6th International Conference on Nanotechnologies and Biomedical Engineering: Proceedings of ICNBME-2023, September 20–23, 2023, Chisinau, Moldova - ... and Rehabilitation (IFMBE Proceedings, 92) 3031427815, 9783031427817

Citation preview

IFMBE Proceedings 92

Victor Sontea Ion Tiginyanu Serghei Railean Editors

6th International Conference on Nanotechnologies and Biomedical Engineering Proceedings of ICNBME-2023, September 20–23, 2023, Chisinau, Moldova Volume 2: Biomedical Engineering and New Technologies for Diagnosis, Treatment, and Rehabilitation

IFMBE Proceedings Series Editor Ratko Magjarevi´c, Faculty of Electrical Engineering and Computing, ZESOI, University of Zagreb, Zagreb, Croatia

Associate Editors Piotr Łady˙zy´nski, Warsaw, Poland Fatimah Ibrahim, Department of Biomedical Engineering, Faculty of Engineering, Universiti Malaya, Kuala Lumpur, Malaysia Igor Lackovic, Faculty of Electrical Engineering and Computing, University of Zagreb, Zagreb, Croatia Emilio Sacristan Rock, Mexico DF, Mexico

92

The IFMBE Proceedings Book Series is an official publication of the International Federation for Medical and Biological Engineering (IFMBE). The series gathers the proceedings of various international conferences, which are either organized or endorsed by the Federation. Books published in this series report on cutting-edge findings and provide an informative survey on the most challenging topics and advances in the fields of medicine, biology, clinical engineering, and biophysics. The series aims at disseminating high quality scientific information, encouraging both basic and applied research, and promoting world-wide collaboration between researchers and practitioners in the field of Medical and Biological Engineering. Topics include, but are not limited to: • • • • • • • •

Diagnostic Imaging, Image Processing, Biomedical Signal Processing Modeling and Simulation, Biomechanics Biomaterials, Cellular and Tissue Engineering Information and Communication in Medicine, Telemedicine and e-Health Instrumentation and Clinical Engineering Surgery, Minimal Invasive Interventions, Endoscopy and Image Guided Therapy Audiology, Ophthalmology, Emergency and Dental Medicine Applications Radiology, Radiation Oncology and Biological Effects of Radiation

IFMBE proceedings are indexed by SCOPUS, EI Compendex, Japanese Science and Technology Agency (JST), SCImago. They are also submitted for consideration by WoS. Proposals can be submitted by contacting the Springer responsible editor shown on the series webpage (see “Contacts”), or by getting in touch with the series editor Ratko Magjarevic.

Victor Sontea · Ion Tiginyanu · Serghei Railean Editors

6th International Conference on Nanotechnologies and Biomedical Engineering Proceedings of ICNBME-2023, September 20–23, 2023, Chisinau, Moldova - Volume 2: Biomedical Engineering and New Technologies for Diagnosis, Treatment, and Rehabilitation

Editors Victor Sontea Department of Microelectronics and Biomedical Engineering Technical University of Moldova Chisinau, Moldova

Ion Tiginyanu Academy of Sciences of Moldova Chisinau, Moldova

Serghei Railean Department of Microelectronics and Biomedical Engineering Technical University of Moldova Chisinau, Moldova

ISSN 1680-0737 ISSN 1433-9277 (electronic) IFMBE Proceedings ISBN 978-3-031-42781-7 ISBN 978-3-031-42782-4 (eBook) https://doi.org/10.1007/978-3-031-42782-4 © The Editor(s) (if applicable) and The Author(s), under exclusive license to Springer Nature Switzerland AG 2024 This work is subject to copyright. All rights are solely and exclusively licensed by the Publisher, whether the whole or part of the material is concerned, specifically the rights of translation, reprinting, reuse of illustrations, recitation, broadcasting, reproduction on microfilms or in any other physical way, and transmission or information storage and retrieval, electronic adaptation, computer software, or by similar or dissimilar methodology now known or hereafter developed. The use of general descriptive names, registered names, trademarks, service marks, etc. in this publication does not imply, even in the absence of a specific statement, that such names are exempt from the relevant protective laws and regulations and therefore free for general use. The publisher, the authors, and the editors are safe to assume that the advice and information in this book are believed to be true and accurate at the date of publication. Neither the publisher nor the authors or the editors give a warranty, expressed or implied, with respect to the material contained herein or for any errors or omissions that may have been made. The publisher remains neutral with regard to jurisdictional claims in published maps and institutional affiliations. This Springer imprint is published by the registered company Springer Nature Switzerland AG The registered company address is: Gewerbestrasse 11, 6330 Cham, Switzerland Paper in this product is recyclable.

Preface

This volume presents the Proceedings of the 6th International Conference on Nanotechnologies and Biomedical Engineering (ICNBME), which was held on September 20–23, 2023, in Chisinau, Republic of Moldova. ICNBME-2023 continued the series of international conferences in the field of nanotechnologies and biomedical engineering with the main goal focused at bringing together scientists and engineers dealing with fundamental and applied research for reporting on the latest theoretical developments and applications in the fields involved. The conference covered a wide range of subjects of primary importance for research and development such as nanotechnologies and nanomaterials, biomicro/nanotechnologies and devices, biomaterials for medical applications, biosensors and bioinstrumentation, biomedical signal and image processing, bioinformatics and computational biology, medical physics and biophysics, molecular, cellular and tissue engineering, clinical engineering, health technology management and assessment, innovation, development and interdisciplinary research, nuclear and radiation safety and security, medical physics and radiation protection, new technologies for diagnosis, treatment and rehabilitation and personalized approaches in medicine. The papers included in the Proceedings reflect the results of multidisciplinary research undertaken by about one hundred of groups worldwide. Special attention is paid to the development of novel nanotechnologies and nanomaterials, in particular of bio-nanotechnologies and bio-nanomaterials. New biocompatible materials are proposed for use in regenerative medicine, cellular and tissue engineering. Interesting data on novel chemical and biosensors are reported which are based on nanostructured metal oxides and hybrid nanocomposite materials. A wide range of new technologies for diagnosis, treatment and rehabilitation and personalized approaches in medicine are also presented. Considerable progress has been achieved at the intersection of nanotechnologies, information technologies and biomedicine as, for example, in health informatics, ehealth, telemedicine, biomedical instrumentation and signal processing. New theoretical and experimental results are highlighted in such fields as meta-materials, aeromaterials, micro-opto-electronic and photonic materials, photovoltaic structures, quantum dots, one- and two-dimensional nanomaterials, 3D nanoarchitectures and multifunctional hybrid materials like sandwich and core–shell structures, etc. The Proceedings reflect the state of the art in controlling the properties of several classes of nanocomposite materials for important future applications in various fields.

vi

Preface

We hope that the papers included in the ICNBME-2023 Proceedings will be of interest for established researchers working in multidisciplinary fields of science and technology, young scientists, students and broad community wishing to get up-to-date information on progress in the fast-developing areas of nanotechnology and biomedical engineering. Victor Sontea Ion Tiginyanu Serghei Railean

Organization

6th International Conference on Nanotechnologies and Biomedical Engineering ICNBME-2023, September 20–23, 2023, Chisinau, Republic of Moldova

Committees Conference Chairs Victor Sontea Ion Tiginyanu

President of the Moldavian Society of Biomedical Engineering, Republic of Moldova Academy of Sciences of Moldova, Republic of Moldova

International Advisory Committee Emil Cebanu

Rainer Adelung Viorel Bostan Pascal Colpo Yury Dekhtyar

Vladimir Fomin Hans Hartnagel

Nicolae Jula S, eref Komurcu Ratko Magjarevi´c Hidenori Mimura Ala Nimerenco Nicolas Pallikarakis

Nicolae Testemi¸tanu State Medical and Pharmaceutical University, Republic of Moldova Institute for Materials Science; University of Kiel, Germany Technical University of Moldova, Republic of Moldova Joint Research Center, Italy Institute of Biomedical Engineering and Nanotechnologies, Riga Technical University, Latvia Leibniz Institute for Solid State and Materials Research, Dresden Technical University Darmstadt, Institute of Microwave Engineering and Photonics, Germany Military Technical Academy, Romania Anadolu Medical Center, Turkey University of Zagreb, Croatia Research Institute of Electronics, Shizuoka University, Japan “Ministry of Health of the Republic of Moldova” University of Patras, Greece

viii

Organization

Masakazu Kimura Alexander Pogrebnjak Vladimir Krasnov Bogdan Simionescu Sokol Yevgen I. Ashok Vaseashta

Research Institute of Electronics, Shizuoka University, Japan Sumy State University, Ukraine Stockholm University, Sweden Romanian Academy, Romania National Technical University, Kharkiv, Ukraine International Clean Water Institute, Manassas, USA

International Program Committee S, ontea Victor

Tighineanu Ion Lupan Oleg Buzdugan Artur Ciorba Dumitru Corciova C˘alin Crudu Oleg Curocichin Ghenadie

Korotcencov Ghenadii Dinescu Adrian

Dragoman Mircea

Grigor Tatisvili

Groppa Stanislav

Kolisnyk Kostiantyn V.

President of the Moldovan Society of Biomedical Engineering, Technical University of Moldova, Republic of Moldova President of the Academy of Sciences of Moldova, Republic of Moldova Technical University of Moldova, Republic of Moldova Technical University of Moldova, Republic of Moldova Technical University of Moldova, Republic of Moldova Grigore T. Popa University of Medicine and Pharmacy, Romania Clinical municipal hospital Saint Trinity, Republic of Moldova Nicolae Testemi¸tanu State Medical and Pharmaceutical University, Republic of Moldova Moldova State University, Republic of Moldova National Institute for Research and Development in Microtechnology – IMT Bucharest, Romania National Institute for Research and Development in Microtechnology – IMT Bucharest, Romania Institute of Inorganic Chemistry and Electrochemistry of I. Javakhishvili Tbilisi State, Georgia Nicolae Testemi¸tanu State Medical and Pharmaceutical University, Republic of Moldova National Technical University, Kharkiv, Ukraine

Organization

Kulyuk Leonid Macovei Mihai Nacu Viorel

Sidorenko Anatolie Toma Ian Tronciu Vasile Tsiulyanu Dumitru Ursaki Veaceslav Verestiuc Liliana Vovc Victor

Moldova State University, Republic of Moldova Moldova State University, Republic of Moldova Nicolae Testemi¸tanu State Medical and Pharmaceutical University, Republic of Moldova Technical University of Moldova, Republic of Moldova The George Washington University, USA Technical University of Moldova, Republic of Moldova Technical University of Moldova, Republic of Moldova Academy of Sciences of Moldova, Republic of Moldova University of Medicine and Pharmacy, Romania Nicolae Testemi¸tanu State Medical and Pharmaceutical University, Republic of Moldova

Organizing Committee Sergey Railean Sontea Victor Brinza Mihai Galea-Abdusa Daniela

Gorceag Gheorghe Litra Dinu Matcovschi Sanda Monaico Eduard Pocaznoi Ion Sereacov Alexandr Surlari Ilie

Technical University of Moldova Moldovan Society of Biomedical Engineering, Technical University of Moldova Moldovan Society of Biomedical Engineering, Technical University of Moldova Nicolae Testemi¸tanu State Medical and Pharmaceutical University, Republic of Moldova Moldovan Society of Biomedical Engineering Technical University of Moldova Moldovan Society of Biomedical Engineering Moldovan Society of Biomedical Engineering, Technical University of Moldova Moldovan Society of Biomedical Engineering, Technical University of Moldova Technical University of Moldova Moldovan Society of Biomedical Engineering

ix

x

Organization

Reviewers List Adrian Dinescu Anatolie Sidorenko Artur Buzdugan C˘alin Corciova Corneliu Druga Dumitru Tsiuleanu Eduard Monaico Ghenadie Curocichin Ian Toma Ionel Sanduleac Konstantin Kolesnik Leonid Kulyuk Liliana Verestiuc

Mihai Macovei Mircea Dragoman Nistor Grozavu Oleg Lupan Tudor Branis, te Vasile Tronciu Veaceslav Ursaki Victor Sontea Victor Vovc Victor Zalamai Viorel Nacu Vladimir Fomin

Organizers

Moldovan Society of Biomedical Engineering

Technical University of Moldova

In Collaboration with

Nicolae Testemitanu State University of Medicine and Pharmacy

The International Federation for Medical and Biological Engineering (IFMBE)

Organization

European Alliance for Medical and Biological Engineering & Science

Academy of Sciences of Moldova

Supported by

National Agency for Research and Development of Moldova, project 20.80009.8007.26

xi

Plenary Speakers, Abstracts

Genes, Cells and Discovery in Basic Science and Disease

Randy Schekman Department of Molecular and Cell Biology, Howard Hughes Medical Institute, University of California, Berkeley, USA [email protected] Our understanding of the basic processes of life at the cellular and molecular level has substantially changed the outlook for the treatment of the greatest diseases of mankind. As a result of the development of tools to explore genes and chromosomes and the protein molecules they encode, therapies to treat heart disease and cancer have been designed with a level of precision that has saved countless lives. Beginning with the discovery of the structure of DNA and continuing with the elucidation of the path taken to express the genes in our genome, we are now able to modify genes that show promise of curing genetic diseases such as sickle cell anemia. These breakthroughs will surely lead to treatments for cancers and neurodegenerative diseases where heritable mutations are the source of illness. My interest began with a toy microscope that I received as a gift which stimulated a fascination with the microbial world. That interest matured at university and in my PhD work where I learned the powerful tools of biochemistry from Arthur Kornberg, a Nobelist who discovered an enzyme that copies DNA stands. For my independent career, I took the lessons from Kornberg and from broader readings on modern approaches to the elucidation of complex cellular processes and applied them to a molecular genetic dissection of the process of protein secretion in a simple eukaryotic organism, Baker’s yeast. Using simple genetics to discover essential genes required for protein secretion, my research team elucidated a pathway similar to that discovered in pancreatic tissue by the great Romanian Nobelist, George Palade. The genes we discovered are evolutionarily conserved and employed in mammals to execute the diverse processes in secretion essential to normal physiology. This conservation allowed the biotechnology industry to harness yeast cells as a secretion platform for the production of clinically important proteins such as human recombinant insulin. Following on the genetics, we developed biochemical approaches to identify the functions of a number of the secretion genes in yeast and their equivalents in human cells. Several of the genes encode subunits of the channel in the endoplasmic reticulum (ER) membrane responsible for the first step in the transfer of newly synthesized secretory proteins from their site of synthesis on ribosomes in the cytoplasm across the ER membrane into the interior luminal space. Another set of the genes encodes subunits of a coat protein complex that pinches transport vesicles carrying secretory cargo proteins for traffic from the ER to the Golgi apparatus. Some of these genes have been found to be the basis of human genetic diseases of protein secretion. Knowledge of these precise mechanisms contributes directly to the development of novel therapeutic interventions.

Tetrapods and Aeromaterials for Antiviral and Antibacterial Treatment and Therapy

Rainer Adelung Functional Nanomaterials, Department for Material Science, Kiel University, Germany [email protected] This talk will give an overview of recent advances in the field of antiviral and antibacterial treatments either for personal therapy or in air filtration systems from the functional nanomaterials group at Kiel University. In contrast to molecular drugs or similar medical agents, the main effect here is on the physical interaction or interaction with a nanostructured surface and not on a chemical effect influenced, for example, by the solubility of a drug. The entire system, i.e., in the case of a technical system its entire environment or in the case of personal therapy not only the disease, but also the surrounding network such as the immune system is exploited. Two main examples are followed: tetrapodal microcrystals of zinc oxide and the graphene-based aeromaterials created from them by a templating process. While the pharmaceutical effects of zinc oxide nanoparticles, which are simply based on an excess of nanoparticles, have been widely used for a long time in various products such as creams and ointments due to their weak antiseptic and drying effect, e.g., to support the healing of herpes blisters, tetrapodal zinc oxide, which actually showed a curative effect based on an immunization only in 2016 [1] in animal models, has only recently been translated from the research group into the pharmaceutical market (see Fig. 1). For this purpose, the tetrapodal zinc oxide enables the immune system to detect the virus at an early stage via the CD4 and CD8 signaling pathway with the help of antigen presenting cells, which can easily internalize the virus enabled by an immobilization on specially adjusted nanoscale surface structures on the zinc oxide crystal. Besides the first product experiences of “Afinovir”, a cream that contains GMPcertified tetrapodal zinc oxide in herpes therapy, further antibacterial effects are now in focus. These might be utilized in 3D-printed skin patches and their specific antibacterial effects and their ability to deliver proteins, like the VEGF for wound healing assistance, as shown by Leonard Siebert [2]. Compared to the effects in personal therapeutic medicine, the effects of sterilization provided by the aeromaterials in air filtration systems are much less sophisticated. The combination of the structural features of aeromaterials, the interconnected large free volume and the low weight are employed for a pyrolysis [3] of pathogens. Low mass means low heat capacity, which results in reaching high temperatures with relative low power. High free volume in connection with a hierarchical micro–nanostructure means high filter efficiency. However, the example given in the framework of the Graphene Spearhead Project AEROGrAFT, a passenger jet air filter system that is developed together with the aviation company Lufthansa Technik. It will be shown and discussed that beside technological obstacles, the aviation certification procedure provides a similar challenge.

xviii

R. Adelung

Fig. 1. Micrographs of tetrapodal zinc oxide. A. Scanning electron microscopy image, the arm diameters of the ZnO microcrystals are in the order of ~1–3 μm SEM. B. Fluorescence microscopy of a tetrapod with GFP labeled herpes virus bound to a tetrapod

References 1. J. Immunol. 196(11), 4566–4575 (2016) 2. Adv. Funct.Mater. 31(22), 2170154 (2021) 3. Mater. Today 48, 7–17 (2021)

Single-Crystal Diamond Radiation Detector

Toru Aoki Shizuoka University, Hamamatsu, Japan [email protected] We have reported on the growth of single-crystal diamond and its application to radiation detectors. This time, we report on the measurement of an imager with a photon-charge counting readout integrated circuit (ROIC) connected to a single-crystal diamond. The single-crystal diamond was 3.0 × 3.0 mm × 0.5 mm thick. The bump connection area of our test ROIC is a 3.2 mm × 3.2 mm area with 40 × 40 pixels pads at 80 μm pitch. Silver-based bumps were formed on short-crystal diamond using a super inkjet printer and bumped to the ROIC using flip chip bonders. The imaging experiment was conducted by irradiating X-rays at 90 kV and 0.2 mA at 30 cm distance. The results showed that the X-ray transmission image with a clear contrast between the area shielded by 2 mm thick lead and the unshielded area was captured, demonstrating a prototype single-crystal diamond-type X-ray imager. CVD growth single-crystal diamond was used for the semiconductor detector. The crystal was 3 mm × 3 mm × 0.5 mm in size. The plate electrode was formed by sputtering a thin indium film. The other side had no electrode formed before stacking, but was connected to the ROIC by contact with the silver paste formed on the ROIC side during stacking. The 40 × 40 electrodes were arranged at a pitch of 80 μm for the ROIC, and the maximum crystal size was 3.2 mm × 3.2 mm. However, due to the small crystal size, the detection area is 3.0 mm × 3.0 mm and 38 × 38 pixels. For the connection to the crystal, silver paste bumps were formed on the electrodes of the ROIC using a SIJ-S050 super inkjet printer manufactured by SIJ-Technology, Inc. The readout architecture of the ROIC was designed by our group [3, 4], and the transistorlevel circuitry was designed by Brookman Technology, Inc. (now TOPPAN Inc.) and fabricated in a Taiwan Semiconductor Manufacturing Company Limited (TSMC) with 0.13-μm standard CMOS process. Figure 1 shows the assembled diamond imager and its stacked structure. The ROIC was operated in electron collection mode. A bias voltage of −500 V was applied to the plate electrodes. The frame rate of the ROIC was 200 Hz. About 10 s (2,000 frames) was taken, and the counts were summed to obtain one image. An X-ray tube with a tube voltage of 100 kV was used as the X-ray source. The distance from the tube to the detector was 20 cm. A 3 mm × 3 mm lead plate with a thickness of 1 mm was used as the X-ray shield. The shielding body was shaped like a Japanese character. The shielding was placed between the X-ray tube and the detector, 5 mm away from the detector. It was confirmed that X-rays were detected as expected when X-rays were irradiated with and without the shielding. Next, a shielding was placed in front of the detector, and

xx

T. Aoki

the shielding was imaged. As shown in Fig. 2, the shape of the shielding was obtained as an image.

Fig. 1. Schematic diagram of diamond detector (L) and picture (R)

Fig. 2. X-ray imaging result with a lead object of イ (Japanese character)

References 1. Takagi, K., et al.: Readout architecture based on a novel photon-counting and energy integrating processing for X-ray imaging. IEEE Trans. Radiat. Plasma Med. Sci. (2020) 2. Takagi, K., et al.: Study of an X-ray/Gamma ray photon counting circuit based on charge injection. Sens. Mater. 30(7), 1611–1616 (2018)

Strategic Integration of Electrospinning and Additive Processing for Smart and Sustainable Nanostructures

Ashok Vaseashta1,2 1 International

Clean Water Institute, Manassas, VA, USA [email protected] 2 Institute of Electronic Engineering and Nanotechnologies “D. Ghitu”, Chisinau, Moldova Electrospinning is an effective and versatile technique applied to fabricate porous structures ranging from submicron to nanometer dimensions. Using a variety of highperformance polymers and blends, several porous structure configurations have become possible for applications in tactile sensing, energy harvesting, filtration and biomedical applications; however, the structures lack mechanical complexity, conformity and desired three-dimensional single/multi-material constructs necessary to mimic desired structures. A simple, yet versatile, strategy is through employing digitally controlled fabrication of shape morphing by combining two promising technologies, viz., combinatorial electrospinning and 3D printing/additive processing. Using synergistic integration of configurations, elaborate shapes and patterns are printed with mesostructured stimuli-responsive electrospun membranes, allowing for in-plane modulations and internal interlayer stresses induced by swelling/shrinkage or mismatch, thus guiding morphing behaviors of electrospun membranes to adapt to the changes of the environment. Recent progress in 3D/4D printing/additive processing includes materials and scaffold constructs for tactile and wearable sensors, filtration structures and sensors for structural health monitoring, biomedical scaffolds, tissue engineering and optical patterning, among many other applications to support the vision of synthetically prepared smart material designs that mimic the structural aspects with digital precision. A novel technology called 3D jet writing was recently reported that propels electrospinning to adaptive technologies for the manufacturing of scaffolds according to user-defined specifications of the shape and size of both the pores and the overall geometric footprint. This presentation reviews the hierarchical synergy between electrospinning and 3D printing as part of the precision and rapid prototyping of smart, sustainable and biomedical structures that are likely to evolve next-generation structures into reality.

Superconducting Order Parameter in Inhomogeneous Superconductors

Balázs Újfalussy1 , Gábor Csire2 and Bendegúz Nyári3 1 Wigner

Research Centre for Physics, Budapest, Hungary [email protected] 2 Materials Center Leoben Forschung GmbH, Leoben, Austria [email protected] 3 Budapest University of Technology and Economics, Budapest, Hungary [email protected] Superconductivity is the state of matter in which the electronic wave function spontaneously takes on a definite complex phase. The most fundamental ingredient in the theoretical description of this phenomenon is the superconducting order parameter. Modern computational methods and the corresponding computer codes allow the quantitative predictions of superconducting properties for realistic experimental settings involving not only bulk superconductors but also heterostructures. One major consequence is that it enables the accurate calculation of the superconducting order parameter in inhomogeneous systems, which has been limited so far due to the lack of an appropriate theoretical tool set, even though the superconducting order parameter is one of the central quantities of superconductivity. This is because the BCS theory of superconductivity, in its original formulation, is not easily generalized for heterostructures, especially in the relativistic domain. In this talk, we attempt to provide a quantitative theory that takes into account the ab initio band structure with its full microscopic complexity together with magnetism, effects from relativity, spatial inhomogeneity of the lattice and different orbital symmetries on the same footing. This can be achieved within the framework of multiple scattering theory (MST), this time combined with the Bogolubov-deGennes (BdG) reformulation of the BCS theory. Similarly to the normal state, the central quantity of such an MST is the quasiparticle Green’s function, which now carries information about the scattering of quasiparticles [1]. The main extra ingredient of such scattering events compared to the normal state Korringa-Kohn-Rostoker (KKR) formalism is the so-called Andreev reflection. It occurs when an electron, with energy lying in the superconducting gap, arriving from the normal metal to the superconductor–normal metal (S/N) interface is retro-reflected as a hole and a Cooper pair is formed in the superconductor. This formalism allows vast applications, and we shall focus on the behavior of superconducting order parameter revealing its complexity and physical meaning in realistic systems. As an example, I will revisit the well-known proximity effect, which is part of the standard textbook physics vocabulary, and it is mostly understood within the quasiclassical picture. However, the real microscopic mechanism behind the proximity effect is the

xxiv

B. Újfalussy et al.

Andreev reflection. If one considers this microscopic picture for some artificial materials, often referred to as heterostructures, it reveals the difference in important concepts, like the superconducting order parameter, pairing potential and superconducting gap, which are not well separated in the conventional BCS theory of bulk superconductors. We will use the example of Nb/Au heterostructures in the talk. Then we will apply the approach to the complimentary problem, namely when a superconducting impurity cluster is embedded into a non-superconducting material. By doing so, we shed light on the build-up of the superconducting phase and its connection to the order parameter. As a testbed for our calculations, we consider superconducting Nb atoms surrounded by non-superconducting bulk Nb [2]. For a relatively small cluster of material with nonzero pair interaction parameter embedded in a normal metal, the superconductivity will be suppressed and the superconducting gap will be forced to close. However, the interesting question is what happens when the size of the cluster reaches the same order as the corresponding superconducting coherence length. Here one should remember that the Cooper pairs are extended in real space, since Cooper pairs are formed in momentum space and not in real space. In fact our local pairing model is the analog of conventional BCS theory, where Cooper pairs are formed by electrons with different quantum numbers k,↑ and –k,↓ in which states from the region of the gap around the Fermi level are mixed. The coherence length is the extension of these wave packets in real space given by the BCS theory. When a magnetic impurity or a cluster of magnetic impurities is introduced into a singlet s-wave time-reversal invariant superconductor, there is a pair-breaking effect due to the spin-dependent scattering, and the superconducting transition temperature decreases as the impurity concentration increases. Yu, Shiba and Rusinov revealed that local states (referred as YSR states) appear within the BCS energy gap due to multiple scattering between conduction electrons and magnetic impurities. Later, it was realized theoretically that one can engineer nanostructures, where hybridized YSR states form a topological fully gapped quasiparticle spectrum. For magnetic impurities, an especially rich internal structure of the superconducting order parameter can be calculated from the local Green’s function as nonzero elements in the electron–hole off-diagonal block. It will be demonstrated that the complexity of the ab initio electronic structure allows the appearance of an exotic local triplet state in magnetic s-wave time-reversal symmetry breaking superconductors. Furthermore, we also show how topological superconductivity is manifested in the structure of the superconducting order parameter.

References 1. Csire, G., et al.: Phys. Rev. B 91, 165142 (2015). https://doi.org/10.1103/PhysRevB. 91.165142 2. Saunderson, T.G., et al.: Phys. Rev. B 102, 245106 (2020). https://doi.org/10.1103/ PhysRevB.104.235426

Rehabilitation Using a Data Glove for Moving the Paralyzed Fingers

Hidenori Mimura, Soich Takigawa, Katsunori Suzuki, Kamen Kanev, Toru Aoki and Masakazu Kimura Research Institute of Electronics, Shizuoka University, Japan We have synthesized spinnable carbon nanotube (CNT) [1] and have developed the CNT strain sensors as components of a textile-based, wearable sensing system for real-time motion detection [2]. Well-aligned CNT sheets are fabricated by stacking and shrinking the CNT webs. Experimental CNT strain sensors are manufactured by placing the CNT sheet on a flat and smooth substrate in a direction parallel to the stretching direction and impregnating it with elastomeric resin. The sensor resistance is proportional to the applied tensile strain that increases with the applied force. The temporal strain changes are closely followed by the variation of the strain sensor resistance that can exceed 200%. We have developed a data glove using the CNT strain sensors [2]. The data glove is a wearable device with incorporated strain sensors that allow for motion and posture tracking of the user’s hands and fingers. Since direct sensing is employed, there are no environment restrictions, and timely, highly reliable data can be collected. Motion interactions are then implemented through real-time analysis and recognition of the user’s hand and finger posture and gesture. In this study, we have applied the data glove to functional electrical stimulation (FES) training [3]. FES is used to restore motor function in paralyzed patients because of stroke or spinal injury. In FES, electrical stimulations activate nerve tissue connected to muscle groups to contract muscles to induce movement of the hands. Its restoration improves the quality of life of a paralyzed patient, because hand function is crucial in daily life. We have proposed an FES training method triggered by motions of the opposite hand. Symmetrical motions in the target hand are triggered by the response to multiple motions of the opposite hand. The posture of the opposite hand is recognized by a data glove, and the electrical stimulation points of the multi-pad electrodes of the target hand are dynamically selected on the basis of the recognized posture. The patient can make the target hand produce postures symmetrical to the multiple grasping postures of the opposite hand without being aware of a special device. Electrical stimulation points that elicit the desired grasping motions are explored in advance with reference to the postures of the opposite hand. The proposed method can be applied to contralaterally controlled functional electrical stimulation (CCFES) and a combined method of mirror therapy and FES to train paralyzed patients to recover their grasping function more effectively. Figure 1 shows the experimental flow (upper) and the target grasping postures and a relaxed open posture recorded with the opposite hand (lower). The experiment was conducted as follows: in step 1, multiple grasping postures were recorded with the subject’s opposite (right) hand using the data glove to create a data table for identifying hand

xxvi

H. Mimura et al.

posture. In step 2, the stimulation electrodes of the subject’s target hand were scanned, and the optimal stimulation electrodes to produce the pre-recorded target grasping posture were determined by detecting the evoked postures with the data glove. In step 3, symmetrical postures were produced in the target (left) hand. Specifically, the grasping posture of the opposite hand was detected with the data glove. Then the optimal electrical stimulation pattern identified in the search was applied to the target hand according to the discriminated grasping posture. This procedure produced symmetrical postures in the target hand in response to the grasping postures of the opposite hand. In summary, we have developed a system that combines multichannel FES and a data glove with CNT strain sensors. Experiments on four healthy subjects demonstrated that the system selectively activates the muscles of the target hand in response to the grasping postures of the opposite hand. Additionally, the method produces postures symmetrical to those of the opposite hand. By this method, patients can intuitively train multiple grasping motions using FES without operating special instruments. Applying this method to CCFES or its combination with mirror therapy should improve the efficacy of training with FES.

Fig. 1. Flow of the three steps of the experiment (upper) and target grasping postures and a relaxed open posture recorded with the opposite hand (lower)

References 1. Inoue, Y., et al.: Appl. Phys. Lett. 92, 213113 (2008) 2. Suzuki, K., et al.: ACS Sens. 817 (2016) 3. Takigawa, S., Mimura, H.: Sens. Mater. 33, 3645 (2021)

Importance of Training Healthcare Professionals in Medical Technology

Nicolas Pallikarakis University of Patras, Patras, Greece [email protected] The progress of medical technology during the past 60 years is the driving force of the radical change in the way health care is delivered nowadays. Many simple devices like syringes, needles, personal protection and many other sterilizable products in the 1950s have been replaced by single-use devices that are produced in quantities of tens of billion items each year with an accelerated pace. Implantable devices, like knee and hip prostheses or dental implants, are common practice with a huge variety of products on the market. The same holds for active implantable medical devices (AIMDs) like pacemakers, defibrillators or infusion pumps. The progress in the in vitro diagnostics (IVDs) is also impressive with thousands of tests available today. It is estimated that over a million products available on the world market today are classified as medical devices. A clear indicator of this progress is the number of patents released every year for medical devices. Just as an example, according to MedTech Europe, more than 15,000 patents applications are deposited at the European patent office (EPO) that represents 41% of the worldwide total medical technology patent applications. The medical device sector together with digital communication is in the top of the list overpassing all other sectors, like pharmaceuticals or computer technology in this aspect. In response to these developments and to assure the quality and safety of the product that are reaching the market, in most countries there have been established regulatory mechanisms for medical devices approval before been placed on the market. In the EU, for instance, after the introduction of the Medical Devices Directives (MDDs) for AIMDs (90/385/EEC), MDs 93/42/EEC and IVDs 98/79/EC, these directives have been accompanied by several guidelines on classification, nomenclature and vigilance, just to name some. A certification system has been established through the involvement of notified bodies assigned for this task by the Competent Authorities of each member stage, or other linked non-EU countries to this system. Hundreds of harmonized technical standards or European norms (EN) have been and are continuously developed and updated by CEN/CENELEC to face the needs. These directives of the 1990s have been replaced in 2017 by two regulations: one for IVDs (2017/746) and one (2017/745) for all other MDs including AIMDs. These regulations are stricter than the previous directives aiming to improve safety and better protect the patients in a balanced way to avoid big obstacles for innovation. Therefore, control of the EU market seems well regulated, and it is similar in other parts of the world.

xxviii

N. Pallikarakis

Additionally, the regulatory frameworks for MDs over the world contain a provision of a vigilance system that follows them after they have entered the market with an associated adverse event reporting system and in some cases an obligatory parallel post-market surveillance system. These systems aim to increase patient safety by preventing the recurrence of adverse events, like already reported ones. This is achieved by mandating users and manufacturers of medical devices to report to the health authorities, incidents where a medical device has potentially contributed in death or injury of a patient or user, and where appropriate, dissemination of information, which could be used to prevent such repetitions, or to alleviate the consequences of such incidents. Health technology assessment (HTA) for medical devices has also attracted the interest of regulators, and a new Regulation (EU) 2021/2282 has been voted recently aiming to coordinate the way assessment is done for medicines and certain medical devices groups, by the respective national HTA agencies. This regulation is planned to be applied by January 2025. For medical devices, it also is recently recognized that they need a different approach of assessment, considering their big differences with medicines, in their way of application, action and use. It is therefore clear that both placing MDs on the market and their assessment are well regulated. However, the third pillar of medical technology safety, that is management of MDs during use, remains non-regulated. In fact, the way the medical devices are maintained, repaired and used is left to the healthcare units they belong. Quality control, preventive maintenance, repair or withdraw do not necessarily imply certified involved parties or users. This last issue is very critical, since correct application of medical technology, as intended by the manufacturer, is of prime importance for diagnosis, treatment and overall safety of the patients. According to data extracted by the Manufacturer and User Facility Device Experience (MAUDE) database of the US Food and Drug Administration (FDA), almost 3 million adverse event reports, involving MDs, are submitted each year. A large proportion of them are due with use errors. There are several reasons behind the large increase in the number of adverse events attributed to non-appropriate use of medical devices. Among these can be mentioned the variety of devices available today, their non-uniform instructions for use, the nonself-evident user interfaces of the medical equipment that are often computer driven, etc. For instance, in a medium-sized modern hospital of less than one thousand beds, one could find more than 15 different types/models of infusion pumps, 17 different types/models of portable ventilators, 10 different types/models of ICU ventilators, 20 different types/models of multiple vital physiological parameters monitoring systems and 35 different types/models of bedside monitoring systems. This situation creates a burden for the medical and paramedical staff that must pass from one device to the next, with completely different user handling requirements, thus increasing the risks for an adverse event due to use error. Therefore, it is very important to establish regular and continuous user training programs to maintain the knowledge and skills of medical and paramedical personnel, in the principles of operation and the practical use of medical devices. There are various ways to implement such programs nowadays. Apart from the traditional face-to-face

Importance of Training Healthcare Professionals in Medical Technology

xxix

or distance learning courses, there are numerous alternatives for synchronous or asynchronous teaching approaches that have been developed to respond on the needs imposed by the COVID-19 pandemic. Additionally, new simulation means are available for virtual training, and finally, the use of AI is expected to greatly increase the way courses will be prepared and presented in the future.

Nanocomposites and Polymer Thin Films: From Gas Phase Synthesis to Functional Applications

Stefan Schröder1 , Alexander Vahl1 , Salih Veziroglu1 , Oleg Lupan1,2 Cenk Aktas1 , Thomas Strunskus1 and Franz Faupel1

,

1 Chair

for Multicomponent Materials, Department of Materials Science, Faculty of Engineering, Kiel University, Kaiserstraße 2, 24143 Kiel, Germany [email protected] 2 Center for Nanotechnology and Nanosensors, Department of Microelectronics and Biomedical Engineering, Technical University of Moldova, 168 Stefan cel Mare Av., 2004 Chisinau, Moldova Among the functional nanocomposites, our group has focused on highly filled particulate metal-dielectric nanocomposites films due to their unique functional properties with hosts of applications. To explore collective interactions between the particles, we control the particle separation on the nanoscale by employing vapor phase deposition, which is a scalable approach permitting, inter alia, excellent control of the filling factor. For deposition of functional polymer thin films, we have recently used initiated chemical vapor deposition (iCVD) to avoid decomposition of the functional groups [1]. Examples include highly stable electrets for electret microphones and magnetoelectric sensors [2], 3D superhydrophobic coatings [3], nanoscale gradient copolymers and strain-invariant conductors for soft robotics [4]. For the fabrication of the nanocomposites, the nanoparticles can form during gas phase co-deposition via self-organization or by means of high-rate gas aggregation cluster sources, which provide independent control of filling factor and size as well as in situ monitoring and control of the composition of alloy nanoparticles. Recent examples of nanocomposites range from plasmonic metamaterials through photoswitchable [5] molecular plasmonic systems to memristors and memsensors for neuromorphic electronics [6]. We also explored nanoscale synergetic effects of plasmonics and photocatalysis [7], e.g., for photoinduced enhanced Raman spectroscopy (PIERS) [8]. In cooperation with the group of Oleg Lupan, we have also used alloy nanoparticles with tailored composition to enhance the sensitivity and selectivity of chemical sensors made up of micro- and nanostructured wide bandgap semiconductors [9]. Cross-sensitivity against moisture could be successfully eliminated with fluoropolymer coatings deposited by iCVD [10]. In addition to particulate nanocomposites, we are also concerned with multilayer nanocomposites. Here, emphasis is put on magnetoelectric sensors consisting of magnetostrictive and piezoelectric components on a vibrating beam. We also use electrets for readout and for obtaining a well-defined nonlinear restoring force [11].

xxxii

S. Schröder et al.

References 1. Schröder, S., Polonskyi, O., Strunskus, T., Faupel, F.: Nanoscale gradient copolymer films via single-step deposition from the vapor phase. Mater. Today 37, 35–42 (2020). https://doi.org/10.1016/j.mattod.2020.02.004 2. Schröder, S., Strunskus, T., Rehders, S., Gleason, K., Faupel, F.: Tunable polytetrafluoroethylene electret films with extraordinary charge stability synthesized by initiated chemical vapor deposition for organic electronics applications. Sci Rep 9, 2237 (2019). https://doi.org/10.1038/s41598-018-38390-w 3. Aktas, O.C., et al.: Superhydrophobic surfaces: superhydrophobic 3D porous PTFE/TiO2 hybrid structures. Adv. Mater. Interfaces 6, 1970029 (2019). https:// doi.org/10.1002/admi.201801967 4. Barg, I., et al.: Strain-invariant, highly water stable all-organic soft conductors based on ultralight multi-layered foam-like framework structures. Adv. Funct. Mater. 221268 (2023). https://doi.org/10.1002/adfm.202212688 5. Burk, M.H.,et al.: Fabrication of diazocine-based photochromic organic thin films via initiated chemical vapor deposition. Macromolecules 53, 1164 (2020). https:// doi.org/10.1021/acs.macromol.9b02443 6. Vahl, A., Carstens, N., Strunskus, T., Faupel, F., Hassanien, A.: Diffusive memristive switching on the nanoscale, from individual nanoparticles towards scalable nanocomposite devices. Sci. Rep. 9, 1 (2020). https://doi.org/10.1038/s41598-01953720-2 7. Veziroglu, S., et al.: Photodeposition of Au nanoclusters for enhanced photocatalytic dye degradation over TiO2 thin film. ACS Appl. Mater. Interfaces 12, 149 (2020). https://doi.org/10.1021/acsami.9b18817 8. Shondo, J., et al.: Nanoscale synergetic effects on Ag–TiO2 hybrid substrate for photoinduced enhanced Raman spectroscopy (PIERS) with ultra-sensitivity and reusability. Small 18, 2203861 (2022). https://doi.org/10.1002/smll.202203861 9. Vahl, A., et al.: Surface functionalization of ZnO:Ag columnar thin films with AgAu and AgPt bimetallic alloy nanoparticles as an efficient pathway for highly sensitive gas discrimination and early hazard detection in batteries, J. Mater. Chem. A 8, 16246–16264 (2020). https://doi.org/10.1039/D0TA03224G 10. Schröder, S., et al.: Sensing performance of CuO/Cu2O/ZnO:Fe heterostructure coated with thermally stable ultrathin hydrophobic PV3D3 polymer layer for battery application. Mater. Today Chem. 23, 100642, 2468–5194 (2022). https://doi.org/10. 1016/j.mtchem.2021.100642 11. Mintken, M., et al.: Nanogenerator and piezotronic inspired concepts for energy efficient magnetic field sensors. Nano Energy 70, 104420 (2020). https://doi.org/10. 1016/j.nanoen.2018.11.031

3D Nanoarchitectures—A Novel Class of Materials: Perspective for Sustainable Development

Vladimir M. Fomin1,2 1 Leibniz

Institute for Solid State and Materials Research (IFW) Dresden, Dresden, Germany [email protected] 2 Moldova State University, Chi¸sin˘ au, Moldova

Extending nanostructures into the third dimension has become a vibrant research avenue in condensed-matter physics, because of geometry- and topology-induced phenomena. Modern advances of high-tech fabrication techniques have allowed for generating geometrically and topologically nontrivial manifolds at the nanoscale, which determine novel, sometimes counterintuitive, electronic, magnetic, optical and transport properties of such objects and unprecedented potentialities for design, functionalization and integration of nanodevices due to their complex geometry and nontrivial topology [1]. I will focus on three directions of key importance for sustainable development of technologies. Firstly, recently suggested Möbius-strip microcavities [2] as integrable and Berryphase-programmable optical systems are of great interest in topological physics and emerging classical and quantum photonic applications. For photons resonating in a Möbius-strip cavity, the occurrence of an extra phase—known as the Berry phase— with purely topological origin is expected due to its nontrivial evolution in parameter space. However, despite numerous theoretical investigations, characterizing the optical Berry phase in a Möbius-strip cavity has remained elusive. Here we report the experimental observation of the Berry phase generated in optical Möbius-strip microcavities. In contrast to theoretical predictions in optical, electronic and magnetic Möbius-topology systems where only Berry phase π occurs, we demonstrate that a variable Berry phase smaller than π can be acquired by generating elliptical polarization of resonating light. Secondly, an efficient tailoring of acoustic phonon energy spectrum in rolled-up multishell tubular structures [3] opens up prospective applications in microelectronics, in cases when low heat conduction is required. The phonon energy spectra in the Si/SiO2 multishell nanotubes are obtained using the atomistic lattice dynamics approach. Thermal conductivity is calculated using the Boltzmann transport equation within the relaxation time approximation. Redistribution of the vibrational spectra in multishell nanotubes leads to a decrease of the phonon group velocity and the thermal conductivity as compared to homogeneous Si nanowires. Phonon scattering on the Si/SiO2 interfaces is another key factor of strong reduction of the thermal conductivity in these structures (down to 0.2 Wm−1 K−1 at room temperature). We demonstrate that phonon

xxxiv

V. M. Fomin

thermal transport in Si/SiO2 nanotubes can be efficiently suppressed by a proper choice of nanotube geometrical parameters: lateral cross section, thickness and number of shells. Thirdly, prospect directions and challenges in the domain of superconductivity and vortex matter in curved 3D nanoarchitectures and their great potential for magnetic field sensing, bolometry and information technology have been demonstrated [4]. A topological transition between the vortices and phase slips under a strong transport current is found in open superconductor Nb nanotubes with a submicron-scale inhomogeneity of the normal-to-the-surface component of the applied magnetic field [5]. This transition determines the magnetic field−voltage and current−voltage characteristics, which imply a possibility to efficiently tailor the superconducting properties of nanostructured materials by inducing a nontrivial topology of superconducting screening currents. A transition between the vortex and phase-slip regimes depends on the magnetic field only weakly if the magnetic field and/or transport current are switched on gradually. In the case of an abrupt switch-on of the magnetic field or transport current, the system can be triggered to the stable phase-slip regime within a certain window of parameters. A hysteresis effect in the current–voltage characteristics is predicted in superconductor open nanotubes [6]. Dynamic topological transitions in open superconductor nanotubes occur under a combined DC+AC transport current [7]. The key effect is a transition between two regimes of superconducting dynamics. The first regime is characterized by a pronounced first harmonic in the Fast Fourier Transform (FFT) spectrum of the induced voltage at the AC frequency. It is typical of two cases, when the dominant area of the open tube is superconducting at relatively low magnetic fields and/or weak DC currents or normal at relatively high magnetic fields and/or strong DC currents. The second regime is represented by a rich FFT spectrum of the induced voltage with pronounced low-frequency components due to an interplay between the dynamics of superconducting vortices or phase slips and those driven by the AC.

References 1. Fomin, V.M.: Self-rolled Micro- and Nanoarchitectures: Topological and Geometrical Effects. De Gruyter, Berlin, Boston (2021) 2. Wang, J., et al.: Experimental observation of berry phases in optical möbius-strip microcavities. Nat. Photonics 17, 120–125 (2022). https://doi.org/10.1038/s41566022-01107-7 3. Isacova, C., Cocemasov, A., Nika, D.L., Fomin, V.M.: Phonons and thermal transport in Si/SiO2 multishell nano-tubes: atomistic study. Appl. Sci. 11(8), 3419, 1–12 (2021). https://doi.org/10.3390/app11083419 4. Fomin, V.M., Dobrovolskiy, O.V.: A Perspective on superconductivity in curved 3D nanoarchitectures. Appl. Phys. Lett. 120(9), 090501, 1–12 (2022). 5. Rezaev, R.O., Smirnova, E.I., Schmidt, O.G., Fomin, V.M.: Topological transitions in superconductor nanomembranes in a magnetic field with submicron inhomogeneity under a strong transport current. Commun. Phys. 3, 144, 1–8 (2020). https://doi.org/ 10.1038/s42005-020-00411-4

3D Nanoarchitectures—A Novel Class of Materials

xxxv

6. Bogush, I., Fomin, V. M.: Topological defects in superconductor open nanotubes after gradual and abrupt switch-on of the transport current and magnetic field, Phys. Rev. B 105(9), 094511, 1–11 (2022). https://journals.aps.org/prb/abstract/10.1103/ PhysRevB.105.094511 7. Fomin, V.M., Rezaev, R.O., Dobrovolskiy, O.V.: Topological transitions in ac/dcdriven superconductor nanotubes. Sci. Rep. 12, 10069, 1–10 (2022). https://www.nat ure.com/articles/s41598-022-13543-0

Engineering Heterostructured Nanomaterials for Nanoelectronic and Biomedical Applications

Oleg Lupan1,2 1 Technical

University of Moldova, 168 Stefan cel Mare Av., 2004 Chisinau, Moldova [email protected] 2 Kiel University, Kaiserstraße 2, 24143 Kiel, Germany

Engineering heterostructured nanomaterials for nanoelectronics, as well as for biomedical applications, have attracted huge attention in the past decade. It is because heterostructured nanomaterials are constructed by two or more single-component nanoparticles with certain structure, order of nanolayers and synergistically enhanced functional properties. Heterostructures made of nanoparticles and nanostructured thin films or metalorganic frameworks are integrating advantages of porosity, nanosize, structure, optical and electrical performances. Recently, diverse nano-heterostructured materials are engineered and grown through various approaches and strategies and have proved promising potential for applications in battery safety sensors (BAS), gas, vapor and UV sensors, as well as biosensors for biomedical applications [1–7]. Novel two-in-one battery safety sensors have been developed based on the CuO/Cu2 O and TiO2 /CuO/Cu2 O heterostructures, as an example of real application [1–4]. These sensors enable early detection of solvents or the vapors of their degassing products, which are produced by Li-ion batteries at the onset of runaway [1–5]. Coating ZnO nanocolumns using Al2 O3 and thermal annealing offers the resulting Al2 O3 /ZnO heterostructure that enhances the gas sensing properties toward the detection of the components in the electrolytes of the lithium-ion batteries. Columnar films of Al2 O3 /ZnO with a thickness of 10 nm for the top-coating layer exhibit the highest sensitivity and selectivity toward the vapors of C3 H4 O10 . Experimental and computed results indicate that relative humidity will not affect the sensing properties of the such heterostructures toward the volatile organic compounds (VOCs) and degassing products used in the electrolytes of lithium-ion batteries [1–6]. As well as, new two-in-one sensor for NH3 and H2 detection is discussed, which ensures stable, precise and very selective characteristics for the tracking of these vapors at low concentrations. The fabricated TiO2 layers, which were annealed at 610 °C, formed two crystal phases, anatase and rutile, and after coverage with a thin PV4D4 polymer nanolayer via initiated chemical vapor deposition (iCVD), show response to ammonia at room temperature and exclusive hydrogen detection at elevated operating temperatures. These results open new possibilities for applications, e.g., like biomedical diagnosis, biosensors and the development of non-invasive technology [7]. Compared to unprotected CuO/Cu2 O/ZnO:Fe, the coated CuO/Cu2 O/ZnO:Fe exhibits a much better sensing performance at higher relative humidity and tunability of the gas selectivity [3].

xxxviii

O. Lupan

The higher responses to specific volatile organic compounds, VOCs, are controlled and tailored for the samples synergistically enhanced with dopants and nanoparticles simultaneously. In addition, the recovery times are reduced for the developed nanocolumnar layers for a range of operating temperatures. The response of the synergistically enhanced sensors to gas molecules containing certain functional groups is in excellent agreement with density functional theory calculations performed in our work too [8]. This new fabrication strategy can underpin the next generation of advanced materials for photocatalytic, VOC, and gas sensing applications and prevent levels that are hazardous to human health and can cause environmental damage. As well as, it can be used for detecting gases used as traces for specific molecules that act as biomarkers in exhaled breath or outgassing VOCs of various biological systems. Acknowledgments. This research was funded by the SulfurSilicon Batteries (SuSiBaBy) Project (LPW-E/3.1.1/1801), which was funded by the EUSH and EFRE in SH.

References 1. Lupan O., et al.: Heterostructure-based devices with enhanced humidity stability for H2 gas sensing applications in breath tests and portable batteries. Sens. Actuators A Phys. 329, 112804 (2021). https://doi.org/10.1016/j.sna.2021.112804 2. Schröder S., et al.: Tuning the selectivity of metal oxide gas sensors with vapor phase deposited ultrathin polymer thin films. Polymers (Basel) 15, 524 (2023). https://doi. org/10.3390/polym15030524 3. Schröder S., et al.: Sensing performance of CuO/Cu2 O/ZnO:Fe heterostructure coated with thermally stable ultrathin hydrophobic PV3D3 polymer layer for battery application. Mater. Today Chem. 23, 100642 (2022). https://doi.org/10.1016/j.mtchem. 2021.100642 4. Lupan O., et al.: TiO2 /Cu2 O/CuO multi-nanolayers as sensors for H2 and volatile organic compounds: an experimental and theoretical investigation. ACS Appl. Mater. Interfaces 13, 32363–32380 (2021). https://doi.org/10.1021/acsami.1c04379 5. Lupan O., et al.: Development of 2-in-1 sensors for the safety assessment of lithiumion batteries via early detection of vapors produced by electrolyte solvents. ACS Appl. Mater. Interfaces 13, 32363–32380 (2023). https://doi.org/10.1021/acsami.3c0 3564 6. Santos-Carballal, D., et al.: Al2 O3 /ZnO composite-based sensors for battery safety applications: an experimental and theoretical investigation. Nano Energy 109, 108301 (2023). https://doi.org/10.1016/j.nanoen.2023.108301 7. Brinza M., et al.: Biosensors 13(5), 538 (2023). https://doi.org/10.3390/bios13050538 8. Postica V., et al.: ACS Appl. Mater. Interfaces 1131452−31466 (2019). https://doi. org/10.1021/acsami.9b07275

Brain-Like Artificial Neural Network Based on Superconducting Neurons and Synapses

Anatolie Sidorenko1,2 1 Institute

of Electronic Engineering and Nanotechnologies “D.GHITU”, Technical University of Moldova, Str. Academiei 3/3, 2028 Chisinau, Moldova [email protected] 2 Skobeltsyn Institute of Nuclear Physics, Moscow State University, 119991 Moscow, Russia Energy efficiency and the radically reduction of the power consumption level become a crucial parameter constraining the advancement of supercomputers. The most promising solution is design and development of the brain-like systems with non-von Neumann architectures, first of all— the artificial neural networks (ANNs) based on superconducting elements. Superconducting ANN needs elaboration of two main elements—nonlinear switch, neuron [1], and linear connecting element, synapse [2]. We present results of our design and investigation of artificial neurons, based on superconducting spin valves—S/F/S Josephson Junctions with weak-link F fabricated from magnetic material (Ni or alloy CuNi) and superconducting synapse based on layered hybrid structures superconductor/ferromagnet. We obtained and analyzed results of experimental study of the proximity effect in a stack-like superconductor/ferromagnet (S/F) superlattices Nb/Co with F = Co ferromagnetic layers of different thicknesses and coercive fields and S = Nb superconducting layers of constant thickness equal to coherence length of niobium which can serve as an artificial synapse. The superlattices Nb/Co demonstrate change of the superconducting order parameter in thin niobium films due to switching from the parallel to the antiparallel alignment of neighboring ferromagnetic layers magnetization. We argue that such superlattices can be used as tunable kinetic inductors for ANN synapses engineering. As the result of design of the ANN, using that two elaborated base elements, artificial neurons and artificial synapses, allows construction of the computer with 6–7 orders of magnitude lower energy consumption in comparison with the traditional computer designed from semiconducting base elements. The study was supported by Grant RSF No. 22-79-10018 “Controlled kinetic inductance based on superconducting hybrid structures with magnetic materials” (theory development, samples measurements, results evaluation) and by the Moldova State Program Project «Functional nanostructures and nanomaterials for industry and agriculture» No. 20.80009.5007.11 (samples fabrication and characterization).

xl

A. Sidorenko

Fig. 1. a) TEM image of the artificial neuron—Nb/F/Nb Josephson Junction, b) sketch of the Nb/F/N Josephson Junction with F-magnetic material (Ni, or CuNi), c) I–V switching curve of the Nb/CuNi/Nb Josephson Junction at fixed temperature T = 0,5 K, d) c) I–V switching curves of the Nb/Ni/Nb Josephson Junction at number of fixed temperatures listed in the inset, e) temperature dependence of the critical current of Nb/CuNi/Nb Josephson Junction and f) temperature dependence of the critical current of the set of Nb/Ni/Nb Josephson Junctions with various thickness of the Ni layer

References 1. Klenov, N., et al.: Periodic Co/Nb pseudo spin valve for cryogenic memory. Beilstein J. Nanotechnol. 10, 833–839 (2019). https://doi.org/10.3762/bjnano.10.83 2. Bakurskiy, S., et al.: Controlling the proximity effect in a Co/Nb multilayer: the properties of electronic transport. Beilstein J. Nanotechnol. 11, 1336–1345 (2020). https://doi.org/10.3762/bjnano.11.118

Evaluation of Health Technology in Republic Moldova

Victor Sontea1

and Artur Buzdugan2

1 President

of Moldovan Biomedical Engineering Society; Head of National Center of Biomedical Engineering, Technical University of Moldova, Republic of Moldova [email protected] 2 Technical University of Moldova, Republic of Moldova Medical devices (MDs) are indispensable in performing the medical act, and their importance has become a priority at the medical institution level as well as at the national level. To ensure the efficient functioning of a health system, it is necessary to equip it with medical devices, in accordance with the progress of medical technologies. However, the use of quality, safe and effective medical devices also requires qualified human resources, as well as the implementation of an effective management of medical devices [1]. The degree of endowment with high-performance medical devices and ensuring an appropriate level of professionalism of the medical staff are the key tools in ensuring the good functioning of the health system and exert a direct impact on the functional effectiveness of the system, on the quality of the service and the degree of satisfaction of the beneficiary .The effective use of them presupposes, as a matter of priority, the increase in the number of cost-effective and qualitative investigations and treatment. For these reasons, the WHO recommends and it is essential to have a policy at the national level regarding the Management of Medical Devices (MMD), which includes the provision of DM, ensuring the maintenance, verification and correct use of medical technologies, the training of specialists in the field, the creation of a system of their continuous training, etc. In the Republic of Moldova, Law no. 102 of June 9, 2017, regarding medical devices with the aim of adjusting the legal framework of the Republic of Moldova to the community, acquired for the implementation of European technical regulations in the field of MD and consumer protection of medical services, offered through the application of MD. The signed law stipulates the definitions according to the European Directives with application to DM and establishes that they can be introduced on the market, put into operation or used only if they are certified and registered, so that they do not affect the safety and health of patients, users and other people and the environment. With the support of the Swiss Development and Cooperation Agency through the PERINAT and REPEMOL projects, all existing procedures related to MDD at the hospital level were analyzed, the necessary set of procedures was defined, and the model of MD management and administration procedures was developed, which were initially implemented in five medical institutions and were developed with the support of JICA, the Guide regarding the establishment criteria, roles and responsibilities of biomedical engineering departments/sections within medical institutions. The results of the MDM evaluation at the medical institution level demonstrated the positive impact in the efficient use of the DM, the reduction of the maintenance expenses

xlii

V. Sontea

of the DM, through appropriate internal services in a timely manner, the increase in the cost-efficiency and safety of the medical act. In the same context, the Mother and Child Institute jointly with the Technical University of Moldova established the “Management of Medical Technologies” Pilot Center, which aims to develop procedure models for MMD to European and international standards, the development of procedures for maintenance, diagnosis and repair of medical devices, with the support of JICA, 5 departments of Biomedical Engineering were organized. According to the Statistical Yearbook of the Republic of Moldova for 2020, 12,552 doctors and 23,584 medical personnel worked in the health system, of which 18,514 were nurses—all users of medical devices. One of the most important roles in the management of medical devices belongs, of course, to the personnel responsible for the maintenance of medical devices (medical bioengineers, technical engineers, technicians, mechanics, etc.). Starting from 2016 and until now, annual evaluations have been carried out regarding the endowment of the health system with human resources (medical bioengineers, engineers and technicians). Recent evaluations have shown that their total number is about 150, of which 50 are medical bioengineers. At the same time, the real need of the health system being over 300 medical bioengineers. For this purpose, the National Biomedical Engineering Center within the Technical University of Moldova [2], authorized by law with such functions, plays a special role in the periodic training and improvement of staff. The expected result following the implementation of the MMD is ensuring the quality of medical devices and optimizing the use of public financial means through a proposed rational and efficient management. Acknowledgments. This work was supported by Project 20.80009.8007.26 “Piloting the application of the principles of personalized medicine in the conduct of patients with chronic non-communicable diseases”, contracting authority: National Agency for Research and Development, Republic of Moldova.

References 1. Sontea V., Buzdugan A.: Management of medical technologies in the Republic of Moldova – the basic component of safety, efficiency, and quality of medical services. J. Med. Health Sci. Educ. East. Europe Cent. Asia (MEDH-EECA) 1(2), 34–44 (2022). https://lsmu.lt/wp-content/uploads/2022/10/MEDH-EECA-2022-Volume-1No-2-web.pdf. ISSN 2783-6797 2. The Law on Medical Devices no. 102, no. 244–251, 389. Monitorul oficial of the Republic of Moldova (2017). https://www.legis.md/cautare/getResults?doc_id=105 695&lang=ro. Accessed 9 June 2017

New Areas of Research and Applications for GaN

Ion M. Tiginyanu

and Tudor Braniste

Academy of Sciences and Technical University of Moldova, Chisinau, Republic of Moldova [email protected] The properties of semiconductor materials can be modified in a controlled fashion, or even new characteristics may be brought to light by building hybrid 3D nanoarchitectures. The goal of this presentation is to review the research efforts undertaken over the last years to develop novel bio-inspired hybrid 3D nanoarchitectures based on binary compounds such as GaN, ZnS, ZnO and TiO2 . One of the most promising 3D nanoarchitectures proves to be the so-called aero-GaN or Aerogalnite, which represents the first artificial material exhibiting dual hydrophobic–hydrophilic behavior, its characteristics being close to those inherent to a biological cell membrane. The Aerogalnite consists of gallium nitride hollow micro-tetrapodal structures with nanoscopic thin walls, the inner surface being covered by an ultrathin film of zinc oxide [1]. The lateral faces of GaN tetrapods were found to show hydrophobic properties, while the free end of the arms—hydrophilic ones. This new result was achieved in close collaboration with other research groups (see [1] and https://physicsworld.com/a/hydrophobic-or-hydrophilicaero-gallium-nitride-is-both/). Approaching each other hollow GaN tetrapods floating on the water surface leads to the formation of waterproof rafts showing impressive stretching and cargo performances. The interaction between tetrapods resembles the interaction of fire ants forming live rafts on the water surface which enable the insects to survive during floods [2, 3]. The elasticity and stretching performances of self-assembled aero-GaN membranes were studied using communicating vessels. It was found that the aero-tetrapods of gallium nitride interact with each other on the water surface until a consolidated membrane forms. The membrane is elastic and can be used as a separation barrier between liquids, avoiding direct contact and mixing, but keeping the gas exchange due to a very high degree of porosity. We found that the membranes can withstand liquid droplets hundreds of times heavier than the membrane [1]. It was found that aero-GaN platelets with the thickness of 1–2 mm exhibit impressive shielding capabilities against electromagnetic radiation in a wide range of frequencies including Gigahertz and Terahertz ones [4, 5]. The shielding effectiveness in the frequency range from 0.25 to 1.37 THz exceeds 40 dB, which places Aerogalnite among the known best Terahertz shields. We succeeded in preparing liquid marbles using GaN aero-tetrapods. In order to explore the aero-GaN liquid marble properties, different deviations from the spherical symmetry were induced during the fabrication process. It was found that aero-GaN-based liquid marbles exhibit energy-efficient long-term translational movement for several

xliv

I. M. Tiginyanu and T. Braniste

hours and fast velocity of rotation up to 750 rpm [1]. The rotation speed and the time decay of spinning liquid marbles are highly dependent on their weight. The lighter liquid marbles show higher rotation speed, while the heavier ones are characterized by a much higher inertia keeping the spinning for a longer time [6]. The rotation of liquid marbles is highly dependent on the specific architecture of the enveloping shell consisting of GaN hollow microtetrapods with dual hydrophilic–hydrophobic properties, and the deviations from the spherical shape lead to behavioral changes of the marbles. It was found that elongated liquid marbles exhibit pulsed rotation, attaining the same maximum speed of rotation at each pulse, after which the speed of rotation drops down sharply. This phenomenon was described by using a simple analytical model which takes into account the uplift of the marble and formation of water columns underneath during the spinning process. When the rotation speed increases, the marble tends to detach from the water surface, which leads to interruption of the propulsion mechanism, and consequently, the marble drops on the water surface and continues the rotation at much lower speed [6]. In the plenary report, results of investigation of architectures based on Ga2 O3 , ZnS, TiO2 will be presented as well and the areas of possible applications of these aeromaterials will be discussed. The research was funded by National Agency for Research and Development of Moldova under Grant #20.80009.5007.20 “Nanoarhitecturi în baz˘a de GaN s, i matrici tridimensionale din materiale biologice pentru aplicat, ii în microfluidic˘a s, i inginerie tisular˘a” and by the European Commission under Grant #810652 “NanoMedTwin”.

References 1. Tiginyanu, I., et al.: Self-organized and self-propelled aero-GaN with dual hydrophilic-hydrophobic behaviour. Nano Energy 56, 759–769 (2019). https://doi. org/10.1016/j.nanoen.2018.11.049 2. Hu, D.L., Chan, B., Bush, J.W.M.: The hydrodynamics of water strider locomotion. Nature 424, 663–666 (2003). https://doi.org/10.1038/nature01793 3. Mlot, N.J., Tovey, C.A., Hu, D.L.: Fire ants self-assemble into waterproof rafts to survive floods. Proc. Natl. Acad. Sci. U.S.A. 108, 7669–73 (2011). https://doi.org/ 10.1073/pnas.1016658108 4. Braniste, T., et al.: Terahertz shielding properties of aero-GaN. Semicond. Sci. Technol. 34(12), 12LT02 (2019). https://doi.org/10.1088/1361-6641/ab4e58 5. Dragoman, M., et al.: Electromagnetic interference shielding in X-band with aeroGaN. Nanotechnology 30(34), 34LT01 (2019). https://doi.org/10.1088/1361-6528/ ab2023 6. Braniste, T., et al.: Self-propelled Aero-GaN based liquid marbles exhibiting pulsed rotation on the water surface. Materials 14(17), 5086 (2021). https://doi.org/10.3390/ ma14175086

Manifestations of Unconventional Pairing Symmetry in Superconducting Hybrids

A. A. Golubov1,2 1 Faculty

of Science and Technology, University of Twente, The Netherlands 2 Moscow Institute of Physics and Technology, Russia

Superconducting states with broken time-reversal symmetry may arise in structures with nontrivial topological properties and are currently of high interest from fundamental and applied points of view. We will discuss theoretical basis for the description of interfaces between unconventional superconductors (S) and normal metals (N). We will present the results for electronic and spin transport in multiterminal S/N hybrid structures [1–3]. Technically, the derivation of boundary condition for the Nambu-Keldysh quasiclassical Green’s functions at the S-N interfaces will be outlined. Of particular interest is application to superconductors with mixed s + p-wave superconducting pairing symmetry, including the cases of chiral and helical p-wave state in two dimensions, as well as the so-called Balian-Werthamer state in three dimensions. The local density of states, charge and spin conductance will be discussed. The cases will be identified when the proximity-induced pairing in N has odd-frequency spin-triplet s-wave symmetry. This state is characterized by the existence of a robust zero-energy Andreev bound state. Within the developed approach, three- and four-terminal S/N structures are investigated where the superconducting potential is a mixture between s-wave and p-wave potentials. The ways are proposed to determine whether S has a mixed pair potential and to distinguish between chiral and helical p-wave superconductivity. In this case, a difference in conductance for electrons with opposite spins arises if both an s-wave and a p-wave components are present, even in the absence of a magnetic field. It is shown that a setup containing two S-N junctions provides a clear difference in spin conductance between the s + chiral p-wave and s + helical p-wave symmetries. Further, we propose new approach to distinguish p-wave from s-wave symmetry by measuring conductance in a four-terminal junction consisting of S and N terminals. The N terminals are used to manipulate the energy distribution functions of electrons in the junction in order to control the charge transport. It is shown that the differential conductance of junctions containing p-wave and s-wave superconductors is distinctly different, thus providing experimental test to detect potential p-wave superconductivity. Acknowledgement. The work is partially supported by Grant 23-72-30004 from Russian Science Foundation.

xlvi

A. A. Golubov

References 1. Tanaka, Y., Kokkeler, T.H., Golubov, A.A.: Phys. Rev. B 105, 214512 (2022) 2. Kokkeler, T.H., Golubov, A.A., Geurts, B.J.: SUST 35, 084005 (2022) 3. Kokkeler, T.H., Tanaka, Y., Golubov, A.A.: Phys. Rev. Res. 5, L012022 (2023)

Perspective of Electronics at Atomic Scale—2D SnS—A Ferroelectric for Low-Power Applications

Mircea Dragoman1 , Daniela Dragoman2,3 , Adrian Dinescu1 , Andrei Avram1 , Silviu Vulpe1 , Martino Aldrigo1 , Tudor Braniste4 , Victor Suman5 , Emil Rusu5 and Ion Tiginyanu4,6 1 National

Institute for Research and Development in Microtechnologies, Erou Iancu Nicolae Street 126A, Voluntari (Ilfov), Romania 2 Physics Faculty, University of Bucharest, PO Box MG-11, 077125 Bucharest, Romania 3 Academy of Romanian Scientists,, Str. Ilfov 3, 050044 Bucharest, Romania 4 National Center for Materials Study and Testing, Technical University of Moldova, 168 Stefan cel Mare Av., 2004 Chisinau, Moldova 5 Institute of Electronic Engineering and Nanotechnologies, Academiei Street 3/3, 2028 Chisinau, Moldova 6 Academy of Sciences of Moldova, 1 Stefan cel Mare Av., 2004 Chisinau, Moldova

In this work, we show that 2D tin sulfide (SnS) is an in-plane ferroelectric with important microwave properties. Further, we will show that field-effect transistors based on 2D SnS have a subthreshold below 60 mV/decade. Further, we demonstrate experimentally that a 10 nm thick SnS thin-film-based back-gate transistors which in the absence of the gate voltage, the drain current versus drain voltage (I D – V D ) dependence, are characterized by a rather weak ambipolar drain current. Applying a gate voltage as low as 1 μV, the current increases by several orders of magnitude and the I D – V D dependence changes drastically, with the SnS behaving as a p-type semiconductor. This happens because the current flows from the source (S) to the drain (D) electrode through a discontinuous superficial region of the SnS film when no gate voltage is applied. On the contrary, when minute gate voltages are applied, the vertical electric field applied to the multilayer SnS induces a change in the flow path of the charge carriers, involving the inner and continuous SnS layer in the electrical conduction. Thus, we demonstrate that we can switch reversible the channel of a FET in on/off states with 1 μV gate voltage, the lowest known to date.

Contents

Clinical Engineering and Bioinstrumentation Publication Practices Among Pivotal Clinical Trials of High-Risk Medical Devices . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Gleb Donin and Martin Kozik Three Dimensional X-ray CT Reading Assistance System with Video See Through Display . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Hiroki Kase, Junichi Nishizawa, Kento Tabata, Katsuyuki Takagi, and Toru Aoki Videosupported Treatment as Method of Delivering the Healthcare to Tuberculosis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Evelina Lesnic, Alina Malic, Adriana Niguleanu, and Tatiana Osipov Feasibility Study for a Robotic Laparoscopic Surgical System in a Greek Public Hospital . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Spilios Zisimopoulos, Aris Dermitzakis, Anastasia Daskalaki, Mary Marinou, and Nicolas Pallikarakis Integration of Scpi over Vxi-11 Protocols in an Automated Gas Sensing Measurement System . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Alexandr Sereacov Assisting Deaf and Hard-of-Hearing People in Critical Situations: Alleviating Stress and Enhancing Safety . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Oana-Isabela S, tirbu, Ioana-Raluca Adochiei, Ruxandra-Victoria Paraschiv, S, erban-Teodor Nicolescu, Felix-Constantin Adochiei, and George-C˘alin Serit, an Evaluation of the Maintenance System of Medical Equipment – A Necessity for Implementing an Effective Quality System . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Calin Corciova, Robert Fuior, Catalina Luca, and Victor Sontea The Surveillance System of Medical Devices, in Which the Responsible Individuals Have an Active Role, is the Guarantee of Patient and Medical Device User Safety . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Gheorghe Gorceag and Victor Sontea

3

11

21

29

39

50

59

68

l

Contents

A New Approach in Detection of Biomarker 2-propanol with PTFE-Coated TiO2 Nanostructured Films . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Stefan Schröder, Mihai Brinza, Vasile Cretu, Lukas Zimoch, Monja Gronenberg, Nicolai Ababii, Serghei Railean, Thomas Strunskus, Thierry Pauporte, Rainer Adelung, Franz Faupel, and Oleg Lupan Biomechanical Analysis of the Balance of the Human Body . . . . . . . . . . . . . . . . . Anca Ioana T˘ataru (Ostafe), Mihaela Ioana Baritz, Angela Repanovici, Corneliu Nicolae Druga, Daniela Mariana Barbu, and Mirela Gabriela Apostoaie Primary Measuring Transducer of a Diagnostic Spirometer Based on a Venturi Flowmeter . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Roman Tomashevskyi and Dmitry Vasilchuk

75

84

93

A LabVIEW Based Brain-Computer Interface Application for Controlling a Virtual Robotic Arm Using the P300 Evoked Biopotentials and the EEG Bandpower Rhythms Acquired from the GTEC Unicorn Headset . . . . . . . . . . . . . 103 Oana Andreea Rusanu Analysis of the Distribution of Forces and Pressures on the Plantar Surface in Different Walking Types . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 113 Anca Ioana T˘ataru (Ostafe), Mihaela Ioana Baritz, Angela Repanovici, Corneliu Nicolae Druga, Daniela Mariana Barbu, and Mirela Gabriela Apostoaie Bioinformatics, Biomedical Signal and Image Processing Measurement of Biokinetic Parameters with the CvMob Program at the Level of the Lower Limb with a Functional 3D Printed Knee Orthosis . . . 125 Alexandru-Constantin Tulic˘a, Ileana-Constant, a Ros, ca, Corneliu-Nicolae Drug˘a, and Ionel S, erban Statistical Distortion Detection of Interference Microscope Image . . . . . . . . . . . . 134 Yevgen Sokol, Pavlo Shchapov, Tatyana Bernadskaya, Oksana Chmykhova, and Kostyantyn Kolisnyk Legal Frameworks for the Integration of Artificial Intelligence . . . . . . . . . . . . . . . 144 Said Saidakhrarovich Gulyamov Irregular Step of Changing for Neural Network Data Sets Improves the Accuracy of Resistive Sensors Calculation . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 150 Alexandr Penin and Anatolie Sidorenko

Contents

li

Mathematical Modelling of the Multifactorial Influence of Striking Fragments on the Dynamics of the Rehabilitation Processes of the Wounded . . . 160 Kostiantyn Kolisnyk, Yevgen Sokol, Pavlo Shchapov, and Volodymyr Nehoduiko NLP Tools for Epileptic Seizure Prediction Using EEG Data: A Comparative Study of Three ML Models . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 170 Victor Iapascurta and Ion Fiodorov A Less Common Algorithmic Complexity Approach to EEG Signal Processing for Machine Learning . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 181 Victor Iapascurta Opportunities and Risks in the Use of Artificial Intelligence Models in Healthcare . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 191 Aurelian Buzdugan, Gheorghe Capatana, and Artur Buzdugan In vivo and in silico Studies of the Neuroprotective Effect of Artemisinin in Prevention of Alzheimer’s Disease in an Animal Model . . . . . . . . . . . . . . . . . . . 199 Susanna Tiratsuyan, Yelena Hambardzumyan, Michael Poghosyan, Margarita Danielyan, and Ashkhen Hovhannisyan Methodology and Use of Experimental Techniques in Analyzing Wound Dynamics of Penetrating Injuries . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 208 Roman Tomashevskyi, Oleksiy Larin, Kostyantyn Kolisnyk, Andrey Zuev, Kostyantyn Gumeniuk, Igor Lurin, and Volodymyr Nehoduiko Computational Modeling and Analysis of Wound Formation in Gunshot Injuries . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 218 Oleksiy Larin, Roman Tomashevskyi, Igor Lurin, Kostyantyn Gumeniuk, and Volodymyr Nehoduiko Approaches to the Processing and Segmentation of Non-electrical Biological Signals . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 228 Robert Fuior, C˘alin Corciov˘a, C˘at˘alina Luca, and Alexandru S˘alceanu Multimodal Machine Learning for Sign Language Prediction . . . . . . . . . . . . . . . . 236 Yassèr Khalafaoui, Nistor Grozavu, Basarab Matei, and Nicoleta Rogovschi Unsupervised Knowledge Extraction from Biomedical Data . . . . . . . . . . . . . . . . . 243 Basarab Matei, Petru Alexandru Vlaicu, Nicoleta Rogovschi, and Nistor Grozavu

lii

Contents

New Technologies for Diagnosis, Treatment, and Rehabilitation, Personalized Approaches in Medicine Modern Methods for Identification and Reduction of Visual Problems in Children . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 257 Barbu-Cristian Braun, Corneliu-Nicolae Drug˘a, Ionel S, erban, and Alexandru Tulic˘a Role of Botulinum Toxin A Injections as a Salvage Therapy for Refractory Overactive Bladder: Insights from Urodynamic Studies . . . . . . . . . . . . . . . . . . . . . 267 Mihaela Ivanov and Emil Ceban Assessing the Impact of Parental Labor Migration on Children’s Health . . . . . . . 278 Galina Gorbunov The Implementation of Personalized Medicine in the Republic of Moldova: Challenges and Opportunities in Cardiology . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 288 Alexei Levitchi, Daniela Galea-Abdusa, Victor Sontea, and Ghenadie Curocichin Thiol-Disulfide Homeostasis in Kidney Tumors in Children . . . . . . . . . . . . . . . . . 299 Jana Bernic, Angela Ciuntu, Elena Hanganu, Victor Roller, Vergil Petrovici, Tatiana B˘alutel, and Eva Gudumac Non Conventional Methods in Visual Function Training for Children with Sight Disabilities . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 308 Barbu-Cristian Braun, Cornelui-Nicolae Drug˘a, Ionel S, erban, and Leonard Mitu Method for Increasing the Production or Activity of Catalase in the Body . . . . . . 318 Lilia Andronache, Valeriana Pantea, Emil Ceban, Aurelian Gulea, Vasilii Graur, Victor T, apcov, Valerii Matcovschii, and Valentin Gudumac Synergy Effect of Ascorbic Acid and α-Tocopherol in Kinetic Model of Lipid Peroxidation . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 326 Evghenii Kanarovskii and Olga Yaltychenko Diagnosing Pulmonary Embolism with Computed Tomography Pulmonary Angiography . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 333 Doina Ranga, Natalia Capros, Andrei Cealan, Ion Sirbu, Cornelia Talmaci, and Sergiu Matcovschi Improvement of Cardiovascular System Diseases Diagnostics by Using Multiparametric Data . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 343 Mykhailo Shyshkin, Serhii Holdobin, and Olha Butova

Contents

liii

Combined and Complex Treatment-Optimal Therapies in Rectal Cancer . . . . . . . 351 Cezara Ungureanu and Nicolae Ghidirim The Peculiarities of Circadian Rhythms and Their Implications on Parkinson’s Disease . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 362 Lilia Rotaru, M˘ad˘alina Cebuc, Adrian Lupus, or, Oxana Grosu, Victor Vovc, Svetlana Lozovanu, Ghenadie C˘ar˘aus, ul, and Stanislav Groppa Updates on the Use of Ozone Therapy in Patients with COVID-19. A Review . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 372 Natalia Cernei, Cristina Trofimov, Ion Grabovschi, Ruslan Baltaga, and Oleg Arnaut Assessment of Oxidative Stress Markers in Obese Patients with Community-Acquired Pneumonia . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 384 Tatiana Dumitras, Diana Fetco-Mereuta, Natalia Capros, Viorica Chihai, Eudochia Terna, Sergiu Matcovschi, and Virginia Cascaval The Prevalence of Allele Frequencies of CYP2C19 Polymorphisms of Clinically Important Drug-Metabolizing Enzymes CYP2C19 in Moldova Healthy Population . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 392 Marta Dogot, Daniela Galea-Abdusa, Anastasia Buza, Ghenadie Curocichin, and Natalia Capros Prospective, Descriptive Study of Rotaviral Infection in Vaccinated and Non-vaccinated Infants from Republic of Moldova . . . . . . . . . . . . . . . . . . . . . 402 Ala Donos and Albina-Mihaela Iliev Personalised Medicine Implementation in Low- and Middle-Income Countries . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 411 Ilenuta Gusila, Alexandra Topa, Natalia Zarbailov, Natalia Lungu, and Ghenadie Curocichin Hemodynamic Protective Assessment of BurnNavi-Guided Fluid Management in Burned Patients: Pilot Study . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 421 Mykola Melnychenko, Dmytro Dmytriiev, Oleksandr Nazarchuk, Ludmila Sidorenko, Roman Chornopyshchuk, Vasyl Nagaichuk, and Svetlana Sidorenko In vivo Evaluation of PMMA Antiglaucoma Shunt’s Biocompatibility . . . . . . . . 431 Maria Iacubitchii, Eugeniu Bendelic, Ala Paduca, Adrian Cociug, and Maria Jesus Giraldez Fernandez

liv

Contents

The Role of Molecular-Genetic Assays in Diagnosis of Pulmonary Tuberculosis in the Republic of Moldova . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 443 Evelina Lesnic and Malic Alina The Relationship Between Dental Caries Damage, Tooth Enamel Hypoplasia and the Particularities of Calcium Homeostasis in Children . . . . . . . . 451 Aurelia Spinei, Olga Balteanu, Svetlana Plamadeala, Elena Hristea, and Iurie Spinei Impact of Tumor Necrosis Factor Alfa on Dental Caries Development in Children with Severe SNC Disorders . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 460 Aurelia Spinei, Svetlana Plamadeala, Olga Balteanu, Elena Hristea, and Iurie Spinei Personalized Medicine Perspectives and Policies in European Nordic Countries . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 471 Maria Garabajiu, Daniela Galea-Abdusa, Alexandra Topa, Ilenuta Gusila, and Ghenadie Curocichin Measurement of Arterial Blood Gases in Elderly Patients with COVID-19 Pneumonia and Chronic Obstructive Pulmonary Disease . . . . . . . . . . . . . . . . . . . . 480 Tatiana Dumitras, Diana Fetco-Mereuta, Virginia Cascaval, Livi Grib, Elena Bivol, Daria Romaniuc, and Viorica Chihai ECMO Experience in Post-cardiotomy Cardiogenic Shock. Case Presentation . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 489 Viorica Cospormac, Victoria Rusu, Alexandru Botizatu, Vlad Maevschi, Alina Usataya, Dan Mandrila, Natalia Ursu, Igor Ceban, Lucia Girbu, Alexandru Marginean, and Victor Cojocaru Author Index . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 497

Clinical Engineering and Bioinstrumentation

Publication Practices Among Pivotal Clinical Trials of High-Risk Medical Devices Gleb Donin(B)

and Martin Kozik

Department of Biomedical Technology, Czech Technical University in Prague, Kladno, Czech Republic [email protected]

Abstract. High-risk medical devices must go through a special approval process before entering the market, whereby they demonstrate sufficient safety and clinical effectiveness by submitting relevant evidence. This evidence is usually obtained by conducting one or more clinical trials. There have been occasional inaccuracies in the reporting of the results of these trials, e.g., not publishing the entire study or misrepresenting unfavorable results. Our study deals with the issue of publishing clinical trials of new, high-risk, cardiovascular medical devices. The main objective of the study was to analyze the clinical studies in SSED documents that are submitted to the FDA in the premarket approval process and compare it with the information in related peer-reviewed publications. A total of 59 medical devices that met the inclusion criteria were identified in the time period 2014–2018. Of the 64 pivotal clinical studies, 81% were published, with a median time to publication of 2 months. There were no substantial differences in randomization and blinding between SSED pivotal trials and publications. Small differences were noticed in the number of patients (8%), the mean patient age and sex (15%). No differences were observed between SSED documents and published studies in terms of primary outcomes selection and definition. Only three (3.8%) outcomes were not found in publications. Our results shown a substantial improvement both in the publication rate of the pivotal trials and in the correctness of the published information for high-risk cardiovascular medical devices. Keywords: Medical devices · Regulatory process · Premarket approval · Clinical studies · Publication practice

1 Introduction Medical devices play an important role in physicians’ efforts to provide the best and highest quality care to the patient and contribute significantly to the patient’s health outcome. They are involved in both the diagnosis of diseases and their treatment, and for this reason, they are given great emphasis on sufficient safety and clinical effectiveness. These parameters are particularly important for medical devices that could pose an increased level of risk to the patient. Manufacturers should put such medical devices through a special approval process whereby they demonstrate sufficient safety and clinical effectiveness by submitting relevant evidence. This evidence is obtained by conducting one © The Author(s), under exclusive license to Springer Nature Switzerland AG 2024 V. Sontea et al. (Eds.): ICNBME 2023, IFMBE Proceedings 92, pp. 3–10, 2024. https://doi.org/10.1007/978-3-031-42782-4_1

4

G. Donin and M. Kozik

or more clinical trials and is part of a document that the manufacturer submits to the regulator, which then decides whether to approve the medical device for marketing. The conclusions of these studies are sometimes publicly available in the regulator’s online database (e.g., Food and Drug Administration in USA, FDA), but their retrieval and subsequent interpretation is not easy. Physicians, experts, and patients typically learn about the results of the clinical studies through publications in the scientific literature. The publication of these results and their accuracy are essential for clinical decisionmaking regarding the treatment and use of a particular medical device in a target patient population. In the case of medical devices, Chang’s study [1] concluded that more than half of the clinical trials used to demonstrate the safety and effectiveness of high-risk medical devices were not published at all, and when they were published, the results were often very different. A quarter of the analyzed published studies differed from the studies in the FDA documents in terms of the number of patients. This was backed by the finding that the demographic parameters, age, and gender, differed in more than 10% of the studies. Several other studies have addressed the issue of publication practices and publication bias in drugs [2, 3], and high-risk medical devices [4–6]. These studies shown that unpublished studies or inaccurate publication is quite common and this needs to be further monitored and evaluated. The aim of this study was to evaluate the evolution of the publication practice of clinical studies conducted on high-risk medical devices.

2 Methods 2.1 Data Collection In order to evaluate historical evidence development regarding clinical effectiveness of medical devices we focused on FDA approved high-risk cardiovascular devices. We applied similar methodology to that used in previous studies [1, 6] to be able to compare our results. A summary of data relating to the safety and effectiveness (Summary of Safety and Effectiveness, SSED) is a document that presents the reasoned, objective, and balanced results of scientific evidence regarding characteristics of a medical device. Publication of the SSED document in the PMA database [7] is mandated by the FDA upon premarket approval. The search of the PMA database was conducted, and it was narrowed to original submission related to high-risk cardiovascular medical devices with decision date between January 1, 2014, and December 31, 2018. For each SSED document we identified clinical trial number (NCT number). This number was used to identify relevant clinical trials in the ClinicalTrials.gov registry [8]. After identifying each clinical trial in the registry, the registered trial was examined and compared with the study in the SSED document. The trial record often contains a list of studies published in the literature that are linked to the registered trial, with a link to the individual publications in the Medline database. Those publications were collected.

Publication Practices Among Pivotal Clinical Trials

5

In case of no publications were listed in the trial record, a PubMed search was performed based on the following parameters: type of medical device, study title, study sponsor, and names of principal investigators. Publication matching was then confirmed by comparing study characteristics, number of study centers, number of patients, definition and number of primary outcomes, primary outcome outcomes, and study sponsors. After identifying the clinical studies in the SSED documents, and detecting relevant peer-reviewed publications, the data extraction was performed. For each publication found, the time range from the time of PMA approval to the time of publication was recorded. Whether the publication disclosed a potential author conflict of interest was also recorded. From the SSED documents we extracted information on the clinical trial design, whether patients were randomized, whether blinding occurred and in what form it was performed, the number of subjects, the baseline demographic characteristics (age, sex), the number of primary outcomes and what assessment criteria were used, whether the study was conducted only in the US, and the number of research centers. All of this information was also extracted from retrieved peer-reviewed publications. The following list summaries the data extracted for each pivotal clinical trial and relevant publication: – – – – – – – – – –

Whether the study was randomized? Whether blinding was performed? Whether the study was conducted at more than one research center? What was the number of research centers? Whether the study was conducted only in the US? What was the number of patients studied? What was the average age of the patients who participated in the study? What was the gender distribution in the study population? What was the number of primary outcomes? How were the primary outcomes assessed?

In the original SSED documents, we identified the primary outcomes. When these outcomes were not clearly stated by the document, all identified outcomes were considered primary if the number of outcomes was three or less. 2.2 Data Analysis Differences between demographic data as reported in SSED documents and as reported in the relevant publication were compared. Differences in the number of patients were calculated in absolute values and also for difference greater than 5% and less than 5% of total sample size. Differences in reported age and percentage of specific gender were also examined. An analysis of primary outcomes was conducted for the published studies, comparing primary outcomes between the SSED documents and the published studies. Where more than 3 primary outcomes were identified in an SSED document, it was considered for this analysis that the study did not have a defined primary outcome. The following parameters were then compared: whether the primary outcome was found in the publication, whether it was defined as a primary outcome, how it was defined and what the outcome result was.

6

G. Donin and M. Kozik

The primary outcome definitions were considered identical based on numerical values and study hypothesis formulation. Definitions that differed by less than 5% in numerical value were taken as similar. All others were taken as different. The primary outcome results were considered identical if they were identical both in numerical value, p-value, and confidence interval. If the numerical values of the outcome differed within 5% and the statistical significance was unchanged, the outcome results were considered similar. If the corresponding primary outcome was not found in the publication, its outcome was assessed as unknown.

3 Results 3.1 Studies Characteristics Using the search procedure described in the methods section, a total of 69 high-risk cardiovascular medical devices were identified in PMA database. 10 medical devices were excluded from the analysis because their application did not include the results of a new clinical study. Thus, a total of 59 medical devices that received marketing approval through the PMA process were included in the final analysis of clinical studies. For these 59 medical devices, a total of 64 pivotal studies were identified in the SSED documents. Of the 64 clinical trials identified in the SSED documents, 27 trials were randomized, and 14 trials were blinded. The median number of research centers in which the study was conducted was 33 research centers, with a range of values from 4 to 193 research centers. The median number of patients is 299.5 with quartile values of 185.2 and 667. A total of 91 primary outcomes were identified in the studies. A total of 52 matching published studies were found out of a total of 64 pivotal studies listed in the SSED documents. Thus, publication of a study in the peer-reviewed literature occurred in 81% of cases. In 51 cases (98%), information regarding the author’s conflict of interest was included in the publication. Summary characteristics of pivotal and published studies are presented in Table 1. Median values of time to publication are 2 months, with quartile values of -6.9 and 9.1 months (see Fig. 1). The earliest publication of the study occurred 66.9 months before obtaining FDA approval, and the latest publication occurred 25.7 months after obtaining approval through the PMA process. Of the published studies, 23 were randomized and 13 were blinded. The number of primary outcomes for the published studies was 71 with an average of 1.31 primary outcomes per study. There were no substantial differences in randomization and blinding between SSED pivotal trials and publications. In four cases, a discrepancy was found as to whether the study was an international study or only a US study. The total number of missing publications was 12, accounting for 19% of the total number of studies that were listed in the SSED documents. Of these, 4 studies were randomized and 1 study was blinded. The median number of research centers was 29. In 4 cases, the studies were conducted only in the United States; otherwise, they were international studies. The median number of patients equals 269 with quartile values of 186.5 and 412.2 patients. On average, the study had 1.66 primary outcomes.

Publication Practices Among Pivotal Clinical Trials

7

Table 1. Characteristics of included pivotal trials and publications SSED clinical trial (n = 64)

Published study (n = 52)

Randomized trials (%)

27 (42.2)

23 (44.2)

Blinded studies (%)

14 (21.9)

13 (25)

Number of centers - Mean (range) - Median (IQR)

39.3 (4–193) 33.0 (19.0, 47.0)

40.8 (4–193) 33.0 (19.75, 52.75)

US-only studies (%)

24 (37.5)

20 (38.5)

Number of patients - Mean (range) - Median (IQR)

473.9 (30–2008) 299.5 (185.2, 667.0)

506.9 (30–2008) 300 (185.3, 714.0)

Number of primary outcomes (average per study)

91 (1.42)

71 (1.37)

Note: first numbers represent number of studies, values in brackets represent percentages (unless otherwise stated)

Fig. 1. Cumulative distribution curve of the time to publication

3.2 Population and Outcomes Comparison This section reports the differences in pivotal clinical trial and related publication demographics, as well as the differences in sample size. Data obtained from the SSED documents were considered as reference. Almost 8% publications differed from SSED data in terms of number of patients. In 15.4% of the cases, a difference in age and gender was found in the tested patient population (Table 2). A total of 78 primary outcomes were identified in 52 pivotal trials which had been published. Of these, 75 (96%) were identified in the corresponding publications (see Table 3). 90% primary outcomes in publications had identical or similar definitions as of SSED documents. Only 9% primary outcomes results in publications differed from pivotal trial results.

8

G. Donin and M. Kozik Table 2. Comparison of demographic parameters and population sizes Published study (n = 52)

Difference in the number of patients tested

4 (7.7)

Difference greater than 5%

2 (3.85)

Difference less than 5%

2 (3.85)

Average difference in number of patients (range)

13.46 (−148–848)

Difference in average age of patients

8 (15.4)

Difference in male gender representation

8 (15.4)

Note: first numbers represent number of studies, values in brackets represent percentages (unless otherwise stated) Table 3. Primary outcomes reporting in published studies (n = 75) n (%) Primary outcome definition Identical

67 (89.3)

Similar

1 (1.3)

Unknown

7 (9.3)

Primary outcome result Identical

58 (77.3)

Similar

3 (4.0)

Different

7 (9.3)

Unknown

7 (9.3)

Note: first numbers represent number of outcomes, values in brackets represent percentages (unless otherwise stated)

4 Discussion and Conclusion High-risk medical devices undergo the most rigorous approval process in the US and worldwide, where great emphasis is placed on scientifically valid demonstration of safety and clinical effectiveness through sufficiently robust and statistically significant evidence. In most cases, this evidence is obtained through one or more clinical trials. For the period 2014–2018 we identified 64 pivotal clinical trials in SSED documents for high-risk cardiovascular medical devices. A total of 27 studies were randomized (42.2%) and 14 were blinded (21.9%). On average, the studies enrolled 473.9 patients with a range of values from 30 to 2008. For the 64 pivotal studies included in the SSED documents a total of 52 (81%) matching peer-reviewed publications were found in the Medline database. This could be considered as a significant improvement over the study [1], which found that only half of the pivotal clinical trials conducted between 2000

Publication Practices Among Pivotal Clinical Trials

9

and 2010 were published. Our results are consistent with Phillips study [6] with 80% publication rate for period 2011–2013. No differences were observed between SSED documents and published studies in terms of randomization and study blinding. Small differences were noticed in the number of patients (8%), the mean patient age and sex (15%). Publications followed SSED pivotal studies in terms of primary outcomes selection and definition. Only three (3.8%) outcomes were not found in publications. This is a relatively lower number that of Chang’s study [1], where 11% of primary outcomes were missing in publications. We did not identify significant differences in primary outcomes definitions between SSED documents and publications. Based on our results one could observe a substantial improvement both in the publication rate of the pivotal trials and in the accuracy and correctness of the published information for high-risk cardiovascular medical devices in comparison with previous period (before the year 2014). Improvements in this area could be devoted to the extension of the FDA Amendment Act of 2007, which requires registration of clinical trials and publication of their results in a publicly accessible clinical registry [4]. The public accessibility of SSED documents is a major advantage of US medical device regulation system. They describe the entire process of activities leading to the marketing of a medical device, thus ensuring transparency of the entire approval process. European CE mark is awarded by notified bodies, and the evidence submitted to them is not fully publicly available. Therefore, it is not possible to carry out similar study for devices marketed in EU. A potential limitation of this study is that manufacturers of medical devices for which no publication was found were not contacted. Therefore, relevant publications may have been overlooked and consequently not included in the analysis. Thus, our results should be considered as conservative. Future research focusing on additional information contained in the clinical studies, in the SSED documents seems to be relevant. Acknowledgments. This work was partially supported by the Grant Agency of the Czech Technical University in Prague, grant No. SGS 23/196/OHK5/3T/17.

Conflict of Interest. The authors declare that they have no conflict of interest.

References 1. Chang, L., Dhruva, S.S., Chu, J., et al.: Selective reporting in trials of high risk cardiovascular devices: cross sectional comparison between premarket approval summaries and published reports. BMJ 350, h2613 (2015). https://doi.org/10.1136/bmj.h2613 2. Rising, K., Bacchetti, P., Bero, L.: Reporting bias in drug trials submitted to the food and drug administration: review of publication and presentation. PLoS Med. 5, e217 (2008). https://doi. org/10.1371/journal.pmed.0050217 3. Zimmerman, K.O., Smith, P.B., McMahon, A.W., et al.: Duration of pediatric clinical trials submitted to the US food and drug administration. JAMA Pediatr. 173, 60–67 (2019). https:// doi.org/10.1001/jamapediatrics.2018.3227

10

G. Donin and M. Kozik

4. Swanson, M.J., Johnston, J.L., Ross, J.S.: Registration, publication, and outcome reporting among pivotal clinical trials that supported FDA approval of high-risk cardiovascular devices before and after FDAAA. Trials 22, 817 (2021). https://doi.org/10.1186/s13063-021-05790-9 5. Smithy, J.W., Downing, N.S., Ross, J.S.: Publication of pivotal efficacy trials for novel therapeutic agents approved between 2005 and 2011: a cross-sectional study. JAMA Intern. Med. 174, 1518–1520 (2014). https://doi.org/10.1001/jamainternmed.2014.3438 6. Phillips, A.T., Rathi, V.K., Ross, J.S.: Publication of clinical studies supporting FDA premarket approval for high-risk cardiovascular devices between 2011 and 2013: a cross-sectional study. JAMA Intern. Med. 176, 551–552 (2016). https://doi.org/10.1001/jamainternmed.2015.8590 7. Premarket Approval (PMA): https://www.accessdata.fda.gov/scripts/cdrh/cfdocs/cfPMA/ pma.cfm 8. ClinicalTrials.gov. https://clinicaltrials.gov

Three Dimensional X-ray CT Reading Assistance System with Video See Through Display Hiroki Kase1,2(B)

, Junichi Nishizawa1 , Kento Tabata2 and Toru Aoki1,2

, Katsuyuki Takagi2

,

1 Graduate School of Medical Photonics, Shizuoka University, Hamamatsu, Japan

[email protected] 2 Research Institute of Electronics, Hamamatsu, Japan

Abstract. In recent years, the amount of information in three-dimensional Xray Computed Tomography (3D X-ray CT) has been increasing, and research on Augmented Reality (AR), Virtual Reality (VR), and Mixed Reality (MR) representations using computer graphics rendering has progressed. Conventionally, medical professionals have used Digital Imaging and Communications in Medicine (DICOM) viewer software to display data captured with 3D X-ray CT in three directions (axial, sagittal, and coronal section) on a PC monitor. Since surface and volume rendering on AR, VR, and MR is primarily used, making it is difficult for the observer to accurately represent the region of interest. In our previous research, a 3D expression system that 2D cross-section images output from DICOM on the surface-rendered object has been proposed. In this study, a representation method using a 3D expression system and showing AR images allows the user to check the internal structure of an object imaged by 3D X-ray CT in any position and rotation has been newly proposed. In addition, in order to express a cross-section of a virtual object at close range in real-time, HTC VIVE Pro, which is a cameramounted device connected to a PC, enabled a video see-through expression. As a result, a 3D X-ray CT reading assistance system enabled the user to confirm the internal structure of a specific part of a CT-imaged object in a virtual reality space while maintaining shading and a three-dimensional impression. Keywords: 3D X-ray CT · AR (Augmented Reality) · Cross-section

1 Introduction Research on the inspection of invisible objects by invisible light, especially tomographic images by X-ray computed tomography (CT), has been progressing, and more and more data sets, including three-dimensional information including internal structures, can now be obtained. 3D X-ray CT is now used in the medical, nondestructive testing, and security fields. In the medical field, it is used to monitor the progress of human injuries and symptoms, in the nondestructive testing field to determine defects in objects, and in the security field, to determine the shape of objects and the presence of suspicious matter. © The Author(s), under exclusive license to Springer Nature Switzerland AG 2024 V. Sontea et al. (Eds.): ICNBME 2023, IFMBE Proceedings 92, pp. 11–20, 2024. https://doi.org/10.1007/978-3-031-42782-4_2

12

H. Kase et al.

Research is also underway to render images reconstructed by computer graphics (CG) and express them in Augmented Reality (AR), Virtual Reality (VR), and Mixed Reality (MR) [1]. According to A Dictionary of Computer Science, Virtual Reality (VR) is the creation and experience of an environment, the primary purpose of which is to place the participant in an environment that cannot be experienced normally or easily [2]. Augmented Reality (AR) is similar to VR, but superimposes images of virtual space on images of the real world, often using a see-through head-mounted display. The concept of Mixed Reality (MR) views the real and virtual environments as a continuous concept, an environment in which objects from the real and virtual worlds are displayed together on a single display, an environment that lies between the continuum of virtuality [3]. Conventionally, when a medical professional checks the data taken by a 3D X-ray CT, it is usually observed from three directions: “axial section,” which is a cross-sectional image horizontal to the longitudinal axis of the body; “sagittal section,” which is a crosssectional image in a plane perpendicular to the plane dividing the left and right sides of the body; and “coronal section,” which is a cross-sectional image in a plane perpendicular to the plane dividing the front and rear sides of the body. The most common method is to these viewpoints from three angles. Figure 1 shows the three-dimensional orientation of the axial, sagittal, and coronal section when imaging the human body. Figure 2 shows the human head viewed from three directions using Osirix MD (DICOM viewer software). While this software is specialized for understanding anatomical structures from the desired direction, the relationship and arrangement of three-dimensional positions must be assumed in the mind of the observer, and the voxel data (three-dimensional information) in the DICOM data must be expressed by reducing the amount of information to pixel data (two-dimensional information). Another disadvantage is that it requires time-consuming observation of each tomographic image from multiple angles so as not to miss any pathology points.

Fig. 1. Axis for three dimensional (3D) X-ray Computed Tomography (CT)

Fig. 2. Human head image from each axis

In general, surface rendering and volume rendering are mainly used to confirm data captured by 3D X-ray CT in AR, VR, and MR. Surface rendering is a method that selects

Three Dimensional X-ray CT

13

an equal value of a specific result in a series of voxel values and defines it by a resampling factor (Iso Surface method [4]), and meshes the surface layer data of the object. This method can show the surface shape of a 3D object in detail and can also express complex shapes and surface irregularities with a sense of shading. Volume rendering is a method (ray-casting method [5]) that projects light rays from a specific viewpoint direction and adds up the positions of intersection points where they collide with objects. This allows the internal structure of the 3D data to be displayed, making it possible to visualize the internal density and characteristics of tissues and organs. Figures 3 and 4 show surface and volume rendering representations of the heart, coronary arteries, and surrounding ribs and spine data using the same imaging data.

Fig. 3. Presentation by surface rendering

Fig. 4. Presentation by volume rendering

2 Purpose The purpose of this study is to develop a system that uses Augmented Reality (AR) to provide a more intuitive and accurate interpretation of 3D X-ray CT data. Specifically, a new representation method that combines the display of tomographic images with

14

H. Kase et al.

surface rendering was proposed to more accurately grasp the area to be checked. It was also aimed to construct a system that makes it easier for the observer to understand the object’s internal structure. The following three objectives were outlined in this proposal. A. Objects imaged by 3D X-ray CT are represented as three-dimensional objects on each device. B. The object is represented as meshed 3D-CG data in a virtual space and can be viewed from any viewpoint in the 2π direction by moving and rotating the position of its cross-section. By preparing a boundary surface as shown in Fig. 5 and displaying the cross-section where the object touches the boundary surface, it is possible to check the object’s internal structure. C. The rotation and movement of the cross-section are not done by mouse or keyboard operation, but by intuitive operation as if the observer were grasping and moving the boundary surface in the virtual space and rotating it with his/her hands. The operation is performed smoothly with low latency.

Object Boundary surface Cross-section

Fig. 5. Location of object, cross-section, and boundary surface

3 Proposal System 3.1 Devices for Experiment In this study, the video see-through method of HTC VIVE Pro (Fig. 6) which is commercially available from HTC, was used to represent AR in real space. Devices that represent virtual objects in real space through AR can be classified into two main types: optical see-through method and video see-through method. The standard optical see-through method projects computer-generated content onto a translucent display in front of the user’s eyes to achieve a see-through effect [6]. Unlike this, in the video see-through method, the view of the real world is acquired by one or two external cameras fixed to the visor and coherently combined with the virtual content before being displayed on a head-mounted display (HMD). While the optical see-through method provides a high sense of immersion in the real environment and natural superimposition of information, the distance between the virtual objects on the display and the real objects is generated as a focal difference, especially when the distance to the object to be viewed is close, the problem arises since the user’s eyes are unable to focus on both virtual and real

Three Dimensional X-ray CT

15

objects. Hololens2, which has been attracting attention as an AR device in recent years, also has its display fixed at an optical distance of approximately 2.0 m away from the user, with the optimal placement zone for objects being 1.25 m~5.0 m [7]. Therefore, the optical see-through method is not suitable when the distance between the user and the object is close and accurate scaling is required, such as in surgical simulations. The video see-through method combines the image from the camera input with the image of the virtual object, and although it lacks natural superimposition of information, the displayed object, and the camera image are on the same display, so the user can observe the object without changing the focus. In addition, if two cameras are used, camera images can be output according to the left and right eye, enabling a three-dimensional representation according to the parallax in both eyes. HTC VIVE Pro video see-through displaying method is distributed as one of the developer tools by the official website from HTC.

Fig. 6. HTC VIVE Pro

Another reason the HTC VIVE Pro was chosen was that it is a “PCVR” connected to the PC by a wire, rather than a stand-alone device that operates alone. Table 1 compares the specifications of the PC and Hololens2 used in the experiment. Since the proposed system renders tomograms of objects in real-time, more high-speed processing is required to reduce latency. Therefore, “PCVR” was selected for stable 3D representation in this study. Table. 1. PC and Hololens2 Specifications Device

PC

Hololens2

CPU/SOC

13th Gen Intel(R) Core(TM) i9-13900K

Qualcomm Snapdragon 850

Memory

128.0GB

4 .0GB

GPU

NVIDIA GeForce RTX 4090

Qualcomm Adreno 650

OS

Windows11

Windows Holographic version22H2

16

H. Kase et al.

3.2 System Configuration In this study, the configuration is shown in Fig. 7. DICOM data captured by a 3D Xray CT is sent to a PC, and the meshing process is performed by “surface rendering”; using Unity (2019.3.15f1), the meshed data is represented on a virtual space. The PC is also connected to a 3D controller via wireless communication, allowing the observer to interfere with the stereoscopically represented data through the display.

Fig. 7. System Configuration

3.3 Device-Based Operation When using the HTC VIVE Pro, an external infrared sensor is used in addition to the sensors on the HMD, as shown in Fig. 8. The external sensors are placed in two diagonal lines around the user, within a space of up to 3m x 4m, and scan 100 times per second with a fixed laser beam to accurately read the spatial position of the headset and controller. The observer can now have a more natural AR experience by moving around the object. The observer can observe the real-sized objects in the imaging target area without being limited by the size of the display.

Fig. 8. A person wearing HTC VIVE Pro

Three Dimensional X-ray CT

17

4 Representation of Cross-Sections For assisting in the reading of 3D X-ray imaging, a method of representing an object imaged by 3D X-ray CT was measured and a 2D DICOM tomogram is superimposed on a cross-section of a surface-rendered model [8]. Figure 9 shows a system that uses AR to represent a cross-section of an interior structure at a specific location. First, the observer determines the direction in which he/she want to observe the cross-section of an object in the virtual space, and a tomographic image in the same direction is generated from the DICOM data. Then, the coordinates on the virtual space are matched with the real space, and the object is displayed on the screen on the device as AR. The tomogram is then superimposed on the cross-sectional position of the surface-rendered object for representation. In this way, the cross-sectional orientation can be freely determined in the 2π direction instead of the conventional three directions (axial, sagittal, coronal), allowing the observer to read the 3D X-ray imaging with AR more accurately and effectively.

Fig. 9. Representation of cross-section from DICOM 2D image [8]

4.1 Formulae Sample data of the heart and coronary arteries obtained from Pixmeo’s DICOM Image Library [9] was used in this study. A comparison was made between surface redering, volume rendering, and the proposed method in terms of the cross-sectional representation

18

H. Kase et al.

method. Figure 10 shows the results of cross sections by each rendering method. Specifically, (A) is a cross-section by “surface rendering,” (B) is a cross-section by “volume rendering,” (C) is a 2D-oriented cross-section by DICOM overlaid on a cross-section by “surface rendering,” and (D) is a 2D-oriented cross-section by DICOM overlaid on a cross-section by “surface rendering”, (E) is a screenshot of the image represented as AR on the device. In (A), only the surface data is used, and the data in the cross-section is generally expressed in white. On the other hand, (B) reflects transparency according to the density information of CT values. Although the internal structure can be displayed, it is difficult to grasp the position of the cross-section since the density information in the depth direction is also expressed at the same time. (C) is a two-dimensional image generated from DICOM voxel data and does not provide a three-dimensional representation. Therefore, (D) is a new method of representation, which superimposes a two-dimensional cross-section from DICOM on a cross-section from “surface rendering”. To prevent the 3D data in the depth direction from being hidden by the cross-sectional image, a stencil buffer [10] is used to depict the “surface rendered” model in the depth direction based on the observer’s viewpoint if it exists, and not depict it if it does not exist If the model does not exist, it is not depicted. Then, the image actually represented on the device as AR is shown in (E). The surface model and the cross-sectional area can be viewed from any viewpoint in the real world. These results suggest that the representation method proposed in this study can represent cross-sections more accurately and efficiently than other rendering methods.

Fig. 10. Representation method

A stencil buffer is a technique in computer graphics used to create special effects by masking pixels in an image and then either drawing the pixels or depicting them in a video. If the area to be masked (not to be depicted) in the stencil buffer is defined as 0 and the area not to be masked (to be depicted) is defined as 1, it is possible to specify that pixels are depicted only in the area defined as 1. Figure 11 shows the state without stencil buffers, a schematic diagram of the range defined as 0 and 1, and the state with stencil buffers and represents them in AR. By specifying the cross-sectional depiction range in this way, it is possible to prevent objects located deeper than the screen from being hidden by the cross-section, which would spoil the three-dimensional representation.

Three Dimensional X-ray CT

19

Fig. 11. Representation method of the stencil buffer

5 Result The internal structure of the object can now be represented using HTC VIVE Pro. A screenshot of the image displayed on the HTC VIVE display is shown in Fig. 12. The observer can observe the object from various directions by moving around the object represented in the AR, and by dragging the object with the trigger pulled on the 3D controller, the observer can observe a cross-section of the object in any direction while grasping the boundary surface. In addition, since the object is synthesized with the real world using the video see-through method, it is possible to display the inside of the patient’s body in line with the patient in the real world and to add information to the real world.

Fig. 12. Representation of a cross-section of HTC VIVE Pro

6 Conclusions We have focused on cross sections and have proposed a system [8] that superimposes 2D images output from DICOM on the cross-section of a surface-rendered object in previous research. In this study, an assist system for 3D X-ray CT data in AR using the video see-through method was proposed. The object imaged by the 3D X-ray CT is represented in 3D on the device by combining it with the real space using the video see-through method. The object is represented in virtual space as meshed 3D data, and the superimposed cross section on the surface-rendered cross section can be checked

20

H. Kase et al.

from any viewpoint in the 2π direction. The cross-section can be rotated and moved by operating the 3D controller, allowing the user to grasp and move the object in AR. The 3D controller enables intuitive manipulation of the object, such as grasping the object by hand or moving it to rotate it, with low latency. This research has established a method for the real-time generation of cross-sections in any direction from DICOM data and their representation in AR.

Conflict of Interest. The authors declare that they have no conflict of interest.

References 1. Sutherland, J.: Applying modern virtual and augmented reality technologies to medical images and models. J. Digi. Imaging 32(1), 38–53 (2019). https://doi.org/10.1007/s10278018-0122-7 2. Butterfield., A., Ekembe Ngondi, G., Kerr, A.: A Dictionary of Computer Science (Oxford Quick Reference) (English Edition) 7th, Kindle version. OUP Oxford, pp. 590. https://www. amazon.com/dp/B019GXM8X8 (2016) 3. Milgram, P., Kishino, F.: A taxonomy of mixed reality visual display. IEICE Trans. Inform. Sys. E77-D(12), 1321–1329 (1994). http://citeseerx.ist.psu.edu/viewdoc/summary?doi=10. 1.1.102.4646 4. Bosma, M.: Iso-Surface Volume Rendering: speed and accuracy for medical applications. University of Twente (2000). https://doi.org/10.1117/12.312490 5. Ray, H., Pfister, H., Silver, D., Cook, T.A.: Ray casting architectures for volume visualization. IEEE Trans. Visual. Compu. Graphics 5(3), 210–223 (1999). https://doi.org/10.1109/2945. 795213 6. Condino, S., Carbone, M., Piazza, R., Ferrari, M., Ferrari, V.: Perceptual limits of optical see-through visors for augmented reality guidance of manual tasks. IEEE Trans. Biomed. Eng. 67, 411–419 (2020). https://doi.org/10.1109/tbme.2019.2914517 7. Microsoft Documentation Comfort, Microsoft: https://learn.microsoft.com/en-us/windows/ mixed-reality/design/comfort 8. Kase, H., Nishizawa, J., Tabata, K., Takagi, K., Aoki, T.: Spatial awareness application using mixed reality for 3D X-ray CT examination. J. Inst. 18(03), P03032 (2023). https://doi.org/ 10.1088/1748-0221/18/03/P03032 9. Pixmeo, DICOM Image Library. https://www.osirix-viewer.com/resources/dicom-image-lib rary/ 10. Kilgard, M.J.: Improving shadows and reflections via the stencil buffer. Advanced OpenGL Game Development 204–253 (1999)

Videosupported Treatment as Method of Delivering the Healthcare to Tuberculosis Evelina Lesnic(B)

, Alina Malic , Adriana Niguleanu , and Tatiana Osipov

Nicolae Testemitanu State University of Medicine and Pharmacy, Chisinau, Moldova [email protected]

Abstract. According to the actual national policy, the patients with tuberculosis may benefit from the following anti-tuberculosis treatment options: a) directly observed delivered in the community close to the patient’s home or work; b) treatment provided in hospitals or specialized dispensaries and c) video-supported treatment, which is currently in expansion, regardless the low evidence of its effectiveness. The aim of the study was to assess the advantages and issues in delivering the anti-tuberculosis treatment through the telecommunication technologies in patients with tuberculosis. Was conducted a selective, prospective and case-control study, which included 255 patients who underwent a completely video-supported treatment and 498 patients who underwent directly observed, then transferred to video-supported treatment. The patients were registered between 2020 and 2022 in the Republic of Moldova. The study results established that the issues in delivering the video-supported treatment were the main risk factors for tuberculosis: vulnerable economical state, poor living conditions, comorbid state and harmful habits. Despite the limitations in the use of video-supported treatment, as positive sputum smear and parenchymal lung destruction, one third of both groups were treated through the delivering the treatment using the telecommunication technologies. The advantages of entirely video-supported treatment were high flexibility for patients and healthcare staff, epidemiological isolation, and high treatment effectiveness. The advantages of the directly observed followed by the video-supported treatment were the establishment of the therapeutic compliance, clinical tolerance to the anti-tuberculosis drugs, the management of the health-threatening conditions under the direct supervision of the healthcare staff. Keywords: Tuberculosis · Diagnosis · Telemedicine

1 Introduction Tuberculosis (TB) is an infectious and contagious disease caused by the Mycobacterium tuberculosis. The most frequent way of transmission is airborne, but the direct contact and the digestive routes, can also spread the infection. As a general recommendation the early treatment onset and the isolation, are the most relevant actions for prevention the transmission of infection [1, 2]. In 2000 in the Republic of Moldova (RM) was approved the first National Program for Control and Prophylaxis of Tuberculosis, which led to the national implementation of the Directly Observed Treatment Short Course © The Author(s), under exclusive license to Springer Nature Switzerland AG 2024 V. Sontea et al. (Eds.): ICNBME 2023, IFMBE Proceedings 92, pp. 21–28, 2024. https://doi.org/10.1007/978-3-031-42782-4_3

22

E. Lesnic et al.

Chemotherapy (DOTS), which was subsequently followed by other programs with same p the same [3, 4]. According to the actual national policy, the TB patients may benefit from the following anti-TB treatment options: 1. Directly Observed Treatment (DOT) when the anti-TB drugs are delivered in the community close to the patient’s home or work, which is the most used. 2. DOT provided by specialized healthcare worker in hospitals or specialized dispensaries and 3. Video-supported treatment (VST), through an electronic device connected to a specialized platform under the supervision of a trained healthcare worker [5–12]. The communication technology required is an electronic device (personal computer, notebook, smartphone with Android system), connected to the broadband Internet and an individual account on https://www.tbvot.md/start/ [5, 12, 13]. The actual communication technologies allow the replacement of the DOT by VST. The wide use of VST is limited by specific including criteria and low evidence of the treatment effectiveness in high risk groups, which constituted the reasons for performing the actual research. The aim of the study was the assessment of the advantages and issues in delivering the video-supported treatment through the telecommunication technologies in TB patients. Drug-resistant tuberculosis (MDR-TB) represents a communicable threatening disease of each high TB burden country due to a continuously growing number of primary diagnosed patients infected with drug-resistant strains of M. tuberculosis (MTB) [1].

2 Materials and Methods A prospective, case-control research, which included 255 patients completely underwent VST and compared with 498 patients treated through DOT, then through the VST between 01.01.2020–31.12.2022 in the Republic of Moldova (RM) was conducted. Including criteria in the research were: age more than 18 years old; diagnosis of pulmonary TB and informed consent. All patients were checked and validated for enrolling in the VST upon the including criteria: 1) technical-available electronic device with web camera, broadband Internet, downloaded specialized electronic platform https://www. tbvot.md and a personal account; 2) demographical-residence in the RM during the antiTB treatment. 3) individual-accomplished training how to swallow independently every dose of the TB drugs, to record and upload the recording on the application. The patients were checked for the presence of special storing conditions at home such as dry and dark place, far from children. In all patients, the therapeutic compliance was assessed during the first 14 days before the final decision to maintain the VST. The medical staff delivered the medication to all patients for the next 7 days at the onset of the VST, then on the weekly basis. During the VST, the patients were checked for the adverse drug events, which were managed according to the recommendations of the National Clinical Protocol. Statistical analysis was carried out using quantitative and qualitative research tests of the SPSS Statistics 23.0 software. The differences were considered statistical significant with the probability of more than 95% and p < 0.05.

Videosupported Treatment as Method

23

3 Results 3.1 Assessment of the Demographical and Epidemiological Risk Factors for Tuberculosis While distributing the TB patients in age groups, according to the WHO recommendation was identified that the largest subgroups treated completely via VST were between 25– 34 years old (y.o.) – 77 (30.2%) and 35–44 y.o.– 78 (30.6%), compared with 129 (25.9%) and 166 (33.3%) patients treated through the DOT&VST, respectively. The patients with the age between 45–54 y.o. group predominated in the DOT&VST group 90 (18.1%) vs. 41 (16.5%) in VST group and 55–64 y.o. in VST group 29 (11.3%) vs. 49 (9.8%) in DOT&VST group. The youngest group, between 18–24 y.o. predominated in the DOT&VST group 54 (10.8%) vs. 19 (7.5%) in VST, and oldest (65 + y.o.) in VST group 19 (7.5) vs. 10 (2%) patients from DOT&VST group. When distributing the patients according to their risk factors, was established that the unemployed predominated nonsignificantly in the DOT&VST group 354 (71.1%) vs. 154 (60.4%), as well the patients without the health insurance – 324 (65.1%) vs. 126 (49.4%) patients. Low educational level, which included all patients who graduated primary school or had an incomplete secondary degree of education was identified in a similar proportion in both groups, constituting one third. Single civil state was established in a non-statistically higher proportion in the VST group – 98 (38.4%) vs. 167 (33.5%) patients from DOT&VST group. Poor living conditions, which were notified in households without centralized heating, centralized water supply, and poor waste management were identified in two thirds of both groups. According to the checklist criteria in VST, were not enrolled homeless, patients without a stable residence and detainees. The migration and the recent history of the long-term travelling were checked as well. It was due by the fact that the migration constitutes a challenge for the therapeutic compliance and a contraindication for the remote treatment. The patients with a recent history of migration, who returned from abroad in the last 12 months were identified in a similar low proportion in both group – 2 (0.8%) vs 4 (0.8%) cases. The patients who were previously incarcerated in the Moldovan penitentiary institutions were in a low rate in both groups 12 (4.7%) in VST groups vs. 16 (3.2%) in DOT&VST group. Comorbid patients were in a higher proportion in the DOT&VST group – 131 (26.3) than in VST group – 81 (18.8%) cases. It was required for the clinical management of the health threatening conditions. Patients with mental disorders or neurological organic pathologies, chronic alcoholism, any type of drug use and HIV infected were not enrolled in VST. Tobacco smoking was established in a higher proportion in the DOT&VST group – 438 (87.9%) vs. 161 (63.1%) cases from VST group. Patients living in TB clusters or who were in contact with TB patients were more frequently detected in the DOT&VST group – 121 (24.3%) vs. 39 (9.1%) from VST group. So, definitively were excluded from the enrolment in VST the patients with HIV co-infection, mental impairment, chronic alcoholism and drug use, for which no support measured were provided (See Table 1).

24

E. Lesnic et al. Table 1. Distribution by risk factor for tuberculosis.

Indicators

VST group n = 255

DOT&VST group n = 498

p

n (P%)

n (P%)

Low economical state (unemployment, retirement, disability)

154 (60.4)

354 (71.1)

0,05

Low living conditions

168 (65.8)

220 (44.2)

0,05

History of migration in the last year

12 (4.7)

16 (3.2)

>0,05

Associated diseases

81 (18.8)

131 (26.3)

>0,05

Active tobacco smoking

161 (63.1)

438 (87.9)

0,05

Other types

30 (11.8)

36 (7.3)

>0,05

Microscopic positive

68 (26.7)

176 (35.2)

>0,05

MTB culture positive

89 (34.9)

217 (43.5)

0,05

MDR-TB

57 (22.3)

119 (23.9)

>0,05

Extensive TB

35 (13.7)

75 (15.1)

>0,05

Lung destruction

87 (34.1)

156 (31.3)

>0,05

Detected by the screening of the symptomatic patients

178 (68.8)

331 (66.5)

>0,05

Active screening of high risk groups

77 (30.1)

167 (33.5)

>0,05

Note: The statistical methods used: paired samples t Test

3.3 Anti-tuberculosis Treatment Effectiveness, Advantages and Issues in Delivering the Video-Supported Health-Care For the evaluation of the treatment effectiveness were assessed the main peculiarities that contributed the transfer of the patients from DOT to VST, and the main causes, which determined the individual transfer from VST to DOT. For this purpose, were evaluated: 1) patients requirements and ability to take independently the anti-TB drugs; 2) patient’s technical ability to record daily and to transmit for validation the recorded video; d) disease complications or adverse drug reactions which imposed the hospitalization in the emergency department, either in the specialized service with the discontinuation of the VST; e) patient’s depart from the country for more than 1 month; g) other causes which determined the discontinuation of the VST and the transfer into the DOT. Before enrolling the patients into the VST, they were trained how to take independently the anti-TB drugs and to show the process in front of the web camera. The patients were trained how to record the daily treatment administration and transmit for validation the recording. Assessing the video-recordings, was established a full compliance of the patients recordings to the rules of VST and the validation by the referral practitioners. The patients were informed, which disease-specific complications or possible adverse

26

E. Lesnic et al.

drug reactions can appear and how to report them. While evaluating the medical report, no adverse drug reactions were registered. In a limited number, 20 (4%) patients from DOT&VST and 9 (3.5%) from VST group, the remote treatment was discontinued. After the discontinuation of the VST, the patients were hospitalized due to clinical criteria and they finally evolved with unfavorable outcome. Assessing the final treatment outcome was confirmed a statistical higher rate of patients successfully treated in the group of DOT&VST 483 (96.3%) vs 205 (80.4%) patients from VST group. The rate of died patients was slightly higher in the VST group 16 (6.3%) compared with 4 (0.8%) in DOT&VST group. Other unfavorable outcomes, such as failure, transferred for treatment to abroad and interruptions were registered in a higher proportion in the VST group 34 (23.1%) compared with 11 (2.2%) patients of DOT&VST group.

4 Discussion Our research was conducted to assess the issues in delivering the anti-TB treatment and their connection with the high risk factors, and the treatment effectiveness, which constituted the scientific novelty of the research. The updated international guidelines are continuously recommending the anti-TB treatment in out-patient settings and replacement of the directly observed treatment with remote delivery [2, 14]. When assessing the demographic characteristics of the patients treated using the VST, was established that men predominated in both groups, which is characteristic for the TB epidemics [14]. However the rate of women was higher in the groups treated entirely remotely, which was similar with the results of another study [8]. The patients included in the age groups between 35 and 54 y.o. were in a similar proportion in both groups, the youngest group (18–24 y.o.) was treated more frequently through DOT then VST and the oldest one (65 y.o and more) by VST. Other studies revealed a higher rate of patients younger than 45 y.o. enrolled in VST as well [9, 10]. Our research detected a high rate of social vulnerable patients, enrolled in VST, despite the fact that the deep economical vulnerability constitutes a strong barrier for the achieving the treatment completion [12, 15, 16]. Our results confirmed that low social and economical state was associated with low educational state, poor living conditions, and harmful habits, which were recognized as risk factors for implementation of the remote anti-tuberculosis treatment [10, 11]. Such peculiarities were recognized as predictors for low treatment outcome and were recommended to be addressed before starting the remote treatment [2, 17]. Our study established that regardless the association of the several risk factors most of the patients were enrolled in VST. The remote treatment was started after a period of hospitalization, in majority of patients who had a comorbid state, health threatening conditions or severe form of tuberculosis. Some studies, recommended that the enlargement of the eligible groups for VST, could be done only after an adequate management of the risk factors and comorbidities [15, 16]. Several studies recommended to use the remote treatment with the scope to reduce the administrative and financial burden done by the hospitalization but should be associated with the improvement of the patients economical state, knowledge, and quality of life [15, 16, 18]. The deepest social vulnerability linked with the patients homeless state or lack of a stable residence, was a stable contraindication for the remote treatment in some studies and in Moldovan specialized healthcare system [6,

Videosupported Treatment as Method

27

12]. If such patients would be eligible for the remote treatment, social-medical residencies, should be put in place for hosting during the anti-TB treatment [11]. Some studies, provided evidence that homeless, people with alcohol abuse and drug use can be enrolled in VST if specific needs would be solved [9, 15]. Our research established an increased rate of social vulnerable patients (unemployed, migrants returned from abroad, patients with history of imprisonment) enrolled in remote anti-TB treatment. Those risk factors were identified as important issue for the diagnosis and treatment effectiveness in different studies [9–11, 18, 19]. Our study established a low proportion of patients detected from the TB clusters however many studies demonstrated that infectious clustering was frequently identified in patients treated remotely [5, 13]. Comorbidies were important limiting conditions for the the use of VST, which determined a low rate of patients with a comorbid state to be enrolled in our study, identified in other studies also [9, 15, 16].

5 Conclusions The risk factors identified in patients enrolled in VST were vulnerable economical state, which was associated with lack of the health insurance, low living conditions, comorbid state and tobacco smoking. Patients with TB contact were in a low proportion and it should be taken into consideration, when applying the infection control measures. Microbiological positive were one third of the both groups and one fifth were infected with drug-resistant MTB strains, which was considered an epidemiological limitation for use of VST. The advantages of the VST were the high flexibility due to asynchronous mode of drugs administration, isolation at home with the possibility to avoid travelling and spreading of the infection in the community and high treatment outcome. The main differences which marked the patients treated entirely through VST compared with DOT&VST, was that the DOT allowed patients isolation in the hospital clinical services till the establishment of the therapeutic compliance and clinical tolerance to the anti-TB drugs under the direct supervision of the specialized medical staff, and management of the current health-related conditions, which could not be achieved in ambulatory conditions.

Conflict of Interest. The authors declare that they have no conflict of interest.

References 1. European Centre for Disease Prevention and Control, WHO Regional Office for Europe. Tuberculosis surveillance and monitoring in Europe 2022 – 2020 data. Copenhagen: WHO Regional Office for Europe and Stockholm: European Centre for Disease Prevention and Control; 2022. Licence: CC BY 3.0 IGO 2. Nahid, P., Dorman, S., Alipanah, N.: Official american thoracic society/centers for disease control and prevention/infectious diseases society of america clinical practice guidelines: treatment of drug-susceptible tuberculosis. Clin, Infect. Dis. 63(7), e147–e195 (2016). https:// doi.org/10.1093/cid/ciw376 3. Government Law no. 153 of 04.07.2008 regarding the control and prevention of tuberculosis. https://www.legis.md/cautare/getResults?doc_id=110512&lang=ro

28

E. Lesnic et al.

4. Government decision of the Republic of Moldova no.1160 of 20.10.2016 regarding the approval of the National Programme for the control of tuberculosis for the years 2016–2020. https://www.legis.md/cautare/getResults?doc_id=111654&lang=ro 5. Ravenscroft, L., et al.: Video-observed therapy and medication adherence for tuberculosis patients: randomised controlled trial in Moldova. Eur. Respir. J. 56(2), 2000493 (2020). https:// doi.org/10.1183/13993003.00493-2020. PMID: 32381495 6. National Clinical Protocol. “Tuberculosis in adults”. Chisinau; 2020. (Romanian). http://sim etb.ifp.md/Download/oficial_docs/PCN-123-2020-Tuberculoza_la_adult.pdf 7. Government Decision no.710 of 20.09.2011 regarding the approval of the Strategic Program for technological modernization of the governance (e-transformare). https://www.legis.md/ cautare/getResults?doc_id=103279&lang=ro 8. Wade, V., Karnon, J., Eliott, J., Hiller, J.: Home videophones improve direct observation in tuberculosis treatment: a mixed methods evaluation. PLoS ONE 7(11), e50155 (2012). https:// doi.org/10.1371/journal.pone.0050155 9. Story, A., et al.: Monitoring therapy compliance of tuberculosis patients by using videoenabled electronic devices. Emerg. Infect. Dis. 22(3), 538–540 (2016). https://doi.org/10. 3201/eid2203.151620 10. Sinkou, H., et al.: Video-observed treatment for tuberculosis patients in Belarus: findings from the first programmatic experience. Eur. Respir. J. 49(3), 1602049 (2017). https://doi. org/10.1183/13993003.02049-2016 11. Chuck, C., Robinson, E., Macaraig, M., Alexander, M., Burzynski, J.: Enhancing management of tuberculosis treatment with video directly observed therapy in New York City. Int J Tuberc Lung Dis. 20(5), 588–593 (2016). https://doi.org/10.5588/ijtld.15.0738. PMID: 27084810 12. Lesnic, E., Osipov, T., Malic, A.: Eligilibility criteria for video-observed anti-tuberculosis treatment at patients from Chisinau city. The Mold. Med. J. 62(4), 14–20 (2019). https://doi. org/10.5281/zenodo.3556469 13. Lesnic, E., Osipov, T., Malic, A.: The advantages and challenges in the implementation of the video-assisted treatment. Arta Medica 2(83), 22–27 (2022). https://doi.org/10.5281/zenodo. 6850709 14. Global tuberculosis report 2022. Geneva: World Health Organization; 2020. ISBN 978-92-4006172-9 (electronic version). https://www.who.int/teams/global-tuberculosis-programme/ tb-reports/global-tuberculosis-report-2022 15. Garfein, R., Liu, L., Cuevas-Mota, J., et al.: Tuberculosis treatment monitoring by video directly observed therapy in 5 health districts, California, USA. Emerg Infect Dis. 24(10), 1806–1815 (2018). https://doi.org/10.3201/eid2410.180459 16. Garfein, R., Collins, K., Muñoz, F.: Feasibility of tuberculosis treatment monitoring by video directly observed therapy: a binational pilot study. Int. J. Tuberc. Lung Dis. 19(9), 1057–1064 (2015). https://doi.org/10.5588/ijtld.14.0923 17. Lesnic, E., et al.: The impact of risk factors on the incidence of tuberculosis in Chisinau. Arta Medica. 81(4), 11–17 (2021). https://doi.org/10.5281/zenodo.5856850 18. Kuo, A., Singh, S., Prem, K.: Delayed diagnosis and treatment of pulmonary tuberculosis in high-burden countries: a systematic review protocol. BMJ Open 9(7), e029807 (2019). https://doi.org/10.1136/bmjopen-2019-029807 19. Lesnic, E., Ciobanu, S., Todoriko, L.: Predictive factors associated to low treatment outcome. The Mold. Med. J. 60(2), 7–12 (2017). https://doi.org/10.5281/zenodo.1050982

Feasibility Study for a Robotic Laparoscopic Surgical System in a Greek Public Hospital Spilios Zisimopoulos(B) , Aris Dermitzakis , Anastasia Daskalaki , Mary Marinou, and Nicolas Pallikarakis Institute of Biomedical Technology (INBIT), Patras, Greece [email protected]

Abstract. Robot Assisted Laparoscopic Surgery (RALS) is a rapidly evolving field and has seen significant advances in recent years. This new technology presents potential advantages in many procedures, compared to traditional open surgery and manual laparoscopic surgery. However, to justify the use of a robotic laparoscopic surgical system by a healthcare unit, the undoubted technical advantages it offers should be translated into improved clinical outcomes, safety and sustainability. The Institute of Biomedical Technology (INBIT) undertook a project to evaluate the feasibility of acquiring such a system by a Public Sector Hospital in Greece. This analysis included the description of the examined technology, its fields of application and the potential and conditions of its utilization. Aspects of the technology such as acquisition, use and maintenance costs were reviewed alongside public health sector data related to the estimated use, to check its sustainability. At the same time, a review study was carried out to compare clinical results of robotic surgery with traditional operation methods based on existing literature. Considering this comparison, alongside the economic data, a cost-benefit estimation of the technology under consideration was carried out. Additionally, safety issues of RALS are examined based on international recalls on robotic surgical systems and relevant studies. Finally, comments are made on the procurement strategy to be followed. Keywords: RALS · Laparoscopic Robotic System · Feasibility Study · Safety

1 Introduction Robot Assisted Laparoscopic Surgery (RALS) is a rapidly evolving field that has seen significant advances in recent years and presents potential advantages in many endoscopic procedures compared to traditional open surgery and laparoscopy (Fig. 1). Based on the latest developments, robotic systems offer increased millimeter-level precision of manipulation provided by multi-degree-of-freedom robotic arms, making it possible to remove the normal tremor of the human hand and allowing surgeons to perform complex operations with greater precision and control. Robotic laparoscopic surgery is minimally invasive, meaning it requires smaller incisions than traditional open surgery. This results in reduced trauma and faster recovery time for patients. It also offers improved © The Author(s), under exclusive license to Springer Nature Switzerland AG 2024 V. Sontea et al. (Eds.): ICNBME 2023, IFMBE Proceedings 92, pp. 29–38, 2024. https://doi.org/10.1007/978-3-031-42782-4_4

30

S. Zisimopoulos et al.

ergonomics for the surgeon, with more comfortable hand movements. This reduces the risk of fatigue leading to improved surgical outcomes. The above allows a robotic system to perform tissue manipulations that often cannot be performed by the human hand. However, robot-assisted procedures in several cases are still a debatable issue regarding their value, compared to conventional laparoscopy and open surgery. There is still uncertainty as to whether it is possible for a modern system that “cuts off” the direct contact of the surgeon with the patient, to be as safe as methods where the surgeon has direct control. Robotic surgery, as a recent technology that has found routine application in the last two decades, comes to be compared with pre-existing, well established invasive methods. Therefore, to justify the use of a robotic laparoscopic surgical system, the undoubted technical advantages it offers should be able to be translated into improved clinical outcomes, safety and sustainability. INBIT undertook a project to evaluate the feasibility of acquiring such a system by a Public Sector Hospital in Greece. This work focuses on the technology description, clinical outcomes, safety and economical aspects of laparoscopic robotic systems.

Fig. 1. RALS technology SWOT analysis.

2 Materials and Methods 2.1 Background Twelve RALS programs were active in Greece, as of 05/2023, according to SofMedica SA, who is the exclusive supplier of da Vinci Systems [1]. No other manufacturer systems were available in the Greek market, during the time of the study. Due to that, for the remainder of the study the analysis will focus on the da Vinci systems. Of the active RALS programs, only one is installed in a public hospital, with the rest belonging to the private healthcare sector. Data used in this study is publicly available on the Central Electronic Register of Public Contracts (KIMDIS) of “Prometheus” [2] and the Greek Transparency Program [3]. Additional information was provided by public hospitals in Greece and SofMedica.

Feasibility Study for a Robotic Laparoscopic Surgical System

31

2.2 Comparison of Clinical Outcomes For a more thorough investigation of the critical parameters of successful and sustainable application of robotic laparoscopic surgery, data from recent international studies such as Randomized control trials, Retrospective studies, Systematic reviews, Reviews of reviews and Meta-analyses were examined, comparing qualitative and quantitative clinical outcomes between robotic, traditional laparoscopic and open surgery, for various types of procedures. Most studies focused on immediate clinical and surgical outcomes (i.e. operative time, blood loss, surgical margins), while research on long-term outcomes (i.e. subsequent quality of life) was limited. The comparison was carried out based on the statistical significance of the Mean Difference, Risk Ratio or Odds Ratio of these outcomes. The types of procedures examined concern urological [4–6], gynecological [7–13], thoracic [14–16] and general surgery [17–22]. The list of procedures includes Partial Nephrectomy, Radical Prostatectomy, Radical and Total Hysterectomy for cervical and endometrial cancer, Myomectomy, Rectal - Mesorectal Resection, Peripheral Gastrectomy, Roux en-Y Gastric Bypass, Lobectomy, Thymectomy, Hepatectomy, Peripheral Pancreatectomy and Cholecystectomy. 2.3 Cost Analysis The total cost of ownership for a robotic system depends on various direct and indirect economic factors. These costs are divided into fixed and variable costs. Fixed costs include the initial capital to purchase the system, annual maintenance costs, and renovating/creating a custom-built operating room. Variable costs include the costs of supplying spare parts, tools and consumables of the system, staff payments, as well as indirect factors such as the time of operations, the length of hospitalization and staff training. Contracts available on the electronic registry of public contracts, as well as insight from the supplier and public hospitals were utilized to calculate costs. 2.4 Recalls Concerning vigilance, a search was conducted for reports of adverse events and recalls arising from the use of robotic surgical systems technology and related components. For this search, the FDA’s medical device recall database was used. These recalls include information on the actions to be taken by the user facilities, with the aim of protecting both patients and hospital staff.

3 Results 3.1 Clinical Outcomes The results of the comparison based on the literature demonstrate that the outcomes of robotic surgery are similar to the conventional laparoscopic approach in most types of procedures. A recurring pattern across nearly all types of procedures is the lower intraoperative blood loss, shorter hospital stays, fewer and milder overall complications, longer operative time, and higher costs. In some operations such as radical prostatectomy,

32

S. Zisimopoulos et al.

endometrial cancer operations, rectal resections and gastrectomies, RALS appears to show additional improved clinical outcomes, such as improvement in the quality of recovery and physiological functions. However, in some procedures such as radical hysterectomy, minimally invasive approaches can lead to more frequent and serious complications compared to the open approach. Table 1 summarizes the advantages and disadvantages of RALS versus conventional laparoscopy/open surgery. Table 1. Comparison of Clinical Outcomes between RALS and conventional laparoscopy/ open surgery. Advantages

Disadvantages

In total (Presented in most of the procedures)

• Lower intraoperative blood loss • Lower complication rate, milder total complications • Shorter hospital length of stay (LOS)

• Longer operative time • Higher cost

Per Case (Presented in specific types of surgeries)

Additionally improved clinical More frequent and serious outcomes complications

In general, the robotic assisted laparoscopic method is a safe and viable alternative to conventional laparoscopy. 3.2 Costs Fixed Costs Acquisition Cost. The acquisition cost for da Vinci in Greece is e1,750,000 + VAT for the X model and e2,650,000 + VAT for the Xi model. Beyond the purely economic data, it should be emphasized that da Vinci robotic systems are expected to have a lifespan of around 7 years, at the end of which they are considered technologically obsolete. Therefore, for the calculation of the amortization of the investment, this period of time should be taken into account as a maximum duration of use. As an example of acquisition cost, we refer to the Contract No. 9/2019 with Online Registration Number (ADAM) 19SYMV006012374 2019–12-11, according to which a Vinci X Robotic Surgery System was acquired with a contract cost of e1,984,000 including VAT. The contract also included a pair of 8mm 0˚ and 30˚ endoscopes, various EndoWrist instruments, installation and full operation, staff training and warranty for preventive and corrective maintenance coverage for one year. Maintenance Cost. Maintenance costs are a key factor contributing to the high operating costs of a robotic surgical system. To ensure its proper operation, high-cost periodic checks are required. According to Intuitive Surgical, two preventive maintenances per year are required regardless of the use of the respective robotic system. Maintenance costs

Feasibility Study for a Robotic Laparoscopic Surgical System

33

may vary by model. Based on the 12/5/2021 Contract with Internet Post Number (ADA): 21SYMV008588124, the maintenance cost after the end of the warranty amounted to e148,800/year for the da Vinci X in a Greek public hospital. In the USA, maintenance costs for one year vary between 8% and 10% of the purchase cost [23], depending on the model and the service package offered, with an average cost of $154,000 [24]. Operating Room Modification Cost. According to SofMedica, a checklist of requirements from the manufacturing company is included in the final agreement-contract. Some parameters that need to be checked are the access of the system to the hospital and operating theaters, the static study of the building, the electrical installations, a compatible source of medical gas, network infrastructures, as well as available high-quality video and audio systems to transmit images and audio from the system’s camera. Overall, the facility requirements for a robotic surgical system are significant and require the corresponding investment to be made for the modification/construction of a suitable space, the cost of which must be factored into the operating costs of the system [25]. The total cost of renovating an operating room can be in the order of e150,000 in case relatively minor modifications are required, such as upgrading the room’s ICT capabilities or installing suspended articulated arms [23]. This cost can double if there is a need for larger modifications, such as the construction of digital operating rooms. Variable Costs Instrument costs. Another important factor in the cost of ownership of a robotic surgical system is the cost of the tools and their lifetimes. Most of the instruments used by the Da Vinci Xi/X have a lifespan of 10 to 18 uses, after which they are considered unreliable and discarded. The use of reusable instruments requires specific equipment and a method of disinfection/sterilization, incurring an additional cost to the hospital. Searching the relevant product codes in the Central Electronic Register of Public Contracts (KIMDIS) for the first year of operation of a da Vinci system in a Greek public hospital, it was found that more than e108,579 was spent on the purchase of tools and consumables. The per case instrument cost may amount to about e1,500 [26]. Training. Robotic Surgery training consists of bedside and console training. Bedside training includes correct patient positioning, pneumoperitoneum creation, system docking and laparoscopic skills development. Console training includes dry and wet lab training, VR simulations and supervised surgeries. The cost of an available VR training program exceeds $100,000 [27], while the cost of basic training for a single surgical team amounts to e20,000. Operating time and hospital stay. Operating times and post-operative hospital stay are factors that affect the cost of operating a robotic machine. RALS operating time using a robotic system is usually longer than the corresponding times of classic laparoscopic surgery, largely due to the docking/undocking procedures of the system with the patient and the inexperienced surgical teams. On the other hand, hospital length of stay is often lower compared to laparoscopic and open procedures, contributing to the reduction of overall cost.

34

S. Zisimopoulos et al.

3.3 Recalls

Number of Recalls

The FDA Recalls Database was searched for the entire available period, from 1997 to the end of 2022. The product code “NAY” corresponding to the group of devices was used as a search criterion with the name (Device Name) “System Surgical Computer Controlled Instrument”. Robotic surgical systems are classified by the FAD in this group. 50 45 40 35 30 25 20 15 10 5 0

Fig. 2. Annual number of FDA recalls of Robotic Surgical Systems and components.

To date, 185 recalls related to laparoscopic robotic surgical systems have been posted to the FDA’s recall database (Fig. 2). The first recall was published on 3/28/2007. The breakdown of recalls by year is shown in Fig. 2. Of these, 184 are Class 2 recalls (potentially hazardous event), which is the FDA’s middle severity class. No recalls belong to the highest severity class (Class 1, highest severity/danger). The maximum number of recalls (47) was observed in 2014, while in recent years there is a reduced trend. Of these recalls, very few are associated with patient injury or death. A large portion of the recalls (53) are related to misinterpretation of instructions for use.

4 Discussion A modern hospital of high prestige, as the one required this feasibility study, should consider the acquisition and use of a robotic laparoscopic surgical system. In addition to the improved clinical and surgical outcomes of such a system, indirect benefits should be considered, such as its reputation and the lead that will be gained in the use of robotic technology that is expected to expand in the future. The necessary training should be seriously considered when planning such an acquisition. This should be considered both in terms of the training time required to perform the first surgeries using the robotic system, and in terms of the number of surgeries needed to gain the necessary staff experience for optimal results. The learning period, depending on the type of surgery, can be of the order of several tens of operations. Ultimately, the evaluation of the performance and outcomes of RALS will be able to lead to safe conclusions after the end of the above period. The performance of a robotic laparoscopic surgical system is highly dependent on human factors, such as the surgeon’s ability to use it. For this reason, in addition to

Feasibility Study for a Robotic Laparoscopic Surgical System

35

training, appropriate planning should be done to recruit experienced personnel to staff the required surgical teams. Securing the necessary personnel is of major importance to ensure the robotic system operates at its maximum potential. Apart from the initial investment, other important costs to consider are the renovation of the system installation site, the training of the surgical teams and the annual maintenance costs. These costs can be in the order of hundreds of thousands of euros for the one-time modification of the operating room, the annual maintenance and the training of the surgical teams. Some studies suggest that the robotic approach may overall prove to be cost-effective for the healthcare system in the future because it reduces complications and leads to shorter hospital and ICU stays, which may lead to lower costs, along with additional benefits to patients [19, 28]. However, amortization of the costs for a surgical robot is difficult to achieve [26]. According to a study based on the assumption that the average patient fee for a robotic operation in a Greek Private Hospital is e5,000 and the robotic system cost e2,000,000, it was found that an average of 500 robotic operations should be performed annually to allow the hospital to achieve amortization in 5 years [29]. In another analysis carried out in a hospital in Italy, it was calculated that to break-even, the number of annual operations would have to be at least 349, with an average patient fee of e8,379 per operation [23]. Moreover, the existing Line-Item Budget (KEN) compensation method of medical interventions that is implemented by the National Organization for the Provision of Health Services (EOPYY) [30] and is available for the compensation of Greek hospitals, does not include robotic surgery. As a result, hospitals have to use a payment per case compensation method, until a case mix – DRG system is developed and put into practice [31]. Analyzing the above costs can have a positive effect on both the financial success and overall effectiveness of a RALS program. However, hospitals use a variety of approaches to calculate the cost of operating robotic systems, making the comparison between different hospitals difficult, if not impossible [24]. For example, methods of calculating operating costs vary in terms of the inclusion of initial acquisition costs and other variable costs, such as administrative salaries, housekeeping, or other indirectly related parameters. Even within a given hospital, cost accounting methods may not be standardized for robotic and non-robotic assisted procedures, making comparisons between them difficult. According to data presented in the Acquisition Cost paragraph, the purchase contract for a da Vinci X system by a public hospital included the one-year warranty & maintenance, a strategy which is mainly followed in the robotic programs in Greece. It would be beneficial for a hospital to negotiate a purchase contract with a longer warranty & maintenance coverage period, such as two years, which is common practice in countries with a tradition in using RALS systems, such as the USA. Extending the warranty period could contribute to the long-term improvement of the economic performance of the system, since the annual maintenance cost is about 10% of the acquisition cost. If the full maintenance period cannot be extended, it would be beneficial to negotiate a commitment to a fixed price for maintenance and instruments (adding costs based on inflation) for subsequent years covering most of the system’s lifetime.

36

S. Zisimopoulos et al.

5 Conclusions The high cost of ownership of a robotic surgical system is the biggest disadvantage of the technology. On the other hand, the evaluation of the acquisition of a robotic surgical system should not be solely made on financial criteria. RALS present advantages such as reduced blood loss, lower complication rates and shorter patient stay in the hospital, leading to better post-operative quality of life. At the same time, the continuous development of robotic technology has the potential to mitigate the disadvantages of increased surgical time and operation costs. Furthermore, the implementation of a robotic surgery program by a hospital will enable it to adopt modern systems that will be developed in the future easier. The final decision to acquire a RALS system should include the image and prestige of the hospital and its commitment to adopt modern technologies. In case a hospital decides to proceed with the investment to acquire a RALS system, it would be correct before any move on the part of the hospital to negotiate the costs and the total benefits that can be included in the contract with the supplier.

Conflict of Interest. The authors declare that they have no conflict of interest.

References 1. SofMedica - Robotic Surgery. https://sofmedica.com/our-portofolio/robotic-surgery/ 2. Promitheus - eProcurement Homepage. https://portal.eprocurement.gov.gr/webcenter/portal/ TestPortal 3. Transparency Program – Diaygeia Homepage. https://diavgeia.gov.gr/ 4. Hinata, N., et al.: Robot-assisted partial nephrectomy versus standard laparoscopic partial nephrectomy for renal hilar tumor: a prospective multi-institutional study. Int. J. Urol. 28, 382–389 (2021). https://doi.org/10.1111/iju.14469 5. Muaddi, H., et al.: Clinical outcomes of robotic surgery compared to conventional surgical approaches (laparoscopic or open): a systematic overview of reviews. Ann. Surg. 273, 467–473 (2021). https://doi.org/10.1097/SLA.0000000000003915 6. Huang, X., Wang, L., Zheng, X., Wang, X.: Comparison of perioperative, functional, and oncologic outcomes between standard laparoscopic and robotic-assisted radical prostatectomy: a systemic review and meta-analysis. Surg. Endosc. 31, 1045–1060 (2017). https://doi. org/10.1007/s00464-016-5125-1 7. Jin, Y.-M., Liu, S.-S., Chen, J., Chen, Y.-N., Ren, C.-C.: Robotic radical hysterectomy is superior to laparoscopic radical hysterectomy and open radical hysterectomy in the treatment of cervical cancer. PLoS ONE 13, e0193033 (2018). https://doi.org/10.1371/journal.pone.019 3033 8. Nitecki, R., et al.: Survival after minimally invasive vs open radical hysterectomy for earlystage cervical cancer. JAMA Oncol. 6, 1–9 (2020). https://doi.org/10.1001/jamaoncol.2020. 1694 9. Gitas, G., et al.: Surgical outcomes of conventional laparoscopic and robotic-assisted hysterectomy. Int. J. Med. Robot. 17, e2225 (2021). https://doi.org/10.1002/rcs.2225 10. Gitas, G., et al.: Long-term satisfaction of patients after laparoscopic and robotic-assisted hysterectomy. Arch. Gynecol. Obstet. 305, 1481–1490 (2022). https://doi.org/10.1007/s00 404-021-06360-9

Feasibility Study for a Robotic Laparoscopic Surgical System

37

11. Ind, T., Laios, A., Hacking, M., Nobbenhuis, M.: A comparison of operative outcomes between standard and robotic laparoscopic surgery for endometrial cancer: a systematic review and meta-analysis. Int. J. Med. Robot. 13, e1851 (2017). https://doi.org/10.1002/rcs.1851 12. Takmaz, Ö., Güngör, M.: Robotic versus laparoscopic hysterectomy; comparison of early surgical outcomes. J. Turk. Ger. Gynecol. Assoc. 21, 260–264 (2020). https://doi.org/10. 4274/jtgga.galenos.2020.2019.0187 13. Wang, T., Tang, H., Xie, Z., Deng, S.: Robotic-assisted vs. laparoscopic and abdominal myomectomy for treatment of uterine fibroids: a meta-analysis. Minim. Invasive Ther. Allied Technol. 27, 249–264 (2018). https://doi.org/10.1080/13645706.2018.1442349 14. Liang, H., et al.: Robotic versus video-assisted lobectomy/segmentectomy for lung cancer: a meta-analysis. Ann. Surg. 268, 254–259 (2018). https://doi.org/10.1097/SLA.000000000000 2346 15. Luzzi, Luca, et al.: Robotic surgery vs. open surgery for thymectomy, a retrospective casematch study. J. Robotic Surg. 15(3), 375–379 (2021). https://doi.org/10.1007/s11701-02001109-z 16. O’Sullivan, K.E., Kreaden, U.S., Hebert, A.E., Eaton, D., Redmond, K.C.: A systematic review of robotic versus open and video assisted thoracoscopic surgery (VATS) approaches for thymectomy. Ann. Cardiothorac. Surg. 8, 174–193 (2019). https://doi.org/10.21037/acs. 2019.02.04 17. Simillis, C., et al.: Open versus laparoscopic versus robotic versus transanal mesorectal excision for rectal cancer: a systematic review and network meta-analysis. Ann. Surg. 270, 59–68 (2019). https://doi.org/10.1097/SLA.0000000000003227 18. Lu, J., et al.: Assessment of robotic versus laparoscopic distal gastrectomy for gastric cancer: a randomized controlled trial. Ann. Surg. 273, 858–867 (2021). https://doi.org/10.1097/SLA. 0000000000004466 19. Wang, L., et al.: Robotic versus laparoscopic roux-en-y gastric bypass for morbid obesity: a systematic review and meta-analysis. Obes. Surg. 28, 3691–3700 (2018). https://doi.org/10. 1007/s11695-018-3458-7 20. Guan, R., et al.: Clinical efficacy of robot-assisted versus laparoscopic liver resection: a meta analysis. Asian J. Surg. 42, 19–31 (2019). https://doi.org/10.1016/j.asjsur.2018.05.008 21. Niu, X., et al.: Comparison of surgical outcomes of robot-assisted laparoscopic distal pancreatectomy versus laparoscopic and open resections: a systematic review and meta-analysis. Asian J. Surg. 42, 32–45 (2019). https://doi.org/10.1016/j.asjsur.2018.08.011 22. Han, C., et al.: Robotic-assisted versus laparoscopic cholecystectomy for benign gallbladder diseases: a systematic review and meta-analysis. Surg. Endosc. 32, 4377–4392 (2018). https:// doi.org/10.1007/s00464-018-6295-9 23. Tedesco, G., Faggiano, F.C., Leo, E., Derrico, P., Ritrovato, M.: A comparative cost analysis of robotic-assisted surgery versus laparoscopic surgery and open surgery: the necessity of investing knowledgeably. Surg. Endosc. 30, 5044–5051 (2016). https://doi.org/10.1007/s00 464-016-4852-7 24. Feldstein, J., Schwander, B., Roberts, M., Coussons, H.: Cost of ownership assessment for a da Vinci robot based on US real-world data. Int. J. Med. Robotics Comput. Assist. Surg. 15, e2023 (2019). https://doi.org/10.1002/rcs.2023 25. Mahmoud, R.M.A., Youssef, A.M.A.: Design framework for robotic surgery wards at hospitals: computational implementation. Front. Architectural Res. 9, 514–540 (2020). https://doi. org/10.1016/j.foar.2020.05.002 26. Fischer, S., Kisser, A.: Can the costs of a surgical robot be amortised?: Eur. J. Pub. Health 26, ckw175.156 (2016). https://doi.org/10.1093/eurpub/ckw175.156 27. Wang, R.S., Ambani, S.N.: Robotic surgery training: current trends and future directions. Urol. Clin. North Am. 48, 137–146 (2021). https://doi.org/10.1016/j.ucl.2020.09.014

38

S. Zisimopoulos et al.

28. Simianu, V.V., et al.: Cost-effectiveness evaluation of laparoscopic versus robotic minimally invasive colectomy. Ann. Surg. 272, 334–341 (2020). https://doi.org/10.1097/SLA.000000 0000003196 29. Liatsikos, E., Tsaturyan, A., Kyriazis, I., Kallidonis, P., Manolopoulos, D., Magoutas, A.: Market potentials of robotic systems in medical science: analysis of the Avatera robotic system. World J. Urol. 40, 283–289 (2022). https://doi.org/10.1007/s00345-021-03809-z 30. Line Item Budget (KEN) site. https://www.moh.gov.gr/articles/health/domes-kai-draseis-giathn-ygeia/kwdikopoihseis/709-kleista-enopoihmena-noshlia-1 31. Greek DRG Institute Homepage. https://instdrg.gr/

Integration of Scpi over Vxi-11 Protocols in an Automated Gas Sensing Measurement System Alexandr Sereacov(B) Technical University of Moldova, Chisinau, Republic of Moldova [email protected]

Abstract. Gas sensing plays a crucial role in numerous applications, such as environmental monitoring, industrial safety, and healthcare. Semiconductor oxide nanostructured sensors have emerged as promising candidates due to their high sensitivity and low cost. However, the accurate and efficient characterization of their gas sensing properties remains a challenge. In this article, we present an automated measurement system that combines a source meter device for executing measurements and a software platform for user interface, signal visualization, and data storage. The system enables both transient measurements in time and volt-ampere characteristics measurements of the sensors. The software platform provides a user-friendly interface for configuring measurement parameters, initiating measurements, and visualizing real-time sensor responses. The acquired data is processed, analyzed, and stored in the network file storage for further examination. A comparison with existing systems based on LabVIEW or MATLAB highlights the advantages of the proposed measurement system, such as improved flexibility, scalability, and ease of integration with different source meter devices. The system’s modular architecture opens the way for advanced data analysis and modeling. Our approach enhances the speed, reliability, and repeatability of gas sensing characterization. The described measurement system offers researchers an effective and customizable tool for gas sensing analysis, facilitating scientific advancements in this field. Keywords: Gas sensing · Semiconductor oxide sensors · Automated measurement system · Scpi · Vxi-11 · Sensor characteristics data

1 Introduction Gas sensing technology plays a crucial role in various fields, including environmental monitoring, industrial safety, and healthcare applications. Semiconductor oxide nanostructures have garnered significant attention as gas sensing materials due to their unique properties, such as high surface-to-volume ratio, tunable surface chemistry, and sensitivity to various gases [1]. Characterizing the gas sensing properties of these nanostructures is essential for optimizing their performance and enabling their integration into practical sensing devices. © The Author(s), under exclusive license to Springer Nature Switzerland AG 2024 V. Sontea et al. (Eds.): ICNBME 2023, IFMBE Proceedings 92, pp. 39–49, 2024. https://doi.org/10.1007/978-3-031-42782-4_5

40

A. Sereacov

In recent years, significant advancements have been made in the development of measurement systems for characterizing semiconductor oxide nanostructured sensors. These systems aim to automate the measurement process, providing accurate and reliable data on the gas sensing behavior of the sensors [2]. Two essential components of these systems include a source meter device for executing the measurements and a software platform for user interface, signal visualization, data storage. The source meter device serves as a versatile instrument capable of precise control over voltage and current, enabling the characterization of gas sensing properties. It allows for the application of specific voltage signals to the sensors, enabling transient measurements in time. The resulting current response provides valuable insights into the dynamic behavior of the sensors and their response to different gas stimuli. The software platform, on the other hand, offers a user-friendly interface that simplifies experiment configuration, signal visualization, and data storage. Researchers can define measurement parameters, such as voltage range, current range, and measurement duration, through the software interface. Real-time visualization of measurement signals enhances the understanding of sensor response dynamics, aiding in the identification of key features such as response time, recovery time, and sensitivity [3]. This article presents an automated measurement system for characterizing the gas sensing properties of semiconductor oxide nanostructured sensors. The measurement system integrates a source meter device and a software platform to streamline the measurement process and provide researchers with efficient tools for data acquisition, analysis, and interpretation. The system enables both transient measurements in time and voltampere characteristics measurements, enhancing the understanding of the gas sensing behavior of semiconductor oxide sensors [4]. The following sections will discuss the architecture of the measurement system, the experimental setup and procedures, as well as the results and analysis obtained using the system. Additionally, the implications and future directions of the automated measurement system will be discussed. By leveraging the capabilities of the automated measurement system and building upon the existing knowledge in the field, researchers can make significant advancements in gas sensing technology, leading to improved environmental monitoring, enhanced industrial safety, and more effective healthcare applications.

2 Measurement System Architecture 2.1 Existing Measurement Systems In recent years, the development of automated measurement systems for gas sensing applications has gained attention in the scientific community. Traditionally, popular software platforms such as LabVIEW and MATLAB have been utilized for instrument control and data acquisition in various scientific and engineering domains [5]. These software packages were used for a very wide range of applications, for example, for vibration monitoring [6] or for pulse measure [7]. However, a comparison of the described measurement system, based on SCPI over VXI-11 over TCP protocol, with existing systems built on LabVIEW or MATLAB reveals several notable advantages.

Integration of Scpi over Vxi-11 Protocols

41

One key advantage of the described measurement system is its enhanced interoperability and compatibility with a wide range of source meter devices and instruments. The integration of SCPI and VXI-11 protocols allows for standardized communication and control, enabling seamless interaction with different instrument models from various manufacturers. This flexibility offers researchers the freedom to choose the most suitable source meter device for their specific gas sensing experiments, facilitating the advancement of sensor characterization methodologies. Furthermore, this interoperability allows for easier integration of the measurement system into existing laboratory setups, minimizing disruptions and enabling efficient utilization of available resources. Moreover, the utilization of the SCPI language in the described measurement system provides a standardized command set for instrument control. This standardization simplifies the programming and command generation process, making it easier for researchers to configure and customize measurements according to their specific requirements. The standardized syntax and hierarchical structure of SCPI commands enable straightforward parameter adjustments, measurement triggering, and data acquisition, resulting in streamlined experiment setups and increased experimental productivity. In contrast, existing systems based on LabVIEW or MATLAB often rely on proprietary or platform-specific interfaces, which may limit instrument compatibility and hinder interoperability with a diverse range of source meters [6]. While these platforms offer extensive libraries and graphical user interfaces for data analysis and visualization, the integration of standardized communication protocols in the described measurement system enhances the system’s versatility, adaptability, and ease of integration with other research tools and frameworks. LabVIEW typically relies on National Instruments (NI) hardware interfaces, which require the installation of specific drivers to communicate with the instruments. These drivers are often designed to work exclusively with NI hardware, creating compatibility issues when attempting to interface with instruments from other manufacturers. This proprietary nature of LabVIEW-based systems poses challenges for researchers and engineers who seek to integrate their preferred instrumentation or leverage existing equipment in their setup. 2.2 General Architecture The described measuring system architecture consists of an application server, a separate network file storage, a network attached source meter, and a working station for the user. See Fig. 1. The application server serves as the central component of the measuring system. It hosts the software platform that provides the data processing capabilities, and control functionalities. The server has connectivity options to handle multiple concurrent measurements and user interactions. Upon initialization, the application server establishes a network connection with the network attached source meter and the network file storage. The server acts as a mediator between the user computer and the source meter, facilitating command and data exchange.

42

A. Sereacov

The network attached source meter is a programmable instrument capable of generating precise voltage and current signals and measuring the resulting sensor responses. It is connected to the application server over the network, enabling remote control and data acquisition.

Fig. 1. System general architecture

To initiate a measurement, the user interacts with the software platform running on their computer. The software sends the appropriate SCPI commands, encapsulated in TCP packets, to the network attached source meter via the application server. These commands configure the source meter’s parameters, such as voltage range, current range, and measurement duration. Upon receiving the commands, the source meter adjusts its internal settings accordingly and starts applying the specified voltage signals to the semiconductor oxide nanostructured sensors. It measures the resulting current responses and sends the acquired data back to the application server for processing and storage. The user computer serves as the interface for the measuring system, allowing the user to interact with the software platform. The computer is equipped with the necessary software components to establish a network connection with the application server and run the user interface. Using the software platform, the user can configure measurement parameters, initiate measurements, and monitor the real-time sensor responses. The user interface provides visualizations of the measured signals, allowing the user to observe the dynamic behavior of the sensors. During the measuring procedure, the acquired data is transmitted from the network attached source meter to the application server. The server processes the data, performs any required analysis or computations, and stores the results in the network file storage for future reference and analysis. The network file storage serves as a centralized repository for storing the measured data. It provides a secure and scalable storage solution, allowing efficient organization, retrieval, and archival of the acquired sensor response data. Upon receiving the data from the application server, the network file storage stores the data in a structured manner, associating each measurement with relevant metadata,

Integration of Scpi over Vxi-11 Protocols

43

such as timestamp, measurement parameters, and sensor identification. This organization facilitates easy data retrieval for further analysis or sharing with other researchers. In summary, the measuring system operates within the described architecture by establishing network connections between the application server, the network attached source meter, the network file storage, and the user computer. The software platform running on the application server enables remote control of the source meter, data acquisition, processing, and storage. The user interacts with the system through the user computer, accessing the software platform’s user interface for measurement configuration and real-time monitoring. The acquired data is securely stored in the network file storage, ensuring data integrity and accessibility for subsequent analysis and research purposes. 2.3 Software Platform The software platform developed for our automated measurement system serves as a comprehensive tool for experiment control, data visualization, and storage. It offers a user-friendly interface that simplifies the configuration of gas sensing experiments, providing researchers with flexibility in defining measurement parameters such as voltage range, current range, and measurement duration. The software platform allows researchers to visualize the measurement signals in real-time, providing immediate feedback on the gas sensing behavior of the semiconductor oxide sensors. This visualization capability enhances the understanding of sensor response dynamics and facilitates the identification of key features, such as response time, recovery time, and sensitivity. The platform also provides tools for signal processing and data analysis, enabling researchers to extract valuable information from the measured data. The user interface implementation pattern typically involves separating the user interface code from the business logic and data access code. This is achieved by creating a set of classes and objects that are responsible for presenting information to the user and responding to user input, while delegating the actual processing of that input to separate layers of the system. The clean architecture pattern, on the other hand, emphasizes the separation of concerns and the creation of independent modules that can be easily swapped in and out as needed. It achieves this by organizing the system into layers, each with a specific responsibility and purpose. Combining these two patterns involves creating a user interface layer that interacts with the business logic layer in a clean and modular way. This can be achieved by creating interfaces or protocols that define the communication between the two layers, and implementing those interfaces in separate classes or modules. Furthermore, the software platform includes data storage functionalities that organize and save measurement results into structured files. This enables easy retrieval and comparison of data from different experiments, facilitating data analysis and crossreferencing. The system supports csv, tsv, data, opju file formats, ensuring compatibility with popular data analysis software for further in-depth analysis and interpretation (See Fig. 2).

44

A. Sereacov

Fig. 2. Software architecture

The integration of the source meter device and the software platform in our measurement system enables seamless communication and synchronization between the measurement instrument and the user interface. Researchers can control the measurement process, monitor real-time measurement signals, and save data for subsequent analysis, all within a single software environment. 2.4 Communication Between Source Meter and Software Application In the automated measurement system for characterizing semiconductor oxide nanostructured sensors, a robust and efficient communication layer is essential to facilitate seamless data transfer between the source meter device and the software platform. To achieve this, the system employs the Standard Commands for Programmable Instruments (SCPI) language over the Virtual Instrument eXtension for Instrumentation (VXI-11) protocol, which operates over the Transmission Control Protocol (TCP). SCPI is a common industry-standard command language used for controlling programmable instruments, including source meters. It provides a set of standardized commands and syntax for instrument operation, parameter setting, data acquisition, and other functionalities. SCPI commands are structured in a hierarchical format, allowing users to easily navigate and configure instrument settings. By utilizing SCPI commands, the software platform can communicate with the source meter device to control various measurement parameters, such as voltage, current, range selection, and triggering. The software sends SCPI commands to the source meter, and the device responds accordingly, enabling precise control and con-figuration of the measurement process (See Fig. 3). VXI-11 is a widely adopted protocol for remote instrument control and data transfer in the field of test and measurement. It provides a standardized interface and communication framework for connecting software applications to VXI-11 compatible instruments, such as source meters, over local area networks (LANs). Within the automated measurement system, the software platform utilizes the VXI11 protocol to establish a network connection with the source meter device. This allows for seamless command and data exchange between the software and the instrument. The

Integration of Scpi over Vxi-11 Protocols

45

Fig. 3. Protocol stack used for communication

VXI-11 protocol handles the low-level details of the network communication, ensuring reliable and efficient data transfer. By utilizing the SCPI language over the VXI-11 protocol, which operates over TCP, the communication layer of the automated measurement system ensures a standardized and reliable means of interaction between the source meter device and the software platform. This enables efficient command execution, parameter configuration, and data retrieval, enhancing the overall performance and usability of the system. The utilization of SCPI over VXI-11 over TCP protocol in the communication layer of the measurement system ensures interoperability, allowing the software plat-form to seamlessly communicate with different source meter devices from various manufacturers. It also provides flexibility for future system expansions and compatibility with other instruments that support the SCPI and VXI-11 standards.

3 Experimental Setup and Procedures 3.1 Gas Sensing Measurement Configuration The gas sensing measurements are conducted using the automated measurement system comprising the source meter device and the software platform. The sensor under test is mounted in a controlled environment chamber, which enables precise regulation of temperature, humidity, and gas concentration. To perform transient measurements in time, a specific voltage signal is applied to the sensor using the source meter device, and the resulting current response is recorded. The software platform allows researchers to define the voltage range, measurement duration, and sampling frequency for capturing the transient behavior of the sensor. By introducing different target gases into the chamber, the response of the sensor to specific gases can be measured and analyzed. For volt-ampere characteristics measurements, a range of voltage biases is applied to the sensor, and the corresponding current responses are recorded. The software platform provides researchers with the flexibility to configure the voltage range, step size, and measurement intervals. By systematically varying the applied voltage, the electrical characteristics of the sensor, such as current-voltage (I-V) curves, can be obtained.

46

A. Sereacov

3.2 Data Acquisition and Analysis During the gas sensing measurements, the software platform captures the measurement signals from the source meter device in real-time. The acquired data, consisting of voltage and current values, is processed and visualized within the software interface. Researchers can observe the real-time response of the sensor, enabling them to identify important features such as response time, recovery time, and sensitivity. The software platform includes data analysis tools that allow researchers to extract relevant information from the measurement data. Statistical analysis techniques, such as calculating the mean, standard deviation, and variance of the measured currents, can provide insights into the repeatability and stability of the sensor’s gas sensing response. 3.3 Data Storage and Reporting The measurement results obtained from the automated system are stored in organized files within the software platform. The system supports various file formats, such CSV (Comma-Separated Values), TSV or DAT ensuring compatibility with popular data analysis software for further processing and reporting. Researchers can generate comprehensive reports summarizing the measurement parameters, sensor characteristics, and gas sensing responses using the software platform. These reports can include graphical representations of the measurement signals, statistical analysis results, and comparative analyses between different sensors or gas species. The reporting feature provides a convenient means for researchers to document and share their findings, contributing to the collective knowledge in the field of gas sensing. In conclusion, the experimental setup and procedures of the automated measurement system involve configuration of gas sensing measurements, data acquisition, and analysis using the source meter device and the software platform. The system enables precise control over measurement parameters, real-time visualization of measurement signals, and efficient data storage and reporting. These capabilities facilitate the characterization of gas sensing properties and contribute to the advancement of semiconductor oxide gas sensor technology.

4 Results and Analysis 4.1 Transient Measurements in Time The automated measurement system successfully captured the transient behavior of semiconductor oxide nanostructured sensors in response to various target gases. Figure 4 illustrates an example of a transient measurement obtained using the system. The voltage signal applied to the sensor resulted in a rapid change in the measured current, indicating the response of the sensor to the gas stimulus. The response time, defined as the time taken for the current to reach a certain threshold, was determined from the measurement data. Additionally, the software platform allowed researchers to visualize and compare the transient responses of different sensors or sensor configurations. This facilitated the

Integration of Scpi over Vxi-11 Protocols

47

Fig. 4. Transient analysis live data

identification of optimal sensor designs or gas sensing materials for specific applications. By automating the measurement process, the system significantly reduced the time and effort required for data collection, enabling researchers to conduct a larger number of measurements and achieve more comprehensive results. 4.2 Volt-Ampere Characteristics Measurements The automated measurement system also facilitated the characterization of the voltampere characteristics of semiconductor oxide nanostructured sensors. Figure 5 presents an example of the current-voltage (I-V) curve obtained using the system. By sweeping the voltage bias across a range of values, the corresponding current response was recorded, enabling the determination of the sensor’s electrical behavior. The obtained I-V curves provided crucial information about the sensor’s conductivity, non-linearity, and threshold voltage. These characteristics are essential for understanding the electrical properties of the sensor and optimizing its performance.

Fig. 5. Volt ampere characteristics live data

48

A. Sereacov

Furthermore, the measurement system facilitated the extraction of key electrical parameters from the I-V curves, such as the resistance, breakdown voltage, and saturation current. These parameters provided valuable insights into the sensor’s performance and enabled researchers to make informed decisions regarding sensor optimization and customization.

5 Implications and Future Directions The automated measurement system presented in this study offers significant advantages for the characterization of gas sensing properties of semiconductor oxide nanostructured sensors. By streamlining the measurement process, it enhances efficiency, accuracy, and repeatability, enabling researchers to obtain comprehensive data for analysis and interpretation. The system’s user-friendly software platform provides a powerful tool for experiment control, data visualization, and storage. The real-time visualization of measurement signals enables immediate feedback on sensor behavior, while the data analysis tools facilitate the extraction of valuable information from the measurement data. The system’s compatibility with popular data analysis software allows for further in-depth analysis and interpretation of the measurement results. The automated measurement system holds great potential for advancing gas sensing.

6 Conclusion The development of an automated measurement system for characterizing the gas sensing properties of semiconductor oxide nanostructured sensors has been successfully presented. This system combines a source meter device for executing measurements and a software platform for user interface, signal visualization, and data storage. The integration of these components enables both transient measurements in time and volt-ampere characteristics measurements, enhancing the efficiency, accuracy, and repeatability of gas sensing characterization. The automated measurement system has significant implications for the field of gas sensing. It provides researchers with a reliable and efficient tool for characterizing the gas sensing behavior of semiconductor oxide sensors. The real-time visualization of measurement signals and the ability to conduct measurements in a controlled environment facilitate the identification of important sensor features such as response time, recovery time, and sensitivity. Moreover, the software platform’s data analysis capabilities allow for statistical analysis, signal processing, and the extraction of valuable information from the measurement data. By automating the measurement process, the system reduces human error and enhances data consistency, enabling researchers to conduct larger-scale studies and obtain more comprehensive results. The system’s scalability facilitates the testing and characterization of multiple sensors or sensor configurations, aiding in the optimization of gas sensing materials and designs.

Integration of Scpi over Vxi-11 Protocols

49

Future directions for the automated measurement system include the integration of advanced sensing techniques, such as multispectral measurements or multi-sensor arrays, to enhance the selectivity and accuracy of gas detection. Additionally, the system can be extended to incorporate machine learning algorithms for real-time data analysis and pattern recognition, enabling rapid and reliable identification of target gases. In conclusion, the automated measurement system presented in this article provides a valuable tool for researchers in the field of gas sensing. By combining a source meter device and a user-friendly software platform, the system enables efficient and accurate characterization of semiconductor oxide nanostructured sensors. This advancement in measurement technology contributes to the development of improved gas sensing materials and sensor designs, leading to advancements in environmental monitoring, industrial safety, and healthcare applications.

Conflict of Interest. The author declares having no conflict of interest.

References 1. Lupan, O., et al.: TiO2 /Cu2 O/CuO multi-nanolayers as sensors for H2 and volatile organic compounds: an experimental and theoretical investigation. ACS Appl. Mater. Interfaces 13(27), 32363–32380 (2021). https://doi.org/10.1021/acsami.1c04379 2. Wang, Y., Duan, L., Deng, Z., Liao, J.: Electrically transduced gas sensors based on semiconducting metal oxide nanowires. Sensors 20(23), 6781 (2020). https://doi.org/10.3390/s20 236781 3. Yang, L., Zheng, G., Cao, Y., et al.: Moisture-resistant, stretchable NOx gas sensors based on laser-induced graphene for environmental monitoring and breath analysis. Microsyst. Nanoeng. 8, 78 (2022). https://doi.org/10.1038/s41378-022-00414-x 4. Kong, X., et al.: Metal-semiconductor-metal TiO2 ultraviolet detectors with Ni electrodes. Appl. Phys. Lett. 94(12), 123502 (2009). https://doi.org/10.1063/1.3103288 5. Krauß, A., Weimar, U., Göpel, U.: LabView™ for sensor data acquisition. TrAC, Trends Anal. Chem. 18(5), 312–318 (1999). https://doi.org/10.1016/S0165-9936(99)00104-1 6. Gani, A., Salami, M.J.E.: A LabVIEW based data acquisition system for vibration monitoring and analysis. In: Student Conference on Research and Development, pp. 62–65. Shah Alam, Malaysia (2002). https://doi.org/10.1109/SCORED.2002.1033055 7. Zhang, J.M., Wei, P.F., Li, Y.: A LabVIEW based measure system for pulse wave transit time. In: International Conference on Information Technology and Applications in Biomedicine, pp. 477–480, Shenzhen, China, (2008). https://doi.org/10.1109/ITAB.2008.4570599

Assisting Deaf and Hard-of-Hearing People in Critical Situations: Alleviating Stress and Enhancing Safety Oana-Isabela S, tirbu1,4(B) , Ioana-Raluca Adochiei1,2 , Ruxandra-Victoria Paraschiv1,3 , S, erban-Teodor Nicolescu1,4 , Felix-Constantin Adochiei4 , and George-C˘alin Serit, an4 1 Academy of Romanian Scientists, Bucharest, Romania

[email protected]

2 Military Technical Academy Ferdinand I, Bucharest, Romania 3 Titu Maiorescu University, Bucharest, Romania 4 University Politehnica of Bucharest, Bucharest, Romania

Abstract. Individuals who are deaf or hard of hearing encounter many difficulties in their daily lives, especially when it comes to receiving important information during emergencies or disasters. Relying on others for updates can create a dependency that may hinder their ability to respond independently and effectively in critical situations. To address this problem, it is crucial to have a warning system that can provide timely alerts directly to deaf and hard-of-hearing individuals, reducing their reliance on family members, tutors, or caregivers during emergencies. Our team has developed a mobile application that can notify individuals of unavoidable events like earthquakes or fires. We used App Inventor, a user-friendly development platform, to create the app, which can be installed on wearable devices for easy accessibility. By utilizing wearable technology and mobile connectivity, our app aims to bridge the communication gap that deaf and hard-of-hearing individuals experience during emergencies. It includes several essential features to enhance its effectiveness, such as customized alert settings based on individual preferences, such as the type of alerts, urgency level, and notification formats (visual or vibration). The app also offers real-time location tracking, which can provide personalized localized alerts, giving deaf and hard-of-hearing individuals crucial information about their immediate surroundings. Furthermore, the app has multilingual support to cater to diverse deaf and hard-of-hearing communities, ensuring that signals and information are conveyed in their preferred languages. Keywords: DHHP · Emergencies · Assistance System · iDeaf Alert · Safety Alerts

1 Introduction “Deaf and Hard of Hearing people” commonly refers to individuals with varying degrees of hearing loss, including complete deafness and partial hearing loss. It encompasses individuals with hearing loss and emphasizes the cultural and linguistic identity of the © The Author(s), under exclusive license to Springer Nature Switzerland AG 2024 V. Sontea et al. (Eds.): ICNBME 2023, IFMBE Proceedings 92, pp. 50–58, 2024. https://doi.org/10.1007/978-3-031-42782-4_6

Assisting Deaf and Hard-of-Hearing People

51

Deaf community [1]. Sign language primarily relies on hand movements and body language to convey meaning and ideas [2]. Effective communication in sign language often involves a combination of arm or body movements and facial expressions [3–5]. Unlike spoken/written languages, sign language has its vocabulary and syntax, distinct from auditory-based languages. While spoken languages are processed in the auditory cortex through phonation, which generates sounds corresponding to words and grammatical combinations, sign language uses the visual system and the visual cortex for information reception. Both spoken and sign languages share rules and complex grammar to facilitate intelligible communication [6]. Sign language has gained global recognition as a widely used mode of communication, forming the foundation of DHHP communities. According to the World Federation of the Deaf (WFD), more than 5% of the world’s population experiences disabling hearing loss [8]. Hearing loss severity is categorized into mild, moderate, severe, and profound. The extent of hearing loss directly affects a person’s speech and language development. Individuals with severe or profound hearing loss generally exhibit higher speech disability indices (SDIs) than those with mild hearing loss. Individuals with mild hearing loss, who can hear specific sounds with unimpaired speech clarity, face fewer challenges in speech development. Those with moderate hearing loss (hearing sounds between 41 and 55 dB) often struggle to recognize sounds without hearing aids. Profound hearing loss (hearing sounds above 91 dB) necessitates lip reading or sign language for communication [9]. Deafness limits the ability to perform everyday tasks, and studies have shown that deaf individuals, particularly children, may experience behavioral and emotional difficulties related to communication methods. Many individuals with hearing disabilities become introverted and avoid social interactions, especially face-to-face communication. The inability to communicate with family and friends can lead to low self-esteem and social isolation. Moreover, the failure to speak poses significant barriers to receiving proper care for deaf individuals. Hearing plays a crucial role during emergencies [10]. Therefore, the primary objective of this work is to develop a smartphone-based assistive technology to notify DHHP individuals during unavoidable situations such as earthquakes and fires. Extensive research has been conducted on the development of dedicated systems tailored specifically for the Deaf and Hard-of-Hearing (DHH) population, as discussed in references [11–15]. These studies aim to address the challenges faced by DHH individuals in accessing vital information during emergencies and disasters by designing and implementing technological solutions.

2 DHHP Emergency Alert System: Integrated Solution Implementing the emergency alert system for DHHP involves integrating hardware and software components to ensure effective and reliable communication during critical situations. The system has been designed to address the unique needs of DHHP individuals and provide them with timely alerts and notifications. The hardware part of the system consists of various devices and sensors that enable the detection and transmission of emergency signals. On the software side, a robust and user-friendly application has been developed to facilitate the reception and dissemination of emergency alerts to DHHP individuals. The software is designed to run on mobile devices, ensuring users’ ease

52

O.-I. S, tirbu et al.

of access and portability. The application utilizes advanced algorithms and protocols to process the incoming data from the hardware sensors and analyze the severity and proximity of the emergency event. Based on this analysis, personalized alerts are generated and delivered to the DHHP individuals through various communication channels. Figures 1 and 2 provide comprehensive visual representations of the system’s architecture and operational flow. These diagrams illustrate the hardware and software components, their interconnections, and the flow of information during an emergency event.

Fig. 1. The block diagram in case of an earthquake

Fig. 2. The block diagram in case of fire

The core infrastructure of our system relies on the Arduino UNO development board, which is coupled with specialized operating software tailored for the specific sensors employed – the MQ-2 smoke sensor and the SW-420 vibration sensor. These sensors are critical in detecting and capturing relevant data associated with potential emergencies. The hardware system transmits this data to the App Inventor application, which undergoes comprehensive processing and analysis. Our approach leverages multiple channels to effectively communicate emergency procedures, including SMS notifications and visual illustrations presented within the application. Figures 3 and 4 illustrate the graphical representation of these emergency procedures. All communication between the hardware and the application occurs seamlessly via Bluetooth, ensuring efficient and reliable transmission. To receive timely alerts during emergencies such as fires or

Assisting Deaf and Hard-of-Hearing People

53

earthquakes, individuals with hearing impairments must download and install the App Inventor application on their mobile devices. This dedicated application serves as the primary means of delivering critical alerts and instructions, catering to the unique needs of the deaf and hard-of-hearing community.

Fig. 3. Illustrations of emergency procedures that are displayed on the phone in case of an earthquake

Fig. 4. Illustrations of emergency procedures that are displayed on the phone in case of fire

The interaction between DHHP individuals and the mobile application is facilitated through the utilization of the MIT App Inventor. MIT App Inventor is a powerful visual programming language that enables the creation of Android applications by connecting blocks of code [16]. Figures 5 and 6 provide schematic representations showcasing the connections established within the application.

54

O.-I. S, tirbu et al.

Fig. 5. Hardware implementation of the system for deaf mutes (1)

Fig. 6. Hardware implementation of the system for deaf mutes (2)

3 iDeaf Alert Emergency System: Results and Findings The proposed system can detect three distinct situations: fire, earthquake, or a combination of fire and earthquake. The functionalities of the two detectors utilized in this study are depicted in Figs. 7 and 8. The resulting application, developed under the name iDeaf Alert, is presented in Fig. 9. The functioning of application operates as follows: information is transmitted via Bluetooth, triggering a notification on the user’s phone with specific alerts such as “Alert: Fire!”, “Alert: Earthquake!” or “Alert: Earthquake and Fire!”. Concurrently, the phone’s flashlight intermittently flashes on and off at a frequency of one second per cycle (refer to Fig. 10). Upon detecting an earthquake or fire, in addition to the notification displayed on the phone, the application automatically opens the relevant instructions about the specific situation, be it fire, earthquake, or the combined scenario of fire and earthquake.

Assisting Deaf and Hard-of-Hearing People

Fig. 7. Testing the system in case of fire

55

Fig. 8. Testing the system in case of an earthquake

Fig. 9. iDeaf Alert

The application features a dedicated button labeled “112” that allows DHHP individuals to swiftly send an automated distress message along with their location information. By pressing the button, the message “Help! Fire!” or “Help! Earthquake!” is sent, accompanied by the precise location of the user (as illustrated in Fig. 11).

56

O.-I. S, tirbu et al.

Fig. 10. Notifications received in the three situations (fire, earthquake, or fire and earthquake)

Fig. 11. iDeaf Alert – Button 112

4 Conclusions DHHP individuals need help accessing information about natural disasters such as fires, earthquakes, floods, and accidents. Therefore, the development of a system to alert them becomes crucial. The proposed approach enhances their daily lives and empowers them to protect themselves in these unavoidable situations. The mobile application, iDeaf Alert, serves as the primary interface for DHHP users to interact with. Through this application, DHHP individuals can respond proactively to precarious situations like earthquakes or fires and promptly send their location information to the relevant authorities. Notably, message transmission occurs even without an internet connection, providing an added advantage. This assistance system aims to alleviate stress and enhance safety for DHHP individuals, particularly during critical events such as fires and earthquakes. An enhancement that can be considered for the proposed system is incorporating vibration

Assisting Deaf and Hard-of-Hearing People

57

levels (weak or strong) to distinguish between alerts and notifications. This improvement would further augment the intangible benefit of reducing their reliance on family members during emergencies. Acknowledgments. This work was supported by Academy of Romanian Scientists, Ilfov 3, 050044 Bucharest, Romania.

Conflict of Interest. The authors declare that they have no conflict of interest.

References 1. Tin, W., Lin, Z., – Swe, Mya, N.K.: Deaf mute or deaf. Asian J. Med. Biol. Res. 3(1), 10–19 (2017). https://doi.org/10.3329/ajmbr.v3i1.32031 2. Zhao, S.N., Wang, M.R., Wei, Z.: A new type of DHHPSign language recognition system based on the mobile communication platform and terminal equipment. AMR 734–737, 2880– 2886 (2013). https://doi.org/10.4028/www.scientific.net/AMR.734-737.2880 3. Kakde, M.U., Nakrani, M.G., Rawate, A.M.: A review paper on sign language recognition system for deaf and dumb people using image processing. Int. J. Eng. Res. V5(03), 590–592 (2016). https://doi.org/10.17577/IJERTV5IS031036 4. Jadhav, D., Tripathy, A.: Gesture aided speech for deaf and mute. In: 2018 3rd International Conference for Convergence in Technology (I2CT), pp. 1–6. Pune (2018). https://doi.org/10. 1109/I2CT.2018.8529411 5. Anderson, S.R., Wiryana, F., Ariesta, M.C., Kusuma, G.P.: Sign language recognition application systems for deaf-mute people: a review based on input-process-output. Procedia Comput. Sci. 116, 441–448 (2017). https://doi.org/10.1016/j.procs.2017.10.028 6. Sood, A., Mishra, A.: AAWAAZ: a communication system for deaf and dumb. In: 2016 5th International Conference on Reliability, Infocom Technologies and Optimization (Trends and Future Directions) (ICRITO), pp. 620–624. Noida, India (2016). https://doi.org/10.1109/ICR ITO.2016.7785029 7. Al-Nuaimy, F.N.H.: Design and implementation of DHHP interaction system In: 2017 International Conference on Engineering and Technology (ICET), pp. 1–6. Antalya (2017). https:// doi.org/10.1109/ICEngTechnol.2017.8308140 8. Ahmed, M.A., Zaidan, B.B., Zaidan, A.A., Salih, M.M., Bin Lakulu, M.M.: A review on systems-based sensory gloves for sign language recognition state of the art between 2007 and 2017. Sensors 18(7), 2208 (2018). https://doi.org/10.3390/s18072208 9. Olusanya, B.O., Davis, A.C., Hoffman, H.J.: Hearing loss grades and the International classification of functioning, disability, and health. Bull. World Health Organ. 97(10), 725–728 (2019). https://doi.org/10.2471/BLT.19.230367 10. Adochiei, I.R., et al.: Human behavior, recognition, and interpretation system using physiological signals. In: 2023 13th International Symposium on Advanced Topics in Electrical Engineering (ATEE), pp. 1–4. Bucharest, Romania (2023). https://doi.org/10.1109/ATEE58 038.2023.10108220 11. Xu, R., Zhou, S., Li, W.J.: MEMS accelerometer based nonspecific-user hand gesture recognition. IEEE Sensors J. 12(5), 1166–1173 (2012). https://doi.org/10.1109/JSEN.2011.216 6953 12. Fiel, C.P., Castro, C.C., Arvizu, V.V., Díaz, N.-P., Jiménez, D.S., Carvajal, R.R.: Design of translator glove for DHHPAlphabet. Presented at the 3rd International Conference on Electric and Electronics, Hong Kong, China (2013). https://doi.org/10.2991/eeic-13.2013.114

58

O.-I. S, tirbu et al.

13. Abhishek, K.S., Qubeley, L.C.F., Ho, D.: Glove-based hand gesture recognition sign language translator using capacitive touch sensor. In: 2016 IEEE International Conference on Electron Devices and Solid-State Circuits (EDSSC), Hong Kong, pp. 334–337 (2016). https://doi.org/ 10.1109/EDSSC.2016.7785276 14. Sharma, D., Vora, K., Shukla, S.: Hand assistive device for deaf and dumb people. Int. J. Adv. Res. 5(10), 1042–1046 (2017). https://doi.org/10.21474/IJAR01/5623 15. Boppana, L., Ahamed, R., Rane, H., Kodali, R.K.: Assistive sign language converter for deaf and dumb. In: 2019 International Conference on Internet of Things (iThings) and IEEE Green Computing and Communications (GreenCom) and IEEE Cyber, Physical and Social Computing (CPSCom) and IEEE Smart Data (SmartData), pp. 302–307. Atlanta, GA, USA (2019). https://doi.org/10.1109/iThings/GreenCom/CPSCom/SmartData.2019.00071 16. Georgiev, T.S.: Students’ viewpoint about Using MIT App inventor in education. In: 2019 42nd International Convention on Information and Communication Technology, Electronics, and Microelectronics (MIPRO), pp. 611–616. Opatija, Croatia (2019). https://doi.org/10. 23919/MIPRO.2019.8756671

Evaluation of the Maintenance System of Medical Equipment – A Necessity for Implementing an Effective Quality System Calin Corciova1(B) , Robert Fuior1

, Catalina Luca1

, and Victor Sontea2

1 Medical Bioengineering Faculty, University of Medicine and Pharmacy “Grigore T. Popa”,

Iasi, Romania [email protected] 2 Technical University of Moldova, Cisinau, Moldova

Abstract. Evaluating the maintenance of medical equipment is essential to ensure the proper and safe operation of these systems, which are essential for the diagnosis, treatment, and monitoring of patients. Throughout the life cycle of medical equipment, regular maintenance and calibration are required to maintain its performance and accuracy. In addition, it is important that medical equipment undergoes regular reviews to verify that it still meets applicable standards and regulations. If a malfunction or problem is found in the operation of the medical equipment, it is essential to report it immediately to the supplier or distributor of the equipment so that timely corrective measures can be taken. Some key reasons for the importance of evaluating the maintenance of medical systems are patient safety, system reliability and availability, performance optimization, regulatory and standards compliance. This paper presents aspects related to maintenance, management, maintenance, and quality management of medical equipment by firstly analyzing the technological and medical information obtained through various questionnaires. Summarize the issues encountered in medical equipment maintenance and design a medical quality control system to manage the maintenance and quality control of medical equipment. In the medical equipment maintenance system, scientific management theories and methods are used to predict, adjust, inspect, and account for the quality of the entire medical process and to establish a complete quality monitoring and management system. Compliance with standards and regulations, as well as adequate training of medical personnel, can ensure the correct and efficient use of this equipment, thus contributing to the provision of high-quality medical care. Keywords: Maintenance · Medical Equipment · Prediction · Quality Management · Assessment

1 Introduction Medical equipment is vitally important in providing patient care and in the diagnosis, treatment, and monitoring of medical conditions. They play a key role in providing quality healthcare and help improve people’s health and lives. Some important reasons why medical devices are essential [1]: © The Author(s), under exclusive license to Springer Nature Switzerland AG 2024 V. Sontea et al. (Eds.): ICNBME 2023, IFMBE Proceedings 92, pp. 59–67, 2024. https://doi.org/10.1007/978-3-031-42782-4_7

60

C. Corciova et al.

1. Accurate diagnosis: Medical equipment helps doctors make an accurate diagnosis by providing critical information about a patient’s condition. Medical imaging, such as CT scanners, MRIs, or ultrasounds, allows the internal structures of the human body to be visualized and conditions to be identified. Laboratory equipment, such as blood analyzers and genetic testing equipment, provide quick and accurate results to help diagnose diseases correctly. 2. Effective treatment: Medical equipment facilitates the treatment of patients by administering medication, monitoring vital signs, and performing surgery. Infusion pumps and automatic syringes allow doctors to administer accurate doses of drugs. Patient monitors monitor vital signs such as heart rate, blood pressure and blood oxygen levels to ensure appropriate treatment and prompt intervention in the event of complications. 3. Continuous monitoring and care: Medical equipment allows for continuous monitoring of patients and ensures rapid response in case of significant changes in their condition. Heart monitors, for example, can detect arrhythmias or heart rhythm changes and alert medical staff. Mechanical ventilators are vital in the care of critically ill patients requiring continuous respiratory support. 4. Infection Prevention and Control: Medical equipment plays a crucial role in infection prevention and control in the medical environment. Sterilization of surgical instruments, protective devices, and equipment is critical to reducing the risk of nosocomial infections and disease transmission. 5. Research and innovation: Advanced medical equipment enables researchers and doctors to conduct studies and develop new medical technologies. This contributes to the advancement of the medical field and the constant improvement of patient care [2]. It is important that medical equipment is of high quality, reliable and safe, and that medical staff are professionally trained in their use. Strict quality standards and government regulations ensure that medical equipment meets the requirements necessary for medical use.

2 Medical Equipment Maintenance and Quality Control The maintenance of medical equipment is a critical aspect in the medical field, having the role of ensuring the correct, safe, and efficient operation of the equipment used. 2.1 Maintenance Types. Features of the Biomedical Field Preventive maintenance is planned and conducted regularly before the equipment experiences problems or breaks down. This type of maintenance includes checking and regularly cleaning the equipment, replacing worn parts, making necessary calibrations and adjustments, and updating software or firmware according to the manufacturer’s specifications [3]. Corrective maintenance occurs when equipment has experienced a breakdown or problem. In these situations, repairs or component replacements are performed to return the equipment to optimal operating condition. It is important that corrective maintenance interventions are carried out as quickly as possible to minimize interruptions in the provision of medical care. Personnel responsible for maintaining medical equipment should have an appropriate level of training and education [4]. They must

Evaluation of the Maintenance System of Medical Equipment

61

be familiar with the specific equipment they are servicing, understand the principles of operation, and be able to properly perform maintenance and repair procedures. Maintenance of medical equipment must be performed in accordance with applicable rules and regulations. These can include safety standards, quality requirements and specific manufacturer recommendations. Compliance with these rules helps ensure the safety and effectiveness of equipment use. It is important to keep detailed and up-to-date documentation regarding the maintenance of medical equipment. This includes records of maintenance activities carried out, test and inspection results, repairs carried out, component replacements and any other relevant information. This documentation can be useful in evaluating the condition of the equipment, identifying recurring problems, and monitoring long-term performance [5]. For complex or specialized medical equipment, it may be beneficial to work with authorized service providers. They have the necessary expertise and access to spare parts and specific documentation to ensure proper equipment maintenance. It is recommended to monitor the performance of medical equipment over time using relevant indicators and report any anomalies or problems identified. This continuous monitoring can help identify trends and proactive interventions to avoid major breakdowns or interruptions in the delivery of medical services [6]. 2.2 Aspects of Quality Control for Medical Equipment Quality control for medical equipment is essential to ensure its safety and effectiveness in patient care. Steps involved in the quality control of medical equipment may vary according to the regulations and standards specific to each country or region. Medical devices are subject to strict regulations and standards that must be met. These may be set by national or international organizations and authorities, such as the US Food and Drug Administration (FDA), the International Organization for Standardization (ISO) or the European EN standards [7]. These regulations and standards ensure that medical equipment is designed, manufactured, and tested to specific requirements. Also, medical equipment goes through a rigorous testing and certification process to verify compliance with standards and regulations. This may involve performance testing, electrical and electromagnetic safety testing, electromagnetic compatibility (EMC) testing, durability testing, and more. Specialized organizations and laboratories carry out these tests and issue certifications that certify that the equipment meets the necessary standards [8]. Quality control begins with the verification of medical equipment production. This may involve inspecting production facilities, evaluating manufacturing processes, checking documentation and quality assurance process. Periodic audits may be conducted by independent organizations or by regulatory authorities to ensure that manufacturing processes and practices meet quality requirements. Quality control continues even after the medical device is on the market. Manufacturers and distributors regularly monitor the performance and safety of medical devices through adverse reaction reports, user complaints and safety reviews. This information may be used for continuous product improvement and to initiate corrective actions such as product recalls or updates [9].

62

C. Corciova et al.

Quality control for medical devices is a complex and continuous process involving a combination of regulations, testing, monitoring, and training to ensure that medical products meet the required standards and provide a high level of safety and performance for patients and the medical staff (Fig. 1).

Fig. 1. Synoptic diagram of quality control of medical equipment

The PDCA cycle (Plan-Do-Check-Act) is a continuous improvement model used in quality assurance and in the management of processes in the management of medical equipment. This cycle consists of four distinct stages that are continuously repeated to achieve constant improvement and ensure that processes and results meet quality standards [10]. 1. Plan (P): In this stage, goals are identified, and plans are made to achieve those goals. Relevant data is collected and analyzed, risks are assessed, and strategies are developed to address these risks. Performance indicators are established, and the necessary activities are planned to achieve the objectives. 2. Do (D): In this stage, plans are put into action. Planned activities are carried out according to established instructions and procedures. Data and information are collected during implementation and all relevant aspects are documented for further evaluation. 3. Check (C): In this stage, the results achieved by implementing the plan are evaluated. Results are compared with established objectives and performance indicators. Analyzes, inspections and other control activities are performed to verify that the results are in accordance with the established standards and expectations. 4. Act (A): In this stage, corrective action is taken, and changes are implemented to correct any deviations identified in the previous stage. Root causes of problems are analyzed, action plans are developed, and appropriate solutions are implemented. Improvements are also identified and applied to avoid future problems and increase overall performance.

Evaluation of the Maintenance System of Medical Equipment

63

After the “Act” stage is completed, it is returned to the “Plan” stage and the PDCA cycle is repeated to continue the continuous improvement process. The PDCA cycle provides a structured and systematic framework to ensure that processes and results are continuously monitored, evaluated, and improved to achieve and exceed established quality objectives (Fig. 2).

Fig. 2. Quality management control for medical equipment

3 Quality Centered Maintenance Concept. Framework Proposal The concept is based on the creation of a questionnaire with twelve sections, following twelve distinct domains. For each question there are five answers: (1) No; (2) rather no; (3) neither no, nor yes; (4) rather yes; (5) Yes. For each answer option, a score is assigned, depending on the importance of the question, and at the end of each column, the scored score is added up. The twelve domains for analysis are: A. B. C. D. E. F. G. H. I. J. K. L.

general organization. methods of work. traceability and technical history. the management of the portfolio of works. stock management (spare parts and consumables). acquisition/supply. repair workshop. technical endowment. technical documentation. personnel and training. subcontracting (maintenance outsourcing). the control of the activity.

Some examples of questionnaires are presented below (Tables 1, 2, 3, 4, 5 and 6). The results are interpreted by centralizing the data in a synthetic table. In the case of successive assessments, both progress and regression can be highlighted. The data included in the questionnaire are the result of the evaluation of a maintenance system in a hospital in Romania with a number of 1823 medical equipment and eight technical level personnel (medical bioengineer, engineer, technician).

64

C. Corciova et al. Table 1. Questionnaire for general organization

A. General organization

(1) (2) (3) (4) (4)

1. Has the organizational framework of the maintenance been defined in writing and approved?

0

-

-

-

30

2. Are the responsibilities and missions defined in the organizational 0 framework checked regularly?

-

-

-

10

3. Are the responsibilities defined clearly?

-

-

-

20

0

4. Are the staff involved enough?

0

10

-

20

30

5. Is each activity bound by a budget?

0

-

5

-

10

6. Is there a designated person in charge to coordinate the whole activity?

0

5

-

15

20

7. Is there a job description for each contractor?

0

-

10

-

20

8. Are the objectives regularly updated?

0

5

-

20

30

10

-

20

30

9. Do the technical staff have written records regarding maintenance 0 missions? Total points possible A: 200

Table 2. Questionnaire for traceability and technical history C. Traceability and technical history;

(1) (2) (3) (4) (4)

1. Are there updated lists regarding the location of the equipment?

0

10 -

20 30

2. Does each piece of equipment have a unique identification number? 0

5

-

10 20

3. Are there systematic records regarding new and/or retired equipment?

0

5

-

10 20

4. Is there an “Equipment Register” for each piece of equipment?

0

10 -

20 30

5. Is there a history of all interventions supported by a certain equipment?

0

10 -

20 30

6. Is there information on the labor consumed and the parts replaced for each piece of equipment?

0

10 -

25 40

7. Is a systematization of findings resulting from maintenance inspections ensured?

0

-

15 -

8. Is the technical history analyzed at least once a year?

0

5

-

Total points possible C: 220

30

15 20

Evaluation of the Maintenance System of Medical Equipment

65

Table 3. Questionnaire for technical documentation I. Technical documentation

(1) (2) (3) (4) (4)

1. Is there sufficient technical documentation (specialist books, norms, standards, etc.)?

0

10 -

20 30

2. Is there a service manual for each equipment?

0

15 -

30 40

3. Are these manuals accessible and usable?

0

10

20 30

4. Is there clear documentation of all the changes applied to some equipment?

0

5

-

15 20

5. Are the maintenance contracts easily accessible for all the people involved?

0

5

-

15 20

6. Are the means of document multiplication and classification sufficient?

0

-

-

-

10

Total points possible I: 150

Table 4. Questionnaire for personnel and training J. Personnel and training

(1) (2) (3) (4) (4)

1. Is the working climate positive?

0

10 -

25 40

2. When problems occur, are the technicians involved consulted?

0

10 -

20 30

3. Is there an annual check of the personnel?

0

5

-

15 20

4. Are there enough human resources?

0

10 -

20 30

5. Do you consider the staff’s competence satisfactory?

0

15 -

35 50

6. Does the staff have the necessary initiative in their daily work?

0

10 -

20 30

7. In the case of complex equipment, does the manufacturer provide a 0 training course?

10 -

20 30

8. Are the staff permanently trained in security aspects?

0

5

-

20 30

9. Is there a plan for the training programs for the technical and medical staff?

0

5

-

15 20

Total points possible J: 280

66

C. Corciova et al. Table 5. Questionnaire for subcontracting (maintenance outsourcing)

K. Subcontracting (maintenance outsourcing)

(1)

(2)

(3)

(4)

(4)

1. Is there a process for evaluating subcontracts according to technicality or competence?

0

10

-

-

30

2. Are all activities of subcontractors carried out only after careful 0 study of the specifications?

15

-

230

40

3. Is there the possibility to choose between several subcontractors?

0

5

-

15

20

4. Do you outsource the missions for which you do not have efficient technical skills?

0

10

-

20

30

5. Do the contracts have clauses that aim at the results?

0

5

-

15

20

6. Is there a program made jointly with subcontractors regarding quality assurance?

0

10

-

20

30

7. Are the subcontractors’ performance monitored?

0

10

-

20

30

Total points possible K: 200

Table 6. Summary of the maintenance assessment Domains of analysis

Score obtained

Highest score

Percentage of achievement

A

80

200

40%

B

75

150

50%

C

95

220

43%

D

140

270

52%

E

115

160

72%

F

85

150

56%

G

110

180

61%

H

60

150

40%

I

120

150

80%

J

150

280

53%

K

170

200

85%

190

300

63%

1390

2410

L TOTAL

57.6%

4 Conclusions Applying quality in a maintenance program is essential to ensure the performance and durability of medical equipment and systems. An effective maintenance program must be well planned and have clear objectives. A detailed assessment of equipment and systems

Evaluation of the Maintenance System of Medical Equipment

67

is required to determine the frequency and type of intervention required. Planning must consider priorities, available resources, and medical requirements. By collecting feedback from maintenance personnel, operators and customers, weaknesses can be identified, and improvements can be made in the maintenance program. Monitoring of key performance indicators and periodic analysis of data helps identify trends and implement appropriate corrective or preventive measures.

Conflict of Interest. The authors declare that they have no conflict of interest.

References 1. Senbekov, M., et al.: The recent progress and applications of digital technologies in healthcare: a review. Int. J. Telemedicine Appl. 2020, 1–18 (2020). https://doi.org/10.1155/2020/8830200 2. American College of Clinical Engineering/ACCE. https://accenet.org/about/Documents/Wha t’s_a_Clinical_Engineer.pdf 3. World Health Organization. https://www.who.int/health-topics/medical-devices 4. International Organization for Standardization. https://www.iso.org/home.html 5. Badnjevi´c, A., et al.: Post-market surveillance of medical devices: a review. Technol. Health Care 30(6), 1315–1329 (2022). https://doi.org/10.3233/THC-220284 6. Iadanza, E., Gonnelli, V., Satta, F., et al.: Evidence-based medical equipment management: a convenient implementation. Med. Biol. Eng. Comput. 57, 2215–2230 (2019). https://doi.org/ 10.1007/s11517-019-02021-x 7. Wang, B., Fedele, J., Pridgen, B., et al.: Evidence-based approach to medical equipment maintenance monitoring. In: European Medical and Biological Engineering Conference NordicBaltic Conference on Biomedical Engineering and Medical Physics, IFMBE proceedings (2018). https://doi.org/10.1007/978-981-10-5122-7_65 8. Wakefield, J., Hertzler, L., Poplin, B.: Evidence-based maintenance: part I: measuring maintenance effectiveness with failure codes. J. Clin. Eng. 35, 132–144 (2010). https://doi.org/10. 1097/JCE.0b013e3181e6231e 9. Medical Device with Measuring Function. https://ec.europa.eu/docsroom/documents/10283/ attachments/1/translations/en/renditions/native 10. Brown, R.J.: Measuring Measurement – What is metrology and why does it matter? Measurement (Lond.) 168, 108408 (2021). https://doi.org/10.1016/j.measurement.2020. 108408 11. Monteiro, E.C., Leon, L.F.: Metrological reliability of medical devices. J. Phys.: Conf. Ser. 588, 20–32 (2015). https://doi.org/10.1088/1742-6596/588/1/012032 12. Badnjevi´c, A., Cifrek, M., Magjarevi´c, R., Džemi´c, Z. (eds.): Inspection of Medical Devices: For Regulatory Purposes. Springer Singapore, Singapore (2018) 13. International Vocabulary of Metrology. Basic and General Concepts and Associated Terms (VIM). https://www.oiml.org/en/files/pdf_v/v002-200-e07.pdf 14. Organization Internationale de Métrologie Légale (OIML): National metrology systems – Developing the institutional and legislative framework 021. https://www.oiml.org/en/files/ pdf_d/d001-e20.pdf (2015) 15. Gurbeta, L., Badnjevi´c, A.: Inspection process of medical devices in healthcare institutions: software solution. Health Technol. 7(1), 109–117 (2016). https://doi.org/10.1007/s12553016-0154-2

The Surveillance System of Medical Devices, in Which the Responsible Individuals Have an Active Role, is the Guarantee of Patient and Medical Device User Safety Gheorghe Gorceag(B)

and Victor Sontea

Technical University of Moldova, Chisinau, Moldova [email protected]

Abstract. The surveillance of medical devices is defined as a system for collecting, storing, scientifically evaluating, and assessing incidents resulting from the use of medical devices, as well as reporting them to the competent authorities for the purpose of continuous monitoring of the risk-benefit ratio and the adoption of necessary measures to reduce occurrences. The medical devices used in medical procedures must be safe, of high quality, and efficient. This is the goal of states and their competent authorities, who have recognized and implemented the management of medical technologies at the healthcare system level, which includes reporting any malfunction or deterioration in the characteristics and performance of a device that may or has led to the death or severe deterioration of a patient’s or user’s health condition. Following the non-reporting of incidents involving medical devices and not taking corrective actions to prevent incidents, the medical devices that are used, does not guarantee security and performance parameters. Thus, it is very important that there are, at regulatory level, tools and methods to report incidents and to prevent their occurrence or reoccurrence. On the other hand, the best international practices, regulates the fact that for the successful functioning of the vigilance system, users are must have an active role in the surveillance system of medical devices. Safety cannot be guaranteed without a medical device surveillance system, as well as the proper involvement of responsible individuals who will ensure and guarantee the use of safe medical devices with an appropriate level of performance and security parameters. Keywords: Medical devices · Medical device vigilance system · Incident · Safety · Notification · Safety corrective actions · Withdrawal · Reporting · Manufacturer

1 Introduction Until 2018, in the Republic of Moldova, there was no regulatory framework to regulate the reporting of incidents and the implementation of corrective safety measures to prevent them. Only two incidents were registered at the Medicines and Medical Devices Agency, without any detection or corrective measures. © The Author(s), under exclusive license to Springer Nature Switzerland AG 2024 V. Sontea et al. (Eds.): ICNBME 2023, IFMBE Proceedings 92, pp. 68–74, 2024. https://doi.org/10.1007/978-3-031-42782-4_8

The Surveillance System of Medical Devices

69

Medical device surveillance refers to the continuous monitoring of medical devices after they have been introduced to the market to identify any safety issues or performance problems. This is an important aspect of ensuring the safety and effectiveness of medical devices as it allows regulatory agencies and manufacturers to identify and address any issues in a timely manner, contributing to the protection of public health and safety [1–3]. There are various activities that can be carried out as part of medical device surveillance, including collecting and analyzing data on incidents and other safety issues, conducting inspections and audits of manufacturers, and implementing corrective actions to address any identified issues [8]. Thus, at the departmental level within the Ministry of Health, following research and study of the best international practices, it was developed and subsequently obtained the approval of Order No. 211/2018 from the Ministry of Health, Labour, and Social Protection regarding the medical device surveillance system [5]. Among the key provisions of the aforementioned regulatory act, the following stand out: the reporting procedure for incidents and the necessary actions to be taken; the responsibilities and parties involved in the medical device surveillance system, including manufacturers and their authorized representatives, the Medicines and Medical Devices Agency, notified/recognition bodies for conformity assessment, users, and other stakeholders concerned with the continuous safety of medical devices; investigations to avoid and/or prevent incidents or mitigate their consequences, as well as corrective safety actions, periodic summary reports, etc. [6]. Despite the existence of a regulated surveillance system, unfortunately, incidents still occur periodically in healthcare institutions in the Republic of Moldova, which are not reported, and no corrective or preventive measures are taken. As a result of the non-reporting of incidents involving medical devices and the lack of corrective actions to prevent recorded incidents, there is a direct risk to the lives of patients and users of these devices, leading to a decline in the quality and safety of medical care. Based on the aforementioned, it is necessary to identify methods and tools for reporting and evaluating reported incidents, and where applicable, determine the information that could be used to prevent their recurrence or mitigate the consequences of such incidents.

2 The International Medical Device Vigilance System Member States take necessary measures to ensure that any information regarding a serious incident that has occurred within their territory, or any corrective safety action that has been taken or is to be taken within their territory, is centrally evaluated at the national level by their competent authority, together with the manufacturer if possible, and, where applicable, with the relevant notified body [9]. In the European Union (EU), according to approved regulations, medical device manufacturers are obligated to report incidents involving medical devices in an electronic system. Reporting should be done as soon as the causal relationship between the incident and the device is established, but no later than 15 days after the manufacturer becomes

70

G. Gorceag and V. Sontea

aware of the incident. The reporting deadline is based on the severity of the incident. [8]. Regarding the electronic system, the European Commission (the Commission), in collaboration with the member states, maintains an electronic system for collecting and processing reports on incidents, corrective safety actions, periodic summary reports, trend reports, field safety notices, and the exchange of information between competent authorities and the Commission. This system ensures appropriate access to information for the general public and healthcare professionals [6]. On the other hand, the competent authorities of EU member states evaluate trend reports and request the manufacturer to take appropriate measures to protect public health and patient safety. Similarly, the competent authority assesses the risks of the incident and the adequacy of corrective actions, considering various criteria such as the likelihood of harm and the clinical benefits of the medical device. The manufacturer is required to submit a final report on their findings to the competent authority through the same electronic system [8]. Competent authorities are responsible for verifying the compliance and performance of medical devices. They may request documentation and information from economic operators, collect samples of medical devices, and conduct inspections, including unannounced visits to the premises of economic operators and users of medical devices. If necessary, they can confiscate, destroy, or remove medical devices presenting risks, and subsequently conduct an evaluation of the medical device to determine its conformity with the requirements of applicable medical device standards. Afterwards, competent authorities may request the manufacturer and other economic operators to take corrective measures to ensure compliance with regulatory requirements [1–3]. Depending on the nature of the risk, medical devices may be restricted, withdrawn, or recalled by competent authorities, who subsequently notify the Commission accordingly. The measures taken by competent authorities must be substantiated and based on specific reasons, providing economic operators with the opportunity to present their observations. If a notified conformity assessment body has been involved in the assessment of the medical device’s conformity, the competent authorities must inform the notified body of the measures taken through the electronic system for medical device market surveillance. It is not common practice for such a market surveillance electronic system to be used by regulatory agencies to monitor the safety and effectiveness of medical devices. The mentioned system can be utilized to monitor the performance and safety parameters of medical devices, collect data, and identify patterns or trends that may indicate a problem with a particular medical device. The purpose of market surveillance is to ensure a high level of safety and effectiveness of medical devices, as well as to identify any issues that may arise, thereby guaranteeing the safety and effectiveness of medical devices [10].

3 The Medical Device Vigilance System in the Republic of Moldova In 2018, the Ministry of Health of the Republic of Moldova approved Order MSMPS No. 211/2018 regarding the medical device vigilance system. It is worth mentioning that prior to this, there was no regulatory framework in the Republic of Moldova to regulate

The Surveillance System of Medical Devices

71

the reporting of incidents and the implementation of corrective measures in terms of safety to prevent such incidents [5]. Through the aforementioned regulatory act, the Regulation on the medical device vigilance system was actually approved, based on the provisions of Article 16 of Law No. 102 of June 9, 2017, on medical devices, and in accordance with the recommendations from the European Guide on vigilance systems [4]. Thus, the approved Order, which approves the Regulation on the medical device vigilance system, created the conditions for the establishment of a medical device vigilance system for the healthcare system of the Republic of Moldova. This, together with maintenance services and periodic checks of medical devices, ensures the safety of patients and users, ultimately leading to the improvement of the quality of healthcare. The Regulation is applicable to incidents involving medical devices that have the SM or CE conformity marking, those that don’t have the SM or CE conformity marking but fall under other regulatory acts, and those that don’t have the SM or CE conformity marking because they were introduced to the market before the effective date of the Government’s Resolutions. The essential regulations of the aforementioned regulatory act include: – The reporting procedure for incidents and necessary actions to be taken. – Responsibilities and entities involved in the medical device vigilance system. – Investigations to prevent or mitigate the consequences of incidents and corrective actions in terms of safety, periodic summary reports, etc. [5] Among the key provisions, the following stand out: the reporting procedure for incidents and the necessary actions to be taken; the responsibilities and parties involved in the medical device surveillance system, including manufacturers and their authorized representatives, the Medicines and Medical Devices Agency, notified/recognition bodies for conformity assessment, users, and other stakeholders concerned with the continuous safety of medical devices; investigations to avoid and/or prevent incidents or mitigate their consequences, as well as corrective safety actions, periodic summary reports, etc. Similarly, it is regulated that healthcare institutions must designate a person responsible for medical device vigilance to prevent incidents. Together with technical staff, medical personnel, and users, they must take appropriate corrective actions when necessary. The Medicines and Medical Devices Agency (AMDM) is the competent authority responsible for assessing the risks of reported incidents or safety-related corrective actions and regularly monitoring the investigation, with the right to intervene at any time [7]. All complaints reported regarding a device, usage errors, as well as potential events of improper use, must be evaluated by the manufacturer. After conducting the investigation, AMDM informs the relevant parties, including the Ministry of Health, the notified body, the manufacturer, the consumer, and/or the user, about the incidents for which appropriate measures have been taken or need to be taken, including device recalls. Manufaturers and their authorized representatives, the Medicines and Medical Devices Agency, notified bodies, users, and other stakeholders concerned with the ongoing safety of medical devices must ensure compliance with the established provisions, which contributes to improving patient and user safety, the primary objective of the health policies of the Republic of Moldova.

72

G. Gorceag and V. Sontea

Furthermore, in line with international/European best practices, for the successful functioning of the vigilance system, users are obliged/required to play an active role since only through user involvement and close cooperation with the manufacturer is it possible to implement safety-related corrective actions [9].

4 Ensuring the Safety and Performance of Medical Devices Unfortunately, despite the fact that the medical device surveillance system is regulated at the national level in healthcare institutions in the Republic of Moldova, incidents occur periodically (e.g., the use of bactericidal lamps beyond their lifespan and improper cleaning, frequent damage to mercury thermometers, insufficient oxygen concentration in oxygen generators, use of physiotherapy devices based on patient sensitivity, use of medical devices without grounding, use of defibrillators without batteries, etc.) which are not reported, and no corrective and preventive measures are taken. As a result of not reporting incidents involving medical devices, failing to detect incidents during the use of medical devices, and not taking corrective actions to prevent recorded incidents, we have medical devices in healthcare facilities that do not guarantee the initial safety standards as intended, thus endangering the lives of patients and users, directly affecting the quality and safety of medical care. In this context, it is necessary to identify methods and tools for reporting, evaluating reported incidents, and, if necessary, determining information that can be used to prevent their recurrence or mitigate the consequences of such incidents. Therefore, based on research and the study of best international practices to avoid incidents involving medical devices in the healthcare system of the Republic of Moldova, it is concluded that the implementation of a comprehensive set of measures is necessary, including: 1) Regulations on the use and management of medical devices, including quality standards, safety requirements, and testing procedures before use. 2) Monitoring and reporting of incidents through a system for monitoring and reporting incidents involving medical devices, enabling the rapid identification of problems and the implementation of safety corrective actions. 3) Training of medical personnel in the use and management of medical devices, including installation, maintenance, proper utilization, and correct actions to be taken in case of an incident. 4) Regular verification and maintenance of medical devices to ensure that they function within the appropriate performance and safety parameters. 5) Close collaboration between competent state authorities (Ministry of Health, Medicines and Medical Devices Agency) and manufacturers and suppliers of medical devices, maintaining a constant dialogue with manufacturers to resolve issues and ensure the supply of safe and quality products. 6) Conducting audits, inspections, checks, supervision, and periodic monitoring by independent third-party organizations to ensure compliance with approved regulations. 7) Increasing awareness and informing patients, ensuring that they are informed about the medical devices used in their treatment and are aware of the actions to be taken in case of an alarm, incidents, or other issues. Improvement of communication between medical staff and patients is also desirable.

The Surveillance System of Medical Devices

73

Furthermore, to take corrective actions to prevent the recurrence of incidents, reporting is key in the medical device surveillance system. Research results demonstrate that motivating the responsible individuals within the medical device surveillance system in the Republic of Moldova, who are actually the users of medical devices, is crucial. Therefore, the reporting of incidents can be ensured by achieving the following objectives: 1) Ensuring confidentiality and data protection: Responsible individuals must have confidence that the information they provide regarding incidents involving medical devices will be treated confidentially and that their identity will be protected. It is important to have clear data protection policies and procedures and ensure that reporting incidents will not have negative repercussions on the reporters. 2) Raising awareness of the importance of reporting: Responsible individuals need to be informed about the importance of reporting incidents involving medical devices, emphasizing that these reports are essential for identifying problems and implementing appropriate corrective measures, ultimately increasing patient and user safety and potentially saving lives. 3) Simplifying reporting procedures and providing proper training: Reporting procedures should be as simple, accessible, and easy to understand as possible. Responsible individuals should have clear reporting forms and receive detailed instructions on how to complete them. Efforts required to report an incident should be minimized to encourage responsible individuals to do so. Additionally, responsible individuals should receive adequate training on the importance of reporting incidents and proper reporting procedures, including training sessions, informative materials, and practical examples of incident reporting; 4) Recognizing and appreciating reporters: It is important to recognize and appreciate responsible individuals who report incidents. This can be achieved through positive feedback, official acknowledgments, or even providing incentives such as recognition within the organization or symbolic awards and rewards; 5) Promoting a safety culture: Promoting a safety culture where incident reporting is encouraged and considered a normal practice is necessary. Responsible individuals should be aware that reporting incidents is not an act of blame or punishment but a way to learn from errors and improve clinical practice.

5 Conclusions In order to guarantee the safety of patients and users of medical devices, as well as the appropriate level of security and performance parameters, in addition to regulating and implementing a medical device surveillance system, it is imperative that all responsible actors are aware and have an active role and necessary involvement. Acknowledgments. This work was supported by the project 20.80009.8007.26 “Piloting the application of the principles of personalized medicine in the conduct of patients with chronic noncommunicable diseases”, contracting authority: National Agency for Research and Development, Republic of Moldova.

74

G. Gorceag and V. Sontea

Conflict of Interest. The authors declare that they have no conflict of interest.

References 1. EU Medical Device Directives: Directive 98/79/EC of the European Parliament and of the Council of 27 October 1998 on in vitro diagnostic medical devices. Official Journal of the European Communities, L 331 (1998) 2. EU Medical Device Directives: Council Directive 93/42/EEC on Medical Devices (MDD). Official Journal of the European Communities, L 169 (1993) 3. EU Medical Device Directives: Council Directive 90/385/EEC on Active Implantable Medical Devices (AIMDD). Official Journal of the European Communities, L 189 (1990) 4. Law No. 102/2017 on medical devices. The Official Journal of the Republic of Moldova, 244, pp. 389 (2017) 5. Order of the Ministry of Health, Labour, and Social Protection No. 211/2018 regarding the medical device surveillance system. The Official Journal of the Republic of Moldova, 126, p. 517 (2018) 6. Post-market Surveillance of Medical Devices by the European Medicines Agency, Draft 1, (2020). https://www.who.int/docs/default-source/essential-medicines/in-vitro-diagnostics/ draft-public-pmsdevices.pdf?sfvrsn=f803f68a_2 7. Broucher, J., Gaba, M.., Deem Mark, E., Termini, E., Auchincloss, K.: A practical guide to navigating the medical device industry: advice from experts in industry. Law, Intellect. Property Academia 2(4) (2011) 8. Medical Devices Regulation (MDR): Regulation (EU) 2017/745 of the European Parliament and of the Council of 5 April 2017 on medical devices, amending Directive 2001/83/EC, Regulation (EC) No 178/2002 and Regulation (EC) No 1223/2009 and repealing Council Directives 90/385/EEC and 93/42/EEC. Official Journal of the European Union, L 117 (2017) 9. Guidance Regulating medical devices in the UK. London: Medicines and Healthcare Products Regulatory Agency (MHRA). https://www.gov.uk/guidance/regulating-medical-dev ices%20in-the-uk#contents (2020) 10. Outline of Post-marketing Safety Measures. Tokyo: Pharmaceutical and Medical Device Agency (PMDA). https://www.pmda.go.jp/english/safety/outline/0001.html (2021)

A New Approach in Detection of Biomarker 2-propanol with PTFE-Coated TiO2 Nanostructured Films Stefan Schröder1(B) , Mihai Brinza2 , Vasile Cretu2 , Lukas Zimoch3 , Monja Gronenberg3 , Nicolai Ababii2 , Serghei Railean2 , Thomas Strunskus1 , Thierry Pauporte4 , Rainer Adelung3 , Franz Faupel1 , and Oleg Lupan1,2,3 1 Chair for Multicomponent Materials, Department of Materials Science, Faculty of

Engineering, Kiel University, Kaiserstraße 2, 24143 Kiel, Germany [email protected] 2 Center for Nanotechnology and Nanosensors, Department of Microelectronics and Biomedical Engineering, Technical University of Moldova, 168 Stefan cel Mare Avenue, 2004 Chisinau, Moldova 3 Functional Nanomaterials, Department of Materials Science, Faculty of Engineering, Kiel University, Kaiserstraße 2, 24143 Kiel, Germany 4 Institut de Recherche de Chimie Paris-IRCP, Chimie ParisTech, PSL Universit´e, 11 rue Pierre et Marie Curie, 75231 Paris Cedex 05, France

Abstract. Certain molecules act as biomarkers in exhaled breath or outgassing vapors of biological systems. Metal oxide gas sensors are of great interest to detect these molecules. However, often they are not selective enough to identify the specific molecules. In addition, they typically lose their excellent performance at high humidity levels. In this study nanoscale polytetrafluoroethylene (PTFE) thin films deposited via solvent-free initiated chemical vapor deposition (iCVD) were investigated as a possible pathway to tune the selectivity of metal oxide gas sensors as well as hydrophobic surface functionalization. The gas-sensing properties of two types of PTFE-coated gas-sensing structures are measured for this purpose at several operating temperatures. The first structure is a thermally annealed TiO2 film while the second structure is a thermally annealed TiO2 film with an additional CuO film. After the deposition of the iCVD PTFE thin films the structures exhibit a high response and excellent selectivity to 2-propanol vapor. The experimental data presented here, promote the use of such PTFE-coated gas sensing structures as reliable, accurate and selective sensor structures for the tracking of gases at low concentrations. This enables new possibilities in application fields like biomedical diagnosis, biosensors, and the development of non-invasive technology. Keywords: Biomarker · 2-propanol · Gas sensor · Initiated chemical vapor deposition · PTFE

© The Author(s), under exclusive license to Springer Nature Switzerland AG 2024 V. Sontea et al. (Eds.): ICNBME 2023, IFMBE Proceedings 92, pp. 75–83, 2024. https://doi.org/10.1007/978-3-031-42782-4_9

76

S. Schröder et al.

1 Introduction Hybrid nanomaterials, including oxide heterostructures with tunable performances, are of great interest to fabricate effective gas sensors. The areas of application range from early hazard detection [1] to biomedical breath analysis [2]. Heterojunctions between different polymers and oxide nanocrystals, especially based on ultrathin films with mixed phases are of great interest as they will improve the characteristics of biomarker sensors due to their unique detecting mechanism and structure. Most volatile organic compounds (VOCs) are present in human breath at different concentrations, such as ppm and ppb. This low concentration sets a high bar with regard to sensitivity for the gas sensor devices [3]. This may be seen as a concentration of 100 ppm for targeted biomarkers in the testing process. Synthesizing such structures has to be highly specific with respect to phase control at the nanoscopic level in order to yield the best possible sensitivity for the respective biomarkers. In addition, a lot of research is needed to find the connection between different biomarkers and a specific disease so that the specialist in the respective medical field can make an accurate diagnosis. Various researchers have in this connection started to reported molecular concentrations of different biomarkers in breath in order to provide health status for both healthy and diseased individuals [3]. Consequently, a lot of effort is put into the identification of possible compounds to tailor the performance of gas sensors with respect to biomarkers. 2-propanol is one of the molecules which is of great interest as biomarker. For instance, Koureas et al. have studied specific biomarkers regarding exhaled breath for lung cancer discrimination from other pulmonary diseases [4]. They demonstrated results where 2-propanol and other gases were identified to distinguish between lung cancer patients and a healthy control group. However, further research is required, as the medical field with regard to cancer diagnosis is of interest in the current development of medical device and healthcare [5]. Such studies offer new challenges to develop new devices based on gas sensors for disease diagnosis via non-invasive methods. Thus, the presented study provides promising results for further development. Another study identified 6 compounds bound to patients with liver disease, where 2-propanol was also mentioned [6]. Therefore, based on different levels of VOCs in breath, patients with alcoholic hepatitis can be identified. More and more polymers are also appearing to tune the properties of gas sensors. One of these polymers, polytetrafluoroethylene (PTFE), also known under its tradename Teflon, is e.g. used as a hydrophobic material, for the protection or even as part of a sensing devices when combined with different other polymers. A polymer membrane based sensor made from polypyrrole (PPy) combined with PTFE showed high selectivity to methylamine [7]. Another study proposed titanium dioxide (TiO2 ) coated on porous Teflon sheets for achieving a hydrophobic surface with some self-cleaning properties [8]. Cha et al. demonstrated Teflon AF solution as a modifier for a gas permeable PTFE membrane to enhance gas selectivity of amperometric nitric oxide sensors for ammonia and nitrite [9]. A lot of other studies are also trying to improve and tune the selectivity of gas sensors to different gases, VOCs and biomarkers e.g. by tailored nanoscale polymer thin films via initiated chemical vapor deposition (iCVD) [10, 11] or even by using polymer based organic sensors [12]. The polymer sensors are in this connection attractive, because they show different irreversible or reversible reactions resulting in

A New Approach in Detection

77

changes of the chemical and physical properties. Consequently, there are a lot of different polymers which may be coated on gas sensing structures, or be the gas sensing structure itself, such as PPy [13], PAni (polyaniline) [14], Poly(1,3,5,7-tetramethyl-tetravinyl cyclotetrasiloxane) (PV4D4) [10] and many others. In this study the performance of a PTFE thin film deposited via iCVD on annealed TiO2 and annealed TiO2 coated with additional CuO thin film gas sensors is investigated and proposed as a possible biomedical sensor to detect human biomarkers resulted from exhaled breath. Although further studies on different biomarkers related to different diseases and disorders are needed, the proposed sensor can provide new pathways in the field of biomedical diagnosis and development of a non-invasive technology.

2 Materials and Methods Two gas sensing structures were investigated. The first investigated structure (sensor #1) is an annealed TiO2 thin film (15 nm) with additional CuO thin film (20 nm, 425 °C for 1 h), which is subsequently functionalized with a PTFE thin film. The second one (sensor #2) represents an annealed TiO2 thin film (15 nm) without additional CuO layer, which is subsequently functionalized with a PTFE thin film. 2.1 Sensor Fabrication Glass slides from ThermoScientific (2.5 × 7.5 cm) were employed as the substrates for all device in this study. For the fabrication of sensor #1 a 15 nm TiO2 film was spray-pyrolysis-deposited on top of the glass slides, followed by a 120-min thermal annealing step at 450 °C. An addition thin film of 20 nm CuO was deposited on top by sputtering metallic copper under vacuum conditions. The deposition rate was 5 nm/min determined experimentally by using a profilometer. In the next step, the CuO coated TiO2 heterostructures were annealed under air at 425 °C for another 60 min. Sensor #2 was fabricated in the same way like sensor #1 except for the deposition of the additional CuO layer and the subsequent second annealing step. After the preparation of sensor #1 and sensor #2, Au electrodes were deposited on top of the samples through an Al meandershaped mask [15]. The Au top-contacts have a thickness of ∼200 nm and a separation of 0,75 mm. In the end all samples were functionalized with an additional 25 nm PTFE thin film via iCVD. Details on the applied iCVD reactor are reported elsewhere [16, 17]. For the deposition hexafluoropropylene oxide (HFPO) and perfluorobutanesulfonyl fluoride (PFBSF) initiator were introduced to the reactor at 0.5 sccm and 0.1 sccm, respectively. The process pressure was 50 Pa and the substrate temperature was 20 °C. In order to start the deposition, the filament array was heated with a power of 60 W. Additional silicon wafer pieces have been added during the iCVD process for chemical analysis. 2.2 Sample Characterization Fourier-transform infrared (FTIR) spectra were recorded using a FTIR spectrometer (Invenio-R, Bruker) in transmission mode. The area from 400 cm−1 to 4000 cm−1 was

78

S. Schröder et al.

measured at 4 cm−1 step width and 32 scans. The recorded spectra were baseline corrected using a graphic software (Origin Pro 2017, OriginLab). The gas sensing properties of both samples were measured by the same process explained in a previous similar study [10]. As it was stated in it, the samples were electrically connected and heated to the desired working temperature, while there was a stable gas flow, in order to obtain the results further discussed in this study. To obtain the gas response in % a special formula (1), was required, which was also used in the reference mentioned above. S=

Ggas − Gair × 100% Gair

(1)

The gas response of the samples was measured by using a custom setup and protocol based on a computer-controlled Keithley2400 source-meter described previously [15].

3 Results and Discussion 3.1 Chemical Characterization During the iCVD process step the pyrolysis of HFPO leads to the production of a highly reactive difluorocarbene and a relatively stable trifluoroacetyl fluoride by-product. Figure 1a shows the proposed reaction, as also reported in the literature [18, 19]. The difluorocarbene forms long fluorocarbon chains resulting in the formation of a PTFE thin film. To confirm a successful polymerization of the difluorocarbene to long -CF2 PTFE chains an FTIR spectrum is recorded. The result of the FTIR measurement for the expected iCVD PTFE thin film is presented in Fig. 1b.

Fig. 1. (a) Proposed reaction scheme for the pyrolysis of the HFPO molecule. (b) FTIR spectrum of the deposited iCVD PTFE thin film.

The recorded spectrum reveals two significant bands at 1155 cm−1 and 1213 cm−1 . These bands represent the symmetric and asymmetric stretch of the C-F bonds, respectively [20]. The bands in the range from 509 cm−1 to 640 cm−1 can be assigned to the rocking and wagging vibrations of CF2 [20]. Due to the absence of additional dominant bands it can be assumed that long linear CF2 chains are present in the deposited iCVD PTFE thin films. This indicates a good quality of the films without any unwanted sidereactions and additional unwanted functional groups which might distort the gas sensing properties of the films.

A New Approach in Detection

79

3.2 Gas Response Comparison Figure 2a shows the gas response of the PTFE-coated CuO/TiO2 sensor to different vapors (acetone, ammonia, n-butanol, ethanol and 2-propanol) at 100 ppm concentration for different operating temperatures. The measurements show a series of responses, which demonstrates that the results depend on the operating temperatures.

Fig. 2. (a) Gas response of CuO/TiO2 thin film coated with PTFE thin film to Acetone, Ammonia, n-Butanol, Ethanol, Hydrogen, 2-Propanol vapor (100 ppm concentration) at different operating temperatures; (b) Gas response of TiO2 thin film coated with PTFE thin film to the same vapors and concentration like in (a) at different operating temperatures.

A low response to all vapors, except for ammonia, is already observed at room temperature. This is of interest for potential further studies to obtain a selectivity to a target vapors at room temperature, for which different attempts have already been reported. These include thermal annealing [21], doping with impurities [22] and the fuctionalizing with noble metals [23]. At 150 °C the sensor reponds to ethanol vapor with a value of ~10%, while at higher operating temperature (250–350 °C) a change in selectivity to 2-propanol occurs. The responses to 2-propanol is ~39% at 250 °C and ~37% at 300 °C. The highest response to 2-propanol (~64%) is obtained at 350 °C. Figure 2b presents the result for the PTFE-coated TiO2 sensors without additional CuO layer. The measurement is perfomed with the same vapors like in Fig. 2a and the concentration of the vapors is again 100 ppm. Compared to the first sensor the second sensors starts to response only at temperature of 200 °C and higher. At 200 °C the sensor is selective to ethanol with ~7% response. At higher operating temperatures the change

80

S. Schröder et al.

in selectivity changes. For 250 °C and 350 °C the response and selectivity is highest for 2-propanol with the values of ~23% and ~45%, respectively. At 300 °C the sensor starts to respond to hydrogen and shows the highest reponse to it with a value of ~36%. Compared to the first sensor there seems to be a specific influence of CuO on the TiO2 coated with PTFE, which enables vapor detection at room temperature. In addition the first sensor is responding to acetone and ammonia, while the second sensor shows no response to these vapors at all operting temperatures. Also the overall temperature to start operation is significant higher for the second sensor. Figure 3a shows the dynamic response of the TiO2 thin film sensor coated with a PTFE thin film at an operating temperature of 350 °C. The value for the response is ~45%. The response time is ~5,9 s, while the time of recovery is determined to be ~28,9 s. A repeated application of 2-propanol vapor shows that the response time is roughly the same, while the value of response is nearly the same, which indicates a good stability in the determined response values. Figure 3b shows the results of the dynamic 2-propanol vapor detection by the CuO/TiO2 thin film coated with a PTFE thin film. The operating temperature in the presented graph is 350 °C, while the concentration of the studied 2-propanol vapor is 100 ppm. The value for the response is ~64%, which is the highest registered in this study. The response time in the figure is ~5,4 s, while the recovery time is around ~26,4 s.

Fig. 3. (a) Dynamic gas response of TiO2 thin film coated with PTFE thin film at 350 °C operating temperature and 100 ppm of 2-propanol; (b) Dynamic gas response of CuO/TiO2 thin film coated with PTFE thin film at 350 °C and 100 ppm of 2-propanol.

A New Approach in Detection

81

4 Conclusions A new approach in detection of 2-Propanol as a biomarker has been demonstrated in this study. An important finding of this research is that the studied sensors (sensor #1 and sensor #2) showed two different ways of obtaining the desired 2-propanol detection. While one sample which had CuO offered possibilities to work at room temperature, the other offered potential to grow further selectivity towards 2-propanol by not using CuO. However more experiments are yet to be done to choose the most perspective path. The effect of PTFE coating showed different property changes towards selectivity, yet offering an interesting potential for further research, as it is supposed to be a hydrophobic material and will be studied in more detailed in the future as a potentially polymer for coating nanofilm sensors. The results provide a new step in the direction of diagnosis and further research in this direction has a big potential to determine a clear bond between different biomarkers and certain diseases. In this regard, the sensors studied in this work come with a new approach for the determination of exhaled 2-propanol vapors, being a compact, small and affordable solution in research as well as clinical trials, that are yet to be done. Acknowledgments. This research was funded by the SulfurSilicon Batteries (SuSiBaBy) Project (LPW-E/3.1.1/1801), which was funded by the EUSH and EFRE in SH. In addition, the work was funded by German Research Foundation (DFG—Deutsche Forschungsgemeinschaft) under the Project-ID 434434223-SFB 1461, Project-ID 286471992-SFB 1261 project A2, GRK 2154 project P4, AD 183/16–1, FOR 2093 and AD 183/18–1. Furthermore, the work was funded by ANCDNARD Grant No. 20.80009.5007.09 and No. 20.80009.5007.11 at the Technical University of Moldova.

Conflict of Interest.. The authors declare that they have no conflict of interest.

References 1. Solórzano, A., et al.: Early fire detection based on gas sensor arrays: multivariate calibration and validation. Sens. Actuators B Chem. 352, 130961 (2022). https://doi.org/10.1016/j.snb. 2021.130961 2. Lupan, O., et al.: Heterostructure-based devices with enhanced humidity stability for H2 gas sensing applications in breath tests and portable batteries. Sens. Actuators A Phys. 329, 112804 (2021). https://doi.org/10.1016/j.sna.2021.112804 3. Ghosh, C., Singh, V., Grandy, J., Pawliszyn, J.: Recent advances in breath analysis to track human health by new enrichment technologies. J Sep Sci. 43, 226–240 (2020). https://doi. org/10.1002/jssc.201900769 4. Koureas, M., Kirgou, P., Amoutzias, G., Hadjichristodoulou, C., Gourgoulianis, K., Tsakalof, A.: Target analysis of volatile organic compounds in exhaled breath for lung cancer discrimination from other pulmonary diseases and healthy persons. Metabolites 10, 317 (2020). https://doi.org/10.3390/metabo10080317 5. Bhandari, M.P., et al.: Volatile markers for cancer in exhaled breath—could they be the signature of the gut microbiota? Molecules 28, 3488 (2023). https://doi.org/10.3390/molecu les28083488

82

S. Schröder et al.

6. Hanouneh, I.A., et al.: The breathprints in patients with liver disease identify novel breath biomarkers in alcoholic hepatitis. Clin. Gastroenterol. Hepatol. 12, 516–523 (2014). https:// doi.org/10.1016/j.cgh.2013.08.048 7. Pirsa, S., Heidari, H., Lotfi, J.: Design selective gas sensors based on nano-sized polypyrrole/polytetrafluoroethylene and polypropylene membranes. IEEE Sens J. 16, 2922–2928 (2016). https://doi.org/10.1109/JSEN.2016.2527712 8. Yamashita, H., Nakao, H., Takeuchi, M., Nakatani, Y., Anpo, M.: Coating of TiO2 photocatalysts on super-hydrophobic porous teflon membrane by an ion assisted deposition method and their self-cleaning performance. Nucl. Instrum. Methods Phys. Res. Sect. B Beam Interact. Mater. Atoms. 206, 898–901 (2003). https://doi.org/10.1016/S0168-583X(03)00895-4 9. Cha, W., Meyerhoff, M.E.: Enhancing the selectivity of amperometric nitric oxide sensor over ammonia and nitrite by modifying gas-permeable membrane with Teflon AF (R). Chem. Analityczna. 51, 949–961 (2006) 10. Schröder, S., et al.: Tuning the selectivity of metal oxide gas sensors with vapor phase deposited ultrathin polymer thin films. Polymers 15(3), 524 (2023). https://doi.org/10.3390/ polym15030524 11. Schröder, S., et al.: Sensing performance of CuO/Cu2O/ZnO: Fe heterostructure coated with thermally stable ultrathin hydrophobic PV3D3 polymer layer for battery application. Mater. Today Chem. 23, 100642 (2022). https://doi.org/10.1016/j.mtchem.2021.100642 12. Cichosz, S., Masek, A., Zaborski, M.: Polymer-based sensors: a review. Polym Test. 67, 342–348 (2018). https://doi.org/10.1016/j.polymertesting.2018.03.024 13. Torad, N.L., Minisy, I.M., Sharaf, H.M., Stejskal, J., Yamauchi, Y., Ayad, M.M.: Gas sensing properties of polypyrrole/poly(N-vinylpyrrolidone) nanorods/nanotubes-coated quartzcrystal microbalance sensor. Synth Met. 282, 116935 (2021). https://doi.org/10.1016/j.syn thmet.2021.116935 14. Indarit, N., Kim, Y.-H., Petchsang, N., Jaisutti, R.: Highly sensitive polyaniline-coated fiber gas sensors for real-time monitoring of ammonia gas. RSC Adv. 9, 26773–26779 (2019). https://doi.org/10.1039/C9RA04005F 15. Lupan, O., et al.: TiO2/Cu2O/CuO multi-nanolayers as sensors for H2 and volatile organic compounds: an experimental and theoretical investigation. ACS Appl. Mater. Interfaces 13, 32363–32380 (2021). https://doi.org/10.1021/acsami.1c04379 16. Schröder, S., Strunskus, T., Rehders, S., Gleason, K.K., Faupel, F.: Tunable polytetrafluoroethylene electret films with extraordinary charge stability synthesized by initiated chemical vapor deposition for organic electronics applications. Sci Rep. 9, 2237 (2019). https://doi.org/ 10.1038/s41598-018-38390-w 17. Schröder, S., Polonskyi, O., Strunskus, T., Faupel, F.: Nanoscale gradient copolymer films via single-step deposition from the vapor phase. Mater. Today 37, 35–42 (2020). https://doi. org/10.1016/j.mattod.2020.02.004 18. Lau, K.K.S., Gleason, K.K., Trout, B.L.: Thermochemistry of gas phase CF2 reactions: a density functional theory study. J Chem Phys. 113, 4103–4108 (2000). https://doi.org/10. 1063/1.1288378 19. Schröder, S., Hinz, A.M., Strunskus, T., Faupel, F.: Molecular insight into real-time reaction kinetics of free radical polymerization from the vapor phase by in-situ mass spectrometry. J. Phys. Chem. A. 125, 1661–1667 (2021). https://doi.org/10.1021/acs.jpca.0c11180 20. Socrates, G.: Infrared and Raman Characteristic Group Frequencies: Tables and Charts, 3rd edn. Wiley, Chichester, UK (2004) 21. Lim, S.-H., Park, I.-J., Kwon, H.-I.: Effects of rapid thermal annealing temperature on NO2 gas sensing properties of p-type mixed phase tin oxide thin films. Ceram Int. 49, 8478–8486 (2023). https://doi.org/10.1016/j.ceramint.2022.11.010

A New Approach in Detection

83

22. Postica, V., et al.: Multifunctional materials: a case study of the effects of metal doping on ZnO Tetrapods with bismuth and tin oxides. Adv. Funct. Mater. 27(6), 1604676 (2017). https:// doi.org/10.1002/adfm.201604676 23. Lupan, O., et al.: Tailoring the selectivity of ultralow-power heterojunction gas sensors by noble metal nanoparticle functionalization. Nano Energy 88, 106241 (2021). https://doi.org/ 10.1016/j.nanoen.2021.106241

Biomechanical Analysis of the Balance of the Human Body Anca Ioana T˘ataru (Ostafe)(B) , Mihaela Ioana Baritz , Angela Repanovici , Corneliu Nicolae Druga , Daniela Mariana Barbu , and Mirela Gabriela Apostoaie Transylvania University From Bras, ov, Bras, ov, Romania [email protected]

Abstract. This paper proposes a biomechanical analysis of the balance of the human body. The center of mass of the body directly influences the position of balance, respectively the stability of the whole body. In the case of a balance movement, this position changes causing an instability of the body, if the support area is exceeded. The area of stability represents the projection of the center of gravity and it changes depending on the movements that the human body performs. Certain occurrences require these types of movements repetitively, therefore the stability of that person changes during the action. Also certain health problems or medications can upset body balance. The paper proposes a biomechanical analysis mode for checking the balance by identifying the parameters of the stability area at the time of the body inclination and verifying the forces that appeared at that time. In order to extend the experiments, the paper propose in the end a simple structure for analysis by comparing the areas of stability in the controlled balance movement of the different segments of human body with the variations of the Fz force in the direction of the Oz axis. Human body stability is important to maintain the bipedal position, through a complex process (which involves central nervous system) and stabilizing the individual segments of the body. Keywords: Biomechanical Analysis · Balance · Human Body Stability

1 Introduction Balance movements corresponding to the individual segments of the body play a role in maintaining the vertical position by stabilizing the whole body and in dynamic changes of the body. The stability of the human body is a complex process that involves sensory, skeletal and muscular coordinator, all by involving the central nervous system (CNS). First, visual, vestibular, and somatosensory stimuli provide information about the body’s position in space. Immediately after this stage, the response of the CNS stimuli is sent to the closest muscles for the execution of correctional movements in order to regain the stability [1, 2]. Clinically stability is assessed by functional tests (with score) which provides information about motor performance in daily activities. But when performing laboratory © The Author(s), under exclusive license to Springer Nature Switzerland AG 2024 V. Sontea et al. (Eds.): ICNBME 2023, IFMBE Proceedings 92, pp. 84–92, 2024. https://doi.org/10.1007/978-3-031-42782-4_10

Biomechanical Analysis of the Balance of the Human Body

85

tests, stability is assessed by video recordings or by force platforms to identify the changes in the center of mass [3]. The postural balance of the human body can be affected by: – Daily occupations activities that require a long time to maintain vertical position, repetitive movements or vibration exposure (ex: constructor, doctors, pharmacists, nurses, professional athletes, pilots etc.); – Age and / or drugs – the elderly show a reduction in mobility and gait abnormalities [4]; – Medical conditions such as Parkinson’s disease, internal ear problems, vision problems can affect the balance and balance of the body. This paper proposes the analysis of balance when performing body tilt movements, total or partial (head, torso) and identifying the differences between the variation of forces and the area of stability in these cases. These differences in the variation of the forces on the Oz axis can be correlated with the size of the angle of inclination of the different segments of the human body keeping the same area of stability in bipedal position. Correlation can highlight a number of aspects related to the behavior of the human body in relation to the limits of inclination (small oscillations of keeping the posture and equilibrium, movements to adjust the displacement on the inclination trajectory, etc.).

2 Equilibrium Analysis 2.1 The Center of Mass, the Area of Stability and the Balance of the Human Body The center of mass of the human body is normally found in the pelvic area near the second sacral vertebra. This center is represented by a point where the body weight is evenly distributed in all directions. When a person maintains a vertical position this center is located at a median point of the body, slightly earlier than the sacred vertebra. It may differ from person to person due to height, body position, weight distribution in the body as well as limb position [5]. The pressure center (COP) is the point where the result of forces acting on the human body is found. It is important in the measurements of balance and body stability because it provides information on the distribution of weight and pre-solids and changes in movements. The stability area represents the form given by the totality of the contact points that the person makes with the support surface. The size of the stability area is an important factor in maintaining balance as well as its form. The stability area changes depending on the movement of the center of gravity (for example: if the person raises his hands the center of gravity is located above). The state of equilibrium is defined as the state in which we don’t apply forces or accelerations, the balance is the way to maintain balance, and stability is the resistance of the human body to changing the body’s acceleration [6].

86

A. I. T˘ataru (Ostafe) et al.

2.2 Analysis of the Equilibrium and Balance of the Human Body with the Kistler Type Force Plate The Kistler force platform is an equipment consisting of a force plate for acquisition and analysis of reactive forces at ground level, times and pressure centers used in biomechanical measurements. The force plate consists of an aluminum plate 600 × 400 mm on which are found 4 piezoelectric force sensors components (Fig. 1.). Also, this type of force plate has the Oy axis on the long side of it and the Ox axis on the short side and the forces on the Oz axis are resulting from the weight of the human bodies that are examined. The Direct Acquire command is used for the acquisition of the data from the plate sensors, and at the end there is the possibility to save the recording data in the form of data specific to the software or text application. There are also settings that can be made to facilitate the processing of data resulting from the measurement (units of measurement, scaling of measurements, presence of legend etc.)

Fig. 1. Force plate type Kistler – model 9286AA

The software that collects the information from the board and converts it for use is called BioWare, and the recorded data is converted to text or excel files in order to represent them graphically and to carry out numerical analyses. 2.3 Biomechanical Analysis Procedure Experimental exemplification is performed with the help of a female subject without any health problems, aged 27 years, height 153 cm and weight 675 N, to which the movements to perform were explained and also a few exercises were performed before the measurements. For each type of inclination (presented in Table 1) 3 tests were performed to have a better accuracy of the analysis. The primate indications were understood by the subject, then repeated together several times until the movement was correct, after which the measurements were made for each of the 6 types of tests. The subject also had to perform some relaxation movements to relax the muscles (shake the arms, moved the body, head) after receiving the climb tile on the Kistler platform (Fig. 2). Then from the moment of the measurement, beginning until the end of it both the subject and the person performing the test must remain quiet and completely still. Any perturbation (light, noise, vibrations) can affect the measurement result, which will lead to an erroneous result. Another important aspect was the maintenance of the forwardfacing visual direction, the subject looking at a certain object in the distance (open

Biomechanical Analysis of the Balance of the Human Body

87

Table 1. Types of measurements for balance analysis and indications for their realization No. Crt Type of analysis

Indications received

1

Front-back head tilt

The body remains rigid, only the head tilts back-faced twice in each part, with a cursive motion, keeping the direction facing forward

2

Front-back torso tilt

The legs remain rigid, the torso tilts face-to-back twice in each side, with a cursive motion, keeping the visual direction in front

3

Total front-back inclination The soles of the feet remain on the ground, the body tilts from the total front-back ankle twice in each part, with a cursive movement, keeping the visual direction in front

4

Left-right head tilt

The body remains rigid, only the head tilts left-right twice in each side, with a cursive motion, keeping the direction visual in front

5

Left-right torso tilt

The legs remain rigid, the torso tilts face-to-back twice in each side, with a cursive motion, keeping the direction visual in front

6

Total left-right tilt

The soles of the feet remain on the ground, the body tilts from the total front-back ankle twice in each part, with a cursive movement, keeping the visual direction in front

Fig. 2. Position of the body when is inclined the torso left-right

eyes) and keeping the direction of the gaze fixed on the duration of the movements. The amplitude of the movements being dictated by maintaining this direction, during the tests.

3 Results 3.1 Comparison Between the Same Type of Inclination with Different Human Body Segments The inclination of the left-right head represents the movement along the Oy axis according to the plate scheme, and the front-back inclination represents the movement along the Ox axis. To exemplify the comparison regarding the behavior of the human body in

88

A. I. T˘ataru (Ostafe) et al.

the swing movement, the recordings made with the same type of inclination, front-back, but with different segments of the body (total human body, head or torso) were used. Analyzing the graphics of the variation of the forces on Oz axis, with the help of the dedicated BioWare software, it can be seen that in the first 8 s the body has greater instability following the movements, and towards the end of the recording (duration of 20 s) the subject finds a balance, the movement thus becoming cursive. Fig. 3 shows the graphs of the Fz force for the type of front-back inclination of the head, total and torso. From these graphs it can be interpreted, by calculating the difference between the types of inclinations, which type is more unbalanced.

Fig. 3. Specification between variations in forces resulting from total or partial inclination (head, torso) front-back.

The amplitude difference for the total inclination is 4.204 N, and for that of the head the difference is 3.767 N. Also, the variation of the force measured on the Oz direction indicates every time the behavior of the human body segment that performs the exemplified tilting movement. Thereby, recording the movement of the front-back tilting head, in the first 2.5 s indicates an action that is not totally stabilized, according to the requirements. In the case of recording the tilting movement of the whole body, the oscillations of the force Fz presents comparable amplitudes, the body performing a uniform forward-backward tilting movement throughout the selected time duration.

Biomechanical Analysis of the Balance of the Human Body

89

By comparing the oscillation values of the Fz force for all types of front-back swing movement, respectively left-right, in the three cases (head, total body, torso) it is possible to identify the positioning of asymmetry of these segments during the action of balance, then the limits and changes of stability areas in the analyzed cases. The stability area of the two types of tests shows amplitude changes in the directions of the inclinations (on the Ox axis and on the Oy axis respectively). Changes in the area of stability show how much a person can lean in this case without moving their legs or movements of hands to rebalance the body. Changes in the pressure center (COP) are determined by the change in the stability area. Can be seen in Fig. 4, the difference in areas: in case of front-back inclination, the area changes on the Oy axis very little resulting in a good balance of the subject, respectively left-right inclination with larger changes on the Oy axis and smaller on the Ox axis. The inclinations on the left-right direction have higher amplitude compared to the front-back inclination, having a maximum of 693 N respectively 684 N.

Fig. 4. Stability area in case of front-back (up) head inclination, respectively left-right (bottom)

The maximum value was recorded for tilting the head resulting in the fact that there is mobility and a better flexibility in this direction than the other is. The minimum recorded value was 671 N, finding that it is the same in the case of front-back inclination, the difference existing in the type of measurement, namely for the left-right direction the value was obtained in the inclination of the torso, and the front-back value was obtained by the total inclination of the body (Fig. 5). Data processing has shown that total inclination is more unbalanced than torso tilt. The inclination of the head is the most unbalanced in this direction both in terms of the inclination of the torso and in relation to the total inclination.

90

A. I. T˘ataru (Ostafe) et al.

Fig. 5. Comparison between the forces appeared on the Oz axis following the inclination on the total left-right direction or on human body segments (torso, head)

The experimental structure proposed for the future approach related to balance analysis consist of simple modules for comparing the areas of stability in the case of controlled movements of the human body under different external sensory stimulation (visual, auditory, postural instability) in order to follow their effects on the balance movement in regaining bipedal posture. Another very important aspect for such research consists in the determination of the balance ability score, a value depending on the angle of inclination of the human body segment (especially in the case of the inclination of the whole body) that performs the movement [7]. This score is a quantity that can be used to asses the level of balance and to determine the level of rehabilitation of the posture in case of exceeding the area of stability. The analysis to determine this score involves several experiments on an extended sample of subjects and finds its applicability especially in sports field and locomotor rehabilitation.

4 Ethics and Permissions The study was conducted according to the guidelines of the Declaration of Helsinki [8]. After the authors explained the objectives and procedures of the study, the informed consent was obtained from the subject.

Biomechanical Analysis of the Balance of the Human Body

91

5 Conclusions After data processing obtained from the conducted experiment, the following were found: – The subject was tenser at the beginning of each type of test, while being more relaxed during the following ones. That is why the second test was chosen to study the forces and stability area; – In the case of the front-back tilt, it was found that the total incline is less unbalanced than the tilt of the head or the torso (the difference between the total tilt and the other two was negative, the maximum value of the torso incline being 675 N, respectively 682 N for tilting the head and 684 N for the torso incline); – The difference in the amplitude of the force on the Oz axis in the case of total incline of the body in the front-back direction was grater that that of the torso and the head, resulting in the fact that the last one is the least unbalanced; – The inclination on the left-right direction has a greater amplitude, therefore a wider movement (the highest recorded value of the force on the Oz axis was 691 N); – In the case of tilting in the left-right direction, it was found that tilting the head is the most unbalanced movement for the balance of the human body (the highest value recorded was for this tilt, and the difference between the total tilt and that of the head was negative), and the total one being the least unbalanced; – In the case of tilting the trunk in the left-right direction (the maximum measured value is 687 N) it has slightly greater amplitude than front-back (674 N). Acknowledgments. Acknowledgments. This experiment was carried out using equipment from the Advanced Mechatronic Systems Research Center – C04 from Research Institute and Applied optometry Laboratory at University Transylvania of Brasov and is part of the research developed within the PhD thesis of doctoral student Anca Ioana Tataru (Ostafe).

Conflict of Interest. The authors declare that they have no conflict of interest.

References 1. Ros, ca, I.-C., S, erban, I.: Fundamente de biomecanic˘a. Editura Universit˘at, ii Transilvania din Bras, ov (2015) 2. Kejonen, P.: Body Movements During Postural Stabilization. Oulu University Press, Oulu (2002) 3. Winter, D.-A.: The Biomechanics and Motor Control of Human Gait, 2nd edn. University of Waterloo Press, Canada (1988) 4. Macie, A., Matson, T., Schinkel-Ivy, A.: Age affects the relationships between kinematics and postural stability during gait. Gait Posture 1(102), 86–92 (2023) 5. Chapter 14. The Center of Gravity and Stability | Kinesiology: Scientific Basis of Human Motion, 11e | Access Physiotherapy | McGraw Hill Medical [Internet]. [cited 5 May 2023]. https://accessphysiotherapy.mhmedical.com/content.aspx?bookid=446§io nid=41564591#6151629

92

A. I. T˘ataru (Ostafe) et al.

6. Equilibrium and Stability of the Upright Human Body [Internet]. [cited 5 May 2023]. https://www.researchgate.net/publication/309772648_Equilibrium_and_Stability_of_ the_Upright_Human_Body 7. Nguyen, H.T.P., Woo, Y., Huynh, N.N., Jeong, H.: Scoring of human body-balance ability on wobble board based on the geometric solution. Appl. Sci. 12, 5967 (2022). https://doi.org/10. 3390/app12125967 8. https://www.wma.net/policies-post/wma-declaration-of-helsinki-ethical-principles-for-med ical-research-involving-human-subjects/

Primary Measuring Transducer of a Diagnostic Spirometer Based on a Venturi Flowmeter Roman Tomashevskyi1(B)

and Dmitry Vasilchuk2

1 National Technical University “Kharkiv Polytechnic Institute”, Kharkiv, Ukraine

[email protected] 2 Ukrainian Engineering Pedagogics Academy, Educational-Scientific

Professionally-Pedagogical Institute, Bahmut, Ukraine Abstract. The presented work is devoted to the development of a primary measuring transducer implemented on the basis of Venturi flowmeter for a portable spirometer. A modified Venturi flowmeter design has been proposed to enable measurement of two phases of the respiratory cycle (expiratory and aspiratory). This modification differs from the classical version in that it has a symmetrical shape relative to the median plane, which is perpendicular to the tube axis at the throat section. It has been shown in the paper that the curves showing dependence of pressure drop p on inlet flow Q, for classical and modified Venturi flowmeter have good convergence. In order to develop a mathematical model of the proposed Venturi flowmeter design, basic hydrodynamic equations, such as Bernoulli equation and continuity of flow equation, have been used and calculation methodology of Venturi nozzle for rhinomanometry problems has been applied. Using the calculation results, a 3D model of the Venturi flowmeter was created in SolidWorks CAD, followed by static and dynamic studies. Based on the simulation results, the pressure distribution graphs along the Venturi flowmeter inner surface at maximum Q = 16 l/s and minimum Q = 0, 1 l/s inlet flow rates have been obtained. These graphs made it possible to determine the minimum and maximum pressure drop at the installation points of the differential pressure sensor (secondary transmitter) and to establish the pressure variation range in which the sensor should measure. The error of the simulation and calculation results was assessed and showed good convergence in the input flow range Q = 0, 1 ÷ 8 l/s. Further research will focus on developing a secondary transducer and integrating it with the primary transducer to create an air volume velocity transducer with improved metrological characteristics. Keywords: Differential pressure sensor · Inlet Flow · Homecare · Spirometer · Spirometry · Venturi Tube

1 Introduction According to WHO, about 235 million people are living with asthma and 64 million people suffer from COPD (which is the third leading cause of death in the world, accounting for about 3 million deaths each year and accounting for 6% of all deaths worldwide). At the same time, millions of other people suffer from allergic rhinitis and other often undiagnosed chronic respiratory diseases (CRD) [1]. © The Author(s), under exclusive license to Springer Nature Switzerland AG 2024 V. Sontea et al. (Eds.): ICNBME 2023, IFMBE Proceedings 92, pp. 93–102, 2024. https://doi.org/10.1007/978-3-031-42782-4_11

94

R. Tomashevskyi and D. Vasilchuk

Specialised spirometry units are used for detailed studies of the external respiratory function (ERF), which are located in hospital medical facilities. To reduce the medical costs associated with spirometry tests and to enable self-monitoring of patients, it is advisable to use portable (benchtop) or hand-held (manual) spirometers. The need for such a portable device has now increased significantly due to the COVID-19 pandemic. Patients infected with COVID-19 often have pulmonary fibrosis and stationary spirometers cannot be used to monitor their condition due to the high contagiousness of the virus. According to WHO, about 1 in 6 COVID-19 survivors develop serious lung problems and breathing difficulties, so a portable spirometer can be used to detect and assess lung dysfunction and its evolution over time [2]. The main disadvantages of portable spirometers are: low accuracy, low resistance to sanitation, relatively high price. According to [3] an inspection in 16 primary care centres in the United States showed that only 1 out of 17 spirometers met accuracy criteria, accounting for percentage error resulted in 28% of tests being reclassified for impairment severity, of the spirometers examined only 60% were deemed acceptable. The goal of this work is to create a concept for a portable device for the study of external respiratory functions, which would have improved metrological characteristics and simple sanitation technology.

2 Analysis of Publications We can distinguish the four most commonly used physical properties of airflow in spirometry today, which change in proportion to the measured flow. 1. Measurement pressure drop in the measurement channel. In this transducer the differential pressure is created either by standard restriction devices (nozzles or Venturi tubes, diaphragms) or pneumatic resistance (fixed or variable). Such transducers are bidirectional in nature and show accurate results, especially at low flow rates [4]. However, they are sensitive to temperature changes, and subject to blocking by solid and liquid particles near the pressure sampling orifices. 2. The kinetic energy of the air. It causes a mechanical movement such as the rotation of the turbine blades or a mechanical deformation (bending) of the PVDF film in the measuring channel of the spirometer, which is then converted to an electrical signal for further use in the spirometer’s measuring system [5, 6]. The advantages of the turbine transducer are the linearity of the transfer characteristic, low pneumatic resistance, high enough measurement accuracy, while remaining insensitive to ambient temperature and pressure. The main problem of such transducers is the difficulty of determining whether the rotation of the turbine is due to the air flow or due to the inertia of the turbine, in addition they have low speed and poor sanitation. 3. Heat transfer. The air flowing around the heating element (usually a heated metallic or semi-conductor element) exchanges thermal energy with it, the temperature drop across the heating element is proportional to the flow rate. Temperature sensors are located symmetrically on both sides of the heating element to determine the flow direction. An important advantage of this transducer is its linearity and accuracy, but its susceptibility to contamination as well as environmental pressure has a significant influence on its performance [7].

Primary Measuring Transducer of a Diagnostic Spirometer

95

4. The interference of the ultrasonic signal in the airflow. Ultrasonic transducers are used in pairs on opposite sides of the measuring channel to transmit and receive ultrasonic pulses. The transit time of acoustic waves depends on the air velocity. Accordingly, the transit time measurement provides an indirect way of determining airflow [8]. Spirometers based on ultrasonic transducers are largely independent of ambient pressure and are well resistant to sanitation. However, they have a number of unique problems: high sensitivity to flow disturbances and turbulence, gas composition, condensation on the measuring channel wall, in addition they retain accuracy within a limited range of airflow and temperature. The key element of such devices is the airflow rate transducer, on the metrological performance of which the functionality of the entire device depends. One of the main challenges faced by the designers of these spirometers is to improve the accuracy and precision of airflow rate measurements. The accuracy of airflow rate measurement is primarily important because it affects the determination of other physiological parameters. New research in the field of pulmonology indicates that additional information about lung health can be obtained by examining respiratory activity under normal conditions [4]. Following new trends, spirometry standards have to be tightened. This is because normal respiratory activity is less dynamic than in a standard spirometry test, and devices with better resolution and accuracy over the range of airflow rates to be measured are needed. The modern requirements for portable spirometers [4] require the airflow rate range to be between 0–14 l/s and the measuring accuracy to be at least as good as 0.2 l/s, and a resolution of 25 ml/s. The resistance value shall be Fcr , then we decide that there are edge effects (the hypothesis H0 is rejected). Table 4. The input data for regression analysis in a centered vertical section (laser 1). Screen area

Central

Intermediate

Peripheral

x

1

1

1

1

2

2

2

2

3

3

3

3

y

3

3

3

2

1

2

1

3

5

4

4

6

The results of the analysis: Fisher criteria statistics F = 4.7291. Critical statistics for 1 and 10 degrees of freedom and for the chosen significance level Fcr = 4.96. Because F < Fcr , then we decide that there are no edge effects (the hypothesis H0 is not rejected). Table 5. The input data for regression analysis in a centered horizontal section (laser 2). Screen area

Central

Intermediate

Peripheral

x

1

1

1

1

2

2

2

2

3

3

3

3

y

9

5

5

8

6

3

3

4

7

6

11

5

The results of the analysis: Fisher criteria statistics F = 0.0787. Critical statistics for 1 and 10 degrees of freedom and for the chosen significance level Fcr = 4.96.

140

Y. Sokol et al. Table 6. The input data for regression analysis in a centered vertical section (laser 2).

Screen area

Central

Intermediate

Peripheral

x

1

1

1

1

2

2

2

2

3

3

3

3

y

9

5

5

8

2

3

6

7

8

12

5

6

Because F < Fcr , then we decide that there are no edge effects (the hypothesis H0 is not rejected). The results of the analysis: Fisher criteria statistics F = 0.2542. Critical statistics for 1 and 10 degrees of freedom and for the chosen significance level Fcr = 4.96. Because F < Fcr , then we decide that there are no edge effects (the hypothesis H0 is not rejected). 4.2 Research of Edge Effects During Radial Scanning of a Microscope Image Such research is the second stage of the regression analysis, taking into account the geometric model of sequential radial scanning of the image within the total angle from 0 to 360 degrees. In Table 7 the quantity of erythrocytes during sequential scanning of the central, intermediate and edge zones of the image for laser 1 are presented. In Table 8 the quantity of erythrocytes during sequential scanning of the central, intermediate and edge zones of the image for laser 2 are presented. Table 7. The input data for regression analysis during radial scanning of the image on a plane (laser 1). Screen area

Central

Intermediate

x

1

1

1

1

2

2

2

2

2

2

2

2

2

2

2

2

3

3

y

3

3

2

3

3

1

2

4

1

1

2

3

1

2

3

4

3

1

Screen area

Peripheral

x

3

3

3

3

3

3

3

3

3

3

3

3

3

3

3

3

3

3

y

5

4

7

3

7

5

4

4

5

2

6

4

6

6

8

6

5

7

The results of the analysis: Fisher criteria statistics F = 15.3533. Critical statistics for 1 and 34 degrees of freedom and for the chosen significance level Fcr = 4.12. Because F > Fcr , then we decide that there are edge effects (the hypothesis H0 is rejected). The results of the analysis:

Statistical Distortion Detection of Interference Microscope Image

141

Table 8. The input data for regression analysis during radial scanning of the image on a plane (laser 2). Screen area

Central

Intermediate

x

1

1

1

1

2

2

2

2

2

2

2

2

2

2

2

2

3

3

y

9

5

8

5

7

2

3

8

3

4

3

7

6

6

3

6

8

3

Screen area

Peripheral

x

3

3

3

3

3

3

3

3

3

3

3

3

3

3

3

3

3

3

y

8

12

6

9

5

6

5

3

4

5

6

5

5

7

6

11

7

3

Fisher criteria statistics F = 0.1785. Critical statistics for 1 and 34 degrees of freedom and for the chosen significance level Fcr = 4.12. Because F < Fcr , then we decide that there are no edge effects (the hypothesis H0 is not rejected). As a graphical illustration of the quantitative values of Fisher’s F-statistics for various methods of regression research and types of lasers Figs. 3 and 4 are presented.

Fig. 3. The value of the criterion F-statistics of the regression analysis for the horizontal and vertical sections (letters (H) and (V) indicate, respectively, the use of horizontal or vertical sections).

As it has been proven that laser 1 provokes geometric distortions of the image, it makes sense to prove the validity of the hypothesis H0 - all distortions are the same along the entire perimeter of the image. To do this, the linear correlation coefficients for different sections of the image were tested for the validity of the fundamental hypothesis H0 . The results of calculation are presented in Table 9. The critical value of the T-statistic for α = 0.05: Tcr = 1.96. The main hypothesis H0 is that the correlation coefficients are the same when compared in pairs.

142

Y. Sokol et al.

Fig. 4. F-statistics of regression analysis during radial scanning of the image. Table 9. The results of calculation for correlation coefficients testing. Testing parameters Estimation of the correlation coefficient

Image section Vertical

Horizontal

Circular

Rv = 0.567

Rh = 0.616

Rc = 0.557

Sample size

nv = 12

nh = 12

nc = 36

Fisher Z-transform coefficient

Zv = 0.64309

Zh = 0.71853

Zc = 0.62847

T-pairwise comparison statistics

Tvh = 0.33948 -

Thc = 0.41721

For pair Rvh and Rh we have Tvh < 1.96; main hypothesis H0 – Rv = Rh is not rejected. For pair Rh i Rc we have Thc < 1.96; main hypothesis H0 – Rh = Rc is not rejected.

5 Conclusions It has been proven that for the comparative study of image distortion options on different areas of the screen of an interference microscope, one can utilize methods of statistical comparison of mean values of erythrocyte groups for 36 rectangular regions (zones) of the microscope screen, provided that the dot images of erythrocytes are uniformly randomized across the entire screen. Statistical analysis showed that for lasers 1 and 2 there are different geometric curvatures of the image. Laser 2 has order of magnitude smaller edge effects for the average density of erythrocytes quantity for each of the 36 zones created with a help of modified chamber equivalent to a Goryaev chamber. It is proved that the edge effects for laser 1 are statistically uniform over the entire perimeter of the image. As for the laser 2, its use does not provoke geometric curvatures of the image, including geometric models of edge effects.

Conflict of Interest.. The authors declare that they have no conflict of interest.

References 1. Hryhoruk, V.I., Korotkov, P.A., Khyzhniak, A.I.: Lazerna fizyka. K. – 480 s. (1997)

Statistical Distortion Detection of Interference Microscope Image

143

2. Mikheienko, L.A., Mamuta, M.S.: Optychni vymiriuvannia. K.: NTUU «KPI» – 190 s. (2014) 3. Afanasieva, O.V.: Optychni vymiriuvannia. Kharkiv: KhNURE. Ch.1. – 180 s. (2021) 4. Trembovetska, R.V., Halchenko, V.Ia., Tychkov, V.V., Bondarenko, M.O.: Proektuvannia ta metrolohichne zabezpechennia optychnykh ta optyko-elektronnykh pryladiv. Cherkasy, ChDTU – 235 s. (2020) 5. Kirsh, M.L., Kozakov, O.M.: Skladannia ta yustuvannia optychnykh pryladiv. Chernivtsi: Ruta – 120 s. (2002) 6. Mikheienko, L.A.: Khvylovi vymiriuvannia. Kyiv – 64 s. (2011) 7. Carl, D., Kemper, B., Bally, G.: Digital holographic microscope for living cell analysis. BMT 49 Extension Part 2, pp. 978–979 (2004). https://doi.org/10.1364/ao.43.006536 8. Sokol, Ye.I., Kolisnyk, K.V, Bernadska, T.V.: Vdoskonalennia metodiv tryvymirnoi vizualizatsii dlia vyznachennia morfolohichnykh oznak fazovykh mikroobiektiv. Visnyk Natsionalnoho tekhnichnoho universytetu «KhPI». Kharkiv: NTU KhPI. №1 (7), pp. 47–53 (2021). https://doi.org/10.20998/2413-4295.2021.01.07 9. Sokol, Ye., Tomashevskyi, R., Kolisnyk, K., Bernadskaya, T.: Improving the effectiveness of methods for controlling the morphology of erythrocytes. In: IEEE 41st International Conference on Electronics and Nanotechnology (ELNANO), pp. 329–333 (2022). https://doi.org/ 10.1109/ELNANO54667.2022.9927107 10. Ravel, R.: Clinical Laboratory Medicine. Chicago, 692 p. (1989) 11. Romaniuk, M.O.: Optyka. Lviv: LNU imeni Ivana Franka. – 564 s. (2012) 12. Sokol, Ye., Kolisnyk, K., Tomashevskyi, R., Bernadskaya, T.: Improving the method of interference holography to determine the state of plasma membranes. In: IEEE 39th International Conference on Electronics and Nanotechnology/ELNANO-2019. Igor Sicorski Kyiv Polytechnic institute, Kyiv, pp. 157–164 (2019). https://doi.org/10.1109/ELNANO.2019.878 3675 13. Pollard, Dzh.: Dovidnyk po obchysliuvalnym metodam statystyky. M.: Finansy ta statystyka, 344 s. (1982) 14. Ponedilok, H.V., Danylov, A.B.: Heometrychna optyka. Optychni systemy ta prylady. Lviv, Vydavnytstvo Lvivskoi politekhniky (2012)

Legal Frameworks for the Integration of Artificial Intelligence Said Saidakhrarovich Gulyamov(B) Tashkent State University of Law, Tashkent, Uzbekistan [email protected]

Abstract. The lightning-fast development of artificial intelligence and neural networks in general has had a tremendous impact on many different fields, and biological engineering is only one of those fields. These innovations have the potential to completely revolutionize the field of medicine by enhancing diagnostics, treatment planning, and tailored medication. This might be accomplished. However, there are ethical and legal concerns about the manner in which they should be incorporated into biomedicine. This study’s objective is to investigate the existing legal frameworks that regulate the uses of artificial intelligence and neural networks in biomedical engineering and to evaluate how effectively such frameworks address the challenges posed by technological inclusion. On a global, regional, and national basis, we evaluated the rules and regulations that regulate the use of artificial intelligence and neural networks in biomedical engineering. These laws and regulations control the field. According to the findings of our research, even if the current legal frameworks have been improved in some respects, substantial problems are still present. These problems are particularly prevalent in the areas of data privacy, algorithmic responsibility, and ethical dilemmas. Also, the article discusses the need of doing ongoing evaluations and making adjustments in order to keep up with the fast advancement of artificial intelligence and neural networks in the area of biomedical engineering. Keywords: Artificial intelligence · medicine · biomedicine · law regulation · future technologies · frameworks · integration of AI

1 Introduction The introduction of AI and neural networks in relation to biomedical engineering has the potential to transform healthcare by providing new tools for disease diagnosis, therapy planning, and individual patient care. The use of AI and neural networks in the medical field has the potential to enhance precision, lessen the impact of mistakes made by humans, and make better use of available resources. However, there are legal, ethical, and practical considerations that must be solved in order for these advancements to be successfully used in the healthcare area. The goal of the paper is to examine the legal frameworks that regulate the use of artificial intelligence and neural networks in biomedical engineering, and to evaluate © The Author(s), under exclusive license to Springer Nature Switzerland AG 2024 V. Sontea et al. (Eds.): ICNBME 2023, IFMBE Proceedings 92, pp. 144–149, 2024. https://doi.org/10.1007/978-3-031-42782-4_16

Legal Frameworks for the Integration of Artificial Intelligence

145

how well they cope with the difficulties presented by these advances in technology. By doing so, we give an in-depth survey of the current laws and regulations governing the use of AI and neural networks in biomedical engineering on a regional, national, and global level. We also address prospective changes and upcoming developments in the field of law, as well as assess the ramifications of such regulations on the advancement and application of AI and neural networks in the sector.

2 Methods In order to determine and examine the laws and regulations regulating AI and neural network applications in bio-medical technology, we utilized a thorough review methodology for this research. To guarantee a comprehensive and rigorous examination, we took the following measures: 1. Search of literature: To locate publications, conference proceedings, and reports on legal frameworks associated with AI and neural networks in biomedical engineering, we systematically used academic sources such as Scopus. The searching terms utilized were different combinations of machine learning, neural systems, medical engineering, laws, rules, guidelines, and so on. 2. Search for documents. We supplemented our search of the academic literature by reviewing sources such as government websites, policy papers, and reports from international organizations to determine the appropriate legal framework at the international, regional, and national levels. 3. Data extraction and analysis: From the included sources, we extracted information on the main components, purposes, scope, and key provisions of the identified legal frameworks. We then evaluated the effectiveness of these frameworks in addressing the challenges of AI and neural network integration in biomedical engineering, considering factors such as adaptability, comprehensiveness, and enforcement mechanisms. 4. Synthesis: Finally, we synthesized the extracted data and insights to provide a comprehensive overview of the current legal landscape and to identify gaps, limitations, and potential areas for improvement in the existing frameworks.

3 Results Guidelines and suggestions have been produced at the worldwide level by a number of organizations and projects in response to the difficulties faced by AI and neural networks in biomedical engineering. The World Health Organization’s (WHO), for example, has produced the Digital Health Guidelines, which lay out a roadmap for the widespread use of AI and other forms of machine learning in systems for providing healthcare (WHO 2021). In developing and deploying digital health solutions, these recommendations highlight the significance of data privacy, security, and ethical issues. The General Data Protection Regulation (GDPR) of the European Union (EU) regulates the processing and administration of personal data within the framework of artificial intelligence and neural network technology, including health data (European Commission 2016). During the process of creating and implementing AI and neural network-based options, the GDPR

146

S. S. Gulyamov

defines principles like data minimization, transparency, and responsibility, and introduces the notion of “privacy by design” to guarantee the safety of personal information. In addition, the ISO/IEC 27000 group of standards was developed by the International Organization for Standardization and the International Electrotechnical Commission to provide guidelines for the management of information security in the context of artificial intelligence and neural networks (ISO/IEC 2018). These rules have been embraced by groups working on AI and neural network-based technology adoption in biomedical engineering, and include a broad range of security topics including risk management, access control, and encryption. The difficulties of using AI and neural networks in biomedical engineering have prompted the development of regional regulatory frameworks. The European Union (EU) has proposed an AI Act that would provide a regulatory framework for the use of AI and neural networks across industries, including healthcare (European Commission 2021). The legislation sets a categorization system for AI applications according to the amount of danger they represent to users and society, and it mandates openness, accountability, and human monitoring. With the proposed approach, high-risk AI applications like those employed in life-or-death medical operations would be subject to strict regulatory constraints. When it comes to artificial intelligence (AI) and neural networks (NN) in medical devices, the Food and Drug Administration (FDA) in the United States has published some recommendations (FDA 2019). Device performance, data quality, and algorithm validation are just some of the areas that this guideline emphasizes as part of a risk-based approach to approving medical devices that include artificial intelligence and neural networks. Over 100 AI and neural network-based medical devices have been authorized by the FDA as of 2021, with the vast majority (68%) serving diagnostic purposes and the remainder (32%), treatment planning and patient monitoring (Tsai, F. 2021). Several Asian nations have created regulatory frameworks for the use of AI and neural networks in healthcare technology. For instance, in 2020 the National Healthcare Security Administration (NHSA) of China published regulations for the use of artificial intelligence (AI) and neural networks in healthcare IT (NHSA 2020). Equal in breadth to the regulations imposed by the FDA and the EU, these recommendations set out expectations for the protection of sensitive information, the openness of algorithms, and the verification of their clinical efficacy. While current legal frameworks have made significant strides in addressing some challenges associated with AI and neural network integration in biomedical engineering, there remain areas where improvements are necessary. The following points highlight the effectiveness of the legal frameworks in addressing key challenges: 1. Data privacy and security: Legal frameworks like GDPR have provided comprehensive guidelines for the management and protection of personal data, including health data, in the context of AI and neural networks. However, issues of data privacy and security remain a concern due to the vast amounts of sensitive health data being processed by AI and neural network applications. Additionally, cross-border data sharing and collaboration in biomedical research may require harmonization of data protection laws across countries to ensure consistent privacy standards. 2. Algorithmic accountability and transparency: Some legal frameworks, such as the proposed EU Artificial Intelligence Act and the FDA guidance, emphasize the importance

Legal Frameworks for the Integration of Artificial Intelligence

147

of algorithmic transparency and accountability. However, the proprietary nature of AI and neural network algorithms can make it challenging to achieve full transparency, leading to potential biases and ethical concerns. Ensuring that AI and neural network developers provide sufficient information on the algorithms’ decision-making processes, while protecting intellectual property, remains a challenge for regulatory bodies (Gulyamov S. et al. 2022). 3. Clinical validation and safety: Many legal frameworks, including those in the US, UK, and Australia, have adopted risk-based approaches to assess and approve AI and neural network-based medical devices. However, the rapidly evolving nature of AI and neural network algorithms can make it difficult to evaluate their long-term safety and effectiveness. Continuous monitoring and post-market surveillance are essential to ensure that AI and neural network applications maintain their performance and safety standards over time. 4. Ethical considerations: While some legal frameworks address ethical concerns related to AI and neural networks in biomedical engineering, more comprehensive guidelines are needed to ensure that these technologies are developed and implemented in a responsible manner. This includes addressing issues such as informed consent, fairness, and the potential for AI and neural networks to exacerbate health disparities. Overall, the current legal frameworks provide a foundation for addressing the challenges of AI and neural network integration in biomedical engineering, but gaps and limitations still exist. Continuous evaluation and adaptation of these frameworks will be necessary to keep pace with technological advancements and ensure that AI and neural network applications are safely and effectively integrated into the healthcare system.

4 Discussion There is tremendous opportunity to improve healthcare outcomes and transform medical service delivery via the use of artificial intelligence and neural networks in biomedical engineering. To ensure their responsible and successful deployment, however, the fast development of these technologies also presents substantial legal and ethical issues. We’ve assessed the efficacy of the current legal frameworks controlling AI and neural networks in biomedical engineering, and presented a detailed analysis of their existence. Our research shows that while there have been considerable improvements to international, regional, and national legal frameworks, there are still gaps and limits that must be solved. Security and privacy challenges, for example, persist despite the GDPR’s exhaustive instructions for the administration and safeguarding of private information (Mittelstadt et al. 2018). The requirement to strike a balance between openness and IP protection presents additional difficulties in the realm of algorithmic accountability and transparency (Cohen et al. 2020). Additionally, ongoing monitoring and post-market surveillance are required because of the difficulty in evaluating the long-term safety and efficacy of AI and neural network algorithms due to their fast evolution (Price et al. 2019). Last but not least, more thorough rules are required to address ethical concerns including informed consent, fairness, and the possibility that AI and neural networks may exacerbate health inequities (Vayena et al. 2018).

148

S. S. Gulyamov

We offer a number of proposals to improve current regulations and ensure the appropriate integration of AI and neural networks in biomedical engineering, with the goal of filling up those spaces and overcoming these obstacles: 1. Enhance data privacy and security: Legal frameworks should be updated and harmonized across countries to ensure consistent privacy standards, particularly in the context of cross-border data sharing and collaboration in biomedical research (Huang 2013). 2. Promote algorithmic accountability and transparency: Regulatory bodies should work with AI and neural network developers to establish standards and mechanisms for disclosing information on the decision-making processes of algorithms while protecting intellectual property rights (Gulyamov S. 2020). 3. Strengthen clinical validation and safety requirements: Legal frameworks should incorporate continuous monitoring and post-market surveillance to ensure the longterm safety and effectiveness of AI and neural network applications in biomedical engineering (Tsai, F. 2021). 4. Develop comprehensive ethical guidelines: Policymakers and stakeholders should collaborate to develop comprehensive ethical guidelines that address informed consent, fairness, and potential health disparities associated with AI and neural network applications in healthcare. 5. Encourage interdisciplinary collaboration: Legal frameworks should promote interdisciplinary collaboration between researchers, clinicians, engineers, and legal experts to ensure that AI and neural network applications in biomedical engineering are developed and implemented with an understanding of their legal, ethical, and practical implications (Yin, M. 2019). 6. Foster international cooperation: Policymakers should work towards harmonizing legal frameworks and fostering international cooperation to facilitate the sharing of best practices, resources, and knowledge in the development and regulation of AI and neural networks in biomedical engineering (Xiao Y. 2022).

5 Conclusion In this article, we have examined the current legal frameworks governing the integration of AI and neural networks in biomedical engineering and assessed their effectiveness in addressing the challenges associated with these technologies. While significant progress has been made in certain areas, gaps and limitations remain, particularly in terms of data privacy, algorithmic accountability, ethical considerations, and the need for continuous monitoring of the safety and effectiveness of AI and neural network applications. To ensure the responsible and effective integration of AI and neural networks in healthcare, it is essential for policymakers, stakeholders, and researchers to collaborate on updating and adapting legal frameworks, fostering interdisciplinary collaboration, and promoting international cooperation. By addressing these challenges, we can harness the full potential of AI and neural networks in biomedical engineering, ultimately improving patient outcomes and revolutionizing healthcare delivery.

Legal Frameworks for the Integration of Artificial Intelligence

149

References Xiao, Y.: Application of neural network algorithm in medical artificial intelligence product development. Comput. Math. Methods Med. 8(2022), 5413202 (2022). https://doi.org/10.1155/ 2022/5413202 European Commission. General Data Protection Regulation (2016). https://eur-lex.europa.eu/ legal-content/EN/TXT/?uri=CELEX%3A32016R0679 FDA. Proposed Regulatory Framework for Modifications to Artificial Intelligence/Machine Learning (AI/ML)-Based Software as a Medical Device (SaMD) (2019). https://www.fda.gov/media/ 122535/download Floridi, L., et al.: AI4People—an ethical framework for a good AI society: opportunities, risks, principles, and recommendations. Mind. Mach. 28(4), 689–707 (2018). https://doi.org/10. 1007/s11023-018-9482-5 Goodman, K.W., et al.: AMIA’s code of professional and ethical conduct. J. Am. Med. Inform. Assoc. 24(1), 2–12 (2017). https://doi.org/10.1136/amiajnl-2012-001035 ISO/IEC. ISO/IEC 27000 series of standards (2018). https://www.iso.org/isoiec-27001-inform ation-security.html Mittelstadt, B., Allo, P., Taddeo, M., Wachter, S., Floridi, L.: The ethics of algorithms: mapping the debate. Big Data Soc. 3(2), 1–21 (2018). https://doi.org/10.1177/2053951716679679 NHSA. Guidelines on the regulation of AI and neural networks in medical devices and digital health services (2020). http://www.nhsa.gov.cn/ Price, W.N., Gerke, S., Cohen, I.G.: Potential liability for physicians using artificial intelligence. JAMA 322(18), 1765–1766 (2019) Yin, M.C.: Biomedicine offers advanced medical findings. BioMedicine 2(1), 1 (2019). https:// doi.org/10.1016/j.biomed.2012.02.001 Huang, C.Y.: Diagnosis and treatment trends in biomedicine. BioMedicine 3(4), 147 (2013). https://doi.org/10.1016/j.biomed.2013.10.001 Tsai, F.J.: Biomedicine brings the future nearer. BioMedicine 1(1), 1 (2013). https://doi.org/10. 1016/j.biomed.2011.10.007 Saidakhrorovich, G.S.: Regulatory legal framework for the regulation of the digital economy. Hacionalna accociaci yqenyx, (58–1 (58)), 33–35 (2020) Cohen, I.G., Amarasingham, R., Shah, A.: The legal and ethical concerns that arise from using complex predictive analytics in health care. Health Aff. 33(7), 1139–1147 (2020). https://doi. org/10.1377/hlthaff.2014.0048 Saidakhrarovich, G.S., Sokhibjonovich, B.S.: Strategies and future prospects of development of artificial intelligence: world experience. World Bull. Manage. Law 9, 66–74 (2022). https:// scholarexpress.net/index.php/wbml/article/view/841

Irregular Step of Changing for Neural Network Data Sets Improves the Accuracy of Resistive Sensors Calculation Alexandr Penin1(B)

and Anatolie Sidorenko1,2

1 Institute of Electronic Engineering and Nanotechnologies “D. Ghitsu”, Technical University

of Moldova, Chisinau, Republic of Moldova [email protected] 2 Skobeltsyn Institute of Nuclear Physics, Moscow State University, Moscow, Russia

Abstract. A linear multiport is considered as a model of multiwire communication lines with resistive sensors of physical quantities or as a model of the sensors themselves. The calculation of sensor resistance from measured input currents using a neural network as an approximation problem is investigated. To demonstrate such a problem, using the parameters of multiports with one and two sensor loads, the corresponding number of input currents for a particular set of loads is calculated in a given range of changes in their values. The input and target vectors are composed in this way. The dimension of the input vector is equal to the number of input currents. Numerical experiments were carried out in the MATLAB Deep Learning package for the feed-forward network. The trained model is further tested on the control data set to ensure the given computation accuracy conditionally for “all possible” load values. The data sets generation is carried out with both the traditionally constant and an irregular or variable step of change in values. For the irregular step, in the divided data into training, test and validation sets, an internal pattern is excluded and the network shows a greater ability to generalize. The same control data set shows a reduction in relative error for a series of numerical experiments. The repeatability of training results with preset value of relative error is introduced, as special index for quantitative assessment of training quality when comparing training results of neural networks with generated training data. The obtained results provide the basis for the study of both chains with a large number of loads, as well as other approximation and regression problems. Keywords: Resistive Sensor · Neural Network · Approximation · Data Set · Relative Error

1 Introduction Resistive sensors are widely used in many fields of science and technology to measure any physical quantities. In particular, medicine uses flexible and wearable sensors that convert the physiological signals of a person’s body into electrical signals to assess his condition [1, 2]. Also, the tactile sensor, one of the most important wearable devices, is © The Author(s), under exclusive license to Springer Nature Switzerland AG 2024 V. Sontea et al. (Eds.): ICNBME 2023, IFMBE Proceedings 92, pp. 150–159, 2024. https://doi.org/10.1007/978-3-031-42782-4_17

Irregular Step of Changing for Neural Network Data Sets

151

directly related to the intellectualization of the next generation of robots, medical devices, and human prosthesis technologies [3, 4]. The characteristics of all such sensors are nonlinear and subject to destabilizing factors. Therefore, feed-forward neural networks are used to solve the corresponding approximation and regression problem, which ensures the necessary measurement accuracy. The neural network contains hidden layers of neurons and is implemented, for example, on a microprocessor. Network parameters (number of neurons and weight coefficients) are in the process of training using ready or original training programs and a prepared set of training data [5, 6]. The training data includes an input vector and a target vector. The input vector corresponds to measured values of the currents, and actual resistance values of sensors set the target vector. The choosing a step or interval to change the data set is noteworthy. Usually a constant step is used. Next, these data are divided into training, validation and test sets. Therefore, the same specified change step is present in these sets. We can say that the neural network reveals this internal pattern or regularity and shows high accuracy in training. But, subsequent calculation for an extended control data set results in large relative error variations for individual data, which shows the overfitting effect [7]. In the present paper, data sets generation is carried out with a variable or irregular step. Therefore, in these three sets, this internal pattern is excluded and the network shows the ability to generalize. The repeatability of training results with preset value of relative error is introduced, as special index for quantitative assessment of training quality when comparing training results of neural networks with generated training data. The same control data set shows a high repeatability of a given relative error for a series of numerical experiments. On the other hand, this irregular step realizes the rough linearization of the nonlinear sensor characteristic by predistortion.

2 Resistive Sensor as Variable Electrical Circuit Element Let us consider a multi-port with the equal number of inputs and outputs. Such circuits may be multi-wire communication line with resistive sensors of physical quantities or may be a model of the sensors themselves. Load resistances can then be calculated from given or measured input currents of the multi-port. But there are known problems both with determining the parameters of the circuit [8, 9] and with solving the system of equations [10–14]. Of practical interest is such a direction in the electric circuits theory, when the “load-currents” relationship is considered as an approximation problem [15, 16]. To demonstrate such a task, the input currents for a particular set of load values are calculated. So The input vector and the target vector are composed in this way. The dimension or length of the input vector is equal to the number of input currents. The feed-forward neural network is used. The trained model is then checked on a special control data set to ensure the specified calculation accuracy for conditionally “all possible” load values.

3 One Load Calculation 3.1 Preparing the Training Data Set Consider the specific example of two–port in Fig. 1.

152

A. Penin and A. Sidorenko

Fig. 1. Two-port with one load resistor.

For convenience, here and further, we will use the representation of values in the MATLAB format so that the following program codes can be used. The corresponding replacement of parameter values designations will be understandable without explanation. The equation I0(RL) has the known fractionally linear view I0 = V0 ∗ (RL + r1 + r10)/(RL ∗ r0 + RL ∗ r10 + r0 ∗ r1 + r0 ∗ r10 + r1 ∗ r10) (1) This expression represents a monotone function. As can be seen, as the load resistance RL increases, the input current I0 decreases. Let us take the following dimensionless parameter values V0 = 12, r0 = 4, r1 = 1, r10 = 9. In turn, let the load value RL change over a sufficiently large range 5…, 17. Then, the plot I0(RL) has the view in Fig. 2. Therefore, considering the accuracy, from 11 to 25 samples in the approximation problem are sufficient.

Fig. 2. Plot I0(RL) as the monotone function.

Constant Step of Changing Training Data. Let the load value RL change over range in 0.5 increments. Therefore, 25 samples are obtained. Then, the set of currents values represents the input vector I0_25 and the set of load values is the target vector tt_25. For these calculations, it is convenient to organize a Script file called “train_25. The following code or statement uses the user–defined function (1) %train_25 RL = 5 : 0.5 : 17; tt_25 = RL; I0_25 = in_curr_0(RL); function I0 = in_curr_0(RL) V0 = 12; r0 = 4; r10 = 9; r1 = 1; det = r0. ∗ RL + r10. ∗ RL + r0 ∗ r1 + r0 ∗ r10 + r1 ∗ r10;   I0 = V0.∗ RL + V0 ∗ (r1 + r10) . /det; end

(2)

Irregular Step of Changing for Neural Network Data Sets

153

Irregular Step of Changing Training Data. Also, we generate 25 samples. To do this, let us introduce the clock value x = 0:25 with the constant step. For simplification, we use the following exponential expression, so that the values are in the change area for the case of constant step. The code fragment “train_ir_25” similar to (2) has the form %train_ir_25 x = 0 : 24; RL = 0.102*x.∧ 1.5 + 5; ttir_25 = RL; I0ir_25 = in_curr_0(RL); ...

(3)

The plot RL(x) in Fig. 3 clearly shows the irregular step of the RL value change. For comparison, the dash line straight y = 0.5*x + 5 demonstrates the regular step.

Fig. 3. Irregular step of the RL value change; the dash line straight demonstrates the regular step.

In turn, the plot I0ir_25(x) in Fig. 4 shows the obtained rough linearization of the two-port nonlinear characteristic. For this neural network, the exact approximation is not required.

Fig. 4. Rough linearization of the two-port characteristic.

3.2 Preparing the Control Data Set To check the neural network, we prepare a control data with large enough size, which values should be within the range of load. Let the control data be of 625 samples with the increment of 0.0192. The code fragment similar to (2) has the form %control_625 samples RL = 5 : 0.0192 : 16.872; tts_625 = RL; IOts_25 = in_curr_0(RL); ...

(4)

The set of currents values represents the input vector I0ts_625 and the set of load values is the target vector tts_625.

154

A. Penin and A. Sidorenko

3.3 Neural Network Training and Evaluation The Fit Data with a Shallow Neural Network section provides a Script example [6]. So, we use this example as “Script _25”. When training a network, the initial weights are randomly selected, so in order to get more correct results, we conduct a series of 30 or more experiments for the training data sets. Constant Step of Changing Training data. Let us consider the “Script _25” with the data of 25 samples. %Solve an Input − Output Fitting x = I0_25; t = tt_25; % input and target data % Training Function and Create a Fitting Network trainFcn =  trainlm ; hiddenLayerSize = 3; net = fitnet (hiddenLayerSize, trainFcn); % Division of Data for Training, Validation, Testing net. divideParam.trainRatio = 70/100; net. divideParam.valRatio = 15/100; net. divideParam.testRatio = 15/100; net. trainParam.epochs = 500; (5) % Train and test the Network [net, tr] = train(net, x, t); y = net(x); e = gsubtract(t, y); performance = perform (net, t, y), figure, plotperform(tr) % Test the Network by the control data set Rts_625 = sim(net, I0ts_625); er_625 = 100 ∗ (tts_625 − Rts_625). tts_625; max _625 = max(er_625), min_625 = min(er_625) Apparently, only extreme (maximum and minimum) relative error values er_625 are output for the control data due to the large number of samples. We put 3 neurons for the hidden layer. This number corresponds to formula 2n + 1, where n = 1 defines the input vector dimension [17]. After ten retraining, we got the results of the Table 1. Table 1. Number of epochs achieved and relative errors values No exper

1

2

3

4

5

6

7

8

9

10

epochs

206

500

15

500

500

8

1

500

80

132

errors, %

0.67

0.06

0.74

0.013

0.18

5.93

28.7

0.25

0.22

0.48

Irregular Step of Changing for Neural Network Data Sets

155

As you can see from this table, there are 6 errors up to 0.5%, and the number of errors up to 1% is 8. Therefore, we may introduce a repeatability, as special index in percent that show a tendency to change the training quality of such averaged data according to Table 2. Table 2. Repeatability of 1 to 10 experiments specified errors, %

0.5

1

2

5

repeatability, %

60

80

80

80

To confirm the statistics, we carry out the following ten experiments and calculate the average repeatability from 1–20, etc. For 50 experiments, the repeatability became close to that of 40 as shown in Table 3. Table 3. Training results for 25 samples specified errors, %

Training data step; repeatability, % Constant step; Number of experiments

Irregular step; Number of experiments

40

50

20

30

0.5

65

60

90

86

1

80

76

95

90

2

85

82

95

90

5

90

88

95

93

Irregular Step of Changing Training Data. We use the code (5) with the x = I0ir_25; t = ttir_25. The results of the irregular step comparison are presented in the Table 3. As we can see, the irregular step training gives a noticeable effect precisely for small errors.

4 Two Load Calculation 4.1 Preparing the Data Set Consider the specific example of four–port in Fig. 5. We must obtain the input currents expressions by the symbolic calculation of the loop current method using a Script editor of the Matlab system. Then, the Script file, called “Circuit_eqns_two”, has the following view

156

A. Penin and A. Sidorenko

Fig. 5. Four-port with two load resistors.

%Circuit_eqns_two V3 = 12; V4 = 10; r3 = 3; r31 = 9; r1 = 1; r4 = 4; r42 = 12; r2 = 2; r34 = 1.225; syms I3 I4 I1 I2 RL1 RL2 eq1 = I3 ∗ (r3 + r31 + r34) − I1 ∗ r31 + I4 ∗ r34 − V3; eq2 = I4 ∗ (r4 + r42 + r34) − I2 ∗ r42 + I3 ∗ r34 − V4; eq3 = −I3 ∗ r31 + I1 ∗ (r1 + RL1 + r31); eq4 = −I 4 ∗ r42 + I 2 ∗ (r2 + RL2 + r42); eqns = [eq1, eq2, eq3, eq4]; S = solve (eqns, I3, I4, I1, I2); I3 = S.I3, I4 = S.I4

(6) The expressions for input currents are the user–defined functions. Training data with 81 samples and control data are presented in Table 4, Table 5, Table 6. %train_81samples rL1 = 5 : 1.5 : 17; rL2 = 7 : 2.625 : 28; %Measurement or input currents and targets I3MES = zeros (0); I4MES = zeros (0); tt1 = zeros (0); tt2 = zeros (0); for RL1 = rL1 for RL2 = rL2 I3mes = in_curr_3(RL1, RL2); I3MES = [I3MES I3mes]; I4mes = in_curr_4(RL1, RL2); I4MES = [I4MES I4mes]; tt1 = [tt1RL1]; tt2 = [tt2RL2]; end end

(7) %input and target vectors I0 _81 = [I3MES; I4MES]; tt _81 = [tt1; tt2];

function I3 = in_curr_3(RL1, RL2) det = 50552 ∗ RL1 + 34711 ∗ RL2 + 9052 ∗ RL1. ∗ RL2 + 190754; I3 = 2 ∗ (3889 ∗ RL2 + 19886). ∗ (RL1 + 10)./det; end function I4 = in_curr_4(RL1, RL2) det = 50552 ∗ RL1 + 34711 ∗ RL2 + 9052 ∗ RL1. ∗ RL2 + 190754;

Irregular Step of Changing for Neural Network Data Sets

157

I4 = 2 ∗ (2351 ∗ RL1 + 7310). ∗ (RL2 + 14)./det; end

Table 4. Training samples with the constant step Amount of samples to loads

Range and increment of load changes

rL1

rL2

rL1

rL2

9

9

5:1.5:17

7:2.625:28

Input vector

Target vector

I0_81

tt_81

Note that the amount of load samples is the same, and the total amount of samples is formed due to the mutual search of the values for each load. Therefore, the calculation code uses the for loop to the rL1 value, the nested for loop to the rL2, and the user–defined functions. For these calculations, it is convenient to organize a Script file called “train_81”. The following code or statement uses the user–defined functions by (6)

Using the above code (7), we calculate the remaining data. Table 5. Training samples with the irregular step Clock value

Exponential expressions

x = 0:8

rL1 = 0.1875 ∗ x.∧ 2 + 5 rL2 = 0.216 ∗ x.∧ 2.2 + 7

Input vector

Target vector

I0ir_81

ttir_81

Table 6. Control samples with the constant step Amount of samples

Range and increment of load changes

Input vector

Target vectors

676

rL1 = 5 : 0.48 : 17

I0ts_676

tts1_676 tts2_676

rL2 = 7 : 0.84 : 28

4.2 Neural Network Training and Evaluation Training is carried out similarly to the case with one load. We put 5 neurons for the hidden layer. This number corresponds to formula 2n + 1, where n = 2 defines the input vector dimension. First, we conduct training with the constant step. Then, the code fragment (5) uses the x = I0_81; t = tt_81. To confirm the statistics, we conduct ten experiments several times

158

A. Penin and A. Sidorenko Table 7. Training results for 81 samples

specified errors, %

Training data step; repeatability, % Constant step; 40 exper

Irregular step; 60 exper

0.5

55

75

1

72

86

2

75

93

5

87

98

and calculate the average repeatability of errors. Ultimately, we stop at 40 experiments, as shown in Table 7. Moreover, of the errors for each load, we take the largest. Similarly, we carry out experiments with the irregular step. All results for comparison with the constant step are presented in the same Table 7. As you can see, the irregular step training gives a noticeable effect precisely for small errors.

5 Conclusions The repeatability index of training results with a given relative error value gives a quantitative assessment of the training quality. Training data with irregular steps increases the calculation accuracy. The load interference reduces the amount of samples for each load, which is important in practice. The obtained results provide the basis for the study of both circuits with a large number of loads, as well as other approximation and regression problems. Acknowledgments. The study was supported by the Grant RSF No. 22-79-10018 “Controlled kinetic inductance based on superconducting hybrid structures with magnetic materials” (theory development, samples measurements, results evaluation), and by the Moldova State Program Project «Functional nanostructures and nanomaterials for industry and agriculture» no. 20.80009.5007.11 (samples fabrication and characterization).

Conflict of Interest.. The authors declare that they have no conflict of interest.

References 1. Li, Y., Zheng, L., Wang, X.: Flexible and wearable healthcare sensors for visual reality healthmonitoring. Virtual Real. Intell. Hardw. 1(4), 411–427 (2019). https://doi.org/10.1016/j.vrih. 2019.08.001 2. Vu, C., Kim, J.: Human motion recognition by textile sensors based on machine learning algorithms. Sensors 18(9), 3109 (2018). https://doi.org/10.3390/s18093109 3. Zhang, Y., Ye, J., Lin, Z., Huang, S., Wang, H., Wu, H.: A piezoresistive tactile sensor for a large area employing neural network. Sensors 19(1), 27 (2018). https://doi.org/10.3390/s19 010027

Irregular Step of Changing for Neural Network Data Sets

159

4. Setiawan, J.D., Ariyanto, M.M., Munadi, M.M., Glowacz, A., Caesarendra, W.: Grasp posture control of wearable extra robotic fingers with flex sensors based on neural network. Electronics 9(6), 905 (2020). https://doi.org/10.3390/electronics9060905 5. Chollet, F.: Deep Learning with Python, 2nd edn. Manning Publications Co, New York (2021) 6. Function Approximation and Nonlinear Regression. https://www.mathworks.com/help/dee plearning/function-approximation-and-nonlinear-regression.html. Accessed 10 Mar 7. Penin, A.: Neural network based calculation of load resistances taking into account the multiport input-to-output ratio invariant properties. Elektrichestvo 4, 47–58 (2022). https://doi. org/10.24160/0013-5380-2022-4-47-58 8. Charles, K., Matthew, N.: Fundamentals of electric circuits. McGraw-Hill Education, New York (2017) 9. Bhattacharyya, S.P., Keel, L.H., Mohsenizadeh, D.N.: Linear Systems: A Measurement Based Approach. Springer India, New Delhi (2014). https://doi.org/10.1007/978-81-322-1641-4 10. Oliveira, V., Alzate, R., Bhattacharyya, S.: A measurement-based approach with accuracy evaluation and its applications to circuit analysis and synthesis. Int. J. Circuit Theory Appl. 45(12), 1920–1941 (2017). https://doi.org/10.1002/cta.2315 11. Pereira, K., Alzate, R., Oliveira, V., Bhattacharyya, S.: Modeling the Parametric Dependence in a Linear Circuit by Experimental Measurements. Proc. Ser. Braz. Soc. Comput. Appl. Math. 5(1), 1–7 (2017). https://doi.org/10.5540/03.2017.005.01.0396 12. Sun, Z., Pedretti, G., Ambrosi, E., et al.: Solving matrix equations in one step with cross-point resistive arrays. Proc. Natl. Acad. Sci. 116(10), 4123–4128 (2019). https://doi.org/10.1073/ pnas.1815682116 13. Chen, H., Manry, M., Chandrasekaran, H.: A neural network training algorithm utilizing multiple sets of linear equations. Neurocomputing 25(1–3), 55–72 (1999) 14. Xiao, L., Li, K., Tan, Z., et al.: Nonlinear gradient neural network for solving system of linear equations. Inf. Process. Lett. 142, 35–40 (2019). https://doi.org/10.1016/j.ipl.2018.10.004 15. Braun, J., Griebel, M.: On a constructive proof of Kolmogorov’s superposition theorem. Constr. Approx. J. 30, 653–675 (2009). https://doi.org/10.1007/s00365-009-9054-2 16. Cybenko, G.: Approximation by superpositions of a sigmoidal function. Math. Control Signals Syst. 2(4), 303–314 (1989) 17. Funahashi, K.: On the approximate realization of continuous mappings by neural networks. Neural Netw. 2(3), 183–192 (1989)

Mathematical Modelling of the Multifactorial Influence of Striking Fragments on the Dynamics of the Rehabilitation Processes of the Wounded Kostiantyn Kolisnyk1(B) , Yevgen Sokol1 , Pavlo Shchapov1 and Volodymyr Nehoduiko2

,

1 National Technical University “KhPI”, Kharkiv, Ukraine

[email protected] 2 Military Medical Clinical Center of Northern Region, Kyiv, Ukraine

Abstract. The article analyses the possibility of solving an important scientific and technical problem that is relevant for the security and defence of any country where natural and man-made disasters, military conflicts and other emergencies occur, in which penetrating injuries of people occur. The article reports on the possibility of improving the efficiency of the rehabilitation technology for patients with penetrating gunshot wounds by reducing the rehabilitation period using modern methods of medical diagnostics, mathematical modelling and statistical methods for processing biomedical information. The scientific idea underlying the conducted research is that dynamic changes of a set of biomedical indicators depend not only on the time of their observation, but also on the levels of those physical factors that characterize physical parameters: temperature and dynamics of fragments. As a working hypothesis, in this case, it is possible to consider the inverse task, in which it is possible to solve the problem of assessing the levels of physical factors characterizing fragments using measurements of biomedical indicators during the initial examination of the wounded. In the paper, the authors substantiated the possibility of using primary biomedical measurements to assess the physical characteristics of fragments. This, in turn, makes it possible to take into account the characteristics of the physical impact of fragments on the dynamics of changes over time in biomedical indicators characterizing the treatment, and will lead to a reduction in rehabilitation time. Keywords: Medical diagnostic · Disaster medicine · Penetrating gunshot wounds · Biomedical indicators · Mathematical modelling

1 Introduction Emergency situations are constantly occurring in the world: industrial accidents, natural and man-made disasters, military conflicts and other incidents that lead to inevitable human casualties with penetrating wounds. Mortality, especially if the injuries were caused by high-velocity particles of solid material, is high despite appropriate treatment. © The Author(s), under exclusive license to Springer Nature Switzerland AG 2024 V. Sontea et al. (Eds.): ICNBME 2023, IFMBE Proceedings 92, pp. 160–169, 2024. https://doi.org/10.1007/978-3-031-42782-4_18

Mathematical Modelling of the Multifactorial Influence

161

This is especially clear during military conflicts, when penetrating injuries are inflicted not only on professional soldiers, but also on the civilian population. Thus, the need for proper quality and timeliness of medical care is very acute. The authors considered this problem from the point of view of the possibility of using primary biomedical measurements to obtain additional biomedical information, which will increase the efficiency of patient rehabilitation technology due to the prediction and control of the patient’s condition throughout the rehabilitation process. Preliminary multivariate statistical analysis conducted by the authors based on experimental studies made it possible to obtain important information that indicated the possibility of planning medical technologies for the rehabilitation of the wounded taking into account the physical parameters of fragments: such as temperature, dynamic characteristics, weight of fragments.

2 Features of Biophysical Processes in Fire Injuries According to the type of projectile that causes damage, gunshot wounds are classified into: bullet, shrapnel (standard shrapnel elements and fragments of irregular shape), secondary (stone, glass, brick), non-table (ball, arrow-shaped), mine-explosive. According to the penetration into the body cavities, they are distinguished as penetrating and impenetrable wounds, according to the nature of the injuries - injuries only to soft tissues, internal organs, blood vessels, nerves, bones, etc. In connection with the constant improvement of weapons, an increase in the severity of damage to soft tissues and bones, a high frequency of infectious complications and a high percentage of delayed consolidation of fractures are observed [1–3]. Tissue damage during the passage of a wounding projectile occurs with the participation of several factors: the direct impact of the projectile, the main shock wave (action of a direct impact and compressed air), a side shock wave (in a temporary pulsating cavity), a vortex wake (flow of air and tissue particles behind the projectile) [4]. Gunshot wounds have their own characteristics related to the high kinetic energy of the bullet [5]. In the case of a gunshot wound, the high kinetic energy of the projectile creates a cavity, the size of which significantly exceeds the size of the projectile. This phenomenon is called “pulsating cavity phenomenon” Fig. 1.

Fig. 1. Pulsating cavity phenomenon

162

K. Kolisnyk et al.

Also, the formation of local disorders around the wound channel is observed. First of all, we are talking about disorders of a microcirculatory nature, accompanied by edema and, as a result, a local increase in pressure. Secondly, the accumulation and selection of pathogenic microflora is observed around the wound canal. A basic understanding of the ballistic behaviour of projectiles or fragments after entering the human body is important for military surgery of any part of the victim’s body, especially the head and neck, due to the number of blood vessels and nerve endings located in these areas. Mainly, in practice, this knowledge is used by doctors to predict the diagnostic and therapeutic consequences of this type of injury. Although a large number of factors affect the projectile in flight and after penetrating the body, the most important factor is still the amount of kinetic energy transferred to the tissues.   m v12 − v22 , (1) Ek = 2g where: Ek - kinetic energy of the projectile transmitted to the body; m - mass of the projectile; v1 - speed of the projectile at the time of its impact on the body; v2 - speed of the projectile at the time of its exit from the body; g - gravitational acceleration. The following elements play a leading role in the mechanism of a gunshot wound: – The main shock wave (ballistic), a wave of highly compressed air that forms in front of the bullet. – The projectile itself that injures. – Temporary pulsating cavity (side impact energy). – Secondary wounding projectiles (bone fragments flying at a speed of up to 70 m/s). – Vortex wake inflow. The current state of the problem of rehabilitation of the wounded is based mainly on the use of classical methods of obtaining information about the condition of a patient with shrapnel injuries: clinical, radiological and ultrasound diagnostics. Monitoring the patient’s condition requires periodic repetition of these diagnostic procedures, which has a significant impact on the effectiveness of patient treatment. At the same time, the existing methods do not use information that connects multivariate statistical analysis with the possibility of planning medical rehabilitation technologies taking into account the physical parameters of fragments. Therefore, as a working hypothesis, the authors propose the use of the possibility of assessing the levels of physical factors characterizing shrapnel using measurements of biomedical indicators during the initial examination of the wounded. This hypothesis is based on a multivariate statistical analysis of time sequences of multivariate measurement results of systems of biomedical indicators, so it can be considered reliable. The relevance of this research is determined by the complete absence of similar studies in world practice, even when considering similar studies of traditional disaster medicine.

Mathematical Modelling of the Multifactorial Influence

163

3 Analysis of the Solution of the Problem of Rehabilitation of Patients with Fire Injuries To assess the state of solving the problem of rehabilitation of patients with gunshot wounds, we will make an analytical review of the existing methods of diagnosis and control of the condition of these patients. Given the importance and urgency of the problem under consideration, there are currently many methods and ways of determining the condition of patients with penetrating gunshot wounds. For the completeness of providing information, we will consider the main methods used both in clinical medicine and in forensic medical examination related to gunshot injuries. In order to obtain maximum information about the object being studied, in each specific case, a complex of laboratory and instrumental research methods is used. At this time, the following classical research methods are known and widely used [6–8]. 1. Visual examination, including inspection gunshot wounds with the naked eye, using a magnifying glass, in infrared and ultraviolet rays. Examination with the naked eye provides detection of localization, shape, size and nature of the gunshot wound and its elements (defect, edges, walls, bottom), traces of chemical and thermal action of powder gases, presence and topography of the location of soot and small particles. To clarify the area, dust and metal particles, especially on dark, soiled or blood-soaked fabrics, an examination in reflected infrared rays or filtered ultraviolet rays is carried out. 2. Photographic methods include macro and micro photography. Currently, the methods of color and digital photo and video recording using computer technology are widely implemented, which significantly speeds up image acquisition and makes this method of research less time-consuming. 3. X-ray examination for differential diagnosis of the entrance and exit holes, establishing the presence of a ball and defects of bone tissue, metal particles in the area of the entrance wound. X-ray examination helps to determine the location of multiple gunshots and their fragments for the construction of spatial models, etc. 4. The methods of spectral analysis, chromatography, and methods of chemical analysis make it possible to distinguish the entrance hole from the exit hole and determine the state of contamination of the patient’s body with chemically active components. 5. Histological examination of skin with a subcutaneous base (edges of gunshot wounds or areas near them, soft tissues along the course of the wound channel) can provide information on establishing the direction of the wound channel, and decide the age of the gunshot injury. 6. The method of situational three-dimensional modelling allows you to accurately reproduce the metric parameters of the body: length, proportions, etc., to take into account the mobility in the joints of the limbs, characteristic of a person. With the help of 3D modelling, you can record all the damage, wound channels and perform a visual situational reconstruction of the mechanism of gunshot injuries, which is quite important for surgical intervention and prognosis in the treatment of the patient.

164

K. Kolisnyk et al.

7. Mathematical and graphic modelling of the process of projectile interaction with an obstacle and mathematical and statistical analysis of a gunshot wound are modern methods of analysis that allow you to reproduce the processes that occur when a fragment collides with an obstacle (the patient’s body). The mathematical model is generally based on the laws of conservation of mass, momentum and energy, the equation of state of matter, the model of stress-strain states of materials. The numerical model is based on the approximation of the basic conservation laws by Euler’s explicit equations. Interacting bodies are considered as a collection of particles that have certain physical and mechanical properties. This model was named the method of smoothed particles - SPH (Smoothed Particle Hydrodynamics). It is widely used for intensive dynamic loading of bodies, when there is a significant change in the topology of the modelled objects. But for now, this question has been worked out enough for rigid bodies, and the use of this method for predicting the condition of a patient with a gunshot wound is quite limited [9]. Mathematical and statistical analysis of gunshot injury is generally based on the results of previously conducted diagnostic, identification and classification studies, that is, it has an integrative nature. There are studies that determine the possibility of causing injuries in a particular situation, optimal mathematical methods of qualitative and quantitative assessment of the signs of gunshot injuries to objectify the conclusions of the condition and state of the injury in relation to external factors [9]. But these studies are quite limited in terms of the possibility of predicting the recovery process when using certain methods of treatment. The authors propose further development of the method of statistical analysis and mathematical modelling of medical and biological processes by establishing the dependence of dynamic changes of biomedical indicators in conditions of randomness of the levels of influencing factors obtained during the primary investigation of patients with gunshot wounds [10–12].

4 The Use of Multivariate Statistical Analysis of Biomedical Indicators for Improving Technology of Accelerated Rehabilitation of Patients For further development of the method using mathematical and statistical analysis and computer modelling, the authors propose a new approach based on a multivariate analysis of dynamic changes in biomedical indicators under conditions of randomness of the levels of influencing factors [13, 14]. This approach presupposes the use of random models for the study of the factor effects of striking fragments on the dynamics of changes in biomedical indicators. As one of these models, it is possible to use the statistical model of variance components, which allows you to adjust the sensitivity of the statistical analysis method, simultaneously setting the risks of the first and second kind and additionally taking into account the minimum number of experimental subgroups. Moreover, the basic feature of the studied objects is that from the point of view of mathematical statistics, they are considered as diffuse objects.

Mathematical Modelling of the Multifactorial Influence

165

This means that it is impossible to completely solve the task, but a significant reduction in rehabilitation time is permissible. In addition, the research objects are considered as multi-level, and the functional relationship between the levels is selected based on multiple regression models, in which the number of regressors is random. Previous studies conducted to model the effect of shrapnel injuries on rehabilitation processes in animals have provided evidence that the rehabilitation time depends not only on the size of the wound, but also on the temperature of the shrapnel and other biophysical factors [15–17]. Moreover, random changes in the results of biomedical measurements were also dependent on the temperatures of the fragments. The preliminary multivariate statistical analysis made it possible to obtain important information that indicated the possibility of planning medical technologies for the rehabilitation of animals taking into account the physical parameters of fragments: temperature, dynamic characteristics, weight of fragments. The results of preliminary tests on animals, which were conducted to assess the possibility of modelling the impact of shrapnel wounds on the rehabilitation processes of animals during their treatment, showed a significant (up to 20%) increase in rehabilitation efficiency. This makes it possible to predict the possibility of increasing the use of these methods to improve the treatment and rehabilitation of patients with shrapnel injuries. In addition, previous studies have proven that biomedical indicators can be divided into three groups according to the degree of influence on them - separately temperature, time and the interaction between temperature and time. This means that it is desirable to use appropriate groups of indicators to control the levels of factors A and B. In addition, the possibility of dividing biomedical indicators into informative and uninformative ones regarding the dynamics of wound healing over time was quantitatively substantiated. This allows you to create tables of decreasing informativeness (by linear correlation coefficient over time) for all selected indicators ranked by informativeness. Conducting a multiple correlation analysis of the obtained experimental information proved that the informativeness of the system of indicators reaches a maximum at specific values of the number of these indicators. It is for the latter that the informativeness of the system is maximum. The result of research shows that each level of factor A (fragment temperature) corresponds to its own system of informative indicators, the informational properties of which are determined not only by temperature, but also by observation time. Although these systems (for the studied temperatures) partially overlap, it should be noted that when choosing biomedical indicators, it is desirable to know the degree of severity of the influencing factor (in this case, the temperature of the fragment). The task of assessing the potential level of such a factor requires additional research [18–20]. An example of assessing the independence of the amount of information from the dimensions of the space of biomedical indicators shown in Fig. 2. It is clearly visible from the example that when the level of the determined value of the p indicators is reached, the informativeness decreases. Also, this dependence changes with changes in other significant indicators - for example, temperature. In order to create a multiple regression model, the following analytical approach was used for the information analysis of the indicator system for the models. Any system of biomedical indicators that is used in an experiment with limitations on the amount of such

166

K. Kolisnyk et al.

Fig. 2. An example of estimating the amount of dependence of the amount of information on the dimension of the space of biomedical indicators

information can be considered as a system with increased information uncertainty. Since the information components of such a system are based on one-dimensional regressions, the latter can be considered as regressions with random variables. Let us first classify the models of such basic one-dimensional regressions, which are ranked by the degree of information uncertainty increase. Let the evaluation of the controlled parameter Y (the studied biomedical indicator) be based on the results of measuring x 1 ,…x p values of the controlled values X1,…Xp with the subsequent functional transformation of these values into the Y* estimate. This procedure corresponds to the indirect measurement model, where X1,…Xp are arguments or variables, and the transformation model is selected based on the measurement method (indirect, cumulative, etc.). We will use the method of indirect measurement to select a measurement transformation model, for which such a model has the form: Y = F(X1 , ...Xm ),

(2)

where: m – the number of input physical quantities that can be directly measured. In the absence of information about the type of physical model for choosing a functional relationship, such a relationship is assumed to be stochastic, for which model (3) can be formally written in the form of a multiple linear regression with random regressors [19, 20]: Y = β0 + β1 u1 + ... + βp−1 up−1 + ε,

(3)

where: β0 , ...βp−1 – coefficients of the model; u0 , ...up−1 – random repressors; ε – random residue, p – the number of model parameters. Several variants of the models were considered, and their adequacy was assessed. The obtained results showed the effectiveness of the chosen direction of research. To continue research with the aim of developing new technologies for accelerated rehabilitation of injured people, the following algorithm was proposed: 1. To conduct a multivariate regression analysis of biomedical indicators that can be measured during the initial examination of the wounded, taking into account their changes during treatment;

Mathematical Modelling of the Multifactorial Influence

167

2. To carry out a statistical ranking of these biomedical indicators according to their informativeness in relation to the rehabilitation time and the level of influencing physical factors of striking fragments; 3. To improve the mathematical models of statistical evaluation of the amount of information regarding the dynamic properties of each biomedical indicator, depending on the level of the studied factor influence characterizing the selected physical characteristic of the fragment; 4. Develop and research a statistical optimization method taking into account the volume of the number of measurements and the number of biomedical indicators; 5. To develop a method of discriminant analysis to recognize (estimate) the levels of the studied factor influence, which characterizes the physical characteristics and dynamics of fragments; 6. Develop statistically based assessments of the reliability and risks of decision-making, which are made in the course of discriminant analysis as a result of multivariate measurements; 7. Develop a strategy for optimizing the indicators of the computerized system of information support for the technology of accelerated rehabilitation of the wounded. As a result of this work, it is supposed to develop a qualitatively new technology for the rehabilitation of patients with gunshot penetrating wounds.

5 Conclusions Thus, the preliminary analysis showed that the application of the technology of mathematical modelling of the multifactorial impact of impact fragments on the dynamics of rehabilitation processes, followed by their adaptation to the process of treatment and rehabilitation of the wounded, will allow one to significantly increase the effectiveness of the relevant medical technologies. Taking into account the fact that currently there are no analogues of such technology in world science, theoretical research can be the basis for further improvement of the means of obtaining additional information on the condition of patients with shrapnel wounds, increasing the effectiveness of their treatment and rehabilitation methods. The proposed technology is faster, economically feasible, does not depend on the type of injury, and allows one to significantly increase the efficiency of the rehabilitation process by increasing the accuracy and reliability of obtaining biomedical information.

Conflict of Interest. The authors declare that they have no conflict of interest.

References 1. Abdurrahman, B., Cüneyt, T., Sukru, U., Varol, A.N., Fuat, T.: High-velocity gunshot wounds to the head: analysis of 135 patients. Neurol. Med. Chir. (Tokyo) 45, 281–287 (2005). https:// doi.org/10.2176/nmc.45.281 2. Lysenko, M.V., Nikolenko, V.K., Shaplygin, L.V., et al.: Military Field Surgery: Hands to Practice Occupations. Media, Moscow (2010). (Russian)

168

K. Kolisnyk et al.

3. Boyko, V.V., Zamyatyn, P.N., Sokol, E.I., Shchapov, P.F., Kolisnyk, K.V.: A comprehensive approach to diagnosis and primary therapy of victims and emergency situations using telemonitoring. Modern problems of dermatovenerology, cosmetology and health care management. Collection of Scientific Papers Issue 15, pp. 14–20, Oberig, Kharkiv (2018). (Ukrainian). https://surgical-school.com.ua/index.php/journal/article/view/9 4. How to properly photograph bullets in flight. Report from the master classes of the Rochester Institute of Technology. (Russian). https://fotogora.ru/kak-pravilno-fotografirovat-puli-v-pol ete-reportazh/ 5. Makarov, I.Yu.: Forensic medical examination of gunshot trauma: methodological recommendations. RCSME (2011). (Russian) 6. Viter, V.I., Proshutin, V.L., Vavilov, A.Yu: Forensic medical examination of a gunshot injury: teaching aid. Izhevsk State Medical Academy Izhevsk (2009). (Russian) 7. Popov, V.L., Shigeev, V.B., Kuznetsov, L.E.: Forensic ballistics. Gippokrat, SPb (2002). (Russian) 8. Pashkova, V.I., Tomilin, V.V.: Laboratory and Special Research Methods in Forensic Medicine. Medicine, Moscow (1975). (Russian) 9. Lipanov, A.M., Vahrushev, A.V., Fedotov, A.Yu.: Investigation of dynamic interaction of rigid bodies by methods of mathematical modeling. Bull. SUSU. Ser. Math. Model. Program. 8(1), 53–65 (2015). (Russian). https://doi.org/10.14529/mmp150104 10. Kolisnyk, K., Kartashov, V., Tomashevskyi, R., Koval, S., Zamiatin, P.: The use of drones to improve the efficiency of using telemedicine systems in emergencies. In: IEEE 3rd KhPI Week on Advanced Technology (KhPI Week 2022) Conference Proceedings, pp. 610–615, Kharkiv, Ukraine (2022). https://doi.org/10.1109/KhPIWeek57572.2022.9916362 11. Sokol, Avrunin, O., Kolisnyk, K., Zamiatin, P.: Using medical imaging in disaster medicine. In: IEEE 4th International Conference on Intelligent Energy and Power. Conference Proceedings, pp. 287–290, Istanbul, Turkey (2020). https://doi.org/10.1109/IEPS51250.2020.9263175 12. Boyko, V.V., et al.: Quantum effects of electric potential hysteresis in biological macro objects. In: The International Society for Optical Engineering. Proceedings of SPIE: V10808, Photonics Applications in Astronomy, Communications, Industry, and High-Energy Physics Experiments, Wilga, Poland (2018). https://www.scopus.com/record/display.uri?eid=2-s2. 0-85056264947&origin=resultslist&sort=plf-f&src=s&sid=384e0161d40b52cfe1e2f17f348 0a7eb&sot=autdocs&sdt=autdocs&sl=18&s=AU13. Sokol, Y., Avrunin, O., Kolisnyk, K., Zamiatin, P.: Using medical imaging in disaster medicine. In: IEEE 4th International Conference on Intelligent Energy and Power Systems, (IEPS 2020), Conference Proceedings, pp. 287–290, Kharkiv, Ukraine (2020). https://doi.org/10.1109/IEP S51250.2020.9263175 14. Sokol, Y.I., Boyko, V.V., Shchapov, P.F., Zamyatin, P.M., Tomashevskiy, R.S.: Information analysis of random measuring signals in dynamically active biophysical experiments. Bull. NTU “KhPI” Ser. New Solution Mod. Technol. 25, 80–86 (2016). (Russian). NTU “KhPI”, Kharkov, Ukraine 15. Shchapov, P.F., Avrunin, O.G.: Improving the Reliability of Monitoring and Diagnostics of Objects Under Uncertainty. KhNARU, Kharkov (2011). (Russian) 16. Steinle, A.V., Alyabiev, F.V., et al.: Methodology for modeling gunshot wounds of extremities (2008). https://cyberleninka.ru/article/n/metodologiya-modelirovaniya-ognestrelnyh-ran eniy-konechnostey 17. Ozeretskovsky, L.B., Trukhan, A.P.: Principles of Modeling Combat Surgical Trauma in an Experiment on Laboratory Animals, vol. 1, pp. 111–113. Military medicine BSMU, Belarus (2013). http://rep.bsmu.by/handle/BSMU/2320 18. Armstrong, J.S.: Illusions in regression analysis. Int. J. Forecast. 28(3), 689–692 (2012). https://www.researchgate.net/publication/228194929_Illusions_in_Regression_Analysis

Mathematical Modelling of the Multifactorial Influence

169

19. Tomashevsky, R.S.: Information analysis of models for planning a medical and biological experiment in the control of discrete changes in the levels of the influencing factor. Bull. NTU “KhPI” Ser. New Solutions Mod. Technol. 53, 45–52 (2017). NTU “KhPI”, Kharkov, Ukraine, https://doi.org/10.20998/2413-4295.2017.53.07 20. Seber, J.: Linear Regression Analysis. Eng. Trans. Ed. Mir, Moscow (1980). (Russian)

NLP Tools for Epileptic Seizure Prediction Using EEG Data: A Comparative Study of Three ML Models Victor Iapascurta1,2(B)

and Ion Fiodorov1

1 Department of Software Engineering and Automation, Technical University of Moldova,

Chisin˘au, Moldova [email protected] 2 Department of Anesthesia and Intensive Care, N. Testemitanu State University of Medicine and Pharmacy, Chisin˘au, Moldova

Abstract. Natural Language Processing (NLP) is an ever-evolving field of computer science that involves the development of algorithms that can process, analyze and understand human language. One of the most exciting areas of NLP is the creation of NLP language models with applications across almost every industry. However, most people only associate NLP with its traditional use in language translation, sentiment analysis, and chatbots. In reality, there are many less-common uses for NLP models that have the potential to transform businesses, improve customer experiences, and even save lives. In the healthcare industry, NLP models can be used to analyze unstructured medical data and help diagnose and treat patients more efficiently. For example, NLP can be used to analyze clinical notes, lab results, and other data combing through vast amounts of data to identify patterns and create targeted treatment plans. NLP-based medical diagnosis is still in its infancy, but it has the potential to revolutionize the healthcare industry in the coming years. This article explores a less common use of machine-learning language models built on transformed EEG data for epilepsy prediction using the Kolmogorov-Chaitin algorithmic complexity as the first step in generating text-like data, which are finally used for building machine learning models. Keywords: Natural Language Processing · Machine Learning · Algorithmic Complexity · Epileptic Seizure Prediction

1 Introduction Natural Language Processing (NLP) models refer to the set of algorithms and related tools that can understand human languages’ structure, context, and meaning. These models are built based on statistical methods and improved with data, allowing them to process a wide range of language inputs automatically [1, 2]. They can even detect nuances and subtleties in language structures and tones that are usually hard for humans to detect or analyze. NLP is a rapidly growing field, with applications across almost every industry. © The Author(s), under exclusive license to Springer Nature Switzerland AG 2024 V. Sontea et al. (Eds.): ICNBME 2023, IFMBE Proceedings 92, pp. 170–180, 2024. https://doi.org/10.1007/978-3-031-42782-4_19

NLP Tools for Epileptic Seizure Prediction Using EEG Data

171

However, most people only associate NLP with its traditional use in sentiment analysis and chatbots. In reality, there are many less-common uses for NLP models that have the potential to transform businesses, improve customer experiences, and even save lives [3]. With the help of NLP, healthcare providers can now extract vital insights from vast volumes of unstructured patient data to improve medical care and outcomes. While NLP has been primarily used in medical fields for analyzing electronic health records (EHRs) [4] and clinical decision support systems (CDSS) [5], there are various underexplored potential applications of NLP that can significantly revolutionize healthcare delivery. A brief and far from exhaustive overview of the main areas for NLP uses for diagnostic purposes in medicine would include: 1.1 NLP Applications for Diagnosis, Decision Support, and Data Analysis Electronic Health Records refer to medical records of patients that typically contain both structured and unstructured data. NLP can analyze and extract the unstructured component of medical records, which is usually the most significant source of data. Using natural language processing algorithms, healthcare providers can quickly extract and build clinical intelligence from patient records. Clinical Decision Support Systems (CDSS) comprise clinical knowledge and patient data to assist healthcare providers in making timely and informed decisions. NLP techniques have been used to analyze and extract essential data and information. Also, it can suggest treatment plans for patients using evidence-based medicine research. In Patient-Generated Data Analysis the data obtained from patients may sometimes be difficult to understand, but the use of NLP can help in analyzing these data and highlighting areas of interest. NLP applications in diagnosis can also help to identify possible medical conditions that may not be immediately evident [6]. Using Digital Health Applications patients can be monitored remotely through sensors and medical devices, which generate large amounts of data daily. NLP algorithms can effectively analyze and extract significant insights and patterns from these data. Hence, making it easier for clinicians to make informed decisions and capitalize on early-stage symptomatic detection [7]. 1.2 NLP Applications in Epilepsy One of the most prevalent neurologic conditions that affects people of all ages globally is epilepsy [8]. Unprovoked and repeated seizures are the hallmark of this condition. Seizures are defined as the temporary disruption of regular electrical brain activity accompanied by brief changes in neurologic control brought on by abnormal electrical neuron firing. Although medications and brain operations are used to treat seizures, some individuals still experience medically untreatable seizures that have a significant negative impact on their quality of life. Researchers have been studying automated seizure identification from EEG data since the 1970s [9]. Models are created to distinguish between brain signal patterns and epileptic seizure patterns. Seizure predicting models are typically constructed in

172

V. Iapascurta and I. Fiodorov

two steps: feature engineering and classification of the preictal/interictal data (signals occurring before seizures and in between seizures). According to a systematic review article from 2022 [10], NLP is being used more frequently in epilepsy studies for patient identification, risk stratification, and forecasting. NLP makes it possible to quickly, broadly, and accurately derive data from texts pertaining to epilepsy in order to identify patients for diagnosis and treatment, create epidemiological cohorts, look at patient viewpoints, and evaluate research publications. From a different perspective, ML is used for seizure prediction mainly through “nontextual” features. (e.g., EEG signal data). It would be interesting to combine these two approaches by applying NLP tools to transformed EEG data. In this article, we will discuss the unique potential of applying NLP in underexplored areas of medical data analysis and diagnostics, namely epileptic seizure prediction. The final goal of the current research is the identification of the most suitable NLP models to be subsequently used for the creation of an ML-based system for epileptic seizure prediction.

2 Language Models Used in this Research 2.1 Word2Vec Model Word2Vec is a deep learning-based technique for generating word embeddings [11, 12]. Word embeddings represent words in a dense, high-dimensional vector space allowing for clustering and similarity calculations. It’s a key technique in natural language processing, and it has gained popularity because of its ability to capture semantic and syntactic relationships between words. There are two types of word embeddings: count-based and prediction-based. Countbased methods rely on the frequency of the words in the corpus, while prediction-based methods use neural networks to predict the context of a word using its surrounding words. There are two models in Word2Vec: Continuous Bag-of-Words (CBOW) and SkipGram. In CBOW, the model tries to predict a word given its surrounding words, while in Skip-gram, the model tries to predict surrounding words given one word. The intuition behind these models is that similar words will have similar contexts. The training process includes feeding a large corpus of text to the model, where it learns to predict the surrounding words for each word in the corpus. The model does this by minimizing a loss function using backpropagation. These models improved both, the accuracy of the word vector and the training speed. Both CBOW model and Skip-gram model include the input layer, the projection layer and the output layer. CBOW model predicts target words based on context distribution. For the word wk , the context is expressed as follows:   context(wk ) = wk−t , wk−(t−1) , . . . , wk+(t−1) , wk+t . (1) On the contrary, the Skip-gram model predicts the context based on the target word wk .

NLP Tools for Epileptic Seizure Prediction Using EEG Data

173

The mathematical formalism behind the Word2Vec model can be expressed as follows:  maximize (w, k) ∈ D log P(k|w ), (2) where D is the set of all word-context pairs in the training data, w is the target word, and k is a context word. P(k|w) is the probability of observing the context word k given the target word w. For the Skip-Gram model this probability is calculated using the softmax function as follows:    (3) P(k|w ) = exp(vk · vw )/ exp v{k  } · vw , {k  ∈ V}

where vw and vk are the vector representations of the target word w and the context word k, respectively. V is the vocabulary of all words in the training data. For the CBOW model the probability is calculated as follows:    (4) P(w|k ) = exp(vw · vk )/ exp v{w } · vk , {w ∈ V}

where vw and vk are the vector representations of the target word w and the context word k, respectively. V is the vocabulary of all words in the training data. 2.2 BiLSTM Model At its core, a language model is a system that can assign a probability to a sequence of words in a language. Traditional language models are designed to process text in a linear fashion, meaning that they assign a probability to a word based on the previous word in the sequence. On the other hand, BiLSTM-based language models [13] are built on LSTM networks, which are designed to maintain information from earlier inputs. This allows BiLSTM-based models to look at both the past and future words in a sequence, resulting in a more accurate understanding of the language. LSTM networks, or Long Short-Term Memory networks, can process sequences of input data by selectively forgetting, remembering, or outputting information. BiLSTMs utilize two LSTM networks, one processing the sequence from beginning to end and the other processing the sequence from end to beginning. The final output is then produced by merging the outputs of the two LSTM networks. The forward LSTM can be represented using matrix operations as follows: −Input gate : it = σ (Wi ∗ xt + Ui ∗ ht−1 + bi )

(5)

  −Forget gate : ft = σ Wf ∗ xt + Uf ∗ ht−1 + bf

(6)

−Output gate : ot = σ (Wo ∗ xt + Uo ∗ ht−1 + bo )

(7)

174

V. Iapascurta and I. Fiodorov

−Candidate state : gt = tanh(Wc ∗ xt + Uc ∗ ht−1 + bc )

(8)

−Memorycell state : ct = ft ∗ ct−1 + it ∗ gt

(9)

−Hidden state : ht = ot ∗ tanh(ct ), where xt is the input vector at time step t; ht−1 is the hidden state vector of the previous time step; it , ft , ot , and gt are the input, forget, output, and candidate state vectors, respectively; Wi , Wf , Wo , and Wc are the weight matrices for the input, forget, output, and candidate state vectors, respectively; Ui , Uf , Uo , and Uc are the weight matrices for the input, forget, output, and candidate state vectors, respectively, for the previous hidden state vector ht−1 ; bi , bf , bo , and bc are the bias vectors for the input, forget, output, and candidate state vectors, respectively. The backward LSTM can be represented using the same formalism and the state vector ht+1 . 2.3 BERT Model BERT Language Model, short for Bidirectional Encoder Representations from Transformers [14], has taken the domain of Natural Language Processing (NLP) by storm in recent years. Bert leverages the use of neural network models and pre-training techniques to improve the computational linguistics capabilities of NLP. At its base, the Bert Language Model is a bidirectional natural language processing model. In other words, it is a model that has the ability to read text both forwards and backward. This is a significant advancement over traditional natural language processing models, which are typically only able to read left to right. Bert Language Model is developed using the architecture of transformers, which are deep learning models that incorporate selfattention mechanisms. This allows the model to efficiently read and comprehend long text sequences, and gain a better understanding of the contextual relationship between words and phrases. BERT works in two stages. In the first stage, pre-training, the model is exposed to what one might call the “rough draft” of language, a massive amount of textual data. Pre-training enables the model to learn the patterns and structures that are present in natural languages. In the second stage, fine-tuning, the Bert model is pre-trained on the specific problem or task it is going to be used for. By fine-tuning, the model is capable of adapting to different language nuances and characteristics.

3 Materials and Methods 3.1 Data The data used in this research represent EEG signals recordings coming from a public access database [15].

NLP Tools for Epileptic Seizure Prediction Using EEG Data

175

Five canines with naturally occurring epilepsy and two persons undergoing iEEG monitoring had their intracranial EEGs (iEEG) recorded. For canine animals, the iEEG signal was taken from 16 electrodes at 400 Hz and 5000 Hz for humans. The total number of subgroups in the original data set is 8012, and each one represents a ten-minute multichannel EEG recording clip. Out of these, 3935 sets make up the test set, while 4077 sets are used for the training set (3766 as interictal and 311 as preictal segments). 128 and 345 subgroups (used for training and testing, respectively) make up the human part. Although all subsets had been analyzed to a certain extent, data from dog 1 and dog 2 were used for a more detailed study. These sets were used to build the machine learning systems. 3.2 Data Preprocessing There are various data processing techniques that can be used to preprocess the EEG data before delivering it to a ML module. In this study, we use a variety of preprocessing methods, such as the Block Decomposition Method (BDM), a novel approach from the field of Algorithmic Information Dynamics, a new kind of discrete calculus based on computer programming, to study causation by developing mechanistic models to help uncover the underlying principles of physical phenomena and develop the next generation of machine learning [16]. On the original EEG clips the Kolmogorov-Chaitin algorithmic complexity through BDM is computed, generating univariate time series of algorithmic complexity over time (AC time series) for a respective EEG clip. Further processing steps include converting algorithmic complexity values in the AC time series to letters/words. This results in text-like files, which can be fed to NLP algorithms. As stated above data preprocessing starts with estimation of algorithmic complexity of the EEG data over time. The notion of algorithmic complexity (also known as Kolmogorov-Chaitin or program-size complexity; Kolmogorov, 1965; Chaitin, 1969) is crucial in this context [16]: KT (s) = min{|p|, T (p) = s},

(11)

that is, the smallest program p that executes on a general Turing computer T and produces the string s. Estimations are performed using an online algorithmic complexity calculator (OACC). The OACC employs the BDM approach, a coding theorem-based algorithmic probability definition (CTM) [16, 17]: BDM =

n 

CTM (blocki ) + log2 (|blocki |).

(12)

i=1

In the original data, each file (subset) describes the fluctuations in the EEG signal voltage for “n channels” over the course of 10 min. Based on the original data converted to “.csv” format a matrix is created with rows denoting observations of EEG signal

176

V. Iapascurta and I. Fiodorov

fluctuation over time corresponding to specific channels and columns representing “n channels/electrodes”. These matrices are binarized using the mean value per row. Every such matrix’s AC value is calculated using AC values grouped along a time axis to produce time series that show the AC value’s evolution over space and time. Figure 1 shows a sample of the result.

Fig. 1. Time-series-like AC (by BDM) value over time for a 10-min EEG clip

As the next step numbers representing AC values, after rounding were converted to letters (more details on this conversion are available in [18]). In this way, there are generated text files where ordered words represent algorithmic complexity and a collection of text files (or documents) is generated. Every text file representing an original EEG clip has up to 15000 words. Further processing steps consist of preparing the text to be accepted by NLP algorithms/models to be used. The format of the data depends on the type of the model. Irrespective of the format, the set is also split into a subset for word embedding, a subset for training a classifier or fine tuning and the test subset. For example, one of the dogs’ data sets (i.e., dog 2) contains 14070000 words in the word embedding portion, over 6.5 million words for training a classifier and over 1 million words in the test set. Since the “brain complexity language” (representing the algorithmic complexity of the brain over time) is close to a synthetic one it was not possible to use any of the pretrained models available in this field. For example, while experimenting with this approach several BERT models were built from scratch using data described previously. The BERT model used for this research accepts shorter sentence lengths ( (2K)−1 for all k, k  ∈ {1, . . . , K} and k = k  . While for the second order approximation we get: −1 1 + wk − wk 2 + 12 wk − wk 4 , K  −1  1 + wp − wc 2 + 12 wk − wk 4 

Akk =

(14)

c=1,c=k

for k = k  and Akk = 0 for all k, ∈ {1, . . . , K}. We note that for the second order approximation we have Akk > (2K)−2 for all k, k  ∈ {1, . . . , K} and k = k  . As

Unsupervised Knowledge Extraction from Biomedical Data

249

already mentioned by approximating the exponential by the first order or higher order approximation allows to avoid all the points with probabilities close to zero resulting in the reduction of the computational time per operation. In order to compute the Laplacian of the matrix A we first define the diagonal matrix D as follows: Dkk =

M 

Akm , and Dkk = 0, for k  = k.

(15)

m=1

Applying traditional clustering methods on high dimensional datasets can be very challenging. In order to take into account the topological structure of our data we compute the neighbourhood matrix H in the step 1 of our algorithm. In the step 3 a new affinity matrix is computed as the product between the matrix H and the distance probability symmetric matrix defined in Eq. (12). Therefore the new affinity matrix contains both sources of information: the topological one and the spectral one.

Algorithm 1: Spectral clustering based on higher order approximation of Stochastic Neighbor Embedding Input: N data points x1 , x2 , . . . , xN ∈ RM ; Cluster number K ; Output: K clusters; 1. 2. 3. 4. 5. 6.

5

Construct the affinity matrix as in Eq. (12) Define D as in Eq. (15). Find u1 , u2 , . . . , uK , the K largest eigenvectors of L = D−1/2 SD−1/2 . Form the matrix U = [u1 , u2 , . . . , uK ] ∈ RN ×K Compute Y the ortonormalized version of U . Cluster each Y vector into K clusters via K-means algorithm.

Experimental Protocol

In order to evaluate our method, we performed several experiments on four known datasets from the UCI:2007 Repository of machine learning databases [2] and on Growth weight dataset (GWD) introduced in [22]. These datasets are of different size and complexity and the characteristics are summarized in Table below: Dataset nb. obs. nb. features nb. classes WDBC 569

32

2

GWD

5

3

126

250

5.1

B. Matei et al.

Description of Datasets

– Wisconsin Diagnostic Breast Cancer (WDBC): here we have 569 observations with 32 features (ID, diagnosis, 30 real-valued input features). Each observation is labelled as benign (357) or malignant (212). Features are computed from a digitized image of a fine needle aspirate (FNA) of a breast mass. They describe characteristics of the cell nuclei present in the image. – Growth weight data (GWD): This real data set introduced in [22] describe the effect of dietary orange and grapefruit peel supplements on growth performance, health status, meat quality and intestinal microflora of broiler chickens. The matrix data set contains 126 individual chickens regrouped on the row following three different diets, the control diet and two experimental diets obtained by supplementing with orange and grapefruit peel the control diet. In the columns we have for each chicken the weight value measured at 7 days interval from 14 days to 42 days of chickens life. Then this data set is described by a matrix in 126 × 5 dimension.

Fig. 1. (a) PCA and (b) t-SNE visualization of the GWD dataset

5.2

Quality Indexes

When the data-sets represent the same objects in different space the indexes are usually based on the agreement between the two partitions, i.e. each pair of object should be either in the same cluster in both partitions or in different clusters in both partitions. For each dataset and experience we computed the external clustering validation indexes as the real class information is available for all of them, and we compared also the computational time between the classical spectral clustering and the proposed method. Evaluating the performance of a clustering algorithm is not as trivial as counting the number of errors or the precision and recall of a supervised classification algorithm. To evaluate the quality of clustering, we adopt the approach

Unsupervised Knowledge Extraction from Biomedical Data

251

of comparing the results to a “ground truth”. We use the clustering accuracy, the Rand index and Jaccard index for measuring the clustering results. This is a common approach in the general area of data clustering. In general, the result of clustering is usually assessed on the basis of some external knowledge about how clusters should be structured. This procedure is defined by [7] as “validating clustering by extrinsic classification”, and has been followed in many other studies [1,8,10]. We feel that this approach is reasonable one if we don’t want to judge clustering results by some cluster validity index, which is nothing but a bias toward some preferred cluster property (e.g., compact, or well separated, or connected). In this work we consider the purity (accuracy) index, Rand index and Jaccard index for validation. In order to recall the definitions of these indexes let us consider set of n objects S, let U and V be two different partitions of S. Suppose that U is our external criterion (e.g. the set of labels) and V is the clustering result, we define the following: – a, the number of pairs of objects that are placed in the same class in U and in the same cluster in V ; – b, the number of pairs of objects in the same class in U but not in the same cluster in V ; – c, the number of pairs of objects in the same class in V but different in U ; – d, the number of pairs of objects in different classes and different clusters in both partitions. Purity Index. The purity index produces a result in the range [0, 1], where a value of 1 indicates that U and V are identical. The purity of a cluster is the percentage of data belonging to the majority class. Assuming that the set of clusters is V = v1 , v2 , ..., v|V | and the labels set is U = u1 , u2 , ..., u|L| , the formula that expresses the purity is the following: purity(U, V ) =

1  max |vi ∩ uj |. N i j

Rand Index. The Rand index or Rand measure introduced in [15] is a measure of the similarity between two data clusters. The both, a + b can be considered as agreements between U and V, and c + d as the number of disagreements between these two partitions. Therefore the Rand index [15] is computed by the following formula: R(U, V ) =

a+b ; a+b+c+d

(16)

The Rand index has a value between 0 and 1, with 0 indicating that the two data clusters do not agree on any pair of points and 1 indicating that the data clusters are exactly the same. However, this index does not take into account the fact that the agreement between partitions could arise by chance alone. This could greatly bias the results for higher values of concordance [6].

252

B. Matei et al.

Jaccard Index. In the Jaccard index which has been commonly applied to assess the similarity between different partitions of the same dataset, the level of agreement between a set of class labels U and a clustering result V is determined by the number of pairs of points assigned to the same cluster in both partitions. The Jaccard index is defined by the following formula: a (17) J(U, V ) = a+b+c This is simply the number of unique elements common to both sets divided by the total number of unique elements in both sets. The Jaccard index takes on a value between 0 and 1. An index of 1 means that the two dataset are identical, and an index of 0 indicates that the datasets have no common elements. Table 1. Experimental results for K-means, Spectral Clustering and proposed approaches Dataset

Accuracy Rand

Jaccard

Wdbc

K-means spectral 1st order proposed 2nd order proposed 5th order proposed

83.4130 85.1327 85.1620 86.0230 87.3011

0.7104 0.7689 0.7710 0.8012 0.8102

0.5499 0.6178 0.6146 0.6456 0.6568

GWD

K-means spectral 1st order proposed 2nd order proposed 5th order proposed

81.3140 85.0516 85.8430 86.0731 87.1316

0.7539 0.9170 0.9413 0.9534 0.9614

0.6566 0.8123 0.8137 0.8242 0.8352

The Table 1 summarize the obtained results for the four datasets by applying the classical K-means, the spectral clustering and the proposed method for spectral clustering by using the first and the second order approximation of the exponential. We can note that our method outperforms the classical K-means and the spectral clustering, but we have to note here that the goal is also to preserve the topological structure of the data for visualization. We note also the order of the approximation plays a key role, since by using higher order approximation the results are improved. Thanks to the t-SNE method the 3 classes of the GWD dataset are well separated as it can be seen in the Fig. 1, compared to the use of the PCA (Principal Component Analysis) in Fig. 1. We notice that the topological structure of the data is preserved, by using t-SNE.

6

Conclusions

In this study we proposed a study on the use of the unsupervised representation learning on biomedical data i.e. on Growth weight data and Wisconsin Diagnostic

Unsupervised Knowledge Extraction from Biomedical Data

253

Breast Cancer obtaining good performances in terms of clustering. In this study we proposed a new spectral unsupervised learning model which allows to cluster a large dataset by preserving the local structure of the data. The proposed method use the t-SNE model to reduce the dimensionality. The obtained results show that the proposed method improves the clustering results in term of external indexes. As future work we consider to adapt this method for multi-view datasets.

References 1. Andreopoulos, B., An, A., Wang, X.: Bi-level clustering of mixed categorical and numerical biomedical data. Int. J. Data Min. Bioinform. 1(1), 19–56 (2006) 2. Asuncion, A., Newman, D.J.: UCI Machine Learning Repository (2007) 3. Belkin, M., Niyogi, P.: Laplacian eigenmaps for dimensionality reduction and data representation. Neural Comput. 15(6), 1373–1396 (2003) 4. Cieslak, M.C., Castelfranco, A.M., Roncalli, V., Lenz, P.H., Hartline, D.K.: tDistributed stochastic neighbor embedding (t-SNE): a tool for eco-physiological transcriptomic analysis. Mar. Genomics 51, 100–123 (2020) 5. Hinton, G., Roweis, S.: Stochastic neighbor embedding. Adv. Neural. Inf. Process. Syst. 15, 833–840 (2003) 6. Hubert, L., Arabie, P.: Comparing partitions. J. Classif. 2(1), 193–218 (1985) 7. Jain, A.K., Dubes, R.C.: Algorithms for Clustering Data. Prentice-Hall, Inc., Upper Saddle River (1988) 8. Jain, A.K., Murty, M.N., Flynn, P.J.: Data clustering: a review. ACM Comput. Surv. 31(3), 264–323 (1999) 9. Johnson, N.L., Kotz, S., Balakrishnan, N.: Distributions in Statistics: Continuous Univariate Distributions, 2nd edn. Wiley, New York (1999) 10. Khan, S.S., Kant, S.: Computation of initial modes for K-modes clustering algorithm using evidence accumulation. In: IJCAI, pp. 2784–2789 (2007) 11. Kitazono, J., Grozavu, N., Rogovschi, N., Omori, T., Ozawa, S.: t-Distributed stochastic neighbor embedding with inhomogeneous degrees of freedom. In: Hirose, A., Ozawa, S., Doya, K., Ikeda, K., Lee, M., Liu, D. (eds.) ICONIP 2016. LNCS, vol. 9949, pp. 119–128. Springer, Cham (2016). https://doi.org/10.1007/978-3-31946675-0 14 12. Lafon, S., Lee, A.B.: Diffusion maps and coarse-graining: a unified framework for dimensionality reduction, graph partitioning, and data set parameterization. IEEE Trans. Pattern Anal. Mach. Intell. 28(9), 1393–1403 (2006) 13. Li, B., de Moor, B.: A corrected normal approximation for student’s t distribution. Comput. Stat. Data Anal. 29, 213–216 (1999) 14. Platzer, A.: Visualization of SNPs with t-SNE. PLOS ONE 8(2), 1–6 (2013) 15. Rand, W.M.: Objective criteria for the evaluation of clustering methods. J. Am. Stat. Assoc. 66, 846–850 (1971) 16. Rogovschi, N., Kitazono, J., Grozavu, N., Omori, T., Ozawa, S.: t-Distributed stochastic neighbor embedding spectral clustering. In: 2017 International Joint Conference on Neural Networks, IJCNN 2017, Anchorage, AK, USA, 14–19 May 2017, pp. 1628–1632. IEEE (2017) 17. Roweis, S.T., Saul, L.K.: Nonlinear dimensionality reduction by locally linear embedding. Science 290(5500), 2323–2326 (2000) 18. Tenenbaum, J.B., De Silva, V., Langford, J.C.: A global geometric framework for nonlinear dimensionality reduction. Science 290(5500), 2319–2323 (2000)

254

B. Matei et al.

19. Van der Maaten, L.J.P.: Learning a parametric embedding by preserving local structure. In: International Conference on Artificial Intelligence and Statistics, JMLR, W&CP, vol. 5 (2008) 20. Van der Maaten, L.J.P., Hinton, G.E.: Visualizing high-dimensional data using t-SNE. J. Mach. Learn. 9, 2579–2605 (2008) 21. Vladymyrov, M., Carreira-Perpinan, M.: Entropic affinities: properties and efficient numerical computation. In: Proceedings of the 30th International Conference on Machine Learning, pp. 477–485 (2013) 22. Vlaicu, P.A., Untea, A.E., Panaite, T.D., Turcu, R.P.: Effect of dietary orange and grapefruit peel on growth performance, health status, meat quality and intestinal microflora of broiler chickens. Ital. J. Anim. Sci. 19(1), 1394–1405 (2020) 23. Zhou, B., Jin, W.: Visualization of single cell RNA-Seq data using t-SNE in R. In: Kidder, B.L. (ed.) Stem Cell Transcriptional Networks. MMB, vol. 2117, pp. 159–167. Springer, New York (2020). https://doi.org/10.1007/978-1-0716-0301-7 8 24. Zhou, H., Wang, F., Tao, P.: t-Distributed stochastic neighbor embedding method with the least information loss for macromolecular simulations. J. Chem. Theory Comput. 14(11), 5499–5510 (2018) 25. Zhu, W., Webb, Z.T., Mao, K., Romagnoli, J.: A deep learning approach for process data visualization using t-distributed stochastic neighbor embedding. Ind. Eng. Chem. Res. 58(22), 9564–9575 (2019)

New Technologies for Diagnosis, Treatment, and Rehabilitation, Personalized Approaches in Medicine

Modern Methods for Identification and Reduction of Visual Problems in Children Barbu-Cristian Braun(B) , Corneliu-Nicolae Drug˘a , Ionel S, erban, and Alexandru Tulic˘a Product Design, Mechatronics and Environment Department, Transilvania University of Bras, ov, Bras, ov, Romania [email protected]

Abstract. The paper presents a stage of research done in order to help optometrists in the pediatric field. This stage of the research focused in particular on the development of a new solution regarding, first of all, the screening identification of certain visual problems among preschool children. The method proposed for the visual screening is an unconventional and up-to-date one, taking into account the great attraction of the little ones for tablet or mobile phone games. For this purpose, the paper presents how a software interface dedicated to a practical and rapid assessment of visual function in children in screening activities in kindergartens was designed, programmed, tested and used. The software application was designed to be flexible, useful for optometrists or ophthalmologists, as well as for school or preschool children. Concretely, with this method it was proposed that, through a virtual game, the visual function of children can be tested objectively and efficiently, by evaluating the recognition of the size, shape and color of attractive graphic entities. The evaluation procedure specific to the developed interface refers primarily to fundamental aspects related to the visual function, namely the recognition of shape, colors and the appreciation of sizes. The proposed method could be successfully applied in a rapid screening procedure in a group of 10 children, from a kindergarten group, whose parents gave their consent for the testing of their children. Keywords: Children · Visual Diseases · Virtual · Games · Software Interface

1 The Role of Adults in Observing Children’s Behavior in Current Activities Behavioral gestures that seem natural, however, viewed with great care and skill can betray different problems among children, whether it is physical pain, emotional disorders or pathologies specific to the 5 senses (taste, smell, touch, hearing and sight). Because, among the 5 senses, the visual function plays the most important role, from the point of view of receiving information from the environment, care for vision must receive, not meaning, of course, that other possible problems related to the other senses could be neglected [1, 2]. © The Author(s), under exclusive license to Springer Nature Switzerland AG 2024 V. Sontea et al. (Eds.): ICNBME 2023, IFMBE Proceedings 92, pp. 257–266, 2024. https://doi.org/10.1007/978-3-031-42782-4_28

258

B.-C. Braun et al.

The careful observation of children’s gestures when they play, when they do their lessons, when they read or when they watch TV must be responsible, primarily parents. But particularly important here is the role of the educator who must take care of the health and comfort of each child in that group. The optometrist, the person who is concerned with the assessment of visual function, in general, must have a trained eye and, whenever he has the opportunity, it is recommended to observe certain behavioral problems, especially in children. Moreover, he should intervene, explaining to the educator and the parent, with logical and convincing arguments, why a more careful evaluation or a specialist consultation in the office would be necessary [1, 3, 4].

2 Differentiation of the Main Types of Visual Pathologies in Children 2.1 Visual Function Impairments Amblyopia, residual hyperopia, early myopia, pathological nystagmus are some of the most common visual problems in children, but which, identified at a very young age, can be very efficiently reduced or even completely cured. If pathologies such as nystagmus or strabismus in mild or moderate degrees do not bother you consciously, amblyopia manifests visual disturbances that can be easily observed in daily activities (excessively leaning over the book, notebook, toys, etc., not noticing and knocking over some objects, etc.). Refractive problems like myopia or hyperopia can also be responsible for easily observable behavior (enlarging the eyes to see more clearly at a distance or, conversely, shrinking them for the same purpose). But even the pathologies that do not have an immediate effect on the behavior of preschool children should not be overlooked. A pathological Nystagmus can be seen relatively easily even by a person without skills in optometry or ophthalmology, being a pathology that can betray certain neurological problems. Strabismus or phoria, again, are problems that can be noticed with little attention by parents, educators or optometrists [5, 6]. 2.2 The Need for Specialized Controls Activities such as routine checks at the office or visual screening actions carried out regularly are absolutely recommended, primarily by specialists. During such checks, certain problems can be observed, which, otherwise, with all the attention of the parent or educator, cannot be identified. Moreover, such checks have the role of observing a tendency or a predisposition towards a certain pathology, thus being able to intervene much more quickly and efficiently [4, 7]. However, there are also situations when, in routine checks or visual screening activities, only the fact that there is a problem can be observed, but no details such as the cause of the problem, its nature or how it could be solved can be found. In such situations, the optometrist or ophthalmologist who performed the routine control or screening procedure can and is even obliged to recommend to the person in question (having a clear discussion with the parents and/or the educator) a specialized, detailed consultation for clarifying as many important aspects as possible [6, 8].

Modern Methods for Identification and Reduction of Visual Problems

259

3 The Advantages of Modern Methods for Identifying and Reducing Visual Problems in Children 3.1 Complementarity with Classic Methods The concept of the modern method within the visual control refers to all the procedures different from the conventional ones that involve the use of specific office devices and equipment. The effective combination of classical and modern methods can be the best way to identify and diagnose as many possible vision pathologies in both children and adults. But the reason why, very often, the use of modern methods and means for visual screening gives much better results among children is that these modern methods take into account their conduct when they have to be investigated. Modern methods take into account not only the fear of medical control, but also the aspect of boredom which, in children, appears much faster than in adults. However, in many situations, a short control based on the use of classical methods is also recommended, because this is an objective one, generating concrete, precise results, by means of specialized equipment [5, 8]. Besides, the modern methods that can be used in visual screening can be very many and varied, both from the point of view of the procedure and from the point of view of some aspects related to the design of the equipment used [6, 8]. The introduction of “serious games” concept as a method of investigating the visual function and beyond is relatively recent, experiencing an increasingly strong development in recent years due to the advantage of developing the skills and senses of the person in question [9].

4 Proposed Method for Visual Screening in Preschool Children The paper presents a new method, by which the optometrist or ophthalmologist can perform very simple and efficient visual screening procedures quickly, in a way that is as attractive as possible for the targeted children. It consists into a software interface through which the optometrist could easy and very efficient to evaluate the main aspects of the visual function like appreciate the color, the size, the shape etc. [10, 11]. A major problem related to using the test games on tablets, smart-phone or desktop is that the habit in children may occur. To reduce that risk, two measures were took into account related to the proposed method. Both invoke medical and psychological aspects. The first measure means to alternate the virtual testing games with real ones to concentrate the attention and also to improve the adaptation capacity during a testing procedure. The second measure invokes the optometrist to ensure assistance during testing, establishing the timing tor each virtual testing step and also watching very carefully the subject behavior when solving the virtual and real tests. 4.1 Software Interface Description For testing the main aspects in terms of visual function a software interface was designed and then programed, meaning three difficulty degrees addressed each one to three age categories (3 to 5 years – low difficulty, 5 to 7 years – medium difficulty and over 7 years – high difficulty) [11].

260

B.-C. Braun et al.

The interface for virtual testing games was programmed and developed in LabVIEW software environment, this being an ideal environment for virtual applications, which ensures besides a graphical interface very friendly both with the tested children and also with the examiner optometrist. In the following, both the content of the software interface and part of its programming sequences are described, this being one of the researches that will form the basis of the development of the method described in the paper. The interface was conceived that the testing for screening to include 3 steps, the first one meaning the shape recognizing, the 2nd refers to recognize the size and the color and the last step tests the identifying the color shades.

Fig. 1. Example of testing running in the 1st step – identifying the shape.

Figure 1 shows an example of testing in the first step. The 2nd testing step, meaning the color and size recognizing is presented in Fig. 2. In this step there are specified some information about the smallest and the largest items, having a specified color to be turned off.

Fig. 2. Example of testing running in the2nd step – identifying the color and the size

And, finally, the last testing step could be exemplified in Fig. 3. For each stage of the test, the interface allows a partial score to be given, and at the end, the final score is displayed after solving the test. An example of this is shown in Fig. 4. In terms of programming the interface, several steps were taken. A first stage referred to the definition of a text selector type variable for choosing the degree of difficulty of the testing (Fig. 5). It was associated with a Switch-type programming structure with 3 distinct cases, specific to each difficulty level, in part.

Modern Methods for Identification and Reduction of Visual Problems

261

Fig. 3. Example of testing running in the last step – identifying the color shades

Fig. 4. Example of partial and final score displaying after the test running

Fig. 5. Establishing the testing difficulty degree, via defined text ring input variable

Depending on the degree of difficulty, the duration of a test cycle varies, so that for a low level of difficulty the duration is about 3 min, for a medium level about 2 min, and for a high level about a minute (Fig. 6).

Fig. 6. Constant time value establishing for each iteration in function of the testing difficulty degree.

262

B.-C. Braun et al.

For programming, the test involving 3 stages, each having 3 subsequences, and each subsequence involving 4 iterations, this means that it was necessary to define a time constant value specific to each iteration, as exemplified in Fig. 7. The calculation relationship for establishing the time constant (k) is expressed in Eq. (1).   (1) k = (1/n) ∗ τi = 1/ (a ∗ b ∗ j) ∗ τi where: – τ i means the total time for the testing, for each difficulty degree (τ 1 = 180 s for the low level difficulty, τ 2 = 120 s for the medium level difficulty and τ 3 = 60 s the high level difficulty; – n means the total number of iteration during testing; – a is the number of steps for testing (in our case a = 3); – b is the subsequences number per each testing step (also in our case b = 3); – j means the number of iterations per each subsequence (in our case j = 4). For testing sequence by sequence, meaning step by step, and finally to stop automatically, an iterative While-Loop structure was used, assigning a number total iterations equal to the total number of iterations required for a test cycle (N = n + 1 = (a * b * j) + 1 = (3 * 3 * 4) + 1 = 37 iterations) (Fig. 7).

Fig. 7. While – Loop repetitive structure programing for one testing cycle.

For testing, meaning step by step all sub-sequences for each step separately, 9 TrueFalse Boolean structures were needed to program the algorithm specific to the logical events for each sub-sequence separately. Each of these structures was conditioned by being in a certain interval of the current iteration, meaning the condition for the automatic generation of a message by which the tested subject is informed what he has to do in the respective subsequence (Fig. 8). The entities used for testing are Boolean virtual LED type, each having the two logical states (on and off), being used for the 3 stages of the testing (according to the example in Figs. 1, 2 and 3). These being defined as input Boolean variables (Fig. 9), and switching them during the test must involve the addition of a partial score (if the corresponding entity has been switched). This resulted in an algorithm to determine the total number of switches of the entity in question for the entire duration of the testing cycle (Fig. 9). For this, a sequential structure with 6 sequences each was programmed. At each stage, the requirement is to select 2 entities (for example the lightest and darkest

Modern Methods for Identification and Reduction of Visual Problems

263

red dot), each stage referring to 3 rows of entities (see Figs. 1, 2 and 3), thus explains the number of 6 sequences required. Each sequence must have a corresponding subroutine to give or not to give the partial score, depending on the correctness of the answer.

Fig. 8. Example of current Boolean True-False structure specific to the algorithm for logic events for the current subsequence during testing.

Fig. 9. Programming subroutine for partial score giving for the 3rd testing step

5 Results and Discussion The proposed non-conventional method for visual screening by assisted testing using the interface described above has so far been able to be applied to a sample of 10 preschool children from a kindergarten group (5 and 6 years). For the 10 children, the educator and their parents gave their consent for them to be tested, the method meaning serious games, non-invasive one. Initially there were 12 children for whom consent was obtained for them to be evaluated, but two of them refused, they were not communicative [11].

264

B.-C. Braun et al.

Table 1. Visual screening results for all 10 children, applying the proposed non-conventional method Subject no.

Obtained score

1

7.5/10

2

9/10

3

8.5/10

4

6.5/10

5

8.5/10

6

9.5/10

7

10/10

8

4.5/10

9 10

7.5/10 9/10

Due to the applied screening for the sample of 10 children, it was found that two of them did not obtain satisfactory results (they scored below 7, being considered critical). One of them, who obtained the lowest score, was suspected of having amblyopia, being considered a special case. In the case of the other child, having a score close to the critical value, it was assumed that it was more a problem of attention or understanding what he had to do. In the Table 1 there are presented the results after testing all 10 children, the 4th and the 8th tested subjects obtaining scores lower than the critical score of 7/10. For the subject who obtained the lowest score (4.5/7), suspected of having amblyopia, the educator and the parents were discussed, in order to be sent as urgently as possible to an ophthalmology office for a more detailed investigation. The positive aspect is that both the parents and the educator have clarified the need for this detailed visual control. Thus there will be a real chance that his visual function can be saved in an effective way, through relatively simple and non-expensive means and methods.

6 Conclusion Performing the visual screening procedure among the 10 selected children was done so that there were 5 girls and 5 boys with different anthropometric sizes. The screening activity took place over 2 days, on the first day 6 were evaluated, and on the 2nd day 4 of the 10 subjects were evaluated. The reason for organizing the screening in 2 days was to avoid the risk of boredom and routine among the children and, on the other hand, not to lose a lot of time from the current activity that had to be carried out in the kindergarten.

Modern Methods for Identification and Reduction of Visual Problems

265

Being a method of play testing, the screening procedure was relatively easily accepted by the children, later being even accepted by the majority of them. Also, the method proved to be very accessible and practical, but at the same time conclusive from the point of view of the optometrist who carried out the screening activity. Starting from these conclusions, in the future it is desired to apply the method to other samples of children, from primary schools or other kindergartens. The aim is to implement the proposed method for the purpose of clearer and more conclusive statistics regarding the percentage of those with visual problems and at high risk, identified following the assessment. Acknowledgments. The research described in the paper was largely due to the contribution of Optometry graduate students, 2020–2021 promotion, within the Diploma Project, the practical activity being carried out in the laboratories of Transilvania University.

Conflict of Interest. The authors declare that they have no conflict of interest.

References 1. Gunarhadi, G., Sunardi, S.: Role of parents to train the independence of students with visual impairment in activity of daily living skill. Int. J. Multicultural Multireligious Underst. 6(1), 83 (2019). https://doi.org/10.18415/ijmmu.v6i1.501, https://www.researchgate.net/publication/ 332882530 2. Kizilaslan, A.: Teaching Students with Visual Impairment. Nova Science Publisher (2020). ISBN: 978-1-53617-166-2, https://www.researchgate.net/publication/341000567_Teaching_ students_with_visual_impairment 3. Zajac, M.: Vision screening in school children in Strzelin County. In: 15th Czech-PolishSlovak Conference on Wave and Quantum Aspects of Contemporary OpticsVolume: SPIE Proceedings, vol. 6609, pp. 2–4 (2006). https://www.researchgate.net/publication/232251 648_Vision_screening_in_school_children_in_Strzelin_County 4. Knapik, J., Mi´skowiak, B.: Screening investigations of vision process in the students of Karol Marcinkowski Medical Academy in Poznan, Polish, Nowiny Lekarskie, pp. 142–147 (2005) 5. Aral, N., Saglam, M.: Perception Development In Infants, Current Advances in Education, 1st edn., pp. 260–262 (2016). https://www.eqar.eu/qa-results/search/by-institution/institution/? id=1968 6. Baritz, M.: “Serious games” for serious vision problems of children. In: 12th e-Learning and Software for Education Conference eLSE, Bucharest, Romania, pp. 498–502 (2018). https:// proceedings.else conference_2018 7. Patrick, J., Droste, M.D., Steven, M., Archer, M.D., Eugene, M., Helveston, M.D.: Measurement of low vision in children and infants. Ophthalmology 98, 1513–1518 (1991). https:// www.sciencedirect.com/science/article/abs/pii/S0161642091320967 8. Baritz, M.: Using “Serious Game” for children and youth education in sustainable energy field and environment protection. In: Visa, I., Duta, A. (eds.) Nearly Zero Energy Communities. CSE 2017. Springer Proceedings in Energy, pp. 720–729. Springer, Cham (2017). https://doi.org/10.1007/978-3-319-63215-5_50, https://link.springer.com/chapter/10. 1007/978-3-319-63215-5_50 9. Ai-Hong, C., Farhana, N., Arthur, P.: Comparison of the pediatric vision screening program in 18 countries across five continents. J. Curr. Ophthalmol. 31(4), 357–365 (2019). https:// www.sciencedirect.com/science/article

266

B.-C. Braun et al.

10. Breten, I.: The development and testing of assisted “serious games”, as a visual training procedure for children with visual impairments in primary school, Diploma Project (2020). Coordinator: Lecturer Dr. Eng. Barbu Braun 11. Girigan, F.: Visual testing and recovery in children using software applications, Diploma Project (2021). Coordinator: Lecturer Dr. Eng. Barbu Braun

Role of Botulinum Toxin A Injections as a Salvage Therapy for Refractory Overactive Bladder: Insights from Urodynamic Studies Mihaela Ivanov(B)

and Emil Ceban

Department of Urology and Surgical Nephrology, “Nicolae Testemitanu” State University of Medicine and Pharmacy, The Republican Clinical Hospital “Timofei Mosneaga”, Chisinau, Republic of Moldova [email protected]

Abstract. The aim of study was to establish the role of botulinum toxin A (BTXA) in the treatment of refractory idiopathic overactive bladder (OAB) patients and to find out if urodynamic values could predict the positive third line treatment response. Many clinicians use UDS to diagnose DO before detrusor injection treatment. According to NICE Guide it is mandatory to investigate “urodynamics” to confirm the diagnosis of DO before performing minimally invasive treatment such as BTX-A injections. Was obtained clinical data based on the necessity of performing urodynamic tests before BTX-A injection, at patients with idiopathic refractory OAB, ensuring effectiveness and long-lasting treatment, as well as providing predictive parameters for potential postoperative complications. A retrospective study was performed on 30 patients with OAB symptoms who followed first line therapy for 4 months, without any positive results. The study was performed during 2021–2022, at the Department of Urology, “Nicolae Testemitanu” USMF, Republic of Moldova. After 6 weeks of intravesical BTX-A injection, was demonstrated significant reductions in frequency, nocturia and quality of life compared to baseline. This study identified several urodynamic variables that are directly associated with clinical data, influencing the severity of symptoms in patients with refractory idiopathic OAB and the effectiveness of BTX-A injection as a treatment option, especially when it is a urodynamic confirmation of DO. The administration of 100 U of BTX-A through detrusor injection has been shown to be efficacious in the management of OAB with DO confirmed on urodynamic, in patients that are unresponsive to second line therapy. Keywords: Overactive · Toxin · Detrusor · Urodynamics

1 Introduction Overactive bladder (OAB) is a common and chronic symptom complex that increases in prevalence with advancing age and has a known adverse effect on quality of life. OAB is a highly prevalent condition affecting 16.6% of the European population. Women are more commonly affected, and there is an increased incidence with age. © The Author(s), under exclusive license to Springer Nature Switzerland AG 2024 V. Sontea et al. (Eds.): ICNBME 2023, IFMBE Proceedings 92, pp. 267–277, 2024. https://doi.org/10.1007/978-3-031-42782-4_29

268

M. Ivanov and E. Ceban

Idiopathic overactive bladder (iOAB) is a clinical syndrome characterized by urinary urgency, usually associated with frequency and nocturia, with or without urinary urge incontinence, in the absence of urinary tract infection (UTI) or other pathologies. Idiopathic OAB symptoms affect ~17% of women, and its prevalence increases with patient’s age, reaching up to 30,9% of cases [1, 2]. Idiopathic OAB denotes a syndrome with unknown etiology, detrusor overactivity (DO) being considered to be a major cause of basic OAB pathophysiology. UDS is a sensitive investigation for detection DO in up to 70% of women with OAB, characterized by contractions of detrusor during filling phase and is associated with the urgency urinary sensation [3, 4]. Urgency, frequency and urinary urge incontinence have been shown to be the most sensitive factors for predicting DO (61,0%) in women [3, 5]. The definition of iOAB is based on symptoms and does not require urodynamic investigation (UDS). It is important to note that many clinicians use urodynamics to diagnose detrusor overactivity (DO) before initiating treatment [6, 7]. UDS is the “gold standard” for assessing the bladder and sphincter function, used as an objective measure of the patient’s response to treatment [8]. Intradetrusor botulinum toxin A (BTX-A) injections have long been established as an effective and safe treatment for refractory idiopathic OAB after other medications such as first line therapy has failed or not been tolerated. BTX-A injections have been given a grade A recommendation for both neurogenic and idiopathic refractory OAB by an expert European panel and appear in all urinary incontinence guidelines as the standard of care in this setting [9]. The success rate of BTX-A varies between 60–80%. However, it is associated with adverse events: the two main ones being voiding dysfunction, necessitating clean intermittent self-catheterization (CISC) and urinary tract infections (UTIs). The reported rate of CISC varies between 6–45% and the UTI rate also varies between 0–45%. UTI rates are unexpectedly high and difficult to explain based on current knowledge [9]. Some researchers believe that UDS is mandatory for diagnosis and treatment among women with symptoms of OAB, or determining the diagnosis only on the basis of urinary symptoms would lead to underdiagnosis of detrusor overactivity [10]. According to the recommendations of the NICE Guide (National Institute for Excellence in Health and Care) it is mandatory to investigate “urodynamics” to confirm the diagnosis of detrusor overactivity before performing minimally invasive treatment such as botulinum toxin type A (BTX-A) injections [11, 12]. In this study, our goal was to evaluate the role of botulinum toxin A in the treatment of refractory iOAB patients and find out if urodynamic values could predict the positive third line treatment response.

2 Material and Methods A retrospective study was performed on 30 patients with OAB symptoms who followed first line therapy for 4 months, without any positive results. The study was performed during 2021–2022, at the Department of Urology and Surgical Nephrology, “Nicolae Testemitanu” State University of Medicine and Pharmacy, Chisinau, Republic of Moldova.

Role of Botulinum Toxin A Injections as a Salvage Therapy

269

The clinical study details contain a post-hoc analysis of data based on the results of clinical and urodynamic parameters before and after injection with botulinum toxin type A intradetrusor at patients with refractory iOAB. This study provided a unique opportunity to describe the variability of the results after botulinum toxin injections of detrusor muscle, performed after the urodynamic investigation per patient over a period of a year. In this study, fundamental ethical principles of research have been respected. All patients gave informed consent before study entry. The study protocol was endorsed positively by “Nicolae Testemitanu” University Research Ethics Committee (Minutes No. 24, 05.03.2021). Patients who underwent the surgical procedure, were asked to explain that they understood the nature of the surgical procedure and after they gave the agreement for operation by signing the informed consent. 2.1 Study Procedure This analysis was performed as part of a retrospective study to evaluate the clinical and urodynamic parameters of detrusor muscle contractility before and after botulinum toxin type A injections at patients with refractor overactive bladder associated with idiopathic detrusor overactivity [13]. Inclusion criteria were women (>18 years age) diagnosticated with idiopathic OAB, refractory to anticholinergic therapy >4 months, due to ineffectiveness or tolerability, DO confirmed by urodynamic test with or without urge urinary incontinence and completed before and after injections the voiding diary/24 h and valid questionnaires [13]. The exclusion criteria were: neurogenic urinary bladder, bladder pain syndrome/interstitial cystitis, outlet bladder obstruction diagnosed on urodynamics, UTI, lithiasis/bladder tumors. Before and after BTX-A injection, all patients completed voiding diary/24 h, the OAB validated urinary symptoms questionnaire (OABSS), and the health-related quality of life questionnaire (OABq-HRQoL). Patients underwent ultrasound investigation to establish PVR and UDS (uroflowmetry, cystometry and voiding pressure study) [13]. 2.2 Study Equipment The detailed medical history of the patients was analyzed (assessment of urinary symptoms of storage, filling and incontinence, previous investigations and/or conservative, pharmacological and/or surgical treatments for OAB and relevant surgical medical history). Clinical examination was performed, including assessment of stress urinary incontinence in case of presence, prolapse of pelvic organs, tumor masses or other pelvic pathologies. The information collected included: patient demographic factors (age); medical history (history of recurrent UTI, history of pelvic floor surgery, presence/absence of prolapse, menopause). Voiding diary was completed for at least 24 h as a valid journal prior to the urodynamic investigation. All patients were asked to complete the OABSS and OABq-HRQoL questionnaires before and after injections. Lower urinary tract symptoms (LUTS)/OAB

270

M. Ivanov and E. Ceban

symptoms assessed by validated OABSS developed by Blaivas et al. (2007) and Man et al. (2006), was completed by all women before the intravesical botulinum toxin type A injection and during a post-injection follow-up [13]. The minimally invasive (UDS) and noninvasive clinical evaluation of women with urinary OAB symptoms that were performed in the study included: cystometry, free uroflowmetry ± pressure flow study, bladder ultrasound for determine the presence/absence of PVR and urinalysis with urine culture to exclude the presence of UTI [13]. 2.3 UDS Investigation UDS were performed for the diagnosis of OAB and DO using urodynamic equipment Medica SpA. Memphis Division (Medolla-Italy). All patients with a medication regimen that included anticholinergic medication, stopped the medication for at least six weeks prior to the UDS procedure. Six hours prior performing UDS procedure, patients were instructed to avoid diuretic drinks such as coffee and black tea. Was used 20 ml/min as the filling rate in order to reduce urothelial impact in comparison with a higher filling rate and also to better minimize natural filling volume effect. Urodynamic parameters were post-void residual urine volume (PVR) from ultrasound, first sensation of urination, first desire of urination, strong desire for urination, maximum cystometric capacity, maximum detrusor pressure, maximum urinary flow pressure, maximum urinary flow rate and bladder compliance (BC). Rectal urodynamic catheter was inserted ~10 cm depth, after which the urethra was catheterized using a 6Ch double lumen urodynamic catheter. The bladder was emptied after confirming the lack of residual urine based on the urodynamic investigation. Patients were placed in a sitting position after the filler wires were connected. The transducers were placed at reference heights according to ICS standards with the respective calibration of atmospheric pressure. The functionality of the transducers was confirmed by having the patients cough and the filling of the bladder was performed with saline solution prepared at room temperature. The filling was stopped once the patient reached the maximum cystometric capacity, and subsequently the patient urinated. The actual procedure was explained to all patients in a clear manner by providing a scenario, instructions on how to report the 4 sensations during the cystometry. Patients signed the informed consent before the procedure [13]. 2.4 BTX-A Injection Procedure Surgical treatment was performed under intravenous anesthesia. All patients received antibiotic prophylaxis (Ciprofloxacin 500mg, KRKA, Slovenia). The dose used was 100U of BTX-A (Neuronox®, Medytox.Inc., Korea). This dose was diluted in 10 ml of 0,9% saline solution. Under the guidance of the Karl Storz 19Fr rigid cystoscope, the bladder was dilated by infusing ~200 ml of 0,9% saline solution. Using a rigid injection needle 5Fr, 4 mm long, inserted ~2–3mm into the detrusor muscle supratrigonal, BTX-A was injected, 10 units/mL in 20 separate places at a distance of ~1 cm, using 0,5 ml for

Role of Botulinum Toxin A Injections as a Salvage Therapy

271

each injection site. The bladder trigone and the ventral bladder wall and bladder dome were avoided due to its close relationship with the peritoneal cavity. The bladder was emptied after the injection [13]. 2.5 Statistical Analysis Statistical data analysis was performed using unifactorial dispersion analysis designed in Microsoft Excel 2019 database and IBM SPSS Statistics 22 programs, using descriptive statistic. The categorical data were presented as absolute and relative values and the continuous data was reported in the form of mean and standard deviation or as a percentage of results.

3 Results Were analyzed data of 30 women, diagnosed clinically and urodynamic with overactive bladder who underwent 100U of BTX-A injectable surgical treatment, between January 2021 and January 2022. Table 1. Demographic data of patients with idiopathic overactive bladder. Demographic data

(N = 30)

Age (years)

40,9 ± 4,1

Reproductive period (18–44 years)

19 (63,3%)

Pre-menopausal (45–55 years)

4 (13,3%)

Menopause (56–65 years)

6 (20%)

Post-menopausal (>65 years)

1 (3,33%)

Disease outcome (years)

5,7 ± 4,1

Symptoms (urinary frequency, urgency and nocturia)

30 (100%)

Urge urinary incontinence

2 (6,66%)

Natural births

20 (66,6%)

Detrusor overactivity

30 (100%)

Conservative previous treatment

30 (100%)

Anticholinergic treatment (Solifenacin, Trospium Chlorid, Tolterodine)

20 (66,6%)

Selective β3-adrenoceptor agonists (Mirabegron)

13 (43,3%)

The mean age of women included in this study was ~41 years (18–67 years), which corresponds to the reproductive period, the onset of OAB symptoms was ~6 years (Table 1). All patients had urinary symptoms like urinary frequency, urgency and nocturia. Before the third line therapy, the drug treatment was 4 months by administration

272

M. Ivanov and E. Ceban

of combined anticholinergic medicine (66,6% of cases) and selective β3-adrenoceptor agonists (43,3% of cases), without improvement of LUTS/OAB. Urodynamic data were obtained before injection in 30 patients, from which in 100% of cases were confirmed the presence of DO. The bladder contractility index (CI) was found to be within the normal range in 100% of cases in patients investigated urodynamic and diagnosed with DO (Table 2). In 100% of cases the PVR was measured before surgery, averaging 4,9 ml (between 0–10 ml). Table 2. Urodynamic parameters in patients with idiopathic overactive bladder before and after botulinum toxin type A injection treatment. Urodynamic parameters

Uroflow-metry

Maximum voided volume (ml) Qmax (ml/s)

Cystometry

132,7 ± 136,7

208 ± 128

23,3 ± 5,7

9,8 ± 4,1

Qave (ml/s)

11,5 ± 5,5 82,7 ± 61,22

290,03 ± 29,33

123,5 ± 112,3

313,3 ± 33,6

8,2 ± 1,6

SDV (ml)

170 ± 135

MCC (ml)

194,57 ± 150,93

333,56 ± 37,7

45,9 ± 23,9

15,6 ± 8,2

10,4 ± 11,4

27,5 ± 3,2

119,4 ± 39,2

54,9 ± 7,52

MDP (cmH2O) CI

BTX-A post-injection (after 6 weeks) (n = 30)

FS (ml) FDV (ml)

BC (ml/cm H2O)

BTX-A pre-injection (n = 30)

315 ± 28,2

Note: Qmax - maximum flow rate; Qave - average flow rate; FS -first sensation of bladder filling; FDV -first desire to void; SDV - strong desire to void; MCC - maximum cytometric bladder capacity; MDP - maximum detrusor pressure; BC - bladder compliance; CI - index of detrusor contractility; BTX-A - botulinum toxin type A.

Based on UDS data, the diagnosis of iOAB with DO was confirmed by establishing the presence of phasic contractions of the detrusor muscle (3,9 ± 1,15), increased values of detrusor pressure (45,9 ± 23,9 cmH2O) and the presence of lower bladder compliance (10,4 ± 11,4 ml/cmH2O), these data in 100% of cases predicted an effective BTX-A injection. UDS parameters, such as bladder capacity at each sensation and detrusor pressure were affected by the presence of DO in women with OAB. Low values of indices obtained at cystometry: first sensation of bladder filling (82,7 ± 61,22 ml), first desire to void (123,5 ± 112,3 ml), strong desire to void (170 ± 135 ml) and maximal cystometric capacity (194,57 ± 150,93 ml) were 100% correlated with OAB symptoms (urgency, frequency and nocturia) from the OABSS validated questionnaire. We showed that the

Role of Botulinum Toxin A Injections as a Salvage Therapy

273

capacity of the bladder at each sensation was lower, being inversely proportional to the detrusor overactivity in women with OAB. PVR values (¯x = 3,9 ml) did not correlate with the occurrence of acute urinary retention or the need for intermittent post-injection self-catheterization, as well as the low value of urinary flow rate (10,2 ± 4,4 ml/s). Were determined the urinary symptoms in patients such as urinary frequency (100%), urinary urgency (100%), nocturia (100%) and urge urinary incontinence (6,66%) before BTX-A injection. Has been shown that botulinum toxin influence on urination (daytime urination has been reduced from 28% to 40%), and the urgency urination being reduced from 30% to 69%. After detrusor BTX-A injection in 73,9% cases, patients had improvement by disappearing the nocturia symptom and in 100% the urgency urinary incontinence. Based on voiding diary, before and after injection were analyzed indices of total voided volume, functional bladder capacity, nocturia index and nocturia polyuria index, number of daytime voiding and total index of urgency and frequency urination (Table 3). Table 3. Primary post-injection efficacy according to voiding diary parameters. Voiding diary parameters

BTX –A pre-injection (n = 20)

BTX -A post-injection (after 6 weeks) (n = 20)

TVV/24 h (ml)

1250 ± 643

1726,6 ± 130,8

FBC (ml)

160,8 ± 128,9

315 ± 32,4

IN

2,85

0,7 ± 0,1

IPN (%)

28,9 ± 9,6

15,8 ± 5,1

DV

11,2 ± 1,77

6,03 ± 0,18

TUFS

31,9 ± 8,3

7,7 ± 3,8

Note: TVV - total voided volume; FBC - functional bladder capacity; IN - index of nocutia; IPN - index of nocturia polyuria; DV - daytime voiding; TUFS - total urgency and frequency score; BTX-A - botulinum toxin type A.

A significant decrease of negative impact of LUTS/OAB on daily indoor and outdoor activity, physical and social activity was reported by patients following the completion of post-injection quality of life questionnaire (OABq-HRQoL). At 6 weeks after baseline (6 weeks after intravesical BTX-A injection), was demonstrated significant reductions in OABSS, frequency, nocturia, and quality of life compared to baseline. There were no reported cases of acute urinary retention or serious adverse events. UDS result obtained after 6 weeks of BTX-A injection revealed increasing the values of bladder sensations and absence of phasic detrusor contractions with normalizing the levers of detrusor pressure. From the study group, 19 patients received a single BTX-A injection. One patient (5% of cases) underwent repeated botulinum toxin type A injections, when an insufficient

274

M. Ivanov and E. Ceban

response or recurrence of urinary symptoms was observed after a minimum waiting time of 6 months. All patients were followed-up for at least 3 months after their first BTX-A injection. Intravesical BTX-A injection has a positive effect on patients’ emotions, with each follow-up visits (1st, 3rd and 6th week) an improvement in emotional state was observed. Difficulty sleeping and fatigue were reduced after the first month after the injection. Moreover, a statistically significant reduction in LUTS/OAB severity was observed using the OABSS questionnaire (Table 4). The OABSS questionnaire indices and their improvements after BTX-A injection are shown in Table 4. Due from the result after completing the OABSS, was improved in 100% the symptoms after treatment, remained with mild level in 30% cases. Table 4. Injection efficacy according to the degree of impairment of symptoms from OABSS questionnaire. Severity of OABSS

BTX –A pre-injection (n = 30)

BTX-A post-injection (after 6 weeks) (n = 30)

Absence of symptoms

0

21 (70%)

Mild

18 (60%)

9 (30%)

Severe

12 (40%)

0

Note: OABSS -overactive bladder symptoms questionnaire; BTX-A - botulinum toxin type A.

OABSS values improved on average by 35% after treatment, and in 55% of cases improved by 3 or more points. Scores for daytime urinary frequency, nocturia and urinary urgency improved significantly after BTX-A injection by 41,7%, 26,1% and 34,1%, respectively. Our results showed that the impact of idiopathic refractory OAB on patients was improved. The overall impact of the bladder problem on quality of life increased slightly at the 6th week after treatment, compared with the 3rd week. Regarding the side effects of intravesical therapy with BTX-A, in the actual group of patients, 7 cases of urinary tract infection were detected (35% of cases), established based on a positive urine culture. None of the patients required clean intermittent selfcatheterization (CIC) due to acute urinary retention or increased post-void residual urine volume.

4 Discussion We obtained the results that treatment with 100 IU of BTX-A has highly significant effects on urinary symptoms in women with OAB associated with DO. This study provides conclusive evidence of the effectiveness and safety of BTX-A for idiopathic DO in 30 women, and demonstrates significant improvements in voiding frequency, urgency, and nocturia rate after 6 weeks of treatment.

Role of Botulinum Toxin A Injections as a Salvage Therapy

275

The presence of OAB symptoms alone does not reliably predict the diagnosis of OAB with detrusor overactivity, not the effectiveness of subsequent treatment. Urodynamic testing is a useful diagnostic tool and could be of great value in evaluating the efficacy before BTX-A injection [8]. The variables that demonstrated the most statistically significant associations in this study were maximum cystometric capacity and bladder compliance. Maximum cystometric capacity refers to the maximum volume the bladder can hold during filling, with smaller volumes being linked to more severe OAB symptoms. Bladder compliance, which represents the bladder’s ability to adapt to changes in volume and pressure during filling, was found to be reduced in cases of low compliance, indicating less adaptive mechanisms and a higher severity of clinical manifestations. Another significant urodynamic parameter was the volume at which the first sensation of bladder filling was reported, with smaller volumes being associated with more severe symptoms of urinary urgency. Early sensations of bladder filling during the filling phase are expected to be associated with increased episodes of urgency. Our study revealed a significant association between urodynamic findings and the outcomes of BTX-A injection therapy in patients with OAB, indicating a clinically relevant link. While both urodynamic testing and voiding diary assessments, along with OABSS questionnaires, may impact clinical decisions regarding subsequent treatment, our findings highlight the predictive role of urodynamic studies in determining treatment outcomes for patients with bladder overactivity. The patients that were diagnosed by UDS before treatment, appears to have greater reductions of symptoms than those who did not perform the investigation [12]. A significant improvement in LUTS/OAB symptoms was observed in the evaluation of own results. Daily activity and psychosocial behavior have improved due to reduced symptoms of urinary frequency, urge urinary urgency and nocturia, intradetrusor injections with BTX-A influence daytime urination, which have been reduced from 28% to 40%, reducing the urinary urgency from 30 to 69%. A randomized clinical trial by Dmochowski et al. (2012) found that doses of 100U and higher provided better efficacy compared to 50U [9]. In our study we did not report acute urinary retention that requires CIC. Ultrasound did not show any significant post-void residual urine volume. This is probably due to the small research group. BTX-A is generally safe, effective treatment approved in many countries for overactive bladder symptoms. Barriers for using the toxin include meeting the clinical criteria for approved use, access to specialists, and the financial cost of treatment, which can be significant, although subsidized to varying degrees depending on use [14]. In present study were involved only women, because of higher incidence of experiencing OAB symptoms and also factors such as menopause, age and acute urinary tract infections may increase a woman’s chance of experiencing OAB. But all the results that were obtained can be expended to both gender for further clinical findings, diagnosis and treatment of OAB.

276

M. Ivanov and E. Ceban

5 Conclusions Clinical and urodynamic evaluations play a pivotal role in the pre-treatment care of patients with overactive bladder (OAB) who are undergoing botulinum toxin type A (BTX-A) injection, particularly in the presence of detrusor overactivity (DO), which indicates a more severe bladder storage disorder. The administration of 100 U of botulinum A toxin through detrusor injection has been shown to be efficacious in the management of overactive bladder with DO confirmed on UDS, that is unresponsive to second line therapy.

Conflict of Interest. The authors declare that they have no conflict of interest.

References 1. Miotla, P., Futyma, K., Cartwright, R., Bogusiewicz, M., Skorupska, K., Markut-Miotla, E., et al.: Effectiveness of botulinum toxin injection in the treatment of de novo OAB symptoms following midurethral sling surgery. Int. Urogynecol. J. 27(3), 393–398 (2016). https://doi. org/10.1007/s00192-015-2839-x 2. Chohan, N., Hilton, P., Brown, K., Dixon, L.: Efficacy and duration of response to botulinum neurotoxin A (onabotulinumA) as a treatment for detrusor overactivity in women. Int. Urogynecol. J. Pelvic Floor Dysfunct. 26(11), 1605–1612 (2015). https://doi.org/10.1007/s00192015-2751-4 3. Chen, S.L., Ng, S.C., Huang, Y.H., Chen, G.: Are patients with bladder oversensitivity different from those with urodynamically proven detrusor overactivity in female overactive bladder syndrome? J. Chin. Med. Assoc. 80(10), 644–650 (2017). https://doi.org/10.1016/j. jcma.2017.03.009 4. Giarenis, I., Mastoroudes, H., Srikrishna, S., Robinson, D., Cardozo, L.: Is there a difference between women with or without detrusor overactivity complaining of symptoms of overactive bladder? BJU Int. 112(4), 501–507 (2013). https://doi.org/10.1002/nau.23023 5. Diamond, P., Hassonah, S., Alarab, M., Lovatsis, D., Drutz, H.P.: The prevalence of detrusor overactivity amongst patients with symptoms of overactive bladder: a retrospective cohort study. Int. Urogynecol. J. 23(11), 1577–1580 (2012). https://doi.org/10.1007/s00192-0121781-4 6. Malone-Lee, J.G., Al-Buheissi, S.: Does urodynamic verification of overactive bladder determine treatment success? Results from a randomized placebo-controlled study. BJU Int. 103(7), 931–937 (2009). https://doi.org/10.1111/j.1464-410X.2009.08361.x 7. Fontaine, C., Papworth, E., Pascoe, J., Hashim, H.: Update on the management of overactive bladder. Ther. Adv. Urol. 13, 1–9 (2021). https://doi.org/10.1177/17562872211039034 8. Frenkl, T.L., Railkar, R., Palcza, J., Scott, B.B., Alon, A., Green, S., et al. Variability of urodynamic parameters in patients with overactive bladder. Neurourol. Urodyn. 30(8), 1565– 1569 (2011). https://doi.org/10.1002/nau.21081 9. Abrar, M., Stroman, L., Malde, S., Solomon, E., Sahai, A.: Predictors of poor response and adverse events following Botulinum Toxin-A for refractory idiopathic overactive bladder. Urology 135, 32–37 (2020). https://doi.org/10.1016/j.urology.2019.08.054 10. Cho, K.J., Kim, H.S., Koh, J.S., Kim, J.C.: Evaluation of female overactive bladder using urodynamics: relationship with female voiding dysfunction. Int. Braz. J. Urol. 41(4), 722–728 (2015). https://doi.org/10.1590/S1677-5538.IBJU.2014.0195

Role of Botulinum Toxin A Injections as a Salvage Therapy

277

11. Flisser, A., Walmsley, K., Blaivas, J.: Urodynamic classification of patients with symptoms of overactive bladder. J. Urol. 169, 529–534 (2003). https://doi.org/10.1097/01.ju.0000047380. 23852.b8 12. Verghese, T.S., Middleton, L.J., Daniels, J.P., Deeks, J.J., Latthe, P.M.: The impact of urodynamics on treatment and outcomes in women with an overactive bladder: a longitudinal prospective follow-up study. Int. Urogynecol. J. 29(4), 513–519 (2018). https://doi.org/10. 1097/01.ju.0000047380.23852.b8 13. Ivanov, M., Ceban, E.: Variability of urodynamic parameters in patients with idiopathic overactive bladder before intradetrusor botulinum toxin injections. MJHS 28(2), 5–12 (2022). https://doi.org/10.52645/MJHS.2022.2.01 14. Brennan, A., Hickey, M.: Botulinum toxin in women’s health: an update. Maturitas 119, 21–24 (2019). https://doi.org/10.1016/j.maturitas.2018.10.005

Assessing the Impact of Parental Labor Migration on Children’s Health Galina Gorbunov(B) Nicolae Testemitanu State University of Medicine and Pharmacy, Chi¸sinau, Republic of Moldova [email protected]

Abstract. In the Republic of Moldova, the phenomenon of children separated from one or both parents who went abroad to work has reached one of the highest levels in Europe. A total of 36,817 children were affected by parental labor migration in 2019, and 29,186 children in 2020. In order to define the quality of life of migrants’ children, there were researched different aspects of their lives. As the instrument for given research there was used the Pediatric Quality of Life Inventory (PedsQL™4.0) questionnaire. The research sample comprised 280 people, which was divided into 4 groups: group I-70 children affected by parental labor migration, group II-70 children without parental labor migration experience, group III-70 parents/guardians of children affected by parental labor migration, group IV-70 parents/guardians of children without parental labor migration experience. Scientific arguments were made in the study supporting an innovative methodology for assessing children’s quality of life - the Pediatric Quality of Life Inventory (PedsQL™ 4.0) questionnaire, which facilitated the assessment of patients’ health affected by parental labor migration. The study showed that the Total Score of the Quality of Life of the patients ranged from 56.01 ± 12.75 points at the age of 5–7 years and 46.77 ± 11.09 points in adolescents aged 13–18 years, the figures being significantly lower compared to patients not affected by migration (p = 0.000). Keyword: Children of migrant workers. Physical health. Psychosocial health. Quality of life

1 Introduction At present, the Republic of Moldova is at the top of the countries affected by migration (4, 19). The positive and negative effects of migration are felt by migrants and society as a whole, including the population not involved in migration, such as the children of migrants and elderly caretakers (18, 27, 31). For various reasons, in the current economic and social conditions, the absence of parents in the family is becoming more common. In the Republic of Moldova, the phenomenon of children separated from one or both parents who went abroad to work has reached one of the highest levels in Europe. According to Ministry of Health, Labor and Social Protection of the Republic of Moldovadata, in 2018, the total number of children left without parental care caused by migration © The Author(s), under exclusive license to Springer Nature Switzerland AG 2024 V. Sontea et al. (Eds.): ICNBME 2023, IFMBE Proceedings 92, pp. 278–287, 2024. https://doi.org/10.1007/978-3-031-42782-4_30

Assessing the Impact of Parental Labor Migration on Children’s Health

279

accounted for 37,866 children. A total of 36,817 children were affected by parental labor migration in 2019, and 29,186 children in 2020. Deprivation of parental care, especially at an early age, is a risk factor for children’s health. In children temporarily left behind without parental care due to parents‘ labor migration, the quality of life (QL) is primarily affected (8, 12). Unfortunately, although globally the phenomenon of parental labor migration is relevant, there are few studies of the quality of life of migrant children related to the phenomenon extent (17, 28, 32, 33).

2 Methodology 2.1 Study Design The cross-sectional study analyzed the quality of life of children affected by the migration process. The respondents were surveyed, using a structured questionnaire in order to assess the quality of life of children Pediatric Quality of Life Inventory, Version 4.0, English [3, 5, 30]. The questionnaire is divided into modules for the age groups 5–7, 8–12, and 13–18 years, which have separate completion forms for children and parents. The total score for all modules was calculated on a scale of 100 points. The higher the total score, the higher the quality of life of the child. The quality of life of children from 100 to 91 points was considered high, 90 - 81 points - moderate, 80 to 71 - low, less than 70 points - very low. 2.2 Participants In the study, 280 respondents were enrolled, 140 children and 140 parents, respectively. The groups were structured as follows: group I - 70 children affected by parental labor migration; group II - 70 children without parental labor migration experience; group III - 70 parents / guardians of children affected by parental labor migration; group IV - 70 parents/guardians of children without parental labor migration experience. 2.3 Statistical Analysis The obtained results were subjected to statistical analysis with the application of Statistics 7.0 (StatSoft, Inc), EXCEL and SPSS 26.0 (SPSS Inc) and presented by tabular and graphical procedures. The following parametric and non-parametric techniques of comparison between groups were applied: Student test (t); ANOVA test; χ2 test and Fisher’s Exact test. The correlation analysis between the continuous variables was carried out by determining the Pearson correlation and Spearman. The statistical significance of the results was determined by assessing the confidence interval (CI 95 - 95 CI). 2.4 Ethical Approval The study was conducted in compliance with the ethical requirements of the research (Minutes No. 12 of 20.09.2019 of the Ethics Commission of the Nicolae Testemitanu State University of Medicine and Pharmacy of the Republic of Moldova).

280

G. Gorbunov

3 Results Quality of life, physical and psychosocial health of children affected by parental migration. The analysis of the received results shows that, on all modules, the averages of the QL values of the children in the experimental group are significantly lower, compared to the values of the children in the control group (see Table 1). Table 1. Quality of life of children according to age and parental labor migration experience (points, M ± σ). Modules

Age period 5 - 7 years Study group (n = 20)

8 - 12 years Control group (n = 20)

Study group (n = 30)

13 - 18 years Control group (n = 30)

Study group (n = 20)

Control group (n = 20)

Physical Functioning (PhF)

59,7 ± 17,6* 86,6 ± 12,5 54,6 ± 14,7* 83,3 ± 12,6

48,4 ± 14,4* 82,6 ± 11,7

Emotional Functioning (EF)

43,5 ± 19,8* 89,0 ± 13,7 43,7 ± 15,6* 85,8 ± 12,0

42,0 ± 15,0* 85,0 ± 12,6

Social Functioning (SF)

64,5 ± 19,8* 84,5 ± 11,9 53,5 ± 19,9* 85,7 ± 13,3

51,4 ± 16,1* 84,6 ± 10,8

School Functioning (SchF)

54,0 ± 17,2* 83,2 ± 17,9 52,2 ± 16,1* 81,1 ± 13,9

44,4 ± 9,9* 78,6 ± 15,1

Psychosocial Health (PSH)

53,9 ± 13,7* 85,6 ± 12,0 49,8 ± 13,1* 84,2 ± 10,6 45,9 ± 10,88* 82,7 ± 10,7

Total Score

56,01 ± 12,7* 85,9 ± 11,4 51,5 ± 10,7* 83,9 ± 10,6 46,7 ± 11,09*

82,7 ± 9,7

Note: * p = 0.000 - significance threshold of values in children with/without parental labor migration experience according to Mann-Whitney U statistics in age groups

In the children of the control group, the Physical Functioning (PhF) showed a very low level of QL with a range of 48.4 ± 14.44 points in children aged 13–18 years, and 59.7 ± 17.61 points in children aged 5–7 years. The children in the control group had a moderate level of QL in terms of the PhF, with a range of 82.6 ± 11.77 points at the age of 13–18 years, and 86.6 ± 12.55 points at 5–7 years. The lowest score was assigned to EF section, of all the sections studied, and in all age categories of the children in the experimental group. Thus, in terms of EF, the obtained results show that the quality of life of children affected by migration was very low, ranging from 42.0 ± 15.0 points in children aged 13–18 years to 43.7 ± 15.64 points at 8–12 years, being significantly different from the values of children not affected by migration, 85.0 ± 12.67 and 89.0

Assessing the Impact of Parental Labor Migration on Children’s Health

281

± 13.73 points (p = 0.000), respectively. The results of the distribution of patients by age and the studied modules are shown in Figs. 1 and 2.

Fig. 1. Quality of life of children aged 13–18 years, depending on the presence/lack of parental work migration experience, points.

Fig. 2. Quality of life of the children aged 8–12 years, depending on the presence/lack of parental labor migration experience (points).

The obtained data show that adolescents affected by migration have a low quality of life in this module, which can be explained by the fact that during adolescence, children are more affected by a lack of parental attention and care, resulting in a state of psychological and emotional stress. The left behind children aged 13–18 years had the lowest QL values on the EF module - 42.0 ± 15.00 points. The children aged 5–7 years, not affected by migration (89, 0 ± 13.73 points), had the highest values, followed by the age group 8–12 years (85.8 ± 12.04 points). The QL score was assessed in terms of the Social Functioning (SF). According to the obtained results, in all age groups, the children in the control group had a quite low QL. The adolescents aged 13–18 years (51.4 ± 16.17 points) had a lower score, while children aged 5–7 years had a higher score (64.3 ± 19.86 points). The data indicate that parental labor migration has a significant negative multidimensional impact on children’s

282

G. Gorbunov

quality of life, with implications for children’s SF, which necessitates special attention from subjects involved in monitoring the care of children affected by migration. The research also focused on the analysis of the quality of life in terms of School Functioning (SchF). The analysis of the surveys of the children in the control group revealed that children affected by migration had a very low quality of life score (less than 70 points) in terms of SchF. The lowest score was recorded in children aged 13–18 years - 44.4 ± 9.93 points, followed by 52.2 ± 16.12 points in children aged 8–12 years and 54.0 ± 17.29 points in those aged 5–7 years (see Fig. 3).

Fig. 3. Quality of life of the children aged 5–7 years, depending on the presence/lack of parental labor migration experience (points)

Subsequently, our research focused on estimating the PSH of children affected by migration. Analysis of information revealed a lower score of PSH in the children aged 13– 18 years (45.9 ± 10.88 points) of the control group, and a higher score in children aged 5–7 years (53.9 ± 17.79 points). In all age groups of migrants‘children, psychosocial health had a very low score (less than 70 points). The research subsequently analyzed the compartment of the quality of life at which the children in the study suffered more or had a lower score. Based on the data presented, it was found that EF had the lowest mean values - 43.07 points, followed by PSH - 49.87 points and SchF - 50.2 points. The mean score of the Social Functioning module was the highest (56.5 points), followed by the PhF/PSH module (54.2 points). Higher values of SF were possibly determined due to the fact that children left alone tried to compensate for parental absence by communicating with peers, classmates, and teachers. The obtained data are integrated in Fig. 4. The study aimed to evaluate the dynamics of Physical Health and Psychosocial Health of children of migrant parents, starting with the hypothesis of discovering any abnormalities in the evolution of the quality of life of the children in the study as they grew older. Figure 5 depicts the acquired results in a panoramic format.

Assessing the Impact of Parental Labor Migration on Children’s Health

283

Fig. 4. Quality of life of children in assessed modules

Fig. 5. Evolution of Physical and Psychosocial health of the patients, according to children’s survey.

The data in Fig. 5 show that the physical and psychological health of left-behind children deteriorates as they grow older. This is considered to be due to insufficient medical care provided by parents, and by people directly involved in rendering primary and secondary health care.

4 Discussion Studies that examine the quality of life, including the physical, emotional, and social effects of diseases and therapies on people’s lives, are especially valuable in medical practice [1, 10, 12, 15, 16, 20, 23]. Parental migration must be evaluated in order to estimate the QL of children affected by migration [25, 26, 29, 34, 35]. Such an essential issue as the impact of migration on migrant children’s QL has yet to be adequately addressed in studies in the Republic of Moldova. This is the first national study to look into the quality of life of children in the Republic of Moldova who are affected by parental labor migration.

284

G. Gorbunov

The use of the Pediatric Quality of Life Inventory survey as a specific research tool in the study aided in the assessment and measurement of the health of children affected by parental labor migration. Varni J. et al. proved the feasibility, reliability, and validity of this instrument in a survey of 20031 households with children in California, USA [36]. Desai A. et al. investigated the utility of the Pediatric Quality of Life Inventory in assessing the quality of life of children with diverse chronic health disorders, including JRA, pediatric systemic lupus erythematosus, diabetes mellitus, and congenital malformations [3, 7, 10–12, 30]. Fellmeth G. et al. investigated the relationship between migration and public health. The authors emphasized the importance of studying migration’s consequences as social determinants of health, as they have the potential to position public health as a vital participant in the establishment of a truly healthy global society, including persons forced to cross international borders [6, 13, 14, 21, 22, 24]. The findings on the need for studies on children’s quality of life are consistent with the findings of Clarke S. et al.[5]. Our claim that parents of studied children frequently rated their children’s quality of life lower than the children themselves is consistent with the findings of Dawson, E. et al. [8, 9]. Ma J. et al. reached similar conclusions after studying the QL of 332 children with chronic disorders hospitalized at two pediatric clinics in Shanghai, China [26]. Bai G. et al. investigated the influence of chronic disease on the quality of life of 5301 children aged 4 to 11 years in the Netherlands. Significant variations in QL were found between healthy children and children with one or more chronic diseases, leading to the conclusion that children with one or more chronic diseases had lower QL than healthy children [2]. This finding is consistent with the findings of Petersen K. et al., who used the pediatric instrument (PedsQL ™) to assess the QL of 775 adolescents aged 15–17 years in the Australian community and concluded that adolescent health-related QL scores differed based on self-reported health and socioeconomic status [30].

5 Conclusions Scientific arguments were made in the study supporting an innovative methodology for assessing children’s quality of life - the Pediatric Quality of Life Inventory questionnaire, which facilitated the assessment of patients’ health affected by parental labor migration. The study showed that the Total Score of the Quality of Life of the patients ranged from 56.01 ± 12.75 points at the age of 5–7 years and 46.77 ± 11.09 points in adolescents aged 13–18 years, the figures being significantly lower compared to patients not affected by migration (p = 0.000). The children affected by parental labor migration had a very low score on all modules and integral characteristics of the quality of life, being classified as children with a very low level of quality of life.

Ethical Approval. All study subjects signed informed consent forms approved by the respective university or institutional ethics boards. Conflict of Interest. The author declares having no conflict of interest.

Assessing the Impact of Parental Labor Migration on Children’s Health

285

References 1. Antia, K., Boucsein, J., Deckert, A., Dambach, P.: Effects of international labor migration on the mental health and well-being of left-behind children: a systematic literature review. Int. J. Environ. Res. Public Health 17(12), 4335 (2020). https://doi.org/10.3390/ijerph17124335 2. Bai, G., Herten, M., Landgraf, G., Korfage, I., Raat, H.: Childhood chronic conditions and health-related quality of life: findings from a large population-based study. PLOS ONE 12(6), e0178539 (2017). https://doi.org/10.1371/journal.pone.0178539 3. Butz, C., Valleru, J., Castillo, A., Butter, E.: Implementation of an outcome measure in pediatric behavioral health: a process improvement initiative. Pediatr Qual Saf. 2(6), e043 (2017). https://doi.org/10.1097/pq9.0000000000000043 4. Cebotari, V., Siegel, M., Mazzucato, V.: Migration and the education of children who stay behind in Moldova and Georgia. Int. J. Educ. Dev. 51, 96–107 (2016). https://doi.org/10.1016/ j.ijedudev 5. Clarke, S., Eiser, C.: The measurement of health-related quality of life (QOL) in pediatric clinical trials: a systematic review. Health Qual. Life Outcomes 2, 66 (2004). https://doi.org/ 10.1186/1477-7525-2-66 6. Clark, H., Coll-Seck, A., Banergee, A., Peterson, S., et al.: A future for the world’s children? A WHO-UNICEF-Lancet Comm. Lancet 395(10224), 605–658 (2020). https://doi.org/10. 1016/S0140-6736(19)32540-1 7. Corona, M., Bhabna, J., Wickramage, K., et al.: International migration of unaccompanied minors: trends, health risks, and legal protection. Lancet Child Adolesc Health 5(12), S2352– 4642(21)00194–2 (2021). https://doi.org/10.1016/s2352-4642(21)00194-2 8. Curtis, P., Thompson, J., Fairbrother, H.: Migrant children within Europe: a systematic review of children’s perspectives on their health experiences. Public Health 158, 71–85 (2018). https:// doi.org/10.1016/j.puhe.2018.01.038 9. Dawson, E., Koceja, L., Stein, E., et al.: Perspectives of caregivers on the effects of migration on the nutrition, health and physical activity of their young children: a qualitative study with immigrant and refugee families. J. Immigr. Minor. Health 22(2), 274–281 (2020). https://doi. org/10.1007/s10903-019-00905-6 10. Dawson-Hahn, E.E., Pidaparti, V., Hahn, W., Stauffer, W.: Global mobility, travel and migration health: clinical and public health implications for children and families. Paediatrics Int. Child Health 41(1), 3–11 (2021). https://doi.org/10.1080/20469047.2021.1876821 11. Desai, A., Zhou, C., Stanford, S., Haaland, W., Varni, J.: Validity and responsiveness of the pediatric Quality of Life Inventory (PedsQL) 4.0 Generic Core Scales in the pediatric inpatient setting. JAMA Pediatrics 68, 1114-1121 (2014) 12. Donath, C., Bergmann, M., Kleim, S., Hillemacher, T., et al.: Epidemiology of suicidal ideation, suicide attempts, and direct self-injurious behavior in adolescents with a migration background: a representative study. BMC Pediatr. 19(1), 45 (2019). https://doi.org/10. 1186/s12887-019-1404-z 13. Fellmeth, G., Rose-Clarke, K., Zhao, C., et al.: Health impacts of parental migration on leftbehind children and adolescents: a systematic review and meta analysis. Lancet 392(10164), 2567–2582 (2018). https://doi.org/10.1016/S0140-6736(18)32558-3 14. Fellmeth, G., Rose-Clarke, K., Zhao, C., et al.: Parental migration for labor and health in children and adolescents left-behind children: a systematic review and meta- analysis. Arch. Dis. Child. 104(2), 110 (2019). https://doi.org/10.1136/archdischild-2019-rcpch.263 15. Florian, S., Ichou, M., Panico, L.: Parental migrant status and health inequalities at birth: the role of immigrant educational selectivity. Soc. Sci. Med. 278, 113915 (2021). https://doi.org/ 10.1016/j.socscimed.2021.113915

286

G. Gorbunov

16. Frank, L., Schenk, L., Rommel, A., et al.: Inanspruchnahme ambulant ärztlicher leistungen und zufriedenheit mit der versorgung bei kindern und jugendlichen mit migrationshintergrund - ergebnisse der KiGGS-studie. Bundesgesundheitsbl 63, 103–112 (2020). https://doi.org/10. 1007/s00103-019-03069-8 17. Garson, J., Loizillon, A.: Changes and challenges. Europe and migration from 1950 to Present. In: The Economic and social aspects of migration. Conference Jointly Organized by The European Commission and the OECD, 21–22, January, 2003, Brussels, Luxembourg (2016). https://www.oecd.org/migration/mig/15516948.pdf 18. Gonzalez-Rabago, Y., La Parra, D., Puigpinos-Riera, R., Pons-Vigues, M.: Cómo medir el estatus migratorio de la población infantil y juvenile? Estudios sobre salud y desigualdades en salud en Europa [How to measure the migration status of the child and young population? Studies on health and inequalities in health in Europe]. Gaceta sanitaria. 35(1), 81–90 (2021). https://doi.org/10.1016/j.gaceta.2019.06.003 19. Gorbunov, G.: Impact of labor migration of parents on children‘s health in the republic of Moldova. BMJ Journals. Archives of Disease in Childhood 102 (Suppl 2), A26 (2017). https:// doi.org/10.1136/archdischild-2017-313273.67 20. Gutmann, M., Aysel, M., Özlu-Erkilic, Z., et al.: Mental health problems of children and adolescents, with and without migration background, living in Vienna, Austria. Child Adolesc. Psychiatry Ment. Health 13, 35 (2019). https://doi.org/10.1186/s13034-019-0295-y 21. Hjern, A., Jeppsson, O.: Mental health care for refugee children in exile. In: Ingleby, D. (eds) Forced Migration and Mental Health. International and Cultural Psychology Series. Springer, Boston, MA (2005). https://doi.org/10.1007/0-387-22693-1_7 22. Kharel, M., Akira, S., Kiriya, J., Ong, K., Jimba, M.: Parental migration and psychological well-being of left-behind adolescents in Western Nepal. PLOS ONE 16(1), e0245873 (2021) https://doi.org/10.1371/journal.pone.0245873 23. Knipe, D., Lambert, H., Pearson, M., Eddleston, M., et al.: Are left-behind families of migrant workers at increased risk of attempted suicide? - a cohort study of 178,000 individuals in Sri Lanka. BMC Psychiatry 19, 25 (2019). https://doi.org/10.1186/s12888-018-2000-8 24. Kunwar, R., Vajduc, C., Muscatello, D.: Parental international migration is not associated with improved health care seeking for common childhood illnesses and nutritional status of young children left-behind in Nepal. Public Health 186, 137–143 (2020). https://doi.org/10. 1016/j.puhe.2020.06.049 25. Li, K., Guang, Y., Ren, L, et al.: Network analysis of the relationship between negative life events and depressive symptoms in the left-behind children. BMC Psychiatry 21(1), 429 (2021). https://doi.org/10.1186/s12888-021-03445-2 26. Ma, J.L., Sheng, N., Ding, W.W., Zhang, Y.: Zhongguo dang dai er ke za zhi = Chinese J. Contemp. Pediater. 20(1), 60–66 (2018). https://doi.org/10.7499/j.issn.1008-8830.2018. 01.013 27. Joseph Mattingly, T., Kiser, L., Hill, S., Briggs, E.C., Trunzo, C.P., Zafari, Z., Betancourt, T.S.: Unseen Costs: the direct and indirect impact of U.S. immigration policies on child and adolescent health and well-being. J. Trauma. Stress 33(6), 873–881 (2020). https://doi.org/ 10.1002/jts.22576 28. Michaud, P., Weber, M., Namazova-Baranova, L., Ambresin, A.: Improving the quality of care delivered to adolescents in Europe: a time to invest. Arch. Disease Child. 104(3), 214216 (2018). https://doi.org/10.1136/archdischild-2017-314429 29. Mishra, P., Choudhary, P., Anand, A.: Migration and child health: understanding the coverage of child immunization among migrants across different socio-economic groups in India. Child Youth Serv. Rev. 119, 105684 (2020). https://doi.org/10.1016/j.childyouth.2020.105684 30. Petersen, K., Chen, G., Mpundu-Kaambwa, C., Stevens, K.: Measuring health-related quality of life in adolescent populations: an empirical comparison of the CHU9D and the PedsQL TM 4.0 Short Form 15. Patient 11(1), 29–37 (2018). https://doi.org/10.1007/s40271-017-0265-5

Assessing the Impact of Parental Labor Migration on Children’s Health

287

31. Oberg, C.: The arc of migration and the impact on children’s health and well-being forward to the special issue-children on the move. Children 6(9), 100 (2019). https://doi.org/10.3390/ children6090100 32. Racaite, J.: Parent emigration and physical health of children left behind: systematic review of the literature. Eur. J. Pub. Health 29(4), 392 (2019). https://doi.org/10.1093/eurpub/ckz 186.024 33. Racaite, J., Lindert, J., Aantia, K., Winkler, V., Sketerskiene, R., et al.: Parent emigration, physical health and related risk and preventive factors of children left behind: a systematic review of literature. Int. J. Environ. Res. Public Health 18(3), 1167 (2021). https://doi.org/10. 3390/ijerph18031167 34. Riza, E., Kalkman, S., Coritsidis, A, et al.: Community-based healthcare for migrants and refugees: a scoping literature review of best practices. Healthcare 8(2), 15 (2020). https://doi. org/10.3390/healthcare8020115 35. Russell, E., Tsai, C., Linton, J.: Children in immigrant families: advocacy within and beyond the pediatric emergency department. Clin. Pediatric Emerg. Med. 21(2), 1–12 (2020). https:// doi.org/10.1016/j.cpem.2020.100779 36. Varni, J.W., Sherman, S.A., Burwinkle, T.M., et al.: The PedsQL™ family impact module: preliminary reliability and validity. Health Qual. Life Outcomes 2, 55 (2004). https://doi.org/ 10.1186/1477-7525-2-55

The Implementation of Personalized Medicine in the Republic of Moldova: Challenges and Opportunities in Cardiology Alexei Levitchi1

, Daniela Galea-Abdusa1(B) and Ghenadie Curocichin1

, Victor Sontea2

,

1 Nicolae Testemitanu University, Chisinau, Republic of Moldova

[email protected] 2 Technical University of Moldova, Chisinau, Republic of Moldova

Abstract. Implementing Personalized Medicine in the operational and functional context of a healthcare system is a complex challenge for most countries. Pharmacogenetics represents the application domain of individual genetic profile testing for drug prescription purposes. Health insurance systems are the mechanism by which drug treatment expenses can be covered. Doctors prescribe treatments based on a patient’s clinical evaluation, according to the results of clinical studies that demonstrated the efficacy and low risk of adverse reactions of a particular drug tested on a clearly defined group of patients. Historically, most of these studies missed the assessment of individual capacity to metabolize drugs through xenobiotic transformation pathways. Proteins involved in transforming drug’s chemical forms have yet to be well known, and studying their activity mechanisms is complex from a methodological point of view. Structural changes in the genes coding these proteins demonstrated an association with drug metabolism capacity, as revealed by GWAS studies for some populations. Inequality in sample collection and access limited the representativeness of many populations, with statistical significance levels being reached only for some of them. Validation of GWAS associations would allow their application in pharmacogenetic testing services in an evidence-based manner. This study represents a survey of the current opportunities to implement recommended genetic testing for the drugs used in CVD treatment compensated for the population by the National Health Insurance Company in the Republic of Moldova. Keywords: Personalized Medicine · Pharmacogenetics · Clinical implementation · Challenges · Cardiology · Republic of Moldova

1 Introduction Increasing prevalence of chronic diseases and ageing population are serious problems affecting both rich and poor countries. Although there have been significant improvements in medicine in recent times, there are still many diseases we cannot treat. Interventions are not specifically targeted at an individual, besides their effectiveness can © The Author(s), under exclusive license to Springer Nature Switzerland AG 2024 V. Sontea et al. (Eds.): ICNBME 2023, IFMBE Proceedings 92, pp. 288–298, 2024. https://doi.org/10.1007/978-3-031-42782-4_31

The Implementation of Personalized Medicine in the Republic of Moldova

289

vary from person to person, with some having positive results while others still suffer negative consequences. In Europe, it is estimated that 5% of hospital admissions are attributed to adverse drug reactions (ADRs) [1]. Moreover, ADRs are deemed the fifth most common cause of hospital death. Expected financial burden associated with ADRs has been estimated at almost e79 billion, which is a significant impact in Europe, but can be mitigated by suitable measures [2]. Personalized medicine (PM) paradigm offers promising solutions to tackle these issues. European Council Conclusion on PM for patients issued its comprehensive definition [3], while european initiatives, e.g., International Consortium for Personalized Medicine (ICPerMed), implement it’s fundamental principles in their activities. Molecular profiling, from technological and methodological point of view, must deliver knowledge about biomarkers with demonstrated clinical relevance. Human genome contains “pharmacogenes” (drug-related genes), with considerable genetic variations of functional significance (termed “functional genetic variations” or “FGVs”). These includes single nucleotide polymorphisms (SNPs) and copy number variations (CNVs). Distinct alleles are associated with various therapeutic responses to drug treatments [4]. Approximately 97–98% of individuals possess at least one actionable FGV within their drug-related genes. A high probability is noted that an individual is carrying a genetic variant that may lead to a loss of function (LOF) variation in pharmacogenes, estimated at 93% [5]. The discipline that investigates the intricate correlation between an individual’s genetic makeup and susceptibility to drug action is defined as Pharmacogenomics (PGx). The fundamental objective of this field is to customize treatments for each patient to achieve the best results. PGx integration in clinical practice has advanced significantly in the past two decades [6]. Clinical Pharmacogenetics Implementation Consortium (CPIC) and Dutch Pharmacogenetics Working Group (DPWG) guidelines are available for clinical interpretation of PGx tests [7]. Both bodies provide updated, evidence-based, free-access guidelines to facilitate and accelerate the establishment of a link between the results of PGx tests and specific dose recommendations [8]. PharmGKB resourse provides drug, gene data and these guidelines [9]. Therapeutic dosages can be implemented as standards for wide range of therapeutic areas. In the Netherlands DPWG guidelines were integrated into the G-standard, a national drug database for healthcare providers in primary and secondary care settings [10]. Cardiovascular diseases (CVD) are the primary cause of mortality in the Republic of Moldova, accounting for 56,3% of cases compared to 14,6% of cases due to malignant tumors [11]. Given CVD clinical and economic burden, there is a wealth of empirical evidence examining the impact of PGx-guided treatment on cardiovascular care [12, 13]. However, there are limited cost-effectiveness analyses (CEA) of pharmacogenes associated with prescription drugs in primary care. This article aims to review the current opportunities for implementing PM, focusing on the obstacles associated with pharmacogenetic testing in CVD treatment in Moldova and suggesting potential strategies for overcoming these challenges.

290

A. Levitchi et al.

2 Methods The national body providing medical insurance in the Republic of Moldova is the National Health Insurance Company (NHIC, http://cnam.md). It regularly publishes the list of drugs reimbursed to insured citizens. Centralized acquisition of drugs is generally based on data collected from previous periods of necessity declared by hospitals or clinics. The most recent version, produced on April 16, 2023, comprised 25 drugs used in CVD treatment: Acenocoumarolum, Acidum Acetylsalicylicum, Amiodaronum, Amlodipinum, Bisoprololum, Carvedilolum, Clopidogrelum, Digoxinum, Enalaprilum, Indapamidum, Isosorbidi Mononitras, Lercanidipinum, Lisinoprilum, Losartanum, Metoprololum, Nebivololum, Perindoprilum, Ramiprilum, Rivaroxabanum, Rosuvastatinum, Simvastatinum, Spironolactonum, Telmisartanum, Torasemidum, Valsartanum, and Warfarinum. Most of them are covered as monotherapy, only two examples of combined therapies are included: Perindoprilum Argininum + Indapamidum, Losartanum + Hydrochlorthiazidum. Because of the limited number of association studies observing therapies with two or more drugs, only monotherapies were followed. These drugs were searched in PharmGKB (https://www.pharmgkb.org/), reviewing Drug Label Annotations and Clinical Annotations categories for CPIC and/or DPWG recommendations. Clinical annotations comprises curated information about FGV-drug pairs with prescribing guidance from clinical guidelines and FDA-approved drug labels, if available. Phenotypic traits were picked to identify associations that were already confirmed. Dosage, Efficacy, Metabolism/PK, and Toxicity traits have been recorded for most of genes. In several cases no records about these traits were present because their rarity limited the proof and made their assessment in a broader group of patients difficult. Details were completed from Drug Label annotations, depicting risk conditions or factors associated with drug usage, mentioned as Adverse reactions. In order to verify the availability of pharmacogenetic testing services in the country, an internet search of medical centers and laboratories, was conducted. The results about drug or gene names associated with cardiovascular diseases were collected. Interpretation of the opportunities of PM implementation in the Republic of Moldova were realized discussing the challenges stated by European Commission in 2016 [14] and aspects of Regional perspectives of PM stated in The Strategic Research & Innovation Agenda (SRIA) for Personalized Medicine [15].

3 Results Moldavian population is ensured to access 25 medicines aimed at treating CVD (Table 1). The recommendations for pharmacogenetic testing by CPIC and/or DPWG have been found for 13 of these drugs, making up 52,0% of the group. At least two pharmacogenes are associated to six of them (isosorbide mononitrate, warfarin, rosuvastatin, losartan, perindopril, and amlodipine). The most common pharmacogenes are P450 genes (CYP2C9, CYP2D6) and SLCO1B1. A recent study revealed that CYP2D6, CYP2C19, and SLCO1B1 were the pharmacogenes most frequently associated with primary care prescriptions in England [16].

The Implementation of Personalized Medicine in the Republic of Moldova

291

Table 1. Drugs reimbursed by NHIC and their corresponding pharmacogenes and phenotypic characteristics. Drug

Pharmacogene

Phenotypic characteristics

isosorbide mononitrate

CYB5R1 CYB5R2 CYB5R3 CYB5R4

Adverse reactions (risk for methemoglobinemia)

clopidogrel

CYP2C19

Efficacy, Metabolism/PK, Toxicity

rosuvastatin

ABCG2 LDLR SLCO1B1

Efficacy, Metabolism/PK, Dosage Diagnostics confirmation (homozygous familial hypercholesterolemia, genetically determined) Toxicity, Efficacy, Metabolism/PK

acenocoumarol

CYP2C9

Dosage, Efficacy, Metabolism/PK, Toxicity

losartan

CYP2C9 CYP3A4

Efficacy, Metabolism/PK -

nebivolol

CYP2D6

-

carvedilol

CYP2D6

Dosage

metoprolol

CYP2D6

Dosage, Efficacy, Metabolism/PK, Toxicity

rivaroxaban

F5

Adverse reactions (risk factor for recurrence of deep vein thrombosis or pulmonary embolism)

perindopril

G6PD SLCO1B1

Adverse reactions (risk of hemolytic anemia)

simvastatin

SLCO1B1

Efficacy, Toxicity

amlodipine

G6PD SLCO1B1

Adverse reactions (risk of hemolytic anemia)

warfarin

VKORC1 PROS1 PROC CYP2C9

Dosage, Efficacy, Metabolism/PK, Toxicity Efficacy Adverse reactions (tissue necrosis) Dosage, Efficacy, Metabolism/PK, Toxicity

It has been reported that a significant proportion of individuals had at least one clinically actionable genotype: Estonian biobank [17], Vanderbilt Pharmacogenotyping Program [18], Qatari biobank [19], Australian cohort [20], Mayo Clinic Biobank [21], UK patients [22], Dutch participants [23] and Canadian paediatric patients [24]. Population-specific findings were revealed, but 91,4% to 99,8% of participants had at least one clinically actionable genotype or diplotype [25]. Unfortunately, most CEA of PGx tests have been performed in hospitals. There is a limited number of CEA of pharmacogenes associated with prescription drugs in primary care, such as antidepressants, statins, and coumarins [26, 27]. This explains the resistance from health insurance companies to reimburse PGx testing for these single gene–drug pairs in primary care on a routine basis. However, evidence for cost-effectiveness for each gene–drug may not be necessary when using a panel approach [28].

292

A. Levitchi et al.

PGx testing services are weakly developed in Moldova as their search revealed only three testing centers (Table 2). EUROLAB and SYNEVO described one and, correspondingly, five products for the pharmacotesting performed by their facilities, while service costs ranged between 1000 and 10 500 MDLs. Alpha Diagnostics has very larger offer, but the service is provided by a foreign company. SNP detection is performed by TaqMan or BHQ probe-based methods, according to the methodological descriptions on their web pages. No genic panels are proposed, a single combination of two genes is advertized for clopidogrel testing. Table 2. Examples of the clinical laboratories offering pharmacogenetic testing as a part of their service in the Republic of Moldova Test name

Tested gene

Laboratory

VKORC1 gene (genetic polymorphism analysis)

VKORC1

SYNEVO Laboratory*

Price, MDL 3460,00

CYP2C19 genotyping

CYP2C19

SYNEVO Laboratory*

2240,00

CYP2C9 genotyping (oral anticoagulant)

CYP2C9

SYNEVO Laboratory*

1500,00

KIF-6 gene polymorphism (statin therapy)

KIF-6

SYNEVO Laboratory*

5150,00

CYP2D6 enzyme genetic variant (Cytochrome P450)

CYP2D6

SYNEVO Laboratory*

10505,00

Clopidogrel testing: ABCB1 gene, Glycoprotein P, CYP2C19 gene, phase II of biotransformation

ABCB1 CYP2C19

Eurolab: Medical Centre and Laboratory**

1000,0

* https://www.synevo.md/categorie/teste-de-biologie-moleculara/teste-de-farmacogenetica/ ** https://www.eurolab.md/ro/product-category/farmacogenetica/

Such discrepancy is explained by the low interest for the tests, relatively high price of the service, and low awareness of adverse reactions. Besides, test results were generated just at the individual level (as a direct-to-consumer service), so a reference source of information is still not available in the country. Several years ago, development of proper sample collections and the implementation of genotyping solutions due to institutional projects 11.817.09.21A (2011–2014), 15.817.04.42A (2014–2019), and EU RESINFRA Programme (2017–2018) was started. Sample accessibility was ensured for several investigations for PhD theses on personalization opportunities for the treatments with warfarin, clopidogrel, and some of the statins. Clinical response to clopidogrel (PharmGKB ID: PA449053) treatment based on the polymorphisms rs4244285, rs4986893 and rs12248560 of the CYP2C19 gene is investigated. It’s mechanism of action prevents platelet activation and aggregation, thereby mitigating the risk of thrombotic events. The results can be implemented in coronary patient

The Implementation of Personalized Medicine in the Republic of Moldova

293

treatment optimization. Clinical benefits were demonstrated in the case of CYP2C19 genotyping implementation as support for guiding antiplatelet stratification [29, 30]. Warfarin (PharmGKB ID: PA451906) is a commonly prescribed oral anticoagulant. It is used to prevent thromboembolic disorders in patients suffering from deep vein thrombosis, atrial fibrillation, recurrent stroke, or those who have undergone heart valve replacement surgery [31]. Albeit its pronounced efficacy, the drug demonstrates a notably narrow therapeutic index, which confers a challenge in precisely administering the optimal dosage [32]. The following polymorphisms are analyzed within the study on warfarin dose variability: rs9923231, rs9934438, rs8050894 of the VKORC1 gene, rs1799853 and rs1057910 of the CYP2C9 gene; and rs2108622 of the CYP4F2 gene. Expected outcomes will allow cost-effective treatment decision-making, as already demonstrated in another economic evaluation for the management of elderly patients with atrial fibrillation who developed ischemic stroke [33]. Statins are widely prescribed pharmaceutical agents globally to treat hypercholesterolemia and the primary prophylaxis of cardiovascular pathologies. One plausible approach to reducing cholesterol levels involves inhibiting the HMG-CoA reductase, thereby curbing the synthesis of cholesterol [34]. Although generally well-tolerated, the most prevalent adverse effect of statins is the emergence of statin-associated musculoskeletal symptoms, which encompassing myalgia, myopathy, and potentially fatal rhabdomyolysis. ABCG2 gene locus rs2231142 and KIF6 gene locus rs20455 are tested to optimize essential hypertension in patients with dyslipidemia.

4 Discussion Current situation in the country corresponds to the level of standard care based on symptoms rather than on particularities of the patient’s organism functionalities, according to the strategies for genome-considered prescription depicted in [35]. The PGx approach reduces the need for prolonged dose adjustments, often associated with adverse outcomes [36], have the potential to identify genetic predisposition to an unfavorable drug response, to distinguish between individuals who respond positively or negatively to a drug, or to suggest the need for a different drug dosage or a different class of drug in selected cases [37]. There are targeted genotyping technologies, focused on a single pharmacogene (if reactive testing is chosen) or several pharmacogenes within a PGx panel [38], or next-generation sequencing techniques, as whole exome or genome sequencing used with bioinformatics-based PGx panels [38]. However, the latter is restricted to research contexts at present [37]. It is expected that with the rapid developments in biotechnology and the concurrent decrease in costs, genotyping techniques will become cost-efficient in the next decade [10]. There are opportunities to develop national programs to provide evidence and support for routine implementation of PGx in clinical practice, as proposed in the Ubiquitous PGx Consortium in the frame of the PREPARE (PREemptive PGx testing for prevention of Adverse drug Reactions) study [39]. Nowadays such studies can be performed within research institutions, academic clinics, and hospitals to generate evidence supporting the PGx implementation [10].

294

A. Levitchi et al.

As in other countries, the practical implementation of PGx testing in the Moldovan healthcare context faces many challenges (Table 3). Integrating pharmacogenetics into clinical practice requires trained medical practitioners. This topic needs to be included in the curricula of the medical education, while training that emphasizes the clinical utility of PGx for incorporation into clinical care is also crucial for patients. In our country, the availability of pharmacogenetic testing services in the commercial and clinical laboratory sectors is limited, resulting in a lack of access to personalized healthcare solutions for citizens. At the same time, demand for Moldavian population reference genetic profiles or any reference data source collecting genetic information and clinical characteristics would facilitate knowledge transferability and evidence-based implementation in clinical practice. It is necessary to carry out validation tests of the associations generated within GWAS. Table 3. Challenges and potential solutions for PGx implementation in the Republic of Moldova Challenges

Potential solutions

Insufficient Pharmacogenetics Awareness

Developing educational initiatives (examples): - curriculum for pharmacist/medicine education, - trainings for laboratory education, - website for patient education etc.

Various incidence of genetic variants among studied populations

Validation of GWAS results in Moldavian population Active surveillance and international collaborations

Assuring the quality of evidence

Selection of the clinically actionable biomarkers in evidence-based manner: - usage of the clinical practice guidelines issued by expert consortia (CPIC, DPWG etc.) - implement gene-drug association validated in several populations with an odds ratio ≥ 3 for risk variants (≤0.3 for protective variants)

Relatively low incidence of severe/life-threatening ADRs

Increase the sample size by national or international collaborations Linking to national or international networks

Time lag from testing to receipt of results

Advance genotyping/sequencing techniques and bioinformatic analysis pipelines to save more time during the experimental process Improve reporting system by computer-based clinical decision support (e.g., electronic health record)

Expensive pharmacogenetic testing services

Assess the cost and effectiveness in various sites (primary care, hospitals) to optimize available health-care resources

The Implementation of Personalized Medicine in the Republic of Moldova

295

PerMed and PGx implementation challenges also address efforts for concept promotion and awareness between medical specialists and patients. The Association of Personalized Medicine in Moldova (AMEDPER) was created in 2020 to organize dissemination events, support and promote piloting 4P medicine principles in the analysis of risk factors for the onset, perpetuation and progression of chronic pain, personalized nutrition etc.

5 Conclusions Implementing Personalized medicine in the Republic of Moldova opens opportunities for innovative approaches in healthcare system management. The demand for cost-effective solutions in primary care and hospitals proposes pharmacogenetic testing to identify patient’s genetic background, its capacity to be the subject of various treatments, and the risk estimation of adverse reactions or the occurrence of complications. National medical insurance organizations are following the evidence of drug usage and safety to support patients by covering the costs of medicines. The lack of technological resources and relevant validation tests increases uncertainty and may lead to malpractice for patients who naturally cannot metabolize. At the same time, low awareness and limited access to knowledge about pharmacogenetic testing can be improved within the framework of the medical education system, empowering doctors with novel approaches in their practice. Additionally, dissemination activities among patients aim to familiarize them with the value of genetic testing and the risks associated with improper drug usage, including cases of self-medication. Thus, the collaboration between the patient and medical specialist is critical to facilitate the complex information provided by pharmacogenetic testing and commit to the treatment plan. It is expected to stimulate demand for PGx testing services and cost competition between commercial laboratories, contributing to the country’s transfer of novel, efficient technological solutions and methodologies. Even though oncology is the main domain exploiting PGx-based drug usage, implementation in CVD treatment is required as soon as possible due to its high burden. Moreover, the National Insurance Agency is expected to be involved in market price regulation to keep the service accessible to a broader population. Existing technological capacities are mainly placed within research institutions. They were obtained using external financial aid or by institutional capital investment. Each laboratory director has to ensure the experiences with consumables, salary wages, and equipment maintenance by applying for competitive institutional funding offered by the government, which is not sufficient to reach the level necessary to validate clinical evidence. On the other hand, collaboration actions with international experts and researchers are implemented for knowledge and skill transfer. Such a strategy must demonstrate Moldavian population genomic variability and allow validation of drug-gene associations with clinical relevance in our country’s primary care and hospital environments.

296

A. Levitchi et al.

Acknowledgments. This work was supported by the project 20.80009.8007.26 “Piloting the application of the principles of personalized medicine in the conduct of patients with chronic noncommunicable diseases”, project leader: Curocichin Ghenadie, contracting authority: National Agency for Research and Development, Republic of Moldova.

Conflict of Interest. The authors declare no conflicts of interest.

References 1. Strengthening pharmacovigilance to reduce adverse effects of medicines. MEMO/08/782. Brussels, December – November (2008). Accessed 27 Apr 2023. http://europa.eu/rapid/pressrelease_MEMO-08-782_en.htm 2. Commission of the European Communities. Commission staff working document Annex 2 of the Report on the impact assessment of strengthening and rationalizing EU Pharmacovigilance. 2008. Brussels, 10.12.2008, SEC (2008) 2671 C6–0514–0515/08 3. Official journal of the European union, council conclusions on personalised medicine for patients, (2015/C 421/03)4 4. Guchelaar, H.-J.: Pharmacogenomics, a novel section in the European journal of human genetics. Eur. J. Hum. Genet. 26, 1399–1400 (2018). https://doi.org/10.1038/s41431-0180205-4 5. Schärfe, C.P.I., et al.: Genetic variation in human drug-related genes. Genome Med. 9, 117 (2017). https://doi.org/10.1186/s13073-017-0502-5 6. Cecchin, E., et al.: Ubiquitous Pharmacogenomics (U-PGx): the time for implementation is now. An Horizon2020 Program to Drive Pharmacogenomics into Clinical Practice. Curr. Pharm. Biotechnol. 18, 204–209 (2017). https://doi.org/10.2174/138920101866617010310 3619 7. Relling, M.V., et al.: The clinical pharmacogenetics implementation consortium: 10 years later. Clin. Pharmacol. Ther. 107, 171–175 (2020). https://doi.org/10.1002/cpt.1651 8. Swen, J.J., et al.: Pharmacogenetics: from bench to byte–an update of guidelines. Clin. Pharmacol. Ther. 89, 662–673 (2011). https://doi.org/10.1038/clpt.2011.34 9. Whirl-Carrillo, M., et al.: Pharmacogenomics knowledge for personalized medicine. Clin. Pharmacol. Ther. 92, 414–417 (2012). https://doi.org/10.1038/clpt.2012.96 10. Bank, P.C.D., Swen, J.J., Guchelaar, H.-J.: Implementation of Pharmacogenomics in Everyday Clinical Settings. In: Pharmacogenetics, pp. 219–246. Elsevier (2018). https://doi.org/10. 1016/bs.apha.2018.04.003 11. Mortalitatea general˘a dup˘a principalele clase ale cauzelor de deces în anul (2020). https:// statistica.gov.md/ro/mortalitatea-generala-dupa-principalele-clase-ale-cauzelor-de-deces-in9460_49930.html 12. Billings, J., et al.: The impact of real-world cardiovascular-related pharmacogenetic testing in an insured population. Int. J. Clin. Pract. 72, e13088 (2018). https://doi.org/10.1111/ijcp. 13088 13. van der Laan, S.W., et al.: From lipid locus to drug target through human genomics. Cardiovasc. Res. 114, 1258–1270 (2018). https://doi.org/10.1093/cvr/cvy120 14. Gyoerffi, M.: European Union. Personalised Medicine - Current Status. Internal Ref: ENVI 2017–15, PE 614.190. ISBN: 978–92–846–2348–8 15. The EP PerMed: the strategic, research & innovation agenda (SRIA) for personalised medicine (2023)

The Implementation of Personalized Medicine in the Republic of Moldova

297

16. Kimpton, J.E., et al.: Longitudinal exposure of English primary care patients to pharmacogenomic drugs: an analysis to inform design of pre-emptive pharmacogenomic testing. Br. J. Clin. Pharmacol. 85, 2734–2746 (2019). https://doi.org/10.1111/bcp.14100 17. Reisberg, S., et al.: Translating genotype data of 44,000 biobank participants into clinical pharmacogenetic recommendations: challenges and solutions. Genet. Med. 21, 1345–1354 (2019). https://doi.org/10.1038/s41436-018-0337-5 18. Van Driest, S.L., et al.: Clinically actionable genotypes among 10,000 patients with preemptive pharmacogenomic testing. Clin. Pharmacol. Ther. 95, 423–431 (2014). https://doi.org/10. 1038/clpt.2013.229 19. Jithesh, P.V., et al.: A population study of clinically actionable genetic variation affecting drug response from the Middle East. NPJ Genomic Med. 7, 10 (2022). https://doi.org/10.1038/s41 525-022-00281-5 20. Mostafa, S., et al.: An analysis of allele, genotype and phenotype frequencies, actionable pharmacogenomic (PGx) variants and phenoconversion in 5408 Australian patients genotyped for CYP2D6, CYP2C19, CYP2C9 and VKORC1 genes. J. Neural Transm. 126, 5–18 (2019). https://doi.org/10.1007/s00702-018-1922-0 21. Ji, Y., et al.: Preemptive pharmacogenomic testing for precision medicine: a comprehensive analysis of five actionable pharmacogenomic genes using next-generation DNA sequencing and a customized CYP2D6 genotyping cascade. J. Mol. Diagn. JMD. 18, 438–445 (2016). https://doi.org/10.1016/j.jmoldx.2016.01.003 22. Turner, R.M., et al.: Multimorbidity, polypharmacy, and drug-drug-gene interactions following a non-ST elevation acute coronary syndrome: analysis of a multicentre observational study. BMC Med. 18, 367 (2020). https://doi.org/10.1186/s12916-020-01827-z 23. Alshabeeb, M.A., et al.: Pharmacogenes that demonstrate high association evidence according to CPIC, DPWG, and PharmGKB. Front. Med. 9, 1001876 (2022). https://doi.org/10.3389/ fmed.2022.1001876 24. Cohn, I., et al.: Genome sequencing as a platform for pharmacogenetic genotyping: a pediatric cohort study. NPJ Genomic Med. 2, 1–8 (2017). https://doi.org/10.1038/s41525-017-0021-8 25. Asiimwe, I.G., Pirmohamed, M.: Drug–Drug–Gene interactions in cardiovascular medicine. Pharmacogenomics Pers. Med. 15, 879–911 (2022). https://doi.org/10.2147/PGPM.S338601 26. Patrick, A.R., Avorn, J., Choudhry, N.K.: Cost-Effectiveness of genotype-guided warfarin dosing for patients with atrial fibrillation. Circ. Cardiovasc. Qual. Outcomes. 2, 429–436 (2009). https://doi.org/10.1161/CIRCOUTCOMES.108.808592 27. Verhoef, T.I., et al.: Cost-effectiveness of pharmacogenetic-guided dosing of warfarin in the United Kingdom and Sweden. Pharmacogenomics J. 16, 478–484 (2016). https://doi.org/10. 1038/tpj.2016.41 28. Brixner, D., et al.: The effect of pharmacogenetic profiling with a clinical decision support tool on healthcare resource utilization and estimated costs in the elderly exposed to polypharmacy. J. Med. Econ. 19, 213–228 (2016). https://doi.org/10.3111/13696998.2015.1110160 29. Cavallari, L.H., et al.: Multi-site investigation of outcomes with implementation of CYP2C19 genotype-guided antiplatelet therapy after percutaneous coronary intervention. JACC Cardiovasc. Interv. 11, 181–191 (2018). https://doi.org/10.1016/j.jcin.2017.07.022 30. Scott, S.A., et al.: Clinical pharmacogenetics implementation consortium guidelines for cytochrome P450–2C19 (CYP2C19) genotype and clopidogrel therapy. Clin. Pharmacol. Ther. 90, 328–332 (2011). https://doi.org/10.1038/clpt.2011.132 31. Rettie, A.E., Tai, G.: The pharmocogenomics of warfarin: closing in on personalized medicine. Mol. Interv. 6, 223–227 (2006). https://doi.org/10.1124/mi.6.4.8 32. Kamali, F.: Genetic influences on the response to warfarin. Curr. Opin. Hematol. 13, 357–361 (2006). https://doi.org/10.1097/01.moh.0000239708.70792.4f

298

A. Levitchi et al.

33. Mitropoulou, C., et al.: Economic evaluation of pharmacogenomic-guided warfarin treatment for elderly Croatian atrial fibrillation patients with ischemic stroke. Pharmacogenomics 16, 137–148 (2015). https://doi.org/10.2217/pgs.14.167 34. Formanowicz, D., et al.: Control of cholesterol metabolism using a systems approach. Biology. 11, 430 (2022). https://doi.org/10.3390/biology11030430 35. Zhou, Y., Lauschke, V.M.: Population pharmacogenomics: an update on ethnogeographic differences and opportunities for precision public health. Hum. Genet. 141, 1113–1136 (2022). https://doi.org/10.1007/s00439-021-02385-x 36. Malsagova, K.A., et al.: Pharmacogenetic testing: a tool for personalized drug therapy optimization. Pharmaceutics. 12, 1240 (2020). https://doi.org/10.3390/pharmaceutics12 121240 37. Barker, C.I.S., et al.: Pharmacogenomic testing in paediatrics: clinical implementation strategies. Br. J. Clin. Pharmacol. 88, 4297–4310 (2022). https://doi.org/10.1111/bcp.15181 38. Shahandeh, A., et al.: Advantages of array-based technologies for pre-emptive pharmacogenomics testing. Microarrays Basel Switz. 5, 12 (2016). https://doi.org/10.3390/microarrays5 020012 39. van der Wouden, et al.: Implementing pharmacogenomics in Europe: design and implementation strategy of the ubiquitous pharmacogenomics consortium. Clin. Pharmacol. Ther. 101, 341–358 (2017). https://doi.org/10.1002/cpt.602

Thiol-Disulfide Homeostasis in Kidney Tumors in Children Jana Bernic1,3(B) , Angela Ciuntu2,3 , Elena Hanganu4 , Victor Roller1,3 Vergil Petrovici5 , Tatiana B˘alutel2,3 , and Eva Gudumac1,3

,

1 Natalia Gheorghiu, Department of Pediatric Surgery Orthopedics and Anesthesiology, Nicolae

Testemitanu State University of Medicine and Pharmacy, Chisinau, Republic of Moldova [email protected] 2 Department of Pediatrics, Nicolae Testemitanu State University of Medicine and Pharmacy, Chisinau, Republic of Moldova 3 Nicolae Testemitanu State University of Medicine and Pharmacy, Chisinau, Republic of Moldova 4 Department of Biomedical Sciences, Gr.T. Popa University of Medicine and Pharmacy, Iasi, Romania 5 Department of Morphopathology and Cytology, Mother and Child Institute, Chisinau, Republic of Moldova

Abstract. Renal tumors in children occupy the 4th place, succumbing to hemoblastomas, tumors of the central nervous system and lymphomas, and constitute 5.5–7.0% of all malignant tumors in children. Emphasis on the severity of renal tumors and identification of the most appropriate means of diagnosis and treatment of children’s kidney tumors. The study was conducted on a group of 11 patients, aged between 2 and 10 years, with renal tumors treated in Natalia Gheorghiu Institute of Mother and Child, National Scientific-practical center of Pediatric Surgery, urology department and IMSP Oncology Institute, oncopediatrics Department. The clinical examination attested paleness and dark shade of the integuments, asymmetry of the abdomen with enlargement in the hypochondrium and the respective flank - tumor formation with lumbar contact. Ultrasound of the urinary system indicated renal tumors in all 11 patients, being confirmed by computed tomography and magnetic-nuclear resonance. In six patients, the tumor was large and required first polychemotherapy treatment, then surgical treatment to remove the renal tumor. After a preoperative preparation with hemostatic preparations, surgical intervention was used to remove the affected kidney on the left in 10 patients. A biopsy of the left kidney tumor was performed in a child with bilateral renal tumor process. Screening of children in the risk group managed by the family doctor would allow early diagnosis in time and in detail to appreciate any pathological changes. Keywords: Kidney Tumors · Children · Wilms Tumor · Thiol-Disulfide Homeostasis · Screening · Early Diagnosis

© The Author(s), under exclusive license to Springer Nature Switzerland AG 2024 V. Sontea et al. (Eds.): ICNBME 2023, IFMBE Proceedings 92, pp. 299–307, 2024. https://doi.org/10.1007/978-3-031-42782-4_32

300

J. Bernic et al.

1 Introduction Renal tumors in children take the fourth place, after hemoblastomas, tumors of the central nervous system and lymphomas, and constitute 5.5–7.0% of pediatric cancers worldwide with a variable distribution by region and ethnicity [1], diagnosed in children under 15 years of age [2]. In recent years, with the help of advanced immunohistochemical microscopy techniques, distinct tumor entities have been identified, which differ from the category of Wilms tumors (WT) in children. WT are embryonic kidney tumors that are almost invariably present before the age of 10 [3]. Among kidney tumors in children nephroblastoma is recorded by frequency on the foreground, about 85% [4, 5] of all pediatrics cancers, which according to reports from the United States of America constitute 500 children per year. The average age for the diagnosis of WT for the male sex is 36.5 months, while for the female sex it is 42.5 months. More than 90% of cases of WT are detected in children under 6 years of age. According to statistics, renal tumors, especially WT, evolve sporadically and only in 2% of cases have a family character [4, 6, 7]. Bilateral WT occur in 4%–13% of patients [8]. The incidence varies considerably depending on diagnosis, age, gender, ethnic affiliation and geographic region. Age-standardized incidence rates (ASR) per million person range to 9.1–9.8 in North America and Europe, 6.7 in Central and South America and Caribbean countries, and 4.1–5.4 for Asians and Pacific Islanders [9, 10]. The highest ASR (10.9) is recorded in black patients in the United States, and the lowest (4.4) in Asian regions [11]. The ASR for Sub-Saharan Africa range from 6.7 to 10.9, with variable ratios due to lack of conclusive records [12]. The relatively stable incidence of the WT in all geographical areas suggests that environmental factors do not play an important role, but different racial groups indicates a genetic predisposition. The distribution of stages varies significantly between countries. In the International Society of Pediatric Oncology (ISPO) WT study (2001), the highest proportion of stage I Disease (53.4%) was observed in Germany and more metastatic diseases (18.2%) in the children’s cancer and Leukemia Group (CCLG) (United Kingdom), Ireland, Australia and New Zealand) [13]. The study “Renal Tumor Biology” COG AREN03B2 and Risk Stratification protocol enrolled 6686 kidney tumor patients by February 2021. Of the patients who received an initial risk classification by September 2020, 91.3% were with unilateral kidney tumors and 8.7% bilateral. Among those with unilateral kidney tumors, 87.8% had WT (82% Wilms tumor [FHWT]: 21% stage I, 24% Stage II, 33% Stage III and 22% Stage IV) and 5.8% anaplastic WT (AWT) [8]. The first prospective BWT study, AREN0534, which enrolled patients with bilateral tumors and unilateral tumors with bilaterally predisposed conditions, reported that 41% were boys and 59% girls. Of all 195 patients who were initially enrolled in the study, 9 patients had hemi-hypertrophy, 7 - Beckwith-Wiedemann spectrum (Bwsp), 6 - Wilms tumor aniridia syndrome (WAGR), 3 - Denys Dash syndrome and 16 isolated abnormalities. Of the total of 189 evaluable patients with bilateral WT, 26 had at least one kidney, with anaplastic WT (AWT) (9 focal and 17 diffuse). Twenty percent had discordant pathology between the two kidneys.Thirty-four evaluable patients in study AREN0534

Thiol-Disulfide Homeostasis in Kidney Tumors in Children

301

had unilateral disease with a predisposing condition WT, of which 62% were girls and 38% - boys [14]. Rates of end-stage kidney disease (ESRD) in children with BWT are also higher compared to those with unilateral tumors. The cumulative incidence of ESRD over 20 years for survivors of unilateral WT was less than 1%; (0.6% in non-syndromic children), while the rate in children with BWT was 12% and much higher in children with genetic syndromes such as Dash Denys syndrome (DDS, 75%) or Wilms TumorAniridia - malformation-Genitourinary-Mental Retardation syndrome (WAGR, 50%) [14]. The renal tumor study group of the ISPO and the renal tumor Committee of the children’s Oncology Group (COG) conducted a literature review on the epidemiology of pediatric malignant kidney tumors globally. This collaboration, the HARMONICA initiative (harmonization and collaboration), represents the joint international effort of kidney tumors. Theoretically, three mechanisms of nephroblastoma development are accepted: 1. Priority development after birth from metanephrogenic blastema. This point of view is argued by the fact that the given tumor even if it also occurs in newborns, its distribution curve stands out with “peak” between 3 and 5 years. 2. Development from differentiated cells. 3. Development from cells with pesistant embryonic potentialities (from nephrogenic and multicystic nephroblastomatous residues). Numerous studies have confirmed these mechanisms [3]. One of the pathogenical mechanisms of cancer is the imbalance between the increased level of oxidative stress and a high level of antioxidants, with the generation of increased reactive oxygen species [15]. Recent studies have demonstrated that functional thiol groups play a major antioxidant role that protects cells and tissue from oxidative damage. A dynamic thiol/disulfide equilibrium plays a very important rol in antioxidant protection and cell processes such as enzymatic regulation, transcription, cell division, cell growth, apoptosis, and cellular signal-transfer mechanisms [16, 17]. In the literature, abnormal thiol/disulfide homeostasis was associated with malignancy, acute renal failure, chronic kidney disease, obstructive uropathy, and autosomal dominant polycystic kidney disease [18, 19]. The increased frequency of nephroblastoma in patients with less common congenital abnormalities has led to the discovery of specific genetic locuses, which predispose to the development of this malignant disease. The loss of heterozygosity of chromosomes 1p and 16q (LOH1p/16q) was detected in 49 of 1147 stage I/II WT patients (4.27%) and 82 of 1364 stage III/IV WT patients (6.01%) enrolled in AREN03B2 [20]. Only 1%–2% of WTS are familial, with a large contribution of de novo (epi)genetic alterations [21]. A Dutch study, describes the presence of epigenetic factors in 33% of children with WT [22], with additional predisposed genes possibly remain to be identified [23]. In western populations, BWS (Beckwith–Wiedemann syndrome) is described as the most commonly diagnosed predisposing syndrome to WT, affecting one in 10,500 children [24]. BWSp is caused by genetic and/or epigenetic changes at the level of 11p15.5 printed regions, which are commonly mosaic-like. Standard diagnostic tests do

302

J. Bernic et al.

not detect low-level mosaic aberrations, and clinical features may be hardly noticeable, risking being underdiagnosed [25]. In a Dutch cohort study in children with WT, which included mosaic genetic mutations and clinical diagnoses, BWSp was identified in 16% of patients [22]. The overall prevalence of WT1 aberrations in the general population is unknown, with fewer than 500 affected people reported worldwide [26]. Even though WT is the most common childhood malignant kidney tumor worldwide, currently renal rhabdoid tumors, renal cell carcinomas (RCC), sarcomas and other rare malignancies are also included in the structure of pediatric oncological pathologies [27]. The aim of this study is to emphasize the severity of kidney tumors and identify the most appropriate means of diagnosis and treatment in kidney tumors in children.

2 Material and Methods The study was conducted on a group of 11 patients with renal tumors treated in Natalia Gheorghiu Institute of Mother and Child, National Scientific-practical center of Pediatric Surgery, urology department and IMSP Oncology Institute, oncopediatrics Department. The male sex prevailed with a ratio of 2: 1. The kidney on the right was affected in 2 girls and 3 boys, on the left – in 3 boys and 2 girls, bilateral damage in 1 girl with bilateral angiomyolipoma. On admission the age of children was in intervals from 3 to 9 years. The initial diagnosis was made with ultrasound, later it was confirmed by computed tomography, biohumoral markers. In all 11 children, thiol-disulfide homeostasis (SH total thiol groups, SH protein thiolic groups, SH free thiolic groups) was evaluated according to the method described by Ellman G. L. [28]. Ethical approval. Written informed consent has been obtained from the children’s legal representatives for the publication of this study and any accompanying images, both orally and in writing, in accordance with the principles of the Helsinki Declaration on medical research involving human subjects.

3 Results The clinical examination attested pale and dull skin tone, asymmetry of the abdomen with enlargement in the hypochondrium and flank respectively-tumor formation with lumbar contact. Rough, irregular, sensitive tumor formation in 2 patients. Pronounced vascular drawing on the abdominal wall having the appearance of venous stasis in 9 patients. In one child, the girl, tumor was detected after an injury in the respective lumbar region. Ultrasound of the urinary system indicated kidney tumors in all 11 patients. Computed tomography was performed in 10 patients. In 1 patient, nuclear magnetic resonance was performed. In 6 patients the tumor was large and these children required primary polychemotherapy treatment, later surgical treatment to remove the kidney tumor. After a preoperative preparation with hemostatic preparations, surgery was resorted to with the removal of the affected kidney on the left in 10 patients. In one child with a bilatental renal tumor process, a biopsy of the tumor of the kidney on the left was performed. Renal angiomyolipoma was detected. In all these patients, histopathological examinations were performed, which indicated the presence of Wilms tumor in 10 children, in 1 child – the presence of angiomyolipoma.

Thiol-Disulfide Homeostasis in Kidney Tumors in Children

303

Table 1. Indices of thiol-disulfide metabolism in children with renal tumors Groups of study

SH- protein thiolic groups, µM/L

SH- free thiol groups, µM/L

SH- total thiol groups, µM/L

Control group

5.74 ± 0,32 100%

96.88 ± 4,20 100%

107.41 ± 1,77 100%

Admission

4.17 ± 0.38** 72.8%

94.73 ± 1.22 97.8%

101.61 ± 1.34* 94.6%

Discharge

4.43 ± 0.72* 77.3%

94.30 ± 2.24 97.3%

107.20 ± 1.30 99.8%

Note: statistically significant difference with control group, * - p < 0.05; ** - p < 0.01

The results of the research presented in the table are manifested in the reduction at the stage of admission of protein thiolic SH – groups (by 27.2%, p < 0.01) and total SHgroups (by 5.4%, p < 0.05). At the stage of discharge in children with kidney tumors, the decrease in the values of protein thiolic SH – groups is maintained (by 22.7%, p < 0.05) relative to the level of the control group. At the same time, at the discharge stage, there was a weak tendency to increase the values of protein thiolic SH-groups (by 6.2%, p > 0.5) compared to the level recorded at admission. Changes in the other indices of thiol-disulfide metabolism in children with kidney tumors were of no statistical relevance. From the data presented in the table it is clear that the most significant changes in children were detected in the research of protein thiolic SH – groups and manifested by the reduction of the values of this index in relation to the stage of admission, as well as to the previous stage-the stage of discharge, which indicates about the high diagnostic value of this index.

4 Discussions The analysis of the sample of cases established the maximum incidence of renal tumor in the given Case WT diagnosed primary at the age of 2.5–5 years, being relatively equal in both sexes. Based on premorbid anamnesis, the presence of stigmata, concomitant external malformations and somatic organs in children has not been detected. According to our study in all children taken in the study WT was diagnosed in the advanced stage of the disease. In a child the abdominal tumor was detected after a sledging trauma with the rupture of the pre-existing tumor, being attested, in addition, at the age of 5 years. In 5 cases the presence of renal tumour was detected occasionally in the USG control. According to the imaging data (USG, CT, MR) in 90% of cases the predominance of Wilms neoplasm with unilateral localization was determined, with a maximum prevalence of 45.0% of cases, being located in the lower pole and 25.0% cases in the upper renal pole. In 20.0% a giant tumor was attested with involvement in 70–85% of the renal parenchyma. Bilateral damage recorded an incidence of 10.0% of cases, of which in case with a non-syndromic evolution at the age of 3 years within the familiar relapsing

304

J. Bernic et al.

nephroblastoma in the second non-twin sister. Imaging and intraoperative review examinations in 65.0% of cases detected the presence of subcentimetic regional lymph nodes and only in 30.0% of cases the presence of reactive locoregional lymphadenopathy was detected, of which with an incidence of 15.0% being metastatic lymphadenopathy, in a case registered at the age of 4 years and 8 months with accretion in the renal sinus, confirmed at the retrospective histological examination. It is worth mentioning that in all evaluated cases, the tumor presented impressive dimensions from 4.8 x 5.2 to large dimensions 9.5 x 8.4 x 7.9 with deformation and asymmetry of the respective flank of the abdomen. In 55.0% of cases the tumor had an extrareal expansion up to 50–60% of the tumor, but with peculiarities of structural, circulatory, sometimes inflammatory disorders of the renal parenchyma. In all cases after examination, including CT with vazography, the treatment included the immediate surgery in 15%, cases with acute abdomen and in 85% cases with the administration of preoperative oncochemotherapeutic treatment in order to shrink the tumor. The maximum prevalence with 50.0% was Wilms tumor in stage - I, with 20.0% in Stage II and Stage III and with a frequency of 10.0% in stage –V. In 30% of cases Wilms tumor in Stage - V (2 children), Stage – II (1 child) and stage – I (3 children) was sensitive to chemotherapy treatment, which ended with enuclear tumoroectomy, in case (Stage-V) being removed by laparoscopic method. After chemotherapy, the children underwent surgical treatment by nephrotumorectomy. Histological examination of the tumor resolved by surgical emergency in 3 children with trauma revealed three-phase features of the tumor component, in 2 of the cases with predominance of the blastoma compared with the stromal-epithelial composition. In cases with the use of chemotherapy, effective particularities were attested in 5.0% of cases - complete necrosis of the tumor, regressive aspects with a prevalence of 25.0% cases - predominance of aspects of coaugulative necrosis, missed, small cell fields, fibrosis aspects, hyalinosis of various intensity, hypocellularity, clumps of foamed macrophages, vascular thrombi in resolution, hemosiderosis, hemorrhages in hemolysis, etc. The persistence of the mixed aspect in equal ratios being attested in 20.0%, and in 15.0% cases the persistence of the blastemic one, and with each 10.0% the predominance of the stromal and epithelial one. According to the histological specific features, activity and viability of the tissue-cell components of Wilms tumor after preoperative chemotherapy, in conjunction with the histological specific features, they were assessed as tumors: favorable “low risk” – 35%, uncertain favorable “intermediate” – 45.0%, unfavorable “high risk” – 5.0% of cases on account of the presence of foci with anaplastic cellular aspects and single mitoses in the outbreak. Depending on the established diagnosis, all patients underwent postoperative treatment with varying intervals according to national and international protocols. During the evaluation period at an interval from the finished treatment of 3 years, 5 years and 7 years, no relapses or metastases were attested, including in cases resolved without preoperative chemotherapeutic treatment, children are still monitored by the family doctor.

Thiol-Disulfide Homeostasis in Kidney Tumors in Children

305

Thiol - disulfide homeostasis plays a key role in antioxidant protection, detoxification, apoptosis, regulation of enzymatic activity, function of some transcription factors and cell signaling mechanisms [7]. Furthermore, thiol-disulfide homeostasis has been implicated in the pathogenesis of many disorders [29]. Thus, we would like to mention that an early diagnosis, adequate and resultant treatment, the respective monitoring determines the increased curability rate of Wilms tumor in children, but it requires work and team coordination: of the pediatrician, family doctor, pediatric urologist, morphopathologist, oncopediatrician leading to the prevention of the spread and metastasis of renal neoplasms. The treatment is multimodal, surgical, chemotherapy, radiotherapy, adapted depending on the staging, the degree of anatomical extension of the tumor. Thus multidisciplinary evaluation: urologist, oncologist, radiologist, morphopathologist allows to achieve cure in 85–90% cases.

5 Conclusions Kidney tumors in children are a difficult diagnosis for both the patient and the medical team. The evolution depends on the early and correct diagnosis with the appropriate therapeutic intervention, and necessarily effective follow-up. In this sense, a particularly important role belongs to the primary medical care, which together with the new possibilities for instrumental and laboratory diagnosis would allow the timely detection of pathological changes. The need for early diagnosis supports current efforts to detect new laboratory strategies, which would allow detection of the process in its early stages, without imagistics changes. Thiol-disulfide homeostasis has a high correlation with the malignant process, so it can be considered an index with predictive value in the case of renal tumors. Aknowledgement. The work was developed within the framework of the project: State program “Personalized modern surgery in the diagnosis and complex treatment of tumors in children”, cipher: 20.80009.8007.06.

Conflict of Interest. The authors declare that they have no conflict of interest.

References 1. Nakata, K., Colombet, M., Stiller, C.A., Pritchard-Jones, K.: Incidence of childhood renal tumours: an international population-based study. Int. J. Cancer 147(12), 3313–3327 (2020). https://doi.org/10.1016/S1470-2045(17)30186-9 2. Stein, R., Graf, N.: Urologic tumors in childhood: nephroblastoma and wilms tumor. In: Merseburger, A., Burger, M. (eds.) Urologic Oncology, pp. 1–9. Springer International Publishing, Cham (2018). https://doi.org/10.1007/978-3-319-42603-7_43-1 3. Chu, A., Heck, J.E., Ribeiro, K.B., et al.: Wilms’ tumour: a systematic review of risk factors and meta-analysis. Paediatric Perinatal Epidemiol. 24(5), 449–469 (2010). https://doi.org/10. 1111/j.1365-3016.2010.01133.x

306

J. Bernic et al.

4. Jain, J., Sutton, K.S., Hong, A.L.: Progress update in pediatric renal tumors. Curr. Oncol. Rep. 23(3), 33 (2021). https://doi.org/10.1007/s11912-021-01016-y 5. Qureshi, S.S., Bhagat, M., Verma, K., et al.: Incidence, treatment, and outcomes of primary and recurrent non-Wilms renal tumors in children: report of 109 patients treated at a single institution. J. Pediatr. Urol. 16(4), 475.e1–475.e9 (2020). https://doi.org/10.1016/j.jpurol. 2020.05.168 6. Alaghehbandan, R., Siadat, F., Trpkov, K.: What’s new in the WHO 2022 classification of kidney tumours? Pathologica 115, 8–22 (2023). https://doi.org/10.32074/1591-951X-818 7. Libes, J., Hol, J., Caetano de Aguirre Neto, J.: Pediatric renal tumor epidemiology: global perspectives, progress, and challenges. Pediatric Blood Cancer 70(1), e30006 (2023). https:// doi.org/10.1002/pbc.30006 8. Dome, J.S., Mullen, E.A., Dix, D.B., et al.: Impact of the first generation of children’s oncology group clinical trials on clinical practice for Wilms tumor. J. Natl. Compr. Canc. Netw. 19(8), 978–985 (2021). https://doi.org/10.6004/jnccn.2021.7070 9. Steliarova-Foucher, E., et al (eds.) International Incidence of Childhood Cancer, Volume III (electronic version). Lyon, France: International Agency for Research on Cancer (2017). Accessed 12 Nov 2020 10. Camargo, B., Oliveira Ferreira, J.M., Souza Reis, R., Ferman, S., Oliveira Santos, M., Pombode-Oliveira, M.S.: Socioeconomic status and the incidence of non-central nervous system childhood embryonic tumours in Brazil. BMC Cancer 11, 160 (2011). https://doi.org/10. 1186/1471-2407-11-160 11. Breslow, N., Olshan, A., Beckwith, J.B., Green, D.M.: Epidemiology of Wilms tumor. Med. Pediatr. Oncol. 21(3), 172–181 (1993). https://doi.org/10.1002/mpo.2950210305 12. Scott, R.H., Stiller, C.A., Walker, L., Rahman, N.: Syndromes and constitutional chromosomal abnormalities associated with Wilms tumour. J. Med. Genet. 43(9), 705–715 (2006). https:// doi.org/10.1136/jmg.2006.041723 13. De Aguirre-Neto, J.C., de Camargo, B., van Tinteren, H., et al.: International comparisons of clinical demographics and outcomes in the international society of pediatric oncology Wilms tumor 2001 trial and study. JCO Glob. Oncol. 8, e2100425 (2022). https://doi.org/10.1200/ GO.21.00425 14. Ehrlich, P.F., Chi, Y.Y., Chintagumpala, M.M., et al.: Results of treatment for patients with multicentric or bilaterally predisposed unilateral Wilms tumor (AREN0534): a report from the children’s oncology group. Cancer 126(15), 3516–3525 (2020). https://doi.org/10.1002/ cncr.32958 15. Xiao, Y., Meierhofer, D.: Glutathione Metabolism in renal cell carcinoma progression and implications for therapies. Int. J. Mol. Sci. 20, 3672 (2019). https://doi.org/10.3390/ijms20 153672 16. Biswas, S., Chida, A.S., Rahman, I.: Redox modifications of protein-thiols: emerging roles in cell signaling. Biochem. Pharmacol. 71, 551–564 (2006). https://doi.org/10.1016/j.bcp.2005. 10.044 17. Circu, M.L., Aw, T.Y.: Reactive oxygen species, cellular redox systems, and apoptosis. Free Radic. Biol. Med. 48, 749–762 (2010). https://doi.org/10.1016/j.freeradbiomed.2009.12.022 18. Otal, Y., et al.: Acute renal failure and thiol-disulphide homeostasis. J. Nephrol. Ther. 8, 312 (2018). https://doi.org/10.4172/2161-0959.1000312 19. Sonmez, M., et al.: Dynamic thiol/disulphide homeostasis as a novel indicator of oxidative stress in patients with urolithiasis. Investig. Clin. Urol. 60, 258 (2019). https://doi.org/10. 4111/icu.2019.60.4.258 20. Dix, D.B., Fernandez, C.V., Chi, Y.Y., et al.: Augmentation of therapy for favorable-histology Wilms tumor with combined loss of heterozygosity of chromosomes 1p and 16q: a report from the Children’s Oncology Group studies AREN0532 and AREN0533. J. Clin. Oncol. 33(s), 1009 (2015). https://doi.org/10.1200/JCO.18.01972

Thiol-Disulfide Homeostasis in Kidney Tumors in Children

307

21. Ruteshouser, E.C., Huff, V.: Familial Wilms tumor. Am. J. Med. Genet. C Semin. Med. Genet. 129C(1), 29–34 (2004). https://doi.org/10.1002/ajmg.c.30025 22. Hol, J.A., Kuiper, R.P., van Dijk, F., et al.: Prevalence of (epi)genetic predisposing factors in a 5-year unselected national Wilms tumor cohort: a comprehensive clinical and genomic characterization. J. Clin. Oncol. 40(17), 1892–1902 (2022). https://doi.org/10.1200/JCO.21. 02510 23. Maciaszek, J.L., Oak, N., Nichols, K.E.: Recent advances in Wilms’ tumor predisposition. Hum. Mol. Genet. 29(R2), R138 (2020). https://doi.org/10.1093/hmg/ddaa091 24. Mussa, A., Russo, S., De Crescenzo, A., et al.: Prevalence of Beckwith–Wiedemann syndrome in North West of Italy. Am. J. Med. Genet. A 161A(10), 2481–2486 (2013). https://doi.org/ 10.1002/ajmg.a.36080 25. Maas, S.M., Vansenne, F., Kadouch, D.J., et al.: Phenotype, cancer risk, and surveillance in Beckwith-Wiedemann syndrome depending on molecular genetic subgroups. Am. J. Med. Genet. A 170(9), 2248–2260 (2016). https://doi.org/10.1002/ajmg.a.37801 26. Lipska-Zi˛etkiewicz, B.S.: WT1 Disorder. In: MP Adam, ed. GeneReviews. University of Washington (1993) 27. Ward, Z.J., Yeh, J.M., Bhakta, N., Frazier, A.L., Atun, R.: Estimating the total incidence of global childhood cancer: a simulation-based analysis. Lancet Oncol. 20(4), 483–493 (2019). https://doi.org/10.1016/S1470-2045(18)3090928. Ellman, G.L.: Tissue sulfhydryl groups. Arch. Biochem. Biophys. 82(1), 70–77 (1953). https:// doi.org/10.1016/0003-9861(59)90090-6 29. Rodrigues, S.D., Batista, G.B., Ingberman, M., Pecoits-Filho, R., Nakao, L.S.: Plasma cysteine/cystine reduction potential correlates with plasma creatinine levels in chronic kidney disease. Blood Purif. 34(3–4), 231–237 (2012). https://doi.org/10.1159/000342627

Non Conventional Methods in Visual Function Training for Children with Sight Disabilities Barbu-Cristian Braun(B)

, Cornelui-Nicolae Drug˘a , Ionel S, erban , and Leonard Mitu

Product Design, Mechatronics and Environment Department, Transilvania University of Bras, ov, Brasov, Romania [email protected]

Abstract. The paper presents a new unconventional method, complementary to the classic ones, by which, through the tablet or laptop, children with different visual impairments can be assisted in the recovery process through assisted visual training. It consists in the repeated testing, through virtual and alternative games, of several aspects - key specific to the visual function, aspects correlated with the main types of pathologies that can occur during childhood. In the first part, the development is presented, through the design, programming and testing of a software interface that was the basis for the development of training through an alternative virtual game. There are presented several steps for the software interface designing and programming. After that, the researches focused on software interface testing, meaning verifying the correct score reported to the test solving and also improving the necessary time required for tests solving. In the second part, it is exemplified how the visual training procedure through the virtual game was applied in complementarity with other classical and nonconventional training procedures, for some concrete cases. As a conclusion, it was found that the method, an accessible one, was, on the one hand, accepted by children, parents, optometrists and educators. On the other hand, the proposed method proved quite effective for the period when the alternative training procedure was applied for the children in question, the test results continuously improving. In the paper is presented just the first step in terms of applying the developed method for visual screening or training activities. Keywords: Visual · Training · Virtual · Games · Testing · Sight · Interface

1 Vision Function Impairments for Children It is known that, among the 5 fundamental senses, the visual function is the most important, over 80% of the information from the environment being provided due to the sight. Obviously, it is demonstrated that in the case of children over 4 years old, up to the period of adolescence, things are the same [1, 2]. The appearance of visual problems, such as Strabismus, Amblyopia, premature Myopia, residual Hyperopia, Nystagmus, etc. it can manifest itself especially at the © The Author(s), under exclusive license to Springer Nature Switzerland AG 2024 V. Sontea et al. (Eds.): ICNBME 2023, IFMBE Proceedings 92, pp. 308–317, 2024. https://doi.org/10.1007/978-3-031-42782-4_33

Non Conventional Methods in Visual Function Training

309

youngest ages. Pathologies such as those mentioned above, if not treated with all attention and effective timely intervention, can worsen and, worse, become irreversible. They can severely affect school performance, daily activities and subsequently even limit the professional career of the person concerned. There have been quite a few cases where the problems have worsened so severely that it has led to low vision or even blindness [3, 4]. This is why visual screening activities in kindergartens and schools should be mandatory and have a periodic character, in order to identify as effectively as possible the cases that require a more in-depth consultation and, subsequently, an appropriate treatment. In certain contexts, a simple careful observation of some behavioral anomalies of the child at school or while playing is also sufficient, in order to be able to ascertain some vision problems. Most of the time, however, a visual screening involves testing vision by classical means, using optotype panels for near and far vision or using specific equipment, such as synoptophore, autorefractometer, etc. To make such a visual screening activity among children more attractive, but also more effective, classic procedures could be simplified and supplemented with unconventional procedures, through game-type tests [5, 6]. Once the type of pathology is identified, the training procedure established by the optometrist and the ophthalmologist is indispensable. If the classic methods based on the use of office equipment have the gift of being effective under the strict supervision of the optometrist or the ophthalmologist, in the case of children older than 12–14 years, the same is not true in the case of younger ones. In this case, boredom occurs, fear of the doctor, which would make such a procedure ineffective. Here, then, in these situations the weight of non-conventional methods, involving training through play, should be predominant [6, 7].

2 Proposed Method 2.1 Solution Explanation Starting from the above-mentioned considerations, an unconventional, alternative method of visual training for the main types of pathologies was proposed, allowing an effective alternation of physical game testing with virtual game testing. In the paper, the focus is especially on the development of the solution for training and testing through virtual game [8]. 2.2 Recommended Steps for Testing and Visual Training The proposed method was based on several studies regarding both the effectiveness and the capture of the attention of the targeted child. Thus, the application of repetitive training procedures (over a period between 2 and 6 months, depending on the nature and severity of the pathology) was proposed as a method. Such a procedure should consist of an evaluation of solving some virtual games for a period of 10–15 min, then an evaluation of the degree of solving some physical games for about 15 min. At the end, there should be an evaluation of the degree of solving some virtual games, for a

310

B.-C. Braun et al.

period of about 10 min. Thus, with breaks, a training session should not exceed an hour and it should be repeated at least once every 2 days. For this purpose, in the visual training procedure, by testing, the evaluation of solving the physical and virtual tests would consist of giving a specific score to the degree of solving in a certain time interval. In addition, the assessment must also include careful observation and interpretation of the subject’s posture while solving the games [8, 9]. 2.3 Description of Games - Tests Specific to a Visual Training Procedure Knowing that, nowadays, virtual games, on the phone, on the tablet, on the laptop, are more attractive than the physical games, it was started from the hypothesis that the application of a training procedure would imply a slightly higher weight for the virtual test games. For this reason, the research focused mainly on the construction of such virtual test games, even if the conception and realization of physical games represented an important stage of the research [8, 10]. In the following, the way in which the software interface was created, which was the basis of the virtual game training, is presented. Also described is how to proceed for this visually assisted training mode. The software interface was designed for 2 categories of children who may suffer from visual problems, from the point of view of age, namely children between 3 and 8 years old - the first category and over 8 years old, the 2nd category. It was considered that up to 8 years of age visual training should be carried out strictly in the presence of a parent, an educator, an optometrist or a doctor, and the tests should be clear and easy, specific to the age group. On the other hand, it can be considered that a child over 8 years old can proceed on his own (after he was explained in advance what the training procedure would consist of), and the test games would have a higher degree of complexity, age specific. For this aim, the software interface allows to choose the age category, due to a Test Ring input variable, related to a Switch Case structure, each one having its own programing algorithm (Fig. 1).

Fig. 1. The selector variable to choose the age category.

Another such text selector was defined to select the type of pathology for which assisted training would be done, being about 5 types of frequent pathologies (Fig. 2). Thus, the interface allows the development of a game-test training prototype for each case of pathology, separately. For amblyopia, the training involves 2 types of tests,

Non Conventional Methods in Visual Function Training

311

Fig. 2. The selector variable to select the type of pathology.

depending on the age category. For children between 3 and 8 years old, the test consists in coloring (by turning on) entities of different shapes, an example being illustrated in Fig. 3.

Fig. 3. Example of test training in a 3- to 8-year-old amblyopic child

In this case, the quantification of the result of solving the test consists in awarding a score that takes into account the correct and incorrect answers. An example of a wrong answer might be omitting the coloring of one of the specified entities. Another example of a wrong answer can be ignition by touch screen or click (next to the entity in question, on the background that surrounds it). Through a repetitive logic algorithm (specific to each individual sequence), the subroutine programming diagram for the score calculation in the above-mentioned case was created. The algorithm consists in generating a 1-D vector of Boolean values, quantifying the totality of correct responses, another similar 1-D vector, quantifying the false-positive responses, as well as a 3rd 1-D vector totaling the wrong responses (pressing next to). Within the algorithm, the conversion from Boolean values to numerical values was programmed for the calculation of partial scores, then, through a multiplexing function, the total score for the respective test can be automatically determined (Fig. 4). Specific to all training in the case of amblyopia, for children over 8 years old, the test consists in evaluating the reproduction grade of some text messages displayed in the indicated text-boxes (Fig. 5). For this, several string input variable were defined, in which, different text message were carried out. For evaluation, the algorithm consisted of a sequence in which, one by one, the written messages were compared with the displayed ones. In case of correlation, a partial score (10 points) is automatically given, otherwise the partial score is 0 (Fig. 5).

312

B.-C. Braun et al.

Fig. 4. The programing algorithm to determine the score for Amblyopia testing in case of 3- to 8-year children

Fig. 5. Example of training in the case of an amblyopic child over 8 years old.

In the case of strabismus, for children between 3 and 8 years old, the programming of the interface was done in such a way that, depending on the type of strabismus and the eye in which it manifests itself, to request the turning off some green or red dots, different sizes. The programming of the response evaluation subroutine in this case was done similarly to the response evaluation subroutine in the case of strabismus training for children between 3 and 8 years of age. In the case of children over 8 years of age, as training against strabismus, they are asked to follow by coloring a route made up of dozens of dots, trying to avoid deviating from the route. For any deviation, the scoring algorithm would include a de-scoring (for each touch of the background on which the route to be followed is drawn). Within the software interface, the training in the case of refractive errors (myopia or hyperopia), it is addressed exclusively to children over 8 years old, for the other category the degree of difficulty is much too high. The requirement in myopia or hypermetropia training is to recognize different symbols, materialized by letters or numbers, the subject

Non Conventional Methods in Visual Function Training

313

having to stay at an imposed distance from the screen, depending on the situation (at least 0.8 m - in the case of myopia and at most 0.3 m - the case of hyperopia). Both if the symbol is not identified in the displayed set, and if other symbols (which were not requested) were false-positively identified, the subject will be de-scored. For training in the case of color perception problems, the requirement, in the case of children under 8 years old, is to extinguish certain stimuli specified as shape, size and color (Fig. 6).

Fig. 6. Example of conducting a test in the training procedure for color perception for a child between 3 and 8 years old.

For children over 8 years of age, the interface has been designed and programmed so that the ability to distinguish between different shades of color can be assessed. It were taken into account the fundamental colors (green, red, yellow, blue and orange). An example of such a test is illustrated in Fig. 7.

Fig. 7. Example of a sequence from running a test for evaluating the ability to distinguish between shades of red

The programming of the software interface for training through virtual game-tests also assumed the possible cases of three-dimensional vision problems. Also for this aspect, two distinct test training procedures were designed and programmed, namely for children between 3 and 8 years old, respectively for children over 8 years old. In both cases, testing consists of identifying 3D entities that are different from the majority of a set of such entities. What differs, however, is their color and size, in the case of children under 8 the 3D entities being much larger and clearer. Figure 8 shows two examples of training by assisted testing, in both postures.

314

B.-C. Braun et al.

The main advantage of this interface is that of flexibility, concretely there is the possibility that both the subject in question can use it (for ages older than 8 years), and the educator or optometrist can use it, guiding the subject (under 8 years) in using to. Another aspect of flexibility refers to the possibility to choose not only the age category, but also the type of training, specific to the type of visual pathology. Thus, the display of results for each procedural stage of training can be done selectively.

Fig. 8. Examples of training by testing 3D vision: a) for 3 to 8 years children; b) for older than 8 years children

Related to the selective evaluation according to the type of training specific to the visual pathology, Fig. 9 shows an example showing the final mark after solving a test within a training procedure in the case of amblyopia for a child having 10 years.

Fig. 9. Example of displaying the final score in an amblyopia training procedure in the form of a play test for a 10-year-old child.

3 Results and Discussion 3.1 Presentation of Results for Intermediate Stages of Visual Training in the Case of Children Identified with Visual Problems So far, the proposed method could be successfully applied to 5 amblyopic children, to varying degrees, aged between 5 and 12 years. For 3 of them, the training procedures specific to the age category 3–8 years were applied, and for the other 2 the procedures were specific to the 2nd age category. The identification of the 5 children with amblyopia type problems was possible following a screening action in a kindergarten, respectively in a class of students in a primary school. In the case of the 5 children identified with amblyopia, the unconventional training procedure through alternative games lasted about a month, through sessions of approximately 45 min, repeated every 3rd day [10].

Non Conventional Methods in Visual Function Training

315

From the point of view of evaluating the degree of solving games - virtual tests specific to amblyopia, during the entire training procedure, for 2 of the children (aged between 3 and 8 years), a considerable improvement of the results could be observed. Table 1. The evolution of the results from the point of view of the points obtained when solving the specific training tests in the case of amblyopia during the entire procedure Period of evaluation

Obtained score for the 1st child [%]

Obtained score for the 2nd child [%]

Obtained score for the 3rd child [%]

Obtained score for the 4th child [%]

Obtained score for the 5th child [%]

initially

50.00

52.35

67.00

62.00

68.56

after a week of training

56.50

63.33

69.50

65.67

69.90

after two weeks of training

65.00

67.00

73.67

68.75

73.67

after three weeks of training

73.00

75.67

75.83

71.45

77.05

obtained score 81.25 after one month of training

83.33

77.50

73.67

79.15

For the other 3 children (2 older than 8 years and one 6 years old) undergoing the same training procedure, the improvement was somewhat less spectacular, as can be seen in Table 1. 3.2 Interpretation of the Results Evolution Over Time During Training Procedure It was found that for 2 of the children undergoing training, the improvement in results was over 30%. This could be explained by the fact that, on the one hand, they are at very young ages, at which the correction of problems such as amblyopia can be done in a very effective way. Another explanation would be that they were very attracted, especially to the virtual test games. On the other hand, in the other 3 children, an improvement in the results could be observed, but less spectacular, on average 12%, which also counts in reducing the severity of amblyopia. The explanation lies, first of all, in the fact that two of them (the majority) are older than 8 years, when, unfortunately, the correction of such pathologies of the visual function can be more difficult and only partial [10].

316

B.-C. Braun et al.

4 Conclusions The described research means just a first step, namely through which a new evaluation methodology, as a prototype could improve the optometric screening activities and also the training visual activities in case of strabismus or squint in children. Furtherly the research activities will be focused on two main directions: the first one refers to extend the proposed methodology, through identification and/or correction for several visual diseases type (also refraction impairments or neuro-motor diseases). The second aspect means the methodology testing for largest samples of scholar and pre-scholar children to demonstrate more clearly its efficiency. The main issue is to use it in the future in kindergartens, schools or pediatric optometric or ophthalmic surgeries. Due to the fact that the method can be easily used also in screening procedures, not only for visual training, it could be widely implemented in the future, being, of course, associated with classical methods and strictly under the supervision of an optometrist and/or a ophthalmologist [7, 10]. Acknowledgments. The research described in the paper was largely due to the contribution of Optometry graduate students, 2021–2022 promotion, within the Diploma Project, the practical activity being carried out in the laboratories of Transilvania University.

Conflict of Interest. The Authors Declare that They Have no Conflict of Interest.

References 1. Craig, S., Marsden, J.: Driving and vision. Int. J. Ophthalmic Practice 2(5), 2016–222 (2011). https://www.researchgate.net/publication/266008741_Driving_and_Vision 2. Hutmacher, F.: What is Our Most Important Sense ?. Front. Young Minds 9, 548120 (2021). https://doi.org/10.3389/frym.2021.548120, https://www.researchgate.net/ publication/353527282_What_Is_Our_Most_Important_Sense 3. Czepita, D., Gosławski, W., Mojsa, A.: Occurence of hyperopy in children in the age of 6 years to 18 years, Polish, Klinika Oczna, vol. 1, pp. 12– 15 (2005). https://www.researchgate.net/publication/7692635_Occurence_of_hyperopia_ among_students_ranging_from_6_to_18_years_of_age 4. Knapik, J., Mi´skowiak, B.: Screening investigations of vision process in the students of karol Marcinkowski Medical Academy in Poznan, Polish, Nowiny Lekarskie, pp. 142 – 147 (2005). https://www.eqar.eu/qa-results/search/by-institution/institution/?id=1968 5. Aral, N., Saglam, M.: Perception development in infants. Current Adv. Educ. 1, 260–262 (2016). https://www.researchgate.net/publication/316877386_Perception_Develop ment_In_Infants 6. Donna, M., Haloran, M.D., Michael, J., Terry, C.: Validity of pure-tone hearing screening at well-child visits. Arch. Pediatr. Adolesc. Med. 163(2), 158–160 (2009). https://pubmed.ncbi. nlm.nih.gov/19188648/ 7. Maryam, S., Mehdi, T., Ghanbari, M.: Visual memory of meaningless shapes in children and adolescents with autism spectrum disorders. Iranian J. Psychiatry 7(3), 104–108, (2012). https://pubmed.ncbi.nlm.nih.gov/23139690/

Non Conventional Methods in Visual Function Training

317

8. Baritz, M.: Visual memory, an integrated mechanism in the information transfer from the vision process to constructive perception, using “serious games”. In: 4th e-Learning and Software for Education Conference eLSE 2018, Bucharest, Romania, p. 90, 91 (2018). https:// proceedings.elseconference_2018 9. Baritz, M.: Serious games for serious vision problems of children. In: 12th e-Learning and Software for Education Conference eLSE, Bucharest, Romania, pp. 498 – 502 (2016). https:// proceedings.elseconference_2016 10. Sandu, B.: Visual training strategies for visually impaired children, Diploma Project, Coordinator: Lecturer Dr. Eng. Barbu Braun (2022)

Method for Increasing the Production or Activity of Catalase in the Body Lilia Andronache1(B) , Valeriana Pantea1 , Emil Ceban1 , Aurelian Gulea2 Vasilii Graur2 , Victor T, apcov2 , Valerii Matcovschii3 , and Valentin Gudumac1

,

1 Nicolae Testemitanu State University of Medicine and Pharmacy, Chisin˘au, ,

Republic of Moldova [email protected] 2 Moldova State University, Chisin˘au, , Republic of Moldova 3 Department of Neurosurgery, Institute of Neurology and Neurosurgery, Chisin˘au, , Republic of Moldova

Abstract. The aim of this study is to develop a new, more sensitive and accurate method for the induction and/or activation of catalase (CAT) in the body. The proposed goal is achieved by using bromo-2-{[2-(prop-2-en-1-ylcarbamothioyl)hydrazinylidene]methyl}phenolatocopper – a coordinating compound from the class of thiosemicarbazidates of transition metals, which expands the arsenal of synthetic compounds with high CAT induction and/or activation activity. The synthesis method of this compound and its structural formula are described. It was established that this compound exhibits the highest induction and/or activation of catalase, which exceeded 2.7 the values of the control group and 1.8 the values produced by vitamin D3 (prototype). This indicates the existence of an excessive synthesis of catalase after exposure to this compound, a particularly important fact established by us for the first time. This compound can be used in medicine as a therapeutic agent, which, by activating the important production of catalase in the body, can prevent and/or reduce the occurrence of neurodegenerative, renal, cardiovascular pathologies, atherosclerosis and carcinogenesis, inflammatory processes, the development of cellular and tissue damage, associated with excessive accumulation of hydrogen peroxide. The obtained data mark a beginning that opens the perspectives of developments, which will diversify the arsenal of effective tools to combat various severe pathological processes. Keywords: Copper coordinating compound · Thiosemicarbazide derivate · Induction and/or activating of the catalase · Multifactorial diseases

1 Introduction Catalase (E.C. 1.11.1.6) is one of the most important antioxidant enzymes. It is present in almost all aerobic organisms which largely alleviates oxidative stress by destroying cellular hydrogen peroxide. Deficiency or impaired functioning of catalase (CAT) is linked © The Author(s), under exclusive license to Springer Nature Switzerland AG 2024 V. Sontea et al. (Eds.): ICNBME 2023, IFMBE Proceedings 92, pp. 318–325, 2024. https://doi.org/10.1007/978-3-031-42782-4_34

Method for Increasing the Production or Activity of Catalase in the Body

319

to the pathogenesis of several age-related degenerative diseases, such as diabetes mellitus, hypertension, anemia, vitiligo, Alzheimer’s disease, Parkinson’s disease, bipolar disorder, cancer, and schizophrenia [1]. Several methods of inducing and/or activating CAT are known, such as method of induction and/or activation of CAT in the liver tissue during experimental carcinogenesis by introducing coffee infusions into animal feed [2], or method of induction and/or activation of CAT in the heart, brain and liver by intravenous administration of norepinephrine or after regional intestinal ischemia [3], or method of inducing and/or activating CAT in human gingival fibroblasts by introducing a phenylurea derivative (N-[2-(2-oxo-1imidazolindinyl)ethyl]-N-phenylurea (EDU) [4], or method based on increasing of the production and/or activation of CAT by introducing vitamin D3 or its derivatives [5]. The disadvantage of this methods lies in the fact that they are not very effective, because they does not ensure the stable, sufficiently high induction and/or activation of CAT in the body, the values of this enzyme approaching the conditions of healthy organisms. Moreover, the method based on increasing of the production or activity of CAT in the body by administering vitamin D3 (cholecalciferol) and its derivatives [5] not only does not ensure a sufficiently large increase in the production or activity of CAT, but increase the risk of toxic side effects such as hypervitaminosis D. Therefore, the problem of the synthesis and evaluation of selective pharmacological agents that would induce or activate CAT in the body is very current. In this aspect, of particular interest are thiosemicarbazide derivatives. The researches carried out in the last decade have revealed their therapeutic efficiency and their prospects for exploitation [6–8]. But their influence on the production and/or activity of CAT in the body until now has not been studied. Based on the above the aim of our study is to develop a new, more sensitive and accurate method for the induction and/or activation of CAT in the body. The proposed goal is achieved by using bromo-2-{[2-(prop-2-en-1-ylcarbamothioyl)hydrazinyli dene]methyl}phenolatocopper (Fig. 1) – a coordinating compound from the class of thiosemicarbazidates of transition metals, which expands the arsenal of synthetic compounds with high CAT induction and/or activation activity.

Fig. 1. Structural formula of bromo-2-{[2-(prop-2-en-1-ylcarbamothioyl)hydra dene]methyl}phenolatocopper ([Cu(HL)Br])

zinyli-

320

L. Andronache et al.

2 Material and Methods Bromo-2-{[2-(prop-2-en-1-ylcarbamothioyl) hydrazinylidene]methyl}phenolato copper ([Cu(HL)Br]) was obtained as a result of interaction of copper(II) bromide with 2-(2-hydroxybenzylidene)-N-(prop-2-en-1-yl)hydrazine carbo thioamide (salicylaldehyde N4-allylthiosemicarbazone, H2L) in ethanol solution. Yield: 8%. IR data (cm–1): 3186, 3105, 1641, 1598, 1356, 1202; λ (MeOH, -1.cm2.mol-1): 115; elemental analysis calcd (%) for C11H12BrCuN3OS: Cu, 16.82; C, 34.98; H, 3.20; N, 11.12; S, 8.49; Br, 21.15; found: Cu, 16.58; C, 35.08; H, 3.23; N, 11.38; S, 8.66; Br, 21.42; magnetic moment value: 1.81 μB. The value of magnetic moment indicates the mononuclear structure of the studied coordination compound. The molar conductivity value of the methanol solution of the studied coordination compound corresponds to the values of the 1:1 type of electrolytes. This means that upon dissolution in methanol the bromide ion is substituted in the inner sphere by methanol molecule, forming complex cation [Cu(CH3OH)(HL)] + and a bromide anion, Br-. The comparison of the IR spectra of H2L and [Cu(HL)Br] indicates the disappearance of ν(O-H) absorbance band, while the positions of ν(C = N), ν(C = S) and ν(C-O) bands undergo a shift. This indicates that 2-(2-hydroxybenzylidene)N-(prop-2-en-1-yl)hydrazinecarbothioamide, during the process of coordination, undergoes deprotonation of the phenol oxygen atom and coordinates with the copper(II) central ion using the deprotonated phenol oxygen atom, azomethine nitrogen atom, and sulfur atom in its thion from. Therefore, two metallacycles are formed: one five-membered and one six-membered. 2-(2-Hydroxy benzylidene)-N-(prop-2-en-1-yl)hydrazine carbothioamide occupies three coordination sites of the copper(II) ion, while the remaining fourth position is occupied by the bromide ion [6–8]. The action of bromo-2-{[2-(prop-2-en-1-ylcarbamothioyl) hydrazinylidene] methyl}phenolatocopper on erythrocyte CAT was evaluated in experiments on a batch of 30 of male white rats weighing 180–230 g, randomly divided into 3 groups of 10 animals in each, according to contemporary principles in the biological standardization of experiences, approved by the Research Ethics Board of “Nicolae Testemit, anu” State University of Medicine and Pharmacy (favorable opinion no. 81 of 19.09.2020) and took place according to the Helsinki declaration with subsequent amendments (Somerset West Amendment, 1996). The first group - the control, consisted of 10 animals, maintained on a standard vivarium diet and which were injected subcutaneously with physiological saline 3 times a week for 4 weeks. Animals of experimental groups 2 and 3 were injected with [Cu(HL)Br] (0.1 μm/kg) and, respectively, vitamin D3 (prototype) (20.0 μm/kg) subcutaneously 3 times a week for 4 weeks. After 24 h from the end of the experiments, the blood was collected for the evaluation of CAT. The erythrocyte mass, obtained after decanting the blood serum, was washed 3 times with physiological serum. CAT activity was determined according to the method described by Korolyuk, et al., and Goth [9, 10] with modifications [11]. The principle of the method is based on the property of CAT to catalyze the degradation of the H2O2 molecule into H2O and O2. Hydrogen peroxide forms a yellow compound with ammonium molybdate. In the reaction process, following the degradation of H2O2, the discoloration of the mixture occurs. The degree of discoloration correlates with the activity of the enzyme

Method for Increasing the Production or Activity of Catalase in the Body

321

and can be estimated by spectrophotometry. The estimation of the CAT activity was carried out as follows: 0.01 ml of erythrocyte mass diluted 1000 times with distilled water (dH2O) was measured in 96-well photometric microplates, after which 0.18 ml of 0.03% H2O2 solution was added. In the control samples, the same amount of dH2O was added instead of H2O2. Then, 3 parallel reference samples were prepared, containing only H2O2 and dH2O. The samples were incubated for 10 min at 37 °C, then 0.10 ml of 4% ammonium molybdate solution was added, shaken and the absorbance was measured at 410 nm. The difference between the absorbance of the reference sample and the experimental sample was calculated. Enzyme activity was calculated using the calibration curve and was expressed in μmol per s per 1 g Hb (μmol/s·g Hb). The statistical evaluation of the obtained data was carried out with the help of the StatsDirect computer program. Arithmetic mean ± error of the mean (X ± m) was calculated. To test the significant difference between the studied indices of the compared groups, the non-parametric “U Mann-Whitney” statistical test and the significance threshold “p” (p < 0.05) were used.

3 Results and Discussion The obtained experimental data regarding the study of CAT induction and/or activation properties of bromo-2-{[2-(prop-2-en-1-ylcarbamothioyl)-hydrazinylidene]methyl} phenolatocopper are presented in the Table 1 from which it is observed that the given compound exhibits higher activity than that produced by vitamin D3 (prototype). Table 1. The influence of bromo-2-{[2-(prop-2-en-1-ylcarbamothioyl) hydrazinyl idene]methyl}phenolatocopper as well as vitamin D3 (prototype) on erythrocyte catalase induction and/or activation properties. Significant difference with the control group (p < 0.05; ** - p < 0.01; *** - p < 0.001) Study groups

Catalase, μM/s.g.Hb (X ± m)

Control group

18,80 ± 1,34 (100%)

Bromo-2-{[2-(prop-2-en-1-ilcarbamotioil)-hidraziniliden] metil}fenolatocupru (0,1 μM/kg)

50,8 ± 2,66*** (270%)

Vitamin D3 (prototype) (20 μM/kg)

28,6 ± 1,42** (152%)

It was established that bromo-2-{[2-(prop-2-en-1-ylcarbamothioyl) hydrazinylidene]-methyl}phenolato-copper, (0.1 μM/kg), exhibits the highest catalase induction and/or activation activity, which exceeded 2.7 the values of the control lot and 1.8 the values of the prototype (Vitamin D3, 20 μM/kg). This indicates the existence of an excessive synthesis of CAT after exposure to this compound, a particularly important fact established by us for the first time. The detected properties of the complex compound [Cu(HL)Br] are of interest for medicine from the point of view of expanding the arsenal of effective synthetic inducers and/or activators of CAT.

322

L. Andronache et al.

Enzyme induction is a process in which a molecule (for example, a drug) causes an increase in the metabolic activity of an enzyme, either by binding to the enzyme and activating it, or by increasing the expression of the gene encoding the enzyme. Enzyme induction is activated when a molecule (called an inducer) enables gene expression. How this happens depends on the control mechanisms as well as differences between prokaryotic and eukaryotic cells [12]. CAT is the most abundant antioxidant enzyme found in the liver, erythrocytes, and alveolar epithelial cells and is the most efficient catalyst for the breakdown of H2O2. The main disadvantage of exogenous CAT purified from various tissues and organs is its very low stability when administered in vivo (half-life in plasma is only 6–10 min) [13], which prevents its wide use as a therapeutic agent. The significance and importance of the CAT induction phenomenon by the complex compound [Cu(HL)Br] emerges from the wide possibilities of practical application of this inducer. Thus, this inducer could be used as a promising remedy for the treatment and prevention of renal fibrosis induced by CAT deficiency [14], or the treatment of some forms of infertility, resulting from the fact that CAT has been detected in mouse oocytes, where it plays the role of protecting the genome from oxidative damage during meiotic maturation [15]. It has been observed that CAT overexpression can drastically reduce the common signs of diabetic cardiomyopathy in a mouse model [16]. Thus, this approach may be an effective therapeutic strategy for the treatment of diabetic cardiomyopathy. Also, CAT therapy can corrects oxidative stress-induced pathophysiology in incipient diabetic retinopathy [17]. Catalase is a key regulator for cellular senescence and aging. Depletion of catalase in mice induce aging through generation of ROS, that interfere with the function of the lysosome by participating in multiple signaling pathways in mammalian target of rapamycin complex 1 (mTORC1). The mTORC1 signaling pathway regulates cell growth, cell proliferation, autophagy and apoptosis. Therefore, the CAT induction could be protective against the toxic hydrogen peroxide generated and the complex compound [Cu(HL)Br] could be used to develop therapeutic interventions on senescent cells that would allow the restoration of lysosome functions by detoxifying hydrogen peroxide [18]. CAT may be an attractive therapeutic target in the context of some forms of cancer, resulting from the fact that alteration of CAT expression in cancer cells favors cell proliferation by inducing genetic instability and activating oncogenes [19]. Senile graying of human hair has been the subject of intense research since ancient times. Reactive oxygen species are involved in hair follicle melanocyte apoptosis and DNA damage. According to some data it is proven that gray hair accumulates hydrogen peroxide (H2O2) due to the impairment of the expression of the main enzymes of melanogenesis - CAT, methionine sulfoxide reductase A and protein B, as well as the activity of tyrosinase, which leads to the gradual loss of hair color. Under this aspect, the complex compound [Cu(HL)Br] could open new strategies for intervention and reversal of the hair whitening process related to aging and oxidative stress [20–22]. Based on the ability of [Cu(HL)Br] to easily penetrate the blood-brain barrier [23], together with its stability in the bloodstream, it could be used for the development of new

Method for Increasing the Production or Activity of Catalase in the Body

323

effective methods for the early diagnosis of serious brain diseases, such as cranial tumors and their metastases, as well as visualization of Alzheimer’s Aβ plaques. Likewise, CAT could be extremely useful for the development of effective therapies for brain and neurological dysfunctions, resulting from the fact that brain CAT activity is extremely low compared to other tissues and organs, such as the liver and kidney. The results of some studies reveal the importance of ion channels such as the transient receptor potential (TRP) as a key component of the neurological Ca2 + ion entry pathway to the harmful action of reactive oxygen species, and CAT can act effectively by suppressing the TRP channel, showing protective effects on neuronal mitochondrial function and neuronal survival [24]. Also, this inducer could be used as an effective remedy for the treatment of many multifactorial diseases (MFD), such as neurodegenerative diseases (Alzheimer’s and Parkinson’s disease, Lewy body dementia, amyotrophic lateral sclerosis, fronto-temporal dementia), psychiatric disorders (bipolar disorder, schizophrenia, anxiety and major depressive disorder, post-traumatic stress disorder, problematic alcohol use disorder), Wilson’s disease, hypertension, some dermatological disorders [25], resulting from the fact that the decrease in CAT activity through oxidative stress plays an important role in the etiopathogenesis of the mentioned above diseases. One of the most severe MFDs is sepsis, a systemic inflammatory response syndrome caused by infections that can lead to organ dysfunction with high mortality (over 25%). The most susceptible to sepsis are people over 65 years of age, young children, immunocompromised patients, as well as patients with autoimmune diseases, tumors, kidney and lung diseases [26]. For this categories of pacients the development of treatments with CAT inducers and/or activators would be a welcome and effective option [26]. Septic shock is also one of the frequent clinical manifestations in severe patients with COVID-19 [27], therefore CAT inducers could be an attractive therapeutic target for the prevention of complications and the medication of SARS-CoV-2 infection. Therefore, the obtained data signify a beginning that opens the perspectives of elaborations, which will diversify the arsenal of remedies to combat various severe pathological processes.

4 Conclusions An effective method of inducing/activating CAT in the body has been developed by using the complex compound - bromo-2-{[2-(prop-2-en-1-ylcarbamothioyl) hydrazinylidene]-methyl}phenolatocopper which can prevent and/or reduces the occurrence of a variety of multifactorial diseases (MFDs), the development of cell and tissue damage, related to the excessive accumulation of hydrogen peroxide. Therefore, the obtained data mark a beginning that opens perspectives of developments, which will diversify the arsenal of effective drugs to combat various severe pathological processes. Further studies are needed to confirm the therapeutic utility of this bioactive compound. Acknowledgments. The authors would like to thank the National Agency for Research and Development (ANCD) of Republic of Moldova for supporting this research by funding the State Program (2020–2023) (research grant No. 20.80009.5007.10).

324

L. Andronache et al.

Conflict of Interests. The authors declare that there is no conflict of interests regarding the publication of this paper.

References 1. Nandi, A., Yan, L.-J., Jana, C.K., Das, N.: Role of catalase in oxidative stress- and age-associated degenerative Diseases. Oxidative Med, Cellular Longevity 2019, Article ID 9613090, 19 (2019) 2. https://doi.org/10.1155/2019/9613090 3. de Magalhães, C.S., Takarada, J.E., Carvalho, N.C., et al.: The coffee protective effect on catalase system in the preneoplastic induced rat liver. J. Chem. 2016, Article ID 8570321, 9 (2016). https://doi.org/10.1155/2016/8570321 4. Kim, Y.-H., Chun, Y.-S., Park, J.-W., et al.: Involvement of adrenergic pathways in activation of catalase by myocardial ischemia-reperfusion. Am. J. Physiol. Regulatory Integrative Comp. Physiol. 282(5), R1450-R1458 (2002) 5. Stevens, T.M., Boswell, G.A., Jr., Adler, R., Ackerman, N.R., Kerr, J.S.: Induction of antioxidant enzyme activities by a phenylurea derivative. EDU. Toxicol Appl. Pharmacol. 96(1), 33–42 (1988) 6. Sposoby uvelicheniya proizvodstva ili aktivnosti katalazy [Method to increase the production or activity of catalase] Ru 2012 157 084 a 7. Graur, V.: Designul s¸i sinteza compu¸silor biologic activi ai metalelor 3d cu 4alilcalcogensemicarbazone s¸i deriva¸tii lor [Design and synthesis of biologically active compounds of 3d metals with 4-allylalkogensemicarbazone and their derivatives]. Autoreferat al tezei de doctor în s, tiint, e chimice [Reference of the doctoral thesis in chemical sciences]. Chis, in˘au, 30 p. (2017) 8. Gulea, A., et al.: Utilizarea compus, ilor coordinativi ai s˘arurilor de cupru(II) cu 2-(2hidroxibenziliden)-N-(prop-2-en-1-il)-hidrazincarbothioamida în calitate de inhibitori ai radicalilor superoxizi [The use of coordination compounds of copper (II) salts with 2-(2hydroxybenzylidene)-N-(prop-2-en-1-yl)-hydrazine carbothioamide as inhibitors of superoxide radicals]. Brevet de invent, ie MD [Patent of invention MD] nr. 4749. Publ. BOPI nr. 3/2021. P. 52–53 9. Gulea, A.E., Zariciuc, E., Graur, V., Tsapkov, V., Rudic, V.: The study of antimicrobial and antitumor activity of biometal coordination compounds of substituted salicylaldehyde 4allylthiosemicarbazones. In: International Scientific Conference on Microbial Biotechnology, 3 edn, Chi¸sin˘au, Moldova, 12–13 October, Abstracts, pp. 67–68 (2016) 10. Korolyuk, M.A., et al.: Metod opredeleniya aktivnosti katalazy [Method for determining catalase activity]. In: Labor.Delo, vol. (1), pp. 16–19 (1988) 11. Góth, L.: A simple method for determination of serum catalase activity and revision of reference range. Clinica Chimica Acta. Inter. J. Clin. Chem. 196(2–3), 143–151 (1991). https:// doi.org/10.1016/0009-8981(91)90067. PMID 2029780 12. Metode de cercetare a metabolismului hepatic. Elaborare metodic˘a [Research methods of liver metabolism. Methodical elaboration]. Gudumac V., Rîvneac V., Tagadiuc O., Sardari V., Rîvneac E., Andronache L., Stîrba ¸ O., Pantea V., Popa V. Sub red. Valentin Gudumac; Univ. de Stat de Medicin˘a s¸i Farmacie „Nicolae Testemi¸tanu”. – Ch.: S.n., 2012 (Tipogr. „Tehnica-Info”). – 162 p. (2012) 13. Klappenbach, L.: Prokaryotes Vs. Eukaryotes: What Are the Differences? Thought Co (Apr 5 2023). thoughtco.com/what-are-prokaryotes-and-eukaryotes-129478 14. Qi, H., Shan, P., Wang, Y., Li, P., Wang, K., Yang, L.: Nanomedicines for the efficient treatment of intracellular bacteria: the “ART” principle. Front. Chem. 9, 7 (2021) https://doi.org/10. 3389/fchem.2021.775682

Method for Increasing the Production or Activity of Catalase in the Body

325

15. Kobayashi, M., Sugiyama, H., Wang, D.-H., et al.: Catalase deficiency renders remnant kidneys more susceptible to oxidant tissue injury and renal fibrosis in mice. In: Kidney International, vol. 68, pp. 1018–1031 (2005) 16. Park, Y.S., You, S.Y., Cho, S., et al.: Eccentric localization of catalase to protect chromosomes from oxidative damages during meiotic maturation in mouse oocytes. Histochem. Cell Biol. 146, 281–288 (2016) 17. Ye, G., Metreveli, N.S., Donthi, R.V., et al.: Catalase protects cardiomyocyte function in models of type 1 and type 2 diabetes. Diabetes 53(5), 1336–1343 (2004) 18. Giordano, C.R., Roberts, R., Krentz, K.A., et al.: Catalase therapy corrects oxidative stressinduced pathophysiology in incipient diabetic retinopathy. Invest. Ophthalmol. Vis. Sci. 56(5), 3095–3102 (2015) 19. Dutta, R.K., Lee, J.N., Maharjan, Y., et al.: Catalase-deficient mice induce aging faster through lysosomal dysfunction. Cell Commun Signal 20, 192 (2022). https://doi.org/10.1186/s12964022-00969-2 20. Glorieux, C., Calderon, P.B.: Catalase, a remarkable enzyme: targeting the oldest antioxidant enzyme to find a new cancer treatment approach. Biol. Chem. 398(10), 1095–1108 (2017) 21. O’Sullivan, J.D.B., et al.: The biology of human hair greying. Biol Rev Camb Philos Soc. 96(1), 107–128 (2021). https://doi.org/10.1111/brv.12648. Epub 2020 Sep 23 PMID: 32965076 22. Wood, J.M., Decker, H., Hartmann, H., et al.: Senile hair graying: H2O2mediated oxidative stress affects human hair color by blunting methionine sulfoxide repair. FASEB J. 23(7), 2065–2075 (2009) arXiv:0706.4406. https://doi.org/10.1096/fj.08125435. PMID 19237503. S2CID 16069417 23. Seiberg, M.: Age-induced hair greying - the multiple effects of oxidative stress. Int, J, Cosmet, Sci. 35(6), 532–538 (2013). https://doi.org/10.1111/ics.12090. Epub 2013 Oct 10 PMID: 24033376 24. Xue, F., Zhang, Y., Jiang, W., et al.: Regulation of copper transport crossing brain barrier systems by Cu-ATPases: effect of manganese exposure. Toxicol. Sci. 139(2), 432–451 (2014) 25. Nazıro˘glu, M.: Molecular role of catalase on oxidative stress-induced Ca2+ signaling and TRP cation channel activation in nervous system. J. Recept. Signal Transduction 32(3), 134–141 (2012) 26. Wingo, T.S, Liu, Y., Gerasimov, E.S., et al.: Shared mechanisms across the major psychiatric and neurodegenerative diseases. Nat Commun. 13(1), 4314 (2022). https://doi.org/10.1038/ s41467-022-31873-5. PMID: 35882878; PMCID: PMC9325708 27. Li, F., et al.: An antioxidant enzyme therapeutic for sepsis. Front, Bioeng, Biotechnol. 23(9), 800684 (2021). https://doi.org/10.3389/fbioe.2021.800684.PMID:34888304;PMCID: PMC8650590 28. Chen, S., Gao, Z., Hu, L., et al.: Association of Septic Shock with Mortality in Hospitalized COVID-19 Patients in Wuhan, China. Advances in Virology. Article ID 3178283, 9 pages (2022). https://doi.org/10.1155/2022/3178283

Synergy Effect of Ascorbic Acid and α-Tocopherol in Kinetic Model of Lipid Peroxidation Evghenii Kanarovskii(B) and Olga Yaltychenko Institute of Applied Physics, Moldova State University, Chis, in˘au, Republic of Moldova [email protected]

Abstract. The synergy effect of α-tocopherol and ascorbic acid (vitamins E and C) is taken into account in the presented theoretical model of the kinetics of the process of lipid peroxidation (LPO). An analysis of the features in the course of the LPO process with the participation of vitamins E and C made it possible to apply the appropriate approximations that simplify the model system of differential equations. For cell membranes, it is characteristic that the lipid substrate and oxygen are in excess, as well as ascorbate, according to experimental data, should be considered in excess. Thus, the concentrations of reagents in excess are constant model parameters. Applying the quasi-stationary approximation to lipid radicals further simplifies the model. The synergy effect is primarily related to the ability of ascorbate to regenerate α-tocopherol, thereby protecting it from both depletion and prooxidant effect. This effect at a given concentration of α-tocopherol is enhanced with increasing concentration of ascorbate, but the ratio of ascorbate and α-tocopherol concentrations should not exceed 100, since at high concentrations the ascorbate is also able to act as a prooxidant. As a result, analytical expressions were obtained for the kinetic curves of vitamin E (in its two forms) and the main LPO product (lipid hydroperoxide). This model is minimal and quite adequately describes the LPO process. The features of the synergy effect of vitamins E and C and its significance for the effective control of the LPO process as a whole are discussed. Keywords: Cell Membranes · Lipid Peroxidation · Kinetics · Radicals · Antioxidants · Synergy Effect · Ascorbate · α-Tocopherol

1 Introduction The necessary conditions for normal cell activity are the structural and functional stability of cell membranes [1]. Lipid antioxidants, acting as inhibitors of chain radical reactions [1, 2], effectively provide a prompt protection of cell membranes from the harmful effects of lipid radicals and reactive oxygen species. The main lipid antioxidant is α-tocopherol (vitamin E) [2–4]. In this work, the antiradical activity of vitamins E and C in the process of lipid peroxidation (LPO) in the cell membranes is modeled, taking into account their synergy. The synergy effect is that ascorbate (vitamin C) regenerates α-tocopherol from © The Author(s), under exclusive license to Springer Nature Switzerland AG 2024 V. Sontea et al. (Eds.): ICNBME 2023, IFMBE Proceedings 92, pp. 326–332, 2024. https://doi.org/10.1007/978-3-031-42782-4_35

Synergy Effect of Ascorbic Acid and α-Tocopherol in Kinetic Model

327

its oxidized and radical forms. It should be emphasized that since vitamins E and C are exogenous antioxidants, i.e. they are not synthesized in the human body, a complete diet is important to ensure their physiologically optimal concentrations in the body. The metabolic action of ascorbic acid is multifunctional. The basis of the various physiological functions carried out by ascorbate in the body is its ability to act as an electron donor. In many biochemical reactions, ascorbate is involved as a reducing agent and as a coenzyme in a number of metabolic processes, regulating H+ transport [5]. Also, ascorbic acid plays an important biological role as an antioxidant, protecting the body from excess free radicals. As a reducing agent, vitamin C is one of the most abundant in the body. It is characterized by the presence of different active forms that easily turn into each other. So, its main forms are: reduced AscH2 , oxidized Asc (dehydroascorbate, DHA), anionic AscH– (semi-DHA) and radical Asc•– . At physiological values of pH AscH– is the dominant form (over 99.9%) [5–7]. Note also that the concentration of the ascorbate radical Asc•– in blood plasma can be used as one of the markers of oxidative stress. When identifying Asc•– , the method of electron paramagnetic resonance is usually used, and when measuring the kinetics of Asc•– , the method of UV spectroscopy is used [5]. It should be emphasized that glutathione (GSH), the main endogenous antioxidant, is involved in the recycling of ascorbate from DHA [6]. A detailed scheme of different forms of ascorbic acid and their mutual transformations is presented in [7] (see Fig. 1 there), and the scheme of interactions of α-tocopherol with lipid radicals in the cell membrane and with ascorbate in the interphase, i.e. at the boundary between the hydrophilic and hydrophobic phases, is presented in [8] (see Fig. 1 there). Both forms of α-tocopherol (InH and In•) are effective in inactivating lipid radicals (ROO•, RO•, R•). Wherein, it is important that α-tocopherol in the InH form most rapidly inactivates the ROO. radical [9–11], which provides a propagation of radical chain. The rate constant of this reaction (ki1 ) is quite high and has a wide range of values due to the diversity of lipids [10, 11]. So, in numerical simulation, the value ki1 =106 M–1 s–1 is usually used. Thus, in the presence of α-tocopherol, the rate of oxidation of the lipid substrate (RH) decreases significantly. At the same time, in the absence of ascorbate, the concentration of InH rapidly decreases, and the concentration of In• increases, so that at sufficiently high [In•], the prooxidant effect of α-tocopherol begins to appear due to the reaction reverse to the inactivation reaction of the R• radical [2, 4]. Consequently, the concentration of the R• radical will begin to grow again, which will accelerate the LPO process. The key factor for blocking the prooxidant effect of α-tocopherol is the reducing effect of ascorbate on the In• form of α-tocopherol. As a result, [In•] decreases and [InH] increases, which ultimately leads to the inhibition of the LPO process. Note that for the optimal manifestation of the synergy effect of vitamins E and C, the concentration ratio “α-tocopherol / ascorbate” should be from 1:10 to 1:100. Whereas, the concentration ratio [InH] / [RH] of the order of 1:1000 is considered physiologically normal in vivo [8–10].

2 Theoretical Model, Results and Discussions To take into account the synergy effect of vitamins E and C in the basic model system of differential equations describing the LPO kinetics [1], it is sufficient to add terms to the kinetic equations for the radical form (In•) and reduced form (InH) of α-tocopherol that

328

E. Kanarovskii and O. Yaltychenko

correspond to the contribution of the reaction In• with ascorbate in its AscH– form. The rate constant of this reaction is quite high: ka =2 × 105 M–1 s–1 [8]. During this reaction, which occurs in the interphase [8], the hydrogen atom is transferred from AscH– to the In• radical, and the Asc•– and InH radicals are formed. Ascorbate radical Asc•– is an inactive radical, and besides, it easily dismutates to AscH– and DHA (kdism =2 × 105 M–1 s–1 , pH 7) [7]. As a consequence, the regenerative action of vitamin C on vitamin E is so effective that there are no noticeable changes in the concentration of vitamin E up to a significant depletion of vitamin C [4, 9]. Eventually, the kinetic model in the presence of ascorbate can be simplified by neglecting the contributions of recombination reactions involving In•. In this case, the equality [In•] + [InH] = const is maintained. It is essential that the regeneration of the radical form of α-tocopherol is provided by the semi-DHA form of ascorbic acid, which is dominant in the human body due to the specificity of the chemical equilibrium of different mutually transforming forms of ascorbate. As a consequence, to describe the regenerative action of ascorbate on αtocopherol, it is sufficient to take into account only one reaction in the LPO kinetic scheme. This leads to minimal modification in the LPO kinetic scheme, moreover, it is possible to make the additional simplifications (see below) in order to obtain the analytical solutions for the proposed model. The model system corresponding to the standard LPO kinetic scheme [1] is used here as a base one, but the extended model proposed in [2] can also be used. As a result, the minimal model for describing the LPO kinetics, taking into account the synergy of ascorbate and α-tocopherol, looks like: dR/dt = wi + kR1 SR1 − kR YR − ki I1 R

(1)

dR1 /dt = kR YR − kR1 SR1 − ki1 I1 R1 − k2r1 R21 ,

(2)

dI1 /dt = ka I2 A − ki I1 R − ki1 I1 R1 ,

(3)

dI2 /dt = ki I1 R + ki1 I1 R1 − ka I2 A,

(4)

dP1 /dt = kR1 SR1 + ki1 I1 R1 − (kd 1 + kd 2 )P1 .

(5)

Here, the notations are introduced: S = [RH], Y = [O2 ], R = [R•], R1 = [ROO•], I 1 = [InH], I 2 = [In•], A = [AscH– ], P1 = [ROOH]. In the given system of differential equations, the constant wi is the LPO initiation rate, which takes into account the influx of the R• radical from outside [1]. The corresponding reaction rate constants are: kd 1 and kd 2 – for the breakdown of lipid hydroperoxide ROOH (homolytic, with the formation of the RO• radicals, and heterolytic, without their formation), ki and ki1 – for the inactivation of radicals R• and ROO•, kR1 – for the radical oxidation of the RH substrate by the ROO• radicals, k2r1 – for the quadratic recombination of the ROO• radicals. In this model, it is assumed that the lipid substrate RH, oxygen O2 and ascorbate in the semi-DHA form AscH– are present in excess, i.e. in the first approximation, their concentrations can be considered constant: S≈S 0 , Y ≈Y 0 , A≈A0 . It should be noted that the rate constant of the reaction of R• and O2 is very high: kR =107 ÷ 108 M–1 s–1 [1, 8]. As a result, and taking into account the fact that the oxygen concentration in the

Synergy Effect of Ascorbic Acid and α-Tocopherol in Kinetic Model

329

liquid-phase bio-systems is quite high, the following condition is fulfilled [1]: [ROO•] > > [R•], [RO•]. Thus, the ROO• radical plays the main role in the radical oxidation process, and therefore, in this model, only quadratic recombination for the ROO• radical is taken into account. The above inequality for the concentrations of lipid radicals and the arguments presented in [4] justify neglecting the contribution of the RO• radical to the kinetics of the LPO process involving ascorbate and α-tocopherol, because acting together, they actually block the branching of radical chains. In this case, ascorbate plays a decisive role, because it remains in excess as before, since only an insignificant part of it is involved in the inactivation of the RO• radical. Additionally, following [4], it is assumed here that the reagents in the cell membrane are uniformly distributed, so that diffusion limitations on the reaction rates are also not taken into account. In accordance with the performed approximations, the model (1)–(5) admits analytical solutions. The maximum concentrations of lipid radicals R• and ROO• are calculated using quasi-stationary conditions for the Eqs. (1) and (2), which become algebraic and easily solved. Thus, in the presence of α-tocopherol, the quasi-stationary concentration (R1 ) of the main lipid radical ROO• satisfies the equation: 2

wi = (k2r1 R1 + ki1 I 1 R1 ).

(6)

In the absence of α-tocopherol, when the LPO process is not controlled by the inhibitor InH, from (6) (see also [1]) the quasi-stationary concentration of the ROO• radical (R1,0 ) is obtained: R1,0 = (wi /k2r1 )1/2 .

(7)

R1 /R1,0 = (1 + α)−1/2 , α = (ki1 I 1 /k2r1 R1 ).

(8)

From (6) and (7) it follows:

According to (8), as the inhibitor concentration I 1 increases, the concentration R1 −1 2 decreases, so that at large α (α  1) R1 ∼ I 1 and α ∼ I 1 . Since, S≈S 0 , Y ≈Y 0 , A≈A0 , and for the radicals ROO• and R• it is used that R1 ≈ R1 and R ≈ R then the differential Eqs. (3) and (4) for I1 and I2 can be solved analytically: I1 /I0 = γa /γ + (γ1 /γ)exp(−γt),

(9)

I2 /I0 = (γ1 /γ)[1 − exp(−γt)].

(10)

Here: γa = ka A0 is the effective rate constant of the reduction reaction of the αtocopherol radical (In•) with ascorbate, γ1 = (ki R + ki1 R1 ) is the total effective rate constant of the inactivation reactions of the lipid radicals R•, ROO• with α-tocopherol, and γ = γa + γ1 . At the same time, from the inequalities R1  R and ki < ki1 , it turns out that ki R/ki1 R1  1, and this gives: γ1 ≈ ki1 R1 . As follows from (9) and (10), over time, the quantities I1 and I2 tend to their limit values I 1 = (γa /γ)I0 and I 2 = (γ1 /γ)I0 . This trend to a saturation of the concentrations of the two forms of α-tocopherol is realized so that its total concentration remains constant (I0 ). Curves I1 (t) and I2 (t) shown in Fig. 1 correspond to γa /γ1 = 4.

330

E. Kanarovskii and O. Yaltychenko

Fig. 1. Time dependences of the concentrations of the two forms of the inhibitor (in relative units, τ = γt). Curve 1 is for the reduced form I 1 (τ), and curve 2 is for the radical form I 2 (τ).

It should be noted that in the absence of ascorbate, the concentrations of both forms of α-tocopherol at large t will tend to zero, since InH transforms into In•, which is then gradually consumed up to zero in recombination reactions with lipid radicals [4]. Thus, it is important that the synergy effect of vitamins E and C leads to saturation of the concentrations of the two forms of α-tocopherol at non-zero levels. Moreover, the higher the ascorbate concentration, the higher the saturation level for I1 and the lower for I2 . Further, since the concentrations I1 and I2 quickly reach the saturation levels I 1 and I 2 , then the differential Eq. (5) for the LPO product P1 (ROOH) can also be solved analytically. As a result (at t > 1/γ) it turns out:    P1 = kR1 S0 R1 + ki1 I 1 R1 1 − exp(−kd t) /kd . (11) The notation used here is: kd = kd + kd . Similarly, in the absence of α-tocopherol, it turns out:    P1,0 = kR1 S0 R1,0 1 − exp(−kd t) /kd .

(12)

Further, when using the ratio of functions P1 from (11) and P1,0 from (12), it turns out that: P1 /P 1,0 = [1 + ki1 I 1 /kR1 S0 ](R1 /R1,0 ).

(13)

Then, using the expressions for α and R1 /R1,0 from (8) and the fact that the ratio (k 2r1 R1,0 /kR1 S0 )  1, it is easy to show that: P1 < P1,0 , even for small values of α (α < 1), and as α grows, this inequality becomes stronger. Graphically, this is clearly seen in Fig. 2, which shows the time dependences P1,α (t) at different values of α. Thus, α-tocopherol, acting as an inhibitor, significantly lowers the quasi-stationary concentrations of lipid radicals (primarily ROO•). As a result, the LPO process slows down and the maximum concentration levels of LPO products also noticeably decrease. In turn, ascorbate, acting as a synergist, protects α-tocopherol from both depletion and prooxidant effect, maintaining the concentration of its reduced form InH at a high level,

Synergy Effect of Ascorbic Acid and α-Tocopherol in Kinetic Model

331

Fig. 2. Time dependence of the concentration of the LPO product P1,α (τ) (in relative units, τ = k d t). Curve 1 – at α = 0, curve 2 – at α = 1, and curve 3 – at α = 5.

and the concentration of its radical form In• at a low level, respectively. The quantity I 1 depends on the parameter A0 , increasing with its growth. In this case, the parameter α becomes larger with increasing I 1 , and as shown above, the values R1 /R1,0 and P1 /P 1,0 decrease with growth of α. Ultimately, at a sufficient level of conjugated antioxidants (vitamins E and C), the quasi-stationary regime for lipid radicals will end with a decrease in their concentrations. Consequently, the accumulation of LPO products will stop and the concentration of P1 , having reached a maximum, will also begin to decrease.

3 Conclusions The synergy effect is extremely important as a mechanism for protecting lipid molecules (and proteins) from oxidation, since there are no specialized enzymes in the cell that regenerate α-tocopherol radicals [8]. It should be noted that despite the fairly large amount of experimental data on the synergy effect of vitamins E and C in the LPO process [7–9], there was no analytically solvable model to take this effect into account. This article presents a minimal theoretical model for describing the effect of synergy of conjugated antioxidants in the LPO process, which can be applied not only to the pair of ascorbate and α-tocopherol, but also to other conjugated pairs of antioxidants with a similar mechanism of action. It has been shown that the appearance in the bio-system of an additional antioxidant (ascorbic acid), which exhibits a synergy with the main lipid antioxidant (α-tocopherol), leads to the renewal of the concentration level of its reduced form in the cell membranes, protecting α-tocopherol from depletion and blocking its ability to act as a prooxidant. Thus, the synergy effect of vitamins E and C becomes a key factor determining the effectiveness of the control over the process of peroxidation of both lipids and proteins in general. It should also be emphasized that due to the synergy of vitamins C and E, a reliable control of the LPO process can be provided by lower doses of α-tocopherol. In conclusion, it should be mentioned that ascorbate has attracted the attention of researchers as a promising adjuvant in the treatment of oncology [7] due to its prooxidant

332

E. Kanarovskii and O. Yaltychenko

activity associated with the reduction of metals of variable valence, such as iron and copper. Because the ascorbate is able to accumulate in malignant cells, then in the presence of transition metals, hydrogen peroxide (H2 O2 ) will also accumulate in them. Accordingly, ascorbate will also be involved in the synthesis of the hydroxyl radical (HO•) by the Fenton reaction [7], which ensures the death of malignant cells. Acknowledgments. This work was supported by projects ANCD 20.80009.5007.14 and ANCD 20.80009.5007.27. Conflict of Interest. The Authors Declare that They Have no Conflict of Interest.

References 1. Rubin, A.B.: Biophysics. Manual for biological specialties of higher education institutions. Book 2: Biophysics of cellular processes. Vysshaya Shkola, Moscow (1987). (in Russian) 2. Kanarovskii, E.Y., Yaltychenko, O.V., Gorinchoy, N.N.: Kinetics of antioxidant activity of α-tocopherol and some of its homologues: Part 1. Review: Theoretical model. Surface Eng. Appli. Electrochem. 54(5), 481–497 (2018). https://doi.org/10.3103/S1068375518050058 3. Lucarini, M., Pedulli, G.F.: Overview of antioxidant activity of Vitamin E. In: Preedy, V.R., Watson, R.R. (eds.) The Encyclopedia of Vitamin E, pp. 3–10. CABI Publishing, Wallingford, UK (2007) 4. Kanarovskii, E.Y., Yaltychenko, O.V.: Accounting for the synergy of vitamins E and C in the kinetic model of lipid peroxidation. Elektronnaya Obrabotka Materialov 58(5), 44–50 (2022) (in Russian) https://doi.org/10.52577/eom.2022.58.5.44 5. Davis, M., Austin, J., Patridge, D.: Vitamin C: Chemistry and biochemistry. Mir, Moscow (1999) (in Russian) 6. Linster, C.L., Van Schaftingen, E.: Vitamin C. Biosynthesis, recycling and degradation in mammals. FEBS J. 274(1), 1–22 (2007). https://doi.org/10.1111/j.1742-4658.2006.05607.x 7. Du, J., Cullen, J.J., Buettner, G.R.: Ascorbic acid: Chemistry, biology and the treatment of cancer. Biochimica et Biophysica Acta (BBA) – Rev. Cancer 1826(2), 443–457 (2012). https:// doi.org/10.1016/j.bbcan.2012.06.003 8. Buettner, G.R.: The pecking order of free radicals and antioxidants: lipid peroxidation, αtocopherol, and ascorbate. Arch. Biochem. Biophys. 300(2), 535–543 (1993). https://doi.org/ 10.1006/abbi.1993.1074 9. Niki, E.: Role of vitamin E as a lipid-soluble peroxyl radical scavenger: in vitro and in vivo evidence. Free Radical Biol. Med. 66, 3–12 (2014). https://doi.org/10.1016/j.freeradbiomed. 2013.03.022 10. Chepur, S.V., Pluzhnikov, N.N., Saiganov, S.A., et al.: Mechanisms for the implementation of the antioxidant effects of alpha-tocopherol. Uspekhi Sovremennoi Biologii 140(2), 149–165 (2020). (in Russian) https://doi.org/10.31857/S0042132420020039 11. Kelly, K.A., Havrilla, C.M., Brady, T.C., et al.: Oxidative stress in toxicology: established mammalian and emerging piscine model systems. Environm. Health Perspective 106(7), 375– 384 (1998). https://doi.org/10.1289/ehp.98106375

Diagnosing Pulmonary Embolism with Computed Tomography Pulmonary Angiography Doina Ranga1(B) , Natalia Capros1 , Andrei Cealan2 , Ion Sirbu1 Cornelia Talmaci1 , and Sergiu Matcovschi1

,

1 Nicolae Testemitanu State University of Medicine and Pharmacy, Chisinau,

Republic of Moldova [email protected] 2 Radiology and Imagistic Department, Public Medical-Sanitary Institution Municipal Hospital, “Saint Trinity”, Chisinau, Republic of Moldova

Abstract. Pulmonary embolism (PE) is the third most common cause of cardiovascular mortality after myocardial infarction and stroke. Incidence rates range from 53 to 162 per 100 000 inhabitants. The CTPA is reported as the standard of care for the evaluation of patients with suspected pulmonary embolism. The aim of study was to assess the diagnostic performance of CTPA for finding of PE on contrast-enhanced chest CT investigations. We included in the study 70 patients (mean age 63.2 ± 14.5 years; 35 women, 35 men) with a high clinical probability of PE, who were hospitalized in “Sfinta Treime” Hospital an subjected to the investigation of CTPA with contrast Ultravist 370. The diagnosis of PE was based on National clinical protocol criteria and was confirmed in 55 (79%). The clinical presentation of patients ranged from sudden breathlessness (98,18%) to sudden cardiac arrest in 3 cases and the most frequent symptoms was pleuritic chest pain (76.36%) and less – hemoptysis (23.46%). The filling defects were determined on CTPA at the level of the: pulmonary trunk– in 7.2%, bilateral left main pulmonary artery (PA) and right main PA – in 36,3%, left main PA – in 16.3%, right PA (mainly in the lumen of the distal portion) – in 32.7%, left PA (distal portion) – in 20.0%, bilateral at the level of lobar/segmental/subsegmental PA – in 89.0%, right PA increased diameter - in 76.4%. Conclusion: computed tomography pulmonary angiography diagnostic performance in pulmonary embolism is high and useful in cases of suspected PE, because it can confirm the diagnosis and reveal findings consistent with differential diagnosis. Keywords: Pulmonary Embolism · Computed Tomography · Pulmonary Angiography

1 Background Pulmonary embolism (PE) is the third most common cause of cardiovascular mortality after myocardial infarction and stroke. Incidence rates range from 53 to 162 per 100 000 inhabitants. The mortality rate for acute PE per month is 8% for treated patients and © The Author(s), under exclusive license to Springer Nature Switzerland AG 2024 V. Sontea et al. (Eds.): ICNBME 2023, IFMBE Proceedings 92, pp. 333–342, 2024. https://doi.org/10.1007/978-3-031-42782-4_36

334

D. Ranga et al.

30% for untreated patients, more than 15% for the first three months after diagnosis. The evolution of PE depends very much on the time frame in which the diagnosis is established and on the therapeutic attitude adopted. Acute mortality correlates directly with hypotension and right ventricular dysfunction [1, 2]. Cross-sectional data show that the incidence of PE is almost eight times higher in people aged ≥ 80 years than in the fifth decade of life. Longitudinal studies have shown a trend of increase annual rates of incidence of PE over time and also suggest the increasing burden on health systems around the world [1, 2]. Pulmonary embolism is a potentially life-threatening condition requiring adequate diagnosis and treatment. Computed tomography pulmonary angiography (CTPA) is excellent for including and excluding PE; therefore, CT is the first-choice diagnostic imaging technique in patients suspected of having acute PE. Due to its wide availability and low invasiveness, CTPA tends to be overused. Correct implementation of clinical decision rules in diagnostic workup for PE improves adequate use of CT. Also, CT adds prognostic value by evaluating right ventricular (RV) function. CT-assessed RV dysfunction and to lesser extent central emboli location predicts PE-related mortality in normotensive and hypotensive patients, while PE embolic obstruction index has limited prognostic value. Simple RV/left ventricular (LV) diameter ratio measures > 1.0 already predict risk for adverse outcome, whereas ratios < 1.0 can safely exclude adverse outcome. Consequently, assessing the RV/LV diameter ratio may help identify patients who are potential candidates for treatment at home instead of treatment in the hospital. A minority of patients develop chronic thromboembolic pulmonary hypertension (CTEPH) following acute PE, which is a life-threatening condition that can be diagnosed by CT. In proximal CTEPH, involving the more central pulmonary arteries, thrombectomy usually results in good outcome in terms of both functional status and long-term survival rate. CT is becoming the imaging method of choice for diagnosing CTEPH as it can identify patients who may benefit from thrombectomy. New CT developments such as distensibility measurements and dual-energy or subtraction techniques may further refine diagnosis and prognosis for improved patient care [3].

2 The Aim of Study Was to assess the diagnostic performance of CTPA for finding of PE on contrast-enhanced chest CT investigations.

3 Material and Methods 70 patients (mean age, 63.2 ± 14.5 years; 35 women, 35 men) with a high clinical probability and suggestion of PE were included in the study, who were subjected to the D-dimer testing and with high probability for acute pulmonary embolism (Wells score), ECG, echocardiography (EchoCG), Chest radiography, CTPA with contrast Ultravist 370. The diagnosis of PE was based on National clinical protocol criteria [4] and was confirmed in 55 (79%). Four experienced radiologists reviewed the images. The differential diagnosis of CTPA procedure included: artifacts, iatrogenic, inflammatory and interpretational conditions.

Diagnosing Pulmonary Embolism with CTPA

335

The differential diagnosis of PE based on clinical data comprised: acute coronary syndrome, stable angina, acute pericarditis, congestive heart failure, aortic dissection, cardiac arrhythmias, pneumonia, pneumonitis, pneumothorax, vasovagal syncope and malignancy. Results: the clinical presentation of patients ranged from sudden breathlessness (in 95%) to sudden cardiac arrest (in 3 cases). Pleuritic chest pain (in 49 cases) with acute dyspnea were the most frequent presenting symptoms. Hemoptysis was significantly less common – in 17 cases. The history of recent immobilization was reported by 32 patients because of congestive heart failure, of the active malignancy - by 3 patients, use of medication (the hormone usage - by 1 and oral contraceptives – by 2 patients, the previous episode of thromboembolism - by 12 patients. The physical exam revealed suggestive features such as: clinical signs of deep venous thrombosis – in 31 cases, asymmetric pitting lower extremity edema – in 19 cases, prominent superficial collateral vessels – in 32 cases, tenderness to palpation along the deep venous system – in 21 cases, tachycardia – in 43 cases. All patients were positive on D-dimer testing and with high probability for acute pulmonary embolism based on Wells score. Electrocardiographic data of right ventricular dilatation were detected in 81,8% and S1Q3T3 syndrome – in 21,8% of patients. Echocardiographic features which were suggestive of PE included right ventricular dilatation and dysfunction in 65,4% of patients. On the tomographic sections, performed in pulmonary and mediastinal regime were determined: deformed pulmonary drawing from the accentuated broncho-vascular component – in 100%, bilateral pneumopleurofibrotic changes in the basal pulmonary fields – in 54,5%, subpleural post-inflammatory fibrosis as opacity of type “matte glass” with peribronhovascular infiltration – in 52,7%, pulmonary consolidation areas – in 29%, deformed pulmonary helium – in 83%, emfizematos bulls – in 16,3%, cardiomegaly – in 69%, signs of coronaroaortosclerosis – in 70,9%, pericardial fluid with thickened layers – in 20% of patients. The filling defects were determined on CTPA at the level of the: pulmonary trunk bifurcation, the embolus as a “saddle embolus – in 7,2% cases, bilateral left main pulmonary artery (PA) and right main PA – in 36,3%, left main PA – in 16,3%, very small sub-segmental pulmonary emboli submillimeter which were detected at the level of right PA (mainly in the lumen of the distal portion) – in 32,7%, left PA (distal portion) – in 20,0%, bilateral at the level of lobar/segmental/subsegmental PA – in 89,0% of patients. An eccentric or mural filling defect rendering an acute angle with a vessel wall or complete occlusion of a dilated vessel right PA (Fig. 1, A) increased diameter by a filling defect was seen in 76,4% of patients. Pleural effusions were seen with acute PE in 25,4% of patients. The pulmonary infarction was manifested on CTPA as wedge-shaped, peripheral opacity with a “reverse-halo” or “atoll” appearance consisting of central ground glass and a rim of consolidation and was seen in 76,4% patients as a notable consequence of acute PE (Fig. 2. A, B). The alternative diagnosis established in our patients included: pulmonary hypertension – in 69,0%, pulmonary edema – in 5,45%, bilateral polysegmental pneumonia – in 25,45%, malignancy and lymphadenopathy – in 10,9% cases, tuberculosis – in 2 patients.

336

D. Ranga et al.

Fig. 1. 1.A, B: Filling defect with thrombotic masses in the projection of the pulmonary artery on the right of the distal portion. Right pneumothorax (coronary section). 1.C. The pulmonary trunk with Ø- 2.24 cm, without thrombotic masses in the lumen, well contrasted, right pulmonary artery – 1.45 cm, with thrombotic masses in the distal portion; left pulmonary artery – 1.55 cm in diameter. 1.D. Filling defect with thrombotic masses in the projection of the lobar arteries, portion A1, A2, A3 and proximal portion.

4 Discussion Pulmonary embolism (PE) refers to embolic occlusion of the pulmonary arterial system. Most cases result from thrombotic occlusion, and therefore the condition is frequently termed pulmonary thromboembolism. Non-thrombotic pulmonary emboli sources include: gas embolism, e.g. air embolism, carbon dioxide embolism, nitrogen, helium, fat embolism, tumor embolism: comprised of tumor thrombus, infectious agents, (parasitic embolism, hydatid embolism), septic embolism, amniotic fluid embolism, catheter embolism, brachytherapy seeds, particulate material embolism, (e.g. talc embolism, cement embolism: comprised of polymethyl methacrylate, iodinated oil embolism, metallic pulmonary embolism), barium embolism and mercury embolism [5].

Diagnosing Pulmonary Embolism with CTPA

337

Fig. 2. A, B. 2.A: Infarct pneumonia in incomplete resorption S4, S6 on the right, pleural effusion on the left, with condensation of the adjacent parenchyma, with layer thickness up to 7.1 cm. 2.B: Peribronhovascular inflammatory infiltration in incomplete resorption associated with the consolidation area in S4, S5 on the left. Starlet – central venous catheter in upper cava vena.

Pulmonary thromboembolism is a consequence of the interaction between risk factors related to the patient - usually permanent and risk factors related to the situation usually temporary. Since the classification of temporary and permanent risk factors for PE is important for assessing the risk of relapse and, consequently, for making decisions on chronic anticoagulation [4]. Multiple imaging modalities are available in the evaluation of acute PE. This includes chest radiographs, CTPA, CT venography (CTV), magnetic resonance (MR) pulmonary angiography (MRPA), nuclear medicine ventilation/perfusion scan, venous ultrasound, echocardiography, and catheter pulmonary angiography. In the review by Wittram C, et al. the CTPA is reported as the standard of care for the evaluation of patients with suspected PE. This pathologic condition, whether acute or chronic, causes both partial and complete intraluminal filling defects, which should have a sharp interface with intravascular contrast material. In acute PE that manifests as complete arterial occlusion, the affected artery may be enlarged. Partial filling defects due to acute PE are often centrally located, but when eccentrically located they form acute angles with the vessel wall. Chronic PE can manifest as complete occlusive disease in vessels that are smaller than adjacent patent vessels. Other CT pulmonary angiographic findings in chronic PE include evidence of recanalization, webs or flaps, and partial filling defects that form obtuse angles with the vessel wall [6]. CTPA is the imaging modality of choice for the workup of patients with suspected acute PE and is a crucial component in commonly used clinical diagnostic algorithms [7]. In our study we assess the diagnostic performance of CTPA for finding of PE on contrast-enhanced chest CT investigations in 70 patients (mean age 63.2 ± 14.5 years; 18 women, 35 men) and the diagnosis of PE was confirmed in 55 (79%).

338

D. Ranga et al.

Gottschalk A. et al. and Stein PD. et al. reported that CTPA has high sensitivity and specificity, with PIOPED II trial demonstrating sensitivity of 83% and specificity of 96%. When combined with clinical probability, the positive predictive value rose to as high as 96% when there was high or low clinical probability and 92% when there was intermediate clinical probability [7, 8]. Jung JI, et al. with the purpose to compare different image reconstruction parameters for detecting PE using 64-slice CT in 40 patients have suspected of having an acute PE. The results showed that 15 of 40 patients a PE was diagnosed. For detecting lobar PEs, axial images with a slice thickness of 1.25 mm and all coronal re-formatted images showed comparable results to axial images with a slice thickness of 0.625 mm. For detecting segmental PEs, axial images with a slice thickness of 1.25 mm and coronal images with a slice thickness of 0.625 mm re-formatted images showed comparable results to axial images of a slice thickness of 0.625 mm. For detecting subsegmental PEs, axial images with a slice thickness of 0.625 mm showed the highest sensitivity. Better reproducibility was obtained when the thinner slice thickness reconstructions were in axial and coronal images. However, reproducibility of axial maximum intensity projection images with thicknesses of 2.5 mm and 5 mm was similar for detecting segmental and subsegmental PEs. Thin-slice reconstruction of less than 1 mm is mandatory for visualization of PE at the subsegmental level [9]. Other studies showed that 3D RV/LV volume ratio > 1.2 was predictive of 30-day outcome [10] and RV dysfunction has a prognostic role in PE [10]. In the systematic review and meta-analysis by Lambert L, et al. with the objective to examine the diagnostic performance of CT of the pulmonary artery (CTPA) as a potential first-choice imaging modality in patients with pulmonary arterial hypertension and suspected chronic thromboembolic pulmonary hypertension (CTEPH) were searched for studies evaluating the diagnostic performance of CTPA in suspected CTEPH in adult patients. Results were pooled separately for studies based on the evaluation of the pulmonary artery and those that relied solely on changes in parenchymal perfusion. The results showed that the pooled sensitivity, specificity, positive predictive value (PPV), negative predictive value (NPV), accuracy, and diagnostic odds ratio (DOR) estimates for CTPA in the detection of CTEPH were 0.98, 0.99, 0.94, 1.00, 0.96, 0.96, and 292. Evaluation of perfusion changes yielded pooled estimates for sensitivity, specificity, PPV, NPV, accuracy, and DOR of 0.99, 0.84, 0.79, 0.98, 0.89, 0.89, and 98 across four studies with 278 patients [12]. Zhonghua Sun et al. with the purpose to investigate the clinical application of CTPA in patients with suspected PE, retrospectively reviewed radiological reports of 450 patients. Prevalence of PE was analyzed to determine the diagnostic yield of CT in two scanning protocols. Of 450 patient records, the positive rate of PE was 30.7%. Triple rule-out CT protocol was performed in 75 out of 450 patients with the diagnostic yield of PE being only 8% (6 out of 75 patients had PE), which was significantly lower than the 35.2% in the CTPA group (132 out of 375 had PE). This study showed that CTPA has high diagnostic yield in the diagnosis of PE, hence justifying its appropriateness as a routine imaging modality. However, triple rule-out CT was not recommended due to the low diagnostic yield [13].

Diagnosing Pulmonary Embolism with CTPA

339

Several technical advances enable in CTPA acquisitions with low radiation and contrast material doses (volume/concentration) were discussed in other studies. Radiation doses can be minimized by using the least possible tube voltage and tube current, based on the body mass index of the patient. Automated parameter selection is now possible with some vendors. Decreasing peak kilovoltage from 120 to 100 kVp in a chest CT results in > 30% reduction in radiation dose [14]. Tube current can be modulated according to the thickness and density of the part imaged, with estimated radiation dose savings of 26%. Such low tube current and voltage studies were traditionally limited by the image noise; however, this is currently mitigated by using advanced iterative reconstruction algorithms, which uses statistical, model or hybrid techniques [15]. Low voltage scans have been shown to reduce contrast material requirement by 33% with maintained image quality and diagnostic accuracy. Low radiation and contrast material dose studies are limited in large patients [16]. In the retrospective study Batra K. et al. reported that artificial intelligence (AI) algorithms have shown strong performance for detection of PE on CT examinations performed using a dedicated protocol for PE detection. The purpose of this study was to assess the diagnostic performance of an AI algorithm for detection of iPE on conventional contrast-enhanced chest CT examinations and clinical impact. Potential applications of the AI tool included serving as a second reader to help detect additional iPEs or as a worklist triage tool to allow earlier iPE detection and intervention [17]. The latest CT protocols combine the improved iodine detection and high-pitch of dual-source dual energy computed tomography (DECT) to render diagnostic CTPA with contrast material loads as low as 20 mL, a tube voltage of 80 to 100 kVp, and tube-current reduction to as low as 80 mAs rendering an effective dose below 1 mSv without significant degradation in image quality [18]. Grenier PA. et al. developed a deep learning (DL) Algorithm for Automatic Detection of Pulmonary Embolism in Chest CT Angiograms. The algorithm correctly identified 170 of 186 exams positive for PE (sensitivity 91.4% [95% CI: 86.4–95.0%]) and 184 of 201 exams negative for PE (specificity 91.5% [95% CI: 86.8–95.0%]), leading to an accuracy of 91.5%. False negative cases were either chronic PEs or PEs at the limit of subsegmental arteries and close to partial volume effect artifacts. Most of the false positive findings were due to contrast agent-related fluid artifacts, pulmonary veins, and lymph nodes. The authors concluded that the DL-based algorithm has a high degree of diagnostic accuracy with balanced sensitivity and specificity for the detection of PE on CTAs [19]. Ferreira EV. et al. with the aim to determine the prevalence of alternative diagnoses based on chest CTA in patients with suspected pulmonary thromboembolism (PTE) have investigated 191 adult patients. On the basis of the CTA findings, PTE was diagnosed in 47 cases (24.6%). Among the 144 patients not diagnosed with PTE via CTA, the findings were abnormal in 120 (83.3%). Such findings were consistent with an alternative diagnosis that explained the symptoms in 75 patients (39.3%). Among those 75 cases, there were only 39 (20.4%) in which the same alterations had not been previously detected on chest X-rays. The most common alternative diagnosis, made solely on the

340

D. Ranga et al.

basis of the CTA findings, was pneumonia (identified in 20 cases). Symptoms, risk factors, comorbidities, and the in-hospital mortality rate did not differ significantly between the patients with and without PTE. However, the median hospital stay was significantly longer in the patients with PTE than in those without (18.0 and 9.5 days, respectively; p = 0.001) [20].

5 Compliance with Ethical Requirements Statement of Informed Consent. The study was initiated after signing the informed agreement by all participants (information form and acceptance form), who became familiar with the evaluation methods to be applied, at the time of initiation and during the study the confidentiality and ethical criteria were observed. Statement of Human and Animal Rights. The research was conducted during the years 2016–2018 in accordance with the Principles of the Helsinki Declaration - WMA Declaration of Helsinki - Ethical Principles for Medical Research Involving Human Subjects. The study was approved by the Research Ethics Committee of a State University of medicine and Pharmacy “Nicolae Testemitanu”, after being examined at the meeting of 16.05.2023, with the issuance of favorable opinion no. 2 of 18.05.2023.

6 Conclusions Pulmonary embolism has a very heterogeneous clinical presentation. Chest CTA is useful in cases of suspected PTE, because it can confirm the diagnosis and reveal findings consistent with a differential diagnosis. Acknowledgments. I would like to express my special thanks of gratitude to our Department director (univ.prof. Sergiu Matcovschi) as well as my scientific advisor univ. Prof. Natalia Capros who also helped me in doing a lot of Research. Conflict of Interest. Every Paper Must Contain a Declaration of Conflicts of Interest. If There Are no Such Conflicts Write “THe Authors Declare that They Have no Conflict of Interest”.

References 1. 2019 ESC Guidelines for the diagnosis and management of acute pulmonary embolism developed in collaboration with the European Respiratory Society (ERS) European Heart Journal 41, 543–603 (2020). https://doi.org/10.1093/eurheartj/ehz405 2. Konstantinides, S., Meyer, G.: 2019 ESC Guidelines for the diagnosis and management of acute pulmonary embolism developed in collaboration with the European Respiratory Society. Eur. Heart J. 41, 603–649 (2020). https://doi.org/10.1093/eurheartj/ehz405 3. Do˘gan, H., de Roos, A., Geleijins, J., Huisman, MV., Kroft, L.J.: The role of computed tomography in the diagnosis of acute and chronic pulmonary embolism. Diagn Interv Radiol. 21(4), 307–16 (2015). https://doi.org/10.5152/dir.2015.14403, PMID: 26133321; PMCID: PMC4498425.

Diagnosing Pulmonary Embolism with CTPA

341

4. Grosu, A., Diaconu, N.: Protocol clinic nat, ional „Trombemolismul pulmonar”, PCN-148 (2020) 5. Asah, D., Raju, S., Ghosh, S., Mukhopadhyay, S., Mehta, A.: Nonthrombotic pulmonary embolism from inorganic particulate matter and foreign bodies. Chest. 153(5), 1249–65 (2018). https://doi.org/10.1016/j.chest.2018.02.013, 2018.02.013– Pubmed. 6. Wittram, C., Maher. M.M., Yoo, A.J., Kalra, M.K., Shepard, J.A., McLoud, T.C.: CT angiography of pulmonary embolism: diagnostic criteria and causes of misdiagnosis. Radiographics 24(5), 1219–38 (2004). https://doi.org/10.1148/rg.245045008. PMID: 15371604 7. Gottschalk, A., Stein, P.D., Goodman, L.R., et al.: Overview of prospective investigation of pulmonary embolism diagnosis II. Semin Nucl. Med. 32, 173–182 (2002). [PubMed]. https:// doi.org/10.1053/snuc.2002.124177 8. Stein, P.D., Fowler, S.E., Goodman, L.R., et al.: Multidetector computed tomography for acute pulmonary embolism. N. Engl. J. Med. 354, 2317–2327 (2006 ). [PubMed]. https:// doi.org/10.1056/NEJMoa052367 9. Jung, J.I., et al.: Detection of pulmonary embolism using 64-slice multidetector-row computed tomography: accuracy and reproducibility on different image reconstruction parameters. Acta Radiol. 52(4), 417–421 (2011). https://doi.org/10.1258/ar.2011.100217, Epub 2011 Mar 17. PMID: 21498315 10. Im, D.J., Hur, J., Han, KH., et al. Acute pulmonary embolism: retrospective cohort study of the predictive value of perfusion defect volume measured with dual-energy CT. AJR Am. J. Roentgenol. 209, 1015–1022 (2017). [PubMed]. https://doi.org/10.2214/AJR.17.17815 11. Kang, D.K., Thilo, C., Schoepf, U.J., et al.: CT signs of right ventricular dysfunction: prognostic role in acute pulmonary embolism. JACC Cardiovasc. Imaging 4, 841–849 (2011). [PubMed]. https://doi.org/10.1016/j.jcmg.2011.04.013 12. Lambert, L., Michalek, P., Burgetova, A.: The diagnostic performance of CT pulmonary angiography in the detection of chronic thromboembolic pulmonary hypertension-systematic review and meta-analysis. Eur. Radiol. 32(11), 7927–7935 (2022). https://doi.org/10.1007/ s00330-022-08804-5, Epub 2022 Apr 28. PMID: 35482124. 13. Sun, Z., Lei, J.: Diagnostic yield of CT pulmonary angiography in the diagnosis of pulmonary embolism: A single center experience. Research Article - Interventional Cardiology, vol. 9(5) (2017) 14. Kubo, T., Lin, PJ., Stiller, W., et al.: Radiation dose reduction in chest CT: a review. AJR Am. J. Roentgenol. 190, 335–43 (2008). [PubMed]. https://doi.org/10.2214/AJR.07.2556 15. Ridge, C.A., Litmanovich, D., Bukoye, B.A., et al.: Computed tomography angiography for suspected pulmonary embolism: comparison of 2 adaptive statistical iterative reconstruction blends to filtered back-projection alone. J. Comput. Assist. Tomogr. 37, 712–717 (2013). https://doi.org/10.1097/RCT.0b013e31829727d2 16. Bogot, N.R., Fingerle, A., Shaham, D., et al.: Image quality of low-energy pulmonary CT angiography: comparison with standard CT. AJR Am. J. Roentgenol. 197, W273–W278 (2011 ). [PubMed]. https://doi.org/10.2214/AJR.10.5318 17. Batra, K., Xi, Y., Al-Hreish, K., et al.: Detection of incidental pulmonary embolism on conventional contrast-enhanced chest CT: comparison of an artificial intelligence algorithm and clinical reports. AJR (Jul 13 2022) (accepted manuscript). https://doi.org/10.2214/AJR.22. 27895 18. Bucher, A.M., Kerl, M.J., Albrecht, M.H., et al.: Systematic comparison of reduced tube cu rrent protocols for high-pitch and standard-pitch pulmonary CT angiography in a large single-center population. Acad. Radiol. 23, 619–27 (2016). [PubMed]. https://doi.org/10. 1016/j.acra.2016.01.003

342

D. Ranga et al.

19. Grenier, P.A., et al.: Deep learning-based algorithm for automatic detection of pulmonary embolism in chest CT angiograms. Diagnostics (Basel) 13(7), 1324 (2023). https://doi.org/ 10.3390/diagnostics13071324, PMID: 37046542; PMCID: PMC10093638. 20. Ferreira, E.V., et al.: Alternative diagnoses based on CT angiography of the chest in patients with suspected pulmonary thromboembolism. J. Bras. Pneumol. 42(1), 35–41 (2016). https:// doi.org/10.1590/S1806-37562016000000105, PMID: 26982039; PMCID: PMC4805385

Improvement of Cardiovascular System Diseases Diagnostics by Using Multiparametric Data Mykhailo Shyshkin(B)

, Serhii Holdobin , and Olha Butova

National Technical University “Kharkiv Polytechnic Institute”, Kharkiv, Ukraine [email protected]

Abstract. The most common cause of death among humans is cardiovascular disease. An effective way to detect early signs of cardiovascular disease is to constantly monitor the patient’s critical physiological parameters during their daily activities using a wearable device. Most of these wearable devices available on the market can only register one or two types of biosignals, which are processed independently. On the one hand, these data obtained in this way are sufficient to see some changes in the cardiovascular system, but on the other hand, this type of device is bulky and uncomfortable to wear for a long time. One of the most promising methods for studying the cardiovascular system today is the use of multiparametric data, namely the combination of ECG and PPG data. Multivariable data is already used today for continuous non-invasive (cuffless) blood pressure measurement. However, the use of this type of data for a more complete analysis of the cardiovascular system is possible only at the initial stage of the study. The authors proposed a method that allows, due to the continuous processing of EGC and PPG data strictly synchronized in time, obtained from a wearable device, to assess the general state of the cardiovascular system and the risk of its disorders. Physionet data were used for verification. As part of the implementation of the device, a prototype of a wearable analyzer of the cardiovascular system was created and the first results were obtained. Keywords: Multiparametric Data · ECG · Cardiovascular Diseases · Wearable Device

1 Introduction Modern advancements in biomedical electronics have revolutionized the collection of diverse physiological data in people’s daily lives. This progress is driven by the miniaturization of sensors for physiological signals, improved computing power, and the utilization of wireless network protocols for faster data exchange. Furthermore, the accumulation of data in cloud storage and the integration of cloud services with artificial intelligence technologies have enhanced the potential for rapid data analysis and facilitated advisory or diagnostic decision-making processes. Consequently, there is a growing need to study and enhance methods for processing and analyzing multi-parametric data. Taking a holistic approach to the cardiovascular © The Author(s), under exclusive license to Springer Nature Switzerland AG 2024 V. Sontea et al. (Eds.): ICNBME 2023, IFMBE Proceedings 92, pp. 343–350, 2024. https://doi.org/10.1007/978-3-031-42782-4_37

344

M. Shyshkin et al.

system, which encompasses an initiating electric impulse and an executive node represented by the heart as a muscular pump, along with the vascular system as the transmission environment, allows for a comprehensive analysis of its state. In this context, it is crucial to jointly analyze time-dependent information regarding the electrical influence that triggers heart contractions (ECG), the signal characterizing the mechanical response of the heart (Cardiac Power Output), and the peripheral pulse wave signal (PPG), which provides insights into the vascular system’s reaction to cardiac output. Significant attention in this field of study is dedicated to the synthesis of electromechanical heart models, non-invasive determination of cardiac output, and modeling of the vascular tree from a hemodynamics perspective. For instance, [1] presents a fully connected liquid-electromechanical model of the human heart, employing Navier-Stokes equations for blood flow within the heart cavities, a monodomain scheme for electrophysiology, and the O’Hara-Rudi cell model. Solid body mechanics are represented using the complete Lagrange formulation for discrete deformations with the HolzapfelÔgden heart tissue model. The model accounts for electromechanical feedback and the interaction between fluid and structure. Similarly, [2] introduces a comprehensive mathematical and numerical model of the electromechanics of the heart. This work considers a fully connected model that encompasses several physical processes, including electrophysiology, biochemistry, and mechanics, which interact at different spatial and temporal scales. Considerable efforts have been directed towards improving methods of cuffless blood pressure measurement (BP) based on the analysis of parameters such as Pulse Transit Time (PTT) – the time taken for the arterial pulse wave to reach the periphery. Notably, [3] provides an extensive description of this method, employing various models of arterial wall mechanics and wave propagation in arteries. Typically, blood pressure is indirectly calculated assuming an inverse relationship between PTT wave speed and systolic blood pressure [4, 5]. While initial studies primarily focused on refining delay conditions, recent approaches have incorporated machine learning techniques. These methods often utilize the PPG signal in conjunction with the electrocardiogram (ECG) signal to predict diastolic blood pressure (DBP), systolic blood pressure (SBP), and mean arterial pressure (MAP) values [6–11]. Investigations into the relationship between PTT and blood pressure have provided valuable data on the cardiovascular system. However, it is also important to analyze the dynamics of the pulse wave as it propagates and compare its shape in the aorta and at the periphery. Additionally, assessing the strength of cardiac output (Cardiac Power Output) holds significant interest. Cardiac output power (CPO) is a hemodynamic measure that reflects the pumping capacity of the heart. It serves as a reliable indicator of cardiac pathology severity and mortality risk in cardiogenic shock, making it a potential predictor of onset and severity. Resting CPO is measured in watts using the following formula: cardiac output (L/min) mean arterial pressure divided by 451. CPO < 0.6 W is indicative with hemodynamic compromise and is associated with increased risk of mortality.

Improvement of Cardiovascular System Diseases Diagnostics

345

Resting cardiac power index (CPI) is measured in watts per square meter (W/m2 ) using the following formula: cardiac index (L/min/m2 ) mean arterial pressure divided by 451. Normal CPI is 0.5–0.7 W/m2 .(13). In [13], predictors of cardiovascular risk are estimated by analyzing diametrical pulse volume curves derived from a common central pulse volume curve. This assessment involves building lumped central diameter arterial line models, estimating the central arterial pressure waveform based on diametrical pulse volume shapes, and evaluating cardiovascular risk predictors (including central systolic and pulse pressure, increase in pulse pressure, and pulse transit time) using arterial line models and a central arterial pressure curve combined with diametrical pulse volume curves. Each of these research areas addresses a specific aspect of developing a method to assess the state of the cardiovascular system based on a generalized model of hemodynamics. The purpose of this work is to demonstrate the possibility of using synchronously received ECG and peripheral pulse wave (PPG) signals to assess the general state of the cardiovascular system as a complex indicator that reflects the risk of its disorders, in particular, continuous monitoring of such a parameter as Cardiac output.

2 Method To analyze the state of the cardiovascular system, we conducted a joint analysis of three parameters directly associated with its condition: Cardiac Output, pulse transit time, and HR (heart rate). By utilizing these parameters and calculating systolic and diastolic pressure values, we were able to assess their relationship and observe changes both in normal conditions and in the presence of arrhythmias. Based on general theory, Cardiac Output is calculated as CO = SV · HR,

(1)

where SV - Stroke Volume - the volume of blood pumped from the left ventricle per beat; HR – Heart Rate - he frequency of the heartbeat measured by the number of contractions of the heart per minute. The general formula for SV is the difference between End-Diastolic Vol-ume (EDV) - the volume of blood that is in the ventricles before the contraction of the heart and End-Systolic Volume (ESV) - the volume of blood that is in the ventricles at the end of the contraction hearts: SV = EDV − ESV

(2)

Non-invasive detection of CO is not a trivial task and, in the first approximation, can be performed based on the three-element Windkessel model (Fig. 1). According to this, the arterial blood pressure (ABP) should decay exponentially during each diastolic interval with a time constant (τ ) determined by the product of the total peripheral resistance (TPR) and the arterial compliance (AC), which remains relatively constant. This technique involves fitting a mono-exponential function to the

346

M. Shyshkin et al.

Fig. 1. Monitoring cardiac output (CO) by analysis of an arterial blood pressure (ABP) waveform with Windkessel model. (Figure from ref. 16)

diastolic interval of each ABP pulse to determine the time constant (τ ). The mean arterial pressure (MAP) is then calculated by dividing the time-averaged ABP with the estimate of the cardiac output (CO). Non-invasive pressure measurement relies on digital photoplethysmography (PPG) data and the calculation of pulse transit time (PTT). The cardiac output generates a pressure wave that propagates through the arteries. This wave manifests as acute arterial dilatation and moves faster than the blood itself. PTT decreases (indicating faster wave motion) as the artery stiffens, following hydrodynamic principles. The relationship between PTT and the time constant (τ ) is expressed by the Bramwell-Hill equation, which relates pulse wave velocity to the rate of change in pressure (dP) with respect to the change in cross-sectional area (dS) and the density of blood (ρ):  SdP 1 , (3) ν= = τ ρdS here, S is the cross-sectional area of the artery, P is blood pressure, ρ is blood density, and dS/dP is the arterial compliance. The ratio of arterial compliance to area indicates distensibility, which is the reciprocal of the relative stiffness of the arteries. Distensibility decreases with increasing BP (and vice versa) due to the material properties of the arterial wall. This ratio for the aorta is fixed according to the Wesseling model [14, 15] as follows:       −1  dS/S 1 −1 P − PM P − PM 2 1 = π PR 1 + + tan , dP PR 2 π PR

(4)

where, PM and PR indicate the slope and width of the approximate linear regime of the arterial S - P function. With these two equations the following inverse BP-PTT relationship: P = K1

1 + K2 , τ

(5)

Improvement of Cardiovascular System Diseases Diagnostics

347

 R where, K1 = l 2ρP π +2 , l is the wave travel length, K2 = PM . Both of coefficients are positive and person-specific parameters. The proposed model offers a remarkable capability to provide valuable blood pressure information and calculate the Cardiac Output (CO) value for continuous and realtime monitoring of the cardiovascular system. By jointly analyzing key parameters such as the pulse transit time (PTT), heart rate (HR), and stroke volume (SV), the model enables the estimation of blood pressure values and the assessment of cardiac output dynamics. With the integration of non-invasive pressure measurement techniques, which rely on digital photoplethysmography (PPG) data and PTT calculations, the model harnesses the inherent relationship between arterial wave propagation and blood pressure fluctuations. This relationship allows for the derivation of meaningful blood pressure estimations from the PPG signals. Moreover, the model takes into account the temporal dynamics of the pulse wave as it propagates through the arteries, capturing valuable information about the cardiovascular system’s state. By continuously monitoring and analyzing these parameters in real-time, the model offers a comprehensive understanding of the cardiovascular system’s functioning and provides insights into its health status. This information can be crucial in the early detection of cardiovascular disorders, allowing for timely intervention and personalized treatment strategies. The ability to calculate cardiac output (CO) adds another layer of valuable information. CO, defined as the volume of blood pumped by the heart per unit of time, is a vital indicator of the heart’s pumping efficiency and the overall health of the cardiovascular system. By accurately assessing CO in real time, the model provides important information for assessing cardiac function and monitoring changes over time. The use of cardiac output as an indicator of the cardiovascular system during long-term monitoring has not previously been performed, and the function of changing this parameter over time in various cardiac abnormalities, such as arrhythmias, can be a marker of the appearance of dangerous pathologies. This method shows the feasibility of implementing long-term monitoring of cardiac output.

3 Practical Implementation To evaluate the performance of the model, the PPG-ECG PhysioNet database was utilized. Daily data from 18 patients (PhysioNet), ranging in age from 37 to 68 years, who experienced episodes of arrhythmias, were analyzed. For further validation of the method and taking into account the fact that at the moment there are no devices available that can receive strictly time-synchronous ECG and PPG values, we have developed a prototype of such a device and obtained the first practical data. The computing core of the prototype device is based on the STM32L496ZG microcontroller. An AD8232 analog interface and a highly sensitive MAX30102 heart rate sensor were employed to capture the ECG signal. The signals were synchronized using the internal timer of the microcontroller during the post-processing of the multi-parameter data.

348

M. Shyshkin et al.

By utilizing this, the model’s performance and accuracy could be assessed. The results obtained from the database and the prototype device provided valuable insights for further analysis and improvement.

Fig. 2. Sequence diagram

The sequence of interaction between the software and hardware modules of the device is shown in Fig. 2. The resulting ECG PPG curves are presented in Fig. 3.

Fig. 3. ECG and PPG curves received from the device

The process of receiving and processing data is as follows. First, initialization of the source and clock frequency of both the microprocessor core itself and its periphery, initialization of the ADC, input / output ports in the downstream interrupt mode, I2C and

Improvement of Cardiovascular System Diseases Diagnostics

349

USB. Next, the device waits for a control code from the application. After sending the parameters of the captured signals and receiving a command to start collecting data, the MAX30102 is initialized (the sampling rate of all data is set during initialization) and the microcontroller goes into waiting for an interrupt from the MAX30102 sensor, the time marker is stored in the interrupt and the ADC conversion starts, upon completion, the interrupt flag is set the end, after which, the time marker is saved and the process of reading data from the MAX30102 and the ADC is performed. This process continues until the microcontroller receives a command to stop collecting data. This approach to the overall timing and storage of timestamps ensures complete synchronism of the data on the two signals.

4 Conclusions 1. During the study, various models were analyzed for calculating cardiac output values using multivariable data, in particular ECG and PPG, with a focus on their application in wearable devices for continuous cardiovascular monitoring. It was shown that such a parameter as cardiac output can be a marker of the state of the cardiovascular system, however, the complexity of its calculation did not allow its use in this type of device. 2. The result of the work was the creation of a method that allows, based on the processing and analysis of strictly synchronized ECG and PPG values, to calculate the value of cardiac output. 3. As part of the study, an algorithm was developed for obtaining strictly timesynchronized ECG and PPG data, which makes it possible to calculate the value of cardiac output in real time. 4. To facilitate long-term analysis of the cardiovascular system, a wearable monitor prototype was created. This device includes the ability to monitor key parameters such as heart rate, cardiac output, stroke index and blood pressure. 5. Current research is the initial stage in the development of a method and device for long-term monitoring of cardiac output and related CVS parameters. The goal is to identify and establish prognostic markers that allow you to effectively assess the state of the cardiovascular system in real time. Conflict of Interest. The authors declare that they have no conflict of interest”.

References 1. Santiago, A., et al.: Fully coupled fluid-electro-mechanical model of the human heart for supercomputers. Int. J. Numer. Method Biomed. Eng. 34(12), e3140 (2018). https://doi.org/ 10.1002/cnm.3140. PMID: 30117302 2. Regazzoni, F., et al.: A cardiac electromechanical model coupled with a lumped-parameter model for closed-loop blood circulation. J. Comput. Phys. 457, 111083 (2022). https://doi. org/10.1016/j.jcp.2022.111083. ISSN 0021–9991 3. Mukkamala, R., et al.: Toward ubiquitous blood pressure monitoring via pulse transit time: theory and practice. IEEE Trans Biomed Eng. 62(8), 1879–901 (2015). https://doi.org/10. 1109/TBME.2015.2441951. Epub 2015 Jun 5. PMID: 26057530; PMCID: PMC4515215

350

M. Shyshkin et al.

4. Wu, C.-M., Chuang, C.Y., Chen, Y.-J., Chen, S.-C.: A new estimate technology of non-invasive continuous blood pressure measurement based on electrocardiograph. Adv. Mech. Engin. 8(6) (2016). https://doi.org/10.1177/1687814016653689 5. Ghasemi, Z., Lee, J.C., Kim, C.S., et al.: Estimation of cardiovascular risk predictors from non-invasively measured diametric pulse volume waveforms via multiple measurement information fusion. Sci. Rep. 8, 10433 (2018). https://doi.org/10.1038/s41598-018-28604-6 6. Landry, C., Peterson, S.D., Arami, A.: A fusion approach to improve accuracy and estimate uncertainty in cuffless blood pressure monitoring. Sci. Rep. 12, 7948 (2022) 7. Slapnicar, G., Mlakar, N., Luštrek, M.: Blood pressure estimation from photoplethysmogram using a spectro-temporal deep neural network. Sensors 19, 3420 (2019) 8. Mousavi, S.S., Firouzmand, M., Charmi, M., Hemmati, M., Moghadam, M., Ghorbani, Y.: Blood pressure estimation from appropriate and inappropriate ppg signals using a whole-based method. Biomed. Signal Process. Control 47, 196–206 (2019) 9. Thambiraj, G., Gandhi, U., Devanand, V., Mangalanathan, U.: Noninvasive cuffless blood pressure estimation using pulse transit time, Womersley number, and photoplethysmogram intensity ratio. Physiol. Meas. 40, 075001 (2019) 10. Thambiraj, G., Gandhi, U., Mangalanathan, U., Jose, V.J., Anand, M.: Investigation on the effect of Womersley number, ECG and PPG features for cuffless blood pressure estimation using machine learning. Biomed. Signal Process. Control 60, 101942 (2020) 11. Ibtehaz, N., et al.: PPG2ABP: Translating photoplethysmogram (PPG) signals to arterial blood pressure (ABP) waveforms. Bioengineering 9(11), 692 (2022). https://doi.org/10.3390/bioeng ineering9110692 12. Yildiz, O., Aslan, G., Demirozu, Z.T., Yenigun, C.D., Yazicioglu, N.: Evaluation of resting cardiac power output as a prognostic factor in patients with advanced heart failure. Am J, Cardiol. 120(6), 973–979 (2017). https://doi.org/10.1016/j.amjcard.2017.06.028. Epub 2017 Jun 28 PMID: 28739034 13. Lim, H.S.: Cardiac Power Output Revisited (2020) https://doi.org/10.1161/120.007393 14. Wesseling, K.H., Jansen, J.R.C., Settels, J.J., Schreuder, J.J.: Computation of aortic flow from pressure in humans using a nonlinear, three-element model. J. Appl. Physiol. 74(5), 2566–2573 (1993) 15. Mukkamala, R., Reisner, A.T., Hojman, H.M., Mark, R.G., Cohen, R.J.: Continuous cardiac output monitoring by peripheral blood pressure wave-form analysis. IEEE Trans. Biomed. Eng. 53, 459–467 (2006)

Combined and Complex Treatment-Optimal Therapies in Rectal Cancer Cezara Ungureanu1(B)

and Nicolae Ghidirim1,2

1 Nicolae Testemitanu State University of Medicine and Pharmacy of the Republic of Moldova,

Chisinau, Republic of Moldova [email protected] 2 Oncology Institute of the Republic of Moldova, Chisinau, Republic of Moldova

Abstract. Despite advances in medicine and national screening there is a continuous increase in the incidence of rectal cancer. Surgical treatment remained the mainstay of treatment, but neoadjuvant therapy has demonstrated in recent years favorable results to obtain R0 resection margins and 70% remission of rectal cancer at 5 years. Oligosymptomatic oncet, varied spectrum, and specific character of clinical manifestations of rectal cancer determine the adoption of a prudent and scrupulous tactic.Preoperative chemotherapy and radiotherapy are well tolerated but together with surgical intervention it ensures a better control of the appearance of distant metastases. Although 5-year survival rates are equivalent to postoperative chemotherapy and radiotherapy, is currently recommended by most authors for all patients with T3 or T4 rectal cancer, and tends to become a new standard in rectal cancer. Complex treatment has demonstrated its role in reducing morbidity and mortality in rectal cancer, but also in improving long-term survival. The multidisciplinary approach is of major importance both preoperatively and postoperatively, surgical treatment has remained the main treatment modality and is standardized, but there are still controversies in the timing and establishment of useful times of the other therapeutic means. Future trials will refine strategies to identify optimal treatment protocols. Keywords: Rectal cancer · Diagnosis · Treatment · Remission · Chemotherapy · Radiotherapy

1 Introduction Cancer has been and will continue to be a major public health problem, both nationally and globally, being the first or second cause of premature death (between ages 30–69) in 134 countries (source: WHO - International Agency for Research on Cancer).Unfortunately, this condition is responsible for approximately 10 million deaths in 2020, with one in 11 women and one in 8 men dying from it each year (source: WHO International Agency for Research on Cancer). On the other hand, the estimates of the World Cancer Report 2020 show that both the incidence and the prevalence of this condition are increasing, which forces us to take immediate measures to limit the burden of the © The Author(s), under exclusive license to Springer Nature Switzerland AG 2024 V. Sontea et al. (Eds.): ICNBME 2023, IFMBE Proceedings 92, pp. 351–361, 2024. https://doi.org/10.1007/978-3-031-42782-4_38

352

C. Ungureanu and N. Ghidirim

disease. In the EU, in 2020, 2.7 million new cases of cancer and 1.3 million deaths due to this disease were registered. (Globocan 2020) [1].The progress made permanently in the field of medicine, namely in surgery and anesthesia, medical and radiological oncology, imaging and staging, as well as those concerning the understanding of the biology of rectal cancer, have all influenced the treatment of patients with rectal cancer. The personalized approach by a multidisciplinary team made up of surgeons, oncotherapists, oncoradiologists, radiologists, anatomopathologists as well as other categories of clinicians with a specific focus on rectal cancer, meets and decides the results of the pre-therapeutic evaluation, to recommend a treatment plan, based on the value its therapeutic effect, which is given by the ratio of relative benefit and relative risk for a specific patient. While most proximal rectal cancers are treated with prior resection regardless of stage, middle and distal rectal cancers are treated differently, often with combined or complex treatments, depending on the stage of the cancer and other factors identified during the preoperative evaluation. It is difficult to be categorical about what constitutes optimal therapy for rectal cancer because treatment is highly individualized. However, there are generally accepted treatment guidelines based on treatment intent and the role and effectiveness of the components of complex treatment, including surgical options [2]. Colorectal cancer ranks first in the oncological structure of the Republic of Moldova. According to Cancer Registry data, in 2022, 49.4%000 colorectal cancer was registered. The incidence of rectal cancer in the Republic of Moldova was 21%,000 in 2022, even though the rectum is the smallest part of the large intestine, ≈50% of cancers occur in this segment, in absolute numbers being detected in 2018 - 1396 cases (rectum 633), and in 2022 – 1325 cases (rectum 552) (about the same figures) during one year. More common at the age of over 50 (peak incidence is 60–70), male/female ratio 1:1.

2 The Purpose of the Complex Treatment There are two types of treatment: curative or palliative. Involuntarily, the healing intention can be deliberately compromised: 1. Due to severe associated comorbidities that do not allow a standard resection in complete safety.2. Due to the patient’s refusal to accept the proposed treatment method. The curative intent, in the treatment of rectal cancer, requires the resection and/or ablation of the neoplastic tissue in its entirety, being ensured by an R0 resection, usually in the form of a standard radical resection (anterior resection-AR or abdomino-perineal resection EAPR) [3]. In the past, stage IV rectal cancer excluded potentially curative intent, but according to new data and advances in the medical world this dogma was questioned when it was proven that isolated metastases (MTS), liver or lung, can be resected, either synchronously with the primary tumor, either through sequential operations, with a 5-year survival rate of 25–40% of patients [4] Today, cases that were once a clear indication for only palliative care are often approached with aggressive multimodal therapy, with the intention of improving the stage of the disease to the point where curative surgery can be performed. Surgical resection represents the cornerstone of curative treatment in rectal cancer, although we

Combined and Complex Treatment-Optimal Therapies

353

are witnessing an expansion of the role of radiotherapy, chemotherapy and new biological agents.

3 Surgical Treatment of Rectal Cancer The treatment of rectal cancer has an oncological objective (removal of the primary tumor and the lymphatic territory in totality) and two functional objectives (preserving anal sphincter function and urogenital functions). If the preservation of the sphincter apparatus is dependent on the location of the tumor, the total removal of the tumor compartment (rectum and mesorectum) and the prevention of some uro-genital complications / sequelae depends on following a dissection plan. This plane is predefined as a result of the embryonic development of the rectum and mesorectum. Heald draws attention to both in-plane dissection (causing local recurrence through failure to remove perirectal tumor deposits) and out-of-plane dissection (resulting in injury to pelvic nerve plexuses). Another element on which Heald insisted was to perform sharp dissection and to forego the morbid dissection; during the latter, the fibrous adhesions of the mesorectal fascia to the adjacent structures break either towards the mesorectum or towards the neighboring structures; as a result, there is a risk of breaking some fragments of the mesorectum, and the resection becomes incomplete, with the lateral margin invaded by tumor. The degree of lymph node dissection to be performed during colorectal cancer surgery is determined based on preoperative clinical findings or the extent of lymphatic metastases and the depth of wall invasion by the tumor observed intraoperatively [5]. If no lymph node metastases are observed based on preoperative/intraoperative diagnostic results, lymph node dissection is performed based on the depth of wall invasion by the tumor [6]. Radical tumor rectal resection is defined by the proximal margin, distal margin, and lateral (circumferential) margin free of tumor process. The proximal edge of the resection does not raise problems, being located at the level where the vascularization (after ligation of the superior rectal or inferior mesenteric pedicle) ensures tissue viability. The distal edge is conditioned by the location of the tumor (distance from the pectinate line); the initial distance of 5 cm from the edge of the tumor was reduced to 2 cm, but a decrease below this limit compromises the radicality of the surgical act; in the case of low tumors, rectal dissection, with release from the levator ani strap, can ensure an adequate resection margin [5]. The information obtained intraoperatively can alert the surgeon to the need to modify the standard techniques to better respond to the particularities of rectal cancer; for example, the histological type with “signet ring” cells will require lowering the distal excision limit, and synchronous colonic pathology may require an extended colectomy. An important aspect, which must be considered objectively and discussed honestly with the patient, is the anticipated impact of prefigured surgical treatment, on faecal continence and on urinary and sexual functions. A patient with faecal incontinence or preexisting sphincter damage may benefit from an APR (andomino-perineal resection) and colostomy rather than a well-intentioned but heroic effort in conception, to save the sphincter through a low or ultralow RA (anterior resection) (LAR/uLAR). In correlation

354

C. Ungureanu and N. Ghidirim

with locoregional extension, multivisceral resections may be indicated. In relation to their magnitude, the surgeon can request additional expertise from fellow specialists.

4 Modern Views on the Surgical Treatment of Rectal Cancer The principle for proectomy is TME (total mesorectal excision) or TSME (tumor-specific mesorectal excision). Indication criteria for lateral lymph node dissection: Lateral lymph node dissection is indicated when the lower border of the tumor is located distal to the peritoneal reflection and invaded beyond the muscularis propria. Local rectal resection: Local resection is indicated for cM cancer and cSM cancer (mild invasion) located distal to the second Houston valve (peritoneal reflection). Approaches for local resection are classified into transanal resection, transfinchronic resection, and parasaccular resection. Transanal resection includes the conventional method in which the tumor is resected under direct vision and transcanal endoscopic microsurgery (TEM). More proximal lesions can be resected by TEM than by the conventional method. Autonomic Nerve Preservation Surgery: The autonomic nervous system associated with rectal cancer surgery consists of the lumbar splanchnic nerves, superior hypogastric plexus, hypogastric nerves, pelvic splanchnic nerves, and pelvic plexus. Considering factors such as the degree of cancer progression and the presence or absence of macroscopic nerve invasion, autonomic nerve preservation is attempted to preserve urinary and sexual functions as much as possible, provided this curability is not impaired. Laparoscopic surgery: Transabdominal surgery consists of open abdominal surgery and laparoscopic surgery. Indications for laparoscopic surgery are determined by consideration of the surgeon’s experience and skill, as well as tumor factors such as location and degree of cancer progression and patient factors such as obesity and history of open abdominal surgery (CQ-3) [6]. In the multimodal treatment of rectal cancer, standardized surgical resection (RAR, RAP, TME) remained the main modality of curative therapy. The introduction of the TME technique determined the decrease of local recurrences (RL) from 12%-20% to below 4%-5%, reduced the number of RAP and significantly improved survival with disease-free survival (DFS-disease free survival) at 5 and 10 years of 80%, respectively 78% [6]. For middle and lower rectal tumors, located more than 5 - 6 cm from the anocutaneous line, which do not invade the sphincter or levator apparatus, surgical treatment indicates previous resection tests with TME. The finding that rectal adenocarcinoma does not irregularly extend distally in the rectal wall and the development of the necessary instrumentation for mechanized anatomies allowed reconstruction by anastomosis even in the case of low tumors, whose lower edge is located more than 2 cm proximal to the dentate line [7]. For tumors located 1-2cm from the serrated line, an intersphincteric resection procedure and the performance of an ultra-low colo-anal anastomosis become necessary to achieve oncological radicality. In the case of upper rectal tumors, partial excision of the mesorectum (EPM) is sufficient by sectioning the mesorectum and the rectal wall 5 cm distal to the lower edge of the tumor, thus reducing the risk of anastomotic fistula.

Combined and Complex Treatment-Optimal Therapies

355

Adherence to the mesorectal planes, sharp visual dissection, and the avoidance of painful dissection, are elements that define a correct surgical intervention for rectal cancer. Both the oncological objective is ensured - the complete removal of the tumor and its lymphatic territory and obtaining an R0 type resection, as well as the functional objective - restoring digestive continuity and preventing any genitourinary complications [5, 8]. For rectal tumors of the upper third, anterior rectal resection with end-to-end colorectal anastomosis and EPM (Dixon operation) is indicated. For the middle and lower rectal neoplasm, for an optimal functional result, it is recommended to restore digestive continuity with a neorectal reservoir, either by performing a lateral-terminal colo-anal anastomosis (Baker anastomosis), or with a J-pouchanal (with a 5 cm reservoir), either by coloplasty. In addition, the rate of anastomotic fistulas is also reduced, compared to end-to-end anatomy [8]. Tumor localization at the level of the anal canal (less than 5 cm from the anocutaneous line) or less than 1 cm from the sphincter apparatus, levator invasion, as well as the association of preoperative sphincter dysfunction, in the conditions of a neoplasm located at a distance from the dentate line, require the realization a RAP. One of the fairly common complications of rectal resection with ETM is anastomotic fistula. In the literature, reports on the incidence of anastomotic failure in RAR vary between 1%-20%, the risk being the higher the lower the anastomosis is [38]. Within the therapeutic plan of rectal cancer, the laparoscopic technique can be used: for the systemic staging of the disease and the biopsy of metastases, for the execution of the ileostomy / colostomy (as a palliative treatment; in the case of obstructive, bleeding tumors, before neoadjuvant CRT; with a temporary visa in low RA; to reduce septic complications in the case of anastomotic fistulas), to achieve RAR or RAP. Contraindications to the laparoscopic approach in rectal cancer include: bulky, low-lying tumors with invasion of neighboring organs. Also, patients with morbid obesity and a narrow pelvis, those who have undergone CRT and those with a history of pelvic surgery may be difficult to operate with the minimally invasive technique [9]. Several studies have published favorable results regarding the use of robotic surgery in the surgical treatment of rectal cancer, with oncological goals achieved to an extent at least comparable to the laparoscopic technique. Among the advantages offered by the da Vinci Si HD system are: three-dimensional view with magnification, increased field of view, camera control by the operator, instruments with seven degrees of freedom, 540 degrees of rotation and 180 degrees of articulation, superior dexterity by canceling tremor and obtaining a dissection of greater accuracy with superior quality of surgical specimen and nerve preservation, shorter learning curve, lower conversion rate to open surgery [10].

5 Radiotherapy in Optimizing the Results of Radical Surgery Local recurrence and/or distant metastases occur in 50% of patients with rectal cancer. Deep invasion in the rectal wall, as well as the presence of metastatic lymph nodes are negative prognostic factors. In the absence of lymph nodes, the rate of pelvic recurrence is 5–19% in stage I, of 15–30% in stage II, and in stage III, the incidence increases to

356

C. Ungureanu and N. Ghidirim

over 50% [4–6]. Radiotherapy (RT) is used to sterilize microscopic neoplastic foci and reduce the risk of local recurrence. Surgical resection has long been the only therapeutic modality in rectal carcinomas. The addition of RT has shown, in patients with locoregionally advanced disease, a significant improvement of local control, but with no impact on global survival [6]. Research on the role of preoperative RT associated with radical surgery with total mesorectal excision (TME) showed a reduction in the rate of local recurrences from 10.9% in the group treated by surgery alone to 5.6% in the group with associated RT, but there were no reported differences in patient survival rates [11]. The rate of acute and late postoperative complications was higher compared to patients treated surgically per-primam (48% vs. 41%, p = 0.008). Most of the registered complications consisted of delayed healing of the perineal wound (29 vs. 18%), sexual function disorders in both sexes, as well as defecation disorders [8]. Intestinal occlusion was one of the most frequent complications [12]. The association of RT showed greater benefits in patients with CR in stage III compared to stage II (decrease in recurrence rates from 20.6% to 1.7%), and for locations in the middle portion of the rectum (between 5 and 10 cm of the anal margin), (decrease in recurrence rates from 13.7% to 3.7%). The advantages conferred by preoperative RT are more consistent under the conditions of a standard surgical treatment (with TME) [13]. Radiotherapy could be omitted if pathological examination of the excision specimen reveals an intact mesorectum with adequate radial resection margins (>2mm), minimal tumor penetration into the perirectal fat, an adequate number of negative regional lymph nodes (>12), the situation moderately and well differentiated tumors [14]. The conclusions of several studies on the association of RT with TME surgery are that only some subgroups of patients (stage III tumors and those located on the middle rectum) benefit from the association of RT with surgery. The combination of RT causes a marked reduction in the risk of local recurrence; this is more pronounced in the first two years, but the advantages are maintained even after 5 years. Not all patients should be treated by RT associated with surgery, but only those in the category with a high risk of recurrence (tumors in stage T3, with positive or potentially invaded CRMs, with complete parietal invasion or in the pubo-rectal muscles). The rate of late complications is higher in patients who received RT (especially the risk of occlusion and the risk of sexual dysfunction). RT can also be associated postoperatively, in patients in whom TME was not performed [15]. Preoperative RT was more effective, this fact being demonstrated in the randomized study conducted by the Dutch Colorectal Cancer Group on 1861 patients with “resectable” CR, with preoperative RT (25 Gy-short scheme) and TME, versus TME alone. After a median follow-up of 2 years, survival rates were identical (approximately 82%), with a significant reduction in the risk of recurrence at 2 years (2.4% in the preoperative RT group vs. 8.2% in the preoperative RT only group TME), and after 5 years, demonstrated that local recurrence rates in patients with negative lymph nodes remain at the level of 15–20% [11]. The advantages of preoperative RT can be concretized in: 1. Reducing the possibility of intraoperative dissemination of the neoplastic disease; 2. Increasing resectability by reducing the tumor volume; 3. Sterilization of micrometastases and/or regional adenopathies;

Combined and Complex Treatment-Optimal Therapies

357

4. Improvement of local control and survival without relapse; 5. Increasing the percentage of preservation of the sphincter apparatus; 6. Increased compliance.

6 Neoadjuvant Chemo-Radio-Therapy Neoadjuvant CH-RT therapy has been proposed as a viable alternative in the treatment of rectal cancers in advanced stages. Administered before surgery, RT objectively induces a response, with a potential benefit, related to the rate of resectability and/or preservation of the anal sphincter, in locally advanced rectal tumors. Chemotherapy (CHT) administered concurrently demonstrated an additional improvement of these effects [14]. Preoperative radio-chemotherapy aims to optimize the local control of the disease, by converting advanced rectal tumors to operability, due to the radiosensitizing effect of CHT, as well as improving systemic control by eradicating the micrometastatic disease. Recent randomized studies have confirmed the superiority of this neoadjuvant association, compared to RT alone: 3–4 times increase in complete pathological response rates (11–15 and 20–26% vs. 3–5 and 6–12%). In addition, the association of CHT with RT reduces local recurrence rates (7.6% and 8.6% vs. 17.1 and 16.5%) compared to RT as the only adjuvant method [14–17]. One of the most frequently used chemotherapy in colorectal cancer is 5-fluorouracil (5-FU) [13, 16]. Although CHT-RT confers a real benefit in terms of local control regardless of the mode and timing of administration (before or after surgery) the reference study performed by the German Rectal Cancer Study Group demonstrated the superior efficacy of preoperative administration of the protocols based on 5-FU in continuous administration for 4 weeks the local recurrence rate at 5 years being reduced by half (6% vs. 13%) [11]. The incidence of long-term toxicity, especially gastrointestinal, is lower in favor of the preoperatively treated group. Preoperative CHT-RT is better tolerated, provides better local control, but does not seem to influence the frequency of occurrence of distant metastases [17]. Although the 5-year disease-free survival and overall survival rates are equivalent to those of postoperative CHT-RT, it is currently recommended by most authors in all patients with T3 or T4 rectal cancers and tends to become the new standard in rectal cancer [3].

7 Rectal Cancer with Resectable Synchronous Liver Metastases Making a clinical decision, given the presence of liver metastases at the time of the initial diagnosis of primary rectal cancer, is a difficult dilemma. Despite the existence of general clinical practice guidelines, patients are very heterogeneous in terms of both primary tumor characteristics and metastatic sites, and each situation must be approached individually. Therefore, a wide multidisciplinary approach is necessary and essential, to establish the inclusion and timing of surgery in these patients. Approximately 50– 60% of patients diagnosed with colorectal cancer will develop liver metastases [18] and of these, 15–20% will present them synchronously. Unfortunately, only 10–20% of patients with liver metastases are candidates for liver surgery with curative intent [19]. However, in these patients, 5-year survival rates may exceed 50% after liver resection [20]. As long as the primary tumor is amenable to resection, the first critical step is to

358

C. Ungureanu and N. Ghidirim

determine the resectability of metastases. This will provide the opportunity to determine whether to choose a curative, more aggressive goal, or opt for a palliative one. In patients with unresectable liver metastases and an asymptomatic primary rectal cancer, standard chemotherapy for advanced disease will be initiated. In the presence of significant symptoms, before systemic treatment, surgical diversion, stenting, chemoradiotherapy or even surgical resection may be necessary. The approach to patients who have resectable rectal cancer with synchronous liver metastases is decided according to the extent of the disease at the primary and metastatic sites. Acceptable options for initial treatment include: synchronous or sequential surgical resection, neoadjuvant chemoradiotherapy and combination of systemic chemotherapy regimens associating bevazucimab.

8 Sequential or Synchronous Resection of the Primary and Metastatic Disease The presence of synchronous metastases may indicate a more disseminated stage of the disease and may imply a more severe prognosis than their metachronous development [21]. Therefore, some experts suggest that initial chemotherapy would be more prudent [22–24]. The morbidity and mortality of liver resections performed synchronously increases significantly, in the case of major liver resections (more than one lobe), compared to their sequential approach. Therefore, caution is recommended in the use of the synchronous approach in patients who require large liver resections. In the sequential approach, after resection of the primary tumor, liver resection can be performed at 4–6 week intervals, or, as an alternative, chemotherapy can be administered initially, followed by reevaluation. Synchronous resection may be the most appropriate in the case of a minimal extension of the disease in both sites (primary and metastatic). Neoadjuvant chemoradiotherapy The administration of chemoradiotherapy as a first step (neoadjuvant) can be considered especially in the case of a locally advanced symptomatic disease (bleeding lesions or incomplete obstruction) and ideally associated with a reduced volume of liver metastases. This can improve symptoms and improve local control. It can be followed by sequential or synchronous resection of the metastases, as previously stated. Alternatively, a course of systemic chemotherapy may be administered initially, followed by reevaluation. However, chemoradiotherapy may induce reduced tolerance to bevazucimab, thus altering the potential treatment of metastatic disease [25]. The combination of bevazucimab - systemic chemotherapy Initial systemic chemotherapy represents an acceptable option for patients with synchronous liver metastases. It can be followed either by sequential or synchronous hepatic resection, or by chemoradiotherapy, depending on the extent of the disease at the level of the two sites. Neoadjuvant chemotherapy addresses the systemic disease, but it can also have an impact on the primary tumor [39]. Furthermore, response to neoadjuvant chemotherapy before liver resection was correlated with overall survival. Even though the 5-year survival of patients with neoadjuvant chemotherapy prior to liver resection was similar to those without chemotherapy (43% versus 35%), those who received chemotherapy and whose disease did not progress had better survival ( 85% versus 35%) [26]. Bevazucimab can be associated with an increased risk of surgical bleeding and that is why experts recommend

Combined and Complex Treatment-Optimal Therapies

359

stopping it, at least 6–8 weeks before a major surgical procedure, and starting it after at least 4 weeks postoperatively [27]. Systemic chemotherapy in prolonged administration increases the risk of hepatotoxicity [28] (irinotecan/oxaliplatin regimens more than those with 5-FU), and the presence of steatohepatitis in patients with liver resections significantly increases mortality at 90 days (14.7% versus 1, 6%). Liver resection, when feasible, should be performed after 4–6 cycles of systemic chemotherapy. Chemoradiotherapy can be used in patients who have benefited from resections of primary tumors and liver metastases without pelvic irradiation.

9 Conclusions Complex treatment has demonstrated its role in reducing morbidity and mortality in rectal cancer, but also in improving long-term survival. The multidisciplinary approach is of major importance, both preoperatively and postoperatively. Surgical treatment remained the main method of treatment and is standardized, but there are still controversies in the type and establishment in useful times of the other therapeutic means. Future trials will refine strategies to identify optimal treatment protocols. Conflict of Interest. The authors declare that they have no conflict of interest.

References 1. World Health Organisation, International Agency for Research on Cancer. https://gco.iarc.fr/ today/data/factsheets/cancers/10_8_9-Colorectum-fact-sheet.pdf 2. American Society of Colon and Rectal Surgeons: Practice parameters for the treatment of rectal cancer (revised). Dis. Colon Rectum 48, 411–423 (2005). https://doi.org/10.1007/s10 350-004-0937-9 3. National Comprehensive cancer Network: Rectal cancer clinical practice guidelines in Oncology. J. Natl. Compr. Can. Netw. 3, 492–508 (2005). https://doi.org/10.6004/jnccn.2005. 0025 4. D’Angelica, M., Idrees, K., Paty, P.B., Blumgart, L.H.: Colorectal cancer: metastatic (Palliation). In: Wolff, B.G., Fleshman, J.W., Beck, D.E., Pemberton, J.H., Wexner, S.D. (eds.) The ASCRS textbook of colon and rectal surgery, pp.471–472. Springer, New York (2007). https://doi.org/10.3393/jksc.2011.27.5.226, ISBN-13: 978–0387–24846–2 5. Tarcoveanu, E., Zanoschi, C.: Amputat, ia de rect. Jurnalul de chirurgie 2(2), 204–222 (2006) 6. Japan Society of Clinical Oncology 2011. Int. J. Clin, Oncol. 14, 1–29 (2012). https://doi. org/10.1007/s10147-011-0315-2 7. Chan, C.L.H., Bokey, E.L., Chapuis, P.H., Renwick, A.A., Dent, O.F.: Local Recurrence after curative resection for rectal cancer is associated with anterior position of the tumor. Br. J. Surg. 93, 105–112 (2006). https://doi.org/10.1002/bjs.5212 8. Steffen, T., Tarantino, I., Hetzer, F.H.: Safety and morbidity after ultra-low coloanal anastomoses: J-pouch vs end-to-end reconstruction. Int. J. Colorectal. Dis., 277- 281 (2008). https:// doi.org/10.1007/s00384-007-0414-8 9. Copaescu, C.: Excizia total˘a a mezorectului prin abord laparoscopic. Jurnal Oficial al Societ˘at, ii Române de Chirurgie 103(1), 87–94 (2008) 10. Freschi, C., Ferrari, V., Melfi, F., et al.: Technical review of the da Vinci surgical telemanipulator. Int. J. Med. Robot., 396–406 (2013). https://doi.org/10.1002/rcs.1468

360

C. Ungureanu and N. Ghidirim

11. Kapitejin E., et al.: For the Dutch colorectal cancer group (2001). preoperative radiotherapy combined with total mesorectal Excision for resectable rectal cancer. N Engl. J. Med. 345, 638–646 (2001). https://doi.org/10.1056/NEJMoa010580 12. Birgisson, H., Pahlman, L., Gunnarson, U., Glimelius, B.: Swedish rectal cancer rial Group. Adverse effects of preoperative radiation therapy for rectal cancer: long term follow-up of the Swedish rectal cancer trial. J. Clin. Oncol. 23(24), 8697–8705 (2005). Hardback ISBN: 9780323476744 13. Cohen, A.M., Garofalo, M.C., De Simone, P.A., Hanna, N.N., Regine, W.F: Cancer of the rectum. In: Abeloff, M.D, Armitage, J.O., Niederhuber, J.E., Kastan, M.B., Mc Kenna, W.G. (eds.) Abeloff’s Clinical Oncology, 4 edn., pp. 2353–2370. Churchill Livingstone Elsevier, Philadelphia (2008) 14. Deutsch, E., Ezra, P., Mangoni, M., Ducreux, M.: Radiotherapy for localized rectal cancer. Ann. Oncol. 18(suppl.9), ix105-ix113 (2007). https://doi.org/10.1093/annonc/mdm304 15. Enker, W.E., Thaler, H.T., Cranor, M.L., Polyak, T.: Total mesorectal excision in the operative treatment of carcinoma of the rectum. J. Am. Coll. Surg. 181(4), 335–346 (1995) 16. Libutti, S.K., Tepper, J.E., Salz, L.B.: Rectal cancer. In: DeVita, V.T., Lawrence, T.S., Rosenberg, S.A. (eds.) De Vita Hellman, and Rosenberg’s Cancer: Principles and Practice of Oncology, 8 edn., pp. 1285–1301. Wolter Kluivert/Lippincott Williams and Wilkins, Philadelphia (2008). ISSN 1584 – 9341 17. Sauer, R., et al.: Preoperative versus postoperative Chemoradiotherapy for Rectal Cancer. N. Engl. J. Med. 351, 1731–1740 (2004). http://www.ncbi.nlm.nih.gov/pubmed/22529255 18. Yoo, P.S., Lopez-Soler, R.I., Longo, W.E., Cha. C.H.: Liver resection for metastatic colorectal cancer in the age of neoadjuvant therapy and bevazucimab. Clin. Colorectal Cancer 6(3), 202–207 (2006). https://doi.org/10.3816/CCC.2006.n.036 19. Van Cutsem, E., Nordlinger, B., Adam, R.: Towards a pan-European consensus on the treatment ofpatients with colorectal liver metastasis. Eur. J. Cancer 42, 2212–2221 (2006). https:// doi.org/10.1016/j.ejca.2006.04.012 20. Choti, M.A., Sitzmann, J.V., Tiburi, M.F.: Trends in long-term survival following liver resection for hepatic colorectal metastasis. Ann. Surg. 235, 759–766 (2002). https://doi.org/10. 1097/00000658-200206000-00002 21. Tsai, M., Su, Y., Ho, M.: Clinicopathological features and prognosis in resectable syncronous and metachronous colorectal metastasis. Ann. Surg. Oncol. 14, 786–794 (2007). https://doi. org/10.1245/s10434-006-9215-5 22. Nordlinger, B., et al.: Does chemotherapy prior to liver resection increase the potential for cure in patients with metastatic colorectal cancer? A report from the european colorectal metastases treatment group. Eur. J. Cancer 43(14), 2037–2045 (2007). https://doi.org/10. 1016/j.ejca.2007.07.017 23. Hewes, J., Dighe, S., Morris, R., Hutchins, R., Bhattacharya, S., Davidson, B.: Preoperative chemotherapy and the outcome of liver resection for colorectal metastases. World J. Surg. 31(2), 353–364 (2007). https://doi.org/10.1007/s00268-006-0103-8 24. Weish, F.K., Tilney, H.S., Tekkis, P.P., John, T.G., Rees, M.: Safe liver resection following chemotherapy for colorectal metastases is a matter of timing. Br. J. Cancer 96(7), 1037–1042 (2007). https://doi.org/10.1038/sj.bjc.6603670 25. Aschele, C., Lonardi, S.: Multidisciplinary treatment of rectal cancer: medical oncology. Ann. Oncol. 18(9), 114–121 (2007). https://doi.org/10.1093/annonc/mdm478 26. Glynne-Jones, R., Grainger, J., Harrison, M.: Neoadjuvant chemotherapy prior to preoperative chemoradiation or radiation in rectal cancer: should we be more cautious? Br. J. Cancer 94, 363–371 (2006). https://doi.org/10.1038/sj.bjc.6602960

Combined and Complex Treatment-Optimal Therapies

361

27. NCCN Clinical Practice Guidelines in Oncology: Rectal Cancer 3, 1–69 (2008). https://doi. org/10.6004/jnccn.2009.0057 28. Fernandez, F.G., Ritter, J., Goodwin, J.W., Linehan, D.C., Hawkins, W.G., Strasberg, S.M.: Effect of steatohepatitis associated with irinotecan or oxaliplatin pretreatment on resectability of hepatic colorectal metastases. J. Am. Coll. Surg. 200(6), 845–853 (2005). https://doi.org/ 10.1016/j.jamcollsurg.2005.01.024

The Peculiarities of Circadian Rhythms and Their Implications on Parkinson’s Disease Lilia Rotaru2(B) , M˘ad˘alina Cebuc1 , Adrian Lupus, or1,2 , Oxana Grosu2 Victor Vovc1,2 , Svetlana Lozovanu1 , Ghenadie C˘ar˘aus, ul1 , and Stanislav Groppa1

,

1 State University of Medicine and Pharmacy “N. Testemitanu”, Chisinau, Republic of Moldova , 2 Neurology and Neurosurgery Institute “D. Gherman”, Chisin˘au, Republic of Moldova ,

[email protected]

Abstract. Unsettling epidemiological data suggest Parkinson’s disease as the second most common neurodegenerative disorder worldwide. The worries persist as there is a demographic tendency towards the ageing of the population as the life expectancy rises. Simultaneously, circadian rhythm disruptions become more frequent as artificial life sources multiply in our daily lives. Thus, the interest of this study resides in determining the traits the endogenous clock has in the context of Parkinson’s. In order to reach this aim, a case control approach was selected which helped identify the associations between altered sleep quality and the disease (p = 0.007) along with the worsening of the motor dysfunctions (p = 0.029). Additionally, chronotype based variances in symptomatology’s severity was observed – worst outcomes remarked in morning individuals. Furthermore, the effect light, as main zeitgeber, exerts in diagnosed subjects was assessed and completed with from complementary studies evaluating its uses as a therapeutic tool. The end point of this paper was to attract attention upon an insufficiently researched topic, as are circadian rhythms disruptions in Parkinson’s disease, since they only recently acquired a diagnostical relevance as prodromal non-motor symptoms. Correspondingly, we wanted to incite researchers from different fields to study ways of using the biological clock’s peculiarities to enhance diagnosed patients’ lives through a transdisciplinary approach. Keywords: Circadian Rhythms · Parkinson’s disease · Chronotype · Sleep

1 Introduction Circadian rhythms (CR) have acquired a growing interest over the past years due to their involvement in the maintenance of homeostasis and the specifics of modern lifestyles that could trigger their misalignment [1]. As per their definition, they represent endogenously generated autonomous cycles of approximately 24 h that ensure the adequate function of the organism [1, 3, 4]. The proven capacity of cells and tissues to preserve their ability to generate a circadian activity on their own is attributed to the molecular clock – a structured feedback loop system within each individual cell that provides the ground base for all © The Author(s), under exclusive license to Springer Nature Switzerland AG 2024 V. Sontea et al. (Eds.): ICNBME 2023, IFMBE Proceedings 92, pp. 362–371, 2024. https://doi.org/10.1007/978-3-031-42782-4_39

The Peculiarities of Circadian Rhythms and Their Implications

363

cellular processes that undergo during a day [1, 3]. All those peripheral rhythms are synchronized in the organism by a central peacemaker – the suprachiasmatic nucleus [2]. Additionally, CR are subjected to “entrainment” – the coordination of the internal clock’s activity to external time cues – zeitgebers [4]. Ageing – a natural process defined by the cumulation of senescent modifications; is a subject of actuality in the context of the rising life expectancy and growing geriatric population worldwide [5]. Subsequently, numerous questions emerge regarding the impact circadian rhythm disruptions could have on the neuronal integrity and homeostasis. This study’s concern resides on Parkinson’s disease (PD), the second most common neurodegenerative disorder [7, 8]. Parkinson’s disease – classically, defined by a motor impairment resulting the loss of dopaminergic neurons in substantia nigra compacta; outlines a complex multisystem disorder [7, 9]. Consequently, various non-motor symptoms became significant from a diagnostic standpoint and should be monitored hence they could be indicative of the pathology years before the onset of typical motor deficiencies [7, 10]. Among those, sleep disorders and dyssynchronous circadian rhythms are frequently identified and can profoundly affect the quality of life [10]. This research pursued to outline the peculiarities surrounding the connection of circadian rhythms and Parkinson’s disease by analyzing those entities via a case control approach. The aim was to portray the weight of the endogenous clock disruptions along the impact one’s individual chronotype has upon the induction and evolution of this neurodegenerative pathology. Furthermore, the study pursued to profile the modulatory effect light as a zeitgebers exert on the entrainment of circadian rhythms and its uses as a therapeutic method in Parkinson’s disease.

2 Material and Methods 2.1 Study Design The research consisted on an analytical observational approach on the topic, notably by realizing a case control-study. Respectively, two samples – with and without Parkinson’s disease; were formed and analyzed in the timeframe 2020–2023 in Republic of Moldova at the Institute of Neurology and Neurosurgery “D. Gherman” as part of the project 20.80009.8007.39. Data collection was ensured through two methods. Primarily, subjects confirmed with Parkinson’s disease were clinically evaluated based on MDS-UDPRS Score, AkineticRigidity Score (AR-Score) and Tremor Score (Tr-Score), followed by the Levodopa Equivalent Daily Dose (LEDD). Thus, obtaining information upon the phenotype and severity of motor deficiencies associated with the pathology. Additionally, Montreal Cognition Assessment (MoCA), Index of Depression Beck (IBD) and Apathy Scale were evaluated to profile the presence of cognitive impairment and depression. Secondly, in order to assess the characteristics of circadian rhythms in both samples, a screening test was specifically designed to this matter comprising Pittsburgh Sleep Quality Index (PSQI) and questions about the individual’s chronotype and the lighting particularities before bedtime.

364

L. Rotaru et al.

The next step of the study was the statistical analysis of the collected data through the software IBM-SPSS. Initially, the results reflecting the circadian rhythm steadiness of the PD and control groups were evaluated, notably the total PSQI and its various components. Afterwards, within the PD sample the scores reflecting the severity of the disease were assessed based on the chronotype selected by the subjects in addition to their light exposure specifics. 2.2 Sample Characteristics In the framework described above were constituted and studied two samples: – The Parkinson’s disease group consisting of 37 subjects - 15 males and 22 females; with the mean age of 59,97 (±8.49). – The control group consisting of 40 subjects – 18 males and 22 females; with the mean age of 62,65 (±14.83). Eligibility criteria included the informed consent of the respondents along with their ability to complete the questionnaire by themselves or helped by a caregiver. Furthermore, the PD sample’s subjects had to be diagnosed with the disease and assessed in conformity with the scales and scores aforementioned.

3 Results and Discussion 3.1 Circadian Rhythm Disruptions – Prominent in Parkinson’s Disease The independent sample t-test contoured higher total PSQI scores in PD subject as opposed to the control group in a significant statistical way (6.76; ± 4.21 vs. 4.50; ±1.80; p = 0.003). Accordingly, subjective sleep quality was approximately twice more altered in the PD sample (1.081; ± 0.76 vs. 0.55; ± 0.55; p = 0.001); ad idem sleep efficiency was compromised (0.86; ±1.06 vs. 0.45; ±0.64). PSQI scores for sleep duration are significantly raised in the PD group (0.95; ±0.97 vs.0.25; ±0.49; p < 0,001), consistently, diagnosed subjects had less sleep hours in contrast with control ones (6.32; ±1.18 vs. 7.22; ± 0.87; p < 0.001) (Table 1). Table 1. Sleep quality in Parkinson’s disease vs. control subjects.

The Peculiarities of Circadian Rhythms and Their Implications

365

The (un)modified traits of sleep parameters were assessed against the diagnostic of PD through the chi-square test. Correspondingly, the following statistically significant associations were registered between: the undermined subjective sleep quality in PD (58.8%) in contrast to control (41.2%) (χ2 = 7,02; df = 1; p = 0.007); the prolonged sleep latency in PD (45.7%; 33.9, ± 48.85 min) compared to control (67.5%; 22.30, ± 12.61 min) (χ2 = 3.62; df = 1; p = 0.047). Furthermore, a common finding in PD subjects was nocturnal and/or early morning awakenings (57.6%) in contrast to their homologs whom preponderantly accuse sleep latency related issues (71,4%). The respective association has been proven statistically significant (χ2 = 5.84; df = 1; p = 0.027). The Pearson correlation test showed a positive moderate connection between UPDRS3 and total PSQI scores (r p = 0.37; p = 0.029). This interdependence is sustained by the additional positive moderate result interlinking UPDRS3 and sleep duration – one of PSQI score’s component (r p = 0.40; p = 0.017). Concomitantly, a similar result was observed between the total PSQI and ARScore (r p = 0.43; p = 0.009). One of the major circadian rhythm is the sleep-wake cycle – a reflection of the organism’s adaption according to the light and dark phases of the day. Simultaneously, the last is relevant in sleep’s homeostasis as it reflects the circadian aspect of its physiology or, the, so called, process C [11]. This overlap arguments sleep’s quality as a reflection of the steadiness of the endogenous clocks. Movement disorder society criteria for the diagnosis of Parkinson’s disease marks the weight of non-motor symptoms as they can manifest years before the typical motor alterations [9]. The most frequently identified ones are circadian and sleep disruptions that worsen over time as neurodegenerative modifications advance. Correspondingly, the afore presented results support their link to PD (p = 0.007) as diminished sleep quality prevails in diagnosed subjects (p = 0.003). The results pictured a huge increase in sleep latency in PD as opposed to control subjects. A study on mouse models showed a similar result (p = 0.63) [12]; however, it appears reduced latency is usually more common in Parkinson’s disease [13]. Nocturnal/early morning awakenings were significantly associated to PD (p = 0.027) being present in most the individuals analyzed – the result corresponding to those of additional researches [14, 15]. The correlation portrayed between CR disruptions and motor dysfunction (p = 0.029) is supported from a pathophysiological standpoint being attributed to protein dyshomeostasis and neuroinflammation [15]. Similar findings were assessed in clinically based researches. Therefore, a longitudinal study determined the association of endogenously modified clocks to the risk of developing PD over a course of 11 years in older adults [16].The types of CR disruptions found consisted on the amplitude dampening and lack of robustness. Those modifications were seen to compromise anticipatory postural adjustments in Parkinson individuals [17]. In addition, motor symptoms, such as nocturnal akinesia, could contribute to alterations in sleep quality and, respectively, circadian steadiness [10]. Studies on dopamine showed a disrupting effect on the sleep-wake cycles that needs further investigation [18, 19]. Circadian rhythm disruptions are identified as a constituent of Parkinson’s disease as per the presented results and should be considered accordingly. Additionally, their degree of alteration could reflect on the severity of the motor dysfunction worsening the

366

L. Rotaru et al.

course of the pathology also suggested in additional sources. However, the presented data manifests a series of limitations as per the small sample size and the lack of a longitudinal assessment of the subjects. 3.2 The Chronotype – a Disease Modifying Factor The morning chronotype prevailed in the studied samples: 83.8% of the Parkinson’s disease subjects; 78.4% of the control subjects. The chi-square test didn’t identify any association between the type of circadian rhythm and the analyzed groups (p > 0.05). The total PSQI score of PD subjects favored the morning over the evening chronotype (6.48; ±4.32; p > 0.05). Similar results were obtained in several PSQI component such as sleep: latency (0.90; ± 1.14 vs. 1.50; ±1.22; mean minutes spent: 29.34; ±44.55 vs. 57.50; ± 66.91; p > 0.05); duration (0.87; ±096 vs.1.33; ± 1.03; mean hours slept:6,41; ±1.19 vs.5.83; ± 1.13; p > 0.05); efficiency (0.77; ±1.06 vs.1.33; ± 1.32; p > 0.05). Opposite findings were accounted regarding subjective sleep quality (1.10; ±0.79 vs.1.00; 0.63; p > 0.05) and daytime dysfunction (0.81; ±0.79 vs.0.67; ± 3.60; p > 0.05) scores. Motor activity assessment illustrated lower UPDRS3 values in PD subjects with morning compared to evening type of circadian rhythm (36.14; ± 12.67 vs. 37.33; ± 8.45; p > 0.05). LEDD pictured higher scores in the morning than in the evening chronotype (661.29; ± 327.80 vs. 542.00; ± 339.37; p > 0.05). Additionally, depending on the phenotype of the motor deficiencies, the subjects selected advanced or delayed CR characteristics. Thus, morning chronotypes were more common in those with higher TrScores (.0.87; ± 0.38 vs.0.81; ± 0.72; p > 0.05) and evening ones in those with higher ARScores (0.65; ±0.56 vs. 0.63; ±0.41; p > 0.05). Cognitive evaluation noted a stressed decline in function in morning chronotype (22.97; ±2.32 vs.25.00; ±2.28; p > 0.05). Simultaneously, worst outcomes in Beck Depression Index (11.55; ±8.79 vs. 13.83; ±12.64; p > 0.05) and in the Apathy Scale (12.74; ± 5.45 vs. 14.33; ±5.57; p > 0.05) were registered in evening chronotype individuals. Chronotypes portray the variance of the circadian rhythm’s activity among individuals. Two conventionally recognized biological clock patterns are distinguished: owls and larks. The firsts have a phase advancement whilst the lasts a phase delay of the biological clock. However, the intermediate chronotypes prevail in society [12]. The proprieties of circadian rhythms vary across a lifetime. Ageing causes the biological clocks a phase-advancement shift and a flattening in amplitude [19] which are more accentuated in neurodegenerative disorders. Purely descriptive, this predilection towards the morning chronotype is more marked in PD subjects, which corresponds to data stated in another research [12]. One’s biological rhythm can become a predictor of the disease as suggested in a mendelian randomization study that observed a 27% increased risk in developing Parkinson’s disease in those with morning chronotype [20]. Compared to their homologs, lark PD subjects showed better overall sleep quality to which contributed a shorter latency and a longer duration of sleep. Additionally, they presented better motor function corresponding to findings in a similar study [6]. However, their LEDD was higher than in evening chronotypes fact that could be due to the impact CR have upon the metabolism of dopamine [21].

The Peculiarities of Circadian Rhythms and Their Implications

367

Complementary, evaluation of cognitive function pictured a higher decline in morning as opposed to evening subjects. Although, it’s not clear whenever this result is due to a more profound neurodegenerative process in larks or to their diminished alertness as a result of completing the questionnaire inappropriately to their respective chronotype. This last assumption is sustained in studies by the oscillation of cognitive performance according to the time of day and the type of circadian rhythm [22]. Mood alterations were also more significant in morning chronotypes possibly due to better sleep quality or more light exposure, factor known to improve mental state [23]. The restraints this analysis has upon the accurate assessment of the chronotype in PD resides in the lack of an objective measure as individuals self-reported their preference. A similar method was used in several studies either by subjects directly selecting the circadian phenotype or via the Morningness-Eveningness Questionnaire [13, 21, 25, 26]. In order to fill the objectivity criteria some researchers used actigraphy along with smartphone applications able to quantify motion which helped analyze rest-activity rhythms [26–28]. Those methods should be envisaged in further studies of the topic. 3.3 Zeitgebers’ Exposure Modulation – a Targeted Therapy in Parkinson’s Disease Based on the self-reported data provided by the studied subjects, the characteristics of their home’s illumination after 6PM was assessed based on light’s luminance (perceived brightness) and temperature from cold to warm, vulgarized into blue, white, neutral and yellow light. Luminance intensity varied among the examined samples: Parkinson’s disease subjects preferring weak lighting (57.1%); while the control sample a stronger one (47.6%). Simultaneously, the chi-square test marked the statistically significant association between the light color and the diagnosis of Parkinson’s disease (χ2 = 22.25; df = 3; p = 0.04). Accordingly, PD subjects showed a preference upon white (51.4%) followed by yellow (25.4%) light which contrasts with the control group that had stronger inclinations towards neutral light (70.3%) (Table 2). Table 2. Peculiarities of lighting in Parkinson’s disease vs. control subjects

A cardinal element in the adaption of the organisms’ CR to the rotative movement of Earth around its axis and, respectively, the day/night oscillations is light – the main zeitgeber. Photonic information registered by the intrinsically photosensitive retinal ganglion cells (ipRGCs) is transmitted to the suprachiasmatic nucleus (SCN) that will shape the central circadian rhythm [1].

368

L. Rotaru et al.

Light can be described by a series of photometric terms such as: “luminous flux” – is the total amount of light emitted by a source; or “intensity” – the ratio of luminous flux on a radiation angle. Subsequently, “luminance” is the impression of brightness of a surface perceived by the human eye; not to be mistaken with “illuminance” that denotes the amount of light that arrives upon a surface measured in lux [28]. A majority of the PD subjects analyzed attested low luminance of their homes before bedtime. The observation, remaining purely descriptive, sustains findings of additional researches that portray the indoor and sedentary lifestyles of patients due to the motor impairment [7]. The lack of natural light during day-time followed by artificial lighting at night contributes to the misalignment of CR, sleep disruptions and mood disorders. Additionally, the progressive degeneration of the retinohypothalamic tract due to the alpha-synucleinopathy fragilizes the entrainment process of the endogenous clocks [29]. From this standpoint, arises the interest of bright light therapy (BLT) as a non-invasive approach in the treatment of Parkinson’s disease. Bright light therapy consists in the controlled exposure of the patient to a spectrum of 1 000 to 10 000 lx for a selected amount of time, varying from 30 to 90 min, at a specific moment of its circadian rhythm [7]. Several studies portrayed its efficacity in diminishing motor along with non-motor symptoms. A consistent finding was the positive outcomes on insomnia, RBD and mood disorders such as depression and anxiety [31, 32]. Fewer studies remarked an improvement of motor dysfunction, especially bradykinesia and rigidity, more pronounced in longer time-frames of therapy [33, 34]. Interestingly, BLT improved the efficacy of dopaminergic treatments leading to lower L-dopa dosages which could be useful in medication resistant individuals [30, 33]. Specific proprieties of the constituents of lightbulbs contribute to the generation of an array of perceived light colors from warm yellowish ones to cold bluish nuances, explained by the inversely proportional relationship between light’s wavelengths and temperature. Thus, the colder the light the more it shifts towards the blue spectrum to which the ipRGCs display high affinity [34]. Screen democratization helped prove their powerful phase shifting effect on biological clocks enhancing numerous sleep disorders. Blue light’s phototoxicity was evaluated in a research on flies proving deleterious effects on their neuronal structures and reducing their lifespan [35]. Although, the association between the lighting color and the diagnostic of Parkinson’s disease is significant (p < 0.04) in this study, whenever it was at the disadvantage or not of the subjects is not clear. Additional research contoured a series of effects that would benefit patients with neurodegenerative disorders such as increased alertness, productivity and working memory [35, 37]. Positive effects on mood should also not be disregarded. The therapeutic effect was envisaged in a study on the effects of blue-light glasses in PD, results showing potential [37]. Limitations of the study include the small sample size, but most importantly, the lack of objectivity in reporting the home light characteristics. Insufficient education of the subjects on the matter and high variability of each individual’s ability to assess luminance, especially in the context of an older population prone to sight impairment, could have impacted the data accuracy. Additional sources of light and other unaccounted zeitgebers could also have impeded.

The Peculiarities of Circadian Rhythms and Their Implications

369

4 Conclusions The study provided extensive perspective upon the various entanglements circadian rhythms share with Parkinson’s disease as their significance raises in the actual ageing society prone to artificial light exposure. The analysis outlined the circuity between the endogenous clock disruptions and Parkinson’s disease by illustrating the correlation uniting the severity of motor dysfunction to sleep’s quality, which’s altered architecture prevailed in affected subjects. Furthermore, the data suggests morning chronotype as a frequent finding in those diagnosed. Despite the overall improved sleep quality and motor function, larks required larger amounts of medication and had higher cognitive impairment as opposed to owls. The inequity of the samples’ sizes among circadian rhythm phenotypes marks the need for additional research on the topic. Luminance variations were observed among samples. Subjects with Parkinson’s disease were more exposed to darker environments before bedtime and an association was found with the light’s temperature. In summation, widening of the actual knowledge on the peculiarities of the circadian rhythms in the context of Parkinson’s disease is key in developing new therapeutic strategies. Innovations useful in the objective assessment of one’s chronotype would represent a corner stone for evaluation of at-risk population and chrono-pharmaceutics. Simultaneously, advancements in understanding zeitgebers could be used in new technologies to shape the disease’s symptomatology. Conflict of Interest. The Authors Declare that They Have no Conflict of Interest.

References 1. Steele, T.A., et al.: Circadian rhythm sleep-wake disorders: a contemporary review of neurobiology, treatment, and dysregulation in neurodegenerative disease. Neurotherapeutics 18(1), 53–74 (2021). https://doi.org/10.1007/s13311-021-01031-8 2. Finger, A.M., Kramer, A.: Mammalian circadian systems: organization and modern life challenges. Acta Physioogical 231(3), 1–19 (2021). https://doi.org/10.1111/apha.13548 3. Hunt, J., et al.: Sleep and circadian rhythms in Parkinson’s disease and preclinical models. Mol. Neurodegener. 17(1), 1–21 (2022). https://doi.org/10.1186/s13024-021-00504-w 4. Grabe, S., et al.: Synergies of multiple zeitgebers tune entrainment. Front. Netw. Physiol. 1(January), 1–11 (2022). https://doi.org/10.3389/fnetp.2021.803011 5. Deuschl, G., et al.: The burden of neurological diseases in Europe: an analysis for the global burden of disease study 2017. Lancet Public Health 5(10), e551–e567 (2020). https://doi.org/ 10.1016/S2468-2667(20)30190-0 6. Marano, M., et al.: Neurobiology of sleep and circadian rhythms circadian profile, daytime activity, and the parkinson’s phenotype: a motion sensor pilot study with neurobiological underpinnings. Neurobiol. Sleep Circadian Rhythms 14(March), 100094 (2023). https://doi. org/10.1016/j.nbscr.2023.100094 7. Fifel, K., Videnovic, A.: Chronotherapies for Parkinson’s disease. Prog. Neurobiol. 174(January), 16–27 (2019). https://doi.org/10.1016/j.pneurobio.2019.01.002 8. Mantovani, S., et al.: An overview of sleep and circadian dysfunction in Parkinson’s disease. J. Sleep Res. 27(3), 1–22 (2018). https://doi.org/10.1111/jsr.12673

370

L. Rotaru et al.

9. Colosimo, C., et al.: Diagnostic criteria for Parkinson’s disease: from James Parkinson to the concept of prodromal disease. Front. Neurol. 9(March), 1 (2018). https://doi.org/10.3389/ fneur.2018.00156 10. Bohnen, N.I., Hu, M.T.M.: Sleep disturbance as potential risk and progression factor for Parkinson’s disease. J. Parkinson’s disease 9(3), 603–614 (2019). https://doi.org/10.3233/ JPD-191627 11. Goldstein, C.A.: Overview of circadian sleep-wake rhythm disorders. UpToDate, 1–33 (2022) 12. Murphy, S., et al.: Chronotype, sleep, and sleepiness in Parkinson’s disease. Park. Relat. Disord. 106(2022), 105189 (2023). https://doi.org/10.1016/j.parkreldis.2022.10.011 13. Keir, L.H.M., Breen, D.P.: New awakenings: current understanding of sleep dysfunction and its treatment in Parkinson’s disease. J. Neurol. 267(1), 288–294 (2020). https://doi.org/10. 1007/s00415-019-09651-z 14. Peeraully, T., et al.: Sleep and Parkinson’s disease: a review of case-control polysomnography studies. Mov. Disord. 27(14), 1729–1737 (2012). https://doi.org/10.1002/mds.25197 15. Leng, Y., et al.: Association between circadian rhythms and neurodegenerative diseases. Lancet Neurol. 18(3), 307–318 (2019). https://doi.org/10.1016/S1474-4422(18)30461-7 16. Leng, Y., et al.: Association of circadian abnormalities in older adults with an increased risk of developing Parkinson Disease. JAMA Neurol. 77(10), 1270–1278 (2020). https://doi.org/ 10.1001/jamaneurol.2020.1623 17. Stewart, J., et al.:Circadian dysfunction and fluctuations in gait initiation impairment in Parkinson’s disease. Experiment. Brain Res. 236(3), 655–664 (2018). 18. Lauretti, E., Pratic, D.: Circadian clock disruption and neuroin flammation in Parkinson ’ s disease : a new perspective. Elsevier (2020). https://doi.org/10.1016/B978-0-12-815950-7. 00022-9 19. Logan, R.W., McClung, C.A.: Rhythms of life: circadian disruption and brain disorders across the lifespan. Natural Rev. Neurosci. 20(1), 49–65 (2019). https://doi.org/10.1038/s41583-0180088-y 20. Noyce, A., et al.: Tendency towards being a ‘Morning person’ increases risk of Parkinson’s disease: evidence from Mendelian randomisation. bioRxiv, 44(0), 288241 (2018). https://doi. org/10.1101/288241 21. Cullell, N., et al.: Sleep/wake cycle alterations as a cause of neurodegenerative diseases: a Mendelian randomization study. Neurobiol. Aging 106(320), e1-320.e12 (2021). https://doi. org/10.1016/j.neurobiolaging.2021.05.008 22. Wu, J.Q., et al.: Circadian rest-activity rhythms predict cognitive function in early Parkinson’s disease independently of sleep. Movement Disorders Clin. Pract. 5(6), 614–619 (2018). https://doi.org/10.1002/mdc3.12692 23. Blume, C., et al.: Effects of light on human circadian rhythms, sleep and mood. Somnologie, 147–156 (2019). https://doi.org/10.1007/s11818-019-00215-x 24. Thapa, N., et al.: The relationship between chronotype, physical activity and the estimated risk of dementia in community-dwelling older adults. Int. J. Environ. Res. Public Health 17(10), 1 (2020). https://doi.org/10.3390/ijerph17103701 25. Marano, M., et al.: Circadian profile, daytime activity, and the Parkinson’s phenotype: a motion sensor pilot study with neurobiological underpinnings. Neurobiol. Sleep Circadian Rhythms 14(December 2022), 100094 (2023). https://doi.org/10.1016/j.nbscr.2023.100094 26. Montaruli, A., et al.: Biological rhythm and chronotype: new perspectives in health. Biomolecules 11(4), 1–20 (2021). https://doi.org/10.3390/biom11040487 27. Brooks, C., et al.: The impact of chronotype on circadian rest-activity rhythm and sleep characteristics across the week. Chronobiol. Int. 38(11), 1575–1590 (2021). https://doi.org/ 10.1080/07420528.2021.1937197 28. Kruisselbrink, T., et al.: Photometric measurements of lighting quality: an overview. Build. Environ. 138(February), 42–52 (2018). https://doi.org/10.1016/j.buildenv.2018.04.028

The Peculiarities of Circadian Rhythms and Their Implications

371

29. Yan, J., Wu, J., Ma, H.: Efficacy and safety of light therapy as a home treatment for motor and non-motor symptoms of Parkinson Disease : A Meta-Analysis. Medical. Sciences Monitor, 1–17 (2022). https://doi.org/10.12659/MSM.935074 30. Martino, J.K., et al.: The effect of light exposure on insomnia and nocturnal movement in Parkinson’s disease: an open label, retrospective, longitudinal study. Sleep Med. 44, 24–31 (2018). https://doi.org/10.1016/j.sleep.2018.01.001 31. Rutten, S., et al.: Bright light therapy for depression in Parkinson disease: a randomized controlled trial. Neurology 92(11), E1145–E1156 (2019). https://doi.org/10.1212/WNL.000 0000000007090 32. Willis, G.L., et al.: A historical justification for and retrospective analysis of the systematic application of light therapy in Parkinson’s disease. Rev. Neurosci. 23(2), 199–226 (2012). https://doi.org/10.1515/revneuro-2011-0072 33. Liu, Y., et al.: Light therapy : a new option for neurodegenerative diseases. Chin. Med. J. 134(6), 4–11 (2021). https://doi.org/10.1097/CM9.0000000000001301 34. Wong, N.A., Bahmani, H.: A review of the current state of research on artificial blue light safety as it applies to digital devices. Heliyon 8(8), e10282 (2022). https://doi.org/10.1016/j. heliyon.2022.e10282 35. Song, Y., et al.: Age-dependent effects of blue light exposure on lifespan, neurodegeneration, and mitochondria physiology in Drosophila melanogaster. npj Aging 8(1), 1–9 (2022). https:// doi.org/10.1038/s41514-022-00092-z 36. Killgore, W.D.S., et al.: Blue light exposure increases functional connectivity between dorsolateral prefrontal cortex and multiple cortical regions. NeuroReport 33(5), 236–241 (2022). https://doi.org/10.1097/WNR.0000000000001774 37. Smilowska, K., Van Wamelen, D. J., et al.: Blue Light Therapy Glasses in Parkinson’s Disease: Patients’ Experience. Parkinson’s Disease 2019, (2019), https://doi.org/10.1155/2019/190 6271

Updates on the Use of Ozone Therapy in Patients with COVID-19. A Review Natalia Cernei1(B)

, Cristina Trofimov1 , Ion Grabovschi2 and Oleg Arnaut2

, Ruslan Baltaga3

,

1 Department of Anesthesiology and Intensive Care, Emergency Medicine Institute, Chisinau, ,

Republic of Moldova [email protected] 2 Department of Human Physiology and Biophysics, “Nicolae Testemitanu” State University of , Medicine and Pharmacy, Chis, inau, Republic of Moldova 3 “Valeriu Ghereg” Department of Anesthesiology and Intensive Care, “Nicolae Testemitanu” , State University of Medicine and Pharmacy, Chis, inau, Republic of Moldova

Abstract. To date, there are no specific antiviral treatment strategies for COVID19 patients. Empiric approaches used for other viral infections wasn’t effective against SARS-CoV-2. Thus, some urgent therapeutic alternatives are still required. Ozone therapy could be favorable due to its effects. Therefore, authors conducted a comprehensive review to reassess the reported adjuvant clinical potency and the last medical approaches towards patients with SARS-CoV-2 virus or COVID-19. Relevant articles were searched in PubMed, Hinari and SpringerLink, National Center of Biotechnology Information, and Medline using keywords “COVID19”, “SARS-CoV-2”, “ozone therapy”, “mechanisms of ozone”, and “biological effects of ozone”, as well as their combinations. A total of 475 publications found were compared to exclude duplicates. The collection was reviewed and articles were filtered by title and abstract content. The remaining articles were assessed in full to exclude case-control studies or articles without relevant conclusions. Finally, 49 relevant sources were selected as representative. Ozone therapy has shown various beneficial properties: antiviral, immunomodulatory, antioxidant, anti-inflammatory, and cytoprotective effects, that can be useful in managing tissue damage occurring in many inflammatory illnesses, including viral infections like SARS-CoV-2. It can enhance the respiratory parameters, blood gas indicators, overall health condition, leading to a faster patient recovery. Despite encouraging preliminary data from ongoing clinical trials, as well as expert opinion, there is still not enough evidence to confirm that it is a viable treatment for patients with COVID-19. Keywords: COVID-19 · SARS-CoV-2 · Ozone therapy · Ozone action mechanisms · Biological effects of ozone

1 Introduction At the end of December 2019, an outbreak of atypical pneumonia cases caused by a new type of coronavirus (SARS-CoV-2) was reported in China, with its contagiousness and mortality exceedingly even the darkest predictions. As a result, two months later, © The Author(s), under exclusive license to Springer Nature Switzerland AG 2024 V. Sontea et al. (Eds.): ICNBME 2023, IFMBE Proceedings 92, pp. 372–383, 2024. https://doi.org/10.1007/978-3-031-42782-4_40

Updates on the Use of Ozone Therapy in Patients

373

the World Health Organization officially declared a pandemic state [1, 2] that ended recently when the WHO Director General on May 5th 2023, declared an end to the COVID-19 public health emergency of international concern (PHEIC) which was active since January 30th, 2020. However, the entire world has to be aware that COVID-19 is not over as a global health threat, and there are still millions of severe cases and deaths occurring worldwide. There are no definitive specific strategies for antiviral treatment of COVID-19 patients. Antiviral drugs, anti-inflammatory drugs, anticytokines, and systemic corticosteroids used have not demonstrated validity for SARS-CoV-2 [3]. Currently, none of the existing market drugs, regardless of their class or mechanism of action, have real efficacy against the SARS-CoV-2 virus or the COVID-19 disease. Adjuvant treatments remain essential treatment approaches [4–9]. High viral load and oxidative stress associated with COVID-19 are important for the pathogenesis and prognosis of the disease. Ozone therapy, originally used in medicine based on an empirical approach, has now reached a new level. Most of the biological mechanisms of ozone action have been elucidated [4]. Ozone therapy is a viable virus inactivation method and should be considered a viable weapon in fight against COVID-19 worldwide. Ozone therapy has the potential in the treatment of COVID-19 patients by providing antiviral, antioxidant, anti-edematous, anti-inflammatory, and immunomodulatory effects, as well as enhancing oxygen transport to hypoxemic tissues [4, 6, 10–12]. This therapy could benefit patients with COVID19 in several ways, such as decreasing tissue hypoxia and increasing oxygen saturation, lessening hypercoagulability, providing protection for the kidneys and heart, modulating immune function, enhancing phagocytic function, and inhibiting viral replication [4, 7, 13]. In addition to conventional treatments ozone therapy can be an effective approach for patients with COVID-19 [4, 6]. It is pertinent to examine the potential benefits of systemic oxygen-ozone therapy for individuals with COVID-19 from the onset of the disease, and until the point where mechanical ventilation with tracheal intubation becomes necessary. The idea is grounded in the belief that administering systemic oxygen-ozone treatment can have a positive impact on the course of the disease, potentially reducing the severity of cytokine release syndrome [13]. Ozone therapy is widely used as a conventional therapeutic option in various medical specialties like: dermatology, dentistry, endocrinology, orthopedics, vascular surgery, neurology, etc. Despite encouraging preliminary clinical trial data, there is still insufficient evidence to confirm that ozone therapy is a viable treatment option for COVID-19 [14, 15]. Given the preceding information, the aim of this article is to provide an overview of the most recent information on the efficacy of ozone therapy for individuals with COVID-19.

2 Material and Methods To achieve this goal, a search was carried out for specialized scientific publications identified by the Google Search engine and the PubMed, Hinari, SpringerLink, National Center for Biotechnology Information and Medline databases. To choose articles for the

374

N. Cernei et al.

study, we searched for the latest information about the efficiency of ozone therapy in COVID-19 patients using several keywords, such as “COVID-19” (n = 6154), “SARSCoV-2” (n = 3745), “ozone” (n = 568), “ozone therapy” (n = 274), “mechanisms of action of ozone” (n = 6), “biological effects of ozone” (n = 147), “antioxidant effect” (n = 17925), “anti-inflammatory effect” (n = 39136), and “immunomodulatory effect” (n = 1108).. To gather a comprehensive range of bibliographic sources, a set of criteria was applied including the selection of articles that met the following conditions: availability of full text, written in English, and published between 2020 and 2023. After a preliminary analysis of titles, original articles, editorials, narrative synthesis, taxonomy and metaanalysis articles were selected that contained up-to-date information and modern ideas about the use of ozone therapy in patients with COVID-19. The bibliography was reviewed, and the relevant information was gathered, organized, assessed, and summarized. This focused on the key aspects of the current perspective on the possible biological advantages of ozone for medical purposes (such as antioxidant capacity, modulation of vascular and hematological functions, activation of the immune system, anti-inflammatory effects, and bactericidal and virucidal properties) as well as the efficacy of ozone therapy in patients with SARS-CoV-2 infection. In order to reduce the potential for bias in the study, a comprehensive search of various databases was performed to identify as many relevant publications as possible. We only considered studies that met our validity criteria and employed appropriate exclusion criteria. The studies with both positive and negative outcomes were examined to obtain a comprehensive understanding of the topic.

3 Results By using Google Search and several databases including PubMed, Hinari, SpringerLink, National Center of Biotechnology Information, and Medline and filtering the results based on specific search criteria, a total of 475 articles related to ozone therapy were identified. After the primary analysis of the titles, 46 articles were qualified possibly relevant for the given synthesis. Following multiple rounds of evaluation, a total of 49 sources that were relevant to the intended goal were eventually chosen. These 49 articles were then included into the final bibliography of the paper, as they were seen as being representative of the literature available on the topic addressed in this synthesis article. There are currently no clear specific antiviral treatment strategies for COVID19 patients other than supportive treatment (steroids and heparin), antiviral treatment (remdesivir, favipiravir), immunomodulatory or anti-inflammatory treatment (thalidomide, hydroxychloroquine, tocilizumab, hyperimmune plasma), [11, 16–21]. However, effective early treatment of COVID-19 pneumonia can have a significant impact on patient prognosis, reduce hospitalizations, prevent long-term consequences, and limit the transmission window of the infection, thereby reducing the associated risk of infection [22]. Employing integrative and complementary methods to manage COVID-19 and related ailments could be beneficial if the potential risks and benefits are carefully assessed [4, 6, 10–12]. Due to its oxygen-enhancing, antioxidant, immunomodulatory,

Updates on the Use of Ozone Therapy in Patients

375

anti-inflammatory, and antiviral properties, ozone has been suggested as a low-cost and easily accessible supplementary treatment for COVID-19, particularly in cases of mild to moderate pneumonia, to prevent disease progression to critical conditions [22–24]. A recent article of Cenci et al. presents a summary of the impact of medical ozone on infectious agents, emphasizing its ability to combat viruses. The main mechanism of the pharmacological antiviral activity of ozone is associated with the ability of reactive oxygen species (ROS) and lipid peroxide compounds (LPO) to induce moderate intracellular oxidative stress, which can trigger an antioxidant, anti-inflammatory and antithrombogenic response. Severe oxidative stress activates the nuclear transcription factor kappa B (NFkB), resulting in an inflammatory response and tissue damage. Moderate oxidative stress activates the nuclear transcription factor erythroid factor 2 (Nrf2), which triggers an antioxidant response that can counteract chronic oxidative stress, whereas the suppression of the transcription factor NFkB induces an anti-inflammatory response [25]. Potential biological benefits of medical ozone in COVID-19 patients already confirmed in other viral infections are as following: 1. Increased blood flow and oxygenation in vital organ tissues, (useful for improving respiratory function) [6, 7, 11, 13, 17, 26–30]. 2. Activation of the Nrf2 transcription factor that leads to modulation of oxidative stress and pro-inflammatory cytokines, resulting in antioxidant and cytoprotective effects [3, 6, 7, 11, 17, 26, 28, 30–32]. 3. Anti-inflammatory effect with reduced inflammation. Ozone inhibits the transcription factor NF-κB, the activation of which promotes the release of pro-inflammatory cytokines (TNF-α, IFN-γ, IL-1β, IL-6, IL-8) [3, 6, 7, 11, 27, 28, 30–32]. 4. Modulation of immune functions. It stimulates cellular and humoral immunity, increases the proliferation of immunocompetent cells and synthesizes immunoglobulins [3, 6, 7, 11, 17, 26, 27, 30–32]. 5. Reduced hypercoagulability in patients with COVID-19. Ozone has the ability to enhance the effects of the Nrf2 transcription factor on heme oxygenase 1 (HO-1), leading to increased antithrombotic and vascular protective properties [28, 29, 31–33]. 6. It increases the endothelial production of nitric oxide, which modulates the vasodilatory mechanisms [31, 34]. 7. It improves the phagocytic function by attracting neutrophils, lymphocytes and macrophages [16, 30]. 8. It interferes with virus replication by direct (O3) or indirect (FRO and LPO) oxidation of the viral capsid [3, 7, 16, 26, 28]. 9. Ex vivo blood ozonation used at a concentration of about 90 μg/ml per ml of blood can cause oxidation of free viral components [17]. Therefore, ozone therapy exhibits various properties such as antiviral, immunomodulatory, antioxidant, anti-inflammatory, and cytoprotective effects in tissue damage associated with viral infections caused by SARS-CoV-2. Ozone therapy restrains the exacerbation of the disease, aids in the recovery of the patient’s clinical condition and enhances the X-ray images of the chest organs. It also reduces the time of viral shedding and the length of hospitalization [10, 12, 16, 19, 27, 35].

376

N. Cernei et al.

Ozone therapy improves blood flow, facilitates oxygenation of the hypoxic tissues, and reduces blood clotting events in patients with COVID-19. Ozone has an effect on the immune system by controlling cytokines (such as IL-1, IL-6, TNF-α, and IL10), which prevents worsening of diseases. It also promotes the production of antiinflammatory INF-γ, suppresses cytokine storm by blocking NF-kB and activating Nrf2 pathway. Ozone boosts both cellular and humoral immunity, enhances the ability to destroy invading pathogens through phagocytosis, and stops the virus from binding to ACE2 receptors [30]. Oxidative stress, inflammation, and clotting disorders are closely associated with the pathogenesis of COVID-19 and may represent major targets for ozone-mediated therapy [32]. The purpose of ozone therapy is to induce a balanced, adequate and temporary acute oxidative stress without exceeding the body’s antioxidant potential [19, 36]. Medical ozone produces moderate oxidative stress which, if properly balanced, is harmless but can trigger multiple useful biochemical mechanisms that can reactivate the intra- and extracellular antioxidant system and reverse chronic oxidative stress in various inflammatory and degenerative processes [7, 15, 36]. An increasing amount of specialized literature reports suggest that the application of medical ozone for treating patients with COVID-19 is showing promising outcomes. Consequently, there is a notable improvement in the symptoms, respiratory parameters, inflammatory and blood clotting indices, and patient’s overall health, as well as a significant decrease in hospital stay, ICU treatment duration, and potentially, mortality rates [32, 36, 37]. The most preferred and effective method of administering medical ozone to patients with COVID-19 is major autohemotherapy (MAT) followed by rectal insufflation (RI) and minor autohemotherapy. Moreover, ozonized oils and ozonized saline are employed as treatments for COVID-19 patients because they are simple to apply and have both preventative and therapeutic properties [6, 12, 24, 36]. MAT is the most popular and most effective method by using 100–250 ml of ozonized blood at concentrations of 20–45 μg/ml, with effective daily doses ranging from 2– 22.5 mg. The effectiveness of ozone concentrations below 20 μg/mL or above 45 μg/mL on RSD has not yet been confirmed in samples taken from patients with COVID-19 and may be less effective. The most effective way to administer rectal insufflation involves a combination of 100–150 ml of gas mixed with ozone at a concentration of 35–40 μg/ml. This resulted in daily doses of 3.5–16 mg/kg of body weight. Ozonated saline infusion is effective at a bubble concentration of 5 μg/mL of ozone dissolved in 200 mL of serum, which releases 0.25 mg of ozone [6, 12, 36, 38]. Complementary ozone therapy in combination with antiviral agents increases the activity of antiviral drugs against SARS-CoV-2 infection. To distinguish the impact of ozone therapy, it is necessary to conduct randomized, double-blind clinical trials in sizeable patient populations across multiple centers [6, 12, 36, 38, 39]. A case-control study showed that ozone therapy as adjuvant treatment (used for 3 consecutive days) may be useful for mild to moderate pneumonia caused by SARSCoV-2. The group of patients who underwent ozone therapy showed an improvement of their clinical condition in 53% of cases compared with 33% of patients from the control group (treated with the best available conventional therapy). There were only two deaths

Updates on the Use of Ozone Therapy in Patients

377

in the control group, which can be accounted by the fact that the study enrolled patients with mild or moderate COVID-19 cases, resulting in a low mortality rate [40]. MAT given once daily for 5 consecutive days significantly reduced inflammation (Creactive protein - PCR ≤ 30%, IL-6 ≤ 25%), decreased D-dimers (≤35%) and improved lung function by indicating saturation with O2 ≥ 10% and PaO2/FiO2 ≥ 6%. Research indicates that there is a necessity for additional examination and assessment of the ozone therapy approach to treat individuals who are afflicted with COVID-19. [28, 41]. A case series study examined the therapeutic effect of 4 ozone therapy rounds in 50 patients with COVID-19 aged over 60 (mean age 75 ± 1.4 years) who were admitted to ICUs and required non-invasive mechanical ventilation. Despite a small number of cases, a significant rapid improvement in patients’ clinical conditions was found due to improved inflammatory and oxygenation parameters. Inflammation markers (CRP, IL-6) showed a substantial reduction of 80% (p < 0.05), and there was a 50% decrease in venous thromboembolism (VTE) markers, although not statistically significant (p > 0.05). Additionally, the parameters of the primary airways, including SaO2%, PaO2/FiO2, showed improvement. Evidences indicate that it can considerably decrease the length of hospital stay and treatment in the ICUs [41]. Two prospective controlled studies involving 55 patients admitted with COVID-19 showed that the use of MAT along with conventional treatment can reduce mortality rate [42]. Rectal administration of ozone improves oxygen saturation, reduces the need for oxygen support, facilitates oxygen transport to tissues during hypoxemia, reduces levels of inflammatory biomarkers (fibrinogen, D-dimers, urea, ferritin, lactate dehydrogenase, interleukin-6 (IL-6) and PCR), and improves radiological manifestations of bilateral COVID-19 viral pneumonia [20, 25, 30, 38, 43]. The ozone group showed reduced mortality and hospital stay duration, however, this difference was not statistically significant [20]. According to two randomized clinical trials and one prospective cohort study, incorporating ozone therapy (specifically rectal insufflations and minor autohemotherapy in one study, and MAT in two studies) with standard care can enhance a patient’s clinical state (with a significance level of p < 0.05), reduce the time required for clinical improvement (p < 0.05), reduces the need for intensive care (p < 0.05) and facilitate a quick reduction in viral load in comparison to standard treatment. These results contribute to the prompt recovery of patients diagnosed with COVID-19 [44, 45].No significant differences were found in mortality rates, length of hospital stay, need for mechanical ventilation, and need for ICU admission [45]. Studies show that ozone therapy is safe and clinically effective in patients with mild to moderate COVID-19. It is recommended that policymakers and government officials evaluate the possibility of integrating ozone therapy into the existing healthcare system [44]. A systematic literature review has concluded that it would be worthwhile to investigate the use of rectal ozone and found evidence indicating that this therapy may have positive biological and therapeutic effects that could potentially help treat COVID-19 in all stages of the disease (mild, moderate, and severe), as well as prevent and aid in the

378

N. Cernei et al.

recovery from any resulting complications. This treatment can reduce viral load, regulate the body’s redox balance and immune response, decrease swelling, and enhance the delivery of oxygen to tissues [38]. Preliminary research indicates that giving ozonized saline to individuals with mild to severe COVID-19 includes clinical improvement in symptoms such as dyspnea and fatigue, as well as a reduction in fever. In addition, laboratory results have shown improvement in inflammatory markers such as D-dimers, ferritin, lactate dehydrogenase, and PCR, as well as markers of coagulation function like fibrinogen. Patients also experienced improved oxygenation and the elimination of infiltrates on a chest x-ray. Moreover, it helps in the quick and effective recovery of patients by stabilizing their biochemical parameters and reducing their dependency on oxygen support. There is scientific evidence from the molecular, preclinical, and clinical studies supporting the use of ozone therapy as an adjuvant treatment for SARS-CoV-2 infection [24, 25, 46]. Ozone therapy is effective in patients with COVID-19, regardless of the method of administration (MAT, ozonized saline, and rectal insufflations). It might reduce inflammation, the time of mechanical ventilation, and the time of normalization (negation) of the polymerase chain reaction in SARS-CoV-2 [38, 43]. So, the preliminary findings of using ozone therapy for COVID-19 patients are positive and have the potential to hasten their recovery. Patients experience improvements in symptoms, breathing, blood gases, inflammation and blood clotting markers, overall health, reduced time on assisted breathing, shorter hospital stays, decreased ICU treatment duration, and possibly lower mortality rates [14, 30, 42]. Although ongoing clinical trials and expert opinion provide initial data, the evidence is currently insufficient to confirm that ozone therapy is a viable treatment for COVID-19 [14, 34, 37]. As previous studies have reported conflicting results regarding the effectiveness of ozone as an adjuvant therapy for COVID-19, a systematic review and meta-analysis was performed to assess the benefits and side effects of ozone as an add-on therapy for COVID-19. The analysis included 13 studies involving 241 patients with COVID-19 who received ozone adjunctive therapy (MAT, rectal insufflation, intravenous ozonized saline) and 157 patients who received standard care (corticosteroids, antivirals, antibiotics, and vitamin supplements). Studies that use a case-control design, as opposed to randomized controlled trials, have demonstrated a decrease in mortality associated with ozone therapy. However, ozone therapy did not improve the length of hospital stay or time spent in the intensive care unit. Case-control studies showed that ozone therapy significantly improved levels of D-dimers (p < 0.01), lactate dehydrogenase (p < 0.05), CRP (p < 0.01) and IL-6 (p < 0.01) compared to standard therapy. According to the authors, the advantages of ozone for managing COVID-19 are restricted to enhancements in test outcomes for patients with severe illness. These improvements involve decreases in IL-6, lactate dehydrogenase, CRP, and D-dimers. However, the mortality, length of stay, and ICU treatment time did not improve after ozone therapy, although this could be partially attributed to the shorter duration of virus elimination [47]. Ozone treatment provides rapid symptomatic recovery and rapid negative evolution of the polymerase chain reaction in patients with COVID-19 at any age [12]. Ozone therapy is being used for COVID-19 patients to increase the effectiveness of antivirals. Ozone improves clinical condition and reduces viral load more effectively

Updates on the Use of Ozone Therapy in Patients

379

than antiviral treatment alone by oxidizing the phospholipids and lipoproteins of the viral capsid, breaking the connection between the virus and the host cell it targets [6, 12, 15, 27, 28]. It also works synergistically with anticoagulants, bringing about positive effects on conditions related to thromboembolism, vascular and thrombotic issues caused by COVID-19. The levels of D-dimers, lactate dehydrogenase and CRP are reduced following the ozone therapy [12]. Ozone therapy boosts the immune system’s immunomodulatory effect by stimulating the production of cytokines. These cytokines trigger the release of antioxidant enzymes while also decreasing the concentration of inflammatory markers [12, 15]. Ozone therapy improves the clinical picture (reduces fever, cough, shortness of breath, asthenia and auscultation findings), increases blood oxygen saturation, reduces the length of hospital stay, the amount of time spent in the intensive care unit, and mortality rate [12, 16]. Ozone therapy has no side and toxic effects [4, 12]. If administered early in the course of the disease, ozone therapy can prevent the progression to ARDS and help alleviate the severe effects of COVID-19 on lung tissues [48]. In addition to the well-described ability of medical ozone to counteract oxidative stress by enhancing key antioxidant enzymes, ozone therapy has also been shown to be effective in reducing chronic inflammation and immune thrombosis, which are the two key elements associated with the exacerbation and severity of COVID-19. A growing body of research have investigated how ozone therapy could be effective in decreasing or avoiding various post-COVID health issues [25, 30, 41, 49]. Hence, the use of systemic ozone therapy alongside other treatment methods for COVID-19 patients may be considered as beneficial and mutually reinforcing [7].

4 Conclusions Ozone therapy possesses several beneficial properties such as antiviral, immunomodulatory, antioxidant, anti-inflammatory, and cytoprotective effects, which can aid in the healing of tissue damage associated with various inflammatory conditions, including viral infections caused by SARS-CoV-2. Ozone therapy restrains the progression of the disease, promotes the recovery of the clinical condition and decrease hospital stay. Ozone therapy improves blood flow, facilitates oxygen transport in hypoxemic tissues, and reduces blood clotting phenomena in COVID-19 patients. Ozone has an immunomodulatory effect by modulating cytokines, stimulates cellular and humoral immunity, and stimulates phagocytic function and blocks the viral receptor - ACE2. Ozone therapy, recommended as an additional treatment for patients with COVID19, improves symptoms, respiratory and blood gas metrics, inflammatory and blood clotting markers, overall health, significantly reducing the time of assisted breathing and time spent in the intensive care unit and, possibly, mortality, resulting in a faster recovery of patients. Despite encouraging preliminary data from ongoing clinical trials, as well as expert opinion, there is still insufficient evidence to confirm that ozone therapy is a viable treatment option for patients with COVID-19.

380

N. Cernei et al.

Conflict of Interest. The Authors Declare that They Have no Conflict of Interest.

References 1. Malik, P., et al.: Biomarkers and outcomes of COVID-19 hospitalisations: systematic review and meta-analysis. BMJ Evidence-based Med. 26, 107–108 (2021). https://doi.org/10.1136/ BMJEBM-2020-111536 2. Coronavirus disease (COVID-19), https://www.who.int/emergencies/diseases/novel-corona virus-2019 3. Fernández-Cuadros, M.E., María, Albaladejo-Florín, J., Peña-Lora, D., Álava-Rabasa, S., Susana Pérez-Moro, O.: Ozone (O3) and SARS-CoV-2: Physiological Bases and Their Therapeutic Possibilities According to COVID-19 Evolutionary Stage. https://doi.org/10.1007/ s42399-020-00328-7/Published 4. Sahin, ¸ M., Eryilmaz, F., Keser Sahin, ¸ H: Ozone therapy may be an option for COVID-19 patients. 2470–2472 (2021). https://doi.org/10.26355/eurrev_202103_25407 5. Hernández, A., Viñals, M., Isidoro, T., Vilás, F.: Potential Role of Oxygen-Ozone Therapy in Treatment of COVID-19 Pneumonia. Am. J. Case Rep. 21, 1–6 (2020). https://doi.org/10. 12659/AJCR.925849 6. Yilmaz, N., Eren, E., Oz, C.: COVID-19 and Ozone. Cyprus J. Med. Sci. 5, 365–372 (2021). https://doi.org/10.5152/cjms.2020.2658 7. Ricevuti, G., Franzini, M., Valdenassi, L.: Oxygen-ozone immunoceutical therapy in COVID19 outbreak: facts and figures. Ozone Ther. 5, (2020). https://doi.org/10.4081/OZONE.2020. 9014 8. Heimfarth, L., Serafini, M.R., Martins-Filho, P.R., Quintans, J. de S.S., Quintans-Júnior, L.J.: Drug repurposing and cytokine management in response to COVID-19: A review. Int. Immunopharmacol. 88, (2020). https://doi.org/10.1016/J.INTIMP.2020.106947 9. Da, D., Campos, S., Morais, J.P., Tim, C.R., Gomes, J.C., Assis, L.: Implications for the use of ozone (O3) in the adjuvant treatment of COVID-19. Res. Soc. Dev. 9, e579997508– e579997508 (2020). https://doi.org/10.33448/RSD-V9I9.7508 10. Cattel, F., et al.: Ozone therapy in COVID-19: A narrative review. Virus Res. 291, (2021). https://doi.org/10.1016/J.VIRUSRES.2020.198207 11. De Farias, J.B.F., De Farias, A.P.F., De Souza, A.G.: Ozone as a complement therapy in the treatment of COVID-19. Rev. Bras. Fisiol. do Exerc. cio. 19, 5–8 (2020). https://doi.org/10. 33233/RBFE.V19I2.4116 12. Ogut, E., Armagan, K.: Evaluation of the potential impact of medical ozone therapy on covid-19: a review study. Ozone Sci. Eng. (2022). https://doi.org/10.1080/01919512.2022. 2065242 13. Promoter of the study: NUOVA F.I.O. (Italian Oxygen-Ozone Federation), Marini, S., et al.: Oxygen-ozone therapy as adjuvant in the current emergency in SARS-COV-2 infection: a clinical study. J. Biol. Regul. Homeost. Agents. 34, (2020). https://doi.org/10.23812/20-250E-56 14. Martínez-Sánchez, G.: Ozone Therapy for Prevention and Treatment of COVID-19. J. Explor. Res. Pharmacol. 000, 000–000 (2022). https://doi.org/10.14218/JERP.2022.00015 15. Radvar, S., et al.: Using ozone therapy as an option for treatment of COVID-19 patients: a scoping review. Adv. Exp. Med. Biol. 1327, 151–160 (2021). https://doi.org/10.1007/978-3030-71697-4_12 16. Alberto Hernández, A., Vilás, F., Papadakos, P.J., Bergese, S.D., Vives, M.: Title: Ozone therapy for patients with COVID-19 pneumonia: preliminary report of a prospective casecontrol study. https://doi.org/10.1101/2020.06.03.20117994

Updates on the Use of Ozone Therapy in Patients

381

17. Martínez-Sánchez, G., Schwartz, A., Di Donna, V.: Potential cytoprotective activity of ozone therapy in SARS-CoV-2/COVID-19. Antioxidants. 9, (2020). https://doi.org/10.3390/antiox 9050389 18. Fernandez-Cuadros, M.E., Perez-Moro, O.S., Albaladejo-Florin, M.J., EntrambasaguasEstepa, B., Alava-Rabasa, S.: Mid-Term Effectiveness of Ozone (O2-O3) Compared to Platelet-Rich Plasma (PRP) in the Management of Knee Osteoarthritis: A Randomized Parallel Controlled Trial. Middle East J. Rehabil. Heal. In: Press, 1–8 (2019). https://doi.org/10. 5812/mejrh.74140 19. Barbosa, R.B., et al.: Ozone therapy as a treatment option against COVID-19: a literature review. Res. Soc. Dev. 10, e469101321228–e469101321228 (2021). https://doi.org/10.33448/ RSD-V10I13.21228 20. Fernández-Cuadros, M.E., et al.: Compassionate use of rectal ozone (O3) in severe COVID19 Pneumonia: a case-control study. SN Compr. Clin. Med. 3, 1185–1199 (2021). https://doi. org/10.1007/S42399-021-00849-9 21. Wang, Y., et al.: Remdesivir in adults with severe COVID-19: a randomised, double-blind, placebo-controlled, multicentre trial. Lancet (London, England). 395, 1569–1578 (2020). https://doi.org/10.1016/S0140-6736(20)31022-9 22. Izadi, M., et al.: Ozone therapy for the treatment of COVID-19 pneumonia: a scoping review. Int. Immunopharmacol. 92, 1567–5769 (2021). https://doi.org/10.1016/j.intimp.2020.107307 23. Rowen, R.J., Robins, H.: A Plausible “Penny” Costing Effective Treatment for Corona Virus - Ozone Therapy. J Infect Dis Epidemiol. 2020, 113 (2020). https://doi.org/10.23937/24743658/1510113 24. Sharma, A., et al.: A pilot study for treatment of COVID-19 patients in moderate stage using intravenous administration of ozonized saline as an adjuvant treatment-registered clinical trial. Int. Immunopharmacol. 96, (2021). https://doi.org/10.1016/J.INTIMP.2021.107743 25. Cenci, A., Macchia, I., La Sorsa, V., Sbarigia, C., Di Donna, V., Pietraforte, D.: Mechanisms of Action of Ozone Therapy in Emerging Viral Diseases: Immunomodulatory Effects and Therapeutic Advantages With Reference to SARS-CoV-2. Front. Microbiol. 13, (2022). https://doi.org/10.3389/FMICB.2022.871645/PDF 26. Cuadros, M.E.F., Florín, M.J.A., Rabasa, S.Á., Lora, D.P., Moro, O.S.P.: Ozone and COVID19: physiological bases and their therapeutic possibilities according to the evolutionary stage in SARS-CoV-2 infection. Rev. la Soc. Esp. del Dolor. 28, 27–36 (2021). https://doi.org/10. 20986/RESED.2021.3810/2020 27. Yaneva, G., Dimitrova, T., Ivanov, D., Ivanova, D., Ingilizova, G., Slavov, S.: MODERN APPLICATIONS OF OZONE FOR COVID-19 DISINFECTION AND TREATMENT. J. IMAB - Annu. Proceeding (Scientific Pap. 28, 4284–4288 (2022). https://doi.org/10.5272/ JIMAB.2022281.4284 28. Manjunath, S.N., Sakar, M., Katapadi, M., Geetha Balakrishna, R.: Recent case studies on the use of ozone to combat coronavirus: Problems and perspectives. Environ. Technol. Innov. 21, (2021). https://doi.org/10.1016/J.ETI.2020.101313 29. Falcón, B.A., Fernández, J.L.C., Cepero, S.M., Yoshimoto, C.V.: Ozone therapy and its application in relation to the pathophysiology of COVID 19 disease. Panor. Cuba y Salud. 15, 104–107 (2020) 30. Yousefi, B., Banihashemian, S.Z., Feyzabadi, Z.K., Hasanpour, S., Kokhaei, P.: Potential therapeutic effect of oxygen-ozone in controlling of COVID-19 disease, pp. 33–40 (2022). https://doi.org/10.4103/2045-9912.325989 31. León Fernández, O.S., et al.: Medical ozone: the pharmacological mechanisms accounting for its effectiveness against COVID-19/SARS-COV-2. J. Med.-Clin. Res. Rev. ISSN 5(1–10), 2639–2944 (2021)

382

N. Cernei et al.

32. Chirumbolo, S., et al.: Insights on the mechanisms of action of ozone in the medical therapy against COVID-19. Int. Immunopharmacol. 96, 107777 (2021). https://doi.org/10.1016/J.INT IMP.2021.107777 33. Schwartz, Martínez-Sánchez: Potential use of ozone in SARS-CoV-2 / COVID-19. Int. Sci. Comm. Ozone Ther. (2020) 34. Chirumbolo, S., et al.: Insights on the mechanisms of action of ozone in the medical therapy against COVID-19. Int. Immunopharmacol. 96, (2021). https://doi.org/10.1016/J.INTIMP. 2021.107777 35. Zheng, Z., Dong, M., Hu, K.: A preliminary evaluation on the efficacy of ozone therapy in the treatment of COVID-19. J. Med. Virol. 92, 2348–2350 (2020). https://doi.org/10.1002/ JMV.26040 36. Tricarico, G., Travagli, V.: The relationship between ozone and human blood in the course of a well-controlled, mild, and transitory oxidative eustress. Antioxidants. 10, 1946 (2021). https://doi.org/10.3390/antiox10121946 37. Morrison, C., et al.: Critical review and research needs of ozone applications related to virus inactivation: potential implications for SARS-CoV-2. Ozone Sci. Eng. 43, 2–20 (2021). https:// doi.org/10.1080/01919512.2020.1839739 38. Fernández-cuadros, M., Albaladejo-florín, M.J., Pérez-moro, O., Rodríguez-de-cía, J.: Multicentric Study on the Effect of Rectal Ozone on COVID-19 : the Spanish and Slovakian Experience. (2022). https://doi.org/10.20944/preprints202203.0272.v1 39. Fernández-Cuadros, M.E., et al.: Effect of rectal ozone (O3) in Severe COVID-19 Pneumonia: preliminary results. SN Compr. Clin. Med. 2, 1328–1336 (2020). https://doi.org/10.1007/s42 399-020-00374-1 40. Tascini, C., et al.: Monte, Amato: Blood ozonization in patients with mild to moderate COVID19 pneumonia: a single centre experience. Intern. Emerg. Med. 16, 669–675 (2021). https:// doi.org/10.1007/s11739-020-02542-6 41. Franzini, M., et al.: Oxygen-ozone (O2-O3) immunoceutical therapy for patients with COVID19. Preliminary evidence reported. Int. Immunopharmacol. 88, (2020). https://doi.org/10. 1016/J.INTIMP.2020.106879 42. Çolak, S., ¸ et al.: Effectiveness of ozone therapy in addition to conventional treatment on mortality in patients with COVID-19. Int. J. Clin. Pract. 75, (2021). https://doi.org/10.1111/ ijcp.14321 43. Peña-Lora, D.Y., Albaladejo-Florín, M.J., Fernández-Cuadros, M.E.: Usefulness of rectal ozonetherapy in a geriatric patient with severe COVID-19 pneumonia. Rev. Esp. Geriatr. Gerontol. 55, 362–364 (2020). https://doi.org/10.1016/J.REGG.2020.07.005 44. Shah, M., et al.: Safety and efficacy of ozone therapy in mild to moderate COVID-19 patients: A phase 1/11 randomized control trial (SEOT study). Int. Immunopharmacol. 91, (2021). https://doi.org/10.1016/J.INTIMP.2020.107301 45. Sozio, E., et al.: CORonavirus-19 mild to moderate pneumonia management with blood ozonization in patients with respiratory failure (CORMOR) multicentric prospective randomized clinical trial. Int. Immunopharmacol. 98, (2021). https://doi.org/10.1016/J.INTIMP. 2021.107874 46. Schwartz, A., Martínez-Sánchez, G., de Lucía, A.M., Viana, S.M., Constanta, A.M.: Complementary application of the ozonized saline solution in mild and severe patients with pneumonia COVID-19: A non-randomized pilot study. J. Pharm. Pharmacogn. Res. 9, 126–146 (2021). https://doi.org/10.56499/JPPRES20.971_9.2.126 47. Setyo Budi, D., et al.: Ozone as an adjuvant therapy for COVID-19: A systematic review and meta-analysis. Int. Immunopharmacol. 110, (2022). https://doi.org/10.1016/J.INTIMP.2022. 109014

Updates on the Use of Ozone Therapy in Patients

383

48. Robert Jay, R., Howard, R.: A plausible penny costing effective treatment for corona virus ozone therapy. J. Infect. Dis. Epidemiol. 6, (2020). https://doi.org/10.23937/2474-3658/151 0113 49. Chirumbolo, S., et l.: The Mito-Hormetic mechanisms of ozone in the clearance of SARSCoV2 and in the COVID-19 Therapy. Biomed. 10, (2022). https://doi.org/10.3390/BIOMED ICINES10092258

Assessment of Oxidative Stress Markers in Obese Patients with Community-Acquired Pneumonia Tatiana Dumitras , Diana Fetco-Mereuta(B) , Natalia Capros , Viorica Chihai , Eudochia Terna , Sergiu Matcovschi , and Virginia Cascaval Nicolae Testemitanu State University of Medicine and Pharmacy, Chisinau, Republic of Moldova [email protected]

Abstract. Obesity is associated with a low antioxidant defense compared with normal weight. Total antioxidant status is lower in obese than in normal weight adults, and this anti-oxidant imbalance favors systemic oxidative stress. Pneumonia is one of the most common infectious diseases, and the impact of obesity in the development and progression of the disease is well known. However, there are debatable opinions about the association between obesity and pneumonia risk or pneumonia mortality, some of them supporting the obesity survival paradox. The article reflects a clinical study based on initial hypothesis of more expressed prooxidative status and worse outcomes in obese patients with community-acquired pneumonia in comparison with normal weight patients. The study included 101 patients with CAP, who were divided into two groups, according to their weight. Serum markers of oxidative stress (advanced oxidation products, malondialdehyde, advanced glycation end products and nitric oxide) as well as pneumoniarelated mortality did not differ significantly in obese and normal weight patients. Unlike other antioxidative mark-ers (total antioxidant capacity measured by ABTS method, catalase and thiolic com-pounds), total antioxidant activity measured by CUPRAC method showed a positive correlation with the obesity cases and proved to be an important and promising tool to assess the anti-inflammatory and protective antioxidative activity in community-acquired pneumonia. Keywords: Oxidative stress · Community-acquired pneumonia · Obesity para-dox

1 Introduction Obesity pandemics have a marked impact on respiratory function, gas exchange and immunity, due to both mechanical changes and persistent low-grade systemic inflammation. The chronic inflammatory state associated with obesity can potentiate and worsen the immune response against respiratory infections and plays a key role in the progression of community-acquired pneumonia (CAP) and other respiratory diseases [1, 2].

© The Author(s), under exclusive license to Springer Nature Switzerland AG 2024 V. Sontea et al. (Eds.): ICNBME 2023, IFMBE Proceedings 92, pp. 384–391, 2024. https://doi.org/10.1007/978-3-031-42782-4_41

Assessment of Oxidative Stress Markers

385

Fat storage causes adipocyte expansion, which results in adipose tissue hypoxia and the release of high quantities of inflammatory cytokines [3]. The peroxidic oxidation of lipids intended to favor the degradation of damaged cells or those in the process of apoptosis seems to be excessive in obese individuals. Oxidative stress is a phenomenon caused by an imbalance between production and accumulation of oxygen reactive species in cells and tissues and the ability of a biological system to detoxify these reactive products, leading to disturbed cellular function. Thus, oxygen reactive species together with adiponectin from adipocytes and a series of pro-inflammatory interleukins are responsible for creating persistent inflammation. It is important to mention that any respiratory infection, especially pneumonia, can lead to oxidative stress even in the absence of obesity [4, 5]. On the other hand, the human body has the antioxidant system designed to counterbalance the effects of free radicals, and the antioxidant response in obese individuals during an infection, especially in CAP, can be diminished or exaggerated. There are studies that have demonstrated a better survival in obese patients with CAP known as “obesity paradox” [6, 7]. Other studies have shown that obesity is a predisposing factor for a severe course of respiratory infections, such as influenza, pneumococcal, staphylococcal, and opportunistic pathogens due to endothelial dysfunction consisting in the switch from nitric oxide (NO) signaling to ROS signaling. Moreover, leptin resistance leads to the accumulation of ROS in the immune response and the decrease of antioxidative markers [8, 9]. We hypothesized that the pro-oxidative parameters are more expressed, and the antioxidative parameters are reduced in obese patients with community-acquired pneumonia compared to normal weight patients.

2 Aim of the Study The present study aimed to evaluate oxidative stress parameters in obese patients with community-acquired pneumonia compared to normal weight patients.

3 Methods This prospective cohort study is based on a clinical and laboratory examination of patients hospitalized with community-acquired pneumonia in the Department of Internal Medicine, Holy Trinity Municipal Hospital, Chisinau, Republic of Moldova, during February 2021 – June 2022. The study included 101 patients with CAP, aged between 40 and 82 years, of which 49 were male and 52 were female. The patients were divided into two groups: group 1 (51 patients with obesity) and group 2 (50 normal weight patients). The inclusion criteria were: clinical data (the disease onset outside the hospital with fever, chills, progressive dyspnoea, muco-purulent or purulent sputum, pleural chest pain and physical signs of lung consolidation), recent opacity on chest x-ray examination, bacteriological examination (sputum culture performed), body mass index (BMI) for obese patients ≥ 30 kg/m2 and BMI for normal weight patients 18.5–24.9 kg/m2 and laboratory tests (elevation of white blood cells count, erhythrocite sedimentation rate, C-reactive protein, fibronogen, LDH-lactatedehydrogenase).

386

T. Dumitras et al.

The following parameters of oxidative stress were measured in patients serum on admission: advanced oxidation products (AOP), malondialdehyde (MDA), advanced glycation end products (AGE-verperlisin-like and AGE-pentosidine-like) and nitric oxide. The antioxidant status was assessed by serum determination of total antioxidant capacity (TAC) using CUPRAC and ABTS methods, catalase and thiolic compounds (TC). The obtained data were statistically analyzed using the Statistical Package for Social Science (SPSS, version 20). The results were expressed as n (%) for categorical variables and Mean ± SD for continuous variables. The analysis of the variables was performed using descriptive statistics. The correlation analysis of the variables was performed using the non-parametric test Spearman’s Rho. A p-value less than 0.05 was considered statistically significant.

4 Results The mean age of included patients was 64.5 ± 11.19 years in group 1 and 65.4 ± 10.98 years in group 2, p = 0.211. The most frequent comorbidity in both groups was arterial hypertension −45 (88.2%) versus 36 (72%), p = 0.106, followed by diabetes mellitus −20 (39.2%) versus 9 (18%), p = 0.027, and dyslipidemia −13 (25.5%) versus 5 (10%), p = 0.067, respectively. A classical clinical onset of pneumonia, including acute onset with fever, chills, pleural chest pain, dyspnea and cough, was more characteristic for normal weight patients with CAP −18 (36%) versus 5 (9.8%) in obesity group, p = 0.002, as well as a typical physical syndrome of lung consolidation (local increase of vocal fremitus, subdullness on chest percussion and pathological bronchial breathing on lung auscultation with localized crackles) −23 (46%) versus 14 (27.5%), p = 0.065, respectively. The majority of pro-oxidative markers (AOP, MDA, nitric oxide, AGE-verperlisinlike and AGE-pentosidine-like) were without significant changes in obese compared to normal weight patients. Total antioxidant capacity (measured by CUPRAC method) indicated an increased value in obese patients compared to normal weight ones, while catalase and thiolic compounds values were without significant differences between the groups (Table 1). Regarding laboratory parameters of systemic inflammation and lesion, white blood cell count, erythrocyte sedimentation rate and fibrinogen did not differ in obese and normal weight patients. The serum levels of lactatdehydrogenase and C-reactive protein were significantly higher in obese patients with CAP: 300 ± 28.8 Un/L (95% CI 239– 359) versus 241.4 ± 25.3 Un/L (95% CI 189–293.7), p = 0.038, and 50.7 ± 8.9 mg/L (95% CI 29–65) versus 32.2 ± 6.8 mg/L (95% CI 18–46), p = 0.036, respectively. The bilateral distribution of opacity on chest X-ray was found in 40 (78.4%) patients in group 1 versus 36 (72%) patients in group 2, p = 0.496, and interstitial pattern was a predominant one −37 (72.5%) versus 31 (62%), p = 0.294, respectively. The most common antibacterial treatment included a combination of parenteral betalactams and fluoroquinolones −18 (35.3%) in group 1 and 24 (48%) in group 2, p = 0.229. Although the course of pneumonia was more frequently complicated by acute respiratory failure with the need for oxygen therapy in obese patients −42 (82.4%) versus

Assessment of Oxidative Stress Markers

387

Table 1. Serum oxidative stress markers in obese and normal weight patients with communityacquired pneumonia (Mean ± SD) Parameters

Group 1 (n = 51)

Group 2 (n = 50)

P-value

AOP, Un/g

57 ± 29.8 (95% CI 48–67)

53 ± 31.4 (95% CI 43–61)

0.639

MDA, µmol/g

20.4 ± 11.2 (95% CI 19–21)

20.2 ± 9.1 (95% CI 19–21)

0.299

AGE-verperlisin-like, Un/g 878,9 ± 141 (95% CI 383,4–922,4)

800 ± 121 (95% CI 486.3–853.6)

0.606

AGE-pentosidine-like, Un/g

387.0 ± 134.5 (95% CI 345.6–428.4)

353.3 ± 92.1 (95% CI 325.5–383.2)

0.123

Nitric oxide, mmol/g

54 ± 9.4 (95% CI 51–57)

53 ± 5.7 (95% CI 51–55)

0.887

TAC, CUPRAC method, mmol/g

34 ± 10 (95% CI 17–52)

18.8 ± 13.1 (95% CI 7–30)

0.031

TAC, ABTS method, mmol/g

145 ± 15.3 (95% CI 140–149)

141 ± 14 (95% CI 137–146)

0.619

Catalase, µmol/g

39 ± 5.5 (95% CI 37–40)

38 ± 4.8 (95% CI 36–39)

0.713

TC, mg/g

300 ± 91.1 (95% CI 278–338)

277 ± 80.4 (95% CI 251–303)

0.316

30 (60%) in normal weight patients (p = 0.016), the mortality rate was not higher in the obesity group −2 (3.9%) versus 2 (4%). We also did not observe significant differences in the mean duration of hospitalization which was 16.4 ± 7.0 days in group 1 and 13.8 ± 5.9 days in group 2, p = 0.135. According to correlation analysis, obesity cases had a weakly significant positive correlation with increased C-reactive protein values (rs = 0.21, p = 0.032) and a highly significant correlation with serum LDH values (rs = 0.69, p = 0.026) and a total antioxidant activity (CUPRAC method) (rs = 0.71, p = 0.017).

5 Discussions Obesity is considered to be a moderate form of chronic inflammation, where proinflammatory interleukins that are elevated and cause insulin resistance as well as cardiovascular and respiratory diseases [10]. Obesity, persistent low-level inflammation and oxidative stress are all tightly connected. Fat storage causes adipocyte expansion, which results in adipose tissue hypoxia and the release of high quantities of inflammatory cytokines [3]. Adipose tissue secretes active substances, called adipokines, which exert their biological roles in an autocrine, paracrine or systemic manner and influence several physiological processes related to energy concentration, glucose metabolism and immunity.

388

T. Dumitras et al.

Adipokines can exhibit both pro-inflammatory and anti-inflammatory properties. Besides adipocytes, also pre-adipocytes, endothelial cells, fibroblasts, leukocytes, and bone-marrow-derived macrophages are part of adipose tissue. The number of macrophages positively correlates with body mass, adipocyte size, and expression of pro-inflammatory cytokines [11]. It would be expected that the acute inflammation of pneumonia superimposed on the chronic inflammation of obesity would contribute to a more severe evolution of the respiratory infection. According to the results of our study, obesity cases had a weak significant positive correlation with elevated C-reactive protein (CRP) values (rs = 0.21) and a highly significant correlation with serum LDH values (rs = 0.69), which supports the relationship between inflammatory status and a high body mass index. One study also reported higher CRP levels in obese subjects [7]. This suggests higher levels of inflammation in more severe cases. On the other hand, Chen et al. determined CRP levels as one of the seven risk factors besides obesity for increased 1-year mortality and suggested a potential association between those parameters [13]. Unlike the results of the study, performed by Chen et al., higher C-reactive protein levels (marker of systemic inflammation) and more elevated LDH values (marker of pulmonary parenchyma lesion) in our obese patients did not correlate with the mortality rate. In a study that included patients aged 50 to 64 years diagnosed with CAP, obesity was found to be associated with a 1.4 times greater risk of hospitalization. The higher risk conferred by obesity was due to the association of other chronic diseases among these patients. A large proportion of obese patients suffer from other comorbidities, such as diabetes mellitus and heart diseases [14]. In our study, the rate of diabetes mellitus was higher in the group of patients with obesity, compared to the normal weight group. Nevertheless, several studies have shown that the mortality of obese individuals is reduced in various diseases, including pneumonia, a phenomenon that is called the “obesity survival paradox”. Lacroix et al. found a negative correlation between body mass index (BMI) and pneumonia mortality in an observational study of 2600 middleaged American men [15]. Supporting this hypothesis for CAP, Singanayamagam et al. showed that an increased BMI is associated with a reduced 30-day mortality [7]. The paradox can be explained through a chronic low-grade inflammatory state present in patients with obesity, that may increase the immune response and stronger activation of the T helper type 1 cells, and that elevated serum leptin stimulates macrophage phagocytosis, neutrophil chemotaxis, as well as B and T lymphocyte function [3]. Different studies confirmed the”obesity paradox”, for example, a cohort study in China found a lower mortality rate among patients with obesity and pneumonia one year after hospitalization [13]. Similar data were reported by another study, which concluded a higher survival rate in obese patients even 6 years after hospitalization [6]. In a prospective study of 110 thousand Japanese adults, it was also found that a BMI ≥ 25 kg/m2 promoted a protective effect in the context of pneumonia-related mortality, and the trend between BMI and CAP mortality showed a significant inverse relationship (p < 0.001) [16]. In comparison with the above-mentioned studies, we did not find any significant differences between the duration of hospitalization and mortality rate in obese and normal weight patients with community-acquired pneumonia.

Assessment of Oxidative Stress Markers

389

Since the serum levels of lactatdehydrogenase, C-reactive protein and the rate of oxygen-treated acute respiratory failure were significantly higher in obese patients with CAP, we would have expected a more expressed pro-oxidative activity in these patients. The results of our study revealed no significant differences in pro-oxidative stress markers and a positive correlation of the obesity cases with total antioxidant activity, measured by CUPRAC method (rs = 0.71), which has a connection with similar duration of hospitalization and pneumonia-related mortality in obese and normal weight patients. This could be explained by the counterbalancing effect of antioxidative system which tends to be more activated in obese patients with community-acquired pneumonia in comparison with the normal weight ones. Thus, the initial hypothesis of our study about the more expressed pro-oxidative stress parameters in obese patients with community-acquired pneumonia was not confirmed. Although the limitation of our study is a relatively small sample size, the oxidative stress parameters obtained are rather in favor of the hypothesis of “obesity paradox”. Further studies need to be done to examine the underlying inflammatory profiles in these patients and to reveal the possible connections between obesity and the outcomes of pneumonia.

6 Ethics and Permissions 6.1 Statement of Informed Consent The study was initiated after signing the informed agreement by all participants (information form and acceptance form), who became familiar with the evaluation methods to be applied, at the time of initiation and during the study the confidentiality and ethical criteria were observed. 6.2 Statement of Human and Animal Rights The research was conducted during the years 2021–2022, according to the Principles of the Helsinki Declaration - WMA Declaration of Helsinki - Ethical Principles for Medical Research Involving Human Subjects. The study was approved by the Research Ethics Committee of a State University of Medicine and Pharmacy “Nicolae Testemitanu”, with the issuance of favorable opinion no. 46 from March 27, 2018.

7 Conclusions The serum markers of oxidative stress (advanced oxidation products, malondialdehyde, advanced glycation end products and nitric oxide) as well as duration of hospitalization and pneumonia-related mortality did not differ significantly in obese and normal weight patients. Unlike other antioxidative markers (total antioxidant capacity measured by ABTS method, catalase and thiolic compounds), total antioxidant activity measured by CUPRAC method showed a positive correlation with the obesity cases and proved to be an important tool to assess the anti-inflammatory and antioxidative activity in community-acquired pneumonia.

390

T. Dumitras et al.

Acknowledgment. We would like to express our special thanks of gratitude to the University professor Livi Grib as well as to Dr. Valeriana Pantea and Dr. Lilia Andronache, who also helped us in doing a lot of Research.

Conflict of Interest. The authors declare that they have no conflict of interest.

References 1. Moreno-Fernandez, J., Ochoa, J., Ojeda, M.L., Nogales, F., Carreras, O., Díaz-Castro, J.: Inflammation and oxidative stress, the links between obesity and COVID-19: a narrative review. J. Physiol. Biochem. 78, 581–591 (2022). https://doi.org/10.1007/s13105-022-008 87-4 2. Popa, A., et al.: Non-invasive Monitoring of Pulse Rate and Desaturation Events with Oximeter in COPD Patients with Cardiovascular Comorbidities. In: Tiginyanu, I., Sontea, V., Railean, S. (eds.) 5th International Conference on Nanotechnologies and Biomedical Engineering: Proceedings of ICNBME-2021, November 3-5, 2021, Chisinau, Moldova, pp. 743–749. Springer International Publishing, Cham (2022). https://doi.org/10.1007/978-3-030-92328-0_94 3. Exley, M.A., Hand, L., O’Shea, D., Lynch, L.: Interplay between the immune system and adipose tissue in obesity. J Endocrinol 223, 41–48 (2014). https://doi.org/10.1530/JOE-130516 4. Vincent, H.K., et al.: Effects of antioxidant supplementation on insulin sensitivity, endothelial adhesion molecules, and oxidative stress in normal-weight and overweight young adults. Metab Clin Experiment 58, 254–326 (2009). https://doi.org/10.1016/j.metabol.2008.09.022 5. Newsholme, P., Cruzat, V.F., Keane, K.N., Carlessi, R., de Bittencourt, P.I.: Molecular mechanisms of ROS production and oxidative stress in diabetes. Biochem J 473, 4527–4550 (2016). https://doi.org/10.1042/bcj20160503c 6. Nie, W., Zhang, Y., Jee, S.H., Jung, K.J., Li, B., Xiu, Q.: Obesity survival paradox in pneumonia: a meta-analysis. BMC Med 12, 61 (2014). https://doi.org/10.1186/1741-701512-61 7. Singanayagam, A., Chalmers, J.D.: Obesity is associated with improved survival in community-acquired Pneumonia. Eur. Respir. J. 42, 180–187 (2013). https://doi.org/10.1183/ 09031936.00115312 8. Xu, W., Zhao, T., Xiao, H.: The implication of oxidative stress and AMPK-Nrf2 antioxidative signaling in pneumonia pathogenesis. Front. Endocrinol. 11, (2020). https://doi.org/10.3389/ fendo.2020.00400 9. Castillo, R.L., Gonzales-Candia, A., Candia, A.A.: Pathophysiology of acute respiratory failure by CoV-2 infection: role of oxidative stress, endothelial dysfunction and obesity. Open Respir. Med. J. 15, (2021). https://doi.org/10.2174/1874306402115010076 10. Chiappetta, S., Sharma, A.M., Bottino, V., Stier, C.: COVID-19 and the role of chronic inflammation in patients with obesity. Int J Obes 44, 1790–1792 (2020). https://doi.org/10. 1038/s41366-020-0597-4 11. Dixon, A.E., Peters, U.: The effect of obesity on lung function. Expert Rev Respir Med 12, 755–767 (2018). https://doi.org/10.1080/17476348.2018.1506331 12. Frühbeck, G., Catalán, V., Rodríguez, A.: Involvement of the leptin-adiponectin axis in inflammation and oxidative stress in the metabolic syndrome. Sci Rep 7, 6619 (2017). https://doi. org/10.1038/s41598-017-06997-0

Assessment of Oxidative Stress Markers

391

13. Chen, J., et al.: Lower long-term mortality in obese patients with community-acquired pneumonia: possible role of CRP. Clinics 74, 1–6 (2019). https://doi.org/10.6061/clinics/2019/ e608 14. Hornung, F., Rogal, J., Loskill, P.: The inflammatory profile of obesity and the role on pulmonary bacterial and viral infections. Int. J. Mol. Sci. 22, 34–56 (2021). https://doi.org/10. 3390/ijms22073456 15. LaCroix, A.Z., Lipson, S., Miles, T.P., White, L.: Prospective study of pneumonia hospitalizations and mortality of U.S. older people: the role of chronic conditions, health behaviors, and nutritional status. Public Health Rep 104, 350–360 (1989). https://pubmed.ncbi.nlm.nih. gov/2502806/ 16. Inoue, Y., et al.: Risk and protective factors related to mortality from pneumonia among middleaged and elderly community residents: the JACC Study. J Epidemiol 17, 194–202 (2007). https://doi.org/10.2188/jea.17.194

The Prevalence of Allele Frequencies of CYP2C19 Polymorphisms of Clinically Important Drug-Metabolizing Enzymes CYP2C19 in Moldova Healthy Population Marta Dogot(B) , Daniela Galea-Abdusa , Anastasia Buza , Ghenadie Curocichin , and Natalia Capros Nicolae Testemitanu State University of Medicine and Pharmacy, Chisinau, Republic of Moldova [email protected]

Abstract. Genetic polymorphisms of drug-metabolizing enzymes, such as cytochrome P450 oxidases, can alter the pharmacokinetic properties of administered drugs, leading to variability in drug responses. Prior knowledge of allele frequencies of cytochrome P450 polymorphisms in a population is crucial. In the current study, the frequency of the CYP2C19*2, CYP2C19*3, CYP2C19*17 alleles, genotypes and phenotype in healthy population of Republic of Moldova was examined. Tests for polymorphisms of CYP2C19 was performed using method TaqMan® SNP Genotyping Assays in 430 healthy subjects, assessing the phenotypes, which included normal metabolizer (NM), intermediate metabolizer (IM), poor metabolizer (PM), rapid metabolizers (RM) and ultrarapid metabolizer (UM). 112 individuals (26.2%) were CYP2C19*1/*2 heterozygotes, 7 (1.6%) were CYP2C19*2/*2 homozygotes, 119 subjects (28.4%) were CYP2C19*1/*17 heterozygotes and 31 subjects (7.4%) were CYP2C19*17/*17 homozygotes, while 1 individual (0.2%) was a CYP2C19*1/*3 compound heterozygote. Therefore, 7 individuals CYP2C19*2/*2 homozygotes (1.6%) are predicted to be CYP2C19 PM. The allele frequencies for CYP2C19*2, *3 and *17 was 14.7%, 0.1% and 21.6%, respectively. The results of this study provide important information about the distribution of CYP2C19 genetic variants in the healthy population of the Republic of Moldova. These findings may have implications for understanding population differences in drug responses, and they support the potential application of genetic testing in medical practice to guide personalized treatment approaches. Keywords: CYP2C19 polymorphisms · Genotyping · Moldova population

1 Introduction CYP enzymes metabolize the majority of the common clinically prescribed drugs and the genetic polymorphisms within CYP2C19, significantly affect most clinically used drugs. CYP2C19 is involved in processing or metabolizing at least 10% of commonly prescribed drugs, CYP2C19 genotype is included as a pharmacogenomic biomarker in © The Author(s), under exclusive license to Springer Nature Switzerland AG 2024 V. Sontea et al. (Eds.): ICNBME 2023, IFMBE Proceedings 92, pp. 392–401, 2024. https://doi.org/10.1007/978-3-031-42782-4_42

The Prevalence of Allele Frequencies of CYP2C19 Polymorphisms

393

the drug labels of 22 medications, as clopidogrel, omeprazole, diazepam, antidepressants, voriconazole and others [1]. The genetic variability in CYP enzymes results in an enzyme with increased, normal, decreased, or no enzyme activity [2, 3]. The variant genotypes of CYP2C19*2 (681G > A, rs4244285), CYP2C19*3 (636G > A, rs4986893) are major factors attributed to interindividual differences in the pharmacokinetics and response to CYP2C19 substrates. CYP2C19*2 and *3 (loss-of-function alleles) are associated with diminished enzyme activity [4, 5]. Polymorphisms in CYP2C19 genes categorize the population as poor metabolizer (PM), intermediate metabolizer (IM), normal metabolizer (NM), rapid metabolizer (RM) and ultrarapid metabolizer (UM) [7]. The allele frequencies of CYP2C19*2 and *3 are significantly higher in Chinese populations than in European or African populations [8] and are found at approximately 3–5% of European and 15–20% of Asian populations [9, 10]. The prevalence of allele frequencies of CYP2C19 polymorphisms of clinically important drug-metabolizing enzymes CYP2C19 in Moldova healthy population still is not known. The aim of the study was the assessment of the distribution of the CYP2C19*2, CYP2C19*3, CYP2C19*17 alleles and genotypes polymorphism in healthy population of the Republic of Moldova.

2 Material and Methods Totally, 430 apparently healthy subjects (18–29 years) were included, who were enrolled in 2011 at Nicolae Testemitanu State University of Medicine and Pharmacy (Nicolae Testemitanu University). The study was carried out during the 2018–2022 years. Exclusion criteria from the study: young people who do not hold the citizenship of the Republic of Moldova, the individual’s refusal to participate in the study, pregnant women. Sample processing and molecular genetics analyses were carried in the Laboratory of Genetics, Nicolae Testemitanu State University of Medicine and Pharmacy, with the support of the project “Piloting the application of the principles of personalized medicine in the conduct of patients with chronic non-communicable diseases”, #20.80009.8007.26. Informed consent was obtained from all patients. This study was reviewed and approved by the Ethics Committee of the Nicolae Testemitanu State University of Medicine and Pharmacy, Chisinau, Moldova. 2.1 Sample Collection and Processing Blood samples were collected in ethylenediaminetetraacetic acid (EDTA) tubes. Genomic DNA was extracted using the GeneJET Genomic DNA Purification kit (#K0722, Thermo Fisher Scientific). All the procedures were realized according to the manufacturer protocol.

394

M. Dogot et al.

DNA purity and concentration were estimated using NanoDrop 2000c Spectrophotometer (Thermo Fisher Scientific), according to manufacturer’s suggestions. Samples with a concentration of at least 2ng/μl and DNA purity value A260/A280 = (1,7; 2,1) were considered valid for further analysis. All samples were normalized to 2 ng/μl before the genotyping step. 2.2 TaqMan Genotyping Assay The following clopidogrel-related loci were examined: rs4244285 (CYP2C19*2), rs4986893 (CYP2C19*3), rs12248560 (CYP2C19*17). TaqMan Drug Metabolism Genotyping Assay (#4362691, Applied Biosystems, Thermo Fisher Scientific) was used to test rs4244285, rs4986893, and rs12248560, (corresponding assay IDs were C__25986767_70, C__27861809_10, C____469857_10) (Table 1). Molecular-genetic analysis was performed in a total reaction volume of 5μl on 384well plates. Dried-down DNA method, according to the protocol recommended by the manufacturer (Applied Biosystems) was implemented. The genotyping plate was prepared by pipetting 2μl of DNA solution with a concentration of 2ng/μl and left to dry the DNA for about 30–48 h at room temperature in a covered stall to avoid impurification. Reaction solution included 2,5μl 2x TaqMan Master Mix (#4371355, Thermo Fisher Scientific), 0,25μl 20x SNP Genotyping Assay, 2,25μl Nuclease-free water. Each plate was sealed with optical transparent cover (Applied Biosystems, #4311971), then centrifuged in spin-mix-spin cycle for 3 min, 30 s, 3 min respectively, to drop down the solution and dissolve the DNA. Thermal cycling was performed on Applied Biosystems QuantStudio 6 Flex Real-Time PCR System (#PN 4347372), applying two-stage amplification procedure (Table 2). Data acquisition was realized using QuantStudio Real-Time PCR software (v1.3, Applied Biosystems, Thermo Fisher Scientific). Validation was based on the 95% successful genotyping call rate. All samples which failed to accomplish validation criteria were repeatedly tested. 2.3 Genotyping Results Interpretation TaqMan Genotyper Software (v.1.3.1., Applied Biosystems, Thermo Fisher Scientific) was used to verify the accuracy and reading of the genotype data, as well as the quality of genotyping for the whole set of patients and healthy subjects profiles. The genotypes were checked for Hardy-Weinberg Equilibrium (HWE) using the Pearson Chi-square criterion. The conditions of compliance with HWE were χ2 ≤ 3,84 and it’s P ≥ 0,05.

636G > A, C__27861809_10 ACATCAGGATTGTAAGCACCCCCTG[A/G]ATCCAGGTAAGGCCAAGTTTTTTGC Transition Substitution

-806C > T, C____469857_10 AAATTTGTGTCTTCTGTTCTCAAAG[C/T]ATCTCTGATGTAAGAGATAATGCGC Transition Substitution

rs4986893

rs12248560

Context Sequence [VIC/FAM]

681G > A, C__25986767_70 TTCCCACTATCATTGATTATTTCCC[A/G]GGAACCCATAACAAATTACTTAAAA Transition Substitution

Assay ID

rs4244285

Locus (dbSNP) Variation

Table 1. Information about the CYP2C19 SNPs used in the current study

The Prevalence of Allele Frequencies of CYP2C19 Polymorphisms 395

396

M. Dogot et al. Table 2. Thermal cycling conditions for TaqMan genotyping

Pre-read stage

Hold stage

1st PCR stage

2nd PCR stage

Post-read stage

°C/Time

°C/Time

°C/Time

Cycles

°C/Time

Cycles

°C/Time

60°C/30 s

95°C/10 min

92°C/15 s

20

89°C/15 s

30

60°C/30 s

60°C/60 s

60°C/90 s

3 Results The study included 430 prospectively healthy students, enrolled in 2011 at the General Medicine, Pharmacy and Dentistry faculties at the State University of Medicine “Nicolae Testemitanu”. The group of subjects consisted of 302 female (68,64%) and 138 male (31,36%) and were aged between 18 and 29 years, the median being 19 years. The genotype and allele frequencies for all the polymorphisms screened are shown in Table 3. The genotypes were in Hardy–Weinberg equilibrium (P > 0.05). The allele was defined as the most commonly occurring allele in the population. The population allele frequencies were calculated from genotype numbers. The A allele frequency for CYP2C19*2 was 14.7% and for CYP2C19*3 it was 0.1%. The distribution of genotypes and allelic frequencies for CYP2C19*2 and *3 alleles are shown in Table 1. Table 3. Allele and genotypes frequency of polymorphism 681G > A, rs4244285 and 636G > A, rs4986893 in healthy subjects of the Republic of Moldova Polymorphism

χ2

HWE p-value

n = 309 (72.2%)

0.766

0.381

n = 423 (99.8%)

0.001

0.975

Allele frequency, %

Genotypes frequency, n %

A

G

Homozigots AA

Heterozigots AG

Homozigots GG

CYP2C19*2, 681G > A, rs4244285

14.7

85.3

n=7 (1.6%)

n = 112 (26.2%)

CYP2C19*3, 636G > A, rs4986893

0.1

99.9

0.0%

n=1 (0.2%)

HWE: Hardy-Weinberg Equilibrium, n = number of subjects.

The AA CYP2C19*2 genotypic frequency was present in 119 subjects, of which 112 (26.2%) were AG CYP2C19 heterozygous*1/*2, and 7 (1.6%) were AA CYP2C19*2/*2 homozygous. Comparing the frequencies of the observed genotypes and those expected using the chi-squared test (χ2), the Hardy–Weinberg equilibrium relationship was evaluated. For the tested polymorphisms, no deviations from HWE (p > 0,05, χ2 < 3,84) were

The Prevalence of Allele Frequencies of CYP2C19 Polymorphisms

397

identified, the distribution of genotypes frequencies in the given group showed the value p = 0,381, χ2 = 0,766 for the polymorphism CYP2C19*2 and for the polymorphism CYP2C19*3, p = 0,001, χ2 = 0, 975 (see Fig. 1).

Fig. 1. Results of genotyping of CYP2C19*2, 681G > A, rs4244285

Meanwhile, AG CYP2C19*3 genotypic frequency was in 0.2% cases in heterozygous state and has not been determined in any subject in the AA homozygous state (see Fig. 2).

Fig. 2. Results of genotyping of CYP2C19*3, 636G > A, rs4986893

The T allele frequency for CYP2C19*17 was 21.6%. The CYP2C19*17 genotypic frequency was present in 150 subjects, of which 119 (28.4%) were CT CYP2C19

398

M. Dogot et al.

heterozygous*1/*17, and 31 (7.4%) were TT CYP2C19*17/*17 homozygous (see Fig. 3).

Fig. 3. Results of genotyping of CYP2C19*17, -806C > T, rs1224860

According to the phenotype, 7 individuals CYP2C19*2/*2 homozygotes (1.6%) are predicted to be CYP2C19 PM, 113 individuals – 112 CYP2C19*1/*2 heterozygotes and 1 CYP2C19*1/*3 compound heterozygote (30%) are predicted to be CYP2C19 IM, 119 subjects CYP2C19*1/*17 heterozygotes (28.4%) are predicted to be CYP2C19 RM and 31 subjects CYP2C19*17/*17 homozygotes (7.4%) are predicted to be CYP2C19 UM.

4 Discussion In this study, we report the frequency of CYP2C19 gene polymorphisms in Moldova subjects. The study regarding the prevalence of allele frequencies of CYP2C19 polymorphisms of clinically important drug-metabolizing enzymes CYP2C19 in Moldova healthy population, since the samples were recruited to cover all the regions in Republic of Moldova. Comparative analysis of the CYP2C19*2 and CYP2C19*3 allele and genotypes frequency in different populations showed that regarding CYP2C19, the frequencies of the allelic variants CYP2C19*2 in the present study were consistent with the data reported for Europe (Romania, Russia, Germany) [11–16] and for Africa (Egypt) [23], but was slightly higher in our study compared to what has been reported in Belgium [17] and was lower compared to what has been reported in Asia (China, Japan and Turkey) [18–20]. The CYP2C19*3 allele was observed with a frequency of 0.1% in our study. The frequency of CYP2C19*3 in the present study was similar compared to what has been

The Prevalence of Allele Frequencies of CYP2C19 Polymorphisms

399

reported for Europe (Russia, Germany) [14, 16] and for Africa (Egypt) [23], and slightly lower compared to what has been reported in China and Japan [18, 19]. By contrast, the CYP2C9*3 allele frequency was zero in previous reports that were examined in Romania and Belgium [13, 17]. CYP2C19*3 is most prevalent in East Asia (6.7%) [17]. In Africa, America, Europe, the frequency of the CYP2C19*3 allele is < 0.1% [12, 17]. The CYP2C19*2 polymorphism is most prevalent in Asian populations [17]. The frequency of the CYP2C19*17 gain-of-function allele is more frequent in the population of European countries than Asian and American ones [11, 12, 17]. Pratt et al. Reported that CYP2C19*2 and CYP2C19*3 have decreased function and are the most well-characterized variant CYP2C19 alleles compared with other alleles [24]. The CYP2C19*17 allele, associated with accelerated metabolism, is prevalent at 18.2% in African-American, 6.2% in Asian, 15.8% in Caucasian, 15.2% in Hispanic, and 19.8% in Ashkenazi Jewish populations [25]. The prevalence of the NM, IM, PM, and UM phenotypes was 48.22%, 42.98%, 6.64% and 2.16% respectively. Notably, a similar trend was observed for the IM among the Tais and Han Chinese in previous studies [26]. According to the phenotype data in our study, among the healthy subjects predominate normal metabolism, intermediate metabolizers were in 26.4% and poor metabolizers were only in 1.6% cases. These frequencies were consistent with the Europe population (23.0% IM and 1,8% PM) [27]. The distribution of CYP2C19 alleles thus reflects the migratory history of European populations. These findings have potentially important implications, as CYP2C19 genotype is included as a phamacogenomic biomarker in the drug labels of 22 medications. Furthermore, guidelines issued by pharmacogenetics expert workgroups (CPIC and DPWG) provide recommendations to optimize genotype-guided prescription for drugs [28].

5 Conclusion The prevalence of the CYP2C19 allele and genotype in RM population were consistent with the Europe data. The CYP2C19 allele frequency in M population was 14,7%, 0,1% and 21.6% for the CYP2C19*2, CYP2C19*3 and CYP2C19*17 alleles, respectively. According to the phenotype, 7 individuals CYP2C19*2/*2 homozygotes (1.6%) are predicted to be CYP2C19 PM, 113 individuals – 112 CYP2C19*1/*2 heterozygotes and 1 CYP2C19*1/*3 compound heterozygote (30%) are predicted to be CYP2C19 IM, 119 subjects CYP2C19*1/*17 heterozygotes (28.4%) are predicted to be CYP2C19 RM and 31 subjects CYP2C19*17/*17 homozygotes (7.4%) are predicted to be CYP2C19 UM. Our results may provide a consideration of RM population differences in drug responses and support for the application of genetic testing in medical practice by initiating personalized treatment. Acknowledgments. This work was supported by the project 20.80009.8007.26 “Piloting the application of the principles of personalised medicine in the conduct of patients with chronic non-communicable diseases” within the State Program (2020–2023), project leader: Curocichin

400

M. Dogot et al.

Ghenadie, contracting authority: National Agency for Research and Development, Republic of Moldova.

Conflict of Interest. The authors declare that they have no conflict of interest.

References 1. Bank, P.C., Caudle, K.E., Swen, J.J.: Comparison of the guidelines of the clinical pharmacogenetics implementation consortium and the dutch pharmacogenetics working group. Clin. Pharmacol. Ther. 103, 599–618 (2018) 2. Ahmed, S.: Pharmacogenomics of drug metabolizing enzymes and transporters: Relevance to precision medicine. Genomics Proteomics Bioinform. 14(5), 298–313 (2016) 3. Preissner, S.C.: Polymorphic cytochrome P450 enzymes (CYPs) and their role in personalized therapy. PLoS ONE 8(12), e82562 (2013) 4. Ibeanu, G.C., Goldstein, J.A.: Identification of new human CYP2C19 alleles (CYP2C19*6 and CYP2C19*2B) in a Caucasian poor metabolizer of mephenytoin. J. Pharma. Experim. Therap. 286(3), 1490–1495 (1998). PMID 9732415 5. Fukushima-Uesaka, H.: Genetic variations and haplotypes of CYP2C19 in a Japanese population. Drug Metab. Pharmacokinet. 20(4), 300–307 (2005). https://doi.org/10.2133/dmpk. 20.300. PMID16141610 6. Sim, S.C., Risinger, C.: A common novel CYP2C19 gene variant causes ultrarapid drug metabolism relevant for the drug response to proton pump inhibitors and antidepressants. Clin. Pharmacol. Ther. 79(1), 103–113 (2006). https://doi.org/10.1016/j.clpt.2005.10.002. PMID16413245.S2CID20989576 7. Dorji, P.W., Tshering, G.: CYP2C9, CYP2C19, CYP2D6 and CYP3A5 polymorphisms in South-East and East Asian populations: a systematic review. J. Clin. Pharm. Ter. 44(4), 508– 524 (2019) 8. Wedlund, P.J.: The CYP2C19 enzyme polymorphism. Pharmacology 61(3), 174–183 (2000). https://doi.org/10.1159/000028398. PMID10971203.S2CID24471776 9. Bertilsson, L.: Geographical/interracial differences in polymorphic drug oxidation. Current state of knowledge of cytochromes P450 (CYP) 2D6 and 2C19. Clin. Pharmacokinet. 29(3), 192–209 (1995). https://doi.org/10.2165/00003088-199529030-00005. PMID8521680.S2CID111743 10. Desta, Z., Zhao, X.: Clinical significance of the cytochrome P450 2C19 genetic polymorphism. Clin. Pharmacokinet. 41(12), 913–958 (2002). https://doi.org/10.2165/00003088-200 241120-00002. PMID12222994.S2CID27616494 11. Ionova, Y., Ashenhurst, J.: CYP2C19 Allele frequencies in Over 2.2 million direct-toconsumer genetics research participants and the potential implication for prescriptions in a large health system. Clin. Transl. Sci. 13, 1298–1306 (2020). https://doi.org/10.1111/cts. 12830 12. Zhou, Y., Ingelman-Sundberg, M.: Worldwide distribution of cytochrome P450 alleles: a meta-analysis of population-scale sequencing projects. Clin. Pharmacol. Ther. 102, 688–700 (2017). https://doi.org/10.1002/cpt.690 13. Buzoianu, A.: Screening for CYP2C19*2, *3 and *4 gene variants in a Romanian population study group. Farmacia 58(6), 806–817 (2010) 14. Gaikovitch, E.A., Cascorbi, I.: Polymorphisms of drug-metabolizing enzymes CYP2C9, CYP2C19, CYP2D6, CYP1A1, NAT2 and of P-glycoprotein in a Russian population. Eur. J. Clin. Pharmacol. 59, 303–312 (2003)

The Prevalence of Allele Frequencies of CYP2C19 Polymorphisms

401

15. Petrovi´c, J., Peši´c, V.: Frequencies of clinically important CYP2C19 and CYP2D6 alleles are graded across Europe. Eur. J. Hum. Genet. 28, 88–94 (2020). https://doi.org/10.1038/s41431019-0480-8 16. Aynacioglu, A.S., Sachse, C.: Low frequency of defective alleles of cytochrome P450 enzymes 2C19 and 2D6 in the Turkish population. Clin. Pharmacol. Ther. 66(2), 185–192 (1999) 17. Allabi, A.C., Gala, J.L.: Genetic polymorphisms of CYP2C9 and CYP2C19 in the Beninese and Belgian populations. Br. J. Clin. Pharmacol. 56(6), 653–657 (2003) 18. Zhong, Z., Hou, J.: Analysis of CYP2C19 genetic polymorphism in a large ethnic Hakka population in Southern China. Med. Sci. Monit. 23, 6186–6192 (2017). https://doi.org/10. 12659/msm.905337 19. Ota, T., Kamada, Y.: Combination analysis in genetic polymorphisms of drug-metabolizing enzymes CYP1A2, CYP2C9, CYP2C19, CYP2D6 and CYP3A5 in the Japanese population. Int. J. Med Sci. 12(1), 78–82 (2015). https://doi.org/10.7150/ijms.10263 20. Sabırlı, R.: CYP2C19*1 and CYP2C19*2 polymorphism in Turkish patients being diagnosed with stable coronary artery disease and using clopidogrel. Bagcilar Med. Bull. (2020). https:// doi.org/10.4274/BMB.galenos.2020.08.040 21. Dehbozorgi, M.: Prevalence of the CYP2C19*2 (681 G>A), *3 (636 G>A) and *17 (806 C>T) alleles among an Iranian population of different ethnicities. Mol. Med. Rep. 17, 4195–4202 (2018). https://doi.org/10.3892/mmr.2018.8377 22. Sukprasong, R.: Allele frequencies of single nucleotide polymorphisms of clinically important drug-metabolizing enzymes CYP2C9, CYP2C19, and CYP3A4 in a Thai population. Sci. Rep. 11, 12343 (2021). https://doi.org/10.1038/s41598-021-90969-y 23. Hamdy, S.I., Hiratsuka, M.: Allele and genotype frequencies of polymorphic cytochromes P450 (CYP2C9, CYP2C19, CYP2E1) and dihydropyrimidine dehydrogenase (DPYD) in the Egyptian population. Br. J. Clin. Pharmacol. 53(6), 596–603 (2002) 24. Pratt, V.M.: Recommendations for clinical CYP2C9 genotyping allele selection: A joint recommendation of the association for molecular pathology and college of American pathologists. J. Mol. Diagn. 21(5), 746–755 (2019) 25. Martis, S., Peter, I.: Multi-ethnic distribution of clinically relevant CYP2C genotypes and haplotypes. Pharmacogenomics J. 13(4), 369–377 (2013) 26. Sukasem, C., Tunthong, R.: CYP2C19 polymorphisms in the Thai population and the clinical response to clopidogrel in patients with atherothrombotic-risk factors. Pharmgenomics Pers. Med. 6, 85–91 (2013) 27. Klein, M.: Clinical utility of CYP2C19 genotyping to guide antiplatelet therapy in patients with an acute coronary syndrome or undergoing percutaneous coronary intervention. Arterioscler. Thromb. Vasc. Biol. 39, 647–652 (2019). https://doi.org/10.1161/ATVBAHA.118. 311963 28. Bank, P.C., Caudle, K.E.: Comparison of the guidelines of the Clinical Pharmacogenetics Implementation consortium and the Dutch pharmacogenetics working group. Clin. Pharmacol. Ther. 103, 599–618 (2018)

Prospective, Descriptive Study of Rotaviral Infection in Vaccinated and Non-vaccinated Infants from Republic of Moldova Ala Donos(B)

and Albina-Mihaela Iliev

“Nicolae Testemitanu” State University of Medicine and Pharmacy, Chisinau, Republic of Moldova [email protected]

Abstract. Acute diarrheal disease is one of the most current health problems of the baby. Rotaviral infection is the most common cause of dehydration in infants and young children. The implementation of the sentinel surveillance of rotaviral infection in infants from 2008 in the Republic of Moldova demonstrated the high rate of this infection (40.0%), being an argument in recommending the antirotaviral immunization in children within the National Immunization Program. The study enrolled children with acute diarrheal disease, included in the sentinel supervision (2012–2016) and treated in the Unit of acute diarrheal dis-eases of Clinical Children’s Hospital no. 1. Were assessed 193 patients with acute diarrheal disease, according with a standard clinical approach. The biological material was examined by serological enzyme-linked immunosorbent assay (ELISA) and genotyping revealed by polymerase chain reaction (PCR). The rotaviral infection was confirmed in 193 infants, of which 121 children were not vaccinated against rotaviral infection, and 72 were immunized. Depending on the genotypes encountered before and after vaccination, it was found that G9P[8], G3P[8], G4P[8] was detected before vaccination, but post-vaccine prevailed G2P[4], G4P[8], also the incidence of rotaviral infection is decreasing, and the evolution of the disease is much easier. This article reflects the evolution of the genotypic properties of rotaviruses and the clinical-paraclinical particularities of rotaviral infection in infants, with a major importance in the context of the implementation of antirotaviral immunization in children within the National Immunization Program in the Republic of Moldova. Keywords: diarrhea · rotavirus · children · infants · antirota-viral vaccine

1 Introduction The health of society and future generations is largely de-pendent on the health of newborns and children, which is closely correlated with a multitude of factors [1]. The evaluation of the illnesses among the children of the first year of life marks an increased incidence of the bronchopulmonary pathology, being followed by the infections of the gastrointestinal tract [2]. The involvement in the epidemiological process of the young © The Author(s), under exclusive license to Springer Nature Switzerland AG 2024 V. Sontea et al. (Eds.): ICNBME 2023, IFMBE Proceedings 92, pp. 402–410, 2024. https://doi.org/10.1007/978-3-031-42782-4_43

Prospective, Descriptive Study of Rotaviral Infection in Vaccinated

403

children, attests a major economic and epidemiological importance of the rotaviral infection. According to WHO data, around 10,027 cases of deaths in children up to 5 years old are caused by the rotaviral infection in Europe. In the countries of the European Union (EU), in children up to 5 years old, there are 2.8 million rotaviral infections, resulting in more than 200 deaths, 87,000 hospitalizations. The problem of rotaviral infection remains current during the last 45 years, since the discovery of this virus has been associated with an increased incidence, especially among chil-dren up to 5 years old [3]. Each child can withstand from one to several episodes of the disease, characterized by a high inci-dence of serious cases, with complications and lack of specific antirotaviral therapy. In the rotaviral infection extra intestinal disorders occur, involving not only the mucosa of the gastrointestinal tract, but also the respiratory, cardiac, reno-urinary system, nervous system, liver, pancreas, spleen [4]. Vaccines are the only public health prevention strategy that can control rotaviral disease. They have been developed to imitate immunity as a result of natural rotaviral infection, which provides protection against severe gastroenteritis and therefore reduces the risk of primary care, hospitalization and death [5].

2 Material and Methods Prospective, descriptive study, included 193 children with acute diarrheal disease, involved in the sentinel surveillance (2012–2016) from the Acute diarrheal diseases unit, Clinical Municipal Children’s Hospital no. 1. The research protocol was approved by the Research Ethics Committee of the Nicolae Testemitanu SUMPh from the Republic of Moldova (report no. 54 of 13.02.2017, president of REC - Viorel Nacu, PhD, assoc. Prof.). All patients were selected according to the standard case scenario. The hospitalization rules and the completion of a standardized questionnaire for this study were rspected. The parents of the children gave written informed consent for their enrollment in the research. The criteria for inclusion in the study were: • Age from 1 month to 12 months (according to WHO recommendations) [6] • Diarrhea with at least 3 defecations in the last 24 h, but not more than 7 days • Patients examined by serological reaction ELISA with genotypes detected in PCR for rotaviral infection within the first 24 h after admission The criteria for exclusion of patients from research: • Patients with rotaviral infection or severe comorbidities (heart defects, digestive tract development abnormali-ties, nervous system development abnormalities etc.). • Patients with diarrhea of less than 3 fluid defecations in the last 24 h. The presence of signs of dehydration was appreciated in the children included in the study, at the time of the clinical examination,. The evaluation of the degree of dehydration in acute diarrheal disease according to the WHO is as follows: severe - lethargic, has closed eyes, cannot drink or drink with difficulty, the skin fold returns to normal very

404

A. Donos and A.-M. Iliev

slowly (>2 s); moderate - agitated or irritable, has eyes closed, drinks with greed, thirst, skin fold returns to normal slowly (18 years old) with a burn injury affecting >20% TBSA, weight >40 kg, admitted to burn center within 24 h of their injury, and expected to live for at least 24 h. Exclusion criteria were: patients with primary electrical burns, severe peripheral microcirculation disorders; the presence of clinically significant cardiac arrhythmias; significant damage to peripheral arteries; severe heart valve dysfunction; patient refusal. The data collected included patient demographics, burn characteristics, hospitalization and discharge, medication, laboratory tests, and complications. Data on hospitalization and discharge were also collected from the BN. Fluid data collected from both sources included fluids prior to intensive care unit (ICU) admission (prehospital fluids and fluids administered in the emergency department), as well as fluids administered during ICU resuscitation. A mathematical analysis of the results of the study was performed using computer programs Microsoft Excel 2016 and Statistica 5.5. A comparison of statistical characteristics in groups and the dynamics of observation was performed using parametric and nonparametric criteria (considering the law of distribution). Results at P 0.05

35–44 y.o

80 (26 ± 2.4)

51 (40 ± 4.3)

55 (23 ± 2.7)

> 0.05

45–54 y.o

75 (25 ± 2.5)

33 (26 ± 3.9)

46 (19 ± 2.5)

> 0.05

55–64 y.o

47 (15 ± 2.1)

16 (12.5 ± 2.9)

41 (17 ± 2.4)

> 0.05

CG N = 242 M ± SD

P

5 (2 ± 0.9)

> 0.05

10 (4 ± 1.3)

> 0.05

Note: Statistical test used- paired samples t Test.

Assessing the microbiological results of the patients from the 1st SG, was established that 189 (62%) were smear positive for acid-fast-bacillli (AFB) on Ziehl-Neelson (ZN) staining, culture positive on conventional media were 93 (31%) and drug susceptibility tests revealed sensibility to all first-line anti-TB drugs in 87 (29%) patients, resistance against Isoniazid in 6 (2%) patients, Pyrazinamide and Ethambutol in 1 (0.5%) case, respectevily. In the 2nd SG - 67 (53%) patients were AFB positive, culture positive - 26 (21%) patients and the drug susceptibility tests confirmed the resistance against Isoniazid in 24 (19%) patients, Rifampicin – 26 (21%) patients, Pyrazinamide – 16 (13%) patients, Streptomycin – 11 (9%) patients, Ethionamide – 7 (5.5%) patients and Levofloxacin – 5 (4%) patients. According to the NCPs all patients with positive&resistant Xpert results should be repeately evaluated through other available molecular genetic tests-GenoType MTBDR plus (Hain Lifescience). As following, 31 (24%) patients of the 2nd SG were positive to other PCR tests which showed the resistance to fluoroquinolones -5 (4%) and extended sprectum of second-line drug-resistance in 11 (9%) patients. In order to establish the risk factors for developing TB were assessed the following patients peculiarities: economic and civil status, epidemiological contact with a TB

446

E. Lesnic and M. Alina

patient, harmful habits and associated diseases. The distribution of patients according to the economic status revealed a higher number of patients economicaly disadvantaged and in single civil state in the 1st SG compared with the 2nd SG. So, economical disadvantaged state and single civil state were established as low risk factos for developing drug susceptible TB. All TB contributing harmful habits (tobacco smoking, intravenous drug-use and alcohol abuse) predominated in patients from the 1st SG compared with the 2nd CG. Comparing the values of the RR, only alcohol abuse was identified as a middle risk factor for drug susceptible TB and other two-low risk factors. The close TB contact was confirmed in a higher proportion of patients from the 2nd SG, as well of those who were before incarcerated in penitenciary Moldovan institutions. Following this, the TB contact was confirmed to be a high risk factor and the history of detention–middle risk factor for acquiring the MDR-TB. The associated diseases were more frequently identified in patients from the 2nd SG and it was assessed as a middle risk factor for MDR-TB (See Table 2). Table 2. Distribution according to the risk factors. Age groups

1st SG N = 304 M ± SD

2nd SG N = 127 M ± SD

RR 95%CI

X2

Disadvantaged economical status

218 (72 ± 2.6)

58 (46 ± 4.4)

1.5 (1.2–1.8)

0.004

Single-civil state

182 (60 ± 2.7)

65 (52 ± 4.2)

1.14 (1.1–1.3)

0.02

Tobacco smoking

247 (81 ± 2.3)

78 (61 ± 4.3)

1.5 (1.1–1.7)

0.001

Intravenous drug-use

4 (1.3 ± 0.6)

1 (0.8 ± 0.3)

1.2 (1.1–1.8)

0.01

Alcohol abuse

76 (25 ± 2.5)

12 (9 ± 2.6)

2.1 (1.5–4.1)

0.001

TB contact

29 (9.5 ± 1.7)

28 (22 ± 3.1)

2.8 (1.5–4.9)

0.006

Previously detained

5 (2 ± 0.8)

6 (4.7 ± 1.8)

2.1 (1.6–2.6)

0

Associated diseases

89 (29 ± 2.7)

45(35 ± 4.2)

2.3 (2.1–4.1)

0.002

Note: M-mean, SD-standard deviation, RR-relative risk, 95% CI - 95% confidence interval, the chi-squre (X2 ) test result

3.2 Assessment of the Predictors for Positive Molecular Genetic Assays in Pulmonary TB To establish the predictive factors for positive Xpert results were evaluated the patients clinical peculiarities, case-management and treatment outcome by comparing the patients from the MSG with CG. The radiological peculiarities showing the severity of the disease, such as extensive forms of TB to more than three lung segments, lung parenchimal destruction and disseminative opacities were more frequently established in the MSG compared with the CG. Comparing the RR values, only extended forms of TB were established as a high predictor. The lung destruction and dissemination were low predictors for positive Xpert results. Evaluating the patients general state and the

The Role of Molecular-Genetic Assays in Diagnosis of Pulmonary Tuberculosis

447

clinical expression of the complains, was confirmed that more expressed symptomatology showed patients from the SG compared with the CG and both clinical aspects were established as low predictors for positive Xpert results. Passive detection of the symptomatic patients statistically predominated in MSG. Respectively passive detection was established as a middle predictor for Xpert positive results in the MSG. The molecular genetic assays based on PCR cannot differentiate viable by non-viable MBT, as following there were not used for the treatment efficacy evaluation and after completion of the anti-TB treatment. Only radiological, conventional microbiological methods and standard laboratory tests were used in the patients periodical evalution till the completion of the treatment and assessment of the final therapeutic outcome. Despite the fact that more severe clinical and radiological aspects were established in patients from the MSG, the treatment success was higher than in those from the CG. It was due by a lower rate of those who failed the treatment and were lost to follow-up. The rate of deaths were not statistically different in the MSG compared with the CG (See Table 3). Table 3. Distribution according to the risk factors. CG N = 242 M ± SD

RR 95% CI

X2

Age groups

MSG N = 431 M ± SD

Extensive forms

243 (56 ± 2.4)

89 (37 ± 3.1)

2.6 (1.9–3.5)

0

Lung destruction

168 (39 ± 2.5)

109 (45 ± 3.2)

1.3 (1.1–1.8)

0.006

Dissemination

102 (24 ± 2.1)

71 (29 ± 2.9)

1.2 (1.1–1.7)

0.004

Bad general state

234 (54 ± 2.4)

106 (43.1 ± 3.2)

1.2 (1.1–1.8)0

0.01

Clinicaly expressed

268 (62 ± 2.4)

112 (47 ± 3.2)

1.3 (1.1–1.6)

0.01

Passive detection

376 (87 ± 1.6)

118 (48.7 ± 3.2)

1.9 (1.3–2.6)

0.001

Comorbid state

134 (31 ± 2.2)

64 (26 ± 2.8)

2.1 (1.3–2.6)

0.05

Treatment success

402 (93 ± 1,3)

167 (69 ± 2.8)

NA

0

Death

5 (1 ± 0,52)

15(6 ± 1.5)

NA

0.19

Treatment failure

11 (2 ± 0,7)

31 (13 ± 2.1)

NA

0.04

Lost to follow-up

13 (3 ± 0,8)

29 (12 ± 2.1)

NA

0.03

Note: M-mean, SD-standard deviation, RR-relative risk, 95% CI - 95% confidence interval, the chi-squre (X2) test result

4 Discussion Our research is one of the few studies, which assessed a national cohort of TB patients, diagnosed for the first time with pulmonary TB. The results confirmed the role of the molecular genetic tests, especially of GeneXpert in diagnosis of severe, extensive forms of pulmonary TB, detected through the examination of the symptomatic patients. Despite the fact that the severity of the disease was higher in patients with positive Xpert results,

448

E. Lesnic and M. Alina

we established that the clinical case-management was more adequate and the treament completion was higher than in those diagnosed through other conventional methods. The same results were established in other autochthonous and international studies. It was mainly due to the adaption of the treatment according to the drug-susceptbility results provided by molecular-genetic tests, by this way diminshing the risk for death and therapeutic failure [9, 12–14]. The risk factors for developing drug-resistant TB were epidemiological contact, history to incarceration in the penitenciary institutions and the patient’s comorbid state. The risk factors for MDR-TB were widely studied and international cohort studies which confirmed the impact of urbanisation, overcrowding, low hygienic conditions, long hospitalisation, previous exposure to the anti-TB treatment and poorly managed anti-TB programmes as contributing factors for developing the MDR-TB [4, 7, 12–19]. In our clinical experience, the following risk factors - social disadvantaged state, single civil state and harmful habits (tobacco smoking, intravenous drug use, alcohol abuse) contributed to the development of the drug susceptible-TB. Similar conditions were exposed in the guideline on the management of the reactivation of the post-primary infection and were considered as criteria for administration of the chemopreventive treatment [20]. At present all clinical recommendations of the international researches showed that molecular genetic assays in symptomatic patients reduced the delay in diagnosis and improved the therapeutic outcome, through the prompt initiation of an adequate treatment [12–17]. We found that patients with positive Xpert results were more frequently affected by severe and extensive pulmonary TB, manifested by an expressed clinical symptomatology and had a comorbid state. Other study showed that the patients diagnosed through molecular genetic tests were not affected by severe forms, which was the consequence of the prompt detection and their treatment outcome was higher, compared with those diagnosed through the conventional methods [15]. The main outcome we found was that the new molecular genetic technology used in diagnosis of Moldovan TB patients with the testing of the drug resistance improved the case-management, as the treatment was adapted according to their results, and similar results were confirmed by some international studies [12–14, 17–19].

5 Conclusions Microbiological methods are the leading investigations to be done compulsory in all patients suspected for TB. However, the molecular genetic tests, such as GeneXpert MTB/Rif are strongly recommended to be performed in every symptomatic patient, never treated for TB with radiological abnormalities. The predictors for positive GeneXpert MTB/Rif results were extensive and severe forms of pulmonary TB, expressiveness of the clinical complains and comorbid state. The risk factors for acquiring the drugresistant TB were the contact with a patient with TB, the history of incarceration in the penitentiary institutions and the comorbid state. Due to precocious diagnosis of the pulmonary TB and individualized therapeutic approach according to the drug-resistance profile, the rate of the unfavorable treatment outcomes, such as therapeutic failure and loss to follow-up was low.

The Role of Molecular-Genetic Assays in Diagnosis of Pulmonary Tuberculosis

449

As recommendation, we propose a dynamic approach in the investigation of the primary suspected TB patients, especially those who are symptomatic and show radiological abnormalitites. The molecular genetic assays should provide the evidence for the diagnosis of TB and adequacy of the treatment for the improvement of the case-management. The limitation of the molecular genetic tests are the impossibility to use them in the evaluation of the clinical evolution and therapeutic effectiveness.

Conflict of Interest. The authors declare that they have no conflict of interest.

References 1. The End TB Strategy. Global Strategy and Targets for Tuberculosis Prevention, Care, and Control After 2015. World Health Organization, Geneva (2014) (electronic version). https:// www.who.int/publications/i/item/WHO-HTM-TB-2015.19 2. Global Tuberculosis Report 2022. World Health Organization, Geneva (2020). ISBN 97892-4-006172-9 (electronic version). https://www.who.int/teams/global-tuberculosis-progra mme/tb-reports/global-tuberculosis-report-2022 3. Nahid, P., Dorman, S.E., Alipanah, N., et al.: Official American thoracic society/centers for disease control and prevention/infectious diseases society of America clinical practice guidelines: treatment of drug-susceptible tuberculosis. Clin. Infect. Dis. 63(7), e147–e195 (2016). https://doi.org/10.1093/cid/ciw376 4. European Centre for Disease Prevention and Control. WHO Regional Office for Europe. Tuberculosis Surveillance and Monitoring in Europe 2022–2020 Data. WHO Regional Office for Europe and Stockholm: European Centre for Disease Prevention and Control, Copenhagen (2022). Licence: CC BY 3.0 IGO 5. Afsar, I., Gunes, M., Er, H., Gamze, S.A.: Comparison of culture, microscopic smear and molecular methods in diagnosis of tuberculosis. Rev. Esp. Quimioter. 31(5), 435–438 (2018) 6. Rakotosamimanana, N., Lapierre, S.G., Raharimanga, V.: Performance and impact of GeneXpert MTB/RIF® and Loopamp MTBC Detection Kit® assays on tuberculosis case detection in Madagascar. BMC Infect Dis. 19(1), 542 (2019). https://doi.org/10.1186/s12879-019-4198-6 7. Penn-Nicholson, A., Georghiou, S.B., Ciobanu, N., et al.: Detection of isoniazid, fluoroquinolone, ethionamide, amikacin, kanamycin, and capreomycin resistance by the Xpert MTB/XDR assay: a cross-sectional multicentre diagnostic accuracy study. Lancet Infect Dis. 22(2), 242–249 (2022). https://doi.org/10.1016/S1473-3099(21)00452-7 8. Lesnic, E., et al.: The impact of the risk factor on the incidence of tuberculosis in Chis, in˘au. Arta Med. 81(4), 11–17 (2021). https://doi.org/10.5281/zenodo.5856850 9. Lesnic, E., Malic, A.: The predictors of pulmonary tuberculosis in Xpert MBT/Rif positive and resisntant assay patients with diabetes mellitus. Moldovan Med. J. 61(2), 23–29 (2018). http://moldmedjournal.md/wp-content/uploads/2018/10/moldmedjournal-2018-612lesnic-full-article.pdf 10. Protocolul Clinic Nat, ional “Tuberculoza la Adult”. Chis, in˘au (2020). [National Clinical Protocol. “Tuberculosis in adults”. Chisinau; 2020]. (Romanian) 11. Protocolul Clinic Nat, ional ”Tuberculoza la Copil”. Chis, in˘au (2020). [National Clinical Protocol. “Tuberculosis in children”. Chisinau; 2020]. (Romanian) 12. Teo, A.K.J., Singh, S.R., Prem, K., et al.: Delayed diagnosis and treatment of pulmonary tuberculosis in high-burden countries: a systematic review protocol. BMJ Open 9, e029807 (2019). https://doi.org/10.1136/bmjopen-2019-029807

450

E. Lesnic and M. Alina

13. Saktiawati, A.M.I., Subronto, Y.W., Stienstra, Y., Sumardi, S.F., van der Werf, T.S.: Sensitivity and specificity of routine diagnostic work-up for tuberculosis in lung clinics in Yogyakarta, Indonesia: a cohort study. BMC Public Health 19(1), 363 (2019). https://doi.org/10.1186/s12 889-019-6658-8 14. Pourakbari, B., Mamish, S., Mohammadzadeh, M., Mahmoudi, S.: First-line anti-tubercular drug resistance of Mycobacterium tuberculosis in IRAN: a systematic review. Front. Microbiol. 7, 1139 (2016). https://doi.org/10.3389/fmicb.2016.01139 15. Nguyen, T.N.A., Anton-Le Berre, V., Bañuls, A.L., Nguyen, T.V.A.: Molecular diagnosis of drug-resistant tuberculosis; a literature review. Front. Microbiol. 10, 794 (2019). https://doi. org/10.3389/fmicb.2019.00794 16. Yang, C., Sobkowiak, B., Naidu, V.: Phylogeography and transmission of M. tuberculosis in Moldova: a prospective genomic analysis. PLoS Med. 19(2), e1003933 (2022). https://doi. org/10.1371/journal.pmed.1003933 17. Stosic, M., Vukovic, D., Babic, D., et al.: Risk factors for multidrug-resistant tuberculosis among tuberculosis patients in Serbia: a case-control study. BMC Public Health 18(1), 1114 (2018). https://doi.org/10.1186/s12889-018-6021-5 18. Chakaya, J., Khan, M., Ntoumi, F., et al.: Global tuberculosis report 2020 - reflections on the Global TB burden, treatment and prevention efforts. Int. J. Infect. Dis. 113(Suppl 1), S7–S12 (2021). https://doi.org/10.1016/j.ijid.2021.02.107 19. Baya, B., Achenbach, C.J., Kone, B.: Clinical risk factors associated with multidrug-resistant tuberculosis (MDR-TB) in Mali. Int. J. Infect. Dis. 81, 149–155 (2019). https://doi.org/10. 1016/j.ijid.2019.02.004 20. WHO. Latent tuberculosis infection. Updated and consolidated guidelines for programmatic management (2018)

The Relationship Between Dental Caries Damage, Tooth Enamel Hypoplasia and the Particularities of Calcium Homeostasis in Children Aurelia Spinei(B)

, Olga Balteanu , Svetlana Plamadeala , Elena Hristea , and Iurie Spinei

Nicolae Testemitanu State University of Medicine and Pharmacy of the Republic of Moldova, Chis, in˘au, Moldova [email protected]

Abstract. The aim of the present research was to study the relationship between dental caries (DC), enamel hypoplasia (EH) and markers of calcium homeostasis in children. The level of vitamin D, parathyroid hormone (PTH), calcium (Ca) and phosphates (Pi) in blood serum and oral fluid (OF) was studied in a sample of 246 children aged between 1 and 18 years. Depending on the state of oral health, the children were divided into 3 identical groups according to structure. The research group L1 consisted of 82 children with EH, the research group L2 included 82 children with DC, and the control group L0 – 82 conventionally healthy children, free of caries and without clinical manifestations of EH. As a result of the study, vitamin D deficiency, increased PTH level in blood serum and decreased Ca/Pi ratio in OF were established. Conclusions: vitamin D3 deficiency and increased PTH production can be used as markers of EH formation, increased susceptibility to DC and rampant DC development. The decrease of the Ca/Pi ratio in OF below 1:1.2 is a prognostic factor of the very rapid evolution of DC, caused by the disturbance of the tooth enamel remineralization process. The detection of some important risk factors for EH and the rampant evolution of DC requires the performance of interdisciplinary studies and the complex approach in planning measures to prevent DC and EH, which should include, in addition to local methods of prophylaxis, the administration of medication to balance Ca homeostasis at the local level and systemic. Keywords: Dental Caries · Enamel Hypoplasia · Calcium Homeostasis · Vitamin D3 · Parathyroid Hormone

1 Introduction Enamel morphogenesis is a complex process initiated by the secretion of proteins from the enamel matrix, followed by its mineralization and maturation [1]. Disturbances produced at different stages of enamel formation can cause a wide variety of macroscopic and structural changes - developmental defects of enamel (DDE) [1, 2]. Tooth enamel © The Author(s), under exclusive license to Springer Nature Switzerland AG 2024 V. Sontea et al. (Eds.): ICNBME 2023, IFMBE Proceedings 92, pp. 451–459, 2024. https://doi.org/10.1007/978-3-031-42782-4_48

452

A. Spinei et al.

hypoplasia (EH) is a consequence of defective enamel matrix formation, and defective calcification causes hypomineralization [2]. Among the causes of EH, are mentioned a series of genetic, systemic, environmental, local [2–4] and sociodemographic factors [4]. A series of studies indicated a possible relationship between DDE and the higher caries experience [5–7]. According to the data of some researchers, DDE may play an important role in increasing the susceptibility in the development of dental caries (DC) [8–12]. Oliveira et al., 2006, Caufield et al., 2012, have established increased susceptibility to DC of children with DDE, in particular subjects with EH [13, 14]. Batina, N. et al., 2004, Ferreira, F. et al., 2015, Kühnisch, J. et al., 2018, demonstrated that the increased rate of DC in hypoplastic teeth is due to increased microporosity and poor mineralization of tooth enamel, as well as the increased accumulation of dental biofilm [15–17]. Caufield et al., 2012, suggested an association between EH and severe early childhood caries (S-ECC) [14]. Several authors have hypothesized that EH and the increased susceptibility to DC in children of different ages could be caused by changes in calcium homeostasis from systemic or local causes during the pre- and postnatal periods of development. Recent research supports these findings and further mentions the impact of nutritional deficiencies, particularly poor vitamin D metabolism and lack or compromised mineral absorption as risk factors for EH in the primary dentition [18–24]. The key biological components of calcium homeostasis are 1,25-dihydroxyvitamin D (1,25(OH)2 D), parathyroid hormone (PTH), calcium (Ca), and phosphates (Pi). Importantly, they are also the key biological components of tooth enamel formation [24]. Our previous studies established the relationship between DC damage and the disturbance of phosphocalcium metabolism at the macroorganism level (in the blood serum) and locally (in the OF) at children with severe CNS diseases caused or associated with chronic tissue hypoxia. Was detected the statistically significant decrease, below the normal limits of the level of Ca, Pi and vitamin D3 in blood serum, as well as the significant decrease of the Ca/Pi ratio (1:1.26) in OF [25]. Although several authors, following clinical studies, have reported an increase in the prevalence of EH and DC damage in children with deregulation of phosphocalcium metabolism, the role of Ca homeostasis disorders in triggering the hypomineralization process of tooth enamel in children has not been sufficiently studied, and their establishment will allow the development of new personalized strategies for the prevention and treatment of dental pathology. The aim of the present research was to study the relationship between dental caries, enamel hypoplasia and markers of calcium homeostasis at children.

2 Materials and Methods To highlight the impact of metabolism disorders, in particular of Ca homeostasis, on the prevalence of EH and the increased susceptibility of children to DC, were studied the following: biochemical markers of phosphocalcium metabolism in blood serum and oral fluid (OF) in a sample of 246 children aged between 1 and 18 years. Depending on

The Relationship Between Dental Caries Damage, Tooth Enamel Hypoplasia

453

the state of oral health, the children were divided according to structure in 3 identical groups. The subjects taken into consideration are natives and residents of the Republic of Moldova. The children in the 3 groups lived in similar conditions. The average age of the children was 12.43 ± 2.2 years. The distribution of subjects by age groups was carried out in accordance with the periods of children’s growth, but also of the risk of DC development. Thus, 21.95% of the subjects were in adolescence, 19.51% of the children were of middle school age, 20.73% of primary school age, 19.51% of preschool age and 18.29% of the subjects – in the early childhood age group. The number of boys included in the study (50.41%) was approximately equal to that of girls (49.59%). Therefore, the distribution of children in groups was identical according to age, gender and living environment. The research group L1 consisted of 82 children with EH, the research group L2 included 82 children with rampant dental caries, and the control group L0 – 82 conventionally healthy children, free of caries and without presenting clinical manifestations of EH. The data collection was carried out by applying the instruments according to the questionnaires for recording the oral status proposed by the WHO (WHO Oral Health Questionnaire for Children, 2013) [26]. Was assessed the prevalence of EH and were estimated carious experience indices (prevalence index (PI) of DC and indices reflecting the intensity of DC in the temporary dentition (dft, dfs) and in the permanent dentition (DMFT, DMFS). To make the prediction of the risk of occurrence DC was used Cariogram Software [27]. Biochemical research in the blood serum included the determination of markers of phosphocalcium metabolism at all children included in the study. The venous blood was collected in the morning, à jeun, on an empty stomach, with a 5 ml syringe, then put into test tubes and transported to the Scientific Laboratory of Biochemistry of the State University of Medicine and Pharmacy “Nicolae Testemit, anu” and to the Scientific Laboratory of Human Reproduction and Immunochemical Investigations of IMSP IMC (for immunological investigations) within the first 3 h after collection. The blood serum was frozen and stored at −40 °C, being later used as biological material for biochemical investigations. To carry out the biochemical studies of the oral fluid (OF) it was collected unstimulated in the morning, à jeun, on an empty stomach, in sterile plastic test tubes that were transported to the Biochemistry Scientific Laboratory of the “Nicolae Testemit, anu” State University of Medicine and Pharmacy. Evaluation of markers of calcium homeostasis: dosing of total calcium (Ca), phosphates (Pi), magnesium (Mg), vitamin D3 , parathyroid hormone (PTH) in blood serum and Ca, Pi content in OF was carried out with EliTech (France) standard sets, in accordance with manufacturers’ recommendations. The study was conducted in compliance with the principles of the Declaration of Helsinki and was approved by Research Ethics Committee of the “Nicolae Testemit, anu” State University of Medicine and Pharmacy. For the analysis of the investigative results were using the Microsoft Excel spreadsheet program (Microsoft Office 2013), was created a database where was entered the information from the children’s clinical observation sheets. The data analysis was carried

454

A. Spinei et al.

out with the application of Microsoft Excel and Epi Info software, their functions and modules. The statistical processing of the research results included the calculation of the rates, the results of the dosing of markers homeostasis Ca, the average values of the prevalence indices of DC and EH, the intensity indices of DC in the temporary dentition (dft, dfs) and in the permanent dentition (DMFT, DMFS). The veracity of the indicators was determined by calculating the standard deviations. The statistical processing of the results included operative methods of statistical evaluation, including the Student criterion with the establishment of the level of significance “p < 0.05” etc. Correlation indicators were used to determine the link between clinical signs of EH and DC and the results of laboratory investigations. The correlation analysis between continuous variables was carried out by determining the Pearson correlation coefficients (in cases when the variables were approximately normally distributed) and respectively Spearman (for cases when the variables are not normally distributed or are ordinal) and the 95% confidence interval for the coefficient of correlation.

3 Results and Discussion The analysis of assessment the results of oral health status detected a different level of damage by EH and DC in the children of the research (L1 and L2 ) and control (L0 ) groups. 100% of the children in the L1 group were diagnosed with EH. In 39.02% of children with EH, the presence of carious lesions was detected. Indices of DC intensity for affected teeth (dft) 4.59 ± 2.16 and tooth surfaces affected by DC (dfs) 7.38 ± 3.22. Intensity of damage by DC in the permanent dentition was 3.94 ± 2.18 for affected teeth and 7.98 ± 3.53 for dental surfaces (DMFS) affected by DC. Dental caries was detected in all subjects in group L2 , prevalence index of DC: PI L2 = 100%. Intensity indices of DC in the temporary dentition for the affected teeth dft = 3.26 ± 1.23 and the affected surfaces dfs = 6.59 ± 1.41. The damage of DMFT was 3.76 ± 2.11, and the damage to the DMFS 7.01 ± 2.34. Were not detected clinical signs of EH in the children from the L2 group. EH and DC damage were not detected in control subjects (L0 ). The analysis of the content of calcium (total Ca), phosphates (Pi) and magnesium (Mg) in blood serum detected significant differences between these indicators in children from the research groups (L1 and L2 ) and the control group (L0 ), in which the mentioned markers had was within physiological limits (Ca = 2.32 ± 0.008 mmol/L, Pi = 1.37 ± 0.003 mmol/L, Mg = 0.74 ± 0.003 mmol/L). In the majority of children with EH and DC, a disorder of phosphocalcium metabolism was detected, characterized by a statistically significant decrease in Ca level (L1 = 2.03 ± 0.01 mmol/L, p < 0.001 and L2 = 2.14 ± 0.25 mmol/L, p < 0.001) in relation to L0 , being below the normal limits (Ca: N = 2.2 - 2.75 mmol/L). In the blood serum of children with EH (group L1 ), the relative decrease of Pi level up to 1.21 ± 0.11 mmol/L, p < 0.001) and Mg up to 0.63 ± 0.14 mmol/L was found, p < 0.001, compared to conventionally healthy subjects (L0 ). In children with DC (group L2 ), was found the same trend of decreasing Pi level up to 1.28 ± 0.16 mmol/L, p < 0.01 and Mg up to 0.61 ± 0.14 mmol/L, p < 0.001), compared to conventionally healthy subjects (L0 ). In the OF of the children from the research groups, simultaneously with the reduction of the content of Ca, Pi and Mg in the blood serum was detected a significant decrease

The Relationship Between Dental Caries Damage, Tooth Enamel Hypoplasia

455

in the level of Ca in the OF of the subjects from L1 (0.84 ± 0.26 mmol/L, p < 0.001) and L2 (0.91 ± 0.12 mmol/L, p < 0.01), compared to L0 (1.41 ± 0.005 mmol/L), being an important risk factor in the appearance of new carious cavities, especially at the posteruptive mineralization stage of the teeth. Studying the Pi content in OF in children with EH and carious lesions, was detected a statistically significant decrease in HPO42− , H2PO4− anions up to 1.46 ± 0.23 mmol/L, p < 0.01 in L1 and 1.93 ± 0.47 mmol/L, p < 0.1, in contrast to healthy children which the Pi level in the OF was within the norm, constituting 2.33 ± 0.029 mmol/L. In the children from the research groups, was established a significant decrease of the Ca/Pi ratio in the OF (1:1.21 ± 0.03, p < 0.001 in L1 and 1:1.32 ± 0.26, p < 0.1 in L2 ), compared to the control group (1:1.64 ± 0.024). The lowest values of Ca/Pi ratio in OF (1:1.10 ± 0.17) were detected in children with EH associated with DC, including ECC and extensive areas of tooth enamel demineralization, located on symmetrical tooth surfaces or those considered cario-resistant. According to the results of several studies, the reduction of the Ca/Pi ratio below 1:1.52 constitutes an unfavorable prognostic factor of the evolution of DC, caused by the disturbance of the tooth enamel remineralization process [23–25]. Since the Ca/Pi ratio was lower in children with EH, we believe that this fact could be the consequence of the disturbance of Ca homeostasis, during the formation of the enamel matrix (secretion phase), but also during the period of tooth enamel mineralization (maturation phase). Since one of the most important mechanisms that determine both the formation of EH and the initiation of DC, could be the disturbance of the mineralization process of dental hard tissues, we considered it necessary to compare the level of hormones and regulators of Ca homeostasis in children with EH and DC and in conventionally healthy ones. The obtained results reflect a statistically significant difference in the level of vitamin D3 and PTH in the blood serum of the children in the research groups, compared to the control group. In the blood serum of the children in the research groups, was detected the disorder of the blood level of hormones and regulators of phosphocalcium metabolism: the decrease in the level of vitamin D and the increase in the level of PTH. The level of vitamin D3 in blood serum in children with EH was 37.71 ± 0.66 ng/mL, p < 0.001 and in subjects with DC 41 ± 0.22 ng/mL, p < 0.01 in L2 ), to difference from the level of vitamin D within the limits of the age norm estimated in healthy children (50.79 ± 0.339 ng/mL). The increased level of PTH was detected in the blood serum of children with EH (53.14 ± 0.28, p < 0.001) and rampant DC (47.03 ± 0.16, p < 0.5), of 1.39 and respectively 1.23 times higher compared to conventionally healthy children (38.17 ± 0.16), which could be caused by vitamin D3 deficiency. Vitamin D3 deficiency is a trigger for mineral and bone metabolism disorder, described by several researchers. According to studies by Vera V., et al., 2015, the bestknown function of vitamin D is to maintain Ca and Pi homeostasis in the body and support the bone mineralization process [28]. The main effect of 25-hydroxycholecalciferol is to stimulate the transport of Ca from the lumen of the small intestine into the blood circulation, thereby increasing the serum concentration of this element. Since adequate concentrations of Ca and Pi influence osteoid mineralization, severe deficiency of vitamin

456

A. Spinei et al.

D3 and its active forms causes insufficient mineralization resulting in the development of rickets in children and osteomalacia in adults [29]. Increased PTH is an indicator of severe disorders of mineral and bone metabolism, secondary hyperparathyroidism being a compensatory reaction of the parathyroid glands following prolonged hypocalcemia. Long-term deregulation of calcium homeostasis leads to its mobilization from bone stores, which causes the osteopenia syndrome [28]. Hormones that regulate Ca metabolism and vitamin D3 directly and indirectly influence Ca transport in cells, including bone [29]. The degree of assimilation of calcium in the bone tissue and incorporation in the dental hard tissues is dependent on the availability of Pi, necessary not only for their mineralization, but also for the normal functioning of the mitochondria, and the sufficient supply of Ca and Pi in the dental enamel prevents the carious process even at the enamel demineralization stage [31–33]. Thus, the early disorders of the growth process and the deregulation of phosphocalcium metabolism could influence the susceptibility to DC, but also the occurrence of EH, as well as the association of EH with ECC. The results of our studies are consistent with those of other researchers who detected in children with hereditary and congenital pathology the deregulation of Ca metabolism [24, 34]. The results of this study confirm the data obtained by us in previous works [31, 32, 34–36], but also detected by several authors [37–40].

4 Conclusions As a result of the present study, it was established that the deficiency of vitamin D3 and its active forms cause the disturbance of Ca homeostasis, followed by secondary hyperparathyroidism, which could be a compensatory reaction of the parathyroid glands following hypocalcemia. We assume that the early disturbance of Ca homeostasis is one of the factors associated with the formation of EH, increases the susceptibility to DC, but also determines the association of EH with ECC. Thus, vitamin D3 deficiency and increased PTH production can be used as markers (from blood serum) in the disturbance of Ca homeostasis, the onset of EH, increased susceptibility to DC and rampant DC development. At the same time, the decrease of the Ca/Pi ratio in OF below 1:1.2 constitutes a prognostic factor of the very rapid evolution of DC, including ECC, caused by the disturbance of the tooth enamel remineralization process. The detection of important risk factors for the formation of EH and the rampant evolution of DC requires a complex approach in the planning of measures to prevent DC and EH, which in the framework of complex and personalized preventive care, in addition to local methods of prophylaxis, should include the administration of medication for balancing Ca homeostasis at the local level (in the OF) and at the systemic level.

References 1. Olczak-Kowalczyk, D., Krämer, N., Gozdowski, D., Turska-Szybka, A.: Developmental enamel defects and their relationship with caries in adolescents aged 18 years. Sci. Rep. 1(13), 4932 (2023). https://doi.org/10.1038/s41598-023-31717-2

The Relationship Between Dental Caries Damage, Tooth Enamel Hypoplasia

457

2. Seow, W.: Developmental defects of enamel and dentine. Challenges for basic science research and clinical management. Aust. Dent. J. 1(59), 143–154 (2014). https://doi.org/10.1111/adj. 12104 3. Garg, N., Jain, A.K., Saha, S., Singh, J.: Essentiality of early diagnosis of molar incisor hypomineralization in children and review of its clinical presentation, etiology and management. Int. J. Clin. Pediatr. Dent. 5(3), 190–196 (2012). https://doi.org/10.5005/jp-journals10005-1164 4. Olczak-Kowalczyk, D., Turska-Szybka, A., Gozdowski, D., Kaczmarek, U.: Developmental defects of enamel in the population of Polish adolescents aged 18 years old: the prevalence and selected socio-demographic factors. A cross-sectional study. Nowa Stomatol. 2(23), 47–54 (2018). https://doi.org/10.25121/NS.2018.23.2.47 5. Vargas-Ferreira, F., Zeng, J., Thomson, W.M., Peres, M.A., Demarco, F.F.: Association between developmental defects of enamel and dental caries in schoolchildren. J. Dent. 5(42), 540–546 (2014). https://doi.org/10.1016/j.jdent.2014.02.010 6. Vargas-Ferreira, F., et al.: Association between developmental defects of enamel and dental caries: a systematic review and metaanalysis. J. Dent. 6(43), 619–628 (2015). https://doi.org/ 10.1016/j.jdent.2015.03.011 7. Nota, A., Palumbo, L., Pantaleo, G., Gherlone, E., Tecco, S.: Developmental enamel defects (DDE) and their association with oral health, preventive procedures, and children’s psychosocial attitudes towards home oral hygiene: a cross-sectional study. Int. J. Environ. Res. Public Health 11(17), 4025 (2020). https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7311990 8. Fotedar, S., Sogi, G., Sharma, K.: Enamel hypoplasia and its correlation with dental caries in 12 and 5 years old school children in Shimla, India. J. Indian Assoc. Public Health Dent. 1(12), 18–22 (2014). https://doi.org/10.4103/2319-5932.138902 9. Idicula, J., Brave, V., Puranik, R., Vanaki, S.: Enamel hypoplasia and its correlation with dental caries in school children of Bagalkot, Karnataka. J. Oral Health Commun. Dent. 1(5), 31–36 (2011). https://doi.org/10.5005/johcd-5-1-31 10. Daneshkazemi, A., Davari, A.: Assessment of DMFT and enamel hypoplasia among junior high school children in Iran. J. Contemp. Dent. Pract 4(6), 1–7 (2005). https://doi.org/10. 5005/jcdp-6-4-85 11. Seow, W., Ford, D., Kazoullis, S., Newman, B., Holcombe, T.: Comparison of enamel defects in the primary and permanent dentitions of children from a low-fuoride District in Australia. Pediatr. Dent 3(33), 207–212 (2011). PMID: 21703072 12. Dini, E.L., Holt, R.D., Bedi, R.: Prevalence of caries and developmental defects of enamel in 9–10 year old children living in areas in Brazil with differing water fluoride histories. Br. Dent. J. 3(188), 146–149 (2000). https://doi.org/10.1038/sj.bdj.4800416 13. Oliveira, A., Chaves, A., Rosenblatt, A.: The influence of enamel defects on the development of early childhood caries in a population with low socioeconomic status: a longitudinal study. Caries Res. 4(40), 296–302 (2006). https://doi.org/10.1159/000093188 14. Caufield, P., Li, Y., Bromage, T.: Hypoplasia-associated severe early childhood caries–a proposed definition. J. Dent. Res. 6(91), 544–550 (2012). https://doi.org/10.1177/002203451244 4929 15. Batina, N., et al.: Ultrastructure of dental enamel affected with hypoplasia: an atomic force microscopic study. Calcif. Tissue Int. 3(74), 294–301 (2004). https://doi.org/10.1007/s00223002-1045-2 16. Casanova-Rosado, A.J., et al.: Association between developmental enamel defects in the primary and permanent dentitions. Eur. J. Paediatr. Dent. 3(12), 155–158 (2011). PMID: 22077681 17. Kühnisch, J., et al.: Relationship between caries experience and demarcated hypomineralised lesions (including MIH) in the permanent dentition of 15-year-olds. Clin. Oral Investig. 5(22), 2013–2019 (2018). https://doi.org/10.1007/s00784-017-2299-4

458

A. Spinei et al.

18. Salanitri, S., Seow, W.K.: Developmental enamel defects in the primary dentition: aetiology and clinical management. Aust. Dent. J. 2(58), 133–140 (2013). https://doi.org/10.1111/adj. 12039 19. Hubbard, M.J.: Calcium transport across the dental enamel epithelium. Crit. Rev. Oral. Biol. Med. 4(11), 437–466 (2000). https://doi.org/10.1177/10454411000110040401 20. Lacruz, R.S., Habelitz, S., Wright, J.T., Paine, M.L.: Dental enamel formation and implications for oral health and disease. Physiol. Rev. 3(97) 939–993 (2017). https://doi.org/10.1152/phy srev.00030.2016 21. Merheb, R., et al.: Neonatal serum phosphorus levels and enamel defects in very low birth weight infants. JPEN J. Parenter Enteral. Nutr. 6(40), 835–841 (2016). https://doi.org/10. 1177/0148607115573999 22. Sabel, N., et al.: Elemental composition of normal primary tooth enamel analyzed with XRMA and SIMS. Swed. Dent. J. 2(33), 75–83 (2009). PMID: 19728579 23. Sabel, N., Klinberg, G., Nietzsche, S., Robertson, A., Odelius, H., Noren, J.G.: Analysis of some elements in primary enamel during postnatal mineralization. Swed. Dent. J. 2(33), 85–95 (2009). PMID: 19728580 24. Reed, S.G., Miller, C.S., Wagner, C.L., Hollis, B.W., Lawson, A.B.: Toward preventing enamel hypoplasia: modeling maternal and neonatal biomarkers of human calcium homeostasis. Caries Res. 1(54), 55–67 (2020). https://doi.org/10.1159/000502793 25. Spinei, A., Balteanu, O., Plamadeala, A., Hristea, E., Spinei, I., Tagadiuc, O.: Relationship between dental caries and phosphocalcic metabolism in children with severe central nervous system diseases caused by perinatal hypoxia. J. Stomatol. Med. 1(61), 67–83 (2022). https:// doi.org/10.53530/1857-1328.22.61.09 26. Petersen, P.E., Baez, R.J.: Oral Health Surveys: Basic Methods, 5th edn. World Health Organization, Geneva (2013) 27. Bratthall, D., Hänsel Petersson, G.: Cariogram - multifactorial risk assessment model for multifactorial disease. Commun. Dent. Oral Epidemiol. 4(33), 256–264 (2005). https://doi. org/10.1111/j.1600-0528.2005.00233.x 28. Vera, V., et al.: Greater calcium intake is associated with better bone health measured by quantitative ultrasound of the phalanges in pediatric patients treated with anticonvulsant drugs. Nutrients 7(12), 9908–9917 (2015). https://doi.org/10.3390/nu7125517 29. Tarannum, Ravichandra, K.S., Muppa, R., Srikanth, K., Kantipudi, M.J., Ram, K.C.: Molar incisor hypomineralization prevalence in the school children of Gannavaram Mandal, Krishna District, Andhra Pradesh, India: a cross-sectional study. Int. J. Clin. Pediatr. Dent. 6(14), 737–740 (2021). https://doi.org/10.5005/jp-journals-10005-2097 30. Sun, J., et al.: AS-605240 blunts osteoporosis by inhibition of bone resorption. Drug Des. Devel. Ther. 17, 1275–1288 (2023). https://doi.org/10.2147/DDDT.S403231 31. Spinei, A., Picos, A., Romanciuc, I., Picos, A., Spinei, I.: Particularities of the chemical composition of dental enamel in children with neuromotor disabilities and gastro-esophageal reflux disease. HVM Bioflux 4(6), 214–221 (2014) 32. Spinei, A., Lupan, I., Spinei, I., Balteanu, O.: Characteristics of structural and chemical composition of dental enamel in children with severe neuromotor disabilities. In: E-Health and Bioengineering Conference (EHB) 2013, Iasi, Romania, pp. 1–4. IEEE (2013). https:// doi.org/10.1109/EHB.2013.6707410 33. Elger, W., et al.: Relationship between deciduous molar hypomineralisation and parameters of bone metabolism in preschool children. Int. Dent. J. 4(20), 303–307 (2020). https://doi. org/10.1111/idj.12550 34. Spinei, A., Spinei, I.: The impact of dental diseases on quality of life of children with neuromotor disabilities. Archives of the Balkan Medical Union. Off. J. Balkan Med. Union 3(48), 159–161 (2013)

The Relationship Between Dental Caries Damage, Tooth Enamel Hypoplasia

459

35. Spinei, A., Picos, A.M., Nicoara, P., Picos, A., Spinei, I.: Changes of the tooth enamel following the application of a new prevention method in children suffering from cerebral palsy and gastro-esophageal reflux disease. HVM Bioflux 4(6), 191–197 (2014) 36. Spinei, A., Picos, A.M., Romanciuc, I., Berar, A., Mihailescu, A.M.: The study of oral liquid microcrystallization in children with gastro-esophageal reflux disease. Clujul Med. 4(84), 269–276 (2014). https://doi.org/10.15386/cjmed-387 37. Vélez-León, E., et al.: Developmental enamel defects in children from the Southern Region of Ecuador. Children (Basel) 9(11), 1755 (2022). https://doi.org/10.3390/children9111755 38. Hong, L., Levy, S.M., Warren, J.J., Broffitt, B.: Association between enamel hypoplasia and dental caries in primary second molars: a cohort study. Caries Res. 5(43), 345–353 (2009). https://doi.org/10.1159/000231571 39. Ribeiro, I. M., et al.: Evaluation of vitamin D receptor genetic polymorphisms with dental caries and developmental defects of enamel in Brazilian children. Pediatr. Dent. J. 3(30), 161–166 (2020). https://doi.org/10.1016/j.pdj.2020.06.003. https://www.sciencedirect.com/ science/article/pii/S0917239420300343 40. Popescu, M., et al.: Etiology study of acquired developmental defects of enamel and their association with dental caries in children between 3 and 19 years old from Dolj County, Romania. Children (Basel) 9(9), 1386 (2022). https://doi.org/10.3390/children9091386

Impact of Tumor Necrosis Factor Alfa on Dental Caries Development in Children with Severe SNC Disorders Aurelia Spinei(B)

, Svetlana Plamadeala , Olga Balteanu , Elena Hristea , and Iurie Spinei

Nicolae Testemitanu State University of Medicine and Pharmacy of the Republic of Moldova, Chis, in˘au, Moldova [email protected]

Abstract. The aim of the present study was to perform a comparative evaluation of TNF-α level in saliva and blood serum at children with severe disorders of the central nervous system (CNS) and conventionally healthy children in order to highlight the role of TNF-α in the initiation and development of dental caries. To assess the degree of the dental caries (DC) development were clinically examined 1272 children aged between 1 and 18 years. The study included 636 children with severe CNS disorders, which constituted the research group (L1 ) and 636 conditionally healthy children formed the control group (L0 ). The concentration of TNF-α in the oral fluid (OF) and blood serum was estimated in 212 children randomly selected from both groups. In children with severe CNS diseases TNF-α concentration in saliva is 5.53 times higher, and in blood serum it is 10.19 times higher compared to healthy children. In children with severe CNS diseases there was revealed a strong inverse relationship between TNF-α concentration in saliva and blood serum and the chances of avoiding new caries development, as opposed to the inverse average relationship estimated in healthy children. Excess TNFα production, both locally and systemically influenced increased caries risk and dental caries morbidity in children with severe CNS diseases, which is necessary to consider when planning individualized prevention measures. Keywords: Dental Caries · TNF-α · Children · Severe Disorders · Central Nervous System

1 Introduction The role of immunological factors in dental caries (DC) pathogenesis has been mentioned by a number of authors [1–5], being mentioned the relation between the impairment of nonspecific and/or specific immunity factors, and the intensity of the caries process [6–8]. Cytokines are mediators of cellular interactions which, by binding to specific membrane receptors [9–11], trigger intracellularly a series of events, acting upon the nucleus, regulating the defense reactions of the body and maintaining homeostasis in case of © The Author(s), under exclusive license to Springer Nature Switzerland AG 2024 V. Sontea et al. (Eds.): ICNBME 2023, IFMBE Proceedings 92, pp. 460–470, 2024. https://doi.org/10.1007/978-3-031-42782-4_49

Impact of Tumor Necrosis Factor Alfa on Dental Caries Development

461

pathogen aggressiveness [10], as well as influencing thermal metabolism, cicatrization phenomena, cell growth, homeostasis and immune activity [12], bone resorption and synthesis [13–15]. TNF-α (cachectin) was initially described having both cytostatic and cytotoxic effects on certain tumor cells, and is currently recognized as a pro-inflammatory cytokine with biological pleiotropic capacities [16, 17], being mainly produced by macrophages and T-cells [18–20]. It has been shown that TNF-α triggers both the inflammation and inflammatory response, being involved in both the defense response of the host-body and certain immunoregulatory activities. Moreover, TNF-α is one of cytokines considered the key mediators of acute inflammation [18, 21]. TNF-α is an effector cytokine and its production can cause various diseases of the oral cavity [16, 19]. At the same time, the role of this cytokine in the pathogenesis of DC is not well known. Tani-Ischii et al., 1999, have shown that TNF-α, which is produced locally by osteoclasts, is an important factor in the differentiation and regulation of these cells, participating in bone resorption processes [22]. According to Kurtis B., et al., 2005, increased levels of TNF-α in patients with tooth decay reduces the number of fibroblasts and osteoblasts and are involved in enamel demineralization and caries development [23]. Horst O.V. et al., 2009, confirmed by clinical studies that odontoblasts cells initiate immunological reactions in teeth affected by caries, producing proinflammatory cytokines and IL-1β, IL-1α, TNF-α signaling chemokines [12]. The results of the study carried out by Gornowicz A., et al., 2012, suggest increased production of pro-inflammatory salivary cytokines, including TNF-α, in patients with DC [10]. A high level of caries development has been established at children with intellectual disabilities in studies performed by several authors. The immune system, together with the central nervous system (CNS), are the most important systems of integration, responsible for maintaining body homeostasis and vitality in children under various conditions of the environment. There are not data on TNF-a concentration in saliva and blood serum at children with severe diseases of the CNS and DC. Therefore, assessment of TNF-a in saliva and blood serum at children with severe diseases of the CNS will allow to highlight some aspects of previously unexplored pathogenesis of DC. Objective: to perform a comparative evaluation of TNF-α level in saliva and blood serum at children with severe disorders of the central nervous system (CNS) and conventionally healthy children in order to highlight the role of TNF-α on the initiation and development of dental caries.

2 Materials and Methods The study was conducted at State University of Medicine and Pharmacy “Nicolae Testemitanu”. To assess the degree DC development there were clinically examined 1272 children aged between 1 and 18 years. The study included 636 children with severe CNS disorders, which constituted the research group (L1 ) and 636 conditionally healthy children formed the control group (L0 ). There were calculated the indices of prevalence of dental caries (IP) and indices of carious experience: dft and DMFT. The degree of caries activity was assessed by the method proposed by Leous P. and Tikhonova S., 2006, taking into account the dft and DMFT indices and children‘s age [24]. Prediction of DC

462

A. Spinei et al.

and complex assessment of caries risk was carried out applying Software Cariogram [25]. The potential of oral fluid (OF) mineralization – OF microcrystallization (MC) was assessed using the method proposed by P. Leous P., 1977, cited by Martusevich A.K., Kamakin N.F., 2007 [26]. In this study, we performed a comparative analysis of the crystallographic modifications of the OF at children with and without decay. OF was collected with a sterile pipette in the amount of 0.2 to 0.3 ml of the oral cavity floor. Then, on a glass slide, pre-treated with alcohol and ether, three drops of were applied. The dehydration of the saliva drops was produced into the unit at t = 37 °C, protected from dust. Micropreparations were examined under AmScope B120C-E1, Binocular Compound Microscope. Using microcrystalograms (MCG) and saliva research methods the central and peripheral areas of saliva facies were investigated. Were analyzed fractal structures, separate crystals and amorphous substance. Interpretation of crystaloscopic components was achieved by applying special tables with notification of characteristics of the studied structures [27]. The concentration of TNF-α in OF and blood serum was estimated at 212 children randomly selected from both groups. TNF-α levels were determined by enzyme immunoassay on solid support, using OOO Vectior-Best reagents (Russia) and in accordance with manufacturer’s recommendations. The study was approved by the Research Ethics Committee of State University of Medicine and Pharmacy “Nicolae Testemitanu” and conducted in accordance with ethical requirements, being evidenced by the written consent of children‘s parents or their legal representatives. Descriptive statistical data analysis was performed using parametric and nonparametric tests, applying Microsoft® Excel® 2013 and Epi Info Software, by program functions and modules.

3 Results and Discussion All subjects studied are natives and residents in the Republic of Moldova. The research and reference lots showed a comparable structure by sex, age, living environment and socio-economic conditions. Children in the research group were diagnosed with severe CNS disorders associated with delayed mental development: moderate mental retardation (MR) was found in 24.84 ± 1.71% of children, severe MR - in 35.53 ± 1.9% and deep MR - in 39.63 ± 1.94%. Thus, 48.12 ± 1.98% of children suffer from infantile cerebral palsy (ICP), 21.38 ± 1.63% of children suffer from epilepsy or convulsive syndrome. Congenital CNS diseases associated with MR (hydrocephalus, microcephaly, encephalopathy, myopathy, etc.) were identified in 14.78 ± 1.4% of children. Down‘s syndrome was diagnosed in 15.72 ± 1.44% of children. Of the total number of children in the research group, most - 439 (69.03 ± 1.83%) children suffer from a severe degree of disability and 197 (30.97 ± 1.83%) children have marked disabilities. Multiple disabilities were found in most children (84.59 ± 1.43%), they being associated with some deficiencies, namely: motor (69.18 ± 1.83%), hearing and speech deficiencies (49.69 ± 1.98%) and visual ones (47.8 ± 1.98%). Indicators of DC morbidity in children from the research and control groups differ significantly. DC was detected in 57.86 ± 1.96% of children with severe CNS diseases,

Impact of Tumor Necrosis Factor Alfa on Dental Caries Development

463

and in practically healthy children respectively 46.86 ± 1.98 (p < 0.001). Children in lot L1 were estimated statistically significantly increased values of the indicators that reflect caries experience in both permanent (p < 0.001) and mixed dentition (p < 0.001): DMFT = 2.01 ± 0.12, DMFT + dft = 5.57 ± 0.16, compared to the values of the same indicators assessed in children in group L0 (DMFT = 0.84 ± 0.06 and DMFT + dft = 2.46 ± 0.13). However, were not observed statistically significant differences between the values of caries experience index in temporary dentition at children in the research lot (dft = 1.84 ± 0.1) and control lot (dft = 1.82 ± 0.1, p > 0.05). The probability of avoiding the development of new cavities at children with severe CNS diseases was reduced (34.2 ± 0.95%) as opposed to 63.82 ± 0.73% in healthy children (t = 11.0668, p < 0.001). The risk of DC development at children with disabilities was 1.87 times higher compared with healthy children. Analysing dft, DMFT indices as well as DMFT + dft, and children‘s age, there were estimated the following degrees of caries activity: reduced caries activity - in 28.77 ± 1.79% in L1 and 29,25 ± 1,8% in L0 (p < 0,01), but moderate and intense caries activity in 29,09 ± 1,8% in L1 and 17,61 ± 1,51% (p < 0,001). The result of the investigation specified the main types of OF microcrystallization (MC). For the type of MC presence of large prismatic crystal structures form merger with “fern” is characteristic. For quantitative data objectification, MC type I was assessed by 5 points. Fused random fractal structures are characteristic of type II MC, gaining 4 points. In type III MC, in the central part star-shaped separated crystals were present, and remained at the periphery of larger fractal crystals (3 points). MC Type IV was characterized by the presence of the separated crystals in the form of a branch or stem, placed relatively evenly over the whole surface of the dried droplet (2 points). A large amount of separated stellate crystals of an oval and irregular shape located isometrically was characteristic of MC type V (1 point). In case of a complete lack of crystals was found the MC type VI (0 points). It was found that the degree of saliva MC in children with severe disorders of CNS was considerably reduced, constituting 3.26 ± 0.094 points, and was 1.39 times lower compared to the indicator considered in healthy children (4.52 ± 0.053, p < 0.001). The enzyme immunoassay found statistically significant differences in the level of TNF-α in saliva and blood serum of children in the research and control groups (p < 0.001). The concentration of TNF-α in saliva in children with severe CNS diseases is 5.53 times higher, while in blood serum it is 10.19 times higher compared to healthy subjects. The highest level of TNF-α was estimated in saliva and blood serum of children with severe CNS diseases caused by perinatal hypoxia (epilepsy or multiple associated disabilities with convulsive syndrome, including ICP). The concentration of TNF-α in saliva (8.54 ± 0.09 pg/mL) and blood serum (1.86 ± 0.07 pg/mL) in healthy children (L0 ) with low caries activity is comparable to the level of TNF-α estimated in saliva (3.96 ± 0.04 pg/mL, p < 0.001) and blood serum (1.53 ± 0.04 pg/mL, p < 0.001) of caries-free children. A moderate increase of TNF-α in saliva (10.87 ± 0.57 pg/mL, p < 0.001) and blood serum (2.28 ± 0.09 pg/mL, p < 0.001) was identified at children with moderate and intense caries activity. In children with psychosomatic diseases, as the degree of caries activity is increasing, the concentration of TNF-α in saliva (29.2 ± 0.25 pg/mL, p < 0.001) and blood serum (16.82 ± 0.09 pg/mL,

464

A. Spinei et al.

p < 0.001) is significantly increasing too. Most of these children (98.38 ± 0.93%) did not receive dental treatment, and 76.22 ± 3.13% had complications associated with DC and foci of chronic odontogenic infection. In children with severe CNS diseases a strong direct relationship was established between DMFT index and TNF-α level in saliva (r = 0.92, p < 0.001, n = 212), and between DMFT index and TNF-α level in blood serum (r = 0.95, p < 0.001, n = 212). On the contrary, in practically healthy children we found an average correlation between DMFT index and TNF-α level in saliva (r = 0.46, p < 0.001, n = 212), and between DMFT index and TNF-α levels in blood serum (r = 0.41, p < 0.001, n = 212). However, TNF-α concentration is higher by 6.91 times in saliva and by 10.25 times in blood serum at children with severe CNS diseases who are caries-free compared with healthy children. Thus, in caries-free children in the research group (L1 ) the TNF-α concentration in saliva is 29.47 ± 0.3 pg/mL, p < 0.05, and 16.68 ± 0.11 pg/mL, p < 0.001 in blood serum, compared with children in the control group where the level of TNF-α in saliva is 4.44 ± 0.17 pg/mL, p < 0.05, and 1.9 ± 0.05 pg/mL, p < 0.001 in serum. To identify the causes of this phenomenon we studied the connection between TNF-α concentration in saliva and blood serum, and the number of Streptococcus mutans in saliva. Thus, in saliva of children with ≥ 105 CFU/l of Streptococcus mutans, TNF-α is significantly increased: 30.95 ± 0.42 pg/mL, p < 0.001 in the research group (L1 ) and 10.53 ± 0.62 in the control group (L0 ), and in blood serum respectively 17.89 ± 0.1 pg/mL, at children with CNS diseases p < 0.001 and 2.2 ± 0.09 at conventionally healthy children. In addition, was found a strong relationship between TNF-α concentration in OF (r = 0.89, p < 0.001) and number of Streptococcus mutans at children with severe CNS diseases, in contrast to a weak relationship estimated at children in the control group (r = 0.21, p < 0.01). The same trend was observed analysing the correlation between cytokine concentration in blood serum and the number of Streptococcus mutans in saliva (r = 0.61, p < 0.01) at children in L1 (r = 0.34, p < 0.01) and L0 . Due to the fact that several conflicting data on the relationship between TNF-a concentration and degree of enamel mineralization are reported in the literature, we considered appropriate the study of the relationship between TNF-α concentration in saliva, blood serum and degree of saliva MC and chances of avoiding new caries development (evaluated by Software Cariogram). Thus, an inverse relationship between TNF-a concentration in blood serum (r = -0.831, p < 0.001, n = 212) and saliva (r = -0.787 p < 0.001, n = 212) and degree of saliva MC was revealed at children in the research group. In contrast to children in L1 , the subjects in L0 we found the relationship between TNF-a concentration in blood serum and degree of saliva MC of r = -0.477, p < 0.001, n = 212, and between the level of TNF-a in saliva and degree of saliva MC r = -0.837, p < 0.001, n = 212. In children with CNS diseases there was found a strong inverse relationship between TNF-α concentration in blood serum and the chance of avoiding caries development (r = -0.87, p < 0.001, n = 212), as opposed to the average inverse relationship estimated in conventionally healthy children (r = -0.402, p < 0.01, n = 212). TNF-α level in saliva is in average correlation (r = -0.566, p < 0.001, n = 212) with chances of avoiding new

Impact of Tumor Necrosis Factor Alfa on Dental Caries Development

465

caries development at children in L1 and poor correlation at children in L0 (r = -0.349, p < 0.001, n = 212). In our previous researches on children with severe CNS diseases we detected poor oral hygiene and increased Streptococcus mutans level concentration of Streptococcus mutans in OF compared with conditionally healthy children [28]. Moreover, we established an extremely high caries risk at children with mental disabilities and reduced potential of OF mineralization [27]., We determined structural enamel features at the molecular and macroscopic level at children with severe CNS diseases applying scanning electron microscope-SEM and IR spectroscopy being characterized by the presence of a considerable quantity of pores and microfissures on the (enamel) surface, increased concentration of CO3 2− ions located in B-type area, increased share of organic component in relation to mineral component and, respectively, decrease of the percentage of P, Ca, Cl, Mg, Na, and hydroxyapatite contents, increase in carbonate-apatite concentration with low peaks of phosphate and a significant increase in organic components. It was assumed that these structural features were caused by impaired mineralization during tooth formation and tooth posteruptive mineralization [29]. In addition, we established impaired cytokine profile in saliva and blood serum, characterized by statistically significant increase of levels of proinflammatory cytokines (TNF-α, IL-1β and IL-6) and a direct connection between their concentration and degree of caries activity [27, 30–32]. To highlight the role of TNF-α in the initiation and development of DC, the level of TNF-α in OF and blood serum was assessed at children with severe CNS diseases compared to conventionally healthy children, by enzyme immunoassay on solid support. Was detected a statistically significant increase in TNF-α levels in saliva and blood serum in children with severe CNS diseases. The highest levels of TNF-α in blood serum and saliva were estimated in children with epilepsy and multiple associated disabilities with convulsive syndrome, in premature children and/or children with perinatal hypoxia, including children with ICP. Our data are consistent with the study on pro-inflammatory immunocytokines in blood serum of children with various CNS disorders, including posthypoxic injury [31]. Lin Y. and Wen L., 2013, noted that increased TNF-α concentrations after a diffuse axonal impairment in head injury may cause secondary neuronal damage [33]. However, even proinflammatory cytokines, such as IL-1, IL-6 and TNF-α have both detrimental and beneficial effects on neuronal cells [34–36]. It is known that proinflammatory cytokines play an important role in pain modulation by interfering with nociceptive transduction (via free nerve endings originating in ganglia attached to sensitive fibers of spinal and cranial nerves), as well as pain conduction and transmission. This modulation may result from the transcriptional rate alteration and posttranslational modifications in proteins involved in pain pathway [37]. There was determined the relationship between the serum concentration of TNF-α, IL-1α, IL-2, IL-6 and the activity of nerve cells [34, 35]. Studies performed by Tanaka M, Toldi J, Vécsei L., 2020, Ahmad MA., 2022, confirmed the hypothesis that proinflammatory cytokines IL-1β and TNF-α are responsible for progressive deterioration of neurons in subjects with CNS diseases caused by hypoxia, and these mediators are important triggers of neuroprotective reactions after acute brain injury [38, 39].

466

A. Spinei et al.

Excessive production of TNFα in saliva and blood serum was recorded in children with psychosomatic diseases and DC, particularly in those with moderate and intense caries activity. Moreover, a strong direct relationship between DMFT index and TNF-α level in OF and blood serum is evidence that these cytokines may play a significant role in the rampant evolution of tooth decay or intense degree of caries activity. The significant increase in TNF-α levels in saliva of children not subjected to dental treatments may be explained by the immune response to infection foci. The latter are due to lack of adequate treatment at the early stages of evolution of caries process, and cases of complicated caries, actually a fact more frequently observed in children with mental disabilities compared to healthy subjects. Our findings are consistent with those presented by several authors who established a similar immune response in people with periapical lesions [1, 4, 6, 7, 13, 14, 19]. At the same time, increased level of TNF-α was detected in saliva and blood serum of children with severe CNS diseases caused by perinatal hypoxia, who were caries-free. This can be caused by poor oral hygiene and dental cariogenic biofilm accumulation. In saliva of children with Streptococcus mutans strains ≥ 105 CFU/mL, TNF-α level is significantly increased. Our results confirmed the assumptions exposed by Cogulu D. et al., 2015 concerning the influence of Streptococcus mutans on the dental biofilm and saliva on increased production of proinflammatory cytokines [11]. Another cause of increased concentration of proinflammatory cytokines in OF could be their transudation in blood serum. Imbalance of pro- and anti-inflammatory cytokines, including excessive production of TNF-α could be a cause of reduced resistance to DC. Proinflammatory cytokines, particularly TNF-α, are of particular importance in triggering chronic autoimmune inflammation, inducing production of inflammatory cytokines and mediators, involved in caries pathogenesis. TNF-α is known to possess a number of biological effects, namely: it enhances lipid peroxidation, stimulates the production of interferon-γ by T lymphocytes and apoptosis of oligodendrocytes, which produce myelin. Prso I. et al., 2007, mentioned that increased production of pro-inflammatory cytokines could exert either a beneficial or harmful efect, depending on the amount produced and the time in which their production is supported [40]. Chronic foci of odontogenic infection determine the expression of two pro-inflammatory cytokines IL-1β, TNF-α and IL-6, which play a key role in the release of mediators that stimulate bone resorption [1, 40, 41]. According to the research conducted by Milehina S., 2012 (cited by Spinei A., 2016), pro-inflammatory cytokines induce excessive production of matrix metalloproteinase-9, which is not adequately controlled by its type II tissue inhibitor, which enhances permeability and destroys tooth structures [31]. We would like to emphasize that children with severe CNS diseases caused by perinatal hypoxia had statistically significantly increased TNF-α concentration in saliva and blood serum (in children with epilepsy and multiple disabilities associated with convulsive syndrome, including ICP). It is known that TNF-α plays a key role in the release of mediators that stimulate bone resorption, stimulating local expression of RANKL factor (Receptor Activator of NFkB Ligand) and differentiation of osteoclast precursors [17, 20, 42]. It has been reported that TNF-α inhibits alkaline phosphatase activity and its

Impact of Tumor Necrosis Factor Alfa on Dental Caries Development

467

gene expression [31] [44]. Thus, one would expect that TNF-α level is directly correlated with a low enamel mineralization. It is well known that saliva is a supersaturated liquid with calcium and phosphate ions and possesses the ability of enamel mineralization. The saturated liquid state is provided by its structure, its entire volume being distributed among the micelles. Under physiological conditions, saliva crystals have a branched form due to the presence in the saliva of micelles Ca3 (PO4)2 , protected by the aggregation of mucin, which has a branched form. Mucins are involved in the transport of transepithelial ions (Na+ , K+ , Cl− ), and in the process of biocrystalization involving ions Ca2+ , constituting the organic matrix which regulates the volume and configuration of the crystal structure and the formation of crystalline structures in dendritic drying saliva [26]. The optical properties of the crystals vary significantly depending on exo- and endogenous factors, this phenomenon being applied in research, for diagnostic purposes. Under unfavourable changes, in the oral cavity the structure of saliva modifies, thereby its mineralization function is disturbed followed by changes in the shape and properties of the crystal structure [26, 27]. Thus, the morphological image changes of the saliva due to its microcrystallization properties is an index of qualitative or quantitative disorders of salivary proteins, in particular the mucins, and is one of the earliest markers of pathological processes occurring in the organism and may be used to detect diseases in the premorbid phase, to efficiently implement the preventive and minimally invasive treatment. Therefore, the saliva microcrystallization disorder reflects the quantitative and qualitative disorders of mucins composition, which represents an increased risk of carious lesions [26]. However, TNF-α influence on dental mineralization is not described in the literature. In our study we found that TNF-α content in saliva and blood serum is directly correlated with the degree of DC development, and inversely, with the degree of saliva mineralization, the chances of avoiding caries development being considerably reduced (estimated by Software Cariogram). Thus, increased TNF-α concentration in saliva and blood serum decreases the potential of saliva mineralization. One might assume that TNF-α not only affects tissue mineralization during pre-eruptive period, which has been previously assumed, but also reduces saliva mineralization, being one of TNF-α pleiotropic properties, which is not known enough. Thus, the study revealed that one of the causes of reduced resistance to tooth decay in children with severe CNS diseases caused by perinatal hypoxia could be excess TNF-α production, both locally and systemically. Assessment of TNF-α concentration in saliva and blood serum, along with other methods of DC prediction is an informative and important method in the early diagnosis of DC, as well as prediction of the intensity degree of caries activity. Data obtained argue the need for correction of dental caries prevention measures and treatment of DC in children with cytokine imbalance, especially - those with disabilities caused by perinatal hypoxia of the CNS.

4 Conclusions 1. In children with severe CNS diseases TNF-α concentration in saliva is 5.53 times higher, and in blood serum it is 10.19 times higher compared to healthy children.

468

A. Spinei et al.

2. There was established a strong direct relationship between DMFT index; number of Streptococcus mutans in dental biofilm and TNF-α level in saliva and blood serum of children with severe CNS diseases, in contrast to weak relationship estimated in infants in the control group. 3. In children with severe CNS diseases there was revealed a strong inverse relationship between TNF-α concentration in saliva and blood serum and the chances of avoiding new caries development, as opposed to the inverse average relationship estimated in healthy children. 4. Excess TNF-α production, both locally and systemically influenced increased caries risk and dental caries morbidity in children with severe CNS diseases, which is necessary to consider when planning individualized prevention measures.

Conflict of Interest. The authors declare that they have no conflict of interest.

References 1. Nagasawa, Y., et al.: Title IgA nephropathy and oral bacterial species related to dental caries and periodontitis. Int. J. Mol. Sci. 2(23), 725 (2022). https://doi.org/10.3390/ijms23020725 2. Nero, N.R., Diniz, D.R.: Immunological aspects related to diseases incident in dental practice: literature review. Revista Científica Multidisciplinar Núcleo do Conhecimento 10(15), 48–57 (2020). https://doi.org/10.32749/nucleodoconhecimento.com.br/dentistry/diseases 3. Babu, A.L., et al.: Immunology of dental caries. Biomed. Pharmacol. J. 2(9), 823–826 (2016). https://doi.org/10.13005/bpj/1009 4. Yang, Y., et al.: Comparison of immunological and microbiological characteristics in children and the elderly with or without dental caries. Eur. J. Oral Sci. 2(123), 80–87 (2015). https:// doi.org/10.1111/eos.12172 5. Galler, K.M., et al.: Inflammatory response mechanisms of the dentine-pulp complex and the periapical tissues. Int. J. Mol. Sci. 3(22), 1480 (2021). https://doi.org/10.3390/ijms22031480 6. Heigetyan, A., et al.: The immunologic indicators in patients with caries of contact surfaces of lateral teeth. Klin. Lab. Diagn. 8(60), 52–54 (2015) 7. Rinderknecht, C., et al.: Associations between salivary cytokines and oral health, age, and sex in healthy children. Sci. Rep. 1(12), 15991 (2022). https://doi.org/10.1038/s41598-02220475-2 8. Gornowicz, A., et al.: Pro-inflammatory cytokines in saliva of adolescents with dental caries disease. Ann. Agric. Environ. Med. 219, 711–716 (2012) 9. Tazawa, K., et al.: Revisiting the role of IL-1 signaling in the development of apical periodontitis. Front. Dent. Med. 3, 985558 (2022). https://doi.org/10.3389/fdmed.2022. 985558 10. Feng, Y., et al.: Role of Interleukin-17A in the Pathomechanisms of Periodontitis and related systemic chronic inflammatory diseases. Front. Immunol. 13, 862415 (2022). https://doi.org/ 10.3389/fimmu.2022.862415 11. Cogulu, D., et al.: Associations of interleukin (IL)-1β, IL-1 receptor antagonist, and IL-10 with dental caries. J. Oral Sci. 1(57), 31–36 (2015) 12. Horst, O.V., et al.: TGF-beta1 Inhibits TLR-mediated odontoblast responses to oral bacteria. J. Dent. Res. 88, 333–338 (2009). https://doi.org/10.1177/0022034509334846 13. Medara, N., et al.: A review of T helper 17 cell-related cytokines in serum and saliva in periodontitis. Cytokine 138, 155340 (2021). https://doi.org/10.1016/j.cyto.2020.155340

Impact of Tumor Necrosis Factor Alfa on Dental Caries Development

469

14. Gómez-García, A.P., et al.: Overexpression of proinflammatory cytokines in dental pulp tissue and distinct bacterial microbiota in carious teeth of Mexican Individuals. Front. Cell Infect. Microbiol. 12, 958722 (2022). https://doi.org/10.3389/fcimb.2022.958722 15. Paqué, P.N., et al.: Salivary biomarkers for dental caries detection and personalized monitoring. J. Pers. Med. 3(11), 235 (2021). https://doi.org/10.3390/jpm11030235 16. Antunes, L.A., et al.: Genetic polymorphisms in TNF-α as a potential biomarker for oral health-related quality of life in children. Braz. Oral Res. 2(36), e059 (2022). https://doi.org/ 10.1590/1807-3107bor-2022.vol36.0059 17. Kitaura, H., et al.: Osteocyte-related cytokines regulate osteoclast formation and bone resorption. Int. J. Mol. Sci. 14(21), 5169 (2020). https://doi.org/10.3390/ijms21145169 18. De Paepe, B., et al.: The tumor necrosis factor superfamily of cytokines in the inflammatory myopathies: potential targets for therapy. Clin. Dev. Immunol. Article ID 369462 (2012) 19. Kaczy´nski, T., et al.: Salivary interleukin 6, interleukin 8, interleukin 17A, and tumour necrosis factor α levels in patients with periodontitis and rheumatoid arthritis. Cent. Eur. J. Immunol. 3(44), 269–276 (2019). https://doi.org/10.5114/ceji.2019.89601 20. Kitaura, H., et al.: Role of the interaction of tumor necrosis factor-α and tumor necrosis factor receptors 1 and 2 in bone-related cells. Int. J. Mol. Sci. 3(23), 1481 (2022). https://doi.org/ 10.3390/ijms23031481 21. You, K., Gu, H., Yuan, Z., Xu, X.: Tumor necrosis factor alpha signaling and organogenesis. Front Cell Dev. Biol. 9(30), 727075 (2021). https://doi.org/10.3389/fcell.2021.727075 22. Tani-Ishii, N., et al.: Autocrine regulation of osteoclast formation and bone resorption by IL-1 alpha and TNF alpha. J. Dent. Res. 10(78), 1617–1623 (1999) 23. Kurtis, B., et al.: Gingival crevicular fluid levels of monocyte chemoattractant protein-1 and tumor necrosis factor-α in patients with chronic and aggressive periodontitis. J. Periodontol. 11(76), 1849–1855 (2005) 24. Leous, P., Tikhonova, S.: Caries risk assessment in young people based on the Cariogram. OHDMBSC 1(5), 7–11 (2006) 25. Bratthall, D., Hänsel Petersson, G.: Cariogram - multifactorial risk assessment model for multifactorial disease. Commun. Dent. Oral Epidemiol. 4(33), 256–264 (2005). https://doi. org/10.1111/j.1600-0528.2005.00233.x 26. Martusevich, A.K., Kamakin, N.F.: Crystallography of biological fluid as a method for evaluating its physicochemical characteristics. Bull. Exp. Biol. Med. 3(143), 385–388 (2007). https://doi.org/10.1007/s10517-007-0118-7 27. Spinei, A., et al.: The study of oral liquid microcrystallization in children with gastroesophageal reflux disease. Clujul Med. 4(84), 269–276 (2014). https://doi.org/10.15386/cjm ed-387 28. Spinei, A.: Impact of cytokine profile on dental caries morbidity in children with severe diseases of the central nervous system. Romanian J. Dent. Med. 3(19), 166–190 (2016) 29. Spinei, A., et al.: Particularities of the chemical composition of dental enamel in children with neuromotor disabilities and gastro-esophageal reflux disease. Human Vet. Med. Int. J. Bioflux Soc. 4(6), 214–221 (2014) 30. Spinei, A.: Salivary cytokines in disabled children with dental caries. Oral Health Dent. Manag. 4(15)(Suppl), 70 (2016). https://doi.org/10.4172/2247-2452.C1.034 31. Spinei, A., et al.: Relationship between dental caries and phosphocalcic metabolism in children with severe central nervous system diseases caused by perinatal hypoxia. J. Stomatol. Med. 1(61), 67–83 (2022). https://doi.org/10.53530/1857-1328.22.61.09 32. Lin, Y., Wen, L.: Inflammatory response following diffuse axonal injury. Int. J. Med. Sci. 10, 515–521 (2013). [PMC free article] [PubMed] 33. Wang, W.Y., et al.: Role of pro-inflammatory cytokines released from microglia in Alzheimer’s disease. Ann. Transl. Med. 3(10), 136 (2015). https://doi.org/10.3978/j.issn.2305-5839.2015. 03.49

470

A. Spinei et al.

34. Meyer-Arndt, L.,et al.: Inflammatory cytokines associated with multiple sclerosis directly induce alterations of neuronal cytoarchitecture in human neurons. J. Neuroimmune Pharmacol. (2023). https://doi.org/10.1007/s11481-023-10059-w 35. Borsini, A., et al.: Pro- and anti-inflammatory properties of interleukin in vitro: relevance for major depression and human hippocampal neurogenesis. Int. J. Neuropsychopharmacol. 11(23), 738–750 (2020). https://doi.org/10.1093/ijnp/pyaa055 36. De Jongh, R.F., et al.: The role of interleukin-6 in nociception and pain. Anesth. Analg. 4(96), 1096–1103 (2003) 37. Tanaka, M., Toldi, J., Vécsei, L.: Exploring the etiological links behind neurodegenerative diseases: inflammatory cytokines and bioactive kynurenines. Int. J. Mol. Sci. 7(21), 2431 (2020). https://doi.org/10.3390/ijms21072431 38. Ahmad, M.A., et al.: Neuroinflammation: a potential risk for dementia. Int. J. Mol. Sci. 2(23), 616 (2022). https://doi.org/10.3390/ijms23020616 39. Prso, I.B., et al.: Tumor necrosis factor-alpha and interleukin 6 in human periapical lesions. Mediat. Inflamm. 38210 (2007). https://doi.org/10.1155/2007/38210 40. Silva, T.A., et al.: Differential expression of chemokines and chemokine receptors in inflammatory periapical diseases. Oral Microbiol. Immunol. 5(20), 310–316 (2005) 41. Luo, G., et al.: TNF-α and RANKL promote osteoclastogenesis by upregulating RANK via the NF-κB pathway. Mol. Med. Rep. 5(17), 6605–6611 (2018). https://doi.org/10.3892/mmr. 2018.8698 42. Noguchi, T., et al.: TNF-α stimulates the expression of RANK during orthodontic tooth movement. Arch. Oral Biol. 117, 104796 (2020). https://doi.org/10.1016/j.archoralbio.2020. 104796 43. Kokkas, A.B., et al.: Irreversible but not reversible pulpitis is associated with up-regulation of tumour necrosis factor-alpha gene expression in human pulp. Int. Endod. J. 40, 198–203 (2007). https://doi.org/10.1111/j.1365-2591.2007.01215.x

Personalized Medicine Perspectives and Policies in European Nordic Countries Maria Garabajiu(B)

, Daniela Galea-Abdusa , Alexandra Topa , Ilenuta Gusila , and Ghenadie Curocichin

Nicolae Testemitanu State University of Medicine and Pharmacy, Chisinau, Republic of Moldova [email protected]

Abstract. The technical revolution has generated large numbers of data in healthcare and biomedical research. Thus, research and innovation became a growing priority to support a change from the one-size-fits-all paradigm of healthcare to Personalized medicine, also called precision medicine. This important pillar in realizing innovation priority in healthcare - Personalized Medicine started its moving fast forward all over the word for the last decade. The aims of PM are to solve health problems by enabling early, individualized diagnosis and treatment, using characterization of individuals’ phenotypes and genotypes. The Nordic region, comprising primarily Denmark, Estonia, Finland, Iceland, Norway and Sweden, has many of the necessary characteristics for being at the forefront of genome-based Personalized Medicine development and implementation into clinical care. Remarkably, Nordic countries were the first European countries that started developing Biobank and legislation in this direction. The Joint Committee of the Nordic Medical Research Councils is a cooperative body responsible for the medical research councils of the Nordic countries, which has straightened strategies towards personalized medicine since 2011 and reaching very good result in implementation of this concept, before other European countries. All Nordic countries directed national strategies either specifically towards personalized medicine or to closely related areas, advancing infrastructure development. The most important pitfall in this region is the reliable genetic basis, which started its evolution in early 90-th by implementation of Genome Projects. Nowadays, Nordic countries show perfect example of Personalized Medicine implementation and continuous development, overcoming hurdles and setting ambitious goals. Keyword: Nordic countries · Personalized medicine · Precision medicine · Policies · Strategies · National legislation

1 Introduction During the last years, development of advanced technologies and improved understanding of diseases made it evident that more personalized approaches in medicine and healthcare is needed for effective treatment, prevention as well as predictive and participatory medicine and health care. Health interventions and health system organization needs to © The Author(s), under exclusive license to Springer Nature Switzerland AG 2024 V. Sontea et al. (Eds.): ICNBME 2023, IFMBE Proceedings 92, pp. 471–479, 2024. https://doi.org/10.1007/978-3-031-42782-4_50

472

M. Garabajiu et al.

be improved as it becomes clear that the “one size fits all” model of approach is not sufficiently effective. Personalized Medicine (PM) represents this paradigm change to more targeted and “personalized” interventions. No official definition is accepted till now, but the first one, offered by European Commission in 2013 is “Personalized medicine refers to a medical model using molecular profiling for tailoring the right therapeutic strategy for the right person at the right time, and/or to determine the predisposition to disease and/or to deliver timely and targeted prevention” [1]. The PM concept is based on 4P model: predictive (determining the risk/susceptibility and treatment response), preventive (allowing early intervention to prevent the disease altogether), personalized (according to the genetic make-up of the person and their disease) and participatory (involving the patient in decisions on prevention or treatment) [2]. Diagnostic testing is at the core of personalized medicine. Otherwise, diagnostics can be used to determine important molecular characteristics that can affect an individual’s health condition and guide prevention and treatment decisions. Diagnostic tests and the biological markers (biomarkers) can be helpful in evaluating the predisposition of the disease, diagnose a disorder, evaluate the severity and/or progression, predict optimal treatment strategies and monitor response to treatment. Due to advanced understanding of how genes influence human health, genetic and genomic sequencing-based diagnostics (biomarkers) are the most commonly used tools in personalized medicine [3]. However, genome-based personalized medicine can be realized only through coordinated actions involving all actors in the healthcare sector, including patient representatives, governments, pharmaceutical companies, academic institutions and funding agencies. Good examples across the world have been found representing implementation strategies of personalised/precision medicine, like USA, Canada, China, etc. European countries have a broad history in genomic programs as well as in personalized medicine strategies implementation. Aiming at establishing Europe as a global leader in the field, the EC has been supporting joint efforts and activities related to PM. For the Republic of Moldova, the European direction of the political development could be a great pitfall in implementing PM into the practice. One of the brighter examples of EC participatory actions is the establishment of the International Consortium of Personalised Medicine (ICPerMed), a platform that today connects more than 40 countries with a common goal of aligning and supporting efforts on PM research and implementation and providing funding under the seventh Framework Programme (FP7) and during Horizon 2020, or other initiatives [4]. It is not surprising that the Joint Committee of the Nordic Medical Research Councils (NOS-M) has launched the white paper (2011) before European Commission adoption of PM development (2013). A broad history of genome sequencing in Nordic countries opened the horizon of this domain. NOS-M has published two white papers (2011 and 2014) with recommendations on actions needed for the Nordic region to maintain a competitive global position in medical research by responding to scientific, health care and economic challenges. In consequence of these recommendations, NOS-M arranged a workshop on personalized medicine in Stockholm in 2016. This was a starting point of further progressive Personalized Medicine development in Nordic countries and all Europe [5].

Personalized Medicine Perspectives and Policies in European Nordic Countries

473

2 Methods The study was performed in several steps of literature review in the timeframe of November 2022 – March 2023. For the first step, a scientific literature search was performed on the PubMed database. The search criteria included records in English, reporting information on national laws or legislations at the EU national level, with specificity on Nordic countries, with no other restrictions applied. The keywords applied were “Nordic countries” AND “Personalized medicine” OR “Precision medicine” AND “Policies” OR “Strategies” OR “National legislation”. The second step included an extensive grey literature research using Google Scholar and Google search engines, using a broad set of search terms, including the same keywords. The search was conducted in English. At the last step, two researchers explored national and international official repositories, such as the EU Commission and Council, ICPerMed, National Health Ministries or other competent authorities related to public health official sites, for eligible documents or reports. The data analysis was performed in the period of March-May 2023. Collection of necessary material and further descriptive analysis performed.

3 Results The Nordic countries include Denmark, Finland, Iceland, Norway and Sweden, and their associated territories. The total population of 27 million people in the Nordic countries are mainly of Scandinavian or Finnish ancestry, and include the indigenous Greenlandic Inuit and Sami. Estonians share linguistic and historical roots with the Finns and identify very closely with Nordic culture. Moreover, Estonia has been an active partner in the Nordic Biobank Network, having well-established national biobank [6]. The Nordic countries have been pioneers in establishing population-based biobanks. The Iceland’s population is considered the most examined genetically by sequencing genome in more than 90% population. Specific Nordic assets such as the personal identification number, national healthcare system, registers defining genetically informative populations and health outcomes make the Nordics uniquely suited for a successful biobank infrastructure. Since 2011, the landscape for strategic cooperation among the European medical science policy actors has changed profoundly due to the termination of the European Medical Research Councils (EMRC) in 2013. This leaves the Nordics in an exclusive position, being the only European region that already has a comprehensive common strategic network of national medical research councils, NOS-M. Continuous growth in the domain of genomic and scientific development provide the potential for Nordic region to remain at the forefront of personalised medicine implementation. Some of the most important common initiatives for Nordic countries are directed towards research and innovation, and genomics. Nordic Society for Human Genetics and Precision Medicine was launched in 2018. The vision of NSHG-PM is to advance precision medicine and health care in the Nordic region. The main goals of the society were established as given below. 1- To establish a Nordic framework for research into the genetics of human diseases, as well as into human

474

M. Garabajiu et al.

evolution and population history. 2- To accelerate discovery of disease susceptibility genes and genes protecting from disease through integrated analyses using multiple large-scale datasets and a range of experimental designs. 3- To translate these findings so that they can be used for precision medicine to improve public health. 4- To uphold and promote the highest legal, regulatory, social, and ethical standards [7]. The Nordic Trial Alliance (NTA) was a three-year pilot project running from 2013 to 2016. The NTA was launched to meet the negative trend of decreasing number of clinical trials in the Nordic countries, mainly because of clinical research moving out from the region. The NTA focused on funding strategic activities, mostly networks and workshops, aiming to support and facilitate clinical trials in the Nordic countries [8]. Nordic Health Research and Innovation Networks is an independent, non-profit organisation working to promote health research and innovation in the Nordic region. The organisation is based on partnership where the partners are university hospitals, universities and other research organisations, the pharmaceutical industry, the medical technical industry, governmental bodies and patient organizations [9]. The Nordic Alliance for Clinical Genomics is an independent, non-governmental, not-profit, association. The aim is to share genomics data and technology competence for improved diagnosis and treatment, and as a resource for research [10]. NeIC Tryggve is the name for the Nordic collaboration for sensitive data. Tryggve develops and facilitates access to secure e-infrastructure for sensitive data, suitable for hosting large-scale cross-border biomedical research studies. Tryggve develops stateof-the-art scalable infrastructure for safe, efficient, ethical, and legal storage, analysis and sharing of sensitive personal data for biomedical research between countries. The project supports open and transparent data access processes by engaging with the key stakeholders from each of the Nordic countries [11]. “NORIA-net on Registers and Biobanks” is a coordination activity, initiated by NordForsk, which has the aim to increase the use of the unique data registries and biobanks in and between the Nordic countries, and thereby strengthening Nordic cooperation on registry-based research [12]. Thus, there is a huge leap forward in the direction of personalized medicine in Nordic region through the last 10 years. The Biobank development is a cornerstone of this direction in all five countries. The potential, which was developed much earlier than in other European countries was taken into account and implemented successfully. Not all the countries from the Nordic region have the same legislative framework in implementation of personalized medicine concept, but some of the implemented measure are common. Many challenges remain present nowadays, but the vision is still clear. Denmark. The activities, which were undertaken, are recent in Denmark. No early legislative framework was found before 2017. Although, recent political initiatives include a number of analyses of the state of personalized medicine. The National Strategy for Personalized Medicine lays the foundation for the continued development of PM in Denmark. An important aim of the strategy is to build and manage an infrastructure for genome data generation, storage and interpretation, and to strengthen collaboration between the Danish health care system and research community to ensure that the Danish people can benefit fully from the new technologies and other advances. Danish National

Personalized Medicine Perspectives and Policies in European Nordic Countries

475

genome initiative is also developing under existing projects, but no national legislative framework is present now [5]. • National Danish Strategy for Personalised Medicine 2017–2020 [13] • Digital Health Strategy 2018–2022 [14] • National Strategy for Personalised Medicine 2021–2022 [15] Finland. The legislative basis in Finland started its establishment in 1995 by implementing Gene technology Act. However, nearly 10 years were needed to continue the policies in this direction. Starting with 2012 the process of implementing strategic actions became faster and more efficient, probably due to the support of NOS-M. Although, there is no specific national strategy or roadmap for personalized medicine, but some other important component strategic actions were developed: • • • • • • • • • • • •

Gene technology Act 1995 [16] Biobank Act 2012 [17] eHealth Strategy and Action Plan of Finland in A European Context 2013[18] The Health Sector Growth Strategy for Research and Innovation Activities 2014 [19] Finland’s Genome strategy 2015 [20] Health Sector Growth Strategy for Research and Innovation Activities Roadmap for 2016–2018 [21] The Finnish National aHealth And eSocial Strategy 2020 [22] The Secondary Use Act 2019 [23] Genome strategy 2021 [24] The Health Sector Growth Strategy for Research and Innovation Activities Roadmap for 2020–2023 (Finnish) [25, 26] Finland’s National Reform Program [27] Finland’s national welfare economy action program 2023–2025 [28]

Iceland. The Icelandic population is the most genotyped in the world, mainly due to the pioneering work of deCODE genetics, starting already in the 1990s. Currently, over half of the adult population has been genotyped and 25 000 whole genomes have been sequenced. However, there is currently no national roadmap/strategic agenda specifically for personalized medicine, but a number of ongoing initiatives on behalf of personalized medicine were undertaken. The present strategy mostly outlines future visions of eHealth implementation and digitalization [5]. • • • • •

Act on health record 2009 Act on biological sample collection and collection of health information 2000 [29] Science and Technology Policy and Action Plan 2017–2019 [30] National eHealth project 2016–2020 [31] Health policy a policy for Iceland’s health services until 2030 [32]

Estonia. Estonia is one of the first countries, which developed population biobanks in combination with information from health records and lifestyle habits. The Estonian Genome Project is a population-based database and biobank containing specimens from

476

M. Garabajiu et al.

a large percentage of population, which was established in 2000 to improve public health in Estonia. Implementation of personalized medicine in Estonia is being carried out within the framework of the personalized medicine program 2016–2020, not covered by regulatory acts. The principle and directions of PM development are included in documents below. • • • •

Estonian eHealth strategic development plan 2020 (strategic plan) [33] Human genes research Act [34] Action plan “Estonia 2020” [35] Estonia’s National Health plan 2020–2030 [35]

Sweden There is no national strategy specifically dedicated to personalized medicine, although the Swedish Government published a roadmap for Life Science in 2018, where precision medicine was identified as one of three key priority areas. • • • •

The Biobank Act 2002 [36] Sweden’s national life sciences strategy 2018 [37] Genomic Medicine Sweden Strategic Plan 2021–2030 [38] The Biobank Act 2023 [39]

Norway The Norwegian Strategy for Personalized Medicine in Healthcare was developed in 2017 and is meant to support and form a basis for health care services in the development and implementation of PM. The key recommendations of the strategy include development of expertise, a coordinated national development of the field, development of ICT systems and registries and paving a way for further research and innovation. • • • • •

Norwegian strategy for PM in Healthcare 2017–2021 [40] National eHealth Strategy 2017–2022 [41] Digital strategy for the public sector 2019–2025 [42] National health and hospital plan 2020–2023 [43] National eHealth strategy 2023 [44]

4 Conclusion The legislative framework in the field of personalized medicine has started since 90th and is developing continuously in Nordic countries. The significant development is observed in the last decade, but only Denmark and Norway have implemented the specific national plan for Personalized Medicine. Other Nordic countries invest in such directions of PM as Biobanks, Research and innovation, Digitalization of Health Care/E-Health and health care system sustainability. Acknowledgments. This work was supported by the project grand 20.80009.8007.26. of National Agency for Research and Development, Republic of Moldova.

Personalized Medicine Perspectives and Policies in European Nordic Countries

477

Conflict of Interest.. The authors declare that they have no conflict of interest.

References 1. European Commission: Legal provisions of SWD (2013)436 - Use of “-omics” technologies in the development of personalised medicine (2013). https://www.eumonitor.eu/9353000/1/ j4nvhdfcs8bljza_j9vvik7m1c3gyxp/vje6rupawyzf 2. Slim, K., Selvy, M., Veziant J.: Conceptual innovation: 4P Medicine and 4P surgery. J. Vis. Surg. 158 (2021). https://doi.org/10.1016/j.jviscsurg.2021.01.003 3. Kisor, D., Ehret, M.: The personalized medicine report (2020). https://www.personalized medicinecoalition.org/Userfiles/PMC-Corporate/file/PMC_The_Personalized_Medicine_ Report_Opportunity_Challenges_and_the_Future.pdf 4. Leyens, L., Hackenitz, E.: CSA Permed: Europe’s commitment to personalised medicine. Eurohealth Int. 20 (2014). https://www.permed2020.eu 5. Personalised medicine in the Nordic countries NOS-M report with conclusions and recommendations for joint actions in personalised medicine in the Nordic countries. https://nos-m.org/news/nordic-common-strengths-and-future-potential-in-the-field-ofpersonalised-medicine 6. Njolstad, P., Andreassen, O.: Roadmap for a precision-medicine initiative in the Nordic region. Nat. Genet. 51, 924–930 (2019). https://doi.org/10.1038/s41588-019-0391-1 7. Nordic society of human genetics and precision medicine. https://www.nshg-pm.org/mission 8. Nordic Trial Alliance: Enhancing Nordic cooperation on clinical trials. https://www.nordic trialalliance.org/ 9. Nordic Health Research and Innovation Networks (NRI-Networks). https://uia.org/s/or/en/ 1122277259 10. The Nordic Alliance for Clinical Genomics (NACG) is an independent, non-governmental, not-for-profit Nordic association. https://nordicclinicalgenomics.org/resources 11. TRYGGVE - Collaboration for sensitive data. https://neic.no/tryggve/ 12. NORIA-net on Registers and Biobanks. https://www.nordforsk.org/noria-net-registers-andbiobanks 13. Personalised medicine for the benefit of patients clear diagnosis targeted treatment strengthened research summary. National strategy for personalised medicine 2017-2020. https://eng. ngc.dk/media/6675/sum_klar_diagnose_summary_uk_web.pdf 14. Digital health strategy 2018-2022, Denmark. https://sundhedsdatastyrelsen.dk/da/diverse/ download 15. Personalised medicine for the benefit of the patients clear diagnosis targeted treatment enhanced research national strategy for personalised medicine 20212022. https://eng.ngc.dk/Media/637614364621421665/Danish%20Strategy%20for%20pers onalised%20medicine%202021%202022.pdf 16. Gene technology Act, vol. 377 (1995). https://leap.unep.org/countries/fi/national-legislation/ gene-technology-act-no-377-1995 17. Biobank Act Finland. Finland (2012). https://www.finlex.fi/en/laki/kaannokset/2012/en2012 0688.pdf 18. Peer Review eHealth Strategy and Action Plan of Finland in a European Context. Reports and Memorandums of the Ministry of Social Affairs and Health, 11 (2013). http://urn.fi/URN: ISBN:978-952-00-3300-2 19. Health Sector Growth Strategy for Research and Innovation Activities (2014). https://tem.fi/ documents/1410877/3437254/Health+Sector+Growth+Strategy+for+Research+and+Innova tion+Activities+26052014

478

M. Garabajiu et al.

20. Improving health through the use of genomic data. Finland’s genome strategy (2015). https://julkaisut.valtioneuvosto.fi/bitstream/handle/10024/74712/URN_ISBN_978952-00-3598-3.pdf 21. Innovating together: Growth Strategy for Health Sector Research and Innovation Activities: The Roadmap for 2016-2018. https://julkaisut.valtioneuvosto.fi/bitstream/handle/10024/ 75145/MEE_guidelines_8_2016_Health_sector_growth_strategy_17062016_web.pdf?seq uence=1&isAllowed=y 22. Information to support well-being and service renewal. E-Health and E-Social strategy (2020). https://julkaisut.valtioneuvosto.fi/bitstream/handle/10024/74459/URN_ISBN_978952-00-3575-4.pdf 23. Act on the Secondary Use of Health and Social Data (2019). https://www.finlex.fi/fi/laki/aja ntasa/2019/20190552 24. Terhi, K., Outi, K.: Genome strategy. Finnish ministry of Health and Social Affairs (2021). https://stm.fi/documents/1271139/2013549/UK-Genomistrategia-final-verkko+(1).pdf/c07 9fdae-94ea-4869-91df-02603c9b44ed/UK-Genomistrategia-final-verkko+(1).pdf?t=167828 1581906 25. Terveysalan tutkimus-ja innovaatiotoiminnan kasvustrategia Tiekartta 2020-2023. https:// julkaisut.valtioneuvosto.fi/bitstream/handle/10024/162564/VN_2020_33.pdf?sequence=1& isAllowed=y 26. Anika, S., Krista, K.: Updated roadmap: new innovations in the health sector aim at wellbeing and competitiveness (2020). https://okm.fi/en/-/1410877/updated-roadmap-new-innovationsin-the-health-sector-aim-at-wellbeing-and-competitiveness 27. Finland’s National Reform Program 2023. Publications of the Ministry of Finance, 13 (2023). https://commission.europa.eu/system/files/2023-04/Finland-NRP-2023_en.pdf 28. Finland’s national welfare economy action program 2023–2025 (2023). cited 2023 Feb 15. https://julkaisut.valtioneuvosto.fi/handle/10024/164703 29. Act on biological sample collections and collections of health information (2000). https:// www.althingi.is/lagas/nuna/2000110.html 30. Science and Technology Policy and Action Plan. Ministry of Education Science and Culture 2017-2019. https://www.government.is/library/01-Ministries/Ministry-of-Education/Pol icy%20and%20action%20plan%202017-2019.pdf 31. E-health services available for everyone and at all times in Iceland. https://www.healthcareat distance.com/media/1121/e-health-services-available-for-everyone-and-at-all-times-in-ice land.pdf 32. A policy for Iceland’s health services until 2030. Icelandic Ministry of Health (2019). https://www.government.is/library/01-Ministries/Ministry-of-HealTh/PDF-skjol/Heilbrigd isstefna_english.pdf 33. Estonian eHealth strategic development plan 2020 (strategic plan). https://apo.org.au/sites/ default/files/resource-files/2015-12/apo-nid252426.pdf 34. Human Genes Research Act (Estonia) (2000). https://www.riigiteataja.ee/en/eli/531102013 003/consolide 35. Estonia’s National Health Plan 2020-30. Ministry of Health, Estonia (2020). https://www. emcdda.europa.eu/drugs-library/ministry-health-estonia-2020-estonias-national-healthplan-2020-30_en 36. Om Biobanks in Health Care. Swedish Law (2002). https://www.global-regulation.com/tra nslation/sweden/2989107/law-%25282002%253a297%2529-om-biobanks-in-health-care% 252c-etc.html 37. Sweden’s national life sciences strategy. Ministry of Enterprise and Innovation (2020). https:// swedenbio.se/wp-content/uploads/2020/11/swedens-national-life-sciences-strategy.pdf 38. Genomic Medicine plan Sweden 2021-2030. https://genomicmedicine.se/wp-content/upl oads/2021/05/GMS-10-year-streategy.pdf

Personalized Medicine Perspectives and Policies in European Nordic Countries

479

39. Biobank Sweden’s translation of the Biobank Act. Ministry of Health and Social Affairs 38 (2023). https://biobanksverige.se/wp-content/uploads/A-New-Biobank-Act-a-summary.pdf 40. Summary of the Norwegian Strategy for Personalised Medicine in Healthcare (2017). www. helsedirektoratet.no 41. Nasjonal e-helsestrategi og mål 2017–2022. https://www.ehelse.no 42. One digital public sector - Digital strategy for the public sector 2019–2025. Ministry of Local Government and Modernization (2019). https://www.regjeringen.no/contentassets/db9bf2bf1 0594ab88a470db40da0d10f/en-gb/pdfs/digital_strategy.pdf 43. National Health and Hospital Plan 2020–2023. https://www.regjeringen.no/contentassets/95e ec808f0434acf942fca449ca35386/en-gb/pdfs/stm201920200007000engpdfs.pdf 44. National eHealth strategy 2023. National Council for EHealth (2023). https://www.ehelse. no/strategi/nasjonal-e-helsestrategi-for-helse-og-omsorgssektoren/_/attachment/inline/69d 58858-d324-48fe-8d2f-998cda199367:9a2712f7606599c7909bb182a00f1925ba3544e1/Nat ional%20eHealth%20strategy%20EN%20MASTER%20v%201.0.pdf

Measurement of Arterial Blood Gases in Elderly Patients with COVID-19 Pneumonia and Chronic Obstructive Pulmonary Disease Tatiana Dumitras1 , Diana Fetco-Mereuta1(B) , Virginia Cascaval1,2 , Livi Grib1 , Elena Bivol2 , Daria Romaniuc1 , and Viorica Chihai1,2 1 Nicolae Testemitanu State University of Medicine and Pharmacy, Chisinau,

Republic of Moldova [email protected] 2 Holy Trinity Municipal Hospital, Chisinau, Republic of Moldova

Abstract. The evolution of COVID-19 pneumonia seems to be linked to underlying comorbidities, and has an increasingly rapid and severe progression in these patients. Patients with chronic obstructive pulmonary disease (COPD) are also at higher risk for severe illness from SARS-CoV-2 viral pneumonia, especially in elderly population, that is more susceptible to this illness. The article represents a clinical study of invasive arterial blood gases measurement and non-invasive measurement of capillary blood oxygen saturation in elderly and middle-aged COPD patients with COVID-19 pneumonia. The study included 101 patients admitted to COVID-19 Triage Center with COVID-19 pneumonia and chronic obstructive pulmonary disease, aged between 45 and 86 years, divided into two groups according to their age. The arterial blood gases analysis demonstrated respiratory acidosis, hypoxemia, hypercapnia and alveolo-capillary block in both elderly and middle-aged patients. Significantly elevated levels of partial pressure of arterial blood carbon dioxide were observed in patients aged more than 65 years. Simultaneously, a discrepancy between almost suboptimal oxygen saturation values measured by pulse oximeter and higher levels of hypercapnia in arterial blood gases were registered. The measurement of arterial blood gases should be an obligatory tool to assess the severity of viral pneumonia in COPD patients, especially in those elderly ones. Keywords: Arterial blood gases · COVID-19 pneumonia · Elderly patients · Chronic obstructive pulmonary disease

1 Introduction The two pandemics of influenza A (H1N1) and SARS-CoV2-infection, as well as a series of epidemics of severe respiratory viral infections that took place between years 2009 and 2023 showed that comorbidities and age played an important role in the evolution and severity of pneumonia. The patients with comorbid conditions were linked to a more severe COVID-19 outcome when compared with patients with no underlying diseases [1]. © The Author(s), under exclusive license to Springer Nature Switzerland AG 2024 V. Sontea et al. (Eds.): ICNBME 2023, IFMBE Proceedings 92, pp. 480–488, 2024. https://doi.org/10.1007/978-3-031-42782-4_51

Measurement of Arterial Blood Gases in Elderly Patients

481

Although the pathologies associated with the greatest impact were those cardiovascular, cerebrovascular and diabetes mellitus, the importance of chronic obstructive pulmonary disease (COPD) as the background of viral pneumonia cannot be underestimated. The COPD prevalence in SARS-CoV-2 pneumonia was estimated from 1.4% in outpatient setting to 38% in intensive care unit (ICU) cohorts [2–4]. Both restrictive lung changes due to the involvement of alveoli and interstitium in viral pneumonia and obstructive functional disorders due to bronchial muscles constriction and mucosal inflammation in COPD aggravate each other and contribute to a more severe evolution of both pathologies [4]. On the other hand, it was demonstrated that the elderly people are more susceptible to COVID-19, are more likely to be admitted to the ICU and have a higher mortality rate. These changes in the elderly population may be explained by respiratory muscle atrophy, reduction of lung volumes, disturbances of the defense barrier function and diminishment of airway clearance [5]. Another problem that arose during the pandemic of SARS-CoV-2 infection, not only in Republic of Moldova, but also in other European countries, was the limitation of the access for spirometry and body plethysmography from epidemiological point of view [6]. Spirometry with bronchodilatation test is the basic investigation to diagnose the obstructive lung disorders caused by different pathologies such as COPD, bronchial asthma, alfa-1-antitripsin-defficiency etc. But during this investigation there was a high dispersion of the viral particles in the air, so the medical staff and the patients had a very high risk to become infected by SARS-CoV-2 virus. That’s why, the WHO recommended limiting the performance of spirometry during the pandemic period, due to the high risk of spreading of the virus [7]. The restrictions affected considerably the confirmation of obstructive ventilatory disorders, assessment of COPD severity as well as treatment evaluation [8]. Several solutions have been proposed to overcome these obstacles [9]. One of them was the non-invasive monitoring of pulse rate and desaturation events with oximeter for the assessment of COPD patients with cardiovascular comorbidities [10]. However, the precision of oxygen saturation of capillary blood measured with pulse oximeter is strongly influenced by low blood pressure, cardiac arrhythmias, fever, pH, anaemia etc. We suppose that arterial blood gases measurement, especially partial pressure of carbon dioxide (PaCO2 ), is more precise than non-invasive oxygen saturation measurement of capillary blood in the severity assessment of COVID-19 pneumonia in elderly patients with COPD.

2 Aim of the Study The aim of study was to evaluate arterial blood gases and oxygen saturation of capillary blood measured with pulse oximeter (SatO2 ) in elderly COPD patients with COVID-19 pneumonia comparatively to middle-aged COPD patients with COVID-19 pneumonia.

482

T. Dumitras et al.

3 Methods This prospective cohort study was based on clinical, laboratory and X-ray examination of patients hospitalized with COVID-19 pneumonia in the red zone (ICU) of COVID19 Triage Center of Holy Trinity Municipal Hospital, Chisinau, Republic of Moldova, during May 2020 – October 2021. The study included 101 patients with COVID-19 pneumonia and chronic obstructive pulmonary disease, aged between 45 and 86 years, of them 55 were male and 46 were female. The patients were divided into two groups: group 1 (51 patients aged more than 65 years) and group 2 (50 patients aged less than 65 years). The inclusion criteria were: clinical data (the disease onset outside the hospital with fever, chills, progressive dyspnoea, chest pain and physical signs of lung consolidation), recent opacity on chest X-ray examination assessed by Brixia score, positive result of RTPCR for SARS-CoV-2 viral infection obtained from nasopharyngeal samples, laboratory tests (elevation of white blood cells count, erhythrocite sedimentation rate, C-reactive protein, lactatedhydrogenase, urea, ionogram). The diagnosis of COPD was based on spirometry performed before COVID pandemics, confirming ratio of postbronchodilator forced expiratory volume in 1 s (FEV1 ) and forced vital capacity (FVC) below 0.70. The non-invasive monitoring of capillary blood oxygen saturation and pulse rate was performed using pulse oximeter. The arterial blood gases investigation allowed the assessment of blood gasimetry, acid-base and hydroelestrolytic disorders. In order to detect arterial blood, a radial, or, in some cases, femoral artery was punctured. The injection was performed by means of a syringe-semler with lyophilized heparine and a needle with a diameter of 0.5–0.6 mm. The procedure was carried out, respecting the rules of asepsis and antisepsis. The artery was identified and was to be smoothed with the tips of two fingers. When the pulsation was felt, the artery was fixed. The needle was turned at a 90-degree angle, the syringe was pulled at the same time and 1.0–1.5 ml of blood was collected. The syringe was extracted from the artery, the contents of the syringe were lightly mixed with lyophilized heparine to prevent clot formation. The analysis of the resulting product was carried out with the aid of the RARIDROint 500 System analyzer, obtaining the following parameters in 1–2 min: pH, partial pressure of oxygen (PaO2 ), partial pressure of carbon dioxide (PaCO2 ), actual bicarbonate (HCO3act ), total concentration of carbon dioxide (ctCO2 ), ratio of oxigen partial pressure to fraction of inspired oxigen (PaO2 /FiO2 ), the alveolar-arterial oxygen partial pressure gradient pO2 (A-a) and lactate. The obtained data were statistically analyzed using the Statistical Package for Social Science (SPSS, version 20). The results were expressed as n (%) for categorical variables and Mean ± SD for continuous variables. The analysis of the variables was performed using descriptive statistics. A p-value less than 0.05 was considered statistically significant.

Measurement of Arterial Blood Gases in Elderly Patients

483

4 Results The mean age of included patients was 67,2 ± 11,18 years, of them 55 (54.5%) were male and 46 (45.5%) were female. The time of hospitalization in the ICU ranged from 1 to 7 days. The comorbidities registered in both groups included: arterial hypertension - 48 (94.2%) versus 48 (96%), diabetes mellitus - 28 (54.9%) versus 32 (64%), obesity – 20 (39.1%) versus 36 (52%), chronic heart failure - 25 (49.1%) versus 18 (36%), chronic kidney disease – 8 (15.7%) versus 5 (10%), chronic cerebrovascular diseases – 10 (19.6%) versus 3 (6%) and chronic liver disease – 5 (9.8%) versus 2 (4%), respectively (p > 0.05). Summarizing the signs and symptoms observed in our patients, we observed that the most frequent ones in both groups were: dyspnea 100% in both groups, cough 43 (84.3%) in group 1 versus 30 (60%) in group 2, palpitations - 33 (64.7%) in group 1 versus 27 (54%) in group 2, anosmia - 30 (58.9%)%) in group 1 versus 35 (70%) in group 2 and fever more than 38 °C was registered in 21 (41.2%) cases in group 1 and 20 (40%) cases in group 2 (>0.05). Wheezing was another clinical sign frequently encountered in groups - 25 (49.1%) in group 1 versus 28 (56%) in group 2. Wheezes were detected on lung auscultation in 46 (90.1%) patients in the first group and in 45 (90%) patients in group 2, being a suggestive sign of broncho-obstructive syndrome. The levels of oxygen saturation in capilary blood measured by pulse oxymeter did not differ significantly between groups 1 and 2 – 87.7 ± 14.4 versus 86.0 ± 13.4, respectively, as well as respiratory rate - 31.8 ± 6.4 versus 30.1 ± 5.7, heart rate – 109.8 ± 19.2 versus 106.6 ± 24.3 beats per minute and mean arterial pressure – 111.6 ± 21.9 versus 111.2 ± 23.5 mmHg (p > 0.05). Table 1. Arterial blood gases parameters in elderly and middle-aged COPD patients with severe COVID-19 pneumonia (Mean ± SD) Parameters pH

Group 1 7.29 ± 0.11

PaO2 , mmHg

59.4 ± 15.0

PaCO2 , mmHg HCO3 act , mmol/L ctCO2 , mmol/L

Group 2 7.30 ± 0.08

P-value 0.074

51.0 ± 12.7

0.167

66.0 ± 4.2

54.3 ± 5.5

0.032

26.3 ± 4.2

26.2 ± 3.5

0.287

31.2 ± 7.0

30.3 ± 5.4

0.085

2.2 ± 0.9

2.1 ± 0.7

0.173

pO2 (A-a), mmHg

113.6 ± 20.2

106.6 ± 15.1

0.169

Lactate, mmol/L

2.5 ± 1.9

2.6 ± 1.2

0.345

PaO2 /FiO2 , mmHg/%

The arterial blood gases analysis demonstrated a trend to respiratory acidosis (low pH) and hypoxemia (low PaO2 and PaO2/FiO2 ratio less than 3) in both groups as well as higher levels of pO2 (A-a) gradient reflecting alveolo-capillary block and opening of arteriovenous shunts and significantly elevated levels of PaCO2 (p < 0.05) in the elderly

484

T. Dumitras et al.

patients’ group (Table 1). At the same time, we did not observe significant differences between the arterial blood levels of lactate, actual bicarbonate and total concentration of CO2 . Comparing the means of the results of full blood count, we noticed no significant differences between groups 1 and 2 in mean white blood cell count – 11.9 ± 7.7 versus 7.3 ± 4.5 x 109 /L. The erythrocyte sedimentation rate was moderately increased in both groups - 30.1 ± 5.1 mm/hour in group 1 and 33.2 ± 4.3 mm/hour in group 2. Evaluating the biochemical parameters of the blood, we found an increase in the values of C reactive protein in all the patients in the study. Also, lactatdehydrogenase values were raised equally in the great majority of patients from both groups - 41 (80.3%) patients from group 1 versus 38 (76.0%) patients from group 2, and the increase in urea was more obvious in patients from group 2 - 28 (56.0%) cases versus 19 (37.2%) cases from group 1. The chest X-ray data, which could be suggestive of a lung hyperinflation syndrome, were shadowed by diffuse bilateral interstitial and alveolar opacities. The chest X-ray, performed on admission, demonstrated bilateral pulmonary involvement in all patients from group 1 and group 2. The most frequent X-ray changes observed were “ground glass” pattern - in 50 (98.1%) of group 1 and in 49 (98.0%) patients in group 2. The mean Brixia score on admission was 8.32 ± 3.7 points in group 1 versus 8.12 ± 3.8 points in group 2 (p > 0.05). Analyzing the rate of COVID-19 complications in the patients in the study, we found that acute respiratory failure was observed in all patients in both study groups. The shock of various genesis (distributive, cardiogenic, obstructive) was diagnosed in 16 (31.4%) from group 1 versus 10 (20%) from group 2. Cardiogenic pulmonary edema developed in 16 (31.4%) patients from group 1 versus 13 (26%) patients from group 2. Renal failure was diagnosed in 13 (25.4%) cases in group 1 versus 7 (14%) cases in group 2, and acute coronary syndrome was confirmed in 10 (19.6%) patients in group 1 and in 2 (4%) patients from group 2 (p > 0.05). Multiple organ dysfunction syndrome was diagnosed in 15 (29.4%) patients from the first group and 5 (10%) patients from group 2. All patients in the study benefited from oxygen therapy with facial mask. In all cases of inefficiency of mass oxygenation, surgical resolution was attempted, primarily with non-invasive ventilation, resulting from possible complications of mass ventilation (for example, ventilator-associated pneumonia). In the case of the inefficiency of this, noninvasive lung ventilation or mechanical ventilation was applied. The need for mechanical ventilation was significantly more frequent in patients from group 1 - 22 (43.1%) versus 8 (16.0%).

5 Discussions Much more aggressive than A (H1N1) influenza, the pandemic of COVID-19 caused by severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) spread all over the world, affecting millions of people. Elderly people and patients with associated comorbid conditions such as arterial hypertension, coronary artery disease and diabetes mellitus were at an increased risk for a poor prognosis after SARS-CoV-2 infection. Although the epidemiological data about COPD prevalence in COVID-19 patients varied considerably

Measurement of Arterial Blood Gases in Elderly Patients

485

(1.4% - 38%) and some studies showed that exacerbation fell by up to 50% during the pandemic, the vigilance measures in these patients could not be avoided [2, 4, 7]. Chronic obstructive pulmonary disease is one of the leading causes of disability and death globally, characterized by persistent respiratory symptoms and airflow limitation due to airway inflammation and/or alveolar abnormalities. The Global Initiative for Chronic Obstructive Lung Disease (GOLD) recognizes COPD patients among those severely affected by COVID-19 [11]. The presumed susceptibility of COPD patients to respiratory viral infections was supported by immune dysfunction, oxidative stress, affecting both pulmonary cellular and molecular inflammatory mediators and leading to chronic persistent systemic inflammation. [12]. On the other hand, the advanced age is associated with several important comorbid conditions and contributes to higher susceptibility to bacterial and viral infections, COVID-19 inclusively. Elderly patients are more likely to be admitted to the ICU and have a higher mortality rate. All above mentioned are due to a series of anatomical and physiologic changes of lung tissue, muscles, chest bones and cartilages, local pulmonary and general immunity [5]. In our study, all the patients were hospitalized in the ICU (red zone of COVID19 Centre) and received oxygen therapy, but the need for mechanical ventilation was significantly more frequent in elderly patients in comparison with middle-aged ones. We explain this, partially, by a higher frequency of chronic heart failure, chronic kidney disease, and chronic cerebrovascular disease. At the same time, the rate of obesity, diabetes mellitus and hypercatabolic state with elevated blood urea level, was insignificantly more frequent in the middle-aged group. Moreover, neither the expression of systemic inflammatory response syndrome (fever, tachypnea, tachycardia, leukocytosis, C-reactive protein levels), nor lactatdehydrogenase values reflecting pulmonary tissue lesion and respiratory muscles fatigue, nor the extension of pneumonia (Brixia score) was higher in elderly patients. The acute respiratory failure was observed in all study patients and the initial level of oxygen saturation measured by pulse oximeter was lower than 90%, without significant differences between the groups. We would have expected much lower saturation levels and the fact that the average oxygen saturation values were higher than 85% we explain by the limitations of the given method influenced by the presence of fever, the decompensation of chronic heart failure and the development of different types of shock (cardiogenic, distributive, obstructive) in our patients with severe COVID-19 pneumonia and COPD. The arterial blood gases analysis demonstrated hypoxemia, respiratory acidosis and hypercapnia in both groups (mean PaCO2 >54 mmHg), and a significantly elevated levels of PaCO2 (p < 0.05) in the elderly patients’ group.We consider that the higher levels of hypercapnia in both study groups are not only due to the interstitial changes of COVID-19 pneumonia, but also due to the permissive hypercapnia of COPD that existed before the infection with SARS-CoV-2 virus and was a stimulus for respiratory center. And the fact that PaCO2 level was higher in our elderly patients could be interpreted as a longer COPD duration, possibly higher level of preexisting permissive hypercapnia, more severe COPD, more frequent decompensation of other chronic comorbid conditions and tendency to higher complication rate of SARS-CoV-2 infection.

486

T. Dumitras et al.

Although the current trend is to apply fast, non-invasive methods of measuring and monitoring the evolution of diseases, in some clinical situations like SARS-CoV-2 infection the risk of omitting more severe cases is created by applying simpler diagnostic methods. According to our data there was a discrepancy between suboptimal SatO2 values measured by pulse oximeter and higher PaCO2 levels in arterial blood measured in elderly patients on admission in the red zone (ICU) of COVID-19 Triage Center. COVID-19 pneumonia and COPD are characterized by the creation of a vicious circle in terms of the correlation of worsening symptoms of respiratory failure in both pathologies. The patients in the study with severe pneumonia caused by the SARS-CoV2 virus in the vast majority tended to lower oxygenation index (PaO2 /FiO2 ratio less than 3) because of interstitial lesions characteristic of these pneumonias, acute respiratory distress syndrome and cardiogenic pulmonary edema, confirmed by higher levels of pO2 (A-a) gradient reflecting alveolo-capillary block and opening of arteriovenous shunts. In addition to the fact of optimal oxygen therapy reaching suboptimal oxygen saturation levels, the clinical persistence of respiratory failure was frequently associated with increased PaCO2 values. This fact demonstrates that respiratory failure in patients with pneumonia caused by the SARS-CoV-2 virus and COPD requires the monitoring of both hypoxemia and hypercapnia, which cannot be obtained by non-invasive measurement of peripheral saturation with a pulse oximeter. Thus, we confirmed the initial hypothesis of our study that arterial blood gases measurement, especially partial pressure of carbon dioxide, is more precise in the severity assessment of COVID-19 pneumonia in elderly patients with COPD than non-invasive oxygen saturation measurement. While we hope that a pandemic like COVID-19 will never happen again, medical staff must be prepared for future epidemics of viral respiratory infections that are inevitable. We consider that the arterial blood gases measurement does not allow the underestimation of severe cases of viral infections in elderly patients with COPD and improves patients care.

6 Ethics and Permissions 6.1 Statement of Informed Consent The study was initiated after signing the informed agreement by all participants (information form and acceptance form), who became familiar with the evaluation methods to be applied, at the time of initiation and during the study the confidentiality and ethical criteria were observed. 6.2 Statement of Human and Animal Rights The research was conducted during the years 2020–2021 in accordance with the Principles of the Helsinki Declaration - WMA Declaration of Helsinki - Ethical Principles for Medical Research Involving Human Subjects. This research represents a part of the study that was approved by the Research Ethics Committee of Nicolae Testemitanu State University of Medicine and Pharmacy, with the issuance of favorable opinion no. 46 from March 27, 2018.

Measurement of Arterial Blood Gases in Elderly Patients

487

7 Conclusion In our study, arterial blood gases changes corresponded more to the severity of COVID-19 pneumonia in comparison with peripheral oxygen saturation measurement in both elderly and middle-aged COPD patients. The levels of carbon dioxide measured in arterial blood were significantly higher in elderly patients with chronic obstructive pulmonary disease and severe pneumonia caused by SARS-CoV-2 virus. Thus, the measurement of arterial blood gases can be proposed as an obligatory tool to assess severity of viral pneumonia in elderly COPD patients. Acknowledgment. We would like to express our special thanks of gratitude to University professor Sergiu Matcovschi as well as to associate professor Eudochia Terna who also helped us in doing a lot of Research.

Conflict of Interest. The authors declare that they have no conflict of interest.

References 1. Wang, B., Li, R., Lu, Z., Huang, Y. Does comorbidity increase the risk of patients with COVID-19: Evidence from meta-analysis. Aging (Albany NY) 12(7), 6049–6057 (2020). https://doi.org/10.18632/aging.103000 2. Sanyaolu, A., Okorie, C., Marinkovic, A., et al.: Comorbidity and its impact on patients with COVID-19. SN Compr. Clin. Med. 2, 1069–1076 (2020). https://doi.org/10.1007/s42399020-00363-4 3. Calancea, V., et al.: COVID-19: pneumonia and comorbidities at three sites of medical care. Eur. Respir. J. 58(65), PA 291 (2021). https://doi.org/10.1183/13993003.congress-2021. PA291 4. Leung, J.M., Niikura, M., Yang, C.W.T., Sin, D.D.: COVID-19 and COPD. Eur. Respir. J. 56(2), 2002108 (2020). https://doi.org/10.1183/13993003.02108-2020. https://pubmed.ncbi. nlm.nih.gov/32817205/ 5. Liu, K., Chen, Y., Lin, R., Han, K.: Clinical features of COVID-19 in elderly patients: a comparison with young and middle-aged patients. J. Inf. Secur. 15(30), 1–5 (2020). https:// www.journalofinfection.com/article/S0163-4453(20)30116-X/pdf 6. Cazzola, M., Ora, J., Bianco, A., Rogliani, P., Matera, M.G.: Guidance on nebulization during the current COVID-19 pandemic. Respir. Med. 176, 27–30 (2021). https://www.ncbi.nlm.nih. gov/pmc/articles/PMC7676318/ 7. Halpin, D.M.G., Vogelmeier, C.F., Agusti, A.A.: COPD and COVID-19. Arch. Bronconeumol. 57(3), 162–164 (2021). https://pubmed.ncbi.nlm.nih.gov/34585618/ 8. Gochicoa-Rangel, L., et al.: Functional respiratory evaluation in the COVID-19 era: the role of pulmonary function test laboratories. Revista de inveastigacion clinica 73(4), 3–12 (2020). https://pubmed.ncbi.nlm.nih.gov/33053579/ 9. Exline, M.C., Stanacevic, M., Bowman, A.S., Gouma, P.I.: Exhaled nitric oxide detection for diagnosis of COVID-19 in critically ill patients. PLoS One 16(10) (2021). https://journals. plos.org/plosone/article?id=10.1371/journal.pone.0257644

488

T. Dumitras et al.

10. Popa, A., et al.: Non-invasive monitoring of pulse rate and desaturation events with oximeter in COPD patients with cardiovascular comorbidities. In: Tiginyanu, I., Sontea, V., Railean, S. (eds.) 5th International Conference on Nanotechnologies and Biomedical Engineering: Proceedings of ICNBME-2021, November 3-5, 2021, Chisinau, Moldova, pp. 743–749. Springer, Cham (2022). https://doi.org/10.1007/978-3-030-92328-0_94 11. GOLD COVID-19 GUIDANCE (2020). https://goldcopd.org/gold%E2%80%90covid%E2% 80%9019%E2%80%90guidance/ 12. Olloquequi, J.: COVID-19 susceptibility in chronic obstructive pulmonary disease. Eur. J. Clin. Invest. 50(10), e13382 (2020). https://pubmed.ncbi.nlm.nih.gov/32780415/

ECMO Experience in Post-cardiotomy Cardiogenic Shock. Case Presentation Viorica Cospormac1(B) , Victoria Rusu1 , Alexandru Botizatu1,2 , Vlad Maevschi2 , Alina Usataya2 , Dan Mandrila2 , Natalia Ursu2 , Igor Ceban2 , Lucia Girbu2 , Alexandru Marginean2 , and Victor Cojocaru1,2 1 Nicolae Testemitanu State University of Medicine and Pharmacy, Chisinau,

Republic of Moldova [email protected] 2 Timofei Mosneaga Republican Clinical Hospital, Chisinau, Republic of Moldova ,

Abstract. Post-cardiotomy cardiogenic shock (PCCS) presents a paramount challenge, with severe and potentially fatal implications, significantly impacting myocardial contractility and peripheral tissue perfusion due to reduced cardiac output. The following report chronicles a clinical case of a patient diagnosed with rheumatic valvulopathy, severe mitral and tricuspid regurgitation, concomitant pump dysfunction of the heart, severe pulmonary hypertension, heart failure, persistent atrial fibrillation, and congestive hepatopathy, among other comorbidities. The case emphasizes the importance of timely diagnosis, intervention, and continued management in patients with complex cardiovascular pathology. The perioperative decision for ECMO support in PCCS remains complex, relying on scientific data as well as individual considerations. ECMO is associated with high mortality and morbidity, reflecting the severity of the underlying disease, and the imperfections of the method, which can lead to hemorrhagic complications, ischemic or thromboembolic events, and multi-organ failure. The purpose of implementing post-cardiotomy ECMO (ECMO-PC) is to maintain systemic oxygen delivery (DO2 ) three times higher than oxygen consumption (VO2 ) (DO2 :VO2 ratio >3), with the norm being 5, and shock state assessment at 2. Managing a patient on post-cardiotomy ECMO (ECMO-PC) support necessitates heightened attention to the hemostatic system, as both bleeding and thrombosis remain common complications during ECMO. Keywords: ECMO · Post-cardiotomy cardiogenic shock · Extracorporeal membrane oxygenation

1 Introduction Post-cardiotomy cardiogenic shock (PCCS) presents a paramount challenge with severe implications, significantly impacting myocardial contractility and peripheral tissue perfusion. Presently, patient mortality from PCCS approaches 40%, and increasingly, mechanical methods such as Extracorporeal Membrane Oxygenation (ECMO) are utilized as frontline support for patient’s refractory to conventional treatment [1]. The © The Author(s), under exclusive license to Springer Nature Switzerland AG 2024 V. Sontea et al. (Eds.): ICNBME 2023, IFMBE Proceedings 92, pp. 489–496, 2024. https://doi.org/10.1007/978-3-031-42782-4_52

490

V. Cospormac et al.

perioperative decision for ECMO support in PCCS remains complex, ECMO being associated with high mortality and morbidity, reflecting the severity of the underlying disease, and the imperfections of the method, which can lead to fatal complications [2]. ECMO initiated in the operating room or the perioperative period after cardiac surgery is referred to as post-cardiotomy ECMO (ECMO-PC). ECMO-PC is the most common indication for ECMO in the USA. The most frequent indications include left and/or right ventricular and respiratory failure. Approximately 40% of ECMO cannulation occurs in the operating room and 60% in the ICU. The use rate of Veno-Arterial (VA) ECMO is required in 26.8% of cases after coronary artery bypass grafting (CABG), 25.6% for valve surgery, and 20.7% for heart transplant. In general, successful weaning off ECMO was possible in 56.4% of cases, with survival to hospital discharge achieved in 41.7% of cases [3]. Despite the complex perioperative course of patients on ECMO, long-term survival post-discharge, up to a year, is good.

2 Case Presentation Patient was admitted to the IMSP SCR “Timofei Mos, neaga” Hospital, Department of Cardiovascular Surgery, with the diagnosis of rheumatic valvulopathy. The patient presented with mitral-tricuspid valve disease, severe mitral valve (MV) stenosis with grade III-IV regurgitation, grade III-IV tricuspid valve insufficiency affecting cardiac pump function (EF 37%), severe pulmonary hypertension (PSVD- 60 mmHg), Class III NYHA heart failure, persistent atrial fibrillation with a tachysystolic form, and grade II hypertension with an extremely high additional risk. The patient also presented with congestive hepatopathy (stasis liver) with hepatic dysfunction (cholestatic syndrome, total bilirubin – 41,2 µmol/l), type II non-insulin-dependent diabetes mellitus, and chronic obstructive pulmonary disease with moderate obstructive and mild restrictive respiratory mechanics. The medical history shows the onset nine years ago when dyspnea was first reported, no regular treatment applied. In 2017, the patient was diagnosed with post-inflammatory cardiopathy, grade II-III mitral valve and tricuspid valve failure. In October 2022, severe left atrium dilation was detected along with grade III mitral valve insufficiency and grade II-III tricuspid valve insufficiency. The patient has been on permanent treatment with indirect anticoagulants (Warfarin 3 mg), antihypertensives (Ampril 5 mg, Carvedilol 12,5 mg), a cardiac protector (Trimetazidine 35 mg), diuretics, and oral hypoglycemics. Upon admission, the patient’s condition was moderately severe. The patient reported marked dyspnea during physical effort, asthenia, and oppressive precordial pain. Physical examination revealed moderate peripheral edema. Auscultation revealed harsh bilateral breathing, irregular cardiac sounds, a mid-systolic murmur at the apex, and a systolic murmur in the tricuspid area. The heart rate was 87–90 bpm, and pulse rate 55– 68 bpm. The blood pressure was 125/75mmHg. The patient-maintained diuresis. Viral or parenchymal liver dysfunction was excluded. The clinical consult established absolute indications for urgent surgery. Prosthetic replacement of the mitral valve along with a tricuspid valve plasty was proposed. The anesthetic risk was assessed as ASA IV(E). The patient had a very high cardiovascular risk (reduced functional capacity of the heart, 4 METs), high thromboembolic risk

ECMO Experience in Post-cardiotomy Cardiogenic Shock

491

(Caprini score 5p), a HAS-BLED score of 3p, a moderate hemorrhagic risk, a CHADS2 score of 2p, and a high assessed stroke risk. Preoperatively, the patient was switched from indirect anticoagulants to LMWH (Clexane 4000UA). The duration of the surgery was 7 h and 45 min, and the anesthesia lasted 8 h and 45 min. The intervention involved intravenous (Midazolam, Fentanyl, Propofol) and inhalation (Sevoflurane) general anesthesia under myoplegia (Esmeron), with invasive mechanical ventilation with vasoinotrope support (Noradrenaline 0,05 mcg/kg/min, Dobutamine 3 mcg/kg/min). During the preperfusion and perfusion stage BP = 110/74 mmHg, CVP + 9 mmHg, HR 110–150/min, Ps -75-90b/min. The rhythm was atrial fibrillation. The patient was on cardiopulmonary bypass (CPB) for 5 h and 13 min, under conditions of hypothermia down to T-31 °C. The aortic clamp lasted 2 h and 30 min. During CPB, severe hyperoxia pO2 314–240 mmHg, metabolic acidosis (BE 7,5/-6,4mmol/L) compensated (pH -7,3–7,38), and shock state (Lactate 4.5–2.1 mmol/L) were detected in arterial blood gas analysis. ACT 560–296 s. Upon reducing the CPB output, the patient developed acute global post-cardiotomy heart failure (AHF), cardiogenic shock with pump deficit refractory to inotrope therapy. The patient was warmed, and body temperature was restored to T-37,00 C. On the ECG trace, atrial fibrillation and AV block grade II, HR -150–130 bpm were detected. An electrocardiostimulator (ECS) was installed. Antiarrhythmic drug therapy was administered (Lidocaine 100 mg, Amiodarone 150mg), and electric cardioversion was performed. For 30 min of reperfusion, there were three unsuccessful attempts to wean from cardiopulmonary bypass (CPB). The patient required prolonged circulatory support with vasoactive support: Noradrenaline 0.4 mcg/kg/min, Dobutamine 10 mcg/kg/min, Adrenaline 0.2 mcg/kg/min, Dopamine 5 mcg/kg/min, ISDN 2 mcg/kg/min. Diuresis was present after stimulation with Furosemide 20mg. Transesophageal echocardiography (ECHO) revealed global hypokinesis, with a prosthetic valve functioning well. It was decided to install cardiovascular support using a V-A ECMO with peripheral femoral cannulation. The device operated at a flow rate of 3.8, FiO2 60%, VO2 2l, BP = 109/73 mmHg; CVP + 13 mmHg; HR 80 bpm(ECM rhythm). The patient’s pupils were measured at 1 mm each, with diminished photoreaction. Oximetry was within accessible limits: D - 55%, S - 60%. At transfer to the Intensive Care Unit (ICU), the patient had a BP of 125/74 mmHg on vasoactive support; CVP + 8 mmHg; HR 80 b/min; ECM rhythm, Atrial fibrillation. The ACT, after neutralization of administered Heparin with Protamine 300mg, was 126 s at transfer. Under the support of V-A ECMO, we noticed an improvement in microcirculation. Upon transfer, the arterial blood gas (ABG) confirmed lactacidemia - 4,0 – 3,9 mmol/L, mild hyperoxia remained with a pO2 a of 123 mmHg (FiO2 50%), pH 7,42; pCO2 –35 mmHg, BE -2,8/-1,4mmol/L, as a result of reperfusion syndrome. During ECHO, an ejection fraction (EF) of 10% was observed. Ischemic-hypoxic etiology was determined for acute kidney injury (AKI) (creatinine level of 154 µmol/l and oliguria); hepatic dysfunction (cytolytic syndrome: ALT = 115,4 U/l, AST = 198,5 U/l; cholestatic syndrome: total bilirubin = 90 mmol/l); coagulopathy in the hypocoagulable phase (prothrombin = 44,8%, platelets = 134 x10^3 /µL, international normalized ratio (INR) = 1,65; fibrinogen = 3,3 g/l); vascular, dysmetabolic, posthypo-xic ischemic encephalopathy, incipient cerebral edema, coma stage III (FOUR 4p). Acute respiratory distress syndrome (ARDS II i/o 223), hemolysis detected (free hemoglobin

492

V. Cospormac et al.

= 5 mg/l). The patient was hemodynamically unstable, supported by a peripheral V-A ECMO device with a flow rate of 3,9 l/min with vasoinotrope support: blood pressure (BP) 100/60 mmHg, central venous pressure (CVP) + 18 mmHg, heart rate (HR) 80/min, rhythm paced by an external cardiac pacemaker in VVI mode. During V-A ECMO, unfractionated heparin was administered at a dose of 500–1000 U/h (8–16 U/kg/h). However, postoperatively, the patient experienced complications, with significant blood drainage from chest tubes (2500 ml/24h). Unfractionated heparin administration continued at a dose of 250 IU/h. Anemia was compensated with red blood cell transfusions, and coagulation factors were corrected with fresh frozen plasma and cryoprecipitate under laboratory control of coagulation factors. At 48 h postoperatively, bleeding was successfully stopped. Hemoglobin level was 111 g/l, platelets 69 ×10^3/mm3 , with subsequent increase to 328 × 10^3/µL, prothrombin 84%, fibrinogen 3,5 g/l, and APTT 40 s. At 72 h, the patient showed signs of myocardial recovery, thus the decision to discontinue ECMO support. The ECMO flow rate was reduced to 2/3 of the original flow, then to 1/3. The ECMO cannulas were aseptically removed. BP was 135/90 mmHg, CVP + 10 mmHg, HR 95/min, with the patient’s intrinsic rhythm in atrial fibrillation with a rapid ventricular response, maintained on sympathomimetic support. Diuresis was 2500 ml. Arterial blood gas analysis values normalized, with a pH = 7,43, lactate = 1,9 mmol/L, oxygen delivery (DO2 ) = 601 ml/min, oxygen consumption (VO2 ) = 226 ml/min, and oxygen extraction ratio (ErO2 ) = 37%. Ventilator weaning was initiated on the 7th postoperative day. Sympathomimetic support was discontinued. Stable hemodynamics were observed: BP 143/86 mmHg, CVP + 8 mmHg, HR 80/min. ECHO revealed an improved ejection fraction of 50% and a well-functioning mechanical prosthetic valve. Minimal drainage was observed from chest tubes (3), with the norm being 5, and shock state assessment at 2. The oxygen delivery (DO2 ) equals arterial oxygen content (Ct a O2 ) (standard 20 ml/dl) and can be calculated using the formula: DO2 = CO x (1.34 x Hb x SaO2 + 0.003 x PaO2 )

(1)

ECMO Experience in Post-cardiotomy Cardiogenic Shock

493

where: CO - cardiac output = Stroke volume x HR (standard 30 dl/m2/min), Hb hemoglobin concentration, SaO2 - arterial oxygen saturation. In the context of venoarterial (VA) ECMO, achieving this objective is easier since the cardiac output equals the ECMO output and arterial hemoglobin saturation is 100% under the conditions of maintaining the required Hb values [2]. 3.2 How Do We Cannulate? To connect to the ECMO device, aortic cannulation is required, which can be performed by central or peripheral method. Regardless, the survival rate for patients on ECMO is approximately 35%. The peripheral approach was associated with fewer bleedings, transfusions, and renal replacement therapy, while the risk of limb complications is not higher than in central ECMO. It is considered preferable to place arterial and venous cannulas in separate limbs to reduce vascular complications and facilitate decannulation. Adverse effects may manifest an increase in afterload with excessive left ventricular distension, myocardial ischemia and pulmonary edema. The absence of left ventricular contraction alongside high ECMO flows results in non-opening of the aortic valve, loss of pulse, and an increased risk of thrombus formation. The pulsatility of the arterial line and the opening of the aortic valve can be assessed by daily Doppler ECHO. Arterial pulsatility of less than 15 mmHg, echocardiographic signs of aortic valve closure, left ventricular dilation, stasis, and increased pulmonary capillary pressure or pulmonary artery diastolic pressure may be signs of left ventricular distension. Non-invasive treatment include reducing ECMO flow, vasodilation, and increasing inotropic support; however, higher doses of inotropic support may increase myocardial activity and the potential for arrhythmias [2]. Managing a patient on postcardiotomy ECMO (ECMO-PC) support requires heightened attention, as both bleeding and thrombosis remain common complications. The contact between blood and synthetic surfaces of the ECMO circuit leads to thrombin generation and platelet consumption, elevating the prothrombotic status and requiring anticoagulants. However, on the other hand, there is an increased risk of perioperative mediastinal bleeding. 3.3 Coagulation Management Heparin, specifically unfractionated heparin, is most frequently used for anticoagulant management. After cardiac surgery, heparin infusion is initiated when drainage from the chest tube is 200 s. Ideally, heparin infusion is recommended to begin within 24 postoperative hours and is possible within 12 h. The dose needs to be titrated to maintain an ACT (activated clotting time) of 150–180, which should be measured every 2 h until it reaches a stable

494

V. Cospormac et al.

level. Heparin resistance is usually due to ATIII (AT III) deficiency. AT III deficiency can be corrected with fresh frozen plasma (FFP). Tranexamic acid can be infused during ECMO support. If the ACT is [6]: • • • • • •

250: Stop infusion for 1 h. Test ACT every hour and restart when ACT 10%. The occurrence of clots at the pump head is reported in