E. Balteau, C. Degueldre, A. Luxen, P. Maquet, C. Cajochen, and P. Peigneux, “Homeostatic sleep pressure and responses to sustained attention in the suprachiasmatic area,” Science, vol. 324 (no. 5926), pp. 516–9, Apr 24 2009. doi:10.1126/science .1167337 [139] M.E. Carter, J. Brill, P. Bonnavion, J.R. Huguenard, R. Huerta, and L. de Lecea, “Mechanism for Hypocretin-mediated sleep-to-wake transitions,” Proceedings of the National Acad­ emy of Sciene USA, vol. 109 (no. 39), pp. E2635–44, Sep 25 2012. doi:10.1073/pnas.12025 26109 [140] R.C. Choudhary, M.A. Khanday, A. Mitra, and B.N. Mallick, “Perifornical orexinergic neu­­ rons modulate REM sleep by influencing locus coeruleus neurons in rats,” Neuroscience, vol. 279, pp. 33–43, Oct 24 2014. doi:10.1016/j.neuroscience.2014.08.017 [141] C. Cirelli and G. Tononi, “Locus ceruleus control of state-dependent gene expression,” Journal of   Neuroscience, vol. 24 (no. 23), pp. 5410–9, Jun 9 2004. doi:10.1523/JNEUROSCI .0949-04.2004 [142] C. Guilding and H.D. Piggins, “Challenging the omnipotence of the suprachiasmatic timekeeper: are circadian oscillators present throughout the mammalian brain?,” European Jour­ nal of   Neurosciemce, vol. 25 (no. 11), pp. 3195–216, Jun 2007. [143] C. Girardet, D. Becquet, M.P. Blanchard, A.M. Francois-Bellan, and O. Bosler, “Neuroglial and synaptic rearrangements associated with photic entrainment of the circadian clock in the suprachiasmatic nucleus,” European Journal of  Neuroscience, vol. 32 (no. 12), pp. 2133–42, Dec 2010. doi:10.1111/j.1460-9568.2010.07520.x [144] P.J. DeCoursey, J.R. Krulas, G. Mele, and D.C. Holley, “Circadian performance of suprachiasmatic nuclei (SCN)-lesioned antelope ground squirrels in a desert enclosure,” Physiol­ ogy & Behavior, vol. 62 (no. 5), pp. 1099–108, Nov 1997. [145] I.V. Zhdanova, K. Masuda, S.V. Bozhokin, D.L. Rosene, J. Gonzalez-Martinez, S. Schettler, and E. Samorodnitsky, “Familial circadian rhythm disorder in the diurnal primate, Macaca mulatta,” PloS One, vol. 7 (no. 3), pp. e33327, 2012. doi:10.1371/journal.pone.0033327 [146] M. Angeles-Castellanos, R. Salgado-Delgado, K. Rodriguez, R.M. Buijs, and C. Escobar,

94  Adolescent Brain Development

[147]

[148]

[149]

[150]

[151]

[152]

[153]

[154]

[155]

[156]

“The suprachiasmatic nucleus participates in food entrainment: a lesion study,” Neuroscience, vol. 165 (no. 4), pp. 1115–26, Feb 17 2010. doi:10.1016/j.neuroscience.2009.11.061 M. Ohtsuka-Isoya, H. Hayashi, and H. Shinoda, “Effect of suprachiasmatic nucleus lesion on circadian dentin increment in rats,” American Journal of   Physiology. Regulatory, Integrative and Comparative Physiology, vol. 280 (no. 5), pp. R1364–70, May 2001. B. Bingham, K. McFadden, X. Zhang, S. Bhatnagar, S. Beck, and R. Valentino, “Early a­dolescence as a critical window during which social stress distinctly alters behavior and brain norepinephrine activity,” Neuropsychopharmacology, vol. 36 (no. 4), pp. 896–909, Mar 2011. doi:10.1038/npp.2010.229 Q. Rainer, S. Speziali, T. Rubino, S. Dominguez-Lopez, F.R. Bambico, G. Gobbi, and D. Parolaro, “Chronic nandrolone decanoate exposure during adolescence affects emotional behavior and monoaminergic neurotransmission in adulthood,” Neuropharmacology, vol. 83, pp. 79–88, Aug 2014. doi:10.1016/j.neuropharm.2014.03.015 E.M. Marco, T. Rubino, W. Adriani, M.P. Viveros, D. Parolaro, and G. Laviola, “Longterm consequences of URB597 administration during adolescence on cannabinoid CB1 receptor binding in brain areas,” Brain Research, vol. 1257, pp. 25–31, Feb 27 2009. doi:10 .1016/j.brainres.2008.12.037 D.F. Swaab, M.A. Hofman, and M.B. Honnebier, “Development of vasopressin neurons in the human suprachiasmatic nucleus in relation to birth,” Developmental Brain Research, vol. 52 (no. 1–2), pp. 289–93, Mar 1 1990. doi:10.1016/0165-3806(90)90247-V D.F. Swaab, J.N. Zhou, T. Ehlhart, and M.A. Hofman, “Development of   vasoactive intestinal polypeptide neurons in the human suprachiasmatic nucleus in relation to birth and sex,” Developmental Brain Research, vol. 79 (no. 2), pp. 249–59, Jun 17 1994. doi:10.1016 /0165-3806(94)90129-5 M.A. Hofman, J.S. Purba, and D.F. Swaab, “Annual variations in the vasopressin neuron population of the human suprachiasmatic nucleus,” Neuroscience, vol. 53 (no. 4), pp. 1103– 12, Apr 1993. doi:10.1016/0306-4522(93)90493-Y M.A. Hofman and D.F. Swaab, “Diurnal and seasonal rhythms of neuronal activity in the suprachiasmatic nucleus of humans,” Journal of Biological Rhythms, vol. 8 (no. 4), pp. 283– 95, Winter 1993. doi:10.1177/074873049300800402 T.M. Lee, D.L. Hummer, T.J. Jechura, and M.M. Mahoney, “Pubertal development of sex differences in circadian function: an animal model,” Annals of the New York Academy of Sci­ ence, vol. 1021, pp. 262–75, Jun 2004. doi:10.1196/annals.1308.031 D.F. Swaab and M.A. Hofman, “Age, sex and light: variability in the human suprachiasmatic nucleus in relation to its functions,” Progress in Brain Research, vol. 100, pp. 261–5, 1994. doi:10.1016/S0079-6123(08)60793-1

References  95

[157] S. Kutcher, P. Williamson, P. Marton, and J. Szalai, “REM latency in endogenously depressed adolescents,” The British Journal of   Psychiatry: The Journal of   Mental Science, vol. 161, pp. 399–402, Sep 1992. doi:10.1192/bjp.161.3.399 [158] D.E. Williamson, R.E. Dahl, B. Birmaher, R.R. Goetz, B. Nelson, and N.D. Ryan, “Stressful life events and EEG sleep in depressed and normal control adolescents,” Biological Psy­ chiatry, vol. 37 (no. 12), pp. 859–65, Jun 15 1995. doi:10.1016/0006-3223(94)00240-4 [159] R.E. Dahl, N.D. Ryan, M.K. Matty, B. Birmaher, M. al-Shabbout, D.E. Williamson, and D.J. Kupfer, “Sleep onset abnormalities in depressed adolescents,” Biological Psychiatry, vol. 39 (no. 6), pp. 400–10, Mar 15 1996. doi:10.1016/0006-3223(95)00190-5 [160] U. Rao, R.E. Dahl, N.D. Ryan, B. Birmaher, D.E. Williamson, R. Rao, and J. Kaufman, “Heterogeneity in EEG sleep findings in adolescent depression: unipolar versus bipolar clinical course,” Journal of   Affective Disorders, vol. 70 (no. 3), pp. 273–80, Aug 2002. doi:10.1016/S0165-0327(01)00396-2 [161] R.L. Morehouse, V. Kusumakar, S.P. Kutcher, J. LeBlanc, and R. Armitage, “Temporal coherence in ultradian sleep EEG rhythms in a never-depressed, high-risk cohort of female adolescents,” Biological Psychiatry, vol. 51 (no. 6), pp. 446–56, Mar 15 2002. doi:10 .1016/S0006-3223(01)01297-5 [162] B.D. Peters, P.R. Szeszko, J. Radua, T. Ikuta, P. Gruner, P. DeRosse, J.P. Zhang, A. Giorgio, D. Qiu, S.F. Tapert, J. Brauer, M.R. Asato, P.L. Khong, A.C. James, J.A. Gallego, and A.K. Malhotra, “White matter development in adolescence: diffusion tensor imaging and meta-analytic results,” Schizophrenia Bulletin, vol. 38 (no. 6), pp. 1308–17, Nov 2012. doi:10.1093/schbul/sbs054 [163] R.K. Sigaard, M. Kjaer, and B. Pakkenberg, “Development of the Cell Population in the Brain White Matter of   Young Children,” Cereb Cortex, Aug 13 2014. doi:10.1093/cercor /bhu178 [164] P. Hagmann, O. Sporns, N. Madan, L. Cammoun, R. Pienaar, V.J. Wedeen, R. Meuli, J.P. Thiran, and P.E. Grant, “White matter maturation reshapes structural connectivity in the late developing human brain,” Proceedings of the National Academy of Sciene USA, vol. 107 (no. 44), pp. 19067–72, Nov 2 2010. doi:10.1073/pnas.1009073107 [165] R.D. Fields, “White matter in learning, cognition and psychiatric disorders,” Trends in Neu­ rosciences, vol. 31 (no. 7), pp. 361–70, Jul 2008. doi:10.1016/j.tins.2008.04.001 [166] L. Menzies, A.L. Goddings, K.J. Whitaker, S.J. Blakemore, and R.M. Viner, “The effects of puberty on white matter development in boys,” Developmental Cognitive Neuroscience, Oct 22 2014. doi:10.1016/j.dcn.2014.10.002 [167] E. Koechlin, G. Basso, P. Pietrini, S. Panzer, and J. Grafman, “The role of the anterior prefrontal cortex in human cognition,” Nature, vol. 399 (no. 6732), pp. 148–51, May 13 1999.

96  Adolescent Brain Development

[168] M. Donoso, A.G. Collins, and E. Koechlin, “Human cognition. Foundations of human reasoning in the prefrontal cortex,” Science, vol. 344 (no. 6191), pp. 1481–6, Jun 27 2014. doi:10.1126/science.1252254 [169] C. Xi, Y. Zhu, C. Niu, C. Zhu, T.M. Lee, Y. Tian, and K. Wang, “Contributions of subregions of the prefrontal cortex to the theory of mind and decision making,” Behavioural Brain Research, vol. 221 (no. 2), pp. 587–93, Aug 10 2011. doi:10.1016/j.bbr.2010.09.031 [170] J. Loughead, E.P. Wileyto, K. Ruparel, M. Falcone, R. Hopson, R. Gur, and C. Lerman, “Working Memory-Related Neural Activity Predicts Future Smoking Relapse,” Neuropsy­ chopharmacology, Dec 3 2014. doi:10.1038/npp.2014.318 [171] J.B. Smaers, J. Steele, C.R. Case, A. Cowper, K. Amunts, and K. Zilles, “Primate prefrontal cortex evolution: human brains are the extreme of a lateralized ape trend,” Brain, Behavior and Evolution, vol. 77 (no. 2), pp. 67–78, 2011. doi:10.1159/000323671 [172] C.S. Weickert, M.J. Webster, P. Gondipalli, D. Rothmond, R.J. Fatula, M.M. Herman, J.E. Kleinman, and M. Akil, “Postnatal alterations in dopaminergic markers in the human prefrontal cortex,” Neuroscience, vol. 144 (no. 3), pp. 1109–19, Feb 9 2007. doi:10.1016 /j.neuroscience.2006.10.009 [173] M.H. Teicher, S.L. Andersen, and J.C. Hostetter, Jr., “Evidence for dopamine receptor pruning between adolescence and adulthood in striatum but not nucleus accumbens,” De­ velopmental Brain Research, vol. 89 (no. 2), pp. 167–72, Nov 21 1995. doi:10.1016/0165 -3806(95)00109-Q [174] S.L. Andersen and M.H. Teicher, “Sex differences in dopamine receptors and their relevance to ADHD,” Neuroscience & Biobehavioral Reviews, vol. 24 (no. 1), pp. 137–41, Jan 2000. doi:10.1016/S0149-7634(99)00044-5 [175] S.L. Andersen, A.T. Thompson, M. Rutstein, J.C. Hostetter, and M.H. Teicher, “Dopamine receptor pruning in prefrontal cortex during the periadolescent period in rats,” Syn­ apse, vol. 37 (no. 2), pp. 167–9, Aug 2000. doi:10.1002/1098-2396(200008)37:2%3C167:: AID-SYN11%3E3.0.CO;2-B [176] S. Karlsson, A. Rieckmann, P. Karlsson, L. Farde, L. Nyberg, and L. Backman, “Relationship of dopamine D1 receptor binding in striatal and extrastriatal regions to cognitive functioning in healthy humans,” NeuroImage, vol. 57 (no. 2), pp. 346–51, Jul 15 2011. doi:10.1016/j.neuroimage.2011.04.047 [177] A. Abu-Akel and S. Shamay-Tsoory, “Neuroanatomical and neurochemical bases of theory of mind,” Neuropsychologia, vol. 49 (no. 11), pp. 2971–84, Sep 2011. doi:10.1016/j.neuro psychologia.2011.07.012 [178] Y. Dauvilliers, M. Tafti, and H.P. Landolt, “Catechol-O-methyltransferase, dopamine, and sleep-wake regulation,” Sleep Medicine Reviews, Oct 27 2014.

References  97

[179] R. Mizrahi, I. Suridjan, M. Kenk, T.P. George, A. Wilson, S. Houle, and P. Rusjan, “Dopamine response to psychosocial stress in chronic cannabis users: a PET study with [11C]-+PHNO,” Neuropsychopharmacology, vol. 38 (no. 4), pp. 673–82, Mar 2013. doi:10.1038 /npp.2012.232 [180] I. Suridjan, I. Boileau, M. Bagby, P.M. Rusjan, A.A. Wilson, S. Houle, and R. Mizrahi, “Dopamine response to psychosocial stress in humans and its relationship to individual differences in personality traits,” Journal of Psychiatric Research, vol. 46 (no. 7), pp. 890–7, Jul 2012. doi:10.1016/j.jpsychires.2012.03.009 [181] R. Ventura, S. Cabib, and S. Puglisi-Allegra, “Opposite genotype-dependent mesocorticolimbic dopamine response to stress,” Neuroscience, vol. 104 (no. 3), pp. 627–31, 2001. doi:10.1016/S0306-4522(01)00160-9 [182] A. Padmanabhan and B. Luna, “Developmental imaging genetics: linking dopamine function to adolescent behavior,” Brain and Cognition, vol. 89, pp. 27–38, Aug 2014. doi:10 .1016/j.bandc.2013.09.011 [183] M. Kathleen Holmes, C.E. Bearden, M. Barguil, M. Fonseca, E. Serap Monkul, F.G. Nery, J.C. Soares, J. Mintz, and D.C. Glahn, “Conceptualizing impulsivity and risk taking in bipolar disorder: importance of history of alcohol abuse,” Bipolar Disorders, vol. 11 (no. 1), pp. 33–40, Feb 2009. doi:10.1111/j.1399-5618.2008.00657.x [184] S. Qin, C.B. Young, K. Supekar, L.Q. Uddin, and V. Menon, “Immature integration and segregation of emotion-related brain circuitry in young children,” Proceedings of the National Academy of Sciene USA, vol. 109 (no. 20), pp. 7941–6, May 15 2012. [185] C. Herbert, B.M. Herbert, and P. Pauli, “Emotional self-reference: brain structures involved in the processing of words describing one’s own emotions,” Neuropsychologia, vol. 49 (no. 10), pp. 2947–56, Aug 2011. doi:10.1016/j.neuropsychologia.2011.06.026 [186] S. Ursu, A.M. Kring, M.G. Gard, M.J. Minzenberg, J.H. Yoon, J.D. Ragland, M. Solomon, and C.S. Carter, “Prefrontal cortical deficits and impaired cognition-emotion interactions in schizophrenia,” American Journal of Psychiatry, vol. 168 (no. 3), pp. 276–85, Mar 2011. [187] J. Binder, D.J. de Quervain, M. Friese, R. Luechinger, P. Boesiger, and B. Rasch, “Emotion suppression reduces hippocampal activity during successful memory encoding,” Neuro­ Image, vol. 63 (no. 1), pp. 525–32, Oct 15 2012. doi:10.1016/j.neuroimage.2012.07.007 [188] M. Fastenrath, D. Coynel, K. Spalek, A. Milnik, L. Gschwind, B. Roozendaal, A. Papassotiropoulos, and D.J. de Quervain, “Dynamic modulation of amygdala-hippocampal connectivity by emotional arousal,” Journal of Neurosci, vol. 34 (no. 42), pp. 13935–47, Oct 15 2014. doi:10.1523/JNEUROSCI.0786-14.2014 [189] R.N. Cardinal, J.A. Parkinson, J. Hall, and B.J. Everitt, “Emotion and motivation: the role

98  Adolescent Brain Development

[190]

[191]

[192]

[193]

[194]

[195]

[196]

[197]

[198]

[199]

of the amygdala, ventral striatum, and prefrontal cortex,” Neuroscience & Biobehavioral Re­ views, vol. 26 (no. 3), pp. 321–52, May 2002. doi:10.1016/S0149-7634(02)00007-6 L.H. Somerville, R.M. Jones, E.J. Ruberry, J.P. Dyke, G. Glover, and B.J. Casey, “The medial prefrontal cortex and the emergence of self-conscious emotion in adolescence,” Psychological Science, vol. 24 (no. 8), pp. 1554–62, Aug 2013. doi:10.1177/09567976134 75633 X. Liu, J. Hairston, M. Schrier, and J. Fan, “Common and distinct networks underlying reward valence and processing stages: a meta-analysis of functional neuroimaging studies,” Neuroscience & Biobehavioral Reviews, vol. 35 (no. 5), pp. 1219–36, Apr 2011. U.J. Muller, J. Voges, J. Steiner, I. Galazky, H.J. Heinze, M. Moller, J. Pisapia, C. Halpern, A. Caplan, B. Bogerts, and J. Kuhn, “Deep brain stimulation of the nucleus accumbens for the treatment of addiction,” Annals of the New York Academy of Science, vol. 1282, pp. 119– 28, Apr 2013. R.A. Depue and P.F. Collins, “Neurobiology of the structure of personality: dopamine, facilitation of incentive motivation, and extraversion,” The Behavioral and Brain Sciences, vol. 22 (no. 3), pp. 491–517; discussion 518–69, Jun 1999. K. Fliessbach, B. Weber, P. Trautner, T. Dohmen, U. Sunde, C.E. Elger, and A. Falk, “Social comparison affects reward-related brain activity in the human ventral striatum,” Science, vol. 318 (no. 5854), pp. 1305–8, Nov 23 2007. doi:10.1126/science.1145876 X. Caseras, N.S. Lawrence, K. Murphy, R.G. Wise, and M.L. Phillips, “Ventral striatum activity in response to reward: differences between bipolar I and II disorders,” American Journal of Psychiatry, vol. 170 (no. 5), pp. 533–41, May 2013. doi:10.1176/appi.ajp.2012 .12020169 H.R. Heekeren, I. Wartenburger, A. Marschner, T. Mell, A. Villringer, and F.M. Reischies, “Role of ventral striatum in reward-based decision making,” Neuroreport, vol. 18 (no. 10), pp. 951–5, Jul 2 2007. doi:10.1097/WNR.0b013e3281532bd7 M. Ernst, E.E. Nelson, S. Jazbec, E.B. McClure, C.S. Monk, E. Leibenluft, J. Blair, and D.S. Pine, “Amygdala and nucleus accumbens in responses to receipt and omission of gains in adults and adolescents,” NeuroImage, vol. 25 (no. 4), pp. 1279–91, May 1 2005. doi:10.1016/j.neuroimage.2004.12.038 A. Galvan, T.A. Hare, C.E. Parra, J. Penn, H. Voss, G. Glover, and B.J. Casey, “Earlier development of the accumbens relative to orbitofrontal cortex might underlie risk-taking behavior in adolescents,” Journal of Neuroscience, vol. 26 (no. 25), pp. 6885–92, Jun 21 2006. doi:10.1523/JNEUROSCI.1062-06.2006 J.R. Cohen, R.F. Asarnow, F.W. Sabb, R.M. Bilder, S.Y. Bookheimer, B.J. Knowlton, and

References  99

[200]

[201]

[202]

[203]

[204]

[205]

[206]

[207]

[208]

R.A. Poldrack, “A unique adolescent response to reward prediction errors,” Nature Neurosci­ ence vol. 13 (no. 6), pp. 669–71, Jun 2010. C.F. Geier, R. Terwilliger, T. Teslovich, K. Velanova, and B. Luna, “Immaturities in reward processing and its influence on inhibitory control in adolescence,” Cerebral Cortex, vol. 20 (no. 7), pp. 1613–29, Jul 2010. E.R. Sowell, P.M. Thompson, C.J. Holmes, T.L. Jernigan, and A.W. Toga, “In vivo evidence for post-adolescent brain maturation in frontal and striatal regions,” Nature Neurosci­ ence, vol. 2 (no. 10), pp. 859–61, Oct 1999. E.R. Sowell, D.A. Trauner, A. Gamst, and T.L. Jernigan, “Development of cortical and subcortical brain structures in childhood and adolescence: a structural MRI study,” Devel­ opmental Medicine and Child Neurology, vol. 44 (no. 1), pp. 4–16, Jan 2002. S.C. Swagerman, R.M. Brouwer, E.J. de Geus, H.E. Hulshoff Pol, and D.I. Boomsma, “Development and heritability of subcortical brain volumes at ages 9 and 12,” Genes Brain, and Behavior, vol. 13 (no. 8), pp. 733–42, Nov 2014. doi:10.1111/gbb.12182 I.L. van Soelen, R.M. Brouwer, G.C. van Baal, H.G. Schnack, J.S. Peper, L. Chen, R.S. Kahn, D.I. Boomsma, and H.E. Hulshoff Pol, “Heritability of volumetric brain changes and height in children entering puberty,” Human Brain Mapping, vol. 34 (no. 3), pp. 713– 25, Mar 2013. M.M. Bohlken, R.M. Brouwer, R.C. Mandl, N.E. van Haren, R.G. Brans, G.C. van Baal, E.J. de Geus, D.I. Boomsma, R.S. Kahn, and H.E. Hulshoff Pol, “Genes contributing to subcortical volumes and intellectual ability implicate the thalamus,” Human Brain Mapping, vol. 35 (no. 6), pp. 2632–42, Jun 2014. doi:10.1002/hbm.22356 A. den Braber, M.M. Bohlken, R.M. Brouwer, D. van ‘t Ent, R. Kanai, R.S. Kahn, E.J. de Geus, H.E. Hulshoff Pol, and D.I. Boomsma, “Heritability of subcortical brain measures: a perspective for future genome-wide association studies,” NeuroImage, vol. 83, pp. 98–102, Dec 2013. doi:10.1016/j.neuroimage.2013.06.027 W.S. Kremen, E. Prom-Wormley, M.S. Panizzon, L.T. Eyler, B. Fischl, M.C. Neale, C.E. Franz, M.J. Lyons, J. Pacheco, M.E. Perry, A. Stevens, J.E. Schmitt, M.D. Grant, L.J. Seidman, H.W. Thermenos, M.T. Tsuang, S.A. Eisen, A.M. Dale, and C. Fennema-Notestine, “Genetic and environmental influences on the size of specific brain regions in midlife: the VETSA MRI study,” NeuroImage, vol. 49 (no. 2), pp. 1213–23, Jan 15 2010. S. Neufang, K. Specht, M. Hausmann, O. Gunturkun, B. Herpertz-Dahlmann, G.R. Fink, and K. Konrad, “Sex differences and the impact of steroid hormones on the developing human brain,” Cerebral Cortex, vol. 19 (no. 2), pp. 464–73, Feb 2009. doi:10.1093/cercor /bhn100

100  Adolescent Brain Development

[209] J.E. Bramen, J.A. Hranilovich, R.E. Dahl, E.E. Forbes, J. Chen, A.W. Toga, I.D. Dinov, C.M. Worthman, and E.R. Sowell, “Puberty influences medial temporal lobe and cortical gray matter maturation differently in boys than girls matched for sexual maturity,” Cerebral Cortex, vol. 21 (no. 3), pp. 636–46, Mar 2011. doi:10.1093/cercor/bhq137 [210] B.G. Moor, B. Guroglu, Z.A. Op de Macks, S.A. Rombouts, M.W. Van der Molen, and E.A. Crone, “Social exclusion and punishment of excluders: neural correlates and developmental trajectories,” NeuroImage, vol. 59 (no. 1), pp. 708–17, Jan 2 2012. [211] C. Sebastian, E. Viding, K.D. Williams, and S.J. Blakemore, “Social brain development and the affective consequences of ostracism in adolescence,” Brain and Cognition, vol. 72 (no. 1), pp. 134–45, Feb 2010. doi:10.1016/j.bandc.2009.06.008 [212] J.S. Silk, G.J. Siegle, K.H. Lee, E.E. Nelson, L.R. Stroud, and R.E. Dahl, “Increased neural response to peer rejection associated with adolescent depression and pubertal development,” Social Cognitive and Affective Neuroscience, vol. 9 (no. 11), pp. 1798–807, Nov 2014. [213] L.R. Squire, “The legacy of patient H.M. for neuroscience,” Neuron, vol. 61 (no. 1), pp. 6–9, Jan 15 2009. [214] H.E. Stevens, “Prefrontal cortex: disorders and development,” Journal of the American Acad­ emy of Child and Adolescent Psychiatry, vol. 49 (no. 3), pp. 203–4, Mar 2010. [215] O. Eyre and A. Thapar, “Common adolescent mental disorders: transition to adulthood,” Lancet, vol. 383 (no. 9926), pp. 1366–8, Apr 19 2014. doi:10.1016/S0140-6736(13)62633-1 [216] A.J. Oldehinkel, J. Ormel, F.C. Verhulst, and E. Nederhof, “Childhood adversities and adolescent depression: a matter of both risk and resilience,” Developmental Psychopathology, vol. 26 (no. 4 Pt 1), pp. 1067–75, Nov 2014. doi:10.1017/S0954579414000534 [217] N. Gogtay, N.S. Vyas, R. Testa, S.J. Wood, and C. Pantelis, “Age of onset of schizophrenia: perspectives from structural neuroimaging studies,” Schizophrenia Bulletin, vol. 37 (no. 3), pp. 504–13, May 2011. doi:10.1093/schbul/sbr030 [218] R.E. Tarter, M.M. Vanyukov, and Center for Education and Drug Abuse Research., Etiol­ ogy of Substance Use Disorder in Children and Adolescents: Emerging Findings from the Center for Education and Drug Abuse Research, New York: Haworth Press, 2001. [219] R.B. Binford, M. Pederson Mussell, C.B. Peterson, S.J. Crow, and J.E. Mitchell, “Relation of binge eating age of onset to functional aspects of binge eating in binge eating disorder,” The International Journal of Eating Disorders, vol. 35 (no. 3), pp. 286–92, Apr 2004. doi:10.1002/eat.10272 [220] A. Heinz, “[The dopamine hypothesis of schizophrenia. New findings for an old theory],” Der Nervenarzt, vol. 71 (no. 1), pp. 54–7, Jan 2000. [221] P.F. Buckley, “Neuroimaging of schizophrenia: structural abnormalities and pathophysi-

References  101

[222] [223]

[224] [225]

[226]

[227]

[228] [229] [230]

[231]

[232]

ological implications,” Neuropsychiatric Disease and Treatment, vol. 1 (no. 3), pp. 193–204, Sep 2005. A. Meyer-Lindenberg and H. Tost, “Neuroimaging and plasticity in schizophrenia,” Restor­ ative Neurology and Neuroscience, vol. 32 (no. 1), pp. 119–27, Jan 1 2014. E. Kuntsche and G. Gmel, “Alcohol consumption in late adolescence and early adulthood— where is the problem?,” Swiss Medical Weekly, vol. 143, pp. w13826, 2013. doi:10.4414 /smw.2013.13826 L.P. Spear, “Adolescents and Alcohol,” Current Directions in Psychological Science, vol. 22 (no. 2), pp. 152–157, Apr 1 2013. R.C. Engels, R.H. Scholte, C.F. van Lieshout, R. de Kemp, and G. Overbeek, “Peer group reputation and smoking and alcohol consumption in early adolescence,” Addictive Behaviors, vol. 31 (no. 3), pp. 440–9, Mar 2006. E. Kuntsche and S. Muller, “Why do young people start drinking? Motives for first-time alcohol consumption and links to risky drinking in early adolescence,” European Addiction Research, vol. 18 (no. 1), pp. 34–9, 2012. W.H. Kaye, G.K. Frank, U.F. Bailer, and S.E. Henry, “Neurobiology of anorexia nervosa: clinical implications of alterations of the function of serotonin and other neuronal systems,” The International Journal of Eating Disorders, vol. 37 Suppl, pp. S15–9; discussion S20-1, 2005. W. Kaye, “Neurobiology of anorexia and bulimia nervosa,” Physiology & Behavior, vol. 94 (no. 1), pp. 121–35, Apr 22 2008. R.P. McManus, Jr., “Adolescent care: reducing risk and promoting resilience,” Primary Care, vol. 29 (no. 3), pp. 557–69, Sep 2002. doi:10.1016/S0095-4543(02)00006-4 B.I. Goldstein, M.R. Carnethon, K.A. Matthews, R.S. McIntyre, G.E. Miller, G. Raghuveer, C.M. Stoney, H. Wasiak, B.W. McCrindle, A. American Heart Association, Hypertension, and Y. Obesity in Youth Committee of the Council on Cardiovascular Disease in the, “Major Depressive Disorder and Bipolar Disorder Predispose Youth to Accelerated Atherosclerosis and Early Cardiovascular Disease: A Scientific Statement From the American Heart Association,” Circulation, vol. 132 (no. 10), pp. 965–86, Sep 8 2015. doi:10.1161 /CIR.0000000000000229 M.J. Knol, J.W. Twisk, A.T. Beekman, R.J. Heine, F.J. Snoek, and F. Pouwer, “Depression as a risk factor for the onset of type 2 diabetes mellitus. A meta-analysis,” Diabetologia, vol. 49 (no. 5), pp. 837–45, May 2006. J. Angst, F. Angst, and H.H. Stassen, “Suicide risk in patients with major depressive disorder,” Journal of Clinial Psychiatry, vol. 60 Suppl 2, pp. 57–62; discussion 75–6, 113–6, 1999.

102  Adolescent Brain Development

[233] S. Kutcher, A. Bagnell, and Y. Wei, “Mental health literacy in secondary schools: a Cana­ dian approach,” Child and Adolescent Psychiatric Clinics of   North America, vol. 24 (no. 2), pp. 233–44, Apr 2015. doi:10.1016/j.chc.2014.11.007 [234] Y. Wei, P.J. McGrath, J. Hayden, and S. Kutcher, “Mental health literacy measures evaluating knowledge, attitudes and help-seeking: a scoping review,” BMC Psychiatry, vol. 15 (no. 1), pp. 291, 2015. [235] G. Adolescent Sleep Working, A. Committee on, and H. Council on School, “School start times for adolescents,” Pediatrics, vol. 134 (no. 3), pp. 642–9, Sep 2014. doi:10.1542 /peds.2014-1697 [236] K.E. Minges and N.S. Redeker, “Delayed school start times and adolescent sleep: A systematic review of the experimental evidence,” Sleep Medicine Reviews, vol. 28, pp. 82–91, Jun 29 2015. doi:10.1016/j.smrv.2015.06.002 [237] H. Gardner and K. Davis, The App Generation, New Haven: Yale University Press, 2014. [238] J. Palfrey and U. Gasser, Born Digital, New York: Basic Books, 2008. [239] P.M. McNamara, “Adolescent suicide in Australia: rates, risk and resilience,” Clinical Child Psychology and Psychiatry, vol. 18 (no. 3), pp. 351–69, Jul 2013. doi:10.1177/1359104512 455812 [240] Y. Wei and S. Kutcher, “International school mental health: global approaches, global challenges, and global opportunities,” Child and Adolescent Psychiatric Clinics of North America, vol. 21 (no. 1), pp. 11–27, vii, Jan 2012. [241] S. Kutcher, “Facing the challenge of care for child and youth mental health in Canada: a critical commentary, five suggestions for change and a call to action,” Healthcare Quarterly, vol. 14 Spec No 2, pp. 14–21, 2011. doi:10.12927/hcq.2011.22359 [242] S. Kutcher and A. McLuckie, “Evergreen: creating a child and youth mental health framework for Canada,” Psychiatric Services, vol. 64 (no. 5), pp. 479–82, May 1 2013. doi:10.1176 /appi.ps.201100269 [243] Y. Wei, S. Kutcher, and J.C. LeBlanc, “Hot Idea or Hot Air: A Systematic Review of Evidence for Two Widely Marketed Youth Suicide Prevention Programs and Recommendations for Implementation,” Journal of the Canadian Academy of Child and Adolescent Psy­ chiatry = Journal de l’Academie canadienne de psychiatrie de l’enfant et de l’adolescent, vol. 24 (no. 1), pp. 5–16, Winter 2015. [244] C.L. Hart, C. Ksir, A.L.O. Hebb, R.W. Gilbert, and S. Black, Drugs, Behaviour, and Society, Canadian Edition: McGraw-Hill Ryerson, 2012.

103

Author Biographies Dr. Lisa Wright, Ph.D., is a neuroscience researcher, author, instructor, business owner, and a mother of two. She obtained her Ph.D. in psychology and neuroscience in 2011 at Dalhousie University in Halifax, Nova Scotia, Canada. Both her master’s and doctoral research work was funded by the Nova Scotia Health Research Foundation. Her doctoral thesis work, supervised by Dr. Tara Perrot, involved investigating the effects of adolescent stressor exposure on development of the brain, the endocrine system, and behavior, using a rat model. She then went on to study endocrine and behavioral profiles of  humans in various circumstances, such as following sleep deprivation or in adolescent girls who have been diagnosed with conduct disorder. She has also taught a number of courses at Dalhousie University and Acadia University in Wolfville, Nova Scotia, Canada. Dr. Wright’s business, Fit Brain Training (www.fitbrain.ca), is co-owned and operated with her long­­time mentor, Dr. Perrot. Dr. Wright and Dr. Perrot have a previous contribution to this series, entitled “Stress and the Developing Brain.” Dr. Wright’s daughters are 4 years old (Charlotte) and 1 year old (Paladina). Dr. Stan Kutcher, ONS, MD, FRCPC, FCAHS, Sun Life Financial Chair in Adolescent Mental Health and Director of  World Health Organization Collaborating Center in Mental Health Policy and Training. Dr. Kutcher is an internationally renowned expert in adolescent mental health and a national and international leader in mental health research, advocacy, training, policy, and services innovation working at the IWK Health Center and Dalhousie University. He has previously served as Department Head of Psychiatry and Associate Dean for International Health at Dalhousie University. Dr. Kutcher has received numerous awards and honors locally, nationally, and internationally for his work including: the Order of Nova Scotia; Excellence in Education Award (CACAP); a Best Doctor in Canada; Doctors Nova Scotia Health Promotion Award; Dr. John Savage Memorial Award for outstanding humanitarian contributions to global

104  Adolescent Brain Development

health; Canadian College of  Neuropsychopharmacology Gold Medal; Lifetime Achievement Award of the Canadian Psychiatric Research Foundation, and the Ruedy Award for Innovation in Medical Education, Association of Faculties of  Medicine Canada. He is a Distinguished Fellow of the Canadian Psychiatric Association and a Fellow of the Canadian Academy of Health Sciences. He has been honored by the Canadian Psychiatric Association with the JM Cleghorn Award for his contribution to mental health research and the Paul Patterson Award for his innovations in psychiatric education. He is and has been a member of numerous boards and national organizations including the Institute of  Neuroscience, Mental Health and Addictions of the CIHR; Interhealth Canada; Mental Health Commission of Canada (CYAC committee); the Canadian Society for International Health; the Canadian Coalition for Global Health Research; and The Sandbox Project. He is the recipient of over 100 research grants and awards, author of more than 300 scientific papers, and the author/co-author of numerous medical textbooks. Locally, he contributes to the work of  Laing House, Immigrant Services and Integration Services, and the Boys and Girls Clubs. Internationally he has been involved in mental health work in over 20 countries. One of his recent projects was leading the development of a national child and youth mental health framework for Canada: Evergreen. Currently, his focus is on knowledge translation pertaining to improving mental health literacy and mental health care in schools and primary care as well as the development, application, and evaluation of electronic youth mental health engagement, self-care and personal health record. He continues his innovative youth mental health development and research across Canada, and globally—including China, South America, Latin America, and Africa.